Department of Zoology Hazara University, Mansehra Pakistan 2016

COMPARATIVE PHYLOGEOGRAPHY OF SCHIZOTHORACINAE FISH IN NORTHERN PAKISTAN AND WESTERN CHINA

MUHAMMAD FIAZ KHAN

DEPARTMENT OF ZOOLOGY HAZARA UNIVERSITY, MANSEHRA PAKISTAN 2016

HAZARA UNIVERSITY, MANSEHRA DEPARTMENT OF ZOOLOGY

COMPARATIVE PHYLOGEOGRAPHY OF SCHIZOTHORACINAE FISH IN NORTHERN PAKISTAN AND WESTERN CHINA

MUHAMMAD FIAZ KHAN

This research study has been conducted as partial fulfillment of the requirement for the Degree of Doctor of Philosophy in Zoology, Hazara University Mansehra, Pakistan

August 22, 2016

COMPARATIVE PHYLOGEOGRAPHY OF SCHIZOTHORACINAE FISH IN NORTHERN PAKISTAN AND WESTERN CHINA

SUBMITTED BY: MUHAMMAD FIAZ KHAN (PhD scholar)

SUPERVISOR: Dr. Muhammad Nasir Khan Khattak Assistant Professor Department of Zoology Hazara University, Mansehra

CO-SUPERVISOR: Prof. Chen Yifeng Institute of Hydrobiology Chinese Academy of Sciences Wuhan, China

DEPARTMENT OF ZOOLOGY HAZARA UNIVERSITY, MANSEHRA PAKISTAN, 2016

DEDICATION

THIS WORK IS DEDICATED TO MY PARENTS AND MY SUPERVISOR

Table of Contents

Chapter 1 1

INTRODUCTION 1

1.1 Study Area 1

1.2 Introduction to Qinghai-Tibetan China 3

1.3 Classifications of Fishes 3

1.4 Pakistan freshwater resources 4

1.5 Fishes of Pakistan 5

1.6 Fishes of China 6

1.7 Taxonomy of genus schizothorax 6

1.8 Origin of Schizothoracinae Fishes 8

1.9 Pleistocene glaciations 8

1.10 Phylogeographic predictions based on glaciations history 10

1.11 Role of Phylogeography in evolution 12

1.12 Rationale of the study 13

1.13 The objectives of the current study was 13

Chapter 2 14

REVIEW OF LITERATURE 14

2.1 Phylogeography 14

2.2 Genetic markers used in phylogeography 16

2.2.1 Mitochondrial genes (mtDNA) 16

2.2.2 Characteristics of Mitochondrial DNA 16

2.2.3 Cytochrome B Gene 19 2.2.4 Control region (D-Loop) 20

2.3 Importance of genetic material in fish identification 22

2.4 Disadvantages of mitochondrial material 23

2.5 Phylogeography of Schizothoracines fishes 23

2.6 Worldwide Distribution of Schizothorax 23

2.7 Role of glaciations history in Phylogeography 26

Chapter 3 29

MATERIALS AND METHODS 29

3.1. Chemicals used during experiment 29

3.2. List of solution used during experiment 29

3.3. Sampling sites 30

3.4 Collected species 31

3.5 Sample collection and preservation 31

3.6 Samples labeling 32

3.7 Fixing of whole specimens 34

3.8 Fish Identification 34

3.9 DNA extraction protocol 35

3.10 Gel Electrophoresis 36

3.11 Primers designing 37

3.12 Laboratory procedures 40

3.13 PCR Procedure 41

3.14 PCR mixture for 60ul 42

3.15 Sequencing 43

3.16 Blast searches 43

3.17 Data Analysis 43

3.17.1 Gene identification and genome analyses 43

3.17.2 Phylogenetic Analysis 44

Chapter 4 46

RESULTS 46

4.1 Genome organization and composition 48

4.2 Overlapping regions and intergentic spacer 49

4.3 OL Region 50

4.4 Protein-Coding Genes 50

4.5 Comparative gene arrangement comparison of S. esocinus, S. plagiostomus and S. labiatus 51

4.6 Base composition in Schizothoracine fishes 61

4.6.1 Base composition in Schizothorax esocinus 61

4.6.2 Base composition in Schizothorax plagiostomus 64

4.6.3 Base composition in Schizothorax labiatus 67

4.7 Frequency of amino acid in protein coding gene 70

4.7.1 Frequency of amino acid in protein coding gene of S. esocinus 70

4.7.2 Frequency of amino acid in protein coding gene of S. plagiostomus 73

4.7.3 Frequency of amino acid in protein coding gene of S. labiatus 76

4.8 Codon usage in protein coding genes of schizothoracine 79

4.8.1 Codon usage in protein coding genes of S. esocinus 80

iii

4.8.2 Codon usage in protein coding genes of S. plagiostomus 84

4.8.3 Codon usage in protein coding genes of S. labiatus 86

4.9 Transfer RNA Genes 89

4.10 AT skew and GC skews value 93

4.11 Noncoding Sequences in Schizothoracinae 100

4.12 Phylogenetic of complete genomes 103

4.13 Comparative study tRNAs in genomes Schizothoracines species 108

4.14. Comparative of protein coding genes 109

4.15 Stop and start codon in protein coding genes 110

4.16 Comparative study of amino acid 111

4.17 Comparative size of other genes 112

4.18 Phylogenetic Analysis 113

4.19 Haplotype diversity in Schizothoracine fishes 113

4.20 Phylogenetic analysis of Cytb 116

4.21 Phylogenetic of Dloop region 118

4.22 Phylogenetic analysis of Cytb and Dloop 120

4.23 Divergence time of Schizothoracinae fishes in Pakistan and Tibet 122

Chapter 5 124

DISCUSSION 124

5.1 Genomic organization 124

5.2 Protein coding genes 125

5.3 Non-coding region 127

5.4 Transfer and Ribosomal RNA Genes 129

5.5 Phylogeography 132

5.6 Divergence time of Schizothoracines fishes 136

CONCLUSIONS 139

RECOMMENDATIONS 140

Chapter 6 141

REFERENCES 141

APPENDICES 167

Appendix i: Best model test of Cytb. 167

Appendix ii: Best model test of Dloop. 170

Appendix iii: Best model test of combined data (Cytb and Dloop). 174

List of Figures

Fig 1: Map of Pakistan, showing major river system (Google, 2015). 2

Fig. 2: Cytochrome b protein (Google, 2015) 20

Fig. 3: Mitochondrial D loop showing different regions (Google, 2015) 21

Fig 4: Different steps and condition for PCR. 41

Fig. 5: DNA extraction bands of complete genome on gel electrophoresis. 46

Fig. 6: PCR results of complete genome on gel electrophoresis. 46

Fig. 7: PCR bands of Cytb gene on gel electrophoresis 47

Fig. 8: PCR bands of Dloop gene on gel electrophoresis 47

Fig. 9: Graphical chart of complete mitochondrial genome of Schizothorax esocinus. 54

Fig. 10: Graphical chart of complete mitochondrial genome of Schizothorax plagiostomus. 57

Fig. 11: Graphical chart of complete mitochondrial genome of Schizothorax labiatus. 60

Fig. 12: Percentile of amino acid in mitochondrial genome Schizothorax esocinus. 72

Fig. 13: Percentile of amino acid in mitochondrial genome Schizothorax plagiostomus. 75

Fig. 14: Percentile of amino acid in mitochondrial genome of Schizothorax. Plagiostomus. Error! Bookmark not defined.

Figure 15: Percentile of amino acid in mitochondrial genome of Schizothorax. labiatus. 78

Fig. 16: Comparative study of amino acid in protein coding gene of Schizothoracines. 79

Fig. 17: The secondary structure of the 22 tRNA genes encoded by Schizothoracine mtDNA represented in cloverleaf form. Standard base pairings (G-C and A-T) are indicated by colons (.). 91

Fig. 18: Sequences of the control region from the S. esocinus mitochondrial genome. 101

Fig. 19: Sequences of the control region from the S. plagiostomus mitochondrial genome. 101

Fig. 20. Sequences of the control region from the S. labiatus mitochondrial genome. 102

Fig. 21. The evolutionary history was inferred using the Neighbor-Joining method. 105

Fig. 22. Neighbor joining phylogenetic tree of complete mitochondrial genomes of S. plagiostomus with closely related species. 106

Fig. 23. The evolutionary history was inferred using the Neighbor-Joining method. 107

Fig. 24: Phylogenetic tree showing the relationship of Schizothoracines fishes on the basis of Cytb gene. Each branch showing Bayesian posterior probability (PP) ≥ 0.95 %. 117

Fig. 25: Phylogenetic tree showing the relationship of Schizothoracines fishes on the basis of Dloop. Each branch showing Bayesian posterior probability (PP) ≥ 0.95 %. 119

Fig. 26: Phylogenetic tree showing the relationship of Schizothoracines fishes on the basis of combined mtDNA (Cytb, Dloop) gene. 121

Fig. 27: Ultra metric ML tree of Schizothoracine fishes based on the NPRS transformation using Cytb data. 123

vii

List of Tables

Table: 1. Details of specimens collected from different locations 33

Table 2: PCR and sequencing primers designed from the complete mitochondrial genome 38

Table 3: PCR and sequencing primers used for amplification of Cytb and Dloop. 40

Table 4. Characteristics of genes in the mitochondrial genome of Schizothorax esocinus 52

Table. 5: Characteristics of the mitochondrial genome of S. Plagiostomus 55

Table 6. Characteristics of the mitochondrial genome of S. Labiatus 58

Table 7: The base composition in different regions of mitochondrial genome of Schizothorax esocinus. 62

Table 8: The base composition in different regions of mitochondrial genome of Schizothorax plagiostomus. 65

Table 9: The base composition in different regions of mitochondrial genome of Schizothorax labiatus. 68

Table 10: Frequency of amino acid in protein coding gene in Schizothorax esocinus are given in percent. 71

Table 11: Frequency of amino acid in protein coding gene in schizothorax plagiostomus are given in percent. 74

Table 12: Frequency of amino acid in protein coding gene in Schizothorax labiatus. 77

Table 13: Amino acid, codon number, frequency and codon usage in protein coding gene of S. esocinus. 81

viii

Table 14: Amino acid, codon number, frequency and codon usage in protein coding gene of S. plagiostomus. 84

Table 15: Amino acid, codon number, frequency and codon usage in protein coding gene of S. labiatus. 87

Table 16: Table shows the AT skew and GC skews value of all genes in mitochondrial genome of S. esocinus. 94

Table 17: Table shows the AT skew and GC skews value of all genes in mitochondrial genome of S. plagiostomus. 96

Table 18: Table shows the AT skew and GC skews value of all genes in mitochondrial genome of S. labiatus. 98

Table 19: Comparative size (bp) of transfer RNA in S. Plagiostomus (bp), S. esocinus (bp) and S. labiatus (bp) 108

Table 20: Comparative size (bp) of protein coding gene in S. Plagiostomus (bp), S. esocinus (bp) and S. labiatus (bp). 109

Table 21: Start and stop codon in protein coding gene of S. Plagiostomus (bp), S. esocinus (bp) and S. labiatus (bp). 110

Table 22: Comparative number of amino acid in protein coding gene of S. plagiostomus, S. esocinus and S. labiatus. 111

Table 23: Comparative size of ribosomal gene, replication origin (OL) and Dloop in S. plagiostomus (bp), S. esocinus (bp) and S. labiatus (bp). 112

Table 24: No of haplotypes in schizothorax plagiostomus, S. esocinus and S, labiatus on the basis of Cytb gene. 115

Table 25: No of haplotypes in schizothorax plagiostomus, S. esocinus and S, labiatus on the basis of Dloop. 115

Table 26: No of haplotypes in schizothorax plagiostomus, S. esocinus and S, labiatus on the basis of cytb and Dloop. 115 List of Maps

Map 1: Sampling points of different areas of Pakistan and China (Google earth, 2015) 30

ACKNOWLEDGMENTS Thanks to ALMIGHTY ALLAH, the most merciful, who gave me opportunity and ability to complete this study. I also offer my humblest thanks, from the deepest core of my heart, to the HOLY PROPHET MUHAMMAD (Peace Be upon Him)” who exists eternally as an embodiment of knowledge and sage for the whole mankind.

I would like to thank my worthy supervisor, Dr. Muhammad Nasir Khan Khattak, for his help, constant guidance and expert advice during the completion of this project. From him, I learnt the fundamentals that will help to carry me through the next stage of my career. I also thank to my co-supervisor Prof. Chen Yifeng, who provided me lab facilities and invited me in Institute of Hydrobiology Chinese Academy of Sciences China for molecular work and Data Analysis. I never forget Prof. He Dekui who helped me a lot during the research work of the PhD in China: he was there right from the beginning of this project and he introduced me to many things that were unfamiliar to me in China. Thank you Prof. He Dekui for your kind support and the intellectual company during my stay in China.

I cannot overlook my parents and brothers for their moral support and prayers which were source of inspiration for me during my study. Without their support, endorsement and strong back up the completion of this project would merely a hollow dream. Many thanks to my all colleagues at Department of Zoology namely; Dr. Ammad Saleem, Dr. Farhad Ullah, Dr. Omiya, Mr. Shabbir Ahmad, Mr. Sardar Azhar Mahmood, Mr. Sajid Mahmood, Mr. Atta ur Rehman, Mr. Jehangir Ahmad, Miss Sadia Tabbasum, Miss Samina Yasmin and Miss Aqsa Bashir for their guidance and cooperation. I am indebted to my Chinese lab mates, Heing Sun, Liang Yangyang, Miss Li, Miss lei, Mr. Chan of their assistance both in Lab and in field as well. I am very grateful to my friend, Farman Ullah Dawar, who helped me a lot during my stay in China. At the end, I would like to attribute Departments of fisheries Khyber Pakhtunkhwa, for positive cooperation in the samples collection from different areas.

Funding from the National Natural Science Foundation of China that funded my stay and study in China, with a PhD grant (41030208) is sincerely acknowledged.

Muhammad Fiaz Khan

LIST OF ABBREVIATIONS

A Adenine AIC Akaike information Criterion Bp Base pair C Centigrade C Cytosine CI Consistency index CR Control region CSBs Conserved sequenced blocks Cytb Cytochrome b gene D-loop Displacement loop DNA Deoxyribonucleic acid DNTPs Deoxynucleoside triphosphates EDTA Ethylene-diamine-tetraacetic acid EtOH Ethanol F primer Forward primer G Guanine K Kilometer KPK Khyberpakhtunkhawa M Meter MCMC Monte Carlo Markov Chain Mins Minutes mtDNA Mitochondrial Deoxyribonucleic acid MYA Millions years ago NaCl Sodium Chloride NCBI National Center for Biotechnology Information NHM Northern High Mountainous Region PCR Polymerase chain reaction PCGs Protein-coding genes QTP Qinghai-Tibetan Plateau

xii

RAPD analysis Random Amplified Polymorphic DNA analysis RI Retention index RNA Ribonucleic acid R primer Reverse primer Rpm Revolution per minute T Thymine TAS Termination-associated sequence domain tRNA Transfer Ribonucleic Acid µl Microliter UV Ultra violet V Volts

xiii

ABSTRACT

The Schizothoracine fishes also known as “snow carp” or “mountain carp” are restrictedly distributed in Northern Pakistan and Western China. Despite several studies on the taxonomy of the extremely multifaceted group of Schizothoracines species established on traditional morphology, the affiliation between these species is poorly understood and the taxonomic authenticity is quiet under discussion. To find phylogeographic relationships among these species, we sequenced complete mitochondrial genome, including cytochrome b gene and control region for phylogenetic relationship. Samples of three species of genus Schizothorax (Schizothorax plagiostomus, Schizothorax esocinus and Schizothorax, labiatus) collected from northern Pakistan and western china using hand net or cast net. Each fish was dissected for muscle tissue, about 10 – 20g muscle tissue of each fish was collected in 1.5 ml eppendorf tube and was preserved in 95% ethanol solution. After that all collected samples were send to Insituate of Hydrobiology Chinese Academy of Sciences Wuhan, China for DNA extraction and data analysis. High salt miller method was used for DNA extraction. The results showed that mitochondrial genome of S. esocinus, S. plagiostomus and S. labiatus was circular having molecular weight of 16591 bp, 16564 bp and 16590 bp respectively. The genome is composed of 37 genes (22 transfer RNA, 13 protein coding, 2 ribosomal RNA and one control region). The major non-coding sequence in mitochondrial genome was D-loop, which was 938 bp, 935 bp and 936 bp in S. esocinus, S. plagiostomus and S, labiatus respectively. All protein coding genes were encoded on heavy strand (H-strand) except ND6, whereas 8 tRNAs genes (tRNAGln, tRNAAla, tRNAAsn, tRNACys, tRNATyr, tRNASer, tRNAGlu and tRNAPro) were placed on light strand of genome.

Cytb showed high level of conservation in contrast to Dloop and no heteroplasmy was seen in the length variation of di-nucleotide (TA)n microsatellites. The focal

xiv taxa were shown to be making a monophyletic group within the Schizothoracines in our phylogenetic analysis. Combined results of Cytb, Dloop in S. plagiostomus, S. esocinus and S. labiatus showed close genetic relationship which is in accordance with the traditional morphology. Interestingly, separate analysis of Cytb, Dloop and their combined analysis showed intermixing of the species. Cytb region showed highly conserved while Dloop exposed variable region, even length variation between and within species were observed. Central conserved region (CSBs) observed in Dloop region were found comparable to other vertebrate species. In some individuals, mitochondrial sequence variations between S. plagiostomus, S. esocinus and S. labiatus were too low to identify those species as separate. The exact date about divergence of Schizothoracinae fishes in Asia is not known. Therefore to find the divergence time, Bayesian relaxed clock method were used to calculate the divergence of Schizothoracinae fishes in Asia. The Beast software version v1.8.2 was used and results was visualized in TRACER 1.5. Towards this direction, we considered the divergence time for Cyprinids as the interval of evaporate deposition and Lago Mare sedimentation in Mediterranean before the Pliocene flooding around 5.33 Mya. Our data shows that Schizothoracinae fishes derived from European Cyprinids. Our findings gives an insight into molecular phylogeny of Schizothorax species and improves our understanding of historical and taxonomic relationships derived from morphological study.

Chapter-1 INTRODUCTION

1.1 Study Area

Pakistan is located between latitudes 24 and 37o N, covers a total region of 803,940 km2. On the basis of landscape, Pakistan can be divided in the Northern High Mountainous Region (NHM), the Baluchistan Plateau, the Potwar Uplands, the Western Low Mountainous region and the plains of Sind and Punjab. The NHM, has moderate climate, covers about 15 percent of the country. Pakistan is divided into three mountain systems, Himalayas, Karakoram and Hindu Kush, which are extended from east to the west, covered north of the NHM and parts of Afghanistan and China. The mountain system, Indus system receives a large number of small and as well as large tributaries such as Swat, Kunhar, Gilgit, Jhelum and Neelum etc. Some downstream in the plains, Ravi, Sutlej and Chenab, all arise from the Indian Himalayas and finally join Indus system from the east (Akhtar, 1992).

The Indus Plain creates eastern parts and folds of mountains inhabit the western and northern parts of the country, with valleys and highlands of varying sizes declining between these mountain folds. The elevations range between the coastlines in the south and the world highest mountain peaks (K-2, 8,611m) above sea line and Nanga Parbat 8,126 m) in the north, having many world’s biggest glaciated highland valleys. The gradual changes in altitude is responsible for the natural slope of the area, while subtropical locality of the country and its dropping in the western-most reaches of the summer monsoons provides a gradual variation in precipitation and temperature. The very low precipitation received by southern and western parts of the country, which occupy very hot desert with undulating sand dunes. In contrast, high precipitation and low temperature receiving by northeastern parts, whereas the snowcapped peaks and glaciers are dominating. Pakistan has significantly large inland aquatic resources in the form of rivers,

1 streams, tributaries, network of canals and natural and man-made lakes. Pakistan is divided into three major drainage systems, on the basis of pattern of flow of rivers and associated streams: the Indus drainage, Baluchistan coastal drainage and landlocked drainage. The prevailing ecological, geologic, geographic and hydrographic distinctions have indorsed to account diverse fish fauna of the country. The Zoo-geographically, Pakistan establishes a transitory zone between the Oriental, Palearctic and Ethiopian ichthyo-ecological regions, therefore the fish fauna of Pakistan is under the influenced of all three geographical regions (Mirza, 1994).

Fig 1: Map of Pakistan, showing major river system (Google, 2015).

2 1.2 Introduction to Qinghai-Tibetan China

The Qinghai-Tibetan Plateau (QTP) constitute one of the World’s largest high- elevation ecosystem, covering about 2.5 million km2 areas, with average altitude >4000 m a.s.l, considering ‘‘the roof of the world’’ (Zheng, 1996). The (QTP) along with southeast China and the Himalayan, has been nominated world’s 34 most important hub of biodiversity, due species richness and abundance of endemic species (Myers et al., 2000).

The Qinghai Tibetan plateau is a huge fault block designed by tectonic events in late Tertiary period, due to conversion of Indian and Eurasian plates. As a result, elevation of the Himalayan, Karakorum and Kunlun ranges blocked the pathway of monsoons from the south west, causing the area to block to form lakes, some in terminal sinks and designed to become more and more salon (Chen et al., 1984; Zhiming, 1987). Massive destructions occurred among the flora and fauna, including the fishes (Chao et al., 1981).

The strong tectonic movement that have occurred during the Pleistocene periods, are considered to have strong impact on the developments, and evolution of the contemporary drainage systems, which was responsible for uplift of the Qinghai– Tibetan Plateau (Zhu et al., 2003), lead habitat alterations that have strong influenced on taxa, including different fresh water fishes in the region (Cao et al., 1981).

1.3 Classifications of Fishes

A fish is defined as “any paraphyletic group of organism that consists of all gill- bearing aquatic animals. It is cold blooded that have ability to swims in water by means of its compressed tail and respires through gills and is found below 2 °C of Antarctic region to hot spring of 52 °C with a wide range of distribution (Ali et al., 1999). According to its characteristics and habitats, there are a variation of fishes

3 which are found all over the Biosphere. Generally these fishes are classified into three major categories, marine water, fresh water, and tropical fishes.

These fishes are commonly found in rivers and lakes in which the salinity is less than 0.05%. About more than 15000 types of the fishes belong to the fresh water habitat. Those fishes which are capable to survive in sea water are known as marine fishes. Tropical environment is compulsory for most of the marine fishes to live. Each species of the marine individuals have their own appearance, nutritional requirements, environmental needs, reproduction capability, and compatibility. Those fishes which require warm and tropical climate for its survival are known as tropical fishes. Both fresh and marine water species come under the heading of tropical fishes.

Fish comprises about half of the total number of vertebrate in the whole world and have ability to live almost all possible aquatic environments. There are about 28,000 fish species reported all over the world so far (Nelson, 2006). According to (Wu, 1964) more than 4,600 fish species have been reported for China and Taiwan. In 28,000 fish species, about 8,411 fish species are reported from fresh water ecosystem, among them 930 fresh water species have been reported from India. India inhabits ninth position in the World in terms of freshwater extra-large biodiversity (Shinde et al., 2009). According to the most recent report, more than 15000 fresh water fishes are reported all over the world (Reid, 2013). In which these 1323 fresh water fish species are recorded from China (Xing et al., 2015).

1.4 Pakistan freshwater resources

Indus River system, which served as the Himalayas drainage basin dominates Pakistan’s freshwater resources. The Indus river system originates from western Tibet, China and enters in Baltistan Pakistan and flows continuously over the Northern Areas, then join Astor, Shyok and Gilgit rivers. While in KPK it is combined with Kabul River, whereas Ravi, Beas, Jhelum, Chenab and Sutlej also

4 join it and finally flows into Sindh earlier draining into the Arabian Sea. Inland water resources of Pakistan covers about 8 million hectares area; including different network of canals, lakes, dams and various water-logged zones that provides shelters to more than 180 fresh water fish species, including loaches, carps and catfish (Govt. of Pakistan, 2001).

The high-elevation areas, including NHM region and western low mountainous region are very cold and hence as cold waters bodies of the country, which harbor endemic and exotic cooled-water fish species. The cold-water areas of Pakistan are divided into five administrative areas: Northern Areas, Azad Jammu and Kashmir, Khyberpakhtunkhawa Punjab and Baluchistan. All these five areas have its own independent fisheries administration, however there is little collaboration among these areas and shows poor coordination of inland fisheries in the country (Akhtar, 1992).

1.5 Fishes of Pakistan

Pakistan also has a very diverse ichthyofauna, according to more recent reports, more than 190 fresh water species reported so far including endemic as well as exotic species (Rafique and Khan, 2012). According to (Mirza and Bhatti, 1999), fresh water fish fauna of Pakistan comprise of 179 species belonging to 82 genera, 26 families, 10 orders, 5 super orders and 3 cohorts (Mirza and Bhatti, 1999). (Mirza, 1991).

The order Cypriniformes is a very big cluster of freshwater fishes that consist of about 3000 species all over the biosphere (Nelson, 2006). There are 28 species of snow trout that have been reported from Himalayan and Sub-Himalayan regions (Mirza, 1991). The nomenclature of genus Schizothorax is controversial (Mirza, 1991; Wu and Tan, 1991; Chen and Cao, 2000). Nomenclature of genus Schizothorax is based on external morphological characters such as head, mouth and lip (Heckel, 1838).

5 1.6 Fishes of China

China is rich in fish biodiversity, So far 1323 fresh water fishes reported from China (Xing et al., 2015). About 70 species and 9 subspecies belong to 11-12 extant or nominal genera account for over 80% of the world’s Schizothoracine species (Wu and Wu, 1992; Yue and Chen, 1998b). Most of the member of the Schizothoracine are endemic to China and commonly dispersed in cold water resources of Qinghai-Tibetan Plateau, while few species distributed in uppers zone of the Yellow River of western China (Wu and Wu, 1992).

1.7 Taxonomy of genus schizothorax

The taxonomic position of the genus Schizothorax is contentious (Mirza, 1991; Talwar and Jhingran, 1991b; Wu and Wu, 1992; Chen and Chen, 2000). However, the phylogenetic relationship between different Schizothoracinae fishes are still unresolved (Cao et al., 1981b). On the basis of external morphological features like head, mouth and lips, genus Schizothorax divided into three groups (Heckel, 1838). Group A has well defined cartilage covering and sharp margin on the surface of lower jaw, while group B has uniform cartilage covering and have horny margin on lower jaw, whereas group C has less advance or even absent and fleshy lips. After that biologist placed these groups into different genera and sub genera such as Schizothorax, Racoma and Schizopyge (Day, 1958; Das and Subla, 1964b; Mirza, 1975; Mirza, 1991; Talwar and Jhingran, 1991b; Wu and Wu, 1992). A recent taxonomic classification has suggested that Schizothoracine fishes having four barbels, small scales and with or without a horny covering on the lower jaw surface (Chen and Cao, 2000). From evolutionary point of view, these groups are known as morphologically primitive, specialized and highly specialized. The primitive Schizothoracinae fishes form one clade while specialized and the highly specialized Schizothoracinae fishes form separate clade. Therefore specialized and highly specialized fishes are intermixed with one another (He et al., 2004; Qi, 2012).

6 Schizothorax plagiostomus

Schizothorax esocinus

Schizothorax labiatus

7 1.8 Origin of Schizothoracinae Fishes

The origin of Schizothoracinae fishes in Himalayan and sub-Himalayan region is debatable and different biologist have different predictions. According to (Cao et al., 1981b) during the late Tertiary period, the subfamily Schizothoracinae originated from old barbine fish that distributed in Tibet and later on advanced into more specific collections due to the uplift of Tibet. But according to (Das and Subla, 1964b), Schizothoracinae fishes migrated into coldwater bodies of Kashmir from central Asiatic south slopes of the Himalayas and Suleiman range. On the basis of biogeography (Das and Subla, 1963) proposed that the subfamily Schizothoracinae migrated during the early Tertiary period from Southeast or South Asia to the great plain, which is occupied by mountains of Central Asia, and was successively isolated by the uplift of the Himalayas and Tibet.

As yet, no palaeogeographical assumption has been suggested to account for the dispersal pattern of Schizothorax, based on spreading and vicariance. The paleontological, morphological and zoogeographical evidence proves that Schizothoracinae fishes arose from primitive barbine fishes dispersed over the areas of Xizang (Tibet) during the late Tertiary period (Das and Subla, 1964b).

Most of our knowledge is based on current distributions of these species and a restricted fossils record of the Schizothoracinae (Wu and Chen, 1980; Cao et al., 1981b). Scientist normally believed that the evolution and distribution designs of principal freshwater fishes reflect the palaeogeographical complication of a region, particularly the extension of rivers and their departure and interconnection events (Hurwood and Hughes, 1998; Montoya-Burgos, 2003; Berendzen et al., 2005).

1.9 Pleistocene glaciations

The Pleistocene glaciations were possibly the supreme historic events, happened during the evolutionary history of most extant species. Most parts of the biosphere

8 were continually hidden beneath massive sheets of ice, triggering extreme alterations on continental scales. It is expected that upto 20 glaciation events occurred during the Pleistocene (Martinson et al., 1987). Each glaciation events covered ≈ 100 000 years, with interglacial stages lasting 10,000–12,000 years (Dawson, 2013). Glacial influences were maximum in Eurasia, North America and Antarctica, with ice covering major parts of their surfaces. The large ice sheet was observed in North America, exceeding the combined coverage of European and Asian glaciers (Dawson, 2013). During this period freshwater habitats were changed on an unprecedented scale and transformed into new lakes and rivers system. Widespread habitat destruction and displacement resulting in extirpation of local populations and biome compression at glacial margins was the consequence of continuous glaciation (Pielou, 2008). As a consequence of direct water connections resulting from the advancing ice fronts and limited dispersal chances, the aquatic species were adversely affected particularly fish. Many new water bodies like pro-glacial lakes were shaped which facilitated the dispersal of fresh water fauna and were continuously nourished and dammed by the glaciers along their northern margins. Consequently, their sizes and locations were determined by the shifting ice sheets while their volumes were principally defined by glacial melting rates. These pro-glacial lakes provided marvelous chances of dispersal over immense biogeographical vicinities (Dyke and Prest, 1987).

The geographical records of the spillways and shorelines support the approximation time for aquatic migration across deglaciated ranges (Shackleton, 1987). Glaciation and deglaciation has great impact on the global sea levels that has been reported as 100 m (relative to present levels) around 18,000 years before present. Increase in aridity was also noticed around the world as a consequence of Glacial maxima (Shackleton, 1987; Dawson, 2013).

It could be assumed that glaciations had major impacts on the genetic structure of anadromous and freshwater species. It is worth mentioning that in the presence

9 study it was highlighted that Pleistocene glaciations are very important but the earlier research work suggested that historical action from Miocene to Pliocene have a pivotal role in structuring the genetic distribution particularly in southern hemisphere (Bermingham and Avise, 1986).

1.10 Phylogeographic predictions based on glaciations history

Several estimates has been made regarding genetic multiplicity and phylogeographic structure of fishes on the basis of glaciated vs. non-glaciated regions. First, fish species which were evacuated by glacial developments are possible to have lesser levels of genetic diversity comparable to species from nonglaciated ranges. Following decline in habitation facts and proportions due to species limitation to glacial refugia. Real in refugia would not be essential source for declines in genetic diversity to happen, as long-standing decreases in population size would have a similar consequence (Avise et al., 1984). Northern species would also exhibit less intraspecific deviance and seem to be more recent in evolutionary history than species from nonglaciated ranges. The frequent extensive troubles and founder-flush rotations caused by successive glacial expansions and withdrawals contributed to the majority of intraspecific mitochondrial variability formerly present would be masked (Avise et al., 1984). According to (Avise et al., 1987) the intraspecific phylogeographic structure would resemble with documented zoogeographic zones. This would hold exact for the most of the northern hemisphere species dispersing from same glacial refugia, as in many situations the migration or dispersal of these species represented to the description of zoogeographic region (McPhail and Lindsey, 1970). Same correspondence is possible for those species which are present in two or more refugia but have disjunction distribution. But, the phylogeographic construction of continuously spreaded multiple-refuge of fish species may not be suitable for zoogeographic estimation, as similar conditions that allowed secondary contact to happen may favoured to successive dispersal. It is usually estimated that allopatric

10 assemblies will be reciprocally monophyletic and easily distinguishable. This supposition may not be acceptable for multiple-refuge northern species, however, as constant glacial progresses may have initiated vicariant movement of a single lineage or may be closely related sets into different refuges. If insufficient evolutionary time lapsed during their period of allopatry, fish from different refugia may show little or no visible phylogenetic variations. Several northern species also usually have greater range sizes compare to the species from nonglaciated zones (McAllister et al., 1986). This is mostly because of post-glacial dispersal opportunity provided by pro-glacial lakes (McAllister et al., 1986; Dyke and Prest, 1987). As a consequence of these dispersion scenarios, species with almost similar ranges that are present in de-glaciated regions may not show good phylogeographic concordance, either in figure of phylogenetic clades or refugial groups, geographical ranges of clades from common refugia, or location and level of secondary connection between refugial groups. Ecological variations between species may also have triggered in marked variations in phylogeographic designs. Habitat conditions in glacial refugia and pro-glacial lakes transformed frequently, as their locations and borders altered due to shifting of glacial borders (Pielou, 2008). As an outcome, species with different environmental appearances and dispersal capabilities may have replied to actions differently, resultant in diverse phylogeographic arrangements.

Scientists are interested in discovering the degree to which phylogeographic patterns of animal taxa particularly fish are related to chronological deviations in the atmosphere to determining the origins of biodiversity on globe (Lydeard et al., 1995). The fishes, are providing key associations among the chronological deviations in the atmosphere and the biotic replies to those (Lydeard et al., 1995; Dodson et al., 1995; Murphy and Collier, 1996). The fish distribution is strongly controlled by water and faunal associations between miscellaneous stream systems that are normally obstructed; therefore, a deeper separation may result

11 from historical changes (Lydeard et al., 1995). In East Asia, a few remarkable variations occurred in speciation, distribution, and connectivity of Cyprinidae, occurred 5–30 million years ago, in response to native environment alteration connected with mass building and river structure altering (Liu and Su, 1962; Zhou, 1990).

From past few decades, studies on molecular conservation genetics and phylogeography have increased quickly. The information derived from molecular data of these studies, undetectable through conventional demography and biogeography, is important to investigate population dynamics and understanding evolutionary mechanism (Avise, 1994; Prior et al., 1997), and may be provided the base for expressing and applying any protection and management plan (Hrbek et al., 2005).

1.11 Role of Phylogeography in evolution

Phylogeographic studies play a significant role to understand the evolutionary history of species in the background of paleoenvironmental deviations (Hewitt, 2004; Pavlova et al., 2005). The biogeographic history of Pakistan and Tibet is particularly hard to understand. Taxa that are present in this areas have experienced far more remarkable geological, climatic and ecological actions than their counterparts in other regions of the continent (Li and Fang, 1999b). Most of the knowledge is grounded on the recent distribution of indivuals and restricted fossils data documented historical distribution of the subfamily Schizothoracine (Yun-fei and Yi-yu, 1980). Freshwater fishes, firmly controlled by drainage structures, have providing vital understandings into the associations among the prevailing genetic structure and the historic changes in the environment (Murphy and Collier, 1996; Hewitt, 2004).

