The Role of the Chaperone CCT in Assembling Cell Signaling Complexes

Brigham Young University BYU ScholarsArchive

Theses and Dissertations

2020-07-21

Nicole C. Tensmeyer Brigham Young University

Follow this and additional works at: https://scholarsarchive.byu.edu/etd

Part of the Physical Sciences and Mathematics Commons

BYU ScholarsArchive Citation Tensmeyer, Nicole C., "The Role of the Chaperone CCT in Assembling Cell Signaling Complexes" (2020). Theses and Dissertations. 9192. https://scholarsarchive.byu.edu/etd/9192

This Dissertation is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected]. The Role of the Molecular Chaperone CCT in Assembling Cell Signaling Complexes

Nicole C. Tensmeyer

A dissertation submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

Barry M. Willardson, Chair Josh L. Andersen John C. Price Pam Van Ry

Department of Chemistry and Biochemistry

Brigham Young University

The Role of the Molecular Chaperone CCT in the Assembly of Signaling Complexes

Nicole C. Tensmeyer Department of Chemistry and Biochemistry, BYU Doctor of Philosophy

In order to function, proteins must be folded into their native shape. While this can sometimes occur spontaneously, the process can be hindered by thermodynamic barriers, trapped intermediates, and aggregation prone hydrophobic interactions. Molecular chaperones are proteins that help client proteins or substrates overcome these barriers so that they can be folded properly. One such chaperone is the chaperonin CCT, a large MDa protein made up of 16 paralogous subunits that form a double ring structure. CCT encapsulates its substrates in a central cavity, where they are sequestered and folded, using ATP binding and hydrolysis to drive conformational changes in the CCT-substrate complex. CCT mediates the folding of many substrates involved in a variety of cellular process, including the cytoskeletal proteins actin and tubulin, and the G protein subunit Gβ, which signals downstream of GPCRs in a variety of cellular processes. We showed that CCT is responsible for folding the β-propeller containing proteins, mLST8 and Raptor, which are subunits of the mTOR complexes. The mTOR complexes (mTORC1 and mTORC2) are master regulators of cell growth and survival by controlling processes such as protein synthesis, energy metabolism, cell survival pathways and autophagy. CCT folds mLST8 and Raptor and help them assemble into the mTOR complexes. As a result, CCT is required for functional mTOR signaling. Furthermore, we solved a 4.0 Ǻ resolution structure of mLST8 bound to CCT. Surprisingly, mLST8 is found in the center of the folding cavity, in between the rings, despite previous evidence suggesting that substrates bind only in the apical domains. Given its role in folding and assembling the mTOR complexes, G proteins, and many other proteins involved in cell survival pathways, CCT has been implicated in cancer. CCT upregulation often correlates with a worse prognosis, likely because uncontrolled growth requires increased chaperone capacity. The peptide CT20P has been shown to have cytotoxic effects in cancer cells, likely through its binding to CCT. We characterized CT20P, showing that it binds to CCT and inhibits its substrate-folding functions in cells. We specifically showed that a GFP-CT20P fusion protein inhibited the assembly of two important signaling complexes Gβγ and mTORC1. These results show that CT20P is a useful inhibitor for the study of CCT function.

Keywords: chaperones, CCT, mTOR signaling, G protein signaling, CT20P ACKNOWLEDGEMENTS

I would like to acknowledge my funding from the Simmons Center for Cancer Research, the Roland K. Robbins Research Fellowship, and the NIH. I would like to thank my committee for their support, and I am especially grateful to my advisor, Dr. Barry Willardson, for his help in every step of this process. The biggest thank you goes to my husband, Chris, for being my greatest supporter in this and every other endeavor in my life. TABLE OF CONTENTS

LIST OF TABLES ...... ix

LIST OF FIGURES ...... x

1. INTRODUCTION ...... 1

1.1 Introduction ...... 1

1.2 Chaperones ...... 2

1.2.1 The role of chaperones in the cell ...... 2

1.2.2 Chaperonins ...... 6

1.2.3 The Chaperonin CCT ...... 7

1.2.4 CCT substrates ...... 9

1.2.5 The folding mechanism of CCT ...... 10

1.2.6 The co-chaperones of CCT ...... 14

1.2.7 CCT in disease ...... 15

1.3 mTOR: a master regulator of cell growth and metabolism ...... 17

1.3.1 The mTOR complexes ...... 18

1.3.2 mTORC1 activation ...... 20

1.3.3 Effects of mTORC1 activation ...... 22

1.3.4 mTORC2 activation ...... 24

1.3.5 Effects of mTORC2 activation ...... 27

iv 1.3.6 mTOR signaling in disease ...... 28

1.4 G protein signaling ...... 29

1.5 Conclusion ...... 30

2. G proteins ...... 31

2.1 Introduction ...... 31

2.2 G protein signaling ...... 32

2.3 The G protein gene family ...... 34

2.4 G protein structure ...... 37

2.5 G protein biogenesis ...... 39

2.6 G-Protein activation ...... 41

2.7 Effector activation ...... 44

2.8 G protein inactivation ...... 46

2.9 Physiology of G protein signaling – vision ...... 47

2.10 Physiology of G protein signaling – synaptic transmission ...... 48

2.11 Physiology of G protein signaling – insulin section ...... 50

2.12 Acknowledgements ...... 51

3. Structural and functional analysis of the role of the chaperonin CCT in mTOR complex assembly ...... 52

3.1 Introduction ...... 52

3.2 Results ...... 56

3.2.1 mLST8 and Raptor β-propellers bind CCT ...... 56

3.2.2 CCT contributes to mTORC assembly and signaling ...... 58

3.2.3 PhLP1 does not assist in mTORC assembly ...... 61

3.2.4 cryo-EM structure of the mLST8-CCT assembly intermediate ...... 62

3.2.5 Position of mLST8 in the CCT folding cavity ...... 65

3.2.6 Crosslinking mass spectrometry ...... 67

3.2.7 The nucleotide state of CCT in the mLST8-CCT complex ...... 69

3.2.8 Comparison with yeast CCT ...... 72

3.3 Discussion ...... 73

3.4 Methods ...... 77

3.4.1 Cell Culture ...... 77

3.4.2 CRISPR knockdown ...... 78

3.4.3 Immunoprecipitation ...... 78

3.4.4 Insulin signaling ...... 79

3.4.5 qPCR ...... 80

3.4.6 Statistical Analysis ...... 80

3.4.7 Isolation of mLST8-CCT ...... 80

3.4.8 Isolation of substrate-free CCT ...... 82

3.4.9 Crosslinking ...... 82

3.4.10 Mass spectrometry ...... 83

3.4.11 XL-MS analysis ...... 84

3.4.12 Cryo-EM grid preparation and data acquisition ...... 84

3.4.13 Image processing ...... 85

3.4.14 Model building ...... 87

3.4.15 Nucleotide distribution analysis ...... 87

3.4.16 Data availability ...... 88

3.5 Acknowledgements ...... 88

4. Using the peptide CT20P to inhibit CCT-mediated assembly of signaling complexes ...... 89

4.1 Introduction ...... 89

4.2 Results ...... 93

4.2.1 CT20P binds to CCT ...... 93

4.2.2 GFP-CT20P inhibits tubulin folding in HEK293T cells ...... 94

4.2.3 CT20P decreases binding of substrates to CCT ...... 96

4.2.4 CT20P inhibits the assembly of signaling complexes ...... 98

4.2.5 GFP-CT20P decreases endogenous expression of signaling proteins ...... 99

4.2.6 CT20P inhibits CCT function in multiple cell types ...... 101

4.2.7 GFP-CT20P inhibits mTOR signaling ...... 102

4.2.8 GFP-CT20P does not inhibit the ATPase cycle of CCT...... 104

4.3 Discussion ...... 105

4.4 Materials and Methods ...... 109

vii

4.4.1 Cell Culture ...... 109

4.4.2 Biotin pulldown ...... 109

4.4.3 Confocal Microscopy ...... 110

4.4.4 Imaging Flow Cytometry ...... 110

4.4.5 Immunoprecipitation ...... 111

4.4.6 ATP release experiment ...... 112

4.4.7 Insulin signaling ...... 112

4.4.8 Flow cytometry ...... 113

4.4.9 qPCR ...... 113

4.4.10 Statistical Analysis ...... 113

4.4.6 Isolation of substrate-free CCT ...... 114

4.5 Acknowledgements ...... 114

APPENDIX A. Supplemental Materials ...... 116

References ...... 135

viii

LIST OF TABLES

Table 1. Data Collection and 3D reconstruction parameters ...... 125

Table 2. Model Refinement and Statistics ...... 126

Table 3. XL-MS Crosslinks ...... 131

Table 4. sgRNA, siRNA and qPCR information...... 132

Table 5. Antibody information ...... 134

LIST OF FIGURES

Figure 1-1. Schematic of chaperone activity...... 3

Figure 1-2. The ATPase cycle of CCT ...... 8

Figure 1-3. β-propeller proteins...... 8

Figure 1-4. mTOR signaling...... 17

Figure 1-5 Structures of the mTOR complexes...... 19

Figure 2-1. Schematic illustration of the G-protein cycle...... 33

Figure 2-2. Gα families have varying roles in the cell ...... 35

Figure 2-3. Families of Gβ and Gγ...... 36

Figure 2-4. Structures of Gαβγ...... 38

Figure 2-5. Schematic model for G protein biogenesis...... 40

Figure 2-6. Receptor-mediated changed in G protein structure...... 42

Figure 2-7. Gα effectors...... 44

Figure 2-8. Regulation of Gα by RGS proteins...... 46

Figure 3-1. mLST8 and Raptor bind CCT...... 57

Figure 3-2 CCT contributes to mTORC assembly ...... 59

Figure 3-3. Cryo-EM structure of the mLST8-CCT complex ...... 64

Figure 3-4. Position of mLST8 within the mLST8-CCT complex...... 66

Figure 3-5. XL-MS of the mLST8-CCT complex...... 68

Figure 3-6. Nucleotide binding state of the CCT-mLST8 complex ...... 71

Figure 3-7. The role of CCT in the folding of β-propeller proteins...... 76

Figure 4-1. CT20P binds to CCT...... 94

Figure 4-2. CT20P inhibits tubulin folding...... 95

Figure 4-3. CT20P inhibits substrate binding to CCT...... 98

Figure 4-4. CT20P inhibits assembly of signaling complexes...... 100

Figure 4-5. CT20P inhibits CCT in multiple cell types...... 102

Figure 4-6. CT20P inhibits mTOR signaling...... 103

Figure 4-7. CT20P does not inhibit the ATPase cycle...... 104

Appendix A Figure 1. mTOR, Rictor and mSIN1 do not bind CCT ...... 116

Appendix A Figure 2. Raptor loss increases Rictor expression...... 117

Appendix A Figure 3. PhLP1 does not contribute to mTORC formation ...... 118

Appendix A Figure 4. Cryo-EM image analysis of the mLST8-CCT complex ...... 119

Appendix A Figure 5. Atomic model of the human CCT complex...... 120

Appendix A Figure 6. Comparison of yeast AMP-PNP CCT and human mLST8-CCT...... 121

Appendix A Figure 7. Comparison of substrate-free CCT and mLST8-CCT ...... 122

Appendix A Figure 8. Comparison of yeast apo-CCT and human CCT-mLST8...... 123

Appendix A Figure 9. Location of the mLST8 molecule at the center of the CCT cavity ...... 124

1. INTRODUCTION

1.1 Introduction

This dissertation will focus on the role of the molecular chaperone CCT (chaperonin containing tailless complex polypeptide 1) in the folding and assembly of important signaling complexes.