12 1.12 Rationale of the study

The vigorous tectonic activities that have happened during the middle Pleistocene, are commonly recognized to have vital impact on the development and evolution of the modern-day drainages systems, which controlled extensive habitat alterations that impacted fauna, including freshwater fishes in the region. This statement arises the following questions:

 If Northern Pakistan and Western China (Tibet) were demographically connected?

 If Schizothoracine fishes of both the regions have same ancestry and their current distribution?

 If genetic analysis confirm the answer to the above questions?

1.13 The objectives of the current study was

The current study covered the following objectives

 To investigate genetic diversity of several Schizothoracine species (snow

trout) in Pakistan.

 To reveal the genetic differentiation of Schizothoracine species between two

regions of China and Pakistan.

 To find the divergence time of Schizothoracines fishes in Pakistan and China.

 To find the genome composition and organization of Schizothoracines fishes.

13 Chapter -2 REVIEW OF LITERATURE

2.1 Phylogeography

Phylogeography is a field of science that concerned with different principal and historical processes that governing the geographic distribution of genealogical lineages, especially those within or among closely related species (Avise and Saunders, 1984; Avise, et al., 1987; Bermingham and Moritz, 1998; Avise, 2000). It is also associated with the process of speciation, based on scarcity in the flow of genetic information among different taxa, the formation of new species is a time taking process, so phylogeographic studies helps better to understand the process of speciation. There is a recent advancement in the use of the phylogeographic studies with the involvment of genomic data . The phylogeographic studies have been critically analysed in different part of the globe, to explain the causes of similarties at genetics level (Hewitt, 2004). In different situations there is an interpretation of results in narration while the genetic knowledge proves the spatial distribution keeping in view the past physical barriers and climate that limited their distribution. The more accurate results can be obtained when phylogeography is used comparative background, to explain the genetic divergence for the better analysis of the molecular structure of the evolutionary independent lineages that co-exist in an environment (Knowles, 2009). The phylogeographic studies can serve as powerful tool in conventional systematic and binding it with molecular studies for the maintenance of distribution and biological diversities (Bermingham and Moritz, 1998; Soltis et al., 2006). The phylogeographic studies act as a key stone to describe the process of speciation and relationship between different species in historical perspective. Most of the currents studies are based upon to analysis the closely linked molecular markers (Ronquist and Sanmartin, 2011).

14 The haplotype sequencing is a techniques which can be based on the phylogeographic studies and is a powerful tool to understand the full information about species and also its distribution patterns. Phylogeographic distribution is based on five main groups which reflects the spatially isolated speciation of population, its genomics based ecological and historical factors (Avise, 2000).

Phylogeography is a zoogeographic sector of different population, phylogenetic groups based on genetic information encoded in their mtDNA (Avise, 2000). Phylogeography help in understanding the process of origin, distribution and also describe the mechanism of speciation in reproductively isolated population groups. The knowledge based on the phylogeography can explain the changes in ecosystem and make clear cut statement about the community and its abiotic environment, phylogeography can explain the ecological parameters and population structures based on genetic information of the present day studies. Keeping in view that the valuable contribution of phylogeography has its important role in defining and better understanding of speciation besides other areas of biology and geology (Avise, 1998; Moritz et al., 2000; Hewitt, 2001; Kohn, 2005). Phylogeography is a multidisciplinary field, has providing significant role in human evolution (Beaumont, 2004; Templeton, 2005; Torroni et al., 2006), conservation biology (Avise et al., 1987; Fraser and Bernatchez, 2001; Frankham et al., 2002), biodiversity research and taxonomy (Taberlet et al., 1998; Beheregaray and Caccone, 2007), paleoecology (Cruzan and Templeton, 2000), paleoclimatology (Hewitt, 2004) and volcanology (Emerson, 2002).

The conceptual and technical simplicity of the phylogeographic approach facilitated the spread of the field, population subdivision and population structure were recognized by strong genealogical structure on intraspecific mtDNA phylogenies for a vast array of taxa (Avise, 2000).

15 2.2 Genetic markers used in phylogeography

In molecular study scientist commonly used, nuclear gene, ribosomal rRNA and complete mitochondrial DNA (mtDNA) to estimate phylogenetic associations among earliest divergences (Van de Peer and De Wachter, 1997; Abouheif et al., 1998; Zardoya and Meyer, 1998; Emerson, 2002).

2.2.1 Mitochondrial genes (mtDNA)

In molecular taxonomy, mitogenome plays an important role to compare different species. The mtDNA is extensively vary in its order, composition and arrangement of its genes. There is self-recognition of mtDNA as multiple arranged form found in a single cell.

The use of mtDNAs surprisingly increased now a days to compare the position of organism in its taxonomic category.

i) Novel methods used for mtDNA extraction,

ii) Application of restriction enzymes to show minor differences in

nucleotide sequences,

iii) Improvement in the use of PCR technologies and methodologies,

iv) Availability of universal primers to analyzing the required sequence of

DNA.

2.2.2 Characteristics of Mitochondrial DNA

Mitochondrial DNA is haploid, maternally inherited, lack of recombination and has a fourfold lower effective population size, which is an useful method for identification of genetic diversity and population construction (Englbrecht et al., 2000; Whitehead et al., 2003; Domingues et al., 2007). The mitochondrial DNA (mtDNA) of vertebrates is typically a 16–20 kb long, circular DNA molecule, found

16 several thousand copies per cell (Meyer, 1993; Burger et al., 2003). Due to universal use of mitochondrial DNA in direct sequencing, it is use as a marker of choice for the phylogeographic studies (Wilson et al., 1985). It is know that mtDNA is inherited from mother; results can be wrong when the life histories of males and females are different (Bowen and Karl, 2007). Previous studies revealed that the fixation of mutation in mitochondrial DNA control region may be faster as compared to some nuclear markers (Song et al., 2010). The research that carried out on animals especially on fish has studied the genes of one mitochondrial DNA in order to determine the taxonomic relationships (Rocha-Olivares et al., 1999; Lovejoy and De Araujo, 2000; Tsigenopoulos, 2000). The animals mitochondrial DNA (mtDNA) contain 37 genes which are typically found in the mtDNAs of protists, fungi, plants and animals (Gray et al., 1998). For some animals a large single and well organized non coding sequence also exist (Shadel and Clayton, 1997a), known as to enclose controlling components for replication as well as for transcription. Whether these largest “control regions” are homologous between distantly associated animals or on the other hand, have arisen from various non- coding sequences separately in different evolutionary lineages, frequently uncertain because they share no sequence similarity except for closely related animals. Even for almost all genomes the non-coding region is illustrated, it does not necessarily suggest homology, also many mtDNAs have other non-coding smaller regions but the existence of controlling elements in them is not illustrated (Shadel and Clayton, 1997b).

The use of nuclear DNA as a markers is an important improvement in the field of phylogeography; the significant evolutionary rates in mtDNA is usually because of imperfect mutation repair mechanism (Brown et al., 1979) that cause abundant information per base pair sequenced. Additionally, mtDNA is inherited from maternal line and therefore genes of this molecule are located in a

17 single copy and do not goes under the process of recombination (Ladoukakis and Zouros, 2001a).

In mtDNAs, all genes transcribed from single strand while some other cases transcription of genes occurred from two strands. In few cases, it is calculated that one large polycistron strand is transcribed from large single strand which is posttranscriptionally processed and contain specific messages of the gene. The secondary structures of transfer RNA genes, are consider to send signal for cleavage (Ojala et al., 1981), distribute some mtDNAs polycistron, however others have clustered genes of tRNA so as to prevent such mechanism. At some of these junctions secondary potential structures are suggested as substitutes but for most cases no clear secondary structure is identified. If the mitochondrial gene expression of an animal is unstudied, the ‘polycistron model’ probably will not be suitable for that animal. Whatever the rearrangement mechanisms of gene, it is obvious that the order of a new gene must reserve, or enable alternates, whatever from the rearranged genome for RNAs transcription and processing signals are necessary (Ojala et al., 1981).

Recently many studies used the data of nuclear sequence like nuclear genes, ribosomal RNA or introns in comparison with mtDNA, to find out the genetic patterns of different species (Teske et al., 2007; von der Heyden et al., 2008). So far these reports rejected the fact that in low dispersal potential species, disorganized genetic structure can immediately produce due to the lack of any important factor of environment (Irwin, 2002). Meanwhile sequence data of DNA from mtDNA have shown suitable for identifying phylogeographic breaks and for detecting cryptic speciation, in the study of newly evolved genetic patterns, like those that formed at the time or latter on the Last Glacial Maxima or those formed at historical times. Because of high mutations in microsatellites (a short tandem repeat), the best evolutionary markers to study new evolutionary events. Even though allot of libraries of microsatellite particularly for teleosts have been

18 developed (Galbusera et al., 2007; Dos Santos et al., 2008; Teske et al., 2009; Bester- van der Merwe et al., 2011).

MtDNA globally used as a molecular tool to explore the phylogeny of numerous fish species and has significant value for studying intraspecific genetic diversity due to its high mutation rate (Merilä et al., 1997; Donaldson and Wilson, 1999; Rankin-Baransky et al., 2001; Larizza et al., 2002).

Following are the mitochondrial genes mainly used in phylogeographic study.

2.2.3 Cytochrome B Gene

The most commonly used mitochondrial gene is Cytochrome b (cyt-b), cytb is well known molecular marker use widely for phylogeographic studies. Out of 37 mitochondrial genes, the cytb gene commonly used for phylogenetic study (McVeigh and Davidson, 1991) phylogenetic relationships (Gilles et al., 1998; Xiao et al., 2001a; Perdices et al., 2004; Kumar et al., 2011) biogeographical patterns (Gilles et al., 2001; Xiao et al., 2001a; Durand et al., 2002) and taxonomy (Burridge, 1999; Xiao et al., 2001a) of fishes. The cyt b gene, a protein coding gene (Irwin et al., 1991) is known to be a good phylogenetic marker in accomplishing the true phylogenetic relationship among various taxa (Zardoya and Meyer, 1996). In family cyprinidae, cyt b gene used for phylogenetic relationship and to place these species in to different ranks and to find their biogeography. The cyt-b gene is also used in systematic studies to resolve divergences at taxonomic levels. The animal Cyt b gene contains several features that make it particularly suitable for evolutionary analysis. Such features include, its small size, the high nucleotide substitution rate at synonymous sites. Cytochrome b/b gene has about 400 amino acid that possibly has 8 transmembrane segments (Zardoya and Meyer, 1996). The evolutionary rate of cyt b gene is suitable for investigating different historical events that have happened since last 20 million years, as the time for evolution of Cyprinidae fishes (Irwin et al., 1991). Cyt-b gene has conserved and variable

19 regions, used for diversity of systematic, phylogeny and latest divergence levels and different fishes (Irwin et al., 1991; Lydeard et al., 1995). The somewhat naive view that this gene is suitable for phylogenetic studies at all phylogenetic levels (Meyer, 1994). The importance of Cytb gene at phylogenetic level have been studied at different taxonomic level for various vertebrate taxa, mainly in fish taxa (Lydeard et al., 1995; Zardoya et al., 1995).

Fig. 2: Cytochrome b protein (Google, 2015)

2.2.4 Control region (D-Loop)

The D-loop in vertebrates, recognized as the AT-rich region, does not code for any functional gene, having high substitution rate (Saccone et al., 1987). The control region is flanked by the genes for tRNAGlu and tRNAPhe in most of the avian species, but by tRNAThr and tRNAPro in some species of Picidae, Passeriformes,

20 Falconiformes, and Cuculidae (Mindell et al., 1998; Bensch and Anna, 2000). The mtDNA control region of animals is classified into three domains, the tRNAGlu domain I, the central domain II and the tRNAPhe domain III also evolve at high rates (Randi and Lucchini, 1998). As compared to domain II within the control region the domains I and III showed maximum variability (Baker and Marshall, 1997).

Fig. 3: Mitochondrial D loop showing different regions (Google, 2015)

In Teleostei, the CR is located between tRNAPro and tRNAPhe. Structurally, the CR is composed of a central conserved domain flanked by two highly variable (left and right) domains. In these large domains, several short (approximately <30bp) but conserved sequenced blocks (CSBs) have been described that varied in occurrence between taxa (Lee et al., 1995). In the central conserved domain, the CSBD is involved in the heavy strand replication, including initiation by a 3-strand displacement loop (D-loop) (Clayton, 1991). The CSB-I, CSB-II, and CSB-III are

21 located in the right domain. The functions of these CSBs are not well understood but in mammals the transition to DNA synthesis occurs in the region surrounding CSB-II, which is also evident in flunder fishes (Lee et al., 1995). Within the regions of the CR, the tRNAPro end (extreme 5 end) is a popular chosen marker for evolutionary and population genetics studies because of its rapid evolutionary rate compared to other mitochondrial genes and nuclear coding regions (Lee et al., 1995; McMillan and Palumbi, 1997). In fishes, this region is also widely used for inter and intra-species investigations, but its hyper-variability cannot be generalized to all taxa (McMillan and Palumbi, 1997). For example, in some salmonids (brown trout) the tRNAPro end of the mtDNA CR seems to evolve at a lower rate (Bernatchez et al., 1992; Apostolidis et al., 1997). Indeed, differences in sequence patterns and evolutionary rate of the CR are evident but poorly understood (Lee et al., 1995; McMillan and Palumbi, 1997).

2.3 Importance of genetic material in fish identification

Mitochondrial DNA (mtDNA) is the single genetic matter outer to the nuclear DNA. Its important features are small molecular weight, simple construction, fast evolutionary rate, maternal heredity and non-tissue specificity. To date, the mtDNA is widely used in analyzing genetic relationship of animal or plant and especially fishes (Knudsen et al., 2006; Lavoue et al., 2007; Morin et al., 2010).

Genetic materials both nuclear DNA and mitochondrial DNA are subjected to continuous changes and mutations. Moreover, there are different agents which are responsible for the shifting in the sequences of nucleotides in genetic material during replication process that agents are physicals or may be chemicals. Due to this reason, different population as well as different strains develop within animals and plants, as an outcome making their identification difficult or impossible. Hence, genetic material and genetic markers specifically DNA

22 markers have reliable and responsible tools in genetics studies and population genetics (Lin et al., 2006).

2.4 Disadvantages of mitochondrial material

There are several drawbacks in using mtDNA completely, including that with a few exemptions, it is only inherited from maternal line and is thus inappropriate for the study of hybridization or reproductive isolation between different genetic lineages and that molecular dating constructed on a single molecular marker is less precise than dating based on multilocus data (Felsenstein, 2006).

2.5 Phylogeography of Schizothoracines fishes

Phylogeographic studies play important role to understand the evolutionary history of species (Hewitt, 2004; Pavlova et al., 2005). The biogeographically history of Himalayas and sub-Himalayas has been particularly hard to decipher. Taxa that in this region have expert for more remarkable environmental events than their counter portions in other areas of the continent (Li et al., 1996). The distribution of freshwater fishes, firmly controlled by drainage systems, have providing significant insights into the affiliations among contemporary genetic structure and the historic changes in the environment (Murphy and Collier, 1996; Hewitt, 2004)..

2.6 Worldwide Distribution of Schizothorax

The family Cyprinidae is one of the most widespread, diverse families of freshwater fishes. It consists of >340 genera and 2000 species and naturally occurs in almost all types of habitats on all continents except for Australia and South America (Banarescu and Coad, 1991). These features make it an excellent group for a diversity of biological studies. The subfamilies Schizothoracinae are extensively dispersed in mountain watercourses around the Himalayan, Karakorum and Hindukush Ranges, Tibet Plateau and Central Asia (Ganai et al., 2011). The genus Schizothorax has been reported from China, India, Afghanistan

23 and some other countries (Coad, 1995) and some of Schizothorax species considered as cultural species because of their nutritional and trade values (Gharaei et al., 2010). The snow trouts are the most important food fish of Uttarakhand Himalaya, inhabits in North Indian hill streams viz Alaknanda, Mandakini, Pinder, Nandakini, Bhagirathi etc. (Badola, 1979) where the temperature is ranging from 8- 19°C. Geographically Schizothorax species inhabited in different rivers, lakes, tributaries through Himalayan and sub-Himalayan region extending to confines of China, eastern Afghanistan, Pakistan, eastern Turkistan, Nepal, Ladakh, Tibet, Bhutan, north-east India including Kashmir, Himachal Pradesh, Uttaranchal (Garhwal and Kumaun region) and Assam (Day, 1958). Member of the subfamily Schizothoracinae are generally inhabitants in hilly streams and have a wider distribution in the freshwaters of Central Asia. The genus schizothorax comprises of 60 species in Kashmir, it is characterized by five species viz. S. niger, S. curvifrons, S.esocinus, S. plagiostomus and S. labiatus. Heckel (1838) was first time introduced Schizothorax fishes of Kashmir to the science, while their definite status revised by many scientist on the basis of external morphology (Hora, 1936; Silas, 1960; Das and Subla, 1964b; Saxena and Koul, 1966).

In Himalaya and sub-Himalaya most commonly the snow carps are restricted to Trans- Himalayan area of the Indus structure where the water temperature remains below 20°C. Nature has bestowed Himalayan and Tibet with cold water resource, with a diverse variety of habitation, most excellent for snow carps. The Schizothoracine fishes are the most diverse ichthyo fauna of Tibetan Plateau, are a good demonstration for exploring the model of evolutionary system and life history. The Schizothoracinae fishes are specified for extraordinary elevation rivers systems and show wonderful adaptation (Chen and Cao, 2000). The members of schizothorax fishes restricted to QTP areas either on high altitudes or high latitudes have developed a sequence of both morphological and physiological traits to acclimatize to the cold and hypoxic atmosphere and show significant roles in the

24 trophic web of QTP freshwater community (Wu and Wu, 1992). The outstanding feature in schizothoracine fishes is that they show maximum diversity in trophic morphology to fulfilled demands for dealing with trophic polymorphisms (Wu and Wu, 1992).

Many investigators are involved in exploring the grade to which phylogeographic designs of animal taxa particularly fish are related to chronological changes in the atmosphere, to determining the origins of biodiversity on earth (Lydeard et al., 1995). The fishes, mainly the fresh-water fishes, have providing significant relationships among the chronological fluctuations in the atmosphere and the biotic responses to those (Dodson et al., 1995; Lydeard et al., 1995; Murphy and Collier, 1996). The distribution of fish is strictly organized by water and faunal associations among diverse stream systems are normally obstructed; consequently, a deeper separation may result from historical changes. Many authors have tried hard to examine the dilemmas and have acquired several useful clue (Lydeard et al., 1995). In East Asia, a few remarkable changes happened in speciation, distribution, and connectivity of Cyprinidae, before 5–30 million years typically in reaction to local climate alteration related with mass construction and river structure modifications (Liu and Su, 1962; Zhou, 1990).

In China, about 70 species and 9 subspecies from 11–12 extant or nominal genera account for over 80% of the world’s Schizothoracine species (Wu and Wu, 1992; Yue and Chen, 1998a). Most species are endemic to China and are generally dispersed in fresh water lakes and rivers of plateau. Taxa that present in this region have experienced remarkable geological and climatic actions than their colleagues in other regions of the continent (Li and Fang, 1999a). Most of our understanding is based on the current distributions of species and an inadequate fossil record supporting historical distributions of the subfamily Schizothoracinae (Yun-fei and Yi-yu, 1980; Cao et al., 1981b).

25 However, no palaeogeographical assumption has been proposed to account for distribution pattern of Schizothorax, based on dispersal and vicariance. It has been documented that palaeo-drainages of major East Asian rivers draining the southeastern Tibet plateau boundary varied distinctly from contemporary drainage patterns (Gregory, 1925; Brookfield, 1998; Hallet and Molnar, 2001; Clark et al., 2004). Newly, a regional assembling of the drainage history in south-eastern Tibet recommended that the contemporary rivers draining the plateau margin existed as a tributaries of single, southward-flowing system, which drained into the South China Sea (Clark et al., 2004). Successively restructuring into recent river drainages was mainly initiated by river capture and reversal actions related with the beginning of Miocene uplift in eastern Tibet. It is generally believed that the evolution and dispersal designs of fresh-water fishes reflect the palaeogeographical complication of a region, particularly the progress of rivers and their separation and interconnection mechanism (Hurwood and Hughes, 1998; Berendzen et al., 2005).

2.7 Role of glaciations history in Phylogeography

The phylogeographic architecture and genetic diversity of fishes have been largely explored in glaciated as well as non-glaciated regions. For instance, marked decrease in genetic diversity have been witnessed among displaced fishes as a result of glacial advances. It is anticipated that the decrease in fish diversity in northern populations could possibly be attributed to the huge destruction and displacement as a consequence of heavy glaciations in this part of the country. Additionally, the reduced habitat number and size would have further impacted the significant losses of intraspecific fish diversity (Avise and Saunders, 1984).

Similarly, the bottlenecks seen in refugia would not be the only factor for deceased fish genetic diversity, as persistent reduction in population size would have equally impacted the fish diversity in the area (Avise and Saunders, 1984). Fish

26 species in the northern Pakistan where there is huge glaciations showed little intraspecific divergence and appeared younger in evolutionary context than species belonging to the non-glaciated areas of Pakistan. Therefore, it is strongly believed that the, previously present marked diversity in mitochondrial DNA would have been lost due to large-scale disturbances and founder effects seen as a consequence of rapid glaciations and retreats (Avise and Saunders, 1984).

Keeping in mind the extensive glaciations phenomenon seen during the Pleistocene (Martinson et al., 1987; Dawson 1992), it is, therefore, reasonable to argue that extant intraspecific mitochondrial lineages within northern species would trace back to a more recent common ancestry as compared to the species present in the non-glaciated regions. Avise et al. (1987) predicted that intraspecific phylogeographic structure should correlate with recognized zoogeographic provinces. This should also hold true for majority of the northern species dispersing from single glacial refugia (McPhail and Lindsey, 1970). Likewise, the similarity is also probable for species which persisted in two or more refugia but have disjunctive distributions (i.e. no secondary contact between refugial groups). Conversely, however, the phylogeographic structure of continuously distributed multiple-refuge species may not fit zoogeographic predictions, because the same conditions that resulted in secondary contact to occur may also have favoured subsequent dispersal. Moreover, it is generally perceived that allopatric groups will be reciprocally monophyletic and readily distinguishable. This assumption, however, may not be justified for multiple-refuge northern species because repeated glacial advances may have resulted in vicariant displacement of a single lineage or closely related groups into separate refuges. If insufficient evolutionary time elapsed during their period of allopatry, fish from separate refugia may show little or no detectable phylogenetic differences. Many northern species, on the other hand, also typically have larger range sizes than species from non-glaciated areas (Martinson et al., 1987). This is could be attributed to the postglacial dispersal

27 opportunities provided by proglacial lakes (Hocutt and Wiley, 1986; Dyke and Prest, 1987). As a result of these dispersal opportunities, species with similar ranges that are present in deglaciated regions may not show good phylogeographic concordance, either in number of phylogenetic clades groups, geographical ranges of clades from shared refugia, or location and extent of secondary contact among refugial groups. Ecological differences between species may also have resulted in marked differences in phylogeographic patterns. Thus, habitat conditions in glacial refugia and proglacial lakes changed regularly, as their locations and boundaries altered with shifting glacial borders (Pielou, 2008).

28 Chapter-3 MATERIALS AND METHODS

3.1. Chemicals used during experiment

Following chemicals were used during experiment,

i. 95 % ethanol ii. 10 % formalin iii. 75% ethanol iv. EDTA v. MolTris vi. NaCl vii. Chloroform viii. Isopropanol ix. Tris-acetate-EDTA buffer x. ethidium bromide xi. loading buffer xii. dNTPs xiii. Taq DNA polymerase xiv. F primer xv. R primer

3.2. List of solution used during experiment

Following solution were used during experiment,

i. 95% ethanol solution (95% ethanol + 5 % water) ii. 75% alcohol solution (75 % alcohol + 25 % water) iii. Home buffer (80m Mol EDTA, 100 mMolTris, 0.5% SDS Proteinase K: 0.15mg/ml).

29 3.3. Sampling sites

Specimens of genera schizothorax were collected during June 2014 to September 2014 from district Swat (River Swat), Chitral (River Chitral), Manshera (River Kunhar and River Siran), Muzaffarabad (River Neelum), Dir (River Panjkora) of Pakistan and from Bangong CO rivers of Tibet, China.

Map 1: Sampling points of different areas of Pakistan and China (Google earth, 2015)

The samples were collected by using gill net or cast net with the help of local people, fishermen and members of Department of Fishery KP Pakistan.

30 3.4 Collected species

All schizothorax species were searched in selected areas of Pakistan, however only two species of genus schizothorax i-e Schizothorax esocinus and Schizothorax plagiostomus were found. In addition, single species of genus schizothorax i-e schizothorax labiatus were collected from Tibet (China). A sum of 3 to 5 individual of each species were collected from each river of Pakistan, and due to limited number of some fish species like S. esocinus, this number was not maintained. From Tibet China, the all specimens were collected from Single River because S. labiatus is found only in Bangong CO River.

3.5 Sample collection and preservation

Samples were collected with hand net or cast net and muscle tissue were preserved in 95 % ethanol and used for DNA extractions. Voucher specimens were fixed in 10% formalin and transported to Department of Zoology Hazara University Mansehra, Pakistan. Each fish was again dissected for muscle tissue and fins clip. For DNA extraction about 10 – 20g muscle tissues or fins clip of each fish were collected in 1.5 ml eppendorf tube and were preserved in 95% ethanol solution. For the cleaning of muscle tissues, the ethanol solution was changed first time after 2 hours, then after 6 hours and may be after 2 days until the solution became colorless. To avoid cross-contamination only one sample was preserved in a tube, as DNA cross-contamination is always a serious issue that can compromise results. Neat and clean knife, scalpel, or scissors were used for muscle tissues/ fin clip, to remove a whole or partial fin from the fish being sampled. Dirt and any visible parasites were removed from tissues to prevent affect over genetic analyses. All the cutting tools and forceps were cleaned using 75% alcohol to minimize sample cross-contamination. All the instruments (e.g knife, razor blade, scissor and forcep) exposed to the preceding sample of tissue were washed with high concentration ethanol (i.e. 70% or greater EtOH) and ignited with spirit lamp.

31 3.6 Samples labeling

The eppendorf tube were labeled with a distinctive label or number on the outside and inside that matched accurately to the information in field book about the collected species and specimen in the tube, locality where the specimen was collected, including date of collection, longitude and latitude, collector name. As small tubes were used for tissues preservation, so some alpha-numeric code was used to find the label and same were noted in field book. After tissues collection, the removed fish tissues were placed in small labeled tube containing 95 % ethanol solution. After that photograph of the collected specimen were also taken with digital camera. Label information is given below,

 Species name/ number  Individual code  Location: Water body Name (Sampling Location; Include Latitude and Longitude)  Date: Day/Month/ Year/

32 Table: 1. Details of specimens collected from different locations

Code of S. No Species Family River Station of collection GPS Coordinates specimen

1 SP 1 Schizothorax plagiostomus Cyprinidae Kunhar Balakot (34° 33' 31"N) (73° 21' 19"E)

2 SP 2 Schizothorax plagiostomus Cyprinidae Kunhar Balakot (34° 33' 31"N) (73° 21' 19"E)

3 SP 3 Schizothorax plagiostomus Cyprinidae Kunhar Balakot (34° 33' 31"N) (73° 21' 19"E)

4 SP 4 Schizothorax plagiostomus Cyprinidae Kunhar Balakot (34° 33' 31"N) (73° 21' 19"E)

5 SP17 Schizothorax plagiostomus Cyprinidae Swat Madyan (35° 35' 31"N) (72° 29' 57"E)

6 SP18 Schizothorax plagiostomus Cyprinidae Swat Madyan (35° 35' 31"N) (72° 29' 57"E)

7 SP19 Schizothorax plagiostomus Cyprinidae Swat Madyan (35° 35' 31"N) (72° 29' 57"E)

8 SP20 Schizothorax plagiostomus Cyprinidae Swat Madyan (35° 35' 31"N) (72° 29' 57"E)

9 SP21 Schizothorax plagiostomus Cyprinidae Swat Madyan (35° 35' 31"N) (72° 29' 57"E)

10 SE 6 Schizothorax Esocinus Cyprinidae Swat Madyan (35° 35' 31"N) (72° 29' 57"E)

11 SP8 Schizothorax plagiostomus Cyprinidae Panjkora Ckhgdra (34° 39' 35"N) (71° 45' 36"E)

12 SP9 Schizothorax plagiostomus Cyprinidae Panjkora Ckhgdra (34° 39' 35"N) (71° 45' 36"E)

13 SP10 Schizothorax plagiostomus Cyprinidae Panjkora Ckhgdra (34° 39' 35"N) (71° 45' 36"E)

14 SP11 Schizothorax plagiostomus Cyprinidae Panjkora Ckhgdra (34° 39' 35"N) (71° 45' 36"E)

16 SE1 Schizothorax Esocinus Cyprinidae Panjkora Ckhgdra (34° 39' 35"N) (71° 45' 36"E)

17 SE2 Schizothorax Esocinus Cyprinidae Panjkora Ckhgdra (34° 39' 35"N) (71° 45' 36"E)

18 SE3 Schizothorax Esocinus Cyprinidae Panjkora Ckhgdra (34° 39' 35"N) (71° 45' 36"E)

19 SE4 Schizothorax Esocinus Cyprinidae Panjkora Ckhgdra (34° 39' 35"N) (71° 45' 36"E)

20 SE5 Schizothorax Esocinus Cyprinidae Panjkora Ckhgdra (34° 39' 35"N) (71° 45' 36"E)

34 SP 5 Schizothorax plagiostomus Cyprinidae Neelum Chela (34° 19' 78"N) (73° 6' 39"E)

35 SP 6 Schizothorax plagiostomus Cyprinidae Neelum Chela (34° 19' 78"N) (73° 6' 39"E)

36 SP 7 Schizothorax plagiostomus Cyprinidae Neelum Chela (34° 19' 78"N) (73° 6' 39"E)

38 SP11 Schizothorax plagiostomus Cyprinidae Siran Acherian (34° 36' 40"N) (73° 4' 45"E)

39 SP13 Schizothorax plagiostomus Cyprinidae Siran Acherian (34° 36' 40"N) (73° 4' 45"E)

40 SP14 Schizothorax plagiostomus Cyprinidae Siran Acherian (34° 36' 40"N) (73° 4' 45"E)

41 SP15 Schizothorax plagiostomus Cyprinidae Siran Acherian (34° 36' 40"N) (73° 4' 45"E)

33 42 SP16 Schizothorax plagiostomus Cyprinidae Siran Acherian (34° 36' 40"N) (73° 4' 45"E)

43 SL1-SL20 Schizothorax labiatus Cyprinidae Bangong Co Tibet (China) (29° 64' 75"N) (91° 11' 75"E)

3.7 Fixing of whole specimens

Whole specimens were preserved in 95% EtOH for DNA extraction but only when collected specimen was small and amount of EtOH much more than the preserved specimen. Ethanol solution was changed 2-3 times after preservation, depend on the colour of ethanol in tubes. Preservation of whole specimens only useful when collected specimens were too small and it was difficult to remove tissue easily or if we don’t have appropriate utensils for tissues storage. But this procedure required much greater quantity of EtOH than the specimen and EtOH was changed regularly. The all collected samples were send to the Insituate of Hydrobiology Chinese Academy of Sciences Wuhan, China for DNA extraction and further molecular study.

3.8 Fish Identification

The fishes were identified to species level by using following keys.

 Jayram (1990). The fresh water fishes of India Region Narendra Publishing House Delhi-110006 (India)  Mirza and Sandhu (2007). Fishes of Punjab Pakistan Polymers Publication Lahore.  Mirza (1990). Pakistan ki Taza Pani ki Machelian (in Urdu) Urdu Science Board, 29-Upper Mall Lahore.

34 3.9 DNA extraction protocol

Reagent:

Home buffer: 80m Mol EDTA, 100 mMolTris, 0.5% SDS Proteinase K: 0.15mg/ml

Steps:

1) At beginning, 500 µl of ethanol (100%) in each eppendorf tube.

2) 0.5 gm of fish fins/muscle tissues were mixed in each eppendorf tube

(containing ethanol) and crushed with seizer till small pieces.

3) Tubes were centrifuged for 5 minutes at 10000 rpm.

4) Ethanol was removed from each tube and pellets were remained in tube.

5) Samples were then placed in incubator for complete drying about 1-2 hours

at 55°C.

6) Hom buffer (atleast 500 µl for one sample) and proteinase k (5 µl for one

sample) were mixed in a beaker and mixed with 505 µl of mixture (hom

buffer and proteinase k) in each eppendorf tube and mixed thoroughly.

7) Sample were then kept for at least 3 hours at 55°C (but checked after 30

mins in first hours).

8) 500 µl Nacl were added.

9) Then 300 µl of chloroform were added and mixed for 15 minutes.

10) Then centrifuged for 10 minutes at 10000 rpm.

11) The supernatant were poured into new tube (upper phase contain DNA).

12) Then 600 µl of isopropanol (at least) were added and mixed for 15 minutes.

35 13) All the samples were kept at - 20°C for 1 hour.

14) Centrifuged for 10 minutes at 13000 rpm and the supernatant were

removed (DNA stilled down).

15) 500 µl of ethanol were added (70%) and shake for 5 minutes.

16) Again centrifuged for 5-10 minutes at 13000rpm.

17) Supernatant were removed carefully don’t removed DNA.

18) 500ul of 100% ethanol were added in each tube and shake well then vertex

for 10 minutes.

19) Again centrifuged for 5 minutes at 13000rpm and supernatant were

removed.

20) Again added 500 µl of ethanol (100%) vertexed for 5 minutes and

centrifuged for 5 minutes at 13000 rpm and supernatant were removed.

21) At last the pellets were dried in incubator for about 50 minutes at 35°C.

22) Distilled water may be 20 ml, 50 ml and 100 ml in each tube. The water

volume depends upon quantity of DNA.

3.10 Gel Electrophoresis

The quality of DNA was evaluated through electrophoresis in a 1% agarose

gel by using the following steps

1) First of all 1 g agarose gel (powder form) was mixed with 100 ml of tris-

acetate-EDTA buffer in agarose tray.

36 2) The agarose was kept in flask and then pour tris-acetate-EDTA buffer was

poured and placed in microwave oven for 2 minutes.

3) After boiling in microwave, 2 µl of ethidium bromide was added in flask

and shaken thoroughly.

4) 2 µl of loading buffer was mixed with 0.5 µl of DNA in dotted method.

5) The mixture (DNA+ buffer) was sucked and loaded in well of the gel.

6) DNA marker was loaded for comparison.

7) All these were run on electric source of 120 w voltage for 30 min.

8) After 30 min gel was removed and band were visualized on Gel-Doc

machine.

3.11 Primers designing

The 16 pairs of primers were designed for DNA amplification on the basis of mitochondrial sequence of Herzensteinia microcephalus (Li et al., 2014) and Schizothorax wangchiachii (Chen et al., 2013).

37 Table 2: PCR and sequencing primers designed from the complete mitochondrial genome

ID Location F Tm

Li-M1 M1-F GCTAGCGTAGCTTAATATAAAGCATAGCACTG 50-660(tRNA- 53-56 phe 12s RNA) (54) 600 M1-R TTATACCCTTCACAGGGTAAGCTGACCGACG

Li-A LI-A-F 12S(490-518) CAAACCTGGGATTAGATACCCCACT 53-63

950 LI-A-R 16S(1414-1439) ACTCTTTTGCCACAGAGACGGGGTT (58)

Li-B LI-B-F 16S(1050-1070) AAGCATCTCACTTACACCGAG 53-63

1500 LI-B-R 16S(2531-2555) TGTCCTGATCCAACATCGAGGTCGT (56.5)

Li-C LI-C-R 16S(2241-2265) CAAGACGAGAAGACCCTTTGGAGCT 54-63

ND2-5(3967- 1700 LI-C-R TAGAAAGTGGTGTAGAGGAAGCAC (60.3) 3990) ND2-5(3870- Li-D LI-D-F AGGACCACTTTGGTAGAGTG 53-64 3890) Trna-Asn(5255- 1500 LI-D-R TTGTAGGATCGAGGCCTTCCCA (59) 5276) (tRNAGln— D D-F tRNATyr)3900- CTAGAAAGAAGGGAATTGAACCC 52-58 5474

1500 D-R CAGGCACCAAATACAAGATAAAGGGT (59.1)

(tRNATyr— E1 E-F1 AAACCTCTGTCTTCGGGGCTAC 52-58 COX1)5402-7024

1600 E-R1 TTTGATTGAATTTGAACGAATGCTG (57)

(COX1—Trna- E2 E-F2 GACACTCGTGCATACTTTACATCTGCAAC 52-58 lys)6300-7875

1600 E-R2 AATACTAAAATTGCGAATCAAGGGC (55)

(Trna-lys— 52-58 F1 F-F1 tRNA-Arg)7900- CGCTAGGAAGCTAAATATTGGAC 10015 (57)

2200 F-R1 CCACAATCTTCTGAGCCGAAATCAGA

38 (Trna-Arg— 52-58 G G-F Trna—Trna- CTATTGATGAGGCTCATAATCTTTCTAG Leu)9600-11950

1600 LI-G-R GCACCAAGAGTTTTTGGTTCCTAAGACC

(Trna-His— 52-58 4 2B-F COX1) 11768- TAGATTGTGATTCTAAAGACAGGGG 13128 (55)

1300 4C-R GAGGTGTTTAGGGCTTCAATAATTGC

(COX1- T 5C-F ND6)13005- ACCCACGCCTTCTTCAAGGC 52-58 14289

1300 H-R CAACGGTGGTTCTTCAAGTC (54.3)

(ND6- N3 N3-F Cytb)14253- GCAGCAAAATAAGGCGTAGG 52-58 14641

400 N3-R TGAAGAAGAATGATGCTCCG (54)

(Cytb-Trna- Cytb L14724 GACTTGAAAAACCACCGTTG 52-58 Thr)14368-15560

1200 H15915 CTCCGATCTCCGGATTACAAGAC (55.5)

Cytb- (Cyt-Dloop) cd-F3 AACAACGAGGACTAACATTC 52-58 Dloop 15300-15800

1500 cd-R3 TGGTGATAATACATACATGTATATTAG (56.1)

D- (Dloop-Trna- DL ACTCTCACCCCGGCTCCCAAAGC 52-58 loop phe) 15654-50

1600 DH GGACCATGGCCTTTGTGCATGC (52)

39 Table 3: PCR and sequencing primers used for amplification of Cytb and Dloop.

Cytb L14724 (Cytb-Trna-Thr)14368-15560 GACTTGAAAAACCACCGTTG 56.1

1200 H15915 CTCCGATCTCCGGATTACAAGAC

Dloop DL (Dloop-Trna-phe) 15654-50 ACTCTCACCCCGGCTCCCAAAGC 52

1600 DH GGACCATGGCCTTTGTGCATGC

3.12 Laboratory procedures

To amplify the whole mitogenome, the total genomic DNA of S. esocinus, S. plagiostomus and S. labiatus was extracted from ethanol preserved skeletal muscle tissues using a high salt extracted method (Miller et al., 1988). Sixteen pairs of primers were designed for polymerase chain reaction (PCR) amplification based on original DNA sequences of cyprinid fish mitochondrial genomes. The cyt b gene and Dloop were amplified using primers L14724 (5’ - GACTTGAAAAACCACCGTTG-3’) and H15915 (5’

CTCCGATCTCCGGATTACAAGAC-3’ ), DL (5’ -ACTCTCACCCCGGCTCCCAAAGC-

3’ ) and DH (5’ -GGACCATGGCCTTTGTGCATGC-3,) respectively adapted from (Xiao et al., 2001b). All the PCR amplifications were performed in LifePro Thermal cycler model TC-96/G/H(b)A, China. The 25 µL reaction cocktail included 6 µL of 10 × buffer, (final 1× PCR buffer), 1.5 µL of each nucleotide (dNTP), 1 µL of each primer, 1.5 unit of Taq DNA polymerase and 1–2 µL of template DNA. The thermocycling procedure was started at 94°C for 5 min, followed by 20 cycles at 94 °C for 30 s, 56 °C for 50 s, and 72 °C for 1 min 30 s, with a reduction of 0.1 °C in annealing temperature for each cycle. This was followed by 12 additional cycles with the annealing temperature fixed at 54 °C, and the final cycle ended with 8 min extension at 72 °C. For each sample, 1 µl of PCR product was electrophoresed (Bio-

40 Rad) on 1.2 % Agarose gel in 1×Trisacetate-EDTA buffer at 80 V for 30 min followed by ethidium bromide staining, and visualized under UV illumination in the Gel-Doc system. Molecular weights were determined using 2000 bp DNA markers and the PCR products were sequenced (Sangon Biotech Company Shanghi).

Fig 4: Different steps and condition for PCR.

3.13 PCR Procedure

Equipment

1. Centrifuges 2. Incubator (55 °C and 65 °C) 3. PCR Thermal cycler

41 PCR reactant contain following mixture

Reaction components Volume (ul)

H2o 16

Buffer 0.2

DNTPs 0.5

F primer 0.3

R primer 0.3

Taq Poly 0.4

DNA 0.5

 Total 19.5 µl reactant mixture and added 0.5 µl of DNA (reaction tube contains 20 µl of all mixture.  Vertexed for a second.  Spin all reaction tube in centrifuge for 2-3 second and all samples were subjected to thermocycler.

3.14 PCR mixture for 60ul

PCR reactant contain following mixture

Reaction components Volume (ul)

H2o 48.5 Buffer 6 DNTPs 1.5 F primer 0.9 R primer 0.9 Taq Poly 1.2 DNA 1

42 3.15 Sequencing

PCR amplification was performed using primers specifically designed for Schizothoracinae fishes. The complete list of successful primers is available in table 2. The PCR products were visualized by electrophoresis in a 1% agarose gel. Each PCR product was represented by a single electrophoretic band and directly sequenced. The purified fragments of complete mitochondrial genome, Cytb and Dloop were sequenced with Bigdye sequencing chemistry with an ABI 377 Automated Sequencer (Sangon Biotech Company Shanghi, China). The amplification PCR primers were used for sequencing. The sequences have been deposited in the GenBank library.

3.16 Blast searches

The true identity of this genome was established using the BLAST program available at the NCBI web site. The NCBI website was also used for complete mitochondrial sequence alignment with its closely associated species by BLAST to minimize the assembling error.

3.17 Data Analysis

3.17.1 Gene identification and genome analyses

The Bioedit and ClustalX 1.8 program was used for sequences alignment (Thompson et al., 1997) and to removed errors and mistakes the complete mitochondrial sequence was aligned with its closely related species by BLAST (Qi et al., 2007). Errors and missing data in sequences were coded as query marks in the analysis. The complete mitochondrial genome of three species have been submitted in GenBank under accession numbers KT184924, KT210882 and KT944287 for S. plagiostomus, S, esocinus, S. labiatus respectively.

43 The protein-coding genes (PCGs), rRNA genes and the remaining putative tRNA genes were identified by sequence comparison with other Schizothorax species. The tRNAscan-SE software was used to identify the secondary structure of tRNA. The nucleotide compositions of the mitogenomes and amino acid information were analyzed using MEGA 6.0 (Tamura et al., 2013b).

Base composition statistics was calculated from the heavy strand (that having greater molecular weight) for whole genome data and from the non-template (coding) strand for each identified gene. AT and GC skews were calculated by the methods of (Perna and Kocher, 1995), where AT skew= [A - T]/[A + T] and GC skew = [G – C]/[G + C].

Mostly tRNA genes were recognized using tRNAscan-SE 1.21 (Lowe and Eddy, 1997) under the ‘tRNAscan only’ search mode, with the vertebrate mitochondrial genetic code and ‘mito/chloroplast’ source. http://lowelab.ucsc.edu/tRNAscan. SE was used for making secondary structure of tRNAase. The complete circular plasmid was drawn for S. plagiostomus, S. esocinus and S. labiatus by using following site http://ogdraw.mpimp-golm.mpg.de. Along with the entire mitogenomes obtained in this study, sequences were used in the phylogenetic analysis, including two outgroups. The DNA sequences of the other species used in the phylogenetic analyses were downloaded from GenBank and MEGA 6 software was used for complete mitochondrial genome phylogenetic analysis.

3.17.2 Phylogenetic Analysis

Sequences were aligned using Bioedit and Clustal X. The MEGA6.0 (Tamura et al., 2013a) was used to calculated the nucleotide base composition and to find bootstrap values. The nucleotide divergence between different sequences were calculated using MEGA 6 software (Kumar et al., 2011). The Mrbayes 3.1.1 software was used for bayesain analysis (Ronquist and Huelsenbeck, 2003).

44 The DnaSPvers. 5.10.01 (Rozas et al., 2003) was used to find the number of invariable, variable, singleton variable and parsimoniously informative sites of Cytb, D-loop and combined sequences. The number of haplotype, haplotypes, diversity (h) and nucleotide diversity (π) were calculated using DnaSP software. For each data set, Modeltest 2.1 was used to find the best model for each data set i-e individual gene (Cytb, Dloop) and combined gene (Cytb + Dloop). The best fit model was designated by the Akaike Information Criterion (AIC) method (Posada and Crandall, 1998). Bayesian inference (BI) analysis was achieved with MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003). In BI analysis, posterior distribution was found by the Monte Carlo Markov Chain (MCMC) method having one cold chain and three heated chains for 50,000,000 generation, with every 100th sample being retained. The first 7500 sampled trees were castoff as conservative burn-in and the residual samples were used to generate a 50% majority rule consensus tree and visualized in Fig Tree v1.4.2.

The exact data about divergence of Schizothoracinae fishes in Asia is not known, divergence time were calculated the Bayesian relaxed clock method by using Beast software version v 1.8.2 and visualized in TRACER v 1.6 (Rambaut and Charleston, 2001). The divergence time for Cyprinids considered as the intermission of evaporate deposition and Lago Mare sedimentation in Mediterranean before the Pliocene flooding 5.33 Myr ago (Lourens et al., 1996). The conditions of MCMC (Markov chain Monte Carlo) were as follows, the first 106 generations were castoff as burn in, the subsequent 1×107 included in the analysis. The sample frequency was 100 per generations.

45 Chapter-4 RESULTS

DNA quantification:

Fig. 5: DNA extraction bands of complete genome on gel electrophoresis.

PCR Amplification:

Fig. 6: PCR results of complete genome on gel electrophoresis.

Fig. 7: PCR bands of Cytb gene on gel electrophoresis

Fig. 8: PCR bands of Dloop gene on gel electrophoresis

47 4.1 Genome organization and composition

Findings of this study showed that, order and organization of genes in the Schizothoracinae fish (Schizothorax esocinus, Schizothorax plagiostomus and Schizothorax labiatus) mitochondrial genome was similar as those understood in other vertebrates, and no structural irregularities were detected. The complete nucleotide sequence of S. esocinus, S. plagiostomus and S. labiatus were circular and molecular weight were 16591 bp, 16564 bp and 16590 bp respectively. The structural organization of the mitochondrial genome of Schizothorax species, coding and non-coding regions was similar to that of other fishes and higher vertebrates, composed up of a typical set of 37 genes, 22 transfer RNA genes, 13 protein coding genes (PCGs) and two ribosomal RNA (12S rRNA and 16S rRNA) genes. Moreover the above mentioned genes, there is one another non-coding region recorded in between 12S rRNA and tRNAIle with a high A+T content and less G+C contents, as a putative control region was also recorded in all three species of genus schizothorax. Commonly genes were encoded on heavy strand (H- strand) which contain 12 protein coding gene excluding one protein coding gene which encode on light chain (L-starnd) which was ND6 gene, whereas 8 tRNAs genes also placed on light strand. Similarly another portion was recorded in

Schizothoracinae fishes, which is replication origin (OL), in S. esocinus 33 bp, S. plagiostomus 08 bp and S. labiatus 08 bp respectively. The organization, arrangement and direction of transcription is shown in fig 9, 10, 11.

48 4.2 Overlapping regions and intergentic spacer

In organization of mitochondrial genome of schizothorax, few genes were interrupted by spacers of variable length, some genes united end to end, whereas some genes overlap, although the length of spacer and overlapping may be diverse from other Schizothoracinae fishes and higher vertebrate. In Schizothoracinae fish (S. esocinus, S. plagiostomus and S. labiatus) a total of 7 overlaps were recorded in thirteen protein coding genes. Four out of thirteen overlaps were recorded among ATP8-ATP6, ATP6-COXIII, ND5-ND6, ND4L-ND4. Out of these only two ATP genes overlaps are recorded in S. Plagiostomus i.e. tRNAIle –tRNAGln and tRNACys - tRNATyr among all 22 tRNA genes and the remaining one overlap is recorded in genes ND3-tRNAArg. The longest overlaps (7 bp long) were recorded between two protein coding genes such as ATP8 and ATP6, second longest overlaps was recorded in, ND4L and ND4 which was 7 bp, while the largest intergenic spacer 27 bp long located between tRNAThr and tRNAPro genes. The overlaps in case of ATPase genes are very common in vertebrate mitochondrial genome upto – 10 bp in size and its size in fish (7–10 bp) is lesser than that in mammals (40–46 bp) (Broughton et al., 2001). The two rRNA gene 12S rRNA (957 bp) and 16S rRNA (1677 bp) located between tRNAPhe and tRNAleu like other vertebrates. The overall organization of the genes in S. esocinus, S. plagiostomus and S. labiatus was similar to other vertebrates (Broughton et al., 2001; Wang et al., 2007; Fiaz Khan et al., 2016).

In mtDNA of Schizothoracinae fishes, two types of rRNAs were recorded 12S and 16S rRNA genes correspondingly, surrounded by tRNAPhe and tRNAVal gene at the 5´ end and the 3´ end by tRNAVal and tRNALeu gene. The length of 12S rRNA was 957 bp and 16S rRNA 1677 bp respectively and were located on heavy strand. The observed average base compositions in rRNA genes was (A=33.45%; G= 21.05%; T=19.95 %; C=25.01%) and A+T contents was 53.04%. Homology analysis revealed that the sequences of the tRNAs and rRNAs gene encoded by mtDNA of Schizothoracinae fishes were relatively conserved. In rRNAs S. esocinus and S.

49 plagiostomus the average AT skew and GC skew were 0.0674 and 0.9970 respectively, while average AT skew and GC skew in S. labiatus were 0.0680 and 0.9970 respectively.

4.3 OL Region

A short structure located between two tRNAs (tRNAAsn 5' and tRNACys 3') in Schizothoracinae fishes was called L- strand origin of replication. The OL origin was 33 bp, 08 bp and 08 bp in S. esocinus, S. plagiostomus and S. labiatus respectively. This specific region has ability to produce a stable stem loops shape in Schizothoracine fishes. This organization plays a very important role in transition of RNA to DNA synthesis during the process of replication initiation.

4.4 Protein-Coding Genes

In all schizothoracine fishes (S. esocinus, S. plagiostomus and S. labiatus) 13 protein coding genes were recorded, among them 12 protein coding genes were located on heavy strand (ND1, ND2, COX1, COXII, COXIII, ATP8, ATP6, ND3, ND4L, ND4, ND5 and Cytb) and one gene was located on light strand (ND6). All the protein coding genes start from ATG except COXI and ND6 start from GTG and TTA respectively which is typically found in bony fishes and many other fishes (Boore, 1999; Liu et al., 2015; Yan et al., 2016; Fiaz Khan et al., 2016) whereas 8 protein coding gene (ND1, COXI, ATP6, ATP8, COXIII, ND4L, ND5 and ND6) share the common termination codons TAA, while ND2 termination codon is TGA, COXII, ND3, ND4 and cytb gene have incomplete stop codon (T--). Similar structure are found in vertebrate mitochondrial genes, it seems that TAA stop codons are formed via posttranscriptional polyadenylation (Ojala et al., 1981). For all protein genes, the heavy strand works as the template for transcription, except ND6. However, this study shows gene sequences in terms of the light strand, which is the sense strand with respect to mRNA.

50 4.5 Comparative gene arrangement comparison of S. esocinus, S. plagiostomus and S. labiatus

The Gene arrangement and organizations are often excluded tRNAs because they are more likely to be in arrangement. Our results revealed that in above mentioned three species, the gene arrangement and organization of gene were essentially almost same except negligible variation in control region (Dloop). Other gene, like protein coding gene in three species almost same in base pairs.

Table 4. Characteristics of genes in the mitochondrial genome of Schizothorax esocinus

Position Codon Anti- Intergentic Locus Abbreviation From To Size (bp) Start Stopa Amino acid codon nucleotideb Strandc tRNAPhe F 1 69 69 GAA 0 H 12S 12SrRNA 70 1026 957 0 H tRNAVal V 1027 1098 72 TAC 0 H 16SrRNA 16S 1099 2775 1677 0 H tRNALeu L 2776 2852 77 TAA 0 H ND1 nd1 2853 3831 979 ATG TAA 326 4 H tRNAIle I 3832 3901 70 GAT -2 H tRNAGln Q 3902 3974 73 TTG -2 L tRNAMet M 3975 4043 69 CAT 0 H ND2 nd2 4044 5088 1045 ATG TGA 348 -2 H tRNATrp W 5089 5161 73 TCA 2 H tRNAAla A 5162 5232 71 TGC 2 L tRNAAsn N 5233 5305 73 GTT 0 L

OL OL 5306 5338 33 0 - tRNACys C 5339 5404 66 GCA -1 L tRNATyr Y 5405 5476 72 GTA 1 L COX I Cox1 5477 7027 1551 GTG TAA 516 0 H tRNASer S 7028 7101 74 TGA 3 L tRNAAsp D 7102 7186 85 GTC 13 H COX II Cox2 7187 7876 690 ATG T-- 229 0 H tRNALys K 7877 7953 77 TTT 1 H ATP8 atp8 7954 8111 158 ATG TAA 51 -10 H ATP6 Atp6 8112 8794 683 ATG TAA 227 -1 H COXIII Cox3 8795 9579 785 ATG TAA 260 -1 H

52 tRNAGly G 9580 9651 72 TCC 0 H ND3 nd3 9652 10000 349 ATG T-- 116 0 H

tRNAArg R 10001 10,070 70 TCG 0 H ND4L nd4L 10071 10,360 290 ATG TAA 95 -7 H

ND4 nd4 10361 11,741 1381 ATG T-- 460 0 H tRNAHis H 11,742 11,810 69 GTG 0 H tRNASer S 11,811 11879 69 GCT 2 H tRNALeu L 11,880 11,955 76 TAG 3 H ND5 nd5 11,956 13775 1820 ATG TAA 605 -4 H

ND6 nd6 13776 14297 522 TTA TAA 173 -2 L

tRNAGlu E 14298 14370 73 TTC 4 L Cyt b Cytb 14371 15511 1141 ATG T-- 380 0 H tRNAThr T 15512 15582 71 TGT 27 H tRNAPro P 15583 15652 TGG 0 L

D-loopCR CR 15653 16591 938 -

a T--and TA- incomplete stop codons. b The numbers in the intergentic nucleotide column correspond on the nucleotides splitting adjacent genes, negative numbers designate overlapping nucleotides. c H and L symbolize the heavy and light strand respectively.

53 Fig. 9: Graphical chart of complete mitochondrial genome of Schizothorax esocinus.

Genes encoded by the heavy strand are exposed outside the circle and genes encoded by the light strand are exposed inside the circle. All protein-coding genes are encoded on the H strand except ND6, which is encoded on the L-strand. The two ribosomal RNA genes are encoded on the H-strand. ND1-6, NADH dehydrogenase subunits 1-6; COXI-III, cytochrome c oxidase sub-unit I-III; ATP6 and, ATPase subunit 6 and 8; Cyt b.

Table. 5: Characteristics of the mitochondrial genome of S. Plagiostomus

Position Codon Anti- Intergentic Stran Locus Abbreviation From To Size (bp) Start Stopa Amino acid codon nucleotideb dc tRNAPhe F 1 69 69 GAA 0 H 12SrRNA 12S 70 1026 957 0 H tRNAVal V 1027 1098 72 TAC 0 H 16SRrna 16S 1099 2775 1677 0 H tRNALeu L 2776 2852 77 TAA 0 H ND1 nd1 2853 3831 979 ATG TAA 326 4 H tRNAIle I 3832 3901 70 GAT -2 H tRNAGln Q 3902 3974 73 TTG -2 L tRNAMet M 3975 4043 69 CAT 0 H ND2 nd2 4044 5088 1044 ATG TAG 347 -2 H tRNATrp W 5089 5161 73 TCA 2 H tRNAAla A 5162 5232 71 TGC 2 L tRNAAsn N 5233 5305 73 GTT 0 L

OL OL 5306 5313 08 0 - tRNACys C 5314 5379 66 GCA -1 L tRNATyr Y 5380 5451 72 GTA 1 L COX I Cox1 5452 7002 1551 GTG TAA 516 0 H tRNASer S 7003 7077 74 TGA 3 L tRNAAsp D 7078 7162 85 GTC 13 H COX II Cox2 7163 7853 690 ATG T-- 229 0 H tRNALys K 7854 7930 77 TTT 1 H ATP8 atp8 7931 8088 158 ATG TAA 52 -10 H ATP6 Atp6 8089 8771 683 ATG TAA 227 -1 H COXIII Cox3 8772 9556 785 ATG TAA 261 -1 H

55 tRNAGly G 9557 9628 72 TCC 0 H ND3 nd3 9629 9977 349 ATG TAG 116 -2 H tRNAArg R 9978 10,047 70 TCG 0 H ND4L nd4L 10,048 10,337 290 ATG TAA 95 -7 H

ND4 nd4 10,338 11,718 1381 ATG T-- 460 0 H

His tRNA H 11,719 11,787 69 GTG 0 H tRNASer S 11,788 11,856 69 GCT 2 H tRNALeu L 11,857 11,932 76 TAG 3 H ND5 nd5 11,933 13,752 1820 ATG TAA 605 -4 H

ND6 nd6 13,753 14,274 522 ATG TAA 173 -2 L tRNAGlu E 14,275 14,347 73 TTC 4 L

Cyt b Cytb 14,348 15,488 1141 ATG T-- 380 0 H

Thr tRNA T 15,489 15,559 71 TGT 27 H tRNAPro P 15,560 15,629 TGG 0 L D-loop CR 15,630 16,564 935 0 -

a T--and TA- denote incomplete stop codons. b The numbers in the intergentic nucleotide column correspond on the nucleotides splitting adjacent genes, negative numbers designate overlapping nucleotides. c H and L symbolize the heavy and light strand respectively.

56 Fig. 10: Graphical chart of complete mitochondrial genome of Schizothorax plagiostomus.

Genes encoded by the heavy strand are exposed outside the circle and genes encoded by the light strand are exposed inside the circle. All protein-coding genes are encoded on the H strand except for ND6, which is encoded on the L-strand. The two ribosomal RNA genes are encoded on the H-strand. ND1-6, NADH dehydrogenase subunits 1-6; COXI-III, cytochrome c oxidase sub-unit I-III; ATP6 and, ATPase subunit 6 and 8; Cyt b.

Table 6. Characteristics of the mitochondrial genome of S. Labiatus

Position Codon Anti- Intergentic Stran Locus Abbreviation From To Size (bp) Start Stopa Amino acid codon nucleotideb dc tRNAPhe F 1 69 69 GAA 0 H 12SrRNA 12S 70 1026 957 0 H tRNAVal V 1027 1098 72 TAC 0 H 16SRrna 16S 1099 2775 1677 0 H tRNALeu(UUR) L 2776 2852 77 TAA 0 H ND1 nd1 2853 3831 979 ATG TAA 326 4 H tRNAIle I 3832 3901 70 GAT -2 H tRNAGln Q 3902 3974 73 TTG -2 L tRNAMet M 3975 4043 69 CAT 0 H ND2 nd2 4044 5088 1044 ATG TA- 347 -2 H tRNATrp W 5089 5161 73 TCA 2 H tRNAAla A 5162 5231 71 TGC 2 L tRNAAsn N 5232 5304 73 GTT 0 L

OL OL 5305 5339 08 0 - tRNACys C 5340 5405 66 GCA -1 L tRNATyr Y 5406 5477 72 GTA 1 L COX I Cox1 5478 7028 1551 GTG TAA 516 0 H tRNASer S 7029 7102 74 TGA 3 L tRNAAsp D 7103 7187 85 GTC 13 H COX II Cox2 7188 7878 691 ATG T-- 229 0 H tRNALys K 7879 7955 77 TTT 1 H ATP8 atp8 7956 8113 158 ATG TAG 52 -10 H ATP6 Atp6 8114 8796 683 ATG TAA 227 -1 H COXIII Cox3 8797 9581 785 ATG TA- 261 -1 H

58 tRNAGly G 9582 9653 72 TCC 0 H ND3 nd3 9654 10002 349 ATG TA- 116 -2 H tRNAArg R 10003 10072 70 TCG 0 H ND4L nd4L 10073 10,362 290 ATG TAA 95 -7 H

ND4 nd4 10,363 11,743 1381 ATG T-- 460 0 H

His tRNA H 11,744 11,812 69 GTG 0 H tRNASer(AGY) S 11,813 11,881 69 GCT 2 H tRNALeu(CUN) L 11,882 11,957 76 TAG 3 H ND5 nd5 11,958 13,777 1820 ATG TAA 605 -4 H

ND6 nd6 13,778 14,299 522 ATG TAA 173 -2 L tRNAGlu E 14,300 14,372 73 TTC 4 L

Cyt b Cytb 14,373 15,513 1141 ATG T-- 380 0 H

Thr tRNA T 15,514 15,584 71 TGT 27 H tRNAPro P 15,585 15,654 70 TGG 0 L D-loop CR 15,655 16,590 936 0 -

59 Fig. 11: Graphical chart of complete mitochondrial genome of Schizothorax labiatus.

Genes encoded by the heavy strand are exposed outside the circle and genes encoded by the light strand are exposed inside the circle. All protein-coding genes are encoded on the H strand except for ND6, which is encoded on the L-strand. The two ribosomal RNA genes are encoded on the H-strand. ND1-6, NADH dehydrogenase subunits 1-6; COXI-III, cytochrome c oxidase sub-unit I-III; ATP6 and, ATPase subunit 6 and 8; Cyt

60 4.6 Base composition in Schizothoracine fishes

4.6.1 Base composition in Schizothorax esocinus

Our study shows that, complete mitochondrial genome of S. esocinus is 16,591 bp and overall base composition are A=31.41%; G= 18.03 %; T=26.19 %; C=24.39%. The highest A+T 57.54% contents were recorded compared to G + C contents 42.42%. The overall base composition in protein coding genes are A=28.99%; G= 16.3 %; T=26.14 %; C=28.58% and A+T contents are 55.13%, whereas base composition in control region are A=32.09%; G= 14.01 %; T=33.04 %; C=19.06%. The observed average base composition in tRNAs gene are A=30.28%; G= 20.17 %; T=25.26 %; C=26.29% and 55.34% A+T content. The observed average base compositions in rRNA genes are A=33.45%; G= 21.55%; T=19.95 %; C=25.01% and 53.04% A+T contents. In mitochondrial genome of S. esocinus, the highest A+T contents (66.03 %) observed in putative control region, whereas the lowest A+T (43.4%) contents in tRNAMet

61 Table 7: The base composition in different regions of mitochondrial genome of Schizothorax esocinus.

A+T G+C Region Base composition content Content A G T C ND1 24.3 19.6 25.7 30.3 50 49.9 ND2 28.9 16.9 22.3 31.9 51.2 48.8 COXI 26.6 18.3 29.7 25.5 56.3 43.8 COXII 29.9 16.7 27.7 25.8 57.6 42.5 ATP8 34.2 10.8 29.1 25.9 63.3 36.7 ATP6 29.9 14.2 28.7 27.2 58.6 41.4 COXIII 28 16.7 26.9 28.4 54.9 45.1 ND3 28.9 14 27.8 29.2 56.7 43.2 ND4 28.6 16.7 25.6 29.2 54.2 45.9 ND4L 24.5 16.9 27.9 30.7 52.4 47.6 ND5 29.8 15.8 25.1 29.3 54.9 45.1 ND6 36.6 18.4 14.6 30.5 51.2 48.9 CYTB 26.7 16.9 28.7 27.7 55.4 44.6 tRNAgene tRNAPhe 34.8 23.2 21.7 20.3 56.5 43.5 tRNAVal 29.2 23.6 19.4 27.8 48.6 51.4 tRNALeu 24.7 26 26 23.4 50.7 49.4 tRNAIIe 27.1 24.3 24.3 24.3 51.4 48.6 tRNAGln 31.5 17.8 27.4 23.3 54.8 41.1 tRNAMet 24.6 23.2 18.8 33.3 43.4 56.5 tRNATrp 37 19.2 26 17.8 63 37 tRNAAla 33.8 15.5 29.6 21.1 63.4 36.6 tRNAAsn 31.5 19.2 20.5 28.8 52 48 tRNACys 21.2 24.2 27.3 27.3 48.5 51.5 tRNAtyr 23.6 22.2 20.8 33.3 44.4 55.5

62 tRNASer 28.4 18.9 24.3 28.4 52.7 47.3 tRNAAsp 36.5 17.6 27.1 18.8 63.3 36.4 tRNALys 32.5 20.8 27.3 19.5 59.8 40.3 tRNAGly 36.1 15.3 27.8 20.8 63.9 36.1 tRNAArg 27.1 21.4 25.7 25.7 52.8 47.1 tRNAHis 33.3 18.8 30.4 17.4 63.7 36.2 TRNASer(UCN) 28.4 18.9 24.3 28.4 52.7 47.3 TRNALeu(CUN) 31.5 21.9 26 20.5 57.5 42.4 tRNAGlu 34.2 13.7 28.8 23.3 63 37 tRNAThr 25.4 22.5 26.8 25.4 52.2 47.9 tRNAPro 33.8 15.5 25.4 25.4 59.2 40.9 rRNA gene 16S rRNA 36.3 20.5 19.6 23.7 55.9 44.2 12S rRNA 30.6 22.6 20.3 26.5 50.9 49.1 Control region 32.9 14.1 33.4 19.6 66.3 33.7 Overall of 28.99 16.3 26.14 28.58 55.13 44.88 protein-coding genes Overall of tRNA 30.28 20.17 25.26 24.29 55.34 44.45 genes Overall of rRNA 33.45 21.55 19.95 25.1 53.4 46.65 genes Overall of the 31.41 18.03 26.19 24.39 57.54 42.42 genome

63 4.6.2 Base composition in Schizothorax plagiostomus

The present study shows that, the complete mitochondrial genome of S. plagiostomus are 16,564 bp, while overall base composition are A=31.64%; G= 17.99 %; T=26.22 %; C=24.19%. The highest A+T (57.54%) contents were recorded compared to G+C (42.42%) contents. The overall base composition in protein coding genes are A=28.95%; G= 16.32 %; T=26.11 %; C=28.59% and (55.13%) A+T contents. In protein coding genes, the highest A+T (63.3%) contents were recorded in ATP6 gene, while lowest A+T (50.01%) contents were recorded in ND1 gene. The base composition in control region are A=33.02%; G= 13.09 %; T=33.06 %; C=19.04%. While the average base composition in tRNAs gene are A=30.95%; G= 20.18 %; T=25.02 %; C=23.66% and 55.13% A+T content. The observed average base compositions in rRNA genes are A=33.45%; G= 21.55%; T=19.95 %; C=25.01% and 53.04% A+T contents. In mitochondrial genome of S. plagiostomus, the highest A+T (66.03%) contents were observed in putative control region, whereas the lowest A+T (43.4%) contents in tRNAMet .

64 Table 8: The base composition in different regions of mitochondrial genome of Schizothorax plagiostomus.

A+T G+C Region Base composition content content A G T C ND1 24.3 19.6 25.8 30.2 50.2 49.8 ND2 28.6 17.1 22.2 32 50.8 49.2 COXI 26.4 18.4 29.7 25.5 56.1 43.9 COXII 30 16.8 27.5 25.7 57.5 42.5 ATP8 34.2 10.8 29.1 25.9 63.3 36.7 ATP6 29.7 14.3 28.8 27.1 58.5 41.5 COXIII 27.9 16.8 26.8 28.5 54.7 45.3 ND3 28.9 14 27.8 29.2 56.7 43.3 ND4 28.6 16.7 25.6 29.1 54.2 45.8 ND4L 24.5 16.9 27.6 31 52.1 47.9 ND5 29.8 15.7 25.2 29.3 55 45 ND6 37 18 14.6 30.5 51.6 48.4 CYTB 26.5 17.1 28.7 27.7 55.2 44.8 tRNAgene tRNAPhe 34.8 23.2 21.7 20.3 56.5 43.5 tRNAVal 29.2 23.6 19.4 27.8 48.6 51.4 tRNALeu(UUR) 35.5 21.1 23.7 19.7 59.2 40.8 tRNAIIe 27.1 24.3 24.3 24.3 51.4 48.6 tRNAGln 31.5 17.8 27.4 23.3 58.9 41.1 tRNAMet 24.6 23.2 18.8 33.3 43.4 56.5 tRNATrp 37 19.2 26 17.8 63 37 tRNAAla 32.4 16.9 31 19.7 63.4 36.6 tRNAAsn 31.5 19.2 20.5 28.8 52 48 tRNACys 19.7 25.8 27.3 27.3 47 53.0 tRNAtyr 23.6 22.2 20.8 33.3 44.4 55.5

65 tRNASer(AGN) 29 23.2 21.7 26.1 50.7 49.3 tRNAAsp 31.8 17.6 29.4 21.2 61.2 38.8 tRNALys 32.5 20.8 26 20.8 58.5 41.5 tRNAGly 36.1 15.3 27.8 20.8 63.9 36.1 tRNAArg 27.1 21.4 25.7 25.7 52.8 47.1 tRNAHis 33.3 18.8 30.4 17.4 63.7 36.2 TRNASer(UCN) 33.3 18.8 30.4 17.4 63.7 36.2 TRNALeu(CUN) 35.5 21.1 23.7 19.7 59.2 40.8 tRNAGlu 34.2 13.7 27.4 24.7 61.6 38.4 tRNAThr 25.4 22.5 26.8 25.4 52.2 47.9 tRNAPro 35.7 14.3 24.3 25.7 60 40 rRNA gene 16S rRNA 36.3 20.5 19.6 23.7 55.9 44.2 12S rRNA 30.6 22.6 20.3 26.5 50.9 49.1 Control region 33.2 13.9 33.6 19.4 66.3 33.7 Overall of 55.13 44.88 protein-coding genes 28.95 16.32 26.11 28.59 Overall of tRNA 55.34 44.45 genes 30.95 20.18 25.2 23.66 Overall of rRNA 53.4 46.65 genes 33.45 21.55 19.95 25.1 Overall of the 57.54 42.42 genome 31.64 17.99 26.22 24.19

66 4.6.3 Base composition in Schizothorax labiatus

The complete mitochondrial genome of S. labiatus are 16,590 bp, while overall base composition are A=30.09%; G= 16.76%; T=28.00 %; C=25.18%. The highest A+T (58.04%) contents were recorded compared to G+C 41.94% contents. The average base composition in protein coding genes are A=29.02%; G= 16.30%; T=26.14%; C=28.5% and A+T contents is 55.13%. In protein coding genes, the highest A+T (63.3%) contents were recorded in ATP6 gene, while lowest A+T (50.01%) contents were recorded in ND1 gene. The base composition in control region was (A=33.03%; G= 13.08%; T=33.02%; C=19.07%). The average base composition in tRNAs gene are A=30.28%; G= 20.17%; T=25.26%; C=24.29% and A+T content is 55.34%. The observed average base compositions in rRNA genes were A=33.45%; G= 21.05%; T=19.95%; C=25.01% and 53.04% A+T contents. In mitochondrial genome of S. labiatus, the highest A+T contents were observed in putative control region (66.05%), whereas the lowest A+T (43.4%) contents in tRNAMet .