Molecular chaperones are proteins that play an essential cellular role in maintaining the proteome by assisting nascent or misfolded proteins to achieve their native structures and assemble into functional complexes2. This process seldom occurs spontaneously in the cell, but requires chaperones to protect proteins from aggregation, to channel their folding pathways and to facilitate their association into multi-protein assemblies3. There are several chaperone systems, including the heat shock proteins such as HSP70, HSP90 and the chaperonins such as CCT, that collectively create a network to coordinate protein folding and protein complex assembly2. These chaperone systems work together to maintain cellular proteostasis and prevent misfolded protein aggregation.

Furthermore, this dissertation will discuss signaling complexes which are substrates of CCT, the mTOR complexes, mTORC1 and mTORC2, as well as the G protein heterodimer Gβγ. The mTOR complexes (mTORC1 and mTORC2) are key regulators of cell growth and metabolism, controlling important cellular processes such as protein synthesis, lipid synthesis, energy metabolism, cell survival and autophagy in response to growth factors, nutrients, oxygen and stress4-6. As a result, they are involved in many pathological processes including cancer, type II diabetes, chronic inflammation and neurodegeneration. Consequently, mTOR complexes

represent high-value therapeutic targets 6-8. G proteins participate in a vast array of signals emanating from G protein coupled receptors that drive cellular responses ranging from hormones and neurotransmitters to photons of light 9, and approximately 30 % of all current

pharmaceuticals target GPCRs and their signaling pathways 10.

The introductory chapter will first focus on chaperones, specifically CCT, and then discuss the

mTOR complexes in detail. Chapter two contains a comprehensive review of G protein

signaling, while chapters three and four contain my primary research results on mTORC

assembly and CCT inhibition, respectively.

1.2 Chaperones

1.2.1 The role of chaperones in the cell

As nascent polypeptides are translated by the ribosome, the string of amino acids must find its

proper three-dimensional shape in order to function properly. The ribosome can modulate the

rate of translation to optimize folding, allowing the chain to collapse and bury nonpolar amino

acids in the core11. However, frequently these chains need further guidance from molecular

chaperones in order fold correctly due to macromolecular crowding and kinetic or

thermodynamic barriers12. Furthermore, most proteins over ~100 amino acids require some form of folding intermediate during their folding, making them more likely to fold into a non-native structure as many intermediate conformations can be kinetically stable misfolded conformations that are difficult to overcome13. If a protein cannot properly fold, exposed hydrophobic residues

can lead to the formation of toxic aggregates, either in the form of amorphous aggregates of

defined amyloid fibrils with extended β sheet structures12.

Figure 1-1. Schematic of chaperone activity. Chaperones stimulate the folding of proteins and the clearance of aggregates, while inhibiting the formation of misfolded proteins, aggregates and amyloid fibrils

Given the importance of proteins reaching their native state and the complexity of the folding

pathways for these macromolecules, it is no surprise that every domain of life has chaperones to

guide protein folding14. As shown in Figure 1-1, chaperones recognize unfolded, misfolded and

aggregated proteins and help them achieve their native state. Many chaperones bind substrates

co-translationally while the peptide is coming off the ribosome, recognizing hydrophobic regions

on newly synthesized proteins15. In some cases, chaperones work by sequestering these peptides

away from the concentrated cellular environment, creating what is called an Anfinsen cage to

allow substrates to fold unhindered16, 17. They may direct folding by binding newly synthesized peptides to avoid premature collapse of the hydrophobic regions in the N-terminal region before

the C-terminus is synthesized18. Chaperones can also play a more active role in protein folding,

frequently through the use of ATPases, to actively drive conformational changes in both the

chaperone and the substrate, allowing for thermodynamically unfavorable conformational

ensembles19. Furthermore, when proteins do become aggregated, molecular chaperones play an

important role in breaking up the aggregates and marking them for degradation20.

Chaperones work together in what is called the proteostasis network, often binding substrates in

large complexes or acting sequentially, handing substrates off for the next stage of folding21.

The most notable molecular chaperones are the heat shock protein families (HSPs), named for

their upregulation in response to the proteomic stress that occurs with heat shock. The major

families include the HSP40s, HSP60s, HSP70s HSP90s, HSP110s and small HSPs22. The

HSP70s can function co-translationally and are also responsible for disassembling aggregates so

that they can be targeted for degradation22, 23.The HSP90 family is an important chaperone that acts as protein folding machine that folds many kinases involved in cell cycle control and cell signaling24. The HSP60s are generally called the chaperonins, a class that includes mitochondrial

HSP60 and the eukaryotic CCT as well as its bacterial homolog GroEL22. The large proteostasis network allows for some redundancy in substrate binding. These various chaperones often work in concert; for example, both the co-chaperone Prefoldin and HSP70 have been shown to bind nascent polypeptide chains and deliver partially folded substrates to CCT or HSP9025, 26.

Chaperones play a role in almost every step of proteome maintenance. Ribosome profiling

experiments show that chaperones bind nascent polypeptides while they are in the process of

being translated. In addition to folding client proteins, chaperones are responsible for helping

substrates assemble into their complexes, which is the case for most multi-subunit complexes in

the cell such as the mTOR and G protein complexes that are the focus of this dissertation, the

anaphase promoting complex, the histone cell cycle regulator complex, and transcription factor

4 complexes among many others27-32. Chaperones may also be responsible for shuttling substrates to their target organelles, such as is the case with proteins containing the Mitochondrial

Targeting Sequence or the transport of the Type 1 Signal Peptidase (SPase1) to the cell membrane33, 34. Many client proteins require chaperones to maintain their stability after folding35.

Chaperones are further involved in various cellular processes such as MHC loading or exporting proteins through secretion systems36, 37. Chaperones recognize fairly nonspecific motifs, generally hydrophobic regions, and therefore can bind many different client proteins38.

Importantly, chaperones are responsible for handling misfolded and aggregated species and targeting them for degradation. Hydrophobic aggregates in the cell can be toxic and lead to disease, as is the case with many neurodegenerative diseases such as Huntington’s Disease and

Alzheimer’s disease39, 40. Chaperones act as a quality control to recognize these harmful species, and are upregulated in response to proteomic stressors such as heat, amyloid fibers, or proteasome inhibition41, 42. Aggregated oligomers usually cannot be degraded, so they must be disassembled into smaller monomers so they can be sorted for refolding or labeled for degradation. In eukaryotic cells, disaggregating complexes are made up of a complex of HSP70 bound to J-protein, HSP110 and small HSPs23. HSP104 can help to remodel aggregated proteins so they can be handed back to chaperones for refolding43. Frequently aggregates must be labeled for degradation by either proteasome or through autophagy. Co-chaperones such as Bag1 can help label chaperone clients with ubiquitin by coordinating the ubiquitin ligase machinery44, 45.

After poly-ubiquitination, misfolded proteins will be degraded by the proteasome46.

Alternatively, chaperone mediated autophagy can be used to clear aggregates. Chaperones play a critical role in helping autophagy-destined substrates bind to the lysosome-associated membrane

protein type 2A (LAMP-2A) so that they can be incorporated into the lysosome for

degradation47.

The basic role of chaperones in the cell is maintenance of the proteome, handling unfolded and

misfolded proteins, and ensuring client proteins assemble with the right binding partners in the

correct cellular compartment. Proteostasis is essential to the health of the cell and organism,

making chaperones vital for proper cellular functioning.

1.2.2 Chaperonins

Chaperonins are a family of large, ~1 megadalton multimeric chaperones that form a double ring

structure and share significant sequence homology. These chaperonins function as prototypical

chaperones – they are responsible for helping unfolded or misfolded proteins to achieve their

native shape. Chaperonins are divided into two groups based on sequence homology. Type I

chaperonins are found in bacteria, mitochondria and chloroplasts, the most notable member

being the bacterial chaperonin GroEL, with HSP60 being found in mitochondria and Rubisco

binding protein found in chloroplasts48-50. Type II chaperonins include CCT in the eukaryotic

cytosol and the thermosome in archaea51. Much of our understanding of CCT comes from studies on GroEL and early structural studies on the thermosome52. Chaperonins form a large-double ring structure, enclosing substrates in an internal cavity. GroEL is composed of 14 identical subunits (two rings of seven) and CCT is composed of eight paralogous subunits, 50-60 kDa each, that form a double ring structure of 16 total subunits53. While GroEL requires the co-

chaperone, GroES to form a lid to trap substrates in the cavity, the apical domains of CCT

protrude inward to close its substrate folding cavity54. Despite a difference in substrate

encapsulation, Type I and Type II chaperonins function similarly. Substrate folding is driven by

ATP hydrolysis in the conserved equatorial domains of chaperonins which contain ATP binding

sites and ATPase activity53. The ATP binding and hydrolysis cycle and how it drives substrate

folding in CCT specifically will be discussed in detail later. GroEL has a hydrophobic lining in

the cavity which binds to hydrophobic regions of unfolded peptides53. These binding regions are relatively promiscuous and can bind a wide range of substrates, allowing GroEL to chaperone approximately 80 % of the E. coli proteome38. Comparatively, CCT has more polar regions

lining its cavity and it is suggested to facilitate the folding of approximately 10 % of all proteins,

although some argue that this is an overestimate55-57.