67 Table 9: The base composition in different regions of mitochondrial genome of Schizothorax labiatus.

A+T G+C content Region Base composition content A G T C ND1 24.4 19.5 25.7 30.3 50.1 49.9 ND2 29.0 16.9 22.3 31.8 51.3 48.7 COXI 26.6 18.2 29.7 25.5 56.3 43.7 COXII 30.1 16.8 27.7 25.8 57.8 42.6 ATP8 34.2 10.8 29.1 25.9 63.3 36.7 ATP6 29.9 14.3 28.7 27.2 58.6 41.5 COXIII 28 16.7 26.8 28.5 54.8 45.2 ND3 28.9 14 27.8 29.1 56.7 43.2 ND4 28.7 16.6 25.6 29.2 54.3 45.8 ND4L 24.5 16.9 27.9 30.7 52.4 47.6 ND5 29.7 15.8 25.2 29.3 54.9 45.1 ND6 36.8 18.2 14.6 30.5 51.2 48.9 CYTB 26.5 17.2 28.7 27.7 55.2 44.9 tRNAgene tRNAPhe 34.8 23.2 21.7 20.3 56.5 43.5 tRNAVal 29.2 23.6 19.4 27.8 48.6 51.4 tRNALeu 24.7 26 26 23.4 50.7 49.4 tRNAIIe 27.1 24.3 24.3 24.3 51.4 48.6 tRNAGln 31.5 17.8 27.4 23.3 54.8 41.1 tRNAMet 24.6 23.2 18.8 33.3 43.4 56.5 tRNATrp 37 19.2 26 17.8 63 37 tRNAAla 33.8 15.5 29.6 21.1 63.4 36.6 tRNAAsn 31.5 19.2 20.5 28.8 52 48 tRNACys 21.2 24.2 27.3 27.3 48.5 51.5 tRNAtyr 23.6 22.2 20.8 33.3 44.4 55.5

68 tRNASer 28.4 18.9 24.3 28.4 52.7 47.3 tRNAAsp 36.5 17.6 27.1 18.8 63.3 36.4 tRNALys 32.5 20.8 27.3 19.5 59.8 40.3 tRNAGly 36.1 15.3 27.8 20.8 63.9 36.1 tRNAArg 27.1 21.4 25.7 25.7 52.8 47.1 tRNAHis 33.3 18.8 30.4 17.4 63.7 36.2 TRNASer(UCN) 28.4 18.9 24.3 28.4 52.7 47.3 TRNALeu(CUN) 31.5 21.9 26 20.5 57.5 42.4 tRNAGlu 34.2 13.7 28.8 23.3 63 37 tRNAThr 25.4 22.5 26.8 25.4 52.2 47.9 tRNAPro 33.8 15.5 25.4 25.4 59.2 40.9 rRNA gene 16S rRNA 36.3 20.4 19.6 23.7 55.9 44.1 12S rRNA 30.6 22.6 20.3 26.5 50.9 49.1 Control region 33.3 13.8 33.2 19.7 66.5 33.5 Overall of 29.02 16.30 26.14 28.58 55.15 44.91 protein-coding genes Overall of tRNA 30.28 20.17 25.26 24.29 55.34 44.45 genes Overall of 33.45 21.05 19.95 25.1 53.4 46.65 rRNA genes Overall of the 30.09 16.76 28.00 25.18 58.04 41.94 genome

69 4.7 Frequency of amino acid in protein coding gene

4.7.1 Frequency of amino acid in protein coding gene of S. esocinus

Our findings revealed that the most abundant amino acid residue was Leucine, abundantly present in 10 proteins coding genes and less abundantly reported in remaining genes ND1, ATP8 and ND6. After Leucine, the second most abundant amino acid was Isoleucine. While tryptophan was least abundant amino acid present in protein coding genes of S. esocinus. As leucine was non-polar and hydrophobic amino acid which were frequently reported in both alpha and beta sheet of protein structure, play vital role in protein stability.

70 Table 10: Frequency of amino acid in protein coding gene in Schizothorax esocinus are given in percent.

ND1 ND2 COXI COXII ATP8 ATP6 COXIII ND3 ND4L ND4 ND5 ND6 CYTB Ala 5.16 12.13 8.98 7.14 4.17 9.01 0.78 7.21 13.68 8.09 8.71 6.45 8.42 Cys 3.23 0.30 0.20 1.34 0.00 0.00 1.57 0.90 2.11 1.12 0.84 3.23 0.82 Asp 1.94 1.18 2.79 5.36 2.08 0.45 0.39 3.60 1.05 0.67 2.18 3.23 2.99 Glu 0.32 1.48 2.20 6.70 6.25 2.25 0.00 5.41 3.16 2.47 2.01 2.58 1.90 Phe 2.26 2.96 7.98 4.02 6.25 5.41 2.75 8.11 8.42 3.82 6.53 2.58 8.15 Gly 7.10 5.33 9.18 4.02 2.08 4.50 2.35 6.31 6.32 6.29 5.36 6.45 6.79 His 4.52 2.07 3.99 4.02 4.17 1.35 4.31 0.90 4.21 2.70 2.18 6.45 3.26 Ile 7.42 10.36 10.38 10.27 12.50 13.51 6.67 11.71 6.32 12.13 11.73 6.45 9.51 Lys 3.23 2.66 1.60 1.79 6.25 0.45 1.57 0.90 0.00 2.02 3.69 8.39 2.45 Leu 7.42 19.23 12.77 12.50 10.42 20.72 12.55 23.42 23.16 19.55 15.58 1.94 16.85 Met 1.29 1.18 2.00 1.79 2.08 1.35 2.35 0.90 2.11 2.92 2.51 0.65 2.17 Asn 5.81 2.37 2.99 3.13 4.17 4.50 7.45 2.70 2.11 2.47 5.19 9.03 4.62 Pro 13.87 5.92 5.59 6.70 14.58 7.66 11.37 7.21 2.11 6.07 4.69 9.68 5.71 Gln 0.65 4.14 1.60 3.57 2.08 3.60 0.78 2.70 2.11 3.15 3.35 4.52 1.63 Arg 10.65 1.48 1.60 2.68 0.00 2.70 13.33 1.80 3.16 2.47 1.84 7.74 2.17 Ser 5.16 6.80 6.39 6.70 8.33 4.05 11.37 4.50 9.47 7.19 6.37 8.39 5.71 Thr 10.00 13.91 7.19 4.91 10.42 8.56 10.59 7.21 8.42 8.99 10.05 7.74 6.25 Val 5.48 3.85 8.38 9.38 4.17 7.66 2.35 2.70 2.11 3.82 4.69 0.65 6.79 Trp 1.29 0.30 0.40 0.00 0.00 0.00 1.18 0.00 0.00 1.12 0.67 0.00 0.00 Tyr 3.23 2.37 3.79 4.02 0.00 2.25 6.27 1.80 0.00 2.92 1.84 3.87 3.80 Total 310.00 338.00 501.00 224.00 48.00 222.00 255.00 111.00 95.00 445.00 597.00 155.00 368.00

Trp, 4.96Tyr, ,0.38% 36.16, 2.78% Ala Val, 62.03, 5% Ala, 99.93, 7.70% Cys Cys, 15.66, 1.21% Asp, 27.91, 2.15% Asp Thr, 114.24, 8.80% Glu, 36.73, 2.83% Glu Phe Phe, 69.24, 5.33% Gly His Ser, 90.43, 6.96% Ile Gly, 72.08, 5.55% Lys Leu MetArg, 50.14, 3.86% His, 44.13, 3.40% Asn ProGln, 33.88, 2.61% Gln Arg Ile, 128.96, 9.93% Ser Pro, 101.16, 7.79% Thr Val Asn, 56.54, 4.35% Lys, 35, 2.70% Trp Met, 23.3, 1.79% Tyr Leu, 196.11, 15.10%

Fig. 12: Percentile of amino acid in mitochondrial genome Schizothorax esocinus.

Map showing number and percent of amino acid in complete mitochondrial genome of Schizothorax esocinus.

72 4.7.2 Frequency of amino acid in protein coding gene of S. plagiostomus

The present study shows that the most abundant amino acid residue was Leucine, abundantly present in 10 proteins coding genes and less abundantly reported in remaining genes ND1, ATP8 and ND6. After Leucine, the second most abundant amino acid was Isoleucine. Whereas, tryptophan was least abundant amino acid present in protein coding genes of S. plagiostomus. As leucine was non-polar and hydrophobic amino acid which were frequently reported in both alpha and beta sheet of protein structure, play vital role in protein stability.

73 Table 11: Frequency of amino acid in protein coding gene in schizothorax plagiostomus are given in percent.

ND1 ND2 COXI COXII ATP8 ATP6 COXIII ND3 ND4L ND4 ND5 ND6 CYTB Ala 4.84 12.17 8.98 7.14 4.17 9.01 8.84 7.21 13.68 8.09 8.71 6.45 8.42 Cys 3.23 0.30 0.20 1.34 0.00 0.00 0.80 0.90 2.11 1.12 0.84 3.23 0.82 Asp 1.94 1.19 2.79 5.36 2.08 0.45 2.01 3.60 1.05 0.67 2.18 1.94 2.99 Glu 0.32 1.48 2.20 6.70 6.25 2.25 4.02 5.41 3.16 2.47 2.01 2.58 1.90 Phe 2.26 2.97 7.98 4.02 6.25 5.41 9.24 8.11 8.42 3.82 6.53 2.58 8.15 Gly 7.10 5.34 9.18 4.02 2.08 4.50 8.43 6.31 6.32 6.29 5.36 5.81 6.79 His 4.19 2.08 4.19 4.46 4.17 1.35 6.43 0.90 4.21 2.70 2.18 6.45 3.26 Ile 7.10 10.39 10.38 10.71 12.50 13.06 9.64 11.71 6.32 12.13 11.56 5.81 9.24 Lys 3.23 2.67 1.60 1.79 6.25 0.45 0.80 0.90 0.00 2.02 3.69 8.39 2.45 Leu 7.42 19.29 12.77 12.50 10.42 20.72 12.45 23.42 23.16 19.55 15.75 1.94 16.85 Met 1.29 1.19 2.00 1.79 2.08 1.80 0.40 0.90 2.11 2.92 2.51 1.29 2.17 Asn 5.81 2.37 2.79 3.13 4.17 4.50 0.40 2.70 2.11 2.47 5.19 10.32 4.62 Pro 13.87 5.93 5.59 6.25 14.58 7.66 5.22 7.21 2.11 6.07 4.69 9.68 5.71 Gln 0.65 4.15 1.40 3.57 2.08 3.60 3.61 2.70 2.11 3.15 3.35 4.52 1.63 Arg 10.65 1.19 1.60 2.68 0.00 2.70 2.01 1.80 3.16 2.47 1.68 8.39 2.17 Ser 5.16 6.82 6.39 6.70 8.33 4.05 5.62 4.50 9.47 7.19 6.37 8.39 5.71 Thr 10.32 13.95 7.19 4.46 10.42 8.56 9.24 7.21 8.42 8.99 10.05 7.74 6.25 Val 5.81 3.86 8.38 9.38 4.17 7.66 6.02 2.70 2.11 3.82 4.86 0.65 7.07 Trp 1.29 0.30 0.40 0.00 0.00 0.00 0.00 0.00 0.00 1.12 0.67 0.00 0.00 Tyr 3.55 2.37 3.99 4.02 0.00 2.25 4.82 1.80 0.00 2.92 1.84 3.87 3.80 Total 310.00 337.00 501.00 224.00 48.00 249.00 255.00 111.00 95.00 445.00 597.00 155.00 368.00

74 Trp, 4.96Tyr,, 0.38%36.16, 2.78% Ala, 99.93, 7.70% Ala Val, 62.03, 5% Cys, 15.66, 1.21% Cys Asp, 27.91, 2.15% Asp Thr, 114.24, 8.80% Glu, 36.73, 2.83% Glu Phe Phe, 69.24, 5.33% Gly His Ser, 90.43, 6.96% Ile Gly, 72.08, 5.55% Lys LeuArg, 50.14, 3.86% His, 44.13, 3.40% Met Asn Gln, 33.88, 2.61% Pro Gln Ile, 128.96, 9.93% Pro, 101.16, 7.79% Arg Ser Thr Asn, 56.54, 4.35% Lys, 35, 2.70% Val Met, 23.3, 1.79% Leu, 196.11, 15.10%

Fig. 13: Percentile of amino acid in mitochondrial genome Schizothorax plagiostomus.

Map showing number and percent of amino acid in complete mitochondrial genome Schizothorax plagiostomus.

75 4.7.3 Frequency of amino acid in protein coding gene of S. labiatus

The most abundant amino acid residue was Leucine, which was abundantly present in all proteins coding genes except ND6. Alanine and threonine were second most abundant amino acid in protein coding genes of S. labiatus. While Cysteine was least abundant amino acid present in protein coding genes of S. labiatus.

76 Table 12: Frequency of amino acid in protein coding gene in Schizothorax labiatus.

ND1 ND2 COXI COXII ATP8 ATP6 COXIII ND3 ND4L ND4 ND5 ND6 CYTB Ala 10.46 11.49 8.72 6.96 3.85 8.81 8.43 6.9 13.54 7.83 8.58 6.62 8.16 Cys 0 0.29 0.19 0.87 0 0 0.77 0.86 2.08 1.09 0.83 3.31 0.79 Asp 1.23 1.15 2.71 5.22 1.92 0.44 1.92 3.45 1.04 0.65 2.15 2.65 2.89 Glu 3.38 1.44 2.13 6.52 5.77 2.2 3.83 5.17 3.13 2.39 1.98 2.65 1.84 Phe 5.23 2.87 7.75 3.91 5.77 5.29 8.81 7.76 8.33 3.7 6.44 2.65 7.89 Gly 5.54 5.46 8.91 3.91 1.92 4.41 8.05 6.03 6.25 6.09 5.28 6.62 6.58 His 1.54 1.72 3.68 4.35 3.85 1.32 6.13 0.86 4.17 2.61 2.15 7.28 3.16 Ile 7.08 6.9 7.56 7.39 11.54 10.13 6.13 8.62 2.08 8.26 8.42 1.99 7.89 Lys 2.15 2.59 1.55 1.74 5.77 0.44 0.77 0.86 0 1.96 3.63 8.61 2.37 Leu 18.77 19.25 12.6 12.17 9.62 20.26 11.88 22.41 22.92 18.91 15.51 1.99 16.05 Met 3.08 4.31 4.46 5.22 1.92 4.41 3.45 3.45 6.25 6.3 5.45 5.3 3.16 Asn 3.69 2.3 2.91 2.61 3.85 4.41 0.38 2.59 2.08 2.39 5.12 9.93 4.47 Pro 7.38 5.46 5.43 6.09 13.46 7.49 4.98 6.9 2.08 5.87 4.62 9.27 5.53 Gln 2.15 4.02 1.55 3.04 1.92 3.52 3.45 2.59 2.08 3.04 3.3 4.64 1.58 Arg 2.46 1.15 1.55 3.04 0 2.64 1.92 1.72 3.13 2.39 1.65 3.97 2.11 Ser 6.77 6.61 6.2 6.96 7.69 3.96 5.36 4.31 9.38 6.96 6.27 9.27 5.53 Thr 5.85 13.79 6.98 4.78 9.62 8.37 8.81 6.9 8.33 8.7 9.9 7.95 6.05 Val 7.08 3.74 8.14 9.13 3.85 7.49 5.75 2.59 2.08 3.7 4.79 0.66 6.84 Trp 2.46 3.16 3.29 2.17 7.69 2.2 4.6 4.31 1.04 4.35 2.15 1.32 3.42 Tyr 3.69 2.3 3.68 3.91 0 2.2 4.6 1.72 0 2.83 1.82 3.31 3.68 Total 325 348 516 230 52 227 261 116 96 460 606 151 380

77 Trp, 42.16, 3%Tyr, 33.74, 3% Ala, 110.35, 8% Ala Val, 65.84, 5% Cys, 11.08, 1% Cys Asp, 27.42, 2% Asp Glu, 42.43, 3% Thr, 106.03, 8% Glu Phe Phe, 76.4, 6% Gly

His Ser, 85.27, 7% Ile Gly, 75.05, 6% Lys Arg, 27.73, 2% Leu His, 42.82, 3% Gln, 36.88, 3% Met Asn Ile, 93.99, 7% Pro Pro, 84.56, 7% Gln Lys, 32.44, 2% Arg Asn, 46.73, 4% Ser Met, 56.76, 4% Leu, 202.34, 16%

Figure 15: Percentile of amino acid in mitochondrial genome of Schizothorax. labiatus.

In mitochondrial genome of protein coding genes Try, Val, Thr, Ser, Gln, Lys, His, Phe,Glu, Asp, Cys, Ala amino acids were almost same, while Try, Met, Arg, Ile showed major deviation in Schizothoracine fishes. Total frequency of these amino acid residues were same in S. esocinus and S. plagiostomus and show greater deviation with S. labiatus.

78 250

200

150

100

0 Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln Arg Ser Thr Val Trp Tyr

S. esocins S. plagiostomus S. labiatus

Fig. 16: Comparative study of amino acid in protein coding gene of Schizothoracines.

4.8 Codon usage in protein coding genes of schizothoracine

All protein coding genes in schizothoracine have open reading frames commonly present in other fishes and vertebrates. For protein coding amino acid with fourfold degenerate third codon positions, codons ending in A and C were always the most regular in schizothoracine fishes, followed by codon ending with T. G was the least common third position nucleotide in all types of amino acids. This pattern of codon usage was similar across almost all vertebrate groups. The mitochondrial genome of Schizothoracine has a strong bias against the usage of “G” at the third codon position. There were 22 tRNAs in complete mitochondrial genome of schizothoracine and there was only one specific tRNA species for greatest amino acids. But some exemptions were observed in case of serine and leucine, which have two tRNAs and helping six

79 possible codons for each amino acid in Schizothoracinae fishes. Therefore, the probable codons for any amino acid, only one (sometimes two) will be completely corresponding to the existing tRNA anticodon, and translation of the others comprise nonspecific (wobble) base pairing. For individual amino acid, only codons ending in A or C will accurately matched by a complementary tRNA anticodon. The corresponding nucleotide is A for fourfold codons and twofold purine codons, and C for twofold pyrimidine codons except methionine, AUG, which assists as a start codon.

4.8.1 Codon usage in protein coding genes of S. esocinus

In the proteins encoded by the mitochondrial genome of S. esocinus, Threonine codon usage was observed for the amino acid Threonine, while minimum codon usage was observed for the amino acid Cysteine.

80 Table 13: Amino acid, codon number, frequency and codon usage in protein coding gene of S. esocinus.

Amino acid Symbol Number Codon Frequency Codon usage (%)

Phe F 70 UUU 0.82 40.93

F 101 UUC 1.18 59.06

Leu L 84 UUA 1.16 58.33

L 60 UUG 0.83 41.66

Leu L 59 CUU 0.81 20.2

L 73 CUC 1 25

L 104 CUA 1.43 35.61

L 56 CUG 0.77 19.17

Ile I 92 AUU 1.16 58.22

I 66 AUC 0.84 41.77

Met M 66 AUA 1.16 45.83

M 48 AUG 0.84 54.16

Val V 18 GUU 0.67 16.82

V 25 GUC 0.93 23.36

V 30 GUA 1.12 28.03

V 34 GUG 1.27 31.77

Ser S 73 UCU 1.25 23.47

S 85 UCC 1.46 27.33

S 77 UCA 1.32 24.75

S 34 UCG 0.58 10.93

Pro P 70 CCU 0.9 22.5

P 106 CCC 1.36 34.08

P 84 CCA 1.08 27

P 51 CCG 0.66 16.39

Thr T 85 ACU 1.03 27.33

T 101 ACC 1.22 30.51

T 104 ACA 1.26 31.41

81 T 41 ACG 0.5 12.38

Ala A 43 GCU 0.81 20.28

A 91 GCC 1.72 42.92

A 59 GCA 1.11 27.83

A 19 GCG 0.36 8.96

Tyr Y 89 UAU 1.09 54.6

Y 74 UAC 0.91 45.39

Stop * 81 UAA 1.64 55.1

* 66 UAG 1.33 44.89

His H 71 CAU 0.9 45.22

H 86 CAC 1.1 54.78

Gln Q 93 CAA 1.24 62

Q 57 CAG 0.76 38

Asn N 90 AAU 0.97 48.38

N 96 AAC 1.03 51.61

Lys K 80 AAA 1.4 70.17

K 34 AAG 0.6 29.82

Asp D 57 GAU 1.11 55.33

D 46 GAC 0.89 44.66

Glu E 62 GAA 1.13 56.36

E 48 GAG 0.87 43.63

Cys C 31 UGU 0.77 38.27

C 50 UGC 1.23 61.72

Trp W 54 UGA 1.14 56.84

W 41 UGG 0.86 43.15

Arg R 26 CGU 0.95 23.63

R 34 CGC 1.24 33.33

R 24 CGA 0.87 23.52

R 26 CGG 0.95 25.49

Ser S 27 AGU 0.46 33.33

S 54 AGC 0.93 66.66

82 Stop * 28 AGA 0.57 54.9

* 23 AGG 0.46 45.09

Gly G 23 GGU 0.65 16.31

G 24 GGC 0.68 17.02

G 46 GGA 1.3 32.62

G 48 GGG 1.36 34.04

83 4.8.2 Codon usage in protein coding genes of S. plagiostomus

In the proteins encoded by the mitochondrial genome of S. plagiostomus, Proline showed maximum codon usage, while minimum codon usage was observed for the amino acid Asparagine.

Table 14: Amino acid, codon number, frequency and codon usage in protein coding gene of S. plagiostomus.

Amino acid Symbol Number Codon Frequency Codon usage (%)

Phe F 51 UUU 1.01 50.49

F 50 UUC 0.99 49.5

Leu L 93 UUA 1.35 72.09

L 36 UUG 0.52 27.9

Leu L 76 CUU 1.1 26.76

L 55 CUC 0.8 19.36

L 81 CUA 1.18 28.52

L 72 CUG 1.05 25.35

Ile I 122 AUU 1.25 63.21

I 73 AUC 0.75 36.78

Met M 61 AUA 1.09 54.46

M 51 AUG 0.91 45.53

Val V 34 GUU 1.08 26.98

V 29 GUC 0.92 23.01

V 38 GUA 1.21 30.15

V 25 GUG 0.79 19.84

Ser S 75 UCU 1.29 31.25

S 67 UCC 1.16 23.84

S 73 UCA 1.26 25.97

S 24 UCG 0.41 8.54

Pro P 137 CCU 1.42 35.49

P 118 CCC 1.22 30.56

84 P 93 CCA 0.96 24.09

P 38 CCG 0.39 9.84

Thr T 102 ACU 1.39 34.69

T 90 ACC 1.22 30.61

T 70 ACA 0.95 23.8

T 32 ACG 0.44 10.88

Ala A 51 GCU 1.2 30

A 56 GCC 1.32 32.94

A 48 GCA 1.13 28.23

A 15 GCG 0.35 8.82

Tyr Y 97 UAU 1.18 59.14

Y 67 UAC 0.82 40.85

Stop * 66 UAA 1.21 59.45

* 45 UAG 0.82 40.55

His H 78 CAU 0.97 63.41

H 82 CAC 1.02 36.58

Gln Q 95 CAA 1.39 69.34

Q 42 CAG 0.61 30.65

Asn N 122 AAU 1.07 53.27

N 107 AAC 0.93 46.72

Lys K 78 AAA 1.38 69.02

K 35 AAG 0.62 30.97

Asp D 41 GAU 1.01 50.61

D 40 GAC 0.99 49.38

Glu E 51 GAA 1.36 68

E 24 GAG 0.64 32

Cys C 33 UGU 0.86 42.85

C 44 UGC 1.14 57.14

Trp W 45 UGA 0.92 57.69

W 53 UGG 1.08 42.3

Arg R 27 CGU 0.68 16.98

85 R 50 CGC 1.26 31.44

R 34 CGA 0.86 21.38

R 48 CGG 1.21 30.18

Ser S 42 AGU 0.72 38.53

S 67 AGC 1.16 61.46

Stop * 46 AGA 0.84 42.59

* 62 AGG 1.13 57.4

Gly G 27 GGU 0.77 19.28

G 44 GGC 1.26 31.42

G 31 GGA 0.89 22.14

G 38 GGG 1.09 27.14

4.8.3 Codon usage in protein coding genes of S. labiatus

In the proteins encoded by the mitochondrial genome of S. labiatus, Asparagine showed maximum codon usage, while minimum codon usage was observed for the amino acid Alanine.

86 Table 15: Amino acid, codon number, frequency and codon usage in protein coding gene of S. labiatus.

Amino acid Symbol Number Codon Frequency Codon usage (%) Phe F 65 UUU 0.88 44.21 F 82 UUC 1.12 55.78 Leu L 93 UUA 1.12 62.83 L 55 UUG 0.66 37.16 Leu L 87 CUU 1.05 24.85 L 81 CUC 0.98 23.14 L 99 CUA 1.19 28.28 L 83 CUG 1 23.71 Ile I 105 AUU 1.1 54.97 I 86 AUC 0.9 45.02 Met M 59 AUA 1.04 51.75 M 55 AUG 0.96 48.24 Val V 20 GUU 0.69 17.24 V 24 GUC 0.83 21.05 V 36 GUA 1.24 31.57 V 36 GUG 1.24 31.57 Ser S 56 UCU 1.12 28.14 S 63 UCC 1.26 31.65 S 56 UCA 1.12 28.14 S 24 UCG 0.48 12.06 Pro P 101 CCU 1.19 29.79 P 91 CCC 1.07 26.84 P 110 CCA 1.3 32.44 P 37 CCG 0.44 10.91 Thr T 93 ACU 1.24 31 T 89 ACC 1.19 29.66 T 81 ACA 1.08 27 T 37 ACG 0.49 12.33 Ala A 39 GCU 0.88 22.03 A 73 GCC 1.65 41.24 A 52 GCA 1.18 29.37

87 A 13 GCG 0.29 7.34 Tyr Y 87 UAU 0.98 49.15 Y 90 UAC 1.02 50.84 Stop * 63 UAA 1.35 51.21 * 60 UAG 1.28 48.78 His H 74 CAU 0.93 46.25 H 86 CAC 1.07 53.75 Gln Q 86 CAA 1.37 68.25 Q 40 CAG 0.63 31.74 Asn N 92 AAU 0.88 44.01 N 117 AAC 1.12 55.98 Lys K 84 AAA 1.39 69.42 K 37 AAG 0.61 30.57 Asp D 42 GAU 0.93 46.66 D 48 GAC 1.07 53.33 Glu E 62 GAA 1.39 69.66 E 27 GAG 0.61 30.33 Cys C 15 UGU 0.5 25 C 45 UGC 1.5 75 Trp W 66 UGA 1.31 65.34 W 35 UGG 0.69 34.65 Arg R 25 CGU 0.78 19.37 R 45 CGC 1.4 34.88 R 34 CGA 1.05 26.35 R 25 CGG 0.78 19.37 Ser S 36 AGU 0.72 35.29 S 66 AGC 1.32 64.7 Stop * 23 AGA 0.49 35.93 * 41 AGG 0.88 64.06 Gly G 19 GGU 0.46 11.44 G 51 GGC 1.23 30.53 G 42 GGA 1.01 25.14 G 54 GGG 1.3 32.33

88 4.9 Transfer RNA Genes

An overall of 22 tRNAs genes were recorded in Schizothoracinae, ranged from 66 bp to 85 bp (fig, 16), these 22 tRNAs were mostly identical with tRNAs encoded by mtDNAs of other fishes and vertebrates. Like other fishes and vertebrates in Schizothoracinae fishes there are two forms of tRNASer (AGN and UCN) among 22tRNAs and was tRNALeu (CUN and UUR). Nine pairs mismatches were pointed out in the secondary structure of 22 tRNAs gene, containing 6 pairs in amino acid acceptor stems, 1 pair in the anticodon loop, 1 pair in D-loop and 1 pair in TΨC stem portion. The mismatch bases were mainly U-U and A-C, in addition, U-C, A-G, C-C and A-A mismatch bases were also observed in tRNAs structure of Schizothoracinae fishes. The most probable reason for this mismatched may be the mitochondrial DNAs is not exposed to recombination process (Lynch, 1997). Like other vertebrates, all 22 tRNAs of Schizothoracine fishes mtDNA can be folded into secondary structure in the form of cloverleaf structure with 7 bp in the aminoacyl stem, 5 bp in the T C and anticodon stems, and 4 bp in the DHU stem. TRNA stem sections contain several noncomplementary and T–G base pairings. Such mutations seem to gather in mitochondrial genes, in portion because mtDNA is not undergoes to the procedure of recombination, which might assist elimination of deleterious mutations (Lynch, 1997b). As in other vertebrates, it seems that CCA nucleotides are provided posttranscriptionally to the 3´ ends to form mature, functional species (Roe et al., 1985). Both ribosomal gene structures might be folded into secondary structures. Potential secondary constructions have free energies of 220.3 kcal/mole for the 12 S subunit and 335.6 kcal/mole for the 16S subunit. Stem areas look to be conserved, however loop areas are somewhat extra mutable comparative to other vertebrate sequences. The functional constraint for precise base pairing appears to oblige the evolution of stems relative to some portions of loops. This arrangement is consistent with phylogenetic studies of a number of vertebrate groups (Sullivan et al., 1995).

89 Like the tRNA genes in the mitochondrial genomes of other vertebrates, the tRNA genes of Schizothoracinae fish mitochondrial genome do not encode the 3' CCA terminus. Consequently, they must be added posttranscriptionally. Various mismatched base pairs are found in the stem sections of the tRNAs encoded by the mtDNAs of Schizothoracinae fishes and other vertebrates. In Schizothoracinae fishes, the longest tRNAs was tRNAAsp (85 bp), while shortest tRNAs were tRNACys (66 bp). In Schizothoracinae fishes all tRNAs were almost complete, but few were incomplete at acceptor stem portion (figure 16). The average base composition in tRNAs gene are A=30.28%; G= 20.17 %; T=25.26 %; C=24.29% and 55.34%. A+T content.

90 Fig. 17: The secondary structure of the 22 tRNA genes encoded by Schizothoracine mtDNA represented in cloverleaf form. Standard base pairings (G-C and A-T) are indicated by colons (.).

Phe Val Leu (UAA)

Ile Gln Met

Ala

Trp Asn

Cys Tyr Ser (UGA

As Lys Gly p

Ser Arg His (UCG )

Leu Gln Thr

92 Pro

4.10 AT skew and GC skews value

Present study indicates that AT skews and GC skews were in equilibrium under normal conditions, but some time AT skews and GC skews in mitochondrial genome deviated from natural equilibrium. Almost all mitochondrial gene in S. esocinus, S. plagiostomus and S. labiatus have positive AT skew and GC skew except in a few tRNAs genes. In the following tables AT skews and GC skews values of all genes are given.

In S. esocinus, AT skew and GC skew were 0.01024 and 0.9952 respectively. All protein coding genes in S. esocinus showed positive AT skew and GC skew values. While, in S. plagiostomus, AT skew and GC skew were 0.01015 and 0.9952 respectively. All protein coding genes in S. plagiostomus showed positive AT skew and GC skew values. In S. labiatus protein coding genes, the highest (63.3%) A+T contents were recorded in ATP6 gene, while lowest (50.01%) A+T contents were recorded in ND1 gene, whereas, in S. labiatus, AT skew and GC skew were 0.1023 and 0.9952 respectively. All 13 protein coding genes in S. labiatus showed positive AT skew and GC skew values.