1.2.3 The Chaperonin CCT

CCT, otherwise known as TriC, is a large, barrel-like structure composed of two rings of eight subunits each, as shown in Figure 1-2. Unlike the other chaperonins which are composed of only one or two unique subunits, CCT is composed of eight unique subunits, termed CCT 1-8, or CCT

α, β, γ, δ, ε, ζ, η, and θ. These subunits mostly likely arose evolutionarily from duplication events and now are only about 27-39% conserved58. In the center of the rings is the substrate

folding cavity, large enough to contain proteins of about 60-70 kDa52. Unfolded proteins are sequestered, and then released out of the cavity once fully folded. Unlike GroEL which cannot fold substrates without its 10 kDa co-chaperone GroES, CCT does not require a co-chaperone to

be able to fold its substrates. It does however interact with other chaperones and co-chaperones that help to deliver client proteins to CCT or release them from CCT26, 59.

Figure 1-2. The ATPase cycle of CCT. In the absence of nucleotide, CCT is in the open conformation (left, Protein Data Bank (PDB) 5GW4). ATP binding partially closes the ring (center, 5GW5) and the ATP hydrolysis transition state completely closes the ring (right, 4AOL).

Figure 1-3. β-propeller proteins. The ribbon structure of the G protein subunit β (PDB 1TBG) and the mTOR binding partner, mLST8, sometimes called GβL (PDB 4JT6)

1.2.4 CCT substrates

Interactome studies of CCT originally suggested that CCT folds 10% of the proteome, however

that is possibly an overestimate due to the fact that CCT interacts with many co-chaperones as

part of the greater proteostasis network60. CCT does, however, fold many important substrates

involved in the cytoskeletal network, cell signaling and survival, cell cycle function and other

crucial cellular processes. Its most notable substrates are actin and tubulin, two abundant

cytoskeletal proteins that absolutely depend on CCT for their proper folding61, 62. CCT has also

been found to fold many proteins containing a β-propeller domain, a tertiary structure with a

complex folding trajectory that is prone to aggregation, such as is the case with the G protein

subunit β (Gb) and mLST8 shown in Figure 1-363. In addition to these two β-propeller proteins,

CCT is responsible for the folding of the cdc20 and cdh1 components of the anaphase promoting complex the Bardet-Biedl syndrome protein 7 (BBS7) subunit of the BBSome ciliary transport

protein complex, protein phosphatase 2A regulatory subunits, the telomerase co-factor TCAB1,

and the TAF5 subunit of the TFIID transcription factor complex28, 29, 64-67. Many of CCT’s

substrates are relevant to diseases including cancer, such as the tumor suppressor von Hippel-

Lindau, and CCT has also been shown to prevent the formation of amyloid fibers responsible for

neurodegenerative diseases68, 69. Some CCT substrates are obligate clients of CCT while others

can utilize either CCT or other chaperone folding pathways70.

CCT substrates do not all share specific common motifs; however, they do tend to contain

complex topologies, generally with some sort of hydrophobic region that must be stabilized so

that the substrate can access the correct folding trajectory71. The β-propeller substrates listed above are the prime example of this. β-propeller containing proteins are involved in numerous

cellular processes including signaling, and act as a scaffold protein lacking enzymatic function72.

The β-propeller is composed of typically 7 blades of β-sheets that fold into a propeller structure.

These sheets are made of approximately 40 amino acids and contain Tryptophan and Aspartic acid; hence they are often referred to as WD40 repeats. β-propellers likely need guidance from

CCT because the β sheets on the final blade of the propeller are actually made from β strands from both the N-terminal and C-terminal regions of the protein domain in order to close the propeller (see Figure 1-3)63.

1.2.5 The folding mechanism of CCT

An important step in understanding the mechanism of CCT substrate folding was obtaining high

resolution structures of the chaperonin. The first mammalian CCT structure was that of apo

bovine CCT which was solved by cryo-electron microscopy (cryo-EM) to 4.0 Ǻ resolution by

Cong et al in 2010, although the identity of each subunit was later corrected by Leitner et al in

2012 using cross-linking mass spectrometry73, 74. This structure represented a closed CCT

conformation, where the apical domains have helical protrusions that rotate inward about 45°

compared to the open form74, 75. This showed that CCT, unlike GroEL, forms a symmetrically

closed conformation, in which both rings are closed at the same time. CCT contains a two-fold

axis of symmetry, with the subunit arrangement of the two rings running counter to each other in

the order 6-8-7-5-2-4-1-3 in a counter-clockwise direction73. Because the rings are separated by an axis of symmetry, inter-ring contacts have six heterotypic interactions, CCT5-CCT4, CCT7-

CCT1, CCT8-CCT3, with CCT2 and CCT6 forming homotypic interactions (see Figure 1-2)73.

Structural studies also revealed the substrate binding sites to generally be in the apical domains76.

The substrate binding sites contains a mix of polar and hydrophobic regions, with each subunit

having a unique substrate binding site. This binding site heterogeneity allows substrates of CCT to bind specifically to different subunits, allowing them to be oriented for folding. Substrates have been shown to span the cavity, binding to multiple subunits, with different substrates binding uniquely to CCT56. The inner lining of the cavity contains polar regions separated into

two hemispheres, with the more negatively charged inner chamber being created by the subunits

CCT4, CCT2 and CCT5, while the more positively inner chamber is created by CCT3, CC6 and

CCT877. Structures of the open conformation of CCT reveal that the apical domains are quite

flexible78. At the bottom of the equatorial domains, both the N- and C- termini of the subunits span the cavity, creating contacts with the other subunits79. This creates a thin barrier between

the rings with 15 of the 16 termini per ring (all but the N termini of CCT4 subunits) inside the bottom of the cavity80.

The ATP binding cycle of CCT is necessary for substrate folding. The ATP binding site resides

in the equatorial domains. Determined structures of CCT and further biochemical studies have

shown that CCT subunits do not have equal affinity for ATP75, 79. The subunits CCT4 and CCT5

have the highest binding affinity for ATP, while CCT7 and CCT2 have moderate affinity, and

the other four subunits have no appreciable affinity for ATP81. Others have suggested that the

lack of affinity for ATP is a result of a very slow off rate for ADP82. Endogenously captured

CCT structures contain what has been termed the ‘nucleotide partially preloaded’ (NPP) state,

with only the ‘low affinity’ subunits CCT6 and CCT8 containing ADP in the nucleotide binding pocket, suggesting that these subunits had yet to release their ADP from before the purification

process began82. Mutation studies suggest that the nucleotide binding sites in the low affinity

subunits are not necessary for CCT function81. However, the residues involved in ATP binding and hydrolysis in the high affinity hemisphere are essential for CCT function. For example, affinity decreasing mutations in the binding pocket of CCT5 (a high affinity subunit) lead to issues in sarcomere formation due to a lack of actin assembly83. Mutations that completely

abolish ATP binding and hydrolysis in these subunits are lethal81. This suggests that the ATP

binding cycle is powered primarily by the high affinity hemisphere.

Comparing various structures, we now can see the different conformations of CCT at each step

in the ATP binding cycle (Figure 2). In the nucleotide free state, the cavity is open, with the

apical domains pointing upward. Interestingly, yeast CCT2 forms a Z-shape when it is not bound

to nucleotide, although human does not82. The ATP binding site is in the equatorial domains

where there is a conserved P-loop motif. ATP binding causes a rearrangement in the apical

domains, creating another open state with less flexibility. In this state, new contacts between

subunits are formed so that each ring forms a tetramer of dimers, where groups of two come

closer together, leaving space between the next group of two84. A catalytic aspartic acid is

responsible for ATP hydrolysis which triggers the closing of the cavity. The nucleotide sensing

loop (NSL) positions a positively charged lysine to interact with the negatively charge γ

phosphate on ATP before hydrolysis. Upon hydrolysis, the lysine moves to interact with the α

phosphate on ATP, which causes the NSL to shift77. This change propagates through the equatorial domains to the apical domains in order to close the cavity. The closing of the cavity changes the contacts between CCT and the substrate, causing it to be released inside the cavity

for folding85. When ADP and inorganic phosphate are released, the cavity reopens and the cycles begins again.

As the most abundant protein in a eukaryotic cell, actin is one of CCT’s most notable substrates and has been the subject of a large percentage of the studies involving CCT. The structure of actin is complex, with many long-range interactions, including an interaction between the N- and

C-terminus. Actin cannot be folded by GroEL or the archaeal thermosome86. This suggests that

actin requires the specific interactions provided by the eight unique subunits found in CCT.

Novel insights into the folding mechanism of actin were found using hydrogen/deuterium

exchange (H/DX) coupled to mass spectrometry87. CCT-bound actin has an extended shape

interacts with CCT4, 2, 5, 7, and 8, most of which have a net negative charge. This allows some

of the helices to form their secondary structure, while preventing non-native interactions from

occurring. Upon ATP binding, the binding interface between CCT and actin changes, allowing

actin to achieve a slightly more folded state, while still preventing it from collapsing. Even upon

ATP hydrolysis, the C-terminus of actin is still held by CCT and is only slowly released so that

actin can achieve its final conformation without any unwanted contacts. This study has proven

that CCT does not act simply as an Anfinsen cage, sequestering proteins to prevent aggregation,

but acts specifically to guide the folding process.

One question left is how CCT accommodates large substrates. The size of the cavity is able to

hold only 60-70 kDa; however, CCT has many substrates that are upwards of 100 kDa. Protease degradation studies show that CCT encapsulates individual domains of large proteins, leaving the rest of the protein outside of the cavity, while CCT folds a single domain88.

1.2.6 The co-chaperones of CCT

Unlike GroEL which requires GroES for substrate folding, purified CCT is able to fold many of

its substrates alone in vitro87. However, in the cell, CCT often works with other co-chaperones.