93 Table 16: Table shows the AT skew and GC skews value of all genes in mitochondrial genome of S. esocinus.

Gene A+T G+C AT Skew GC skew ND1 50 49.9 0.001 1 ND2 51.2 48.8 0.024 0.999 COXI 56.3 43.8 0.1249 0.9943 COXII 57.6 42.5 0.1508 0.9929 ATP8 63.3 36.7 0.266 0.9856 ATP6 58.6 41.4 0.172 0.9917 COXIII 54.9 45.1 0.098 0.9957 ND3 56.7 43.2 0.1351 0.9938 ND4 54.2 45.9 0.0829 0.9964 ND4L 52.4 47.6 0.048 0.998 ND5 54.9 45.1 0.098 0.9957 ND6 51.2 48.9 0.023 0.9991 CYTB 55.4 44.6 0.108 0.9952 PCG avg 55.1 44.9 0.1024 0.9952 TRNAPhe 56.5 43.5 0.13 0.994 TRNAVal 48.6 51.4 -0.028 1.0011 TRNALeu 50.7 49.4 0.013 0.9995 TRNAIIe 51.4 48.6 0.028 0.9988 TRNAGln 54.8 41.1 0.1429 0.9931 TRNAMet 43.4 56.5 -0.1311 1.0047 TRNATrp 63 37 0.26 0.986 TRNAAla 63.4 36.6 0.268 0.9855 TRNAAsn 52 48 0.04 0.9983 TRNACys 48.5 51.5 -0.03 1.0012 TRNAtyr 44.4 55.5 -0.1111 1.004 TRNASer 52.7 47.3 0.054 0.9977 TRNAAsp 63.3 36.4 0.2698 0.9853 TRNALys 59.8 40.3 0.1948 0.9904 TRNAGly 63.9 36.1 0.278 0.9847 TRNAArg 52.8 47.1 0.0571 0.9976 TRNAHis 63.7 36.2 0.2753 0.9849 tRNASer(UCN) 52.7 47.3 0.054 0.9977 tRNALeu(CUN) 57.5 42.4 0.1512 0.9929 TRNAGlu 63 37 0.26 0.986 TRNAThr 52.2 47.9 0.043 0.9982 TRNAPro 59.2 40.9 0.1828 0.9911 TRNAavg 55.3 44.5 0.1092 0.9942 16S Rrna 55.9 44.2 0.1169 0.9947

94 12S Rrna 50.9 49.1 0.018 0.9993 RRNAavg 53.4 46.7 0.0674 0.997

95 Table 17: Table shows the AT skew and GC skews value of all genes in mitochondrial genome of S. plagiostomus.

A+T content G+C content AT skew GC skew ND1 50.1 49.8 0.0030 0.9999 ND2 50.8 49.1 0.0170 0.9993 COXI 56.1 43.9 0.1220 0.9945 COXII 57.5 42.5 0.1500 0.9930 ATP8 63.3 36.7 0.2660 0.9856 ATP6 58.5 41.4 0.1712 0.9918 COXIII 54.7 45.3 0.0940 0.9959 ND3 56.7 43.2 0.1351 0.9938 ND4 54.2 45.8 0.0840 0.9963 ND4L 52.1 47.9 0.0420 0.9982 ND5 55 45 0.1000 0.9956 ND6 51.6 48.5 0.0310 0.9987 CYTB 55.2 44.8 0.1040 0.9954 PCG avg 55.06 44.92 0.1015 0.9952 TRNAPhe 56.5 43.5 0.1300 0.9940 TRNAVal 48.6 51.4 -0.0280 1.0011 tRNALeu(UUR) 59.2 40.8 0.1840 0.9910 TRNAIIe 51.4 48.6 0.0280 0.9988 TRNAGln 58.9 41.1 0.1780 0.9914 TRNAMet 43.4 56.5 -0.1311 1.0047 TRNATrp 63 37 0.2600 0.9860 TRNAAla 63.4 36.6 0.2680 0.9855 TRNAAsn 52 48 0.0400 0.9983 TRNACys 47 53.1 -0.0609 1.0023 TRNAtyr 44.4 55.5 -0.1111 1.0040 tRNASer(AGN) 50.7 49.3 0.0140 0.9994 TRNAAsp 61.2 38.8 0.2240 0.9885

96 TRNALys 58.5 41.6 0.1688 0.9919 TRNAGly 63.9 36.1 0.2780 0.9847 TRNAArg 52.8 47.1 0.0571 0.9976 TRNAHis 63.7 36.2 0.2753 0.9849 TRNASer(UCN) 63.7 36.2 0.2753 0.9849 TRNALeu(CUN) 59.2 40.8 0.1840 0.9910 TRNAGlu 61.6 38.4 0.2320 0.9880 TRNAThr 52.2 47.9 0.0430 0.9982 TRNAPro 60 40 0.2000 0.9900 TRNAavg 56.15 43.84 0.12 0.99 16S Rrna 55.9 44.2 0.1169 0.9947 12S Rrna 50.9 49.1 0.0180 0.9993 RRNAavg 53.4 46.65 0.0674 0.9970

97 Table 18: Table shows the AT skew and GC skews value of all genes in mitochondrial genome of S. labiatus.

A+T content G+C content AT skew GC skew ND1 50.1 49.9 0.0020 0.9999 ND2 51.3 48.7 0.0260 0.9989 COXI 56.3 43.7 0.1260 0.9942 COXII 57.8 42.6 0.1514 0.9929 ATP8 63.3 36.7 0.2660 0.9856 ATP6 58.6 41.5 0.1708 0.9918 COXIII 54.8 45.2 0.0960 0.9958 ND3 56.7 43.2 0.1351 0.9938 ND4 54.3 45.8 0.0849 0.9963 ND4L 52.4 47.6 0.0480 0.9980 ND5 54.9 45.1 0.0980 0.9957 ND6 51.2 48.9 0.0230 0.9991 CYTB 55.2 44.9 0.1029 0.9954 PCG avg 55.15 44.91 0.1023 0.9952 TRNAPhe 56.5 43.5 0.1300 0.9940 TRNAVal 48.6 51.4 -0.0280 1.0011 tRNALeu(UUR) 50.7 49.4 0.0130 0.9995 TRNAIIe 51.4 48.6 0.0280 0.9988 TRNAGln 54.8 41.1 0.1429 0.9931 TRNAMet 43.4 56.5 -0.1311 1.0047 TRNATrp 63 37 0.2600 0.9860 TRNAAla 63.4 36.6 0.2680 0.9855 TRNAAsn 52 48 0.0400 0.9983 TRNACys 48.5 51.5 -0.0300 1.0012 TRNAtyr 44.4 55.5 -0.1111 1.0040 tRNASer(AGN) 52.7 47.3 0.0540 0.9977 TRNAAsp 63.3 36.4 0.2698 0.9853

98 TRNALys 59.8 40.3 0.1948 0.9904 TRNAGly 63.9 36.1 0.2780 0.9847 TRNAArg 52.8 47.1 0.0571 0.9976 TRNAHis 63.7 36.2 0.2753 0.9849 TRNASer(UCN) 52.7 47.3 0.0540 0.9977 TRNALeu(CUN) 57.5 42.4 0.1512 0.9929 tRNAGlu 63 37 0.2600 0.9860 tRNAThr 52.2 47.9 0.0430 0.9982 tRNAPro 59.2 40.9 0.1828 0.9911 tRNAArg 55.34 44.45 0.1065 0.9946 16S rRNA 55.9 44.1 0.1180 0.9947 12S rRNA 50.9 49.1 0.0180 0.9993 rRNAavg 53.40 46.60 0.0680 0.9970

99 4.11 Noncoding Sequences in Schizothoracinae

The major non-coding sequence in mitochondrial genome of Schizothoracinae was D- loop, which was 938 bp, 935 bp and 936 bp in S. esocinus, S. plagiostomus and S, labiatus respectively. The two ends of D-loop covered by tRNAPro and tRNAPhe genes in Schizothoracinae fishes respectively. The mitochondrial DNA (mtDNA) control region is the main non-coding portion of animal mitochondrial genome. Control region is the greatest variable portion of the vertebrate mtDNA genome and mutation rates were comparatively higher than other mtDNA genes and nuclear genes, the control region sequences were used normally to approximate phylogenetic relationships. Control region in the genome of Schizothoracinae fishes are similar to other fishes than the coding sequences, with several nucleotide substitutions, insertions and deletions. Though, numerous important regulatory elements are present. Three domains were detected in mtDNA of Schizothoracinae fishes namely, the extended termination- associated sequence domain (TAS), the central conserved sequence block domains (CSB-F, CSB-E, CSB-D and CSB-B) and TATA Box. The D-loop region of S. esocinus mtDNA is 938 bp in length and reported base composition were T 33 .4%, A 32.9%, C 19.6% and G 14.1% respectively, while A+T 66.3% were higher as G+C 33.7%. The D- loop region of S. plagiostomus mtDNA is 935 bp in length and its base composition were T 33 .6%, A 33.2%, C 19.3% and G 13.9% respectively, while A+T 66.8% were higher compared to G+C 33.2%. The D-loop region of S. labiatus mtDNA is 936 bp in length and its base composition were T 33 .2%, A 33.3%, C 19.7% and G 13.8% respectively, while A+T 66.5% were higher as G+C 33.5%The A + T content. A putative termination-associated sequence (TAS) of TACATATATGTATTATCACCATTTTATCT TAACCATAAA is identified in the 3' end of the D-loop region of S. esocinus, S. plagiostomus and S. labiatus (genome position 15711-15752 and 15685- 15726 respectively). Complete Sequence alignment control region (D-loop) showed 785 to 809 bp in all three species under consideration.

100 Fascinatingly the length deviation was detected in di- nucleotide (TA)n microsatellite with a variable number of repeat units.

Fig. 18: Sequences of the control region from the S. esocinus mitochondrial genome.

GGGTACACCCCTTATGGTTTAGTACATAATATGCATAATATTACATTAATGTACTAGTACATATATGTATTATCACCATTTTATTATCTTAACCATAAAGC TAS AGGTACTAAATATTAAGGTATGCATAAGCATAATATTAAAACTCACAAATAATTTTATTTTAAATTGGGTAATATATT AATTCCATAAAAATTTGACCTCAA ATTTTTCCTTGAAATAAACAACTAAAATCCCAACTAACCATATTAATGTAGTAAGAAACCACCAACTAATTTATATAAAGGTATATCATGCATGATAGAAT CSB-F TATA Box CAGGGACAATAACTGTGGGGGTTGCACACTGTGAATTATTACTGGCATCTGGTTCCTATTTCAGGAACATATATTGTAGTATCCCACCCTCGGATAATTAT CSB-D ACTGGCATTTGATTAATGGTGTAGTACATATGTCTCGTTACCCACCAAGCCGAGCGTTCTCTTATATGCATAACGTATTTTTTCCTTTTTTCATTTCATCTGG CSB-B CATCTCAGAGTGCAGGCTCAAATGTTATTTAAGGTAGAACATTTTCCTTGTATGTGATAATAAATATTAATTATTGTAAGACATAACCTTAAGAACCACAT CSB-1 ATTTTTAAGTCAAGTGCATAACATATTCATCTCTTGTTCAGCTTATCCTTATATAGTGCCCCCTTTTTTGGTTTTTGCGCGACAAACCCCCCTACCCCCCTAC CSB-2 GCTCAGCGAATCCTGTTATCCTTGTCAAACCCCTAAACCAAGGAGGACTCAAGAACGCGCGGGCCAACAAGTTGAGGTATAAATTGGCATCCACATTAT CSB-3 CSB-E TATA Box ATATATATATATATATATATGTGCACTAATCTTTATTTATGCATCCGCCAATTGGCGCTGAAAGCCTCTATTAAAAATTTACGAAAAAGTAATCCGGCACT Microsatellite AAATATTCTAACATATTATC

Fig. 19: Sequences of the control region from the S. plagiostomus mitochondrial genome.

101 Fig. 20. Sequences of the control region from the S. labiatus mitochondrial genome.

102 4.12 Phylogenetic of complete genomes

Small mitochondrial gene fragments only used to a restricted level to resolve the phylogenetic relationships at higher taxonomic levels, from past few years the phylogeny of higher level taxa have oftenly been reconstructed using the complete mitochondrial DNA sequence (Lavoue et al., 2007). The present study is a first attempt to find the taxonomic status of genus Schizothorax. In this study we estimated the evolutionary relationship of Schizothoracine species within genus Schizothorax by constructing phylogenetic trees using the completed mitochondrial genomes. These trees were generated on complete mitochondrial genome of our own species and sequence retrieve from NCBI.

The phylogenetic relationships of S. esocinus within the genus Schizothorax were investigated using the completed mitochondrial genomes with outgroup (Catla catlla, Labeo rohita, Puntius snyderi, Cyprinus carpio and Barbus barbus) and examined by the MEGA6 software (Tamura et al., 2013). The phylogenetic tree is shown in (fig 20) with high bootstrap supports values. The Neighbor-Joining phylogenetic tree suggested that four species including S. esocinus from Panjkora River, Pakistan formed a monophyletic group, with S. richardsonii, S. progastus and S. niger from Kashmir (India) shows the closest relationship to each other. While two species A. laticeps and S. biddulphi formed a monophyletic group.

The phylogenetic relationships of S. plagiostomus within the genus Schizothorax were investigated using the complete mitochondrial genomes with outgroup (Catla catlla and Carassius auratus) and examined by the MEGA6 software (Tamura et al., 2013). The phylogenetic tree shows high bootstrap supports (fig 21). The Neighbor-Joining phylogenetic tree suggested that five species from Swat River, Pakistan including S. plagiostomus in a monophyletic clade, with S. richardsonii, S. progastus, S. esocinus and S. niger from Kashmir (India) and showed the closest relationship to each other. While

103 four species Schizothorax macropogon, Schizothorax waltoni, Schizothorax wangchiachii and oconnori shown a monophyletic group.

The phylogenetic position of S. labiatus within Cyprinid was reconstructed using complete mitochondrial genome. The phylogenetic trees exhibit high bootstrap supports (fig 22). From the tree topologies, we can trace that the molecular phylogenetic relationship of these 20 species was similar to the traditional taxonomy. The phylogenetic relationships show within the genus Schizothorax, with outgroup (Cyprinus carpio and Barbus barbus), Neighbor-Joining phylogenetic tree suggested that S. labiatus from Bangong River Tibet China, interestingly shows close relationship with outgroup (Cyprinus carpio and Barbus barbus) and with S. plagiostomus (from Pakistan), S. progastus and S. niger from Kashmir (India).

104 91 Schizothorax prenanti 100 Schizothorax davidi 94 Schizothorax lissolabiatus 100 Schizothorax chongi 100 Schizothorax dolichonema 87 Schizothorax lantsangensis Schizothorax macropogon Schizothorax waltoni 78 100 Schizothorax oconnori 83 100 Schizothorax wangchiachii Schizopyge niger 100 Schizothorax esocinus 100 Schizothorax progastus 100 100 100 Schizothorax richardsonii Schizothorax biddulphi 100 Aspiorhynchus laticeps Schizothorax pseudoaksaiensis Barbus barbus Cyprinus carpio Puntius snyderi 100 Labeo rohita 58 100 Catla catla

0.02

Fig. 21. The evolutionary history was inferred using the Neighbor-Joining method.

The optimal tree was constructed with the sum of branch length = 0.59. The bootstrap values (1000 replicates) are shown next to the branches. The evolutionary distances were computed using the Kimura 2-parameter. The analysis involved 22 nucleotide sequences.

105 86 Schizothorax prenanti 100 Schizothorax davidi 92 Schizothorax lissolabiatus 100 Schizothorax chongi 100 Schizothorax dolichonema 84 Schizothorax lantsangensis Schizothorax macropogon

100 Schizothorax waltoni 66 76 Schizothorax oconnori 100 Schizothorax wangchiachii Schizothorax niger Schizothorax plagiostomus 100 100 100 Schizothorax esocinus 69 Schizothorax progastus 64 Schizothorax richardsonii Schizothorax biddulphi 100 Aspiorhynchus laticeps Schizothorax pseudoaksaiensis Cyprinus carpio 100 Carassius auratus

0.02

Fig. 22. Neighbor joining phylogenetic tree of complete mitochondrial genomes of S. plagiostomus with closely related species.

The maximum likelihood phylogeny tree constructed using Mega 6 with 1000 bootstrap replications, Kimura 2-parameter as a model of nucleotide substitution, and ML heuristic method by gamma distributed.

106 66 Schizothorax lissolabiatus

64 Schizothorax pseudoaksaiensis 64 Schizothorax macropogon 66 Schizothorax waltoni 66 Schizothorax lantsangensis 66 Schizothorax prenanti

66 Schizothorax dolichonema Schizothorax wangchiachii Schizothorax oconnori 66 Schizothorax davidi 69

62 Schizothorax esocinus 64 Schizothorax biddulphi Schizothorax chongi Barbus barbus Schizothorax richardsonii 66 Cyprinus carpio 70 Schizothorax plagiostomus 66 Schizothorax labiatus 65 Schizothorax progastus 98 97 Schizopyge niger Fig. 23. The evolutionary history was inferred using the Neighbor-Joining method.

The optimal tree with the sum of branch length = 12.91 is shown. The bootstrap values (1000 replicates) are given next to the branches. The evolutionary distances were computed using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. The analysis involved 20 nucleotide sequences.

107 4.13 Comparative study tRNAs in genomes Schizothoracines species

Comparative study of three genomes showed that almost all genes in genome are similar in size. The largest tRNA was tRNAAsp which was 85bp long in all species, while smallest tRNA was tRNACys which was 66 bp long in Schizothorax species.

Table 19: Comparative size (bp) of transfer RNA in S. Plagiostomus (bp), S. esocinus (bp) and S. labiatus (bp)

S. No tRNAs S. Plagiostomus (bp) S. esocinus (bp) S. labiatus (bp) 1 tRNAPhe 69 69 69 2 tRNAVal 72 72 72 3 tRNALeu 77 77 77 4 tRNAIle 70 70 70 5 tRNAGln 73 73 73 6 tRNAMet 69 69 69 7 tRNATrp 73 73 73 8 tRNAAla 71 71 71 9 tRNAAsn 73 73 73 10 tRNACys 66 66 66 11 tRNATyr 72 72 72 12 tRNASer 74 74 74 13 tRNAAsp 85 85 85 14 tRNALys 77 77 77 15 tRNAGly 72 72 72 16 tRNAArg 70 70 70 17 tRNAHis 70 69 69 18 tRNASer 69 69 69 19 tRNALeu 76 76 76 20 tRNAGlu 73 73 73 21 tRNAThr 71 71 71 22 tRNAPro 69 69 70

108 4.14. Comparative of protein coding genes

Comparative size of protein coding genes showed that the largest gene is COXI which was 1551bp pairs long while the smallest gene was ND4L which was 290bp long in Schizothorax plagiostomus, Schizothorax esocinus and Schizothorax labiatus respectively.

Table 20: Comparative size (bp) of protein coding gene in S. Plagiostomus (bp), S. esocinus (bp) and S. labiatus (bp).

S. No Protein coding gene S. Plagiostomus (bp) S. esocinus (bp) S. labiatus (bp) 1 ND1 979 979 979 2 ND2 1044 1045 1044 3 COX I 1551 1551 1551 4 COX II 690 690 691 5 ATP8 158 158 158 6 ATP6 683 683 683 7 COXIII 785 785 785 8 ND3 349 349 349 9 ND4L 290 290 290 10 ND4 1381 1381 1381 11 ND5 1820 1820 1820 12 ND6 522 522 522 13 Cyt b 1141 1141 1141

109 4.15 Stop and start codon in protein coding genes

Comparative study of start and stop codon showed similarity in Schizothoracines species. Two types of stop codon was observed complete and incomplete. In case of ND1, COX I, ATP8, ATP6, COXIII, ND3, ND4, ND5 and ND6 complete stop codons were observed, whereas in remaining protein coding genes incomplete stop codon were observed in the form of TA- and T—in Schizothorax plagiostomus, Schizothorax esocinus and Schizothorax labiatus respectively.

Table 21: Start and stop codon in protein coding gene of S. Plagiostomus (bp), S. esocinus (bp) and S. labiatus (bp).

S. No Protein coding gene S. Plagiostomus S. esocinus S. labiatus Start Stop Start Stop Start Stop 1 ND1 ATG TAA ATG TAA ATG TAA 2 ND2 ATG TA- ATG TA- ATG TA- 3 COX I GTG TAA GTG TAA GTG TAA 4 COX II ATG T-- ATG T-- ATG T-- 5 ATP8 ATG TAA ATG TAA ATG TAG 6 ATP6 ATG TAA ATG TAA ATG TAA 7 COXIII ATG TAA ATG TAA ATG TA- 8 ND3 ATG TAG ATG TAG ATG TA- 9 ND4L ATG TAA ATG TAA ATG TAA 10 ND4 ATG T-- ATG T-- ATG T-- 11 ND5 ATG TAA ATG TAA ATG TAA 12 ND6 TTA TAA TTA TAA ATG TAA 13 Cyt b ATG T-- ATG T-- ATG T--

110 4.16 Comparative study of amino acid

In Schizothoracines species similar number of amino acid were recorded in three species, the maximum amino acid was observed in ND5 gene which was 605bp long, while minimum amino acid were observed in ATP8 gene which was 51 in Schizothorax plagiostomus, Schizothorax esocinus and Schizothorax labiatus respectively.

Table 22: Comparative number of amino acid in protein coding gene of S. plagiostomus, S. esocinus and S. labiatus.

S. No Protein coding gene S. plagiostomus S. esocinus S. labiatus 1 ND1 326 326 326 2 ND2 347 348 347 3 COX I 516 516 516 4 COX II 229 229 229 5 ATP8 51 51 52 6 ATP6 227 227 227 7 COXIII 260 260 261 8 ND3 116 116 116 9 ND4L 95 95 95 10 ND4 460 460 460 11 ND5 605 605 605 12 ND6 173 173 173 13 Cyt b 380 380 380

111 4.17 Comparative size of other genes

Other gene includes 12SrRNA, 16SrRNA, OL and D-loop region. The 12SrRNA was 957 long in Schizothorax plagiostomus, Schizothorax esocinus and Schizothorax labiatus respectively. Only few variations was observed in D-loop region and OL regions 51 in Schizothorax plagiostomus, Schizothorax esocinus and Schizothorax labiatus respectively.

Table 23: Comparative size of ribosomal gene, replication origin (OL) and Dloop in S. plagiostomus (bp), S. esocinus (bp) and S. labiatus (bp).

S. No Locus S. Plagiostomus S. esocinus S. labiatus 1 12SrRNA 957 957 957 2 16SrRNA 1677 1677 1677 3 OL 08 33 08 4 D-loop 935 938 936

112 4.18 Phylogenetic Analysis

In present study all sequences were aligned by using Clustalx software and ambiguously aligned characters were excluded from data analysis. Data was divided into three categories, the first dataset comprised of indivuals analysis of Cytb gene, second dataset we used only D-loop, third dataset included combined analysis of Cytb and D-loop sequences of three species from different localities. Firstly we considered sequences only from Pakistan and China, but later we also extracted some sequences from Kashmir (India) for comparative study and to calculate the divergence time of Schizothoracinae fishes in Asia. NCBI sequences of European Cyprinids were used for divergence time calculation. Phylogenetics analysis verified that multiple individuals representing the different species and formed monophyletic and distinct lineages. The complete alignment of Cytb gene sequences shows that, presence of a common conserved region in all the three species from Pakistan, China and India, indicating that these species belong to same family and same genus. This statement is further supported by homology of these species to previously published literature (sequences) from other related fish species through NCBI GeneBank.

4.19 Haplotype diversity in Schizothoracine fishes

Our findings show that on the basis of Cytb gene the maximum haplotypes, haplotype diversity and total number of mutation were shown by Schizothorax esocinus, while minimum haplotypes, haplotype diversity and mutation were shown by Schizothorax labiatus. By considering D-loop then again we observed same results, the maximum haplotypes, haplotype diversity and total number of mutation shows by Schizothorax esocinus, while minimum haplotypes, haplotype diversity and total number of shows by Schizothorax labiatus. Whereas, same results were observed in combined analysis of Cytb and D-loop, the maximum haplotypes, haplotype diversity and total number of mutation shows by Schizothorax esocinus, while minimum haplotypes, haplotype diversity and total number observed in Schizothorax labiatus. Among 46 indivuals of 3

113 species belonging to genus Schizothorax, to find the haplotypes of all species, we used 35 complete sequences (Cytb and Dloop) which included positions 2076 and total number of sites were 2072 on the basis of these sequence we observed 21 haplotypes, 10, 5, 6 haplotypes were recorded in S. plagiostomus, S. esocinus and S. labiatus respectively, but no shared haplotypes was recorded among three species. The haplotypes diversity (h) is ranging from 0.000 to 1.000. The lowest haplotypes diversity was recorded for S. labiatus (0.477) and highest haplotypes diversity was recorded in S. esocinus (1.000), while for S. plagiostomus haplotypes diversity was (0.955). The nucleotide recorded diversity for S. plagiostomus, S. esocinus and S. labiatus was 0.00289, 0.00415 and 0.00073 respectively. The lowest nucleotide diversity was recorded for S. labiatus (0.00073) and highest in S. esocinus (0.00415), while 0.00289 for S. plagiostomus.

114 Table 24: No of haplotypes in schizothorax plagiostomus, S. esocinus and S, labiatus on the basis of Cytb gene.

Total Haplotype Variance Standard number of (gene) of Deviation of No. of No. of mutations diversity Haplotype Haplotype Nucleotide Species specimens Haplotypes(h) (Eta) (Hd) diversity diversity diversity (Pi: ) S. plagiostomus 21 5 4 0.652 0 0.069 0.00105

S. Esocinus 6 5 10 0.933 0.01 0.122 0.00333

S. Labiatus 18 2 1 0.209 0.01 0.116 0.00018

Table 25: No of haplotypes in schizothorax plagiostomus, S. esocinus and S, labiatus on the basis of Dloop.

Total number Haplotype Variance Standard of (gene) of Deviation of No. of No. of mutations diversity Haplotype Haplotype Nucleotide Species specimens Haplotypes(h) (Eta) (Hd) diversity diversity diversity (Pi: ) S. plagiostomus 13 9 12 0.936 0 0.051 0.0049

S. Esocinus 6 6 14 1 0.01 0.096 0.00651

S. Labiatus 18 2 1 0.209 0.01 0.116 0.00018

Table 26: No of haplotypes in schizothorax plagiostomus, S. esocinus and S, labiatus on the basis of cytb and Dloop.

S. Esocinus 5 5 19 1 0.02 0.126 0.00415

S. Labiatus 18 4 7 0.477 0.02 0.134 0.00073

115 4.20 Phylogenetic analysis of Cytb

Cytb gene sequences were aligned to assess phylogenetic analysis of Schizothoracine phylogeny. Most of the sequences of Cytb in Schizothoracine species were conserved and number of variation were observed on first and third codon position. Globally the nucleotide composition of the Cytb sequence is G- deficient, whereas similar frequencies were observed among three nucleotide basis A (26.5 %), C (27.7%), T (28%.7), G (17.1%). Same nucleotide composition pattern has reported in several other fish studies (Durand et al., 2002). Strong bias in base composition is a distinctive feature of the cytb gene and other mitochondrial protein coding (Irwin et al., 1991)

Phylogenetic tree of Cytb supports the close genetic relationship among the three species under study. It has established that population collected from various sites do not cluster to their particular species and display intermixing by Cytb sequence data analysis. Our finding showed that some specimens of Schizothoracine species like S. plagiostomus does not form separate and single cluster, however some specimens showed relationships with S. esocinus and S. labiatus.

The Cytb results showed 1140 bp sequence, of which 1127 bp (98.8%) were conserved while 13 bp (1.2%) were variable without any deletion/insertion. The results of maximum parsimony showed that total length of the branches of the tree was 187, while CI excluding uninformative character was equal to 0.97 and RI was 0.90, whereas RCI (0.88) for all sites and iCI (0.66) was for parsimony informative sites. The best fit model for the Cytb data was TrN+I. The recorded nucleotide frequencies was A (26.59%), T (28.66%), C (27.66%) G and (7.09%). The transitional substitution rate ratio (K1 = 283.24) for purines and (K2 = 80) for pyrimidines respectively. The overall recorded transition/transversion bias was R = 55.00. Tajima´s neutrality test of Cytb sequences showed that, total 45 sequence were used for analysis, among them 13 segregation sites, 0.001 nucleotide diversity and Tajima test statistic was -1.21.

116 Schizothorax plagiostomus P-34 Schizothorax esocinus E-22 Schizothorax labiatus L-18 Cyprinus carpio Schizothorax plagiostomus SP-78 Schizothorax plagiostomus SP-18 Schizothorax labiatus L-9 Schizothorax labiatus L-42 Schizothorax plagiostomus L-53 Schizothorax plagiostomus SP-5 Schizothorax plagiostomus SP-2 Schizothorax plagiostomus SP-7 Schizothorax plagiostomus SP-1 Schizothorax plagiostomus SP-3 Schizothorax esocinus SE-1 Schizothorax esocinus SE-2 Schizothorax esocinus SE-4 Schizothorax plagiostomus SP-15 Schizothorax plagiostomus SP-12 Schizothorax labiatus SL-11 Schizothorax plagiostomus SP-14 Schizothorax plagiostomus SP-8 Schizothorax plagiostomus SP-13 Schizothorax esocinus SE-5 Schizothorax labiatus SL-1 Schizothorax labiatus SL-2 Schizothorax labiatus SL-5 Schizothorax labiatus SL-8 Schizothorax labiatus SL-12 Schizothorax labiatus Schizothorax esocinus Schizothorax esocinus Schizothorax esocinus Schizothorax esocinus Schizothorax plagiostomus P-96 Schizothorax esocinus SE-3 Schizothorax plagiostomus P-20 Schizothorax esocinus E-48 Schizothorax esocinus E-6 Barbus barbus Ptychobarbus dipogon

Fig. 24: Phylogenetic tree showing the relationship of Schizothoracines fishes on the basis of Cytb gene. Each branch showing Bayesian posterior probability (PP) ≥ 0.95 %.

117 4.21 Phylogenetic of Dloop region

Sequence alignment of control region shows length variation among Schizothoracine species which are under reading. Excitingly, the length variation was detected in di- nucleotide (Ta)n microsatellite region with variable number of repeat units. The sequence conformation and arrangement of the repeat vary significantly among and within species. These species had a (TA)n microsatellite not related with longer tandem repeats in the 3´ end light (L) strand of the mitochondrial control region. The nucleotide sequences alignment also permitted the identification of most of the preserved elements defined in vertebrate sequence as reported by (Ahmad et al., 2014) in Schizothoracine fishes of Kashmir.

The results of Bayesian inference of Dloop region (fig 24) repeat same results as mentioned in Cytb case, that S. plagiostomus from different areas shows close relationship with S. labiatus and S. esocinus, while other group of all three Schizothoracine species cluster separately. The D-loop results showed 936 bp, of which 912 bp (97.43%) were conserved and remaining 24 bp (2.57%) were variable without any deletion/insertion. Among 24 sites, 15 sites (62.5%) were parsimony informative polymorphic, while 9 sites (37.5 %) were singleton variable. The best fit ML model for the D-loop data was (HKY+I). The observed nucleotide frequencies were A (33.99%), T/U (33.55%), C (19.45%), G and (13.61%). The results of maximum parsimony showed that CI excluding uninformative character was equal to 0.70 and RI was 0.89, while RCI was 0.62 for all nucleotides, iCI was 0.60 and iRI was 0.89. The transitional/transversion rate ratio (K1 = 107.23) for purines and (K2 = 83.104) for pyrimidines. The overall transition/transversion bias was R = 41.369. The results of maximum parsimony showed that CI excluding uninformative character was equal to 0.71 and RI was 0.89, while RCI (0.62) for all sites, iCI (0.60), iRI was 0.89 (for parsimony informative sites). Tajima´s neutrality test of Cytb sequences showed that, total 37 sequences were used for analysis, among them 23 segregation sites, 0.005 nucleotide diversity and -0.57 Tajima test statistic was recorded.

118 Cyprinus carpio Barbus barbus 0.1169 Schizothorax plagiostomus SP-14 0.1185 Schizothorax plagiostomus SP-8 0.1213 Schizothorax plagiostomus SP-14 Schizothorax plagiostomus SP-13 Schizothorax labiatus SL-12 0.1164 0.1234 Schizothorax labiatus SL-1 0.1171 Schizothorax labiatus SL-2 0.1188 Schizothorax labiatus SL-5 0.1207 Schizothorax labiatus SL-8 0.1206 Schizothorax esocinus SE-5 0.1222 Schizothorax labiatus SL-11 0.1247 Schizothorax esocinus SE-4 0.1203 Schizothorax esocinus SE-2 0.1229 Schizothorax plagiostomus SP-3 1 Schizothorax plagiostomus SP-5 0.1204 Schizothorax esocinus E-48 0.1195 Schizothorax esocinus E-6 0.1236 Schizothorax plagiostomus P-20 Schizothorax plagiostomus P-36 0.1018 0.2053 Schizothorax plagiostomus P-96 0.107 Schizothorax plagiostomus P-18 0.1273 Schizothorax labiatus L-9 0.099 0.0607 0.0615 Schizothorax labiatus L-53 0.1229 0.0624 Schizothorax plagiostomus P-78 0.0795 Schizothorax labiatus L-42 Schizothorax plagiostomus P-78 0.1290 0.1165 Schizothorax plagiostomus SP-1 0.118 Schizothorax plagiostomus SP-12 Schizothorax plagiostomus SP-7 0.1208 0.186 Schizothorax plagiostomus SP-2 Schizothorax esocinus SE-1 Schizothorax esocinus SE-3 Ptychobarbus dipogon

Fig. 25: Phylogenetic tree showing the relationship of Schizothoracines fishes on the basis of Dloop. Each branch showing Bayesian posterior119 probability (PP) ≥ 0.95 %.

4.22 Phylogenetic analysis of Cytb and Dloop

The total length of the mtDNA sequence alignment of 37 sequences were 2079 bp, including 1141 bp of Cytb and 938 bp of D-loop region. The data were partitioned by gene with GTR + G model, which gave more precise estimate of posterior probabilities across generations of the long Bayesian run. Among them 2040 bp (98.26%) were conserved, while 36 bp (1.74%) were variable without any deletion/insertion. The results of maximum parsimony showed that CI excluding uninformative character was 0.70 and RI was 0.87, while RCI was 0.62 for all bp, iCI was 0.60 and iRI was 0.53 (for parsimony informative sites). The recorded nucleotide frequencies were 29.61% (A), 30.86% (T/U), 23.97% (C) and 15.56 % (G). The transitional/transversion rate ratio was (K1 = 130.16) for purines and (K2 = 50.35) for pyrimidines. The overall transition/transversion bias was R = 39.254. Tajima´s neutrality test of Cytb sequences showed that, total 35 sequence were used for analysis, among them 35 segregation sites, 0.003 nucleotide diversity and -0.82 Tajima test statistic.

The following tree shows two distinctive relationships within S. plagiostomus, S. esocinus and S. labiatus. Some species of S. labiatus formed cluster with S.plagiostomus and some species of S. esocinus from Pakistan showed close relationship with S. labiatus of Tibet China.

120 Schizothorax labiatus SL-5 0.194 0.925 Schizothorax labiatus SL-12 0.996 Schizothorax labiatus SL-1 Schizothorax labiatus SL-2 0.941 Schizothorax labiatus SL8 0.310 Schizothorax esocinus SL-5 Schizothorax labiatus SL-11 0.914 Schizothorax plagiostomus SP-14 Schizothorax plagiostomus SP-8 0.920 Schizothorax plagiostomus SP-15 Schizothorax plagiostomus SP-13 Schizothorax esocinus Se-2 Schizothorax esocinus SE-4 0.170 Schizothorax esocinus SE-1 Schizothorax plagiostomus SP-1 Schizothorax plagiostomus SP-12 Schizothorax plagiostomus SP-7 0.497 Schizothorax plagiostomus SP-2 Schizothorax plagiostomus SP-3 Schizothorax plagiostomus SP-5 0.866 Schizothorax esocinus SE-3 0.872 Schizothorax plagiostomus P-20 0.819 Schizothorax plagiostomus P-96 Schizothorax esocinus E-48 Schizothorax esocinus E-6 0.328 Schizothorax labiatus L-9 0.966 Schizothorax labiatus L-53 0.981 1 Schizothorax labiatus L-42 1 1 Schizothorax labiatus L-18 Schizothorax plagiostomus P-78 1 1 Schizothorax plagiostomus P-18 Schizothorax plagiostomus P-34 Schizothorax esocinus E-22 Ptychobarbus dipogon 0.6932 Barbus barbus Cyprinus carpio

0.02

Fig. 26: Phylogenetic tree showing the relationship of Schizothoracines fishes on the basis of combined mtDNA (Cytb, Dloop) gene.