Prefoldin is best known for binding to nascent actin and tubulin and delivering them to CCT, but

is responsible for delivering other substrates as well89, 90. Prefoldin is a hetero-hexamer that is

compared structurally to a jellyfish, with six arms extending out to bind the substrates. Prefoldin

homologs are found in eukaryotes and archaea, but not in bacteria, suggesting that it only

interacts with group II chaperonins91. Structures of actin bound to prefoldin show that prefoldin

grabs substrates with the ends of its ‘tentacles’92. The same study solved a low-resolution

structure of CCT and prefoldin, suggesting that prefoldin directly delivers substrates by binding

the apical domains of CCT.

CCT has also been shown to coordinate with HSP70 for substrate folding. Recent ribosome

profile studies suggest that CCT and HSP70 bind to nascent polypeptides sequentially. They

suggest that HSP70 binds co-translationally as the N- terminus is being translated, then CCT binds later while the C terminal regions are being translated93. Another study in yeast showed

that both CCT and HSP70 were required for the assembly of the VHL-elongin BC tumor

suppressor complex94. HSP70 mutants had a decrease in binding of VHL to CCT, while CCT

mutants did not decrease VHL binding to HSP70, suggesting again that HSP70 must bind first. A

structure of CCT and the HSP70 nucleotide binding domain shows that HSP70 binds to the

apical domain of CCT295. This stable interaction likely mediates a hand-off where HSP70 can deliver substrates to CCT.

The phosducin like proteins (PhLPs) are key co-chaperones of CCT with varied roles depending

on the isoform and substrate. For example, PhLP3 is responsible for modulating the folding of

actin and tubulin by decreasing CCT ATPase activity96. In this way, it is antagonistic of

prefoldin, which works to support actin and tubulin folding. On the other hand, mutant studies in

yeast suggest that PhLP2 is necessary for the folding of CCT substrates97. PhLP1 supports the

assembly of the G protein heterodimer Gβ1γ2. Gβγ is an obligate dimer because both subunits are

unstable on their own. Therefore, PhLP1 contributes to their assembly by releasing Gβ1 from

32 CCT and delivering it to Gγ2 . A structure of PhLP1 with Gβ1 bound to CCT shows that it stabilizes the Gβ fold, and disrupts its interaction with CCT so that it can be released to bind Gγ1.

Interestingly, PhLP1 also contributes to the dimer between Gβ5 and the regulator of G protein

signaling (RGS), however, in the case of Gβ5, it stabilizes the interaction between CCT and Gβ5

so that it can fold31.

1.2.7 CCT in disease

Given that CCT is responsible for the folding of so many important proteins, it follows that CCT is relevant to the discussion of many diseases. First and foremost is the role of CCT – and

chaperones, in general – in neurological disorders. The capacity of the proteostasis network to

handle aggregates and proteomic stress decreases with age12. Several of the most common

neurological disorders in the aging population are, essentially, diseases of proteomic stress with

an excess of aggregates that the proteostasis network cannot handle. This includes Alzheimer’s

diseases which is caused by plaque formation of the amyloid peptides (Aβ) and Tau;

Huntington’s disease, which results from a mutant allele adding an aggregation prone poly-

glutamine tracts to the gene huntingtin; and Parkinson’s disease, which is defined by large

aggregates termed Lewey bodies composed mostly of α synuclein98-101. These are complex

diseases where multiple chaperones play a role in handling the buildup of aggregates. CCT has

been shown to prevent the formation of some of these aggregates. For example, CCT is

important for the autophagy-mediated clearance of aggregated mutant huntingtin and other

polyQ containing proteins102. CCT also binds an α-synuclein mutant responsible for Parkinson’s

disease, preventing amyloid fiber assembly69. Furthermore, CCT knockdown leads to an

103 increase in Aβ42 aggregates as well as the aggregation of other neuropathogenic proteins .

Many have argued that chaperonotherapy, or the targeting of chaperones, may be useful in the

case of these neurological diseases104, 105.

Chaperones have also been linked to cancer, as they are often responsible for folding and

assembling oncogenic proteins106. Specifically, CCT is responsible for the folding of signal

transducer and activator transcription (STAT3), VHL, cyclins, and p53, among others94, 107-109.

CCT expression levels tend to be higher in cancer cells, and higher CCT levels often correlate

with a worse prognosis110. Although not usually considered oncogenic proteins, actin and tubulin

play an essential role in cancer. The uncontrolled cell growth and division that takes place in

cancer requires a higher level of actin and tubulin folding, a deregulation of the normal assembly

dynamics that takes place in the cell. The role of CCT in assembling the cytoskeleton makes it

essential to cancer progression56. Disrupting the interaction between tubulin and CCT caused apoptosis in cancer cells, whereas it was much less toxic to non-cancerous cells with normal

CCT levels111. Taken together, these studies suggest that targeting CCT could be a potential

therapeutic for cancer.

In addition to these previously studied substrates of CCT, the work of this dissertation includes

the discovery of a new substrate relevant to cancer – subunits of the mechanistic target of

rapamycin (mTOR) complexes, mLST8 (mammalian Lethal with SEC13 protein 8) and Raptor

(Regulatory associated protein of mTOR).

1.3 mTOR: a master regulator of cell growth and metabolism

The mTOR kinase is a serine/threonine kinase that acts downstream of insulin, nutrients, growth

factors, and other growth promoting stimuli8. The mTOR complexes, identified as mTORC1 and

mTORC2, are master regulators of cell growth, metabolism and survival (Figure 1-4). As such, they are involved in many disease processes and are high-value drug targets6. In addition to the mTOR kinase, the core components of mTORC1 include mLST8 and Raptor, while the mTORC2 core components include mTOR, mLST8, Rictor (rapamycin-insensitive companion of mTOR), and mSIN1 (mammalian stress-activated MAP kinase-interacting protein 1)112, 113.

Figure 1-4. mTOR signaling. Simplified diagram depicting activation of the mTOR complexes and their downstream effects.

1.3.1 The mTOR complexes

The mTOR kinase functions as part of two distinct complexes that each have their own subunits

and unique functions. The mTOR kinase was originally discovered as the target of the drug

rapamycin, with mTORC1 being the rapamycin-sensitive mTOR complex114. In addition to the

kinase itself, the protein mLST8 is included in both mTORC1 and mTORC2. mLST8 binds to

the kinase domain of mTOR, stabilizing the kinase activation loop113. mLST8 is necessary for

the assembly and function of mTORC2, although some evidence suggests that mTORC1 can

function without it115. Because mLST8 is composed of a single β-propeller domain homologous

to the G protein β subunit, it is sometimes called GβL, or Gβ-like. Raptor also contains a C-

terminal β-propeller domain, as well as armadillo repeats and the Raptor N-terminal conserved domain through which it binds mTOR113. Raptor acts to promote substrate recognition, binding

specifically to many mTORC1 substrates, including 4EBP-1 and p70 S6 kinase116, 117. mTORC1

substrates typically contain a conserved mTOR signaling (TOS) motif that is recognized by

Raptor117. The solved mTORC1 structure shows that mTORC1 forms a dimer with mLST8 and

Raptor bound peripherally, associated on opposite ends of mTOR (the kinase domains and the

HEAT repeat domain, respectively), as shown in Figure 1-5a113. The homodimer interface

occurs between two opposite facing mTOR subunits, which are each made up of an α solenoid

domain and a horn and bridge domain linking it to the kinase domain. In addition to the core

components of mTORC1 are the sometimes-associated components proline-rich Akt substrate of

40 kDa (PRAS40) which acts downstream of insulin and AKT to inhibit mTORC1 and DEP

domain containing mTOR interacting protein (DEPTOR), which modulates both mTORC1 and

mTORC2118, 119.

Figure 1-5 Structures of the mTOR complexes. a) mTORC1 structure (PDB 5FLC). b) mTORC2 structure (PDB 5ZC2).

The mTORC2 complex is differentiated from mTORC1 due to its subunits, substrates, and the facts that it is rapamycin-insensitive120. The mTORC2 complex also includes mLST8 for kinase stabilization, but replacing Raptor with Rictor and mSin1 confers unique substrate recognition121.

How Rictor regulates substrate specificity of mTORC2 is not as well understood; however, it is essential for mTORC2 function122. mSin1 is also essential for mTORC2 signaling and appears to stabilize the interaction between mTOR and Rictor123. Instead of PRAS40, mTORC2 is regulated by protein observed with Rictor-1/2 (Protor1/2, also called PRR5L)124, 125. The structure of the core subunits of the mTORC2 complex was solved by cryo-EM to 4.9 Ǻ resolution (see Figure

1-5b)126. Like mTORC1, mTORC2 forms a homodimer with mTOR acting as the scaffold for the complex. The N-terminal domain of Rictor binds close to the binding site of Raptor, explaining why Rictor and Raptor binding is mutually exclusive. They also showed that mSin1 has independent interactions with both mTOR and Rictor, resting between Rictor and mLST8, which

binds in the same location as in the mTORC1 complex. The structure also reveals the mechanism

for rapamycin-insensitivity – Rictor and mSin1 block the FKB12-Rapamycin binding site

discovered in the mTORC1 structure113, 126.

1.3.2 mTORC1 activation

mTORC1 signaling is responsible for the upregulation of various anabolic pathways, such as

protein and nucleotide synthesis, while downregulating catabolic pathways such as autophagy127.

Its activation can be described as a result of the regulation of metabolic homeostasis, determining when the cell needs to use nutrients to grow (anabolic processes) or conserve energy and break down molecules to produce more energy (catabolic processes). Given this, it is important that mTORC1 be activated when nutrients and growth factors are abundant and be inactivated when the cell is experiencing stress environments. Specifically, mTORC1 responds to intracellular amino acids and extracellular growth factors on cell surface receptors, such as insulin128. Central

to the activation of mTORC1 is its recruitment to the lysosomal surface, where it can bind to its

activator, the small GTPase Ras homolog enriched in brain (Rheb)129. Its inhibition by the

tuberous sclerosis complex (TSC) is regulated via TSC phosphorylation by growth-factor

dependent kinases such as AKT or the MAP Kinase Erk8. The tightly regulated activation of

mTORC1 is the convergence of multiple signals on the lysosomal complexes.

mTORC1 is recruited to the lysosome by a group of small GTPases called the Rag GTPases via

an interaction with Raptor129. The Rag GTPases form heterodimers RagA/B-RagC/D with an

active conformation (that recruits mTORC1 to the lysosome) consisting of GTP bound RagA/B

and GDP bound RagC/D. The nucleotide state of the Rag GTPases is regulated by the amino

acid levels in the cells, such that mTORC1 is only recruited when amino acid levels are

sufficient130. For example, leucine has been shown to regulate Rag activity via the GATOR

complexes (GAP activity toward Rag)130. GATOR1 resides on the lysosomal surface and acts as

a GAP for RagA/B, inhibiting mTORC1. GATOR2 inhibits GATOR1, but this interaction is in

turn inhibited by Sestrin (SESN) in the absence of leucine. In the presence of leucine, the

inhibitory effects of Sestrin are relieved, thereby allowing Rag-mediated recruitment of

mTORC1. Another important regulator of the Rag GTPases is the Ragulator complex, which acts

as a GEF, as well as a scaffold for recruiting mTORC1131.

Once mTORC1 has been recruited to the lysosomal surface, it can interact with its activator,

Rheb132. Rheb is a GTP binding protein that is recruited to the lysosomal membrane through a

lipid modification131. A cryo-EM structure of Rheb with mTORC1 shows that Rheb binds mTOR

and causes a conformational change on the catalytic site, activating the kinase133. The activation

of mTORC1 by Rheb is inhibited by TSC complex, which consists of TSC1, TSC2 and TRE-

BUB2-CDC16 domain family member 7 (TBC1D7)134. Many of the signals that regulate

mTORC1 converge on the TSC. Growth factor removal and amino acid starvation leads to

localization of the TSC to the lysosome135. Downstream of the insulin/insulin-like growth factor-

1 (IGF-1), and the PI3 Kinase (phosphatidylinositol-3-OH kinase), AKT phosphorylates TSC1, leading to its dissociation from the lysosome and the subsequent activation of mTORC1136. The

receptor tyrosine kinase dependent Ras signaling also leads to the phosphorylation of TSC2 by

the MAP kinase Erk, inhibiting the TSC8.

In order to avoid growth in poor circumstances, mTORC1 is inhibited by low ATP levels, ER

stress, DNA damage and hypoxia131. Under conditions of stress, AMPK recognizes the change

in the AMP/ATP ratio in the cell and becomes activated by AMP. AMPK then phosphorylates

TSC2 to activate it, deactivating mTORC1, allowing catabolic pathways such as autophagy to

take place. The tight regulation of mTORC1 includes many other factors which work together to

balance the incoming signals of growth conditions versus cellular stress.

1.3.3 Effects of mTORC1 activation mTORC1 serves the essential role of condensing and relaying signals from the cellular environment to mediating a major change in metabolic processes. It regulates the downstream

pathways of protein, lipid and nucleotide synthesis, and autophagy inhibition. These processes

are essential for cellular growth and division.

mTORC1 acts to increase protein synthesis through its direct phosphorylation of the eukaryotic

translation initiation factor 4e-binding proteins (4E-BP1 and 2)137. In its unphosphorylated form,

4E-BP inhibits the translation initiation factor eIF4E, preventing it from forming an active translation initiation complex138. mTORC1 phosphorylation of 4E-BP prevents its inhibition of

eIF4E, therefore allowing for global protein translation. mTORC1 further supports protein

synthesis by controlling the translation of mRNAs containing 5’-terminal oligopyrimidine (TOP)

tracts, which encode for ribosomal proteins and translation initiation factors, thereby increasing

the capacity for peptide synthesis in the cell139. The other main effector on protein synthesis is S6

Kinase (S6K), which mTORC1 directly phosphorylates. S6K acts on several downstream

proteins, including eIF4B, activating its stimulatory activity on the helicase eIF4A140. S6K is also

responsible for the phosphorylation and activation of the 40S ribosomal protein, S6141.

Furthermore, by phosphorylating MAF1, a repressor of Pol III, mTORC1 stimulates the synthesis of RNA involved in protein synthesis142.

In addition to protein synthesis, mTORC1 is responsible for the stimulation of nucleotide

synthesis. Growth and division require nucleotides both in the form of DNA, and ribosomal

RNA. mTORC1 activates de novo pyrimidine synthesis by phosphorylating and activating

carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydro-orotase (CAD)143.

De novo purine synthesis is also activated by mTORC1 by way of the pentose phosphate

pathway and the mitochondrial tetrahydrofolate (mTHF) pathway128, 144. mTORC1 upregulates

lipid synthesis via activation of the sterol responsive element binding protein (SREBP1) which

modulates the expression of enzymes involved in lipid homeostasis145. Several glycolytic enzymes are also activated by mTORC1, shifting glucose metabolism to glycolysis8.

An important aspect of converting the cell into an anabolic state is inhibiting catabolic process

such as autophagy. mTORC1 is responsible for phosphorylating ULK1, which in its

unphosphorylated state activates the key regulator of autophagy, AMPK146. The phosphorylation

of ULK1 inhibits its activating interaction with AMPK. The effect of mTORC1 on the

proteasome is somewhat ambiguous, but it appears that mTOR stimulates the ubiquitin

proteasome system (UPS)-mediated degradation of some proteins, while inhibiting the

degradation of others147.

Through its many roles in the cell, activation of mTORC1 creates a complete shift in

metabolism, preparing the cell for growth and division in times of sufficient nutrients.

1.3.4 mTORC2 activation

The activation of mTORC2 is less well understood than that of mTORC1. mTORC1 activation

requires both external signals (growth factors) and internal signals (nutrient levels); however,

mTORC2 activation appears to be primarily regulated from external signals such as insulin6.

While mTORC1 is responsible for cell growth via mediating metabolic pathways, mTORC2, on

the other hand, is responsible for regulating cell survival. As a cell survival kinase, it must be

regulated with feedback mechanisms to avoid unregulated survival. However, current models

regarding the activation of mTORC2 are highly debated, with much that is not understood.

mTORC2 is activated via the PI3K signaling pathway. PI3K is activated downstream of

receptors such as the insulin receptor via the adapter protein insulin receptor substrate (IRS).

Once active, PI3K is responsible for phosphorylating phosphatidylinositol (3,4)-bisphosphate

148 (PIP2) lipid into phosphatidylinositol (3,4,5)-triphosphate (PIP3) . PIP3 then binds to the PH

domains of both AKT and PDK1, which causes them to translocate to the plasma membrane.

PDK1 then phosphorylates Thr308 in the activation loop of AKT, causing it to become partially

activated148. AKT then phosphorylates and activates mTORC2, specifically phosphorylating

mSin1 at Thr86149. This creates a positive loop because mTORC2 then goes on to phosphorylate

AKT at Ser473 (different from the PDK1 site), causing it to become fully activated. In addition to the phosphorylation of mSin1 by AKT, PI3K catalyzed phosphorylation of PIP2 into PIP3

activates mTORC2 directly. The PH domain of mSin1 binds to the kinase domain of mTOR,

150 suppressing its activity . PIP3 (specifically, the phosphatidylinositol (3,4,5)-triphosphate)

interacts with the PH domain on mSin1, causing it to release from kinase domain on mTOR,

enabling mTOR activation.

While mTORC1 must be associated with the lysosome to be activated, the localization of

mTORC2 is much less clear. Many studies suggest the mTORC2 associates with the plasma

membrane (PM), and its association with the PM is necessary for its function151. Its association

with the membrane is intuitive given its association with receptor mediated signals involving the

membrane, such as the lipid PIP3, and AKT which is associated with the membrane in its active

form150. However, numerous studies have shown mTORC2 localization not only at the plasma membrane, but also at the endoplasmic reticulum, the mitochondria, the cytosol and even the nucleus152. Activation of mTORC2 by growth factors appears to stimulate its association with the

ribosome153. mTORC2 has also been shown to localize to the ER sub-compartment called the

mitochondria-associated ER membrane (MAM), with some studies suggesting that the ER is its

primary localization site154, 155. This corroborates the idea that mTORC2 is bound to ribosomes in

its active form because ribosomes are associated with the MAM156. Consistent with its

localization to the ribosome-associated MAM, mTORC2 can co-translationally phosphorylate

AKT at the ribosome, in addition to its canonical phosphorylation pathway at the PM152. The

localization of mTORC2 to the mitochondria is important for its activity in regulating

mitochondrial associated proteins154.

One explanation for the differences in localization of mTORC2 is the various isoforms of mSin1.

mSin1 has three different isoforms (mSin1.1, mSin1.2, and mSin1.5). These different isoforms

25 form distinct complexes with mTORC2, one of which is not regulated by insulin157. It is possible that these isoforms are expressed differently under various conditions, explaining why mTORC2 localizes different in various cell types and conditions152.

While signaling through growth factors and the PI3K pathway is the most canonical mTORC2 activation pathway, new evidence suggests that mTORC2 can be activated independent of growth factors. For example, β-adrenergic receptor-mediated activation of adenylyl cyclase causes the formation of cAMP. cAMP may then mediate phosphorylation and activation of mTORC2 via PKA158. Further evidence suggests an exercise-induced mechano-mediated phosphorylation of DEPTOR, the inhibitory subunit of mTORC2152, 159. More studies must be done to tease out these mechanisms and understand how they relate to growth-factor stimulated activation of mTORC2.

mTORC2 signaling includes a negative feedback loop for the regulation of its activity. mTORC2 activates AKT, which in turn activates mTORC1. The mTORC1 substrate S6K is responsible for phosphorylating IRS1, which leads to its degradation160. Without IRS1, PI3K is not activated downstream of the receptor, leading to decreased activation of mTORC2. Other enzymes are responsible for modulating the signal activation, such as phosphatase and tensin homolog

(PTEN) which is responsible for catalyzing the conversion of PIP3 back to PIP2 and downregulating mTORC2 singaling152. These signals, among others, work together to balance mTORC2 activation and modulate its activity.