Each branch showing Bayesian posterior probability (PP) ≥ 0.95 %.

121 4.23 Divergence time of Schizothoracinae fishes in Pakistan and Tibet

The exact data about divergence of Schizothoracinae fishes in Asia is not known. To find the divergence time, Bayesian relaxed clock method by using Beast software version v1.8.2 was used and visualized in TRACER 1.5. The divergence time for Cyprinids was considered as the interval of evaporate deposition and Lago Mare sedimentation in Mediterranean before the Pliocene flooding around 5.33 Mya. The conditions of MCMC (Markov chain Monte Carlo) were as follows, the first 106 generations were discarded as burn in the succeeding 1×107 involved in the analysis. The sample frequency was 100 per generations. As we stated before, the Cyprinids fishes are really denoted in fossils record, it is hard to correctly estimate the divergence time based on cyprinids fossils alone and external calibration points are necessary (Cavender, 1992; Imoto et al., 2013).

122 Barbus sclateri 1.0792, 5.032 Barbus steindachneri

0.3486, 4.1447 Barbus comizo Barbus bocagei 5.1287, 5.5232 B microcephallus Clade 1 0.4244, 4.1501 Barbus guiraonis 1.28131513 Barbus graellsii Barbus callensis Schizothorax plagiostomus P-20 S esocinus E-18 Schizothorax labiatus L-18 Schizothorax plagiostomus SP-18

0.5687, 5.2225 Schizothorax esocinus E-37 5.0288, 10.7608 Schizothorax plagiostomus P-34 Schizothorax plagiostomus P-78 Schizothorax labiatus L-53 0.7347,6. 1874 Schizothorax labiatus L-9 0.373, 3.754 Schizothorax labiatus L-42 Schizothorax esocinus E-6 Schizothorax esocinus SE-2 Schizothorax plagiostomus SP-5 Schizothorax plagiostomus SP-6 1.6774, 6.9911 Schizothorax plagiostomus SP-3 Schizothorax plagiostomus SP-1 0.0844, 4.0119 Schizothorax plagiostomus SP-2 Schizothorax esocinus SE-1 Clade 2 Schizothorax plagiostomus SP-14 Schizothorax plagiostomus SP-13 Schizothorax plagiostomus SP-8 1.122, 5.6297 0.2571, 4.0574 Schizothorax plagiostomus SP-12 Schizothorax labiatus SL-11 0.484, 4.9965 Schizothorax plagiostomus SP-15 Schizothorax esocinus SE-4 Schizothorax esocinus SE-3 Schizothorax esocinus SE-5 0.8989, 6.2911 Schizothorax esocinus Schizothorax esocinus Schizothorax esocinus Schizothorax esocinus 0.5333, 4.8462 Schizothorax plagiostomus SP-20 0.2225, Schizothorax labiatus 3.7766 Schizothorax labiatus SL-2 Schizothorax labiatus SL-1 0.1303, 3.427 Schizothorax labiatus SL-12 Schizothorax labiatus SL-5 Schizothorax labiatus SL-8

0.6

Fig. 27: Ultra metric ML tree of Schizothoracine fishes based on the NPRS transformation using Cytb data.

123 Chapter-5 DISCUSSION The `present study was conducted to find out the complete mitochondrial genome organization, composition and phylogeography of Schizothoracinae fishes in northern Pakistan and western China. Present study was divided into two parts, first to find out the complete mitochondrial arrangement and organization of three species of genus Schizothorax, two species from Pakistan (S. esocinus and S. plagiostomus) and one specie from Tibet, China (S. labiatus) and second to find the comparative phylogeography of Schizothoracinae fishes from northern Pakistan, western China and Kashmir, India (NCBI sequences). For this purpose we collected samples of S. esocinus and S. plagiostomus from different rivers system of Northern Pakistan and S. labiatus was collected from western China (Tibet).

5.1 Genomic organization

Our finding revealed that the order, organization and arrangement of genes in the mitochondrial genome of Schizothoracine fish (S. esocinus, S. plagiostomus and S. labiatus) was similar as those observed in other vertebrates and no organizational irregularities were detected. The complete nucleotide sequence of S. esocinus, S. plagiostomus and S. labiatus were circular and molecular weight was 19591 bp, 16564 bp and 16590 bp respectively, which was similar with mtDNAs of other vertebrates such as human (16,795 bp), mouse (16,295 bp) and chicken (16,795 bp). The structural association of the mitochondrial genome of Schizothorax species, coding and non- coding regions was similar to that of other bony fishes and higher vertebrates (Catanese et al., 2008; Chen et al., 2013; Goel et al., 2016), is composed of a typical set of 37 genes, 22 transfer RNA genes, 13 protein coding genes (PCGs), two ribosomal RNA (12S rRNA and 16 S rRNA) (Cheng et al., 2010; Shi et al., 2012) genes as recorded in common carp (Chang et al., 1994), cod (Johansen and Bakke, 1996), X. laevis (Roe et al., 1985) and mammals (Anderson et al., 1981; Bibb et al., 1981; Gadaleta et al., 1998). All protein coding genes and the two ribosomal genes of Schizothoracinae fish

124 mitochondrial genome were interrupted by at least one tRNA gene and these tRNA gene in schizothorax were assumed to be acting as a recognition signal for mitochondrial RNA processing (Ojala et al., 1981). The complete base composition in mtDNA of S. esocinus was (A=31.41%; G= 18.03 %; T=26.19 %; C=24.39%), while highest A+T 57.54% contents was recorded compared to G + C contents 42.42%, while overall base composition of S. plagiostomus was (A=31.64%; G= 17.99 %; T=26.22 %; C=24.19%), whereas, highest A+T 57.54% contents was recorded compared to G + C contents 42.42%, which is same to other teleosts (Tzeng et al., 1992; Wang et al., 2007). The complete mitochondrial genome of S. labiatus was 16,590 bp, overall base composition was (A=30.09%; G= 16.76 %; T=28.00 %; C=25.18%). An increased A+T 58.04% contents was documented compared to G + C contents 41.94%, which demonstrated an observable anti-guanine bias which is normally observed in teleost fishes (Jondeung et al., 2007; Chen et al., 2013). Our outcomes are also confirmed by (Hassanin et al., 2005) which showed that AT contents were higher than GC contents in most teleostean mitogenomes.

5.2 Protein coding genes

The complete mitochondrial genome of Schizothoracine fishes, contains 13 protein coding genes, out of them 12 protein coding genes arranged on heavy strand (ND1, ND2, COX1, COXII, COXIII, ATP8, ATP6, ND3, ND4L, ND4, ND5 and Cytb) as reported by (Gong et al., 2012; Jiang et al., 2014), only one gene was positioned on light strand (ND6) (Saitoh et al., 2006; Qiao et al., 2013). All the protein coding genes start from ATG except COXI and ND6 started from GTG and TTA respectively which is common in bony fishes (Boore, 1999). Like many other fishes, 8 protein coding genes (ND1, COXI, ATP6, ATP8, COXIII, ND4L, ND5 and ND6) share the common termination codons TAA and ND2 termination codon is TGA, while COXII, ND3, ND4 and cytb gene having incomplete stop codon (T--) (Liu et al., 2014; Yan et al., 2016).

125 In Schizothoracine species, among 13 protein coding genes, 8 genes end with TAA stop codon, while one protein gene end with TGA, whereas remaining 4 genes don’t end with complete stop codon, it contains incomplete codon in the form of TA- and T--. Therefore the stop codon of these protein coding genes in mitochondrial genome, seem to be created through the adding of adnylate remains to the primary transcript as projected for other fishes and vertebrates (Ojala et al., 1981). In COXI gene of cod and chicken, occurrence of an GTG stop codon is also perceived (Johansen et al., 1990) and in chicken (Desjardins and Morais, 1990) in the ND1 gene of mouse (Bibb et al., 1981) and ND5 gene of Drosophila yakuba (Clary and Wolstenholme, 1985), in some cases GTG stop codon is also described in prokaryotic genes. For all protein coding genes excluding ND6, the heavy strand functions as the template for transcription. In S. esocinus protein coding genes, the highest A+T contents was recorded in ATP6 gene which was (63.3%), while lowest A+T contents was recorded in ND2 and ND6 genes which was (51.2%), while in S. plagiostomus protein coding genes, the highest A+T contents was recorded in ATP6 gene which was (63.3%), while lowest A+T contents was recorded in ND1 gene which was (50.01%), whereas in S. labiatus protein coding genes, the highest A+T contents was recorded in ATP6 gene which was (63.3%), while lowest A+T contents was recorded in ND1 gene which was (50.01%). The strong bias against the nucleotide G was observed at third codon position in genome of S. esocinus, which is consistent with other vertebrates (Broughton et al., 2001). The abundance for nucleotide A has been shown to be related with transcription efficacy, as ATP is normally the most important ribonucleotide in mitochondria (Xia, 1996). The considerable bias against G might be due to collection against least established G nucleotides on the light strand (Clayton, 1991).

The codon usage in 13 PCG of Schizothoracine fishes were recognized. The mitochondrial DNA encodes 3619, 3591, 3624 amino acid containing stop codons in S. esocinus, S. plagiostomus and S. labiatus respectively. For the amino acid with fourfold degenerative third position codon genes, T is the most common, followed by

126 A and C for Leu and Val. Between Ser, Pro and Ala, C was commonly seen. However, for Gly, A is often used as compared with other bases. Among two-fold degenerate codons, T seems to be used more than C in pyrimidine. Except for Gly, G is the least frequently occurring at third position nucleotide in all codon families. All these features can also be seen in vertebrates (Broughton et al., 2001; Xia et al., 2007).

5.3 Non-coding region

Two non-coding regions were observed in the mitochondrial genome of

Schizothoracine fishes. One is an L-strand origin (OL) which resides in a collection of five tRNA genes (WANCY) as described in other vertebrate (Oh et al., 2007). The putative OL, were situated among tRNA-Asn and tRNA-Cys. The OL region folds into a stable stem loop secondary structure and it has been predicted that OL region is involved in conversion from RNA to DNA synthesis (Hixson et al., 1986). The mitochondrial DNA (mtDNA) control region is the principal non-coding portion of animal mitochondrial genome. The control regions of three Schizothoracine fishes were positioned among the tRNA-Pro and tRNA-Phe genes, which were 938 bp, 935 bp and 936 bp in S. esocinus, S. plagiostomus and S. labiatus respectively (Chen et al., 2013). Control region lacks coding strains and hence is generally a variable part of the vertebrate mtDNA genome (Baker and Marshall, 1997). Because of this variability, the control region orders were used usually to estimate phylogenetic relationships (Donne-Goussé et al., 2002; Huang et al., 2009) and population genetics (Zhong et al., 2013; Xiao et al., 2015) in animals. Therefore, control region of Cypriniformes was used for evaluation to our original data (Liu et al., 2002), which selected a putative termination-associated sequence (TAS) and the remaining conventional structure elements including TATA-boxes. This sequence (TAS) appears to be act as a signal for termination of D-loop strand (Doda et al., 1981). Doda et al (1981) documented some well-preserved 15 bp sequence such as termination association sequence (TAS) located at 3´ end regions in human and mouse cells. In addition, some conserved sequence blocks (CSB) were also recognized within D-loop sequences. Specifically,

127 central conserved sequence block domains (CSB-F, CSB-E, CSB-D, CSB-B) (Liu et al., 2002;) were also acknowledged at the central conserved domain at the 3´ end of the D-loop region in the Schizothoracine fishes as reported by Southern et al (1988) in mammals. The TAS, central CSB were identified in the control region, which is similar to most bony fishes (Clayton, 1991; Shadel and Clayton, 1997; Zhang et al., 2013). All these three elements recognizable in Schizothoracinae fishes show strong similarity to CSBs identified by different authors in other vertebrate sequences (Roe et al., 1985; Foran et al., 1988).Though not much is known about the function of the conserved block (Sbisà et al., 1997; Guo et al., 2005). The CSBD block is highly conserved in fishes and it is involved in the regulation of H-strand beginning and replication of the D- loop (Clayton, 1982). In some fishes, CSB-D sequences seemingly show a higher level of deviation (Lee et al., 1995; Jin-Liang et al., 2006). We found that the central conserved sequences of CSBD, CSBE and CEBF having TTATATGCATAACGTATTTT, TATTACTGGCATCTGGTTCCTATTTCAGG,andATATTGTAAGTAAGAAACCAC CAA respectively, typically present in Sinipercine fishes (Jin-Liang et al., 2006) can be identified in Cynoscion acoupa and also in other Percoidei such as pagellus bogaraveo (Ponce et al., 2008) and also observed in Lates calcarifer (Lin et al., 2006). The peripheral domain was extremely conserved compared to central domains, due to which this domain is appropriate for phylogenetic analysis, but small amount of variable positions in this region were exposed to high statistical fluctuations, thus was not significant for phylogenetics distance based purpose (Saccone et al., 1991). Three CSB domains were identified in Schizothoracinae fishes such as (CSB1, CSB2 and CSB3) but the degree of similarity between CSBs was variable among different taxa even in the same species. CSB1 was found in almost all organisms with a different degree of similarity in hedgehog, whale and opossum, we had found that duplication of CSB1, CSB2 and CSB3 were more preserved but were not present equally in all organisms (Sbisà et al., 1997).

128 We observed one of the most important portions in control region (D-loop) was microsatellite region in all three species as seen in Schizothoracinae fishes of Kashmir (India) (Ahmad et al., 2014). The microsatellite locus (TA) of Schizothoracinae fishes positioned between 16461 to 16486 bp in S. esocinus, 16437 to 16460 bp in S. plagiostomus and 16465 to 16488 bp in S. labiatus as recorded by (Goel et al., 2016). Complete Sequence alignment of (D-loop) revealed 935 to 938 bp in three species under consideration. Excitingly the length variation was detected in di- nucleotide (TA)n microsatellite with an inconstant number of repeat units. The sequence arrangement and composition of the repeats vary significantly between and within species. These three species had a (TA)n microsatellite related with longer tandem repeats in the 3´ end of the light strand (L) of the control region (Ahmad et al., 2014).

Sequence investigation of vertebrate mtDNAs has shown that the D-loop region is the most quickly evolving portion of the genome. But, the midportions of the D-loop region are comparatively conserved (60% identity), mostly the last one-third part. Earlier information confirmed that the conserved sequence region exists at D-loop control section in vertebrate mitochondrial genome, which is the DNA polymerase and RNA polymerase binding site for transcription and replication of DNA (Foran et al., 1988; Shadel and Clayton, 1997). The non- coding portion (control region) which is present in mtDNA that’s controls transcription as well as replication. The major domain of control region does not show to be specifically vital for controlling function because this portion has a wide variability among and to some extent between taxonomic groups (Clayton, 1991; Shadel and Clayton 1997).

5.4 Transfer and Ribosomal RNA Genes

A total of 22 tRNAs genes were noted in Schizothoracinae fishes, extended from 66 bp to 85 bp, these 22 tRNAs were generally matching with tRNAs programmed by mtDNAs of other fishes and vertebrates. Like other fishes and vertebrates in Schizothoracine fishes there are two forms of tRNAs-Ser (AGN and UCN) among

129 22tRNAs and was tRNAs-Leu (CUN and UUR). Nine pairs mismatches were pointed out in the secondary structure of 22 tRNAs gene, with 6 pairs in amino acid acceptor stems, 1 pairs in the anticodon loop, 1 pair in D-loop and 1 pair in TΨC stem portion. The mismatch bases were mainly U-U and A-C, in addition, U-C, A-G, C-C and A-A mismatch bases were also detected in tRNAs structure of Schizothoracinae fishes. The most probable reason for this mismatched may be that the mitochondrial DNAs was not subjected to recombination process (Lynch, 1997a). As seen in other vertebrates, all 22 tRNAs of Schizothoracine fishes mtDNA tend to make secondary structure in the form of cloverleaf structure having 7 bp in the aminoacyl stem, 5 bp in the T C and anticodon stems, and 4 bp in the DHU stem. The stem section of tRNA contain many noncomplementary and TG rich regions. The reason that these mutations tend to accumulate in mitochondrial genes, is mainly due to the lack of recombination in mitochondrial genome leading to the elimination of deleterious mutations (Lynch 1997). Though the stem sections looks conserved, the loop regions are somewhat more variable compare to other vertebrate sequences. Because stem is functionally important is more conserved than the loop which is in line the phylogenetic studies of a number of vertebrate groups (Sullivan et al., 1995). The tRNA genes of Schizothoracinae fish mitochondrial genome do not encode the 3' CCA terminus like the tRNA genes in the mitochondrial genomes of other vertebrates, and are added posttranscriptionally. Many mismatched base pairs are found in the stem regions of the tRNAs encoded by the mtDNAs of Schizothoracinae fishes and other vertebrates. In Schizothoracinae fishes, the longest tRNA was tRNA-Asp (85 bp), while shortest tRNAs were tRNA-Cys (66 bp). In Schizothoracinae fishes all tRNAs were almost complete, but few were incomplete at acceptor stem portion. The average base composition in tRNAs gene was (A=30.28%; G= 20.17 %; T=25.26 %; C=24.29%) and A+T content was 55.34%.

In mtDNA of Schizothoracinae fishes two forms of rRNAs were recorded 12S RNA and 16S RNA genes respectively; bounded by tRNAPhe and tRNAVal gene at the 5´ end

130 and the 3´ end by tRNAVal and tRNALeu gene as recorded in other vertebrates (Miya and Nishida, 1999; Inoue et al., 2000). The length of 12S RNA was 95 bp and 16S RNA 1677 bp respectively. Both rRNAs were located on heavy strand. The observed average base compositions in rRNA genes was (A=33.45%; G= 21.05%; T=19.95 %; C=25.01%) and A+T contents was 53.04% analogous to other vertebrates, and the rRNA genes are A + C-rich (58.2%) as in bony fishes (Zardoya and Meyer, 1999) homology analysis discovered that the sequences of the tRNAs and rRNAs gene encoded by mtDNA of Schizothoracinae fishes were relatively conserved.

In rRNAs S. esocinus and S. plagiostomus the average AT skew and GC skew were 0.0674 and 0.9970 respectively, while average AT skew and GC skew in S. labiatus were 0.0680 and 0.9970 respectively. The AT-skew and GC-skews all the time show high inter or intra-phylum variation, which may influence phylogenetic analyses (Nesnidal et al., 2011).

131 Section -B

5.5 Phylogeography

Phylogeography is the reading of the geographical, biogeographical designs, ancient and phylogenetic constituents of the distribution of lineages within and between closely associated species. In current study we found the Phylogeographic relationship between Schizothoracines species of Northern Pakistan and Western Tibet China. The phylogeny of the Schizothoracines is valuable for taxonomy and exploration of evolutionary mechanism and Phylogeographical phenomenon in northern Pakistan and western China (Tibet). All earlier investigators estimated the associations between genera of the sub family Schizothoracinae, mostly established on morphological characters, have achieved similar deduction (Cao et al., 1981a). Unluckily, the morphological features of this group have not evidenced to be reliable in solving inter and intra species relationships (Nyman and Swedmar, 1999). There is a discrepancy between numerous scientists about the figure of species present (Heckel, 1838; Silas, 1960; Das and Subla, 1964; Talwar and Jhingran, 1991a). Heckel founded the genus Schizothorax for some species having four barbels and deprived of labial papillae, designated by him from Kashmir Valley, the classification of the group has been confused and doubtful. Though some authors suggested partition of the initial genus Schizothorax into new genera or subgenera (Day, 1878; Das and Subla, 1964a; Mirza, 1975; Mirza and Saeed 1988; Talwar and Jhingram, 1991). The morphological dissimilarity between populations among the genus Schizothorax is normal when the species inhibits a large range (Wu and Wu, 1992). The greater morphological variations and the coinciding features among species have resulted in absence of consensus about their taxonomy (Chen and Cao, 2000).

Our outcomes provided a strong geographical construction among different drainages system. Species sampled from the same drainage system repeatedly clustered together with high statistical support, however their lip and mouth features

132 revealed remarkable variations that were measured as the supreme important standards for classifying Schizothorax into genera or subgenera and even though species (Day, 1878; Das and Subla, 1964a; Mirza, 1991; Mirza and Saeed, 1988; Talwar and Jhingran, 1991a; Wu and Wu, 1992).

Moreover, morphological features related that trophic features, like the contour of the mouth and lips, are typically linked with food of fishes and associated to adaptive evolution. A species having a sharp horny edge to the lower jaw normally feed on appendicular algae, however those deprived of a sharp horny edge mostly nourish on aquatic insects. When both kinds of species residing in river, these changes in morphological features may decrease interspecific struggle for foodstuff due to nourishing deviation (Chen and Cao, 2000).

The alignment of Cytb, D-loop and combined sequence analysis showed the occurrence of common conserved region in all three species of Schizothorax, showed that these species belong to same subfamily Schizothoracinae. This statement also strengthen by prior available sequences from other Schizothoracine fish species on NCBI record. The phylogenetic relationship data showed that distinct association with similar geographical distribution. The species that are distributed in the same river system as well as the species distributed in the different drainage system exhibited closer phylogenetic relationship as our results showed that few indivuals of S. plagiostomus and S, esocinus cluster together in all three figures which is consistent with reported results (Ahmad et al., 2014) about the Schizothoracines fishes of Kashmir. This situation may be due to hybridization actions or represent ecophenotypic variants. Almost same studies were described by Dimmick and Edds (2002) for some Schizothorax Species. The poor relationship between morphology and mtDNA of Schizothoracines in genus or subgenus level because of imperfect lineage arranging (He and Chen, 2006).

133 The Cytb sequence data was used to construct the phylogenetic tree. It showed the close relation between S. plagiostomus, S. labiatus, S. esocinus and reinforced two separate groups of selected species. The classification of the genus Schizothorax has been debatable ever since Hackel this group in 1838. The use of The Cytb, the D-loop sequences for phylogenetic analysis facilitated to displayed the S. plagiostomus, S. esocinus and S. labiatus phylogeographic relationship which are in line with traditional morphological studies. For elucidating the evolutionary affiliation of Schizothorax species, we analyzed a combined data sets of Cytb, D-loop and combined (Cytb, Dloop) with its closely related species available in GeneBank. This approach generated two clades within Schizothoracines from different river system of three regions (Pakistan, China, and Kashmir). Furthermore, S. plagiostomus and S. esocinus found in Pakistan clusters with the Kashmir (Indian) Schizothorax species and help to expose the chronological biogeography of species from the Central Asiatic south slopes of the Himalayas to Kashmir, India.

Evolutionary studies show that the evolution of Schizothorax fishes is very complex in Pakistan, China and India, and show a fascinating relationship between the species of three countries. In few individuals, mitochondrial sequence differences between S. plagiostomus, S. esocinus and S. labiatus is extremely low to classify these species separately. The lack of variation in the mitochondrial sequence data of Schizothorax species might be described in conditions of introgressive hybridization, rapid radiation, incomplete lineage sorting and homoplasy (Tsigenopoulos and Berredi 2000;; He and Chen 2006; Qi et al., 2007). This interspecific hybridization occurs on large scale and leads to great increase in numbers of each species exist and overlaps in breeding time and spatial distributions (Silas 1960).

The combined phylogenetic tree of Schizothoracinae species also revealed a close phylogenetic relation between S. plagiostomus, S. esocinus and S. labiatus species distributed in different river systems even different countries. Dekui et al. (2004) also found that there was close affiliation between the species that were dispersed in the

134 same drainage. (Tilak, 1987) recognized atypical specimens occur commonly among S. labiatus, S. esocinus and S. plagiostomus, the two species that specialized in hypertrophied lip structures. These species are commonly found in fast running waters and even spawning ground. According to Das and Subla, the prolonged evolution of Schizothoracines under cruel mountain land environments caused in the advancement of special adaptive mechanisms (number of barbels, reduction of scales, depressed body or rounded) to these Schizothorax species (Das and Subla, 1963).

The current study did not fully resolve the phylogenetic relationships between the three species of subfamily Schizothoracinae, but study of cytochrome b (cytb) sequences in three species provides valuable insights into the taxonomic position of these fishes and sets the step for future inquiries dealing with phylogenetic, taxonomic and conservation issues in this important group in Northern areas (Pakistan). The phylogenetic relationship of the Schizothoracines is valuable for taxonomy and also for the inspection of evolutionary pattern and mechanisms in Pakistan, China and Kashmir (India). But, unfortunately, the morphological characters of schizothorax group have not been completely truthful in resolving intra and inter specific relationships (Kullander et al., 1999; Raina et al., 1999). Furthermore, there is dissimilarity between different authors about total number of species present now a days (Heckel 1838; Silas 1960; Das and Subla 1964; Talwar and Jhingram, 1991).

We observed extremely low genetic diversity in S. plagiostomus and S. esocinus, and accompanying low population difference observed in this study due to various reasons: (1) slow rate of evolution at genomic level (2) population history (3) small population size leading to higher level of inbreeding, and (4) incomplete lineage sorting. Low population size was observed in S. esocinus during sampling, and we know that the decrease of genetic diversity is considered as directly associated to species population decline (Frankham, 2005 and Richter et al., 2009). But, it is important to know that whether this loss of genetic diversity is the cause of population reduction or vice versa. Loss of genetic diversity can lead to produce inbreeding

135 depression, reduction in long term survival, fitness and condensed adaptation (DeSalle and Amato, 2004; Frankham, 2005). Therefore, it should be of paramount importance to pay considerable attention to stop the decline of these species, to support conservation procedures, and to keep natural environment of these species.

5.6 Divergence time of Schizothoracines fishes

The subfamily Schizothoracinae have no fossils record, different author’s proposed different time about the divergence of Schizothoracines fishes in Asia. Our result showed that Schizothoracinae fishes originated from European Cyprinids during Messinian salinity crisis. The Messinian salinity disaster is broadly considered one of the extreme histrionic events of oceanic change since 20 million years or so. Previous descriptions were that extremely dense evaporates were deposited in a deep and dehydrated Mediterranean basin that had been frequently isolated from the Atlantic Ocean, but explanations of the separation whether determined generally by glacio- eustatic or tectonic actions have been delayed by the lack of an exact time frame. Isolation from the Atlantic Ocean was accepted between 5.59 and 5.33 million years ago, initiating a large fall in Mediterranean water level followed by erosion (5.59 - 5.50 million years ago) and deposition (5.50 - 5.33 million years ago) of non-marine sediments in a large `Lago Mare' (Lake Sea) basin. Cyclic evaporate deposition is completely associated with Mediterranean climate variations driven by changes in the Earth's precession, and not to obliquity-induced glacio-eustatic sea-level changes. The dominant tectonic origin for the Messinian salinity crisis, though its correct timing may well have been controlled by the 400-kyr component of the Earth's eccentricity cycle (Krijgsman et al., 1999).

The expected divergence times established on the basis of mitochondrial genome and shown that the primitive Schizothoracine fishes, chiefly the genus Schizothorax radiated successively from the Late Miocene to the Early Pleistocene (10.2–1.0 Ma) (Li et al., 2013). The severe uplift of Qinghai-Tibetan Plateau is suggested during this period (Li

136 et al., 2001). The estimated time of parting of Schizothoracinae species seems to be late Pleistocene (0.15 MYA) period (Li et al., 1996). While genus Schizopygopsis originated during middle Pliocene (2.66 MYA), when powerful uplifts occurred in the QTP (3.4- 1.1 MYA) (Fang et al., 1997), its seems to be conceivable that the population of ancestral Schizothorax was divided by this through massive tectonic activities, and responsible for subsequent speciation mechanism.

Rising of the QTP and surrounding areas is a progression of multistep, heterogeneity, exclusively tectonic actions and rigorous elevation which occurred in the late Cenozoic about 8, 3.6, 2.5 and 1.7 MaBP had considerably affected the expansion of the upland. The key cladogenetic actions of the specialized Schizothoracines fishes are very corresponding to the tectonic actions, which reflected that the origin and evolution of the Schizothoracines fishes are closely related with the obvious ecological variations attended to the multistage rising of the QTP and surrounding areas. The evolutionary process and distribution pattern of the specialized Schizothoracine fishes are due to their adaptation to environmental and climatic fluctuations in the plateau (Li, et al., 2001).

The QTP raised during Oligocene and Miocene, the origin and dispersal of Schizothoracine fishes should also have occurred at that time. Some studies showed that two subfamilies of European Cyrinidae, Cyprininae Leciscinae radiated during the late Oligocene and Miocene. So, the origin of Schizothoracinae, which derived from Barbinae should happen during that period. Based on cytb, three genera of the specialized schizothoracine fishes diverged during the late Miocene (about 8 MaBP), and specialization actions occurred mostly after 3.54 MaBP, which revealed that the full height of the QTP would be about 2750-3750 m at that time (Zardoya and Doadrio 1999).

The origin and progression of Schizothoracine were in closely related with significant environmental fluctuations triggered by powerful upheaval of the Plateau (Cao et al.,

137 1981b). In short, the conclusive aspects that give rise to the contemporary distribution design of the extant Schizothoracine were the environment and river system deviations due to uplift of plateau. The tentative divergence time for specialized Schizothoracine fishes occurred during 3.71― 3.59 Ma, (He et al., 2004).

138 CONCLUSIONS

Our work provides first molecular genomic and phylogenetic framework in Pakistan for an important group of Schizothorax species. Our study provides a platform for the investigation of the evolutionary mitogenomics of teleosts. The tools we applied in our studies i.e. population genetics, phylogenetic analysis, sequencing methods and taxonomic sampling may prove decisive in understanding debated relationships among teleosts. Our study showed that the complete mitochondrial genome of Schizothoracine fishes contains the total 37 genes, 13 protein coding gene, 22 tRNAs genes, 2 rRNAs genes and one control region that are most commonly found in fishes and other vertebrate mtDNAs. On the basis of complete genome analysis (phylogenetic trees) we concluded that S. esocinus showed close relationship with S. niger and S. progastus, while S. plagiostomus showed close relationship with S. niger, S. esocinus and S. progastus, whereas S. labiatus showed close relationship with S. plagiostomus, S. progastus and C. carpio. Phylogeographic analysis revealed that Schizothorax esocinus, Schizothorax plagiostomus of Pakistan and Schizothorax labiatus of China shows close Phylogeographic relationship. In conclusion, this data presents the first molecular phylogenetic framework for an important group of Schizothorax species found in Pakistan, Kashmir (India) and China and improves our understanding of the complexity of the relationship between the species. The length variation in D-loop microsatellites of the schizothorax species might be a marker of selection for population genetics in this conventional taxonomically challenging group of fish and could provide insight into the evolution, distribution and cladogenesis of these species with limited fossil records.

139 RECOMMENDATIONS

i. To use this study as baseline and to find the complete mitochondrial genome

of different fish species in Pakistan.

ii. To find the relationships of other fish species in Pakistan. iii. To resolve minor taxonomic anomalies among other genera/species on the

basis of Cytb and Dloop and DNA sequencing. iv. To amplify different bar coding gene in Schizothoracines fishes and other fishes

in Pakistan.

v. Like this study, to find the relationship of other species in Pakistan. vi. We observed that the population of S. esocinus had declined during our

sampling due to illegal hunting, we recommend that, fishery Department

should pay instant attention to stop the decline of these species and advocate

conservation measures, also to protect natural habitat of these species and to

control the illegal capturing, like using of poisonous chemicals.

140 Chapter-6 REFERENCES

Abouheif, E., Zardoya, R. and Meyer, A. (1998) Limitations of metazoan 18S rRNA sequence data: implications for reconstructing a phylogeny of the animal kingdom and inferring the reality of the Cambrian explosion. Journal of Molecular Evolution, 47(4): 394-405.

Ahmad, S. M., Bhat, F. A., Balkhi, M.-u. H. and Bhat, B. A. (2014) Mitochondrial DNA variability to explore the relationship complexity of Schizothoracine (Teleostei: Cyprinidae). Genetica, 142(6): 507-516.

Akhtar, N. ( 1992) Pakistan's cold water fisheries and trout farming sector study: trends, opportunities and challenges. Report for FAO/UNDP Projects PAK/88/048 and PAK/91/008. Rome, FAO. 75.

Ali, S and S (1999) Fishery and fishwater biology. Second edition, Nasim Publisher, Urdu Bazar Karachi, Pakistan.

Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijin, M. H. L., Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, C. D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J. H., Staden, R. and Young, I. G. (1981) Sequence and organization of the human mitochondrial genome. Nature, 290: 457–465.

Apostolidis, A. P., Triantaphyllidis, C., Kouvatsi, A. and Economidis, P. S. (1997) “Mitochondrial DNA sequence variation and phylogeography among Salmo trutta L. (Greek brown trout) populations. Molecular Ecology, 6(6): 531–542.

Avise, J. C. (1994) Molecular Markers, Natural History, and Evolution. . Chapman and Hall, New York.

Avise, J. C. (1998) Pleistocene phylogeographic effects on avian populations and the speciation process. Proceedings of the Royal Society of London B: Biological Sciences, 265(1395): 457-463.

141 Avise, J. C. (2000) Phylogeography: the history and formation of species. Harvard University Press, Cambridge.

Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA and NC, S. (1987) Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. . Annual Review of Ecology and Systematics, 18: 489–522.

Avise, J. C., Arnold, J., Ball, R. M., Bermingham, E., Lamb, T., Neigel, J. E., Reeb, C. A. and Saunders, N. C. (1987) Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Annual Review of Ecology and Systematics: 489-522.

Avise, J. C., Neigel, J. E. and Arnold, J. (1984) Demographic influences on mitochondrial DNA lineage survivorship in animal populations. Journal of Molecular Evolution, 20(2): 99-105.

Avise, J. C. and Saunders, N. C. (1984) Hybridization and introgression among species of sunfish (Lepomis): Analysis by mitochondrial DNA and allozyme markers. Genetics, 108: 237–255.

Badola, S. P. (1979) Ecological studies on the Ichthyofauna of freshwater resources of Garhwal region. D. Phil. Thesis, University oj Garbwal, Srinagar (Garhwal),India.

Baker, A. and Marshall, H. (1997) Mitochondrial control region sequences as tools for understanding evolution. Avian molecular evolution and systematics: 51-82.

Banarescu, P. and Coad, B. W. (1991) Cyprinids of Eurasia. In Cyprinid Fishes. Systematics, Biology and Exploitation. Winfield, I. J. & Nelson, J. S., eds. London: Chapman & Hall.: 127–155.

Beaumont, M. (2004) Recent developments in genetic data analysis: what can they tell us about human demographic history? Heredity, 92(5): 365-379.

142 Beheregaray, L. B. and Caccone, A. (2007) Cryptic biodiversity in a changing world. Journal of Biology, 6(4): 1.

Bensch, S. and Anna, H. (2000) Mitochondrial genomic rearrangements in songbirds. Molecular Biology and Evolution, 17(1): 107-113.

Berendzen, P. B., Simons, A. M. and Wood, R. M. (2005) Phylogeography of the northern hogsucker, Hypentelium nigricans (Teleostei: Cypriniformes): genetic evidence for the existence of the ancient Teays River. Journal of Biogeography, 30: 1139–1152.