1.3.5 Effects of mTORC2 activation

While mTORC1 is primarily responsible for cell growth by mediating protein synthesis and other metabolic processes, mTORC2 is an important mediator of cell survival and proliferation, as well as cytoskeletal rearrangement. It works by activating kinases and transcription factors that shift the balance of signals away from apoptosis to survival.

mTORC2 effectors are primarily from the AGC (PKA-, PKG-, PKC-related) family of serine/threonine kinases. Some of the first substrates of mTORC2 that were found were protein kinase C (PKC) α/β, through which mTORC2 regulates the actin cytoskeleton.120, 121. mTORC2

activates a Rho1 GTPase, which allows Rho1 to activate PKC and mediate cytoskeletal

remodeling which is important for cell migration and division161. mTORC2 also phosphorylates

serum/glucocorticoid regulated kinase1 (SGK1). SGK1 shares many targets with AKT, but has

some unique targets including NDRG1 and -2 (N-myc downstream-regulated gene), which are

involved in many survival processes and are upstream of p53162.

The prototypical effector of mTORC2 is AKT, which both phosphorylates and is phosphorylated

by mTORC2163. After complete activation by mTORC2, AKT goes on to phosphorylate several

downstream targets, including MAP kinase pathway components, GSK3β (which phosphorylates

and inactivates glycogen synthase), the TSC complex (relieving its inhibition on the mTORC1

complex), and the transcription factor FOXO161. Upon phosphorylation by AKT, FOXO is

translocated from the nucleus to the cytoplasm, where it is ubiquitinated and degraded by the

proteasome164. In the absence of insulin stimulation, FOXO is localized in the nucleus where it

stimulates the transcription of cell cycle arrest and apoptosis stimulating target genes. Notably,

many of these AKT targets can be phosphorylated by SGK1 if AKT is inhibited, and this is a

mechanism of resistance to PI3K or AKT inhibitors165. mTORC2 activity is also important for supporting the immune system166. Activation of mTORC2 is necessary for immune functions,

enhancing growth, division and differentiation of immune cells167.This includes its involvement

in macrophage activation by means such as enhancing interferon regulatory factor (IRF)-4168.

The end result of mTORC2 activation is an upregulation of various cell survival and proliferation

genes.

1.3.6 mTOR signaling in disease

As master regulators of cellular metabolism, growth, proliferation and survival, it comes as no

surprise that the misregulation of the mTOR complexes would be involved in human diseases,

most notably cancer and diabetes.

Type II diabetes is the clinical manifestation of insulin insensitivity on a cellular level. mTOR

mediated responses have evolved to protect people from periods of starvation and are ill-

equipped to handle the excess of food that is common in western society. Over-feeding leads to

the hyperactivation of mTORC1 resulting in a negative feedback loop that phosphorylates S6k1,

which in turn phosphorylates IRS1 and disrupts insulin signaling169. In this case, mTORC1 is likely activated by high nutrient levels rather than downstream of the disrupted insulin signal170.

Additionally, mTORC1 activation leads to increased triglyceride synthesis, and the formation of

white adipose tissue, leading to obesity which further contributes to insulin resistance8.

Understanding the role of mTOR in diabetes is crucial to understanding clinical implications of

the disease.

The relevance of mTOR signaling in cancer is apparent from its involvement in cell survival and

suppression of apoptosis pathways, the misregulation of which perfectly describes the conditions

for cancer171. The role of mTOR in cancer is confirmed by the number of mutations involving

mTOR pathway mediators found in cancer patients, including overactivating mutations of AKT,

Rheb, 4EBP1, PI3K and S6K1, as well as inactivating mutations of TSC1/2 and PTEN161.

Additionally, Rictor amplification is common in human cancers172. These mutations suggest that

mTOR inhibitors may be of use clinically. Rapamycin analogs (Rapalogs) have been tested, but

have had limited success in most cancers, likely due to the fact that Rapamycin primarily inhibits

mTORC1, rather than the survival promoting complex, mTORC2173. ATP-competitive inhibitors

of mTOR may be more useful because they inhibit both mTOR complexes and have been

successful in treating breast cancer174. Even more effective than mTORC inhibitors are dual

inhibitors that can inhibit both PI3K and mTOR175, 176. These inhibitors avoid cells becoming

resistant by using alternate pathways downstream of PI3K and they have been used successfully

in multiple cancer types.

1.4 G protein signaling

In addition to mLST8 and Raptor, another important substrate of CCT is the G protein subunit,

Gβ64. G-protein coupled receptors (GPCRs) transduce extracellular signals to the cell via the

heterotrimeric guanine-nucleotide-binding regulatory proteins (G-proteins). The role of G

proteins in the cell is very diverse, including the regulation of adenylyl cyclase, phospholipase C,

and RhoGEF proteins177. G protein signaling is mediated by the binding of an extracellular

ligand to a GPCR triggers a conformational change which stimulates the dissociation of the G

29 protein heterotrimer into the Gα subunit and the Gβγ dimer, which then go on to bind to and modulate effector proteins. Chapter Two of this dissertation contains a complete review of G proteins; therefore, they will not be discussed in detail here.

1.5 Conclusion

The molecular chaperone CCT plays an essential role in the cell by assisting in the folding of numerous substrates, including the cytoskeletal proteins, actin and tubulin, cell cycle mediators, and important signaling proteins. Its newly discovered role in mTOR complex assembly indicates that it is necessary for functional mTOR signaling. Given the role of mTOR signaling in cell growth and survival, this can further explain why CCT is upregulated in many cancers.

The relevance of both CCT and mTOR to human diseases renders the study of these complexes beneficial to our scientific understand of these diseases. Understanding how CCT assembles mTOR complexes is essential to understanding mTORC biogenesis. Furthermore, inhibiting

CCT-mediated mTORC assembly could prove beneficial in the treatment of disease.

2. G proteins

Willardson, B.M. and Tensmeyer, N.C. (2017) “G Proteins.” eLS. John Wiley and Sons

Abstract

Cells respond to many hormones, neurotransmitters, bioactive peptides and sensory molecules through G protein signaling. The process begins with the binding of the signaling molecule to the extracellular face of a G protein-coupled receptor (GPCR) that initiates binding of the G protein heterotrimer on the intracellular side of the receptor. This interaction causes exchange of

GDP for GTP on the G protein α subunit, triggering a conformational change that dissociates the

Gα-GTP from Gβγ. These G protein sub-complexes then interact with effector enzymes and ion channels and elicit a cellular response to the signal. GPCRs constitute the largest class of transmembrane receptors, with 800 genes in the human genome. Consequently, G protein signaling contributes to almost all aspects of human physiology, and GPCRs are the single most common class of drug targets.

2.1 Introduction

To sustain life all organisms must detect and respond to changes in their environment. This process becomes complex in large, multicellular organisms in which responses to environmental cues must be coordinated among trillions of cells to elicit an appropriate response. The means by which cells detect and respond to these cues is called cell signaling. Key components of cell signaling systems are transmembrane receptor proteins. These proteins span the plasma membrane and interact with extracellular signaling molecules such as growth factors, hormones

31 and neurotransmitters. Binding of these ligands to the receptor results in conformational changes in the receptor that are transduced across the membrane to the cytoplasm to elicit a cellular response. Transmembrane receptors are classified into several classes, including ligand-gated ion channels such as nicotinic acetylcholine receptors, receptor enzymes such as receptor tyrosine kinases, cell adhesion receptors such as integrin receptors, and G protein-coupled receptors such as adrenergic receptors.

G protein-coupled receptors (GPCRs) are by far the largest class of transmembrane receptors.

More than 800 different GPCR genes exist in the human genome, representing approximately

3% of all genes. GPCRs are characterized by their seven-transmembrane helical structure containing a ligand binding site on the extracellular surface and a heterotrimeric GTP-binding protein (G protein) binding site on the intracellular surface178. GPCRs detect an array of signals, including those from the external environment such as odorants, taste molecules and photons of light as well as those from the internal environment such as biogenic amines, amino acids, nucleotides, peptides and Ca2+ ions. As a result, GPCRs are involved in almost all aspects of human physiology from vision to neurotransmission to cardiac output, and they are the single most common class of drug targets in the human genome179.

2.2 G protein signaling

When a GPCR binds an activating ligand (called an agonist) on its extracellular surface, a conformational change occurs in the transmembrane domain that opens up the helical bundle on the cytoplasmic side of the receptor and creates a binding site for the heterotrimeric G protein

(Figure 2-1)180. The G protein consists of three subunits: a 41 kDa Gα subunit, a 37 kDa Gβ

subunit, and an 8 kDa Gγ subunit. The Gα subunit harbors a guanine nucleotide binding site

(hence the name G protein) that is occupied by GDP in its resting state181. GPCR binding opens

up the nucleotide binding pocket on the Gα subunit to release GDP180. Because of the high GTP

to GDP ratio inside the cell, GTP rapidly associates with Gα, causing a conformational change

that dissociates Gα-GTP from both the receptor and the Gβγ dimer182-185. Gα-GTP and Gβγ diffuse along the membrane surface and interact with effectors. G protein effectors consist of enzymes such as adenylyl cyclase186 and phospholipase Cβ187 and ion channels such as inwardly

rectifying K+ channels188 and voltage-gated Ca2+ channels189. Gα-GTP or Gβγ binding modulates

the activity of the effector to change the cellular concentration of second messengers such as

Figure 2-1. Schematic illustration of the G-protein cycle. See text for details. Structures are from the following PDB files: β2-AR bound to Gs, 3SN6; Gi heterotrimer, 1GP2; Gαq bound to RGS8, 5DO9; Gαt, 1TAG; Gαs bound to adenylyl cyclase, 1AZS; Gβ1γ2-GIRK, 5HE1.

cAMP, inositol phosphates and Ca2+ or to alter the membrane potential in the case of ion channel

effectors. These changes drive the cellular response to the agonist.

The duration of G protein activity is controlled by the rate of GTP hydrolysis on Gα. Once GTP

is hydrolyzed to GDP, Gα reassociates with Gβγ to form the inactive heterotrimer. If the agonist

is still present, the GPCR can catalyze another round of nucleotide exchange and reactivate the G

protein. This process of activation, inactivation and reactivation is referred to as the G protein

cycle. The rate limiting step in the cycle is the hydrolysis of GTP to GDP on Gα190. Gα is itself

a GTPase but its intrinsic GTP hydrolysis rate is slow compared to physiological rates191. This discrepancy led to the discovery of GTPase accelerating proteins (GAPs) for Gα that have been given the name “regulators of G protein signaling” (RGS) proteins192. RGS proteins accelerate

GTP hydrolysis by binding Gα-GTP and stabilizing the transition state for breaking the γ

phosphate bond193, 194. In this manner, RGS proteins determine the duration of the G protein

cycle and the time required to terminate the signal after the agonist is gone.