Bermingham, E. and Avise, J. C. (1986) Molecular zoogeography of freshwater fishes in the southeastern United States. Genetics, 113(4): 939-965.

Bermingham, E. and Moritz, C. (1998) Comparative phylogeography: concepts and applications. Molecular Ecology, 7(4): 367-369.

Bernatchez, R., Guyomard and Bonhomme, F. (1992) DNA sequence variation of the mitochondrial control region among geographically and morphologically remote European brown trout Salmo trutta populations. Molecular Ecology, 1(3): 161–173.

Bester-van der Merwe, A. E., Roodt-Wilding, R., Volckaert, F. A. and D’Amato, M. E. (2011) Historical isolation and hydrodynamically constrained gene flow in declining populations of the South-African abalone, Haliotis midae. Conservation Genetics, 12(2): 543-555.

Bibb, M. J., Van Etten, R. A., Wright, C. T., Walberg, M. W. and Clayton, D. A. (1981) Sequence and gene organization of mouse mitochondrial DNA. Cell, 26(2): 167- 180.

Boore, J. L. (1999) Animal mitochondrial genomes. Nucleic Acids Research, 27(8): 1767- 1780.

143 Bowen, B. W. and Karl, S. A. (2007) Population genetics and phy‐ logeography of sea turtles. . Molecular Ecology, 16: 4886–4907.

Brookfield, M. E. (1998) The evolution of the great river systems of southern Asia during the Cenozoic India–Asia collision: rivers draining southwards. Geomorphology, 22: 285–312.

Broughton, R. E., Milam, J. E. and Roe, B. A. (2001) The complete sequence of the zebrafish (Danio rerio) mitochondrial genome and evolutionary patterns in vertebrate mitochondrial DNA. Genome Research, 11(11): 1958-1967.

Brown, W. M., George, M. and Wilson, A. C. (1979) Rapid evolution of animal mitochondrial DNA. . Proceedings of the National Academy of Sciences, USA,, 76: 1967–1971.

Burger, G., Gray, M. W. and Lang, B. F. (2003) Mitochondrial genomes: anything goes. TRENDS in Genetics, 19(12): 709-716.

Burridge, C. P. (1999) Molecular Phylogeny ofNemadactylus and Acantholatris (Perciformes: Cirrhitoides: Cheilodactylidae), with implications for taxonomy and bibliography. Mol. Phylogenet. Evol, 13(1): 93-109.

Cao, W., Chen, Y., Wu, Y. and Zhu, S. (1981a) Origin and evolution of Schizothoracine fishes in relation to the upheaval of the QinghaiG Xizang Plateau. Anonym. Studies on the Period, AmpliG tude and Type of the Uplift of the QinghaiGXizang Plateau, 118.

Cao, W. X., Chen, Y. Y., Wu, Y. F. and Zhu, S. Q. (1981b) Origin and evolution of schizothoracine fishes in relation to the upheaval of the Xizang Plateau. Studies on the period, amplitude and type of the uplift of the Qinghai-Xizang Plateau (ed. by

Tibetan Expedition Team of the Chinese Academy of Science). Science Press, Beijing: 118–130 (in Chinese).

144 Chang, Y.-s., Huang, F.-l. and Lo, T.-b. (1994) The complete nucleotide sequence and gene organization of carp (Cyprinus carpio) mitochondrial genome. Journal of Molecular Evolution, 38(2): 138-155.

Chao W, Chen Y, Wu F and Zhu S (1981) Origin and evolution of Schizothoracinae fishes in relation to the uplift of Qingahai Xing Plateau. Proceedings on the Qinagahi Xizang (Tibet) plateau. Geological and ecological studies Sciences press, Beijing, 2: 1053-1060.

Chen, X. L., Yue, P. Q. and Lin, R. D. (1984) Major groups within the family Cyprinidae and their phylogenetic relationships. Acta. Zootaxon. Sinica, 9: 424–440.

Chen Y, Cheng QQ, Qiao HY, Zhu YX, Chen WM and GJ., R. (2013) The complete mitochondrial genome sequence of Schizothorax wangchiachii (Cypriniformes: Cyprinidae). Mitochondrial DNA, 24: 353–355.

Chen, Y., Cheng, Q., Qiao, H., Zhu, Y. and Chen, W. (2013) The complete mitochondrial genome sequence of Rastrelliger kanagurta (Perciformes: Scombridae). Mitochondrial DNA, 24(2): 114-116.

Chen, Y. F. and Cao, W. Y. (2000) Schizothoracinae. Fauna Sinica, Osteichthyes, Cypriniformes III. Science Press, Beijing: 273–335 (in Chinese).

Chen, Z. M. and Chen, Y. F. (2000) Genetic relationships of the specialized Schizothoracinae fishes inferred from random amplified polymorphic DNA analysis. Zool. Res. (In Chinese), 21(4): 262-268.

Cheng, Y., Xu, T., Shi, G. and Wang, R. (2010) Complete mitochondrial genome of the miiuy croaker Miichthys miiuy (Perciformes, Sciaenidae) with phylogenetic consideration. Marine genomics, 3(3): 201-209.

Clark, M. K., Schoenbohm, L. M., Royden, L. H., Whipple, K. X., Burchfiel, B. C., Zhang, X., Tang, W., Wang, E. and Chen, L. (2004) Surface uplift, tectonics, and erosion of eastern Tibet from largescale drainage patterns. Tectonics, 23.

145 Clary, D. O. and Wolstenholme, D. R. (1985) The mitochondrial DNA molecule ofDrosophila yakuba: nucleotide sequence, gene organization, and genetic code. Journal of Molecular Evolution, 22(3): 252-271.

Clayton, D. A. (1982) Replication of animal mitochondrial DNA. Cell, 28: 693–705.

Clayton, D. A. (1991) Replication and transcription of vertebrate mitochondrial DNA. Annual Review of Cell Biology, 7: 453–478.

Coad, B. W. (1995) Freshwater fishes of Iran. Acta. Sc. Nat. Brno, 29(1).

Cruzan, M. B. and Templeton, A. R. (2000) Paleoecology and coalescence: phylogeographic analysis of hypotheses from the fossil record. Trends in Ecology & Evolution, 15(12): 491-496.

Das, S. and Subla, B. (1964a) Ichthyofauna of Kashmir. Part II: The speciation of Kashmir fishes, Ichthyologia, 3: 57-62.

Das, S. M. and Subla, B. A. (1963) The ichthyofauna of Kashmir: part I history, topography, origin, ecology and general distribution. Ichthyologica, 2: 87–106.

Das, S. M. and Subla, B. A. (1964b) The Ichthyofauna of Kashmir, Part II. The speciation of Kashmir fishes. . Ichthyologica, 3: 57-62.

Dawson, A. G. (2013) Ice age earth: late quaternary geology and climate, Routledge.

Day, E. (1958) The Fishes of India: Being a natural history of the fishes Known 10 inhabit the seas and fresh waters of India, Burma and Ceylon. William Dawson and Sons Uti., London, 1: 564.

Day, F. (1878) The Fishes of India (in two volumes). Bernard Quaritch, London.

DeSalle, R. and Amato, G. (2004) The expansion of conservation genetics. Nature Reviews Genetics, 5(9): 702-712.

Desjardins, P. and Morais, R. (1990) Sequence and gene organization of the chicken mitochondrial genome: a novel gene order in higher vertebrates. Journal of Molecular Biology, 212(4): 599-634.

146 Doda, J. N., Wright, C. T. and Clayton, D. A. (1981) Elongation of displacement-loop strands in human and mouse mitochondrial DNA is arrested near specific template sequences. Proceedings of the National Academy of Sciences, 78(10): 6116- 6120.

Dodson, J., Colombani, F. and Ng, P. (1995) Phylogeographic structure in mitochondrial DNA of a South‐east Asian freshwater fish, Hemibagrus nemurus (Siluroidei; Bagridae) and Pleistocene sea‐level changes on the Sunda shelf. Molecular Ecology, 4(3): 331-346.

Domingues, V. S., Faria, C., Stefanni, S., Santos, R. S., Brito, A. and Almada, V. C. (2007) Genetic divergence in the Atlantic–Mediterranean Montagu's blenny, Coryphoblennius galerita (Linnaeus 1758) revealed by molecular and morphological characters. Molecular Ecology, 16(17): 3592-3605.

Donaldson, K. A. and Wilson, R. R. (1999) Amphi-panamic geminates of snook (Percoidei: Centropomidae) provide a calibration of the divergence rate in the mitochondrial DNA control region of fishes. Molecular Phylogenetics and Evolution, 13(1): 208-213.

Donne-Goussé, C., Laudet, V. and Hänni, C. (2002) A molecular phylogeny of anseriformes based on mitochondrial DNA analysis. Molecular Phylogenetics and Evolution, 23(3): 339-356.

Dos Santos, S., Klopper, A., Oosthuizen, C. J. and Bloomer, P. (2008) Isolation and characterization of polymorphic tetranucleotide microsatellite loci in the pelagic perciform fish Pomatomus saltatrix (Linnaeus, 1766) from South Africa. Molecular Ecology Resources, 8(5): 1065-1067.

Durand, J. D., Tsigenopoulos, C. S., Unlu, E. and Berrebi, P. (2002) Phylogeny and biogeography of the family Cyprinidae in the Middle East inferred from cytochrome b DNA: Evolutionary significance of this region. Mol. Phylogenet. Evol.,, 22(1): 91-100.

147 Dyke, A. S. and Prest, V. K. (1987) Late Wisconsinan and Holocene history of the Laurentide ice sheet. Geographie Physique et Quaternaire, 41(2): 237-263.

Emerson, B. (2002) Evolution on oceanic islands: molecular phylogenetic approaches to understanding pattern and process. Molecular Ecology, 11(6): 951-966.

Englbrecht, C., Freyhof, J., Nolte, A., Rassmann, K., Schliewen, U. and Tautz, D. (2000) Phylogeography of the bullhead Cottus gobio (Pisces: Teleostei: Cottidae) suggests a pre‐Pleistocene origin of the major central European populations. Molecular Ecology, 9(6): 709-722.

Fang, X., Li, J., Zhu, J., Chen, H. and Cao, J. (1997) Absolute age determination and division of the Cenozoic stratigraphy in the Linxia Basin, Gansu Province, China. Chinese Science Bulletin (in Chinese), 42(14): 1457-1471.

Felsenstein, J. (2006) Accuracy of coalescent likelihood estimates: do we need more sites, more sequences, or more loci? Molecular Biology and Evolution, 23(3): 691- 700.

Fiaz Khan, M., Nasir Khan Khattak, M., He, D., Liang, Y., Li, C., Ullah Dawar, F. and Chen, Y. (2016) The complete mitochondrial genome organization of Schizothorax Plagiostomus (Teleostei: Cyprinidae) from Northern Pakistan. Mitochondrial DNA Part A, 27(5): 3630-3632.

Foran, D. R., Hixson, J. E. and Brown, W. M. (1988) Comparisons of ape and human sequences that regulate mitochondrial DNA transcription and D-loop DNA synthesis. Nucleic Acids Research, 16(13): 5841-5861.

Frankham, R. (2005) Stressandadaptationinconservationgenetics. . Journal of Evolutionary Biology, 18: 750–755.

Frankham, R., Briscoe, D. A. and Ballou, J. D. (2002) Introduction to conservation genetics, Cambridge University Press.

148 Fraser, D. J. and Bernatchez, L. (2001) Adaptive evolutionary conservation: towards a unified concept for defining conservation units. Molecular Ecology, 10(12): 2741- 2752.

Gadaleta, G., Pepe, G., De, C., Quagliariello, C., Sbisa, E. and Saccone, C. (1998) The complete nucleotide sequence of the Rattus norvegicus mitochondrial genome cryptic signals revealed by comparative analysis between vertebarates. . Journal of Molecular Evolution, 28: 497-516.

Galbusera, P. H., Gillemot, S., Jouk, P., Teske, P. R., Hellemans, B. and Volckaert, F. A. (2007) Isolation of microsatellite markers for the endangered Knysna seahorse Hippocampus capensis and their use in the detection of a genetic bottleneck. Molecular Ecology Notes, 7(4): 638-640.

Ganai, F. A., Yousuf, A. R., Dar, S. A., Tripathi, N. K. and Wani, S. U. (2011) Cytotaxonomic status of schizothoracine fishes of Kashmir Himalaya (Teleostei: Cyprinidae). Caryologia, 64(4): 435-445.

Gharaei, A., A., R. and Ghaffari, M. (2010) Schizothorax zarudnyi as a potential species for aquaculture. Paper presented in the Aqua 2010, Phuket, Thailand,. 119-120.

Gilles, A., Lecointre, G., Faure, E., Chappaz, R. and Brun, G. (1998) Mitochondrial phylogeny of the European cyprinids: Implications for their systematics, reticulate evolution, and colonization time. Mol. Phyl. Evol, 10: 132–143.

Gilles, A., Lecointre, G., Miquelis, A., Chappaz, R. and Brun, G. (2001) Partial combination applied to phylogeney of European Cyprinids using the mitochondrial control region. Mol. Phylogenet. Evol, 19(1): 22-33.

Goel, C., Sahoo, P. K. and Barat, A. (2016) Complete mitochondrial genome organization of Schizothorax plagiostomus (Heckel, 1838). Mitochondrial DNA Part A, 27(1): 113-114.

Govt. of Pakistan (2001) Economic Survey 2000-2001. Islamabad.

149 Gray, M. W., Lang, B. F., Cedergren, R., Golding, G. B., Lemieux, C., Sankoff, D., Turmel, M., Brossard, N., Delage, E., Littlejohn, T. G., Plante, I., Rioux, P., Saint- Louis, D., Zhu, Y. and Burger, G. (1998) Genome structure and gene content in protist mitochondrial DNAs. Nucleic Acids Res, 15(865–878).

Gregory, J. W. (1925) The evolution of the river system of South-eastern Asia. . The Scottish Geographical Magazine: 129–141.

Guo, X., He, S. and Zhang, Y. (2005) Phylogeny and biogeography of Chinese sisorid catfishes re-examined using mitochondrial cytochrome b and 16S rRNA gene sequences. Molecular Phylogenetics and Evolution, 35(344–362).

Hallet, B. and Molnar, P. (2001) Distorted drainage basins as markers of crustal strain east of the Himalayas. Journal of Geophysical Research, 106: 13697–13709.

Hassanin, A., Léger, N. and Deutsch, J. (2005) Evidence for multiple reversals of asymmetric mutational constraints during the evolution of the mitochondrial genome of Metazoa, and consequences for phylogenetic inferences. Systematic Biology, 54(2): 277-298.

He, D. K., Chen, Y. F. and Chen, Y. Y. (2004) Molecular phylogeny of the specialized schizothoracine fi shes (Teleostei: Cyprinidae), with their implications for the uplift of the Qinghai-Tibetan Plateau. . Chin. Sci. Bull, 49: 139– 148.

Heckel, J. J. (1838) Fishe aus Caschmir, gesammelt und herausgegeben von Carl Freiherrn von Hu¨gel, beschrieben von Joh. Jaacob Heckel, Mechita Risten, Vienna. 111-112.

Hewitt, G. (2004) Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 359(1442): 183-195.

Hewitt, G. M. (2001) Speciation, hybrid zones and phylogeography—or seeing genes in space and time. Molecular Ecology, 10(3): 537-549.

150 Hixson, J., Wong, T. and Clayton, D. A. (1986) Both the conserved stem-loop and divergent 5'-flanking sequences are required for initiation at the human mitochondrial origin of light-strand DNA replication. Journal of Biological Chemistry, 261(5): 2384-2390.

Hocutt, C. H. and Wiley, E. O. (1986) The zoogeography of North American freshwater fishes, Wiley.

Hora, S. (1936) On a further collection of fish from the Naga Hills. Rec. Indian Mus, 38(3): 317-331.

Huang, Z., Liu, N., Xiao, Y. a., Cheng, Y., Mei, W., Wen, L., Zhang, L. and Yu, X. (2009) Phylogenetic relationships of four endemic genera of the Phasianidae in China based on mitochondrial DNA control-region genes. Molecular Phylogenetics and Evolution, 53(2): 378-383.

Hurwood, D. A. and Hughes, J. M. (1998) Phylogeography of the freshwater fish, Mogurnda adspersa, in streams of northeastern Queensland, Australia: evidence from altered drainage patterns. Molecular Ecology,, 7: 1507–1517.

Inoue, J. G., Miya, M., Tsukamoto, K. and Nishida, M. (2000) Complete mitochondrial DNA sequence of the Japanese sardine Sardnops melanostictus. Fish. Sci, 66: 924–932.

Irwin, D. E. (2002) Phylogeographic breaks without geographic barriers to gene flow. Evolution, 56(12): 2383-2394.

Irwin, D. M., Kocher, T. D. and Wilson, A. C. (1991) Evolution of the cytochromeb gene of mammals. Journal of Molecular Evolution, 32(2): 128-144.

Jin-Liang, Z., Wei-Wei, W., Si-Fa, L. and Wan-Qi, C. (2006) Structure of the mitochondrial DNA control region of the sinipercine fishes and their phylogenetic relationship. Acta Genetica Sinica, 33(9): 793-799.

151 Johansen, S. and Bakke, I. (1996) The complete mitochondrial DNA sequence of Atlantic cod (Gadus morhua): relevance to taxonomic studies among codfishes. Molecular marine biology and biotechnology, 5(3): 203-214.

Johansen, S., Guddal, P. H. and Johansen, T. (1990) Organization of the mitochondrial genome of Atlantic cod, Gadus morhua. Nucleic Acids Research, 18(3): 411-419.

Jondeung, A., Sangthong, P. and Zardoya, R. (2007) The complete mitochondrial DNA sequence of the Mekong giant catfi sh and the phylogenetic relationships among Siluriformes. Gene, 387: 49– 57.

Knowles, L. L. (2009) Statistical phylogeography. Annual Review of Ecology, Evolution, and Systematics, 40: 593-612.

Knudsen, B., Kohn, A. B., Nahir, B., McFadden, C. S. and Moroz, L. L. (2006) Complete DNA sequence of the mitochondrial genome of the seaslug, Aplysia californica: conservation of the gene order in Euthyneura. Mol. Phylogenet. Evol, 38: 459– 469.

Kohn, L. M. (2005) Mechanisms of fungal speciation. Annu. Rev. Phytopathol., 43: 279- 308.

Krijgsman, W., Hilgen, F., Raffi, I., Sierro, F. and Wilson, D. (1999) Chronology, causes and progression of the Messinian salinity crisis. Nature, 400(6745): 652-655.

Kumar, S. S., Gaur, A. and Shivaji, S. (2011) Phylogenetic studies in Indian scleractinian corals based on mitochondrial cytochrome b gene sequences. Curr. Sci, 101(5): 69-676.

Ladoukakis, E. D. and Zouros, E. (2001a) Direct evidence for homologous recombination in mussel (Mytilus galloprovincialis) mitochondrial DNA. Molecular Biology and Evolution, 18(7): 1168-1175.

152 Ladoukakis, E. D. and Zouros, E. (2001b) Recombination in animal mitochondrial DNA: evidence from published sequences. Molecular Biology and Evolution, 18(11): 2127-2131.

Larizza, A., Pesole, G., Reyes, A., Sbisà, E. and Saccone, C. (2002) Lineage specificity of the evolutionary dynamics of the mtDNA D-loop region in rodents. Journal of Molecular Evolution, 54(2): 145-155.

Lavoue, S., Miya, M., Saitoh, K., Ishiguro, N. B. and Nishida, M. (2007) Phylogenetic relationships among anchovies, sardines, herrings and their relatives (Clupeiformes), inferred from whole mitogenome sequences. Mol. Phylogenet. Evol, 43: 1096–1105.

Lee, W. J., Conroy, J., Howell, W. H. and Kocher, T. D. (1995) Structure and evolution of teleost mitochondrial control regions. . Journal of Molecular Evolution, 41: 54- 66.

Li, C., Chen, Y., Liu, C., Juan, T. and He, D. (2014) The complete mitochondrial genome sequence of Herzensteinia microcephalus (Cypriniformes: Cyprinidae). Mitochondrial DNA: 1-2.

Li, J. and Fang, X. (1999a) Uplift of the Tibetan Plateau and environmental changes. Chinese Science Bulletin, 44(23): 2117-2124.

Li, J., Fang, X., Ma, H., Zhu, J., Pan, B. and Chen, H. (1996) Geomorphological and environmental evolution in the upper reaches of the Yellow River during the late Cenozoic: Science in China, v. 39.

Li, J., Fang, X. and Pan, B. (2001) Late Cenozoic intensive uplift of QinghaiXizang Plateau and its impact on environments in surrounding area. Quat Sci, 5: 381– 391.

Li, J. J. and Fang, X. M. (1999b) Uplift of the Tibetan Plateau and environmental changes. Chinese Science Bulletin, 44: 2117– 2125.

153 Li, Y., Ren, Z., Shedlock, A. M., Wu, J., Sang, L., Tersing, T., Hasegawa, M., Yonezawa, T. and Zhong, Y. (2013) High altitude adaptation of the schizothoracine fishes (Cyprinidae) revealed by the mitochondrial genome analyses. Gene, 517(2): 169-178.

Lin, G., Lo, L. C., Zhu, Z. Y., Feng, F., Chou, R. and Yue, G. H. (2006) The complete mitochondrial genome sequence and characterization of single-nucleotide polymorphisms in the control region of the Asian seabass (Lates calcarifer). . Marine Biotechnology, 8(1): 71 –79.

Liu, H. and Su, T. (1962) Pliocene fishes from Yushe basin, Shansi. Vertebrata PalAsiatica, 6: 1-47.

Liu, H., Tzeng, C.-S. and Teng, H.-Y. (2002) Sequence variations in the mitochondrial DNA control region and their implications for the phylogeny of the Cypriniformes. Canadian Journal of Zoology, 80(3): 569-581.

Liu, Y., Li, Q., Gong, Q., Li, H. and Du, J. (2014) The complete mitochondrial genome of Rhinogobio ventralis (Teleostei, Cyprinidae, Gobioninae). Mitochondrial DNA: DOI: 10.3109/19401736.19402013.19836519.

Liu, Y., Li, Q., Gong, Q., Li, H. and Du, J. (2015) The complete mitochondrial genome of Rhinogobio ventralis (Teleostei, Cyprinidae, Gobioninae). Mitochondrial DNA, 26(4): 651-652.

Lovejoy, N. and De Araujo, M. (2000) Molecular systematics, biogeography and population structure of Neotropical freshwater needlefishes of the genus Potamorrhaphis. Molecular Ecology, 9(3): 259-268.

Lowe, T. M. and Eddy, S. R. (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research, 25(5): 955- 964.

154 Lydeard, C., Wooten, M. C. and Meyer, A. (1995) Molecules, morphology, and area cladograms: a cladistic and biogeographic analysis of Gambusia (Teleostei: Poeciliidae). Systematic Biology, 44(2): 221-236.

Lynch, M. (1997a) Mutation accumulation in nuclear, organelle, and prokaryotic genomes: Transfer RNA genes. Mol. Biol. Evol, 14(914–925).

Lynch, M. (1997b) Mutation accumulation in nuclear, organelle, and prokaryotic transfer RNA genes. Molecular Biology and Evolution, 14(9): 914-925.

Martinson, D. G., Pisias, N. G., Hays, J. D., Imbrie, J., Moore, T. C. and Shackleton, N. J. (1987) Age dating and the orbital theory of the ice ages: development of a high-resolution 0 to 300,000-year chronostratigraphy. Quaternary Research, 27(1): 1-29.

McAllister, D. E., Platania, S., Schueler, F., Baldwin, M. and Lee, D. (1986) Ichthyofaunal patterns on a geographic grid. The zoogeography of North American freshwater fishes: 17-51.

McMillan, W. O. and Palumbi, S. R. (1997) Rapid rate of control-region evolution in Pacific butterflyfishes (Chaetodontidae). Journal of Molecular Evolution, 45(5): 473-484.

McPhail, J. D. and Lindsey, C. C. (1970) Freshwater fishes of northwestern Canada and Alaska, Fisheries Research Board of Canada Bulletin 173, Ottawa.

McVeigh, H. P. and Davidson, W. S. (1991) A Salmonid phylogeny inferred from mitochondrial cytochrome b gene sequences. J. Fish Biol, 39: 277-282.

Merilä, J., Björklund, M. and Baker, A. J. (1997) Historical demography and present day population structure of the greenfinch, Carduelis chloris-an analysis of mtDNA control-region sequences. Evolution: 946-956.

Meyer, A. (1993) Evolution of mitochondrial DNA in fishes. Biochemistry and molecular biology of fishes, 2: 1-38.

155 Miller, S., Dykes, D. and Polesky, H. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research, 16(3): 1215.

Mindell, D. P., Sorenson, M. D. and Dimcheff, D. E. (1998) Multiple independent origins of mitochondrial gene order in birds. Proceedings of the National Academy of Sciences, 95(18): 10693-10697.

Mirza, M. (1991) A contribution to the systematics of the Schizothoracine fishes (Pisces: Cyprinidae) with the description of three new tribes. Pakistan Journal of Zoology.

Mirza, M. and Bhatti, M. N. (1999) Biodiversity of the freshwater fishes of Pakistan and Azad Kashmir. Proc. Sem.

Mirza, M. and Saeed, T. (1988) A note on the systematics of the genus Schizothorax Heckel, 1938 (Pisces: Cyprinidae). Pakistan Journal of Zoology.

Mirza M.R. (1991) A contribution to the systematics of the Schizothoracine fishes (Pisces: Cyprinidae) with the description of three new tribes. Pakistan J. Zool, 23: 339-341.

Mirza, M. R. (1975) Freshwater fihes and zoogeography of Pakistan. Bijdragen tot de Dierknnde, 45: 143-180.

Mirza, M. R. (1994) Geographical distribution of freshwater fihes in Pakistan: a review. Punjab Univ. J. Zool, 9(93-108).

Miya, M. and Nishida, M. (1999) Organization of the mitochondrial genome of a deep- sea fish, Gonostoma gracile (Teleostei: Stomiiformes): first example of transfer RNA gene rearrangements in bony fishes. Mar. Biotechnol, 1: 416–426.

Montoya-Burgos, J. I. (2003) Historical biogeography of the catfish genus Hypostomus (Siluriformes: Loricariidae), with implications on the diversification of Neotropical ichthyofauna. Molecular Ecology,, 12: 1855–1867.

156 Morin, P. A., Archer, F. I., Foote, A. D., Vilstrup, J., Allen, E. E., Wade, P., Durban, J., Parsons, K., Pitman, R., Li, L., Bouffard, P., Abel Nielsen, S. C., Rasmussen, M., Willerslev, E., Gilbert, M. T. and Harkins, T. (2010) Complete mitochondrial genome phylogeographic analysis of killer whales (Orcinus orca) indicates multiple species. Genome Res, 20: 908–916.

Moritz, C., Patton, J., Schneider, C. and Smith, T. (2000) Diversification of rainforest faunas: an integrated molecular approach. Annual Review of Ecology and Systematics: 533-563.

Murphy, W. J. and Collier, G. E. (1996) Phylogenetic relationships within the aplocheiloid fish genus Rivulus (Cyprinodontiformes, Rivulidae): implications for Caribbean and Central American biogeography. Molecular Biology and Evolution, 13(5): 642-649.

Myers N, Mittermeier R.A, Mittermeier C.G, da Fonseca GAB and Kent, J. (2000) Biodiversity hotspots for conservation priorities. Nature 403: 853–858.

Nelson, J. S. (2006) Fishes of the World, fourth ed. Wiley, New York. 601.

Nesnidal, M. P., Helmkampf, M., Bruchhaus, I. and Hausdorf, B. (2011) The complete mitochondrial genome of Flustra foliacea (Ectoprocta, Cheilostomata)- compositional bias affects phylogenetic analyses of lophotrochozoan relationships. BMC genomics, 12(1): 1.

Nyman, L. and Swedmar, G. (1999) River Jhelum, Kashmir Valley: impacts on the aquatic environment.

Oh, D.-J., Kim, J.-Y., Lee, J.-A., Yoon, W.-J., Park, S.-Y. and Jung, Y.-H. (2007) Complete mitochondrial genome of the rock bream Oplegnathus fasciatus (Perciformes, Oplegnathidae) with phylogenetic considerations. Gene, 392(1): 174-180.

Ojala, D., Montoya, J. and Attardi, G. (1981) tRNA punctuation model of RNA processing in human mitochondria. . Nature, 290: 470–474.

157 Pavlova, A., Zink, R. M. and Rohwer, S. (2005) Evolutionary history, population genetics, and gene flow in the common rosefinch (Carpodacus erythrinus). Molecular Phylogenetics and Evolution, 36(3): 669-681.

Perdices, A., Cunha, C. and Coelho, M. (2004) Phylogenetic structure of Zacco platypus (Teleostei, Cyprinidae) population on upper and middle Chang Jiang (Yangtze) drainage inferred from cytochrome b sequence. Mol. Phylogenet. Evol, 31(1): 192-203.

Perna, N. T. and Kocher, T. D. (1995) Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. Journal of Molecular Evolution, 41(3): 353-358.

Pielou, E. C. (2008) After the ice age: the return of life to glaciated North America, University of Chicago Press.

Ponce, M., Infante, C., Jiménez-Cantizano, R. M., Pérez, L. and Manchado, M. (2008) Complete mitochondrial genome of the blackspot seabream, Pagellus bogaraveo (Perciformes: Sparidae), with high levels of length heteroplasmy in the WANCY region. . Gene, 409: 44–52.

Posada, D. and Crandall, K. A. (1998) Modeltest: testing the model of DNA substitution. Bioinformatics, 14(9): 817-818.

Prior, K. A., Gibbs, H. L. and Weatherhead, P. J. (1997) Population genetic structure in the black rat snake: implication for management. Conserv. Biol., 11: 1147– 1158.

Qi, D., Guo, S., Tang, J., Zhao, X. and Liu, J. (2007) Mitochondrial DNA phylogeny of two morphologically enigmatic fishes in the subfamily Schizothoracinae (Teleostei: Cyprinidae) in the Qinghai-Tibetan Plateau. Journal of Fish Biology, 70: 60–74.

158 Qi, D. L. (2012) Convergent parallel and correlated evolution of trophic morphologies in the subfamily Schizothoracinae from the Qinghai-Tibetan Plateau. . PLoS One, 7: 34070.

Qiao, H., Cheng, Q., Chen, Y., Chen, W. and Zhu, Y. (2013) The complete mitochondrial genome sequence of Coilia ectenes (Clupeiformes: Engraulidae). Mitochondrial DNA, 24(2): 123-125.

Raina, H., Petr, T. and Petr, T. (1999) Coldwater fish and fisheries in the Indian Himalayas: lakes and reservoirs. Fish and fisheries at higher altitudes: Asia: 64-88.

Rambaut, A. and Charleston, M. (2001) TreeEdit: Phylogenetic tree editor version 1. UK: University of Oxford.

Randi, E. and Lucchini, V. (1998) Organization and evolution of the mitochondrial DNA control region in the avian genus Alectoris. Journal of Molecular Evolution, 47(4): 449-462.

Rankin-Baransky, K., Williams, C. J., Bass, A. L., Bowen, B. W. and Spotila, J. R. (2001) Origin of loggerhead turtles stranded in the northeastern United States as determined by mitochondrial DNA analysis. Journal of Herpetology: 638-646.

Richter, S. C., Crother, B. I. and Broughton, R. E. (2009) Genetic consequences of population reduction and geographic isolation in the critically endangered frog, Rana sevosa. Copeia, 2009(4): 799-806.

Rocha-Olivares, A., Kimbrell, C. A., Eitner, B. J. and Vetter, R. D. (1999) Evolution of a Mitochondrial CytochromebGene Sequence in the Species-Rich GenusSebastes (Teleostei, Scorpaenidae) and Its Utility in Testing the Monophyly of the SubgenusSebastomus. Molecular Phylogenetics and Evolution, 11(3): 426-440.

Roe, B. A., Ma, D.-P., Wilson, R. and Wong, J. (1985) The complete nucleotide sequence of the Xenopus laevis mitochondrial genome. Journal of Biological Chemistry, 260(17): 9759-9774.

159 Ronquist, F. and Huelsenbeck, J. P. (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19: 1572–1574.

Ronquist, F. and Sanmartin, I. (2011) Phylogenetic methods in biogeography. Annual Reviews of Ecology and Sys‐ tematics, 42: 441–464.

Rozas, J., Sanchez-DelBarrio, J. C., Messeeguer, X. and Rozas, R. (2003) DnaSP, DNA polymorphism analysis by the coalescent and other methods. Bioinformatics, 19: 2496-2497.

Saccone, C., Attimonelli, M. and Sbisa, E. (1987) Structural elements highly preserved during the evolution of the D-loop-containing region in vertebrate mitochondrial DNA. Journal of Molecular Evolution, 26(3): 205-211.

Saccone, C., Pesole, G. and Sbis E. (1991) The main regulatory region of mammalian mitochondrial DNA: structure-function model and evolutionary pattern. J. Mol. Evol, 33: 83-91.

Saitoh, K., Sado, T., Mayden, R., Hanzawa, N., Nakamura, K., Nishida, M. and Miya, M. (2006) Mitogenomic evolution and interrelationships of the Cypriniformes (Actinopterygii: Ostariophysi): The first evidence toward resolution of higher- level relationships of the world’s largest freshwater fish clade based on 59 whole mitogenome sequences. Journal of Molecular Evolution, 63(6): 826-841.

Saxena, D. and Koul, B. (1966) Fish and fisheries of Jammu and Kashmir State. Part I. Fisheries resources and problems. Ichthyologica, 5: 45-52.

Sbisà, E., Tanzariello, F., Reyes, A., Pesole, G. and Saccone, C. (1997) Mammalian mitochondrial D-loop region structural analysis: identification of new conserved sequences and their functional and evolutionary implications. Gene, 205(1): 125-140.

Shackleton, N. (1987) Oxygen isotopes, ice volume and sea level. Quaternary Science Reviews, 6(3): 183-190.

160 Shadel, G. S. and Clayton, D. A. (1997a) Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 66, 66(409–435).

Shadel, G. S. and Clayton, D. A. (1997b) Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem, 66: 409–435.

Shi, G., Jin, X., Zhao, S., Xu, T. and Wang, R. (2012) Complete mitochondrial genome of Trypauchen vagina (Perciformes, Gobioidei). Mitochondrial DNA, 23(2): 151- 153.

Shinde, S., Pathan, T., Bhandare, R. and Sonawane, D. (2009) Ichthyofaunal Diversity of Harsool Savangi Dam, District Aurangabad,(MS) India. World J. Fish and Marine Sci, 1(13): 141-143.

Silas, E. G. (1960) Fishes from the Kashmir valley. Journal of Bombay Natural History Society, 57(1): 66-77.

Soltis, D. E., Morris, A. B., McLachlan, J. S., Manos, P. S. and Soltis, P. S. (2006) Comparative phylogeography of unglaciated eastern North America. Molecular Ecology, 15(14): 4261-4293.