2.3 The G protein gene family

Unlike the 800 GPCRs, there are only 16 Gα subunits, 5 Gβ subunits and 12 Gγ subunits. Thus,

many GPCRs can activate the same G protein, creating a funneling effect in which multiple

GPCRs can initiate similar responses in different cell types, depending on the receptors and G

proteins expressed in a given cell. The Gα gene family is subdivided into four subgroups based on their effector targets and their sequence similarity (Figure 2-2). The Gαs group activates

adenylyl cyclase, the Gαi group inhibits adenylyl cyclase and activates phosphodiesterase, the

Gαq group activates phospholipase Cβ and Rho GTPase nucleotide

Figure 2-2. Gα families have varying roles in the cell. A) Phylogenetic tree of the Gα subunits. Alignments were done using ClustalX and trees were generated using FigTree. The scale bar represents evolutionary distance, a 0.05 fractional change in sequence. B) Table of the Gα subunit families, examples of receptors that activate them, and their expression. C) Schematics of effector activation by the different Gα families.

35 exchange factors, and the Gα12 group activates Rho GTPase nucleotide exchange factors. The receptor classes that activate these Gα subgroups are summarized in Figure 2-2 (see the GPCR database for an extensive list).

Figure 2-3. Families of Gβ and Gγ. A) Phylogenetic tree of the Gβ subunits. B) Table of the Gβ subunits and their expression. C) Phylogenetic tree of the Gγ subunits divided into sub-families. D) Table of the Gγ subunits and their expression.

The five Gβ subunits are classified into two subgroups (Figure 2-3A). Gβs1-4 display more than

80% sequence identity195 and form heterodimers with subsets of the twelve Gγ subunits196.

These are obligate dimers that do not dissociate under physiological conditions. Gβ5 represents

its own subgroup with only 50% sequence identity to Gβ1-4, and rather than interacting with Gγ

subunits, Gβ5 forms obligate dimers with RGS proteins of the R7 family that contain a Gγ-like

197 domain . These Gβ5-R7 RGS dimers are found exclusively in neuronal cells where they

function as the predominant RGS proteins in neuronal G protein signaling.

The twelve Gγ subunits have been subdivided into five subgroups based on sequence identity

31, 196 (Figure 2-3C) and these subgroups show some Gβγ dimer specificity . In vitro, Gβ1 and

Gβ4 form dimers with all Gγ subgroups, whereas Gβ2 preferentially forms dimers with Gγ

31, 196 196 subgroups II and III . In contrast, Gβ3 interacts weakly with all Gγ subgroups . In vivo,

specific Gβγ combinations are found in certain tissues and cell types that are generally consistent with the dimer preferences observed in vitro. The physiological significance of this specificity

has been investigated for some time, and current data suggest some selectivity in effector

activation by different Gβγ pairs198.

2.4 G protein structure

Research into G protein function has benefited greatly from X-ray crystallography studies that revealed the atomic structures of the G protein subunits and the G protein heterotrimer181-185, 199,

200. The Gα subunit consists of two domains, a Ras-like domain that is structurally homologous

to small GTPases and a helical domain unique to Gα (Figure 2-4). The nucleotide binding site is located in a cleft between the two domains. Three switch regions of the Ras domain have 37

different conformations depending on whether GDP or GTP is bound (Figure 2-4B), and these

conformational differences allow signal propagation through Gα. In the GDP-bound state, the switch II region interacts with Gβγ, allowing the heterotrimer to form (Figure 2-4D) 183, 185. In

the GTP-bound state, the change in the switch II conformation disrupts contacts with Gβγ,

resulting in dissociation of the heterotrimer. In Gα-GTP, effector interaction sites involving the switch II region are exposed, allowing Gα-GTP to bind its effectors194, 201-203.

Figure 2-4. Structures of Gαβγ. Structure of Gαt-GTPγS (PDB 1TND). GTPγS is in magenta. B) Aligned structures of Gαt-GTPγS and Gαt-GDP (PDB 1TND and 1TAG, respectively). Switch I, II, and III regions are highlighted in orange and purple for the GTPγS and GDP bound structures, respectively. GDP is shown in red. C) Gβ1γ1 heterodimer (PDB 1TBG). Gβ1 is in blue, Gγ1 is in orange. D) Gαtβ1γ1 heterotrimer (PDB 1GOT). Switch regions are highlighted in purple.

The Gβ subunit consists of seven WD40 repeat sequences that fold into a β-propeller structure

made of seven β-sheets199 (Figure 2-4C). This β-propeller fold is not stable in the absence of

Gγ. The small 70 residue Gγ subunit forms two helices when bound to Gβ199. One helix wraps

around one side of Gβ, making extensive contacts that hold the β-sheets of the β-propeller

together. The other helix forms a coiled-coil interaction with the N-terminal α-helical extension of Gβ that is not part of the β-propeller. Gα-GDP interacts with Gβ on a surface opposite that of

Gγ and makes no contact with Gγ in the Gαβγ heterotrimer183, 185. No conformational changes

occur in Gβγ upon Gα-GDP binding183, 185, 199. However, the same surface of Gβ that binds Gα-

GDP also participates in interactions with effectors204. Thus, Gα-GTP dissociation triggers Gβγ activation by exposing the effector binding site and not by causing conformational changes in

Gβγ.

2.5 G protein biogenesis

To function in the cell, the G protein heterotrimer must be assembled from its individual subunits after they have been synthesized by the ribosome. The assembly process is not trivial, primarily because Gβγ is an obligate dimer in which the individual subunits are not stable on their own.

Early work on Gβγ dimer formation suggested that additional factors were required for assembly205. These factors turned out to be the cytosolic chaperonin CCT and its co-chaperone phosducin-like protein (PhLP1)32, 206. CCT is a large protein folding machine made up of eight

homologous subunits that assemble into a ring structure. Two of these rings associate with each

other to form a 1 MDa double ring structure. Nascent and unfolded proteins bind to a large

cavity in the center of the rings. Each CCT subunit is an ATPase that undergoes a substantial

conformational change upon ATP binding and hydrolysis that closes the folding cavity and traps

39 the substrate inside. Phosphate release opens up the cavity and allows the folded protein to escape. Gβ binds to CCT, but does not release from the folding cavity after the ATPase cycle because it cannot achieve a stable fold without Gγ1. Instead, PhLP1 binds Gβ in the folding cavity, stabilizing the β-propeller and allowing Gβ to dissociate from CCT1. Once released, Gγ binds Gβ in the PhLP1-Gβ complex and forms a stable Gβγ dimer1. Gα can then displace

PhLP1 and bind Gβγ to form the Gαβγ heterotrimer (Figure 2-5).

Figure 2-5. Schematic model for G protein biogenesis. See text for details.

Gα is also assisted in its folding by the chaperone resistance to inhibitors of cholinesterase 8

(Ric-8)207. Ric-8 is a 60 kDa protein that binds to the Gα subunit in the absence of nucleotide

and prior to its association with Gβγ. When the nucleotide binds, Gα is stabilized in its native

fold and Ric-8 dissociates. The nucleotide-bound Gα can then associate with Gβγ. In this

manner, Ric-8 assists Gα in loading nucleotide and achieving its native structure. The fact that

Gα cannot be expressed in the cell in the absence of Ric-8 demonstrates the importance of Ric-8

in Gα folding207.

2.6 G-Protein activation

GPCRs activate G proteins by catalyzing nucleotide exchange on Gα. Structural studies of the

β-adrenergic receptor (β-AR) in complex with the Gs heterotrimer have yielded considerable

insight into the mechanism of nucleotide exchange. The X-ray crystal structure of the β-AR-Gs

complex shows an allosteric exchange mechanism in which β-AR binds regions of Gs far from

180 the GDP binding site to induce GDP release (Figure 2-6A). In the β-AR-Gs complex, the

cytoplasmic end of β-AR helix 6 swings outward away from the receptor’s helical bundle by 14

Å compared to inactive β-AR, opening up the bundle and allowing the C-terminal α5 helix of the

Ras domain of Gαs to insert between the β-AR helices. This interaction is coupled with an

additional interaction between intracellular loop 2 of β-AR and the N-terminal α-helix (αN)-β1

loop of Gαs (Figure 2-6C). These contacts move the other ends of the α5 helix and the β1

strand, displacing the α5-β6 loop and the β1-α1 loop that make contacts with the guanine ring

and the β-phosphate of GDP, respectively (Figure 2-6D). In this manner, receptor binding to

Gαs disrupts the nucleotide binding pocket some 30 Å away from the receptor binding sites and

Figure 2-6. Receptor-mediated changed in G protein structure. A) Structure of the Gs heterotrimer bound to β2- AR (PDB 3SN6). The receptor is in red, Gα is in aqua, Gβ is in blue, Gγ is in orange. The α-helical domain (AH) and the Ras domain are indicated. B) The GTPγS -bound form of Gαs (coral) (PDB 1AZT) aligned with the receptor bound Gαs (aqua), showing the changes in the structure when Gαs binds to the receptor. The receptor- bound Gs was rotated ~180o and Gβγ was removed to view the change in position of the α-helical domain. C) View of the changes in the α5 helix and the αN-β1 loop in the GTP bound Gαs and the receptor bound Gαs. Color scheme is the same as B. D) View of the changes in α1-β1 and α5-β6 loops.

drives GDP dissociation. Upon GDP release, the helical domain of Gαs undergoes a rigid body motion away from the Ras domain and no longer caps the nucleotide binding site. These movements leave the nucleotide binding site on the Ras domain completely open and primed for

GTP binding.

In the β-AR-Gs structure, the receptor does not contact Gβγ and the interface between Gβ and

180 Gαs is unchanged . These observations do not explain the dramatic increase in Gα binding to

receptors induced by Gβγ.208 However, the structure strongly suggests a mechanism by which

Gβγ could enhance receptor binding indirectly. Gβγ interacts extensively with αN of Gαs,

stabilizing the αN-β1 loop and solidifying the interaction of this loop with intracellular loop 2 of

β-AR.