Song, N., Zhang, X.-M. and Gao, T.-x. (2010) Genetic diversity and population structure of spottedtail goby (Synechogobius ommaturus) based on AFLP analysis. Biochemical systematics and ecology, 38(6): 1089-1095.

Sullivan, J., Holsinger, K. E. and Simon, C. (1995) Among-site rate variation and phylogenetic analysis of 12S rRNA in sigmodontine rodents. Molecular Biology and Evolution, 12(6): 988-1001.

Taberlet, P., Fumagalli, L., Wust‐saucy, A. G. and Cosson, J. F. (1998) Comparative phylogeography and postglacial colonization routes in Europe. Molecular Ecology, 7(4): 453-464.

Talwar, P. K. and Jhingran, A. G. (1991a) Inland fishes of India and adjacent countries, CRC Press.

161 Talwar, P. K. and Jhingran, A. G. (1991b) Inland fishes of India and adjacent countries. . Oxford and IBH Publishing, New Delhi.

Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. (2013a) MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution: mst197.

Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. (2013b) MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30(12): 2725-2729.

Templeton, A. R. (2005) Haplotype trees and modern human origins. American Journal of physical anthropology, 128(S41): 33-59.

Teske, P. R., Barker, N. P. and McQuaid, C. D. (2007) Lack of genetic differentiation among four sympatric southeast African intertidal limpets (Siphonariidae): phenotypic plasticity in a single species? Journal of Molluscan Studies, 73(3): 223- 228.

Teske, P. R., Cowley, P. D., Forget, F. R. and Beheregaray, L. B. (2009) Microsatellite markers for the roman, Chrysoblephus laticeps (Teleostei: Sparidae), an overexploited seabream from South Africa. Molecular Ecology Resources, 9(4): 1162-1164.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G. (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25(24): 4876- 4882.

Tilak, R. (1987) Fauna of India: Pisces: Schizothoracinae. Zoological Survey of India, Calcutta.

Torroni, A., Achilli, A., Macaulay, V., Richards, M. and Bandelt, H.-J. (2006) Harvesting the fruit of the human mtDNA tree. TRENDS in Genetics, 22(6): 339- 345.

162 Tsigenopoulos, C. S. and P, B. (2000) Molecular phylogeny of North Mediterranean freshwater barbs genus Barbus: Cyprinidae) inferred from cytochrome b sequences: biogeographic and systematic implications. . Mol Phylogenet Evol, 14: 165–179.

Tzeng, C.-S., Hui, C.-F., Shen, S.-C. and Huang, P. (1992) The complete nucleotide sequence of the Crossostoma lacustre mitochondrial genome: conservation and variations among vertebrates. Nucleic Acids Research, 20(18): 4853-4858.

Van de Peer, Y. and De Wachter, R. (1997) Evolutionary relationships among the eukaryotic crown taxa taking into account site-to-site rate variation in 18S rRNA. Journal of Molecular Evolution, 45(6): 619-630. von der Heyden, S., Prochazka, K. and Bowie, R. C. (2008) Significant population structure and asymmetric gene flow patterns amidst expanding populations of Clinus cottoides (Perciformes, Clinidae): application of molecular data to marine conservation planning in South Africa. Molecular Ecology, 17(22): 4812- 4826.

Wang, X., Wang, J., He, S. and Mayden, R. L. (2007) The complete mitochondrial genome of the Chinese hook snout carp Opsariichthys bidens (Actinopterygii: Cypriniformes) and an alternative pattern of mitogenomic evolution in vertebrate. Gene, 399(1): 11-19.

Whitehead, A., Anderson, S. L., Kuivila, K. M., L Roach, J. and May, B. (2003) Genetic variation among interconnected populations of Catostomus occidentalis: implications for distinguishing impacts of contaminants from biogeographical structuring. Molecular Ecology, 12(10): 2817-2833.

Wilson, A. C., Cann, R. L., Carr, S. M., George, M., Gyllensten, U. B., HELM‐ BYCHOWSKI, K. M., Higuchi, R. G., Palumbi, S. R., Prager, E. M. and Sage, R. D. (1985) Mitochondrial DNA and two perspectives on evolutionary genetics. Biological Journal of the Linnean Society, 26(4): 375-400.

163 Wu, X. W. (1964) The Fauna of Chinese Cyprinidea in China, Shanghai. Shanghai Science and Technology Press.

Wu, Y. and Wu, C. (1992) The fishes of the Qinghai-Xizang plateau, Sichuan Publishing House of Science & Technology.

Wu, Y. F. and Chen, Y. Y. ( 1980) Fossil cyprinid fishes from the late Tertiary of north Xizang (in Chinese). China Vertebrata PalAsiatica, 13: 15–20.

Wu, Y. F. and Tan, Q. J. (1991) Characteristics of the fish-fauna of Qinghai- Xizang Plateau and its geographical distribution and formation. Acta Zool. Sin., (in Chinese), 37(2): 135-151.

Xia, J., Xia, K., Gong, J. and Jiang, S. (2007) Complete mitochondrial DNA sequence, gene organization and genetic variation of control regions in Parargyrops edita. Fisheries science, 73(5): 1042-1049.

Xia, X. (1996) Maximizing transcription efficiency causes codon usage bias. Genetics, 144(3): 1309-1320.

Xiao, W., Zhang, Y. and Liu, H. (2001a) Molecular systematics of Xenocyprinae (Teleostei: Cyprinidae): Taxonomy, bibliography, and coevolution of a special group restricted in East Asia. Mol. Phylogenet. Evol., 18(2): 163-173.

Xiao, W., Zhang, Y. and Liu, H. (2001b) Molecular systematics of Xenocyprinae (Teleostei: Cyprinidae): taxonomy, biogeography, and coevolution of a special group restricted in East Asia. Molecular Phylogenetics and Evolution, 18(163–173).

Xiao, Y., Song, N., Li, J., Xiao, Z. and Gao, T. (2015) Significant population genetic structure detected in the small yellow croaker Larimichthys polyactis inferred from mitochondrial control region. Mitochondrial DNA, 26(3): 409-419.

Yan, S.-x., Xiong, M.-h., Zhu, B., Tian, H., Liao, X.-l. and Shao, K. (2016) The complete mitochondrial genome of Rhinogobio typus (Teleostei, Cyprinidae, Gobioninae). Mitochondrial DNA Part A, 27(1): 698-699.

164 Yue, P. Q. and Chen, Y. Y. (1998a) China red book of endangered animals, Pisces. Science Press, Beijing.

Yue, P. Q. and Chen, Y. Y. ( 1998b) China Red Book of Endangered Animals, Pisces. Beijing: Science Press.

Yun-fei, W. and Yi-yu, C. (1980) Fossil cyprinid fishes from the late Tertiary of North Xizang, China. Certebrata Palasiatica, 1: 002.

Zardoya, R., Garrido-Pertierra, A. and Bautista, J. M. (1995) The complete nucleotide sequence of the mitochondrial DNA genome of the rainbow trout, Oncorhynchus mykiss. J. Mol. Evol, 41: 942–951w.

Zardoya, R. and Meyer, A. (1996) Phylogenetic performance of mitochondrial protein- coding genes in resolving relationships among vertebrates. Molecular Biology and Evolution, 13(7): 933-942.

Zardoya, R. and Meyer, A. (1998) Complete mitochondrial genome suggests diapsid affinities of turtles. Proceedings of the National Academy of Sciences, 95(24): 14226- 14231.

Zhiming (1987) Lake retreat in the Qinghai- Xizang plateau with reference to its climate significance. Chinese Journal of Oceanography and limnology, 5: 251-262.

Zhong, L., Song, C., Wang, M., Chen, Y., Qin, Q., Pan, J. and Chen, X. (2013) Genetic diversity and population structure of yellow catfish Pelteobagrus fulvidraco from five lakes in the middle and lower reaches of the Yangtze River, China, based on mitochondrial DNA control region. Mitochondrial DNA, 24(5): 552- 558.

Zhou, J. (1990) The Cyprinidae fossils from middle Miocene of Shanwang. Vert Palasiat, 28: 95–127.

165 Zardoya, R. and Doadrio, I. (1999) Molecular evidence on the evolutionary and biogeographical patterns of European cyprinids. J. Mol. Evol, 49: 227–223.

Zheng, D. (1996) The system of physico-geographical regions of the Qinghai-Tibet (Xizang) Plateau. Science in China, 39: 410–417.

Zhiming (1987) Lake retreat in the Qinghai- Xizang plateau with reference to its climate significance. Chinese Journal of Oceanography and limnology, 5: 251-262.

Zhou, J. (1990) The Cyprinidae fossils from middle Miocene of Shanwang. Vert Palasiat, 28: 95–127.

Zhu, X., Kang, A., Han, D., Wang, Y. and Kang, Q. (2003) Relation among Quaternary environmental evolution, tectonic deformation in the Qaidam Basin and uplifting of the Qinghai–Tibet Plateau. Chinese Journal of Geology, 38(3): 367-376.

166 APPENDICES

Appendix i: Best model test of Cytb.

The JModeltest 2.1 was used to find the best model for Cytb data. The best fit model was designated by the Akaike Information Criterion (AIC) method. The results showed that TrN+I model is best for Cytb data.

Model InL K AIC delta weight cum Weight uDelta TrN+I 1623.471 46 3338.9421 0 0.1844 0.1844 84.7773 TrN+G 1623.9417 46 3339.8834 0.9414 0.1152 0.2996 85.7187 TrN 1625.1168 45 3340.2335 1.2915 0.0967 0.3963 86.0688 TrN+I+G 1625.4676 47 3340.9352 1.9931 0.0681 0.4644 86.7704 TIM2+I 1623.471 47 3340.942 2 0.0678 0.5322 86.7773 TIM3+I 1623.4711 47 33340.9422 2.002 0.0678 0.6 86.7775 TIM1+I 1623.4717 47 3340.9434 2.0014 0.0678 0.6678 86.7787 TIM1+G 1623.9417 47 3341.8834 2.9414 0.0424 0.7102 87.7187 TIM2+G 1623.9417 47 3341.8834 2.9414 0.0424 0.7526 87.7187 TIM3+G 1623.9417 47 3341.8834 2.9414 0.0424 9.7949 87.7187 TIM1 1625.4657 46 3342.2314 3.2894 0.0356 0.8306 88.0667 TIM2 1625.4658 46 3342.2316 3.2895 0.0356 0.8662 88.0688 TIM3 1625.1168 46 3342.2335 3.2915 0.0356 0.9017 88.0688 TIM2+I+G 1623.4676 48 3342.9352 3.9931 0.025 0.9268 88.7704 TIM1+I+G 1623.4722 48 3342.9444 4.0023 0.0249 0.9517 88.7796 TIM3+I+G 1623.4722 48 3342.9444 4.0023 0.0249 0.9766 88.7796 GTR+I 1623.4711 48 3342.2314 6.0002 0.0092 0.9858 90.7775 GTR+G 1623.9417 49 3354.8834 6.9414 0.0057 0.9915 91.7187 GTR 1625.1168 48 3342.2325 7.2915 0.00048 0.9964 92.0688 GTR+I+G 1623.4722 50 3346.9444 8.0023 0.0034 0.9997 92.7796 HKY+I 1632.3183 45 3354.6366 15.6946 7.21E-05 0.9998 100.4719 HKY+I+G 1632.3059 46 3356.6118 17.6698 2.68E-05 0.9998 102.4471 TPM1uf+I 1632.3184 46 3356.6368 17.6648 2.65E-05 0.9999 102.4471 TPM2uf+I 1632.3184 46 3356.6368 17.6648 2.65E-05 0.9999 102.4471 TPM3uf+I 1632.3184 46 3356.6368 17.6648 2.65E-05 0.9999 102.4471 HKY+G 1635.8135 45 3357.627 18.685 2.62E-05 0.999 103.4623 HKY 1635.1471 44 3358.2941 19.3521 1.16E-05 0.999 104.1294 TPM1uf+I+G 1632.3061 47 3358.6121 19.6701 9.87E-06 0.999 104.4474 TPM3uf+I+G 1632.3061 47 3358.6121 19.6701 9.87E-06 1 104.4474 TPM2uf+I+G 1632.3061 47 3358.6123 19.6702 9.87E-06 1 104.4475 TPM1uf+G 1633.8135 46 3359.627 20.685 5.94E-06 1 105.4623 TPM2uf+G 1633.8135 46 3359.627 20.685 5.94E-06 1 105.4623

167 TPM3uf+G 1633.8135 46 3359.627 20.685 5.94E-06 1 105.4623 TPM1uf 1635.1471 45 3360.2941 21.3521 4.26E-06 1 106.1294 TPM3uf 1635.1471 45 3360.2941 21.3521 4.26E-06 1 106.1294 TPM2uf 1635.1494 45 3360.2988 21.3567 4.25E-06 1 106.134 TVM+I 1632.3183 48 3360.6366 21.6946 3.59E-06 1 106.4719 TVM+I+G 1632.3071 49 3362.6143 23.6722 1.33E-06 1 108.4495 TVM+G 1633.8135 48 3363.627 24.685 8.04E-07 1 109.4623 TVM 1635.1494 47 3364.2987 25.3567 5.75E-07 1 110.134 F81+I 1643.6285 44 3375.2571 36.315 2.40E-09 1 121.0923 TrNef+I 1644.6553 43 3375.3106 36.3686 2.34E-09 1 121.1459 TrNef+G 1645.1981 43 3376.3962 37.4542 1.36E-09 1 122.2315 TrNef 1646.3949 42 3376.7897 37.8477 1.12E-09 1 122.625 F81+I+G 1646.3949 42 3376.7897 37.8477 1.12E-09 1 122.625 TIM1ef+I 1644.6553 44 3377.3107 38.3686 8.59E-10 1 123.1459 TIM2ef+I 1644.6553 44 3377.3107 38.3686 8.59E-10 1 123.1459 TIM3ef+I 1644.6553 44 3377.3107 38.3686 8.59E-10 1 123.1459 F81+G 1644.7624 44 3377.5249 38.5828 7.72E-10 1 123.3601 F81 1646.0573 43 3378.1146 39.1725 5.75E-10 1 123.9498 TIM1ef+G 1645.1983 44 3378.3966 39.4546 4.99E-10 1 124.2319 TIM2ef+G 1645.1983 44 3378.3966 39.4546 4.99E-10 1 124.2319 TIM3ef 1646.3951 43 3378.7901 39.8481 4.10E-10 1 124.6254 TIM1ef 1646.3952 43 3378.7903 39.8483 4.10E-10 1 124.6256 TIM2ef 1646.3952 43 3378.7903 39.8483 4.10E-10 1 124.6256 TIM2ef 1646.4003 43 3378.8006 39.8586 4.08E-10 1 124.6359 TIM1ef+I+G 1644.6631 45 3379.3261 40.3841 3.14E-10 1 125.1614 TIM2ef+I+G 1644.6638 45 3379.3275 40.3855 3.13E-10 1 125.1628 TIM3ef+I+G 1644.6638 45 3379.3275 40.3855 3.13E-10 1 125.1628 SYM+I 1644.6553 46 3381.3106 42.3685 1.16E-10 1 127.1458 SYM+G 1645.1983 46 3382.3966 43.4546 6.76E-11 1 128.2319 SYM 1646.3951 45 3382.7902 43.8482 5.55E-11 1 128.6255 SYM+I+G 1646.3951 45 3382.7902 43.8482 5.55E-11 1 128.6255 SYM+I+G 1644.6638 47 3383.3275 44.3855 4.24E-11 1 129.1628 K80+I 1652.1589 42 3388.3179 49.3758 3.50E-12 1 134.1531 TPM1+I 1652.159 43 3390.3179 51.3759 1.29E-12 1 136.1532 TPM2+I 1652.159 43 3390.3179 51.3759 1.29E-12 1 136.1532 TPM3+I 1652.159 43 3390.3179 51.3759 1.29E-12 1 136.1532 TPM3+I 1652.159 43 3390.3179 51.3759 1.29E-12 1 136.1532 TPM3+I 1652.159 43 3390.3179 51.3759 1.29E-12 1 136.1532 K80+I+G 1652.1595 43 3390.3189 51.3769 1.29E-12 1 136.1542 K80+G 1653.3822 42 3390.7643 51.8223 1.03E-12 1 136.5996 K80 1654.6901 41 3391.3802 52.4381 7.57E-13 1 137.2154

168 TPM1+I+G 1652.1589 44 3392.3178 53.3758 4.74E-13 1 138.1531 TPM3+I+G 1652.1589 44 3392.3178 53.3758 4.74E-13 1 138.1531 TPM2+I+G 1652.1592 44 3392.3185 53.3764 4.73E-13 1 138.1537 TPM1+G 1653.3822 43 3392.7643 53.8223 3.79E-13 1 138.5996 TPM2+G 1653.3822 43 3392.7643 53.8223 3.79E-13 1 138.5996 TPM3+G 1653.3822 43 3392.7643 53.8223 3.79E-13 1 138.5996 TPM1 1654.6876 42 3393.3752 54.4331 2.79E-13 1 139.2104 TPM2 1654.6876 42 3393.3752 54.4331 2.79E-13 1 139.2104 TPM3 1654.6876 42 3393.3752 54.4331 2.79E-13 1 139.2104 TVMef+I 1652.1589 45 3394.3178 55.3758 1.74E-13 1 140.1531 TVMef+I+G 1652.1588 46 3396.3175 57.3755 6.41E-14 1 142.1528 TVMef+G 1653.3822 45 3396.7643 57.8223 5.13E-14 1 142.5996 TVMef 1654.6876 44 3397.3751 58.4331 3.78E-14 1 143.2104 JC+I 1663.1447 41 3408.2894 69.3474 1.61E-16 1 154.1247 JC+I+G 1663.1432 42 3410.2864 71.3444 5.94E-17 1 156.1217 JC+G 1664.368 41 3410.7359 71.7939 4.74E-17 1 156.5712 JC 1665.6734 40 3411.3468 72.4047 3.49E-17 1 157.182

-lnL: negative log likelihod K: number of estimated parameters AIC: Akaike Information Criterion delta: AIC difference weight: AIC weight cumWeight: cumulative AIC weight

Model selected:

Model = TrN+I partition = 010020 -lnL = 1623.4710 K = 46 freqA = 0.2657 freqC = 0.2763 freqG = 0.1711 freqT = 0.2869 R(a) [AC] = 1.0000 R(b) [AG] = 65323.4272 R(c) [AT] = 1.0000 R(d) [CG] = 1.0000 R(e) [CT] = 1.0000 R(f) [GT] = 1.0000

169

Appendix ii: Best model test of Dloop.

The JModeltest 2.1 was used to find the best model for Dloop data. The best fit model was designated by the Akaike Information Criterion (AIC) method. The results showed that (HKY+I) model is best for Dloop data. Model InL K AIC delta weight cum Weight HKY+I 1454.1612 43 2994.3224 0 0.1457 0.1457 TPM3uf+I 1453.1929 44 2994.3858 0.0633 0.1411 0.2868 TPM1uf+I 1453.3935 44 2994.7869 0.4645 0.1155 0.4023 HKY+I+G 1453.8475 44 2995.735 1.4126 0.0719 0.4742 TPM3uf+I+G 1452.9 45 2995.8001 1.4777 0.0696 0.5438 TrN+I 14534.0606 44 2996.1213 1.7989 0.0593 0.306 TIM3+I 1453.0898 45 2996.1796 1.8572 0.0576 0.6606 TPM1uf+I+G 1453.0956 45 2996.1913 1.8688 0.0572 0.7178 TIM1+I 1453.2885 45 2996.5769 2.2545 0.0472 0.765 TPM2uf+I+G 1453.515 45 2997.03 2.7075 0.0326 0.8352 TrN+I+G 1453.6096 45 2997.3192 2.9968 0.0326 0.8352 TIM3+I +G 1452.6939 46 2997.3878 3.0654 0.0315 0.8667 TIM2+I 1453.6999 45 2997.3999 3.0775 0.0313 0.8979 TVM+I 1452.8274 46 2997.6548 3.3324 0.0275 0.9255 TIM1+I+G 1452.8844 46 2997.7689 3.4465 0.026 0.9515 TIM2+I+G 1452.3151 46 2998.6301 4.3077 0.0169 0.9684 TVM+I+G 1452.5457 47 2999.0934 4.771 0.0134 0.9818 GTR+I 1452.7302 47 2999.4603 5.1379 0.0112 0.9929 GTR+I+I 1452.3625 48 3000.7249 6.4025 0.0059 0.9995 TPM2uf+I+G 1458.5477 44 3005.0955 10.773 0.0007 0.9996 TPM3uf+G 1460.7251 44 3009.4502 15.1278 7.56E-05 0.9996 HKY+G 1461.7358 43 3009.4716 15.1492 7.48E-05 0.9997 TPM1uf+G 1460.9261 44 3009.8523 15.5299 6.18E-05 0.9997 TIM3+G 1459.9864 45 3009.9628 15.6404 5.85E-05 0.9998 TrN+G 1460.9864 44 3009.9727 15.6504 8.58E-04 0.9999 TIM1+G 1460.1805 45 3010.7895 16.0385 4.79E-05 0.9999 TPM2uf+G 1461.3948 44 3010.7895 16.4671 3.87E-05 0.9999 TIM2+G 1460.6506 45 3011.3012 16.9788 3.00E-05 1

170 TVM+G 1460.3918 46 3012.7835 184,611 1.43E-05 1 GTR+G 1459.646 47 3013.292 18.9696 1.11E-05 1 TPM3uf 1472.2083 43 33028.431 34.1086 5.71e-900 1 HKY 1472.2155 42 3028.6553 34.1086 4.00E+00 1 TIM3 1470.3276 44 3028.6553 34.3329 5.11E-09 1 TrN 1471.2393 43 3028.6586 34.3362 5.10E-09 1 TPM1uf 1472.2155 43 3028.6553 34.1086 4.73E-09 1 TIM1 1470.5176 44 3029.0352 34.7128 4.22E-09 1 TIM2uf 1471.873 43 3029.7461 35.4237 2.96E-09 1 TIM2 1470.9829 44 3029.9785 35.6561 2.64E-09 1 TVM 1470.8662 45 3031.7325 37.4101 1.10E-09 1 GTR 1469.9848 46 3031.9695 37.6471 9.74E-10 1 F81+I 1485.9047 42 3055.8095 61.487 6.48E-15 1 F81+I+G 1485.7393 43 3037.4786 63.1562 2.81E-15 1 F81+G 1493.236 42 3070.4719 76.1465 4.24E-18 1 F81 1503.5762 41 3089.1525 94.83 3.73E-27 1 K80+I 1515.7938 40 3111.5877 117.2652 5.01E-27 1 TPM3+I 1515.0658 41 3112.1316 117.8092 3.81E-27 1 TPM1+I 1515.1264 41 3112.2529 117.9304 3.59E-27 1 TPM2+I 1515.2286 41 3112.4571 118.1347 3.24E-27 1 K80+I+G 1515.6318 41 3113.2637 118.9413 2.17E-27 1 TrNef+I 1515.7863 41 3113.5726 118.2502 1.86E-27 1 TPM3+I+G 1514.896 42 3113.7919 119.4695 1.662-027 1 TPM1+I+G 1514.9632 42 3113.9264 119.604 1.55E-27 1 TPM2+I+G 1515.0653 42 3114.1305 119.8081 1.40E-27 1 TIM3ef+I 1514.896 42 3113.2637 119.4695 1.40E-27 1 TIM1ef+I 1515.1228 42 3114.2456 119.9231 1.33E-27 1 TVM2ef+I 1515.2222 42 3114.4444 120.122 1.20E-27 1 TVMef+I 1514.5004 43 3115.0009 120.6785 9.09E-28 1 TrNef+I+G 1515.6291 42 3115.2582 120.9358 7.99E-28 1 TIM3ef+I+G 1514.8913 43 3115.7826 121.4602 6.15E-28 1 TIM1ef+I+G 1514.9621 43 3115.9241 121.6018 5.73E-28 1 TIM1ef+I+G 1514.9621 43 3115.9242 121.6018 5.73E-28 1 TIM2ef+I+G 1515.0644 43 3116.1287 121.8063 5.17E-28 1 TVMef+I+G 1514.3342 44 3116.6685 122.3461 3.95E-28 1

171 SYM+I 1514.4978 44 3116.6732 122.6732 3.35E-28 1 SYM+I+G 1514.3305 45 3118.6611 124.3387 1.46E-28 1 K80+G 1524.0446 40 3128.0891 133.7667 1.31E-30 1 TPM3+G 1523.2177 41 3128.4354 134.113 1.10E-30 1 TPM1+G 1523.3567 41 3128.7134 134.3909 9.57E-31 1 TPM2+G 1523.5242 41 3129.0485 134.7261 8.09E-31 1 TrNef+G 1523.8589 41 3129.7178 135.3954 5.79E-31 1 TIM3ef+G 1523.0353 42 3130.0706 135.7482 4.85E-31 1 TIM1ef+G 1523.1727 42 3130.3455 136.0231 4.23E-31 1 TIM2ef+G 1523.3382 42 3130.6765 136.3541 3.59E-31 1 TVMef+G 1522.7191 43 3131.4383 137.1159 2.45E-31 1 SYM+G 1522.5285 44 3133.057 138.7346 1.09E-31 1 K80 1534.5429 39 3147.0857 152.7633 9.80E-35 1 TPM3 1533.6985 40 3147.3971 153.0746 8.39E-35 1 TPM1 1533.8549 40 3147.7099 153.3875 7.17E-35 1 TPM2 1534.0319 40 3148.0639 153.7415 6.01E-35 1 TrNef 1534.3013 40 3148.6026 154.2802 4.59E-35 1 TIM3ef 1533.4633 41 3148.9266 154.6042 3.90E-35 1 TIM1ef 1533.6142 41 3149.2284 154.906 3.36E-35 1 TIM2ef 1533.7944 41 3149.5887 155.2663 2.80E-35 1 TVMef 1533.2129 42 3150.4258 156.1033 1.84E-35 1 SYM 1532.9709 43 3151.9418 157.6194 8.65E-36 1 JC+I 1545.3304 39 3168.6608 174.3384 2.02E-39 1 JC+I+G 1545.211 40 3170.422 176.0996 8.39E-40 1 JC+G 1553.1009 39 3184.2018 189.8794 8.54E-43 1 JC 1563.5157 38 3203.0314 208.709 6.96E-47 1

-lnL: negative log likelihod K: number of estimated parameters AIC: Akaike Information Criterion delta: AIC difference weight: AIC weight cumWeight: cumulative AIC weight

172 Model selected: Model = HKY+I partition = 010010 -lnL = 1454.1612 K = 43 freqA = 0.3341 freqC = 0.1929 freqG = 0.1366 freqT = 0.3364 kappa = 72.8005 (ti/tv = 32.2959) p-inv = 0.9480

173 Appendix iii: Best model test of combined data (Cytb and Dloop).

The JModeltest 2.1 was used to find the best model for Cytb and Dloop data. The best fit model was designated by the Akaike Information Criterion (AIC) method. The results showed that (TrN+I) model is best for Cytb and Dloop data. cum Model InL K AIC delta weight Weight TrN+I 3135.9649 46 6363.9297 0 0.1998 0.1998 TIM3+I 3135.1451 47 6364.2902 0.3604 0.1668 0.3666 TIM1+I 3135.2571 47 6364.5143 0.5846 0.1491 0.5157 TIM2+I 3135.5042 47 6365.0085 1.0787 0.1165 0.6322 TrN+I+G 3136.4063 47 6366.8126 2.8829 0.0473 0.6795 HKY+I 3138.425 45 6366.85 2.9202 0.0464 0.7258 TIM3+I+G 3135.5942 48 6367.1883 3.2586 0.0392 0.765 TPM3uf+I 3137.6108 46 6367.2217 3.2919 0.0385 0.8035 GTR+I 3134.6839 49 6367.3677 3.438 0.0358 0.8393 TIM1+I+G 3135.7084 48 6367.4168 3.4871 0.0349 0.8743 TPM1uf+I 3137.7272 46 6367.4545 3.5248 0.0343 0.9086 TPM2uf+I 3137.9308 46 6367.8615 3.9318 0.028 0.9365 TIM2+I+G 3137.9308 46 6367.8615 3.9318 0.028 0.9365 TIM2+I+G 3135.9774 48 6367.9547 4.025 0.0267 0.9632 TVM+I 3137.1187 48 6370.2374 6.3077 0.0085 0.9718 GTR+I+G 3135.1608 50 6370.3215 6.3918 0.0082 0.9799 HKY+I+G 3139.4768 46 6370.9536 7.0239 0.006 0.9859 TPM3uf+I+G 3138.6627 47 6371.3254 7.3956 0.0049 0.9909 TPM1uf+I+G 3138.7615 47 6371.5231 7.5933 0.0045 0.9953 TPM2uf+I+G 3138.9888 47 6371.9776 8.0478 0.0036 0.9989 TVM+I+G 3138.1742 49 6374.3484 10.4187 0.0011 1 TrN+G 3153.3603 46 6398.7205 34.7908 5.57E-09 1 TIM3+G 3152.5346 47 6399.0693 35.1395 4.68E-09 1 TIM1+G 3152.6311 47 6399.2622 35.3324 4.25E-09 1 TIM2+G 3152.9439 6399.8879 35.9581 3.11E-09 1 GTR+G 3152.1151 49 6402.2302 6402.2302 9.63E-10 1 HKY+G 3161.382 45 6412.7641 48.8343 4.97E-12 1 TPM3uf+G 3160.5498 46 6413.0996 49.1699 4.20E-12 1 TPM1uf+G 3160.6505 46 6413.3011 49.3714 3.80E-12 1

174 TPM2uf+G 3160.9576 46 6413.9151 49.9854 2.79E-12 1 TVM+G 3160.1252 48 6416.2504 52.3206 8.69E-13 1 TrN 3172.0344 45 6434.0688 70.1391 1.17E-16 1 TIM3 3171.2085 46 6434.4169 70.4872 9.87E-17 1 TIM1 3171.305 46 6434.61 70.6803 8.96E-17 1 TIM2 3171.6158 46 6435.2316 71.3018 6.57E-17 1 GTR 3170.7869 48 6437.5738 73.6441 2.04E-17 1 HKY 3180.4288 44 6448.8575 7.22E-20 7.22E-20 1 TPM3uf 3179.5988 45 6449.1976 85.2678 6.09E-20 1 TPM1uf 3179.6962 45 6449.3923 85.4626 5.53E-20 1 TPM2uf 3180.007 45 6450.014 86.0842 4.05E-20 1 TVM 3179.1768 47 6452.3536 88.4239 1.26E-20 1 F81+I 3186.4869 44 6460.9739 97.0441 1.69E-22 1 F81+I+G 3187.6325 45 6465.2651 101.3353 1.98E-23 1 TrNef+I 3202.357 43 6490.714 126.7843 5.88E-29 1 TIM3ef+I 3201.6348 44 6491.2696 127.3398 4.46E-29 1 TIM1ef+I 3201.6829 44 6491.2696 127.4361 4.25E-29 1 K80+I 3203.6934 42 6491.3868 127.4571 4.20E-29 1 TIM2ef+I 3201.7245 44 6491.449 127.5193 4.07E-29 1 TPM3+I 3202.9945 43 6491.9889 128.0592 3.11E-29 1 TPM2+I 3203.0568 43 6492.1135 128.1838 2.92E-29 1 TrNef+I+G 3202.5606 44 6493.1211 129.1914 1.77E-29 1 TIM3ef+I+G 3201.834 45 6493.668 129.7382 1.34E-29 1 TIM1ef+I+G 3201.8654 45 6493.7307 129.801 1.30E-29 1 TIM2ef+I+G 3201.9003 45 6493.8006 129.8708 1.26E-29 1 SYM+I 3201.0079 46 6494.0158 130.086 1.13E-29 1 K80+I+G 3204.2114 43 6494.4228 130.493 9.21E-30 1 TVMef+I 3202.3615 45 6494.7231 130.7933 7.93E-30 1 TPM3+I+G 3203.5114 44 6495.0229 131.0931 6.82E-30 1 TPM1+I+G 3203.5395 44 6495.079 131.1493 6.63E-30 1 TPM2+I+G 3203.579 44 6495.158 131.2282 6.38E-30 1 SYM+I+G 3203.579 44 6495.158 131.2282 6.38E-30 1 SYM+I+G 3203.579 47 6495.158 131.2282 6.38E-30 1 TVMef+I+G 3202.8798 46 6497.7597 133.83 1.74E-30 1 F81+G 3207.6408 44 6503.2815 139.3518 1.10E-31 1

175 TrNef+G 3221.4086 43 6528.8173 164.8875 3.13E-37 1 TIM3ef+G 3220.6487 44 6529.2973 165.3676 2.46E-37 1 TIM1ef+G 3220.7202 44 6529.4404 165.5106 2.29E-37 1 TIM2ef+G 3220.8396 44 6529.6792 165.7495 2.03E-37 1 SYM+G 3220.0865 46 6532.1731 168.2433 5.85E-38 1 K80+G 3226.3664 42 6536.7329 172.8031 5.98E-39 1 TPM3+G 3225.6071 43 6537.2141 173.2844 4.70E-39 1 TPM1+G 3225.6762 43 6537.3524 173.4226 4.39E-39 1 TPM2+G 3225.8 43 6537.6001 173.6703 3.88E-39 1 F81 3226.486 43 6538.972 175.0423 1.95E-39 1 TVMef+G 3225.0509 45 6540.1018 176.1721 1.11E-39 1 TrNef 3240.7041 42 6565.4082 201.4784 3.55E-45 1 TIM3ef 3239.9392 43 6565.8784 201.9487 2.80E-45 1 TIM1ef 3240.0147 43 6566.0295 202.0997 2.60E-45 1 TIM2ef 3240.146 43 6566.2921 202.3624 2.28E-45 1 SYM 3239.3896 45 6568.7792 204.8495 6.58E-46 1 K80 3245.8617 41 6573.7235 209.7937 5.55E-47 1 TPM3 3245.0974 42 6574.1948 210.265 4.39E-47 1 TPM1 3245.1701 42 6574.3403 210.4106 4.08E-47 1 TPM2 3245.3011 42 6574.6023 210.6726 3.58E-47 1 TVMef 3244.5468 44 6577.0935 213.1638 1.03E-47 1 JC+I 3249.5874 41 6581.1748 217.2451 1.34E-48 1 JC+I+G 3250.1188 42 6584.2376 220.3078 2.89E-49 1 JC+G 3271.4782 41 6624.9563 261.0266 4.16E-58 1 JC 3290.9085 40 6661.8169 297.8872 4.12E-66 1

-lnL: negative log likelihod K: number of estimated parameters AIC: Akaike Information Criterion delta: AIC difference weight: AIC weight cumWeight: cumulative AIC weight

176 Model selected: Model = TrN+I partition = 010020 -lnL = 3135.9649 K = 46 freqA = 0.2960 freqC = 0.2388 freqG = 0.1556 freqT = 0.3096 R(a) [AC] = 1.0000 R(b) [AG] = 155.3109 R(c) [AT] = 1.0000 R(d) [CG] = 1.0000 R(e) [CT] = 55.5064 R(f) [GT] = 1.0000 p-inv = 0.9640

177