These observations from the β-AR-Gs crystal structure are supported by other structural and

biophysical studies. For example, deuterium exchange mass spectrometry analysis of the β-AR-

209 Gs interaction confirmed the proposed movements in Gs upon β-AR binding. Site-directed spin labeling and double electron-electron resonance spectroscopy also showed a separation of

210 the helical domain from the Ras domain of Gαi upon rhodopsin binding. Finally, the crystal

structure of the adenosine A2a receptor and the Ras domain of Gαs showed similar interactions

211 between the receptor and Gαs.

The nucleotide free receptor-G protein complex captured in the β-AR-Gs crystal structure exists

only transiently at cellular GTP concentrations. GTP binding to the open nucleotide binding site

reverses the process, dissociating the receptor and recapping the nucleotide binding site with the

helical domain. The γ-phosphate of GTP also changes the conformation of the switch II region

of Gα, resulting in dissociation of Gα from Gβγ. Thus, GTP binding disrupts the receptor-G

protein complex, releasing Gα-GTP and Gβγ to interact with effectors and the receptor to

interact with another G protein complex.

2.7 Effector activation

The switch II region of Gα-GTP plays a key role in interactions with effectors. When GTP

binds Gα, the switch II region changes from a disordered structure to an α-helix, creating a cleft

between the switch II helix and the α3 helix of the Ras domain of Gα181, 182. In all Gα-GTP- effector structures that have been solved, the effector makes contacts with switch II and the

194, 201-203 switch II-α3 cleft (Figure 2-7) . In the case of Gαs-GTP bound to adenylyl cyclase

(Figure 2-7A), the switch II helix inserts into a groove on the C2 domain of the cyclase202. This

interaction rotates the C2 domain of adenylyl cyclase relative to the C1 domain, aligning the

active site between the two cyclase domains and allowing cAMP synthesis202. Upon GTP

hydrolysis, the switch II interaction surface is disrupted and many of the contacts between Gαs

and adenylyl cyclase are lost, uncoupling Gαs-GDP from adenylyl cyclase. Rebinding of Gβγ to the switch II region reforms the Gαβγ heterotrimer and completes the inactivation process.

Figure 2-7. Gα effectors. A) Structure of Gαs-GTPγS bound to adenylyl cyclase (green) (PDB 1AZS). Switch regions are highlighted in purple. The α3 helix is highlighted in goldenrod. B) Structure of Gαt-GDP-AlF4 bound to PDEγ (yellow) and RGS9 (pink) (PDB 1FQJ). C) Gαq-GDP-AlF4 bound to PLCβ (salmon) (PDB 3OHM).

In the visual system, the light-activated receptor rhodopsin initiates nucleotide exchange on the visual G protein transducin (Gαt). Gαt-GTP interacts with the inhibitory γ subunit of cGMP phosphodiesterase (PDEγ), displacing it from the activate site to allow cGMP hydrolysis. As

with Gαs and adenylyl cyclase, PDEγ binds in the cleft between the switch II helix and the α3

194 helix of Gαt -GTP (Figure 2-7B) . Interestingly, the GTPase activation domain of RGS9 also participates in this interaction, binding on the side of the switch II helix opposite PDEγ194. In

this position, RGS9 stabilizes the interaction between Gαt-GTP and PDEγ, while at the same time catalyzing GTP hydrolysis194. Thus, activation of PDE results in subsequent inactivation of

Gαt-GTP, creating a brief pulse of PDE activity that quickly subsides. This pulse plays an

important role in vision by allowing the visual system to rapidly adjust to changes in light

conditions212.

Gαq-GTP activates another important G protein effector Phospholipase Cβ (PLCβ). Upon

activation, PLCβ hydrolyzes phosphatidylinositol 4,5 bisphosphate (PIP2) to inositol 1,4,5

2+ trisphosphate (IP3) and diacylglycerol that release internal Ca stores and activate protein kinase

C, respectively. At the same time, PLCβ accelerates the hydrolysis of GTP on Gαq but without

the aid of an RGS protein. The structure of the Gαq-PLCβ complex shows how both PLCβ

201, 203 activation and Gαq-GTP hydrolysis occur (Figure 2-7C) . A helix-turn-helix region of

PLCβ binds in the switch II-α3 helix cleft of Gαq-GTP as seen with other effectors, and this interaction orients the activate site of PLCβ at the membrane, displacing an inhibitory loop from the active site. A second interaction occurs between an EF hand region of PLCβ and the residues

of Gαq that interact with GTP, accelerating GTP hydrolysis. Thus, the interaction activates PLCβ

and subsequently inactivates Gαq-GTP, creating a transient pulse of PLCβ activity like the pulse

of PDE activity discussed above.

2.8 G protein inactivation

G proteins are inactivated by GTP hydrolysis on Gα-GTP and reassociation of Gβγ with Gα-

GDP. Proteins containing RGS domains, or the effector itself in the case of PLCβ, accelerate the

rate of GTP hydrolysis. Over 20 proteins have been found with functionally active RGS

- domains, and the structures of several bound to Gα-GDP-AlF4 , a transition state analog for GTP

hydrolysis, have been determined193, 194, 213, 214. These structures show that interactions between

Gα and the RGS domain stabilize the transition state for GTP hydrolysis without directly

contributing residues to the active site (Figure 2-8). In particular, interactions with RGS

position a threonine residue in switch I (T177 in Gαt) and a glutamine residue in switch II (Q200

in Gαt) to orient a water molecule that attacks the γ-phosphate and hydrolyzes the phosphodiester

bond193, 194. By controlling the rate of GTP hydrolysis in this manner, RGS proteins set the

duration of the G protein cycle.190

Figure 2-8. Regulation of Gα by RGS proteins. Changes in Gαt upon RGS9 binding. A) RGS9 (pink) orients Thr 177 and Gln 200 on Gαt - (aqua) to stabilize the transition state for GTP hydrolysis (PDB 1FQJ). Switch regions are in purple, GDP is in red, water is in blue, AlF4 is in 2+ ¯ yellow, Mg is in green. B) Comparison of RGS9 bound Gαt-GDP-AlF4 with Gαt-GTPγS (PDB 1TND) to show the changes in Thr 177 and ¯ Gln 200. RGS9 bound Gαt-GDP-AlF4 is in purple and Gαt-GTP is in orange.

2.9 Physiology of G protein signaling – vision

We will now turn to some examples of how G protein signaling contributes to important

physiological processes, beginning with the G protein cascade of vision. Vision research has

yielded a wealth of information about G protein signaling. Visual signaling occurs in the rod and

cone photoreceptor cells of the retina. These cells have a unique morphology, consisting of a

large cilium, called the outer segment, filled with thousands of membrane discs containing a high

concentration of the GPCR rhodopsin for efficient photon capture. Rhodopsin has a covalently

bound antagonist, 11-cis retinal, that absorbs a photon of light and isomerizes to all-trans retinal which is a potent agonist. The 7-transmembrane helical bundle of rhodopsin opens up to bind the C-terminus of Gαt, which elicits nucleotide exchange in a manner similar to that observed

210, 215 with Gs and the β-adrenergic receptor . Upon GTP binding, Gαt-GTP dissociates from rhodopsin and diffuses along the disc membrane until it binds the PDEγ subunit along with

194 RGS9-Gβ5 complex . This interaction activates the PDEα and β subunits by displacing PDEγ from the active site. Activated PDE rapidly hydrolyzes cGMP, depleting the cGMP concentration in the outer segment and causing cGMP dissociation from cGMP-gated cation channels in the outer segment plasma membrane. In the dark resting state, the cGMP concentration is high, and the channels are open, which maintains the photoreceptor cell in a depolarized state. When the channels close upon light activation, the photoreceptor cell hyperpolarizes, which causes voltage-gated Ca2+ channels to close at the photoreceptor synapse

and block the release of glutamate into the synaptic cleft between the photoreceptors and ON- bipolar cells. Thus, unlike other neurons, photoreceptors are depolarized in their inactive state and hyperpolarized in their active state.

In contrast, ON-bipolar cells are hyperpolarized in the dark resting state by the action of

glutamate at the synapse. Glutamate binds the mGluR6 GPCR on the ON-bipolar cell post-

216, 217 synaptic membrane and mGluR6 activates Gαo . Gαo-GTP and Gβγ interact with TRPM1

cation channels in the synaptic membrane and holds TRPM1 in a closed, inactive state218. Light

reduces the glutamate concentration in the synapse, inactivating mGluR6 and allowing RGS-

219 mediated GTP hydrolysis to inactivate Gαo . The TRPM1 channels open, depolarizing the

ON-bipolar cells and initiating neurotransmitter release by the ON-bipolar cells to activate

ganglion cells that project from the retina to the brain via the optic nerve. These visual signals

are integrated in the visual cortex to produce an image in the brain. In this manner, G proteins

play an essential role in both photoreceptor cells and ON-bipolar cells to convert light into a neuronal response that produces vision.

2.10 Physiology of G protein signaling – synaptic transmission

Electrical impulses are initiated in excitable cells, such as the retinal bipolar cells mentioned above, by a signaling event that results in membrane depolarization and release of neurotransmitters (such as acetylcholine) into the synaptic cleft. The neurotransmitters bind and open cation channels (such as the nicotinic acetylcholine receptor channel) in the post-synaptic

membrane of the downstream neuron. The resulting influx of Na+ and Ca2+ causes a local

depolarization at the post-synaptic membrane that in turn opens voltage-gated Na+ channels in

the axon, initiating an action potential. The wave of depolarization is propagated down the axon

to the presynaptic membrane where voltage-gated Ca2+ channels open and release Ca2+. The

increase in Ca2+ concentration triggers neurotransmitter release into the next synapse. In this

manner, the electrical impulse is passed between neurons and from neurons to muscles at neuro-

muscular junctions.

G proteins down-regulate neuronal signaling by inhibiting voltage-gated Ca2+ channels189. For

example, muscarinic acetylcholine receptors (ACM2, ACM4) in the presynaptic membrane bind

the acetylcholine in the synapse and activate the Gi/o family of G proteins. The Gβγ dimers

2+ released upon activation bind the cytoplasmic region of Cav2 voltage-gated Ca channels and

inhibit channel opening220, 221. The resulting decrease in Ca2+ at the presynaptic membrane

blocks further neurotransmitter release until the acetylcholine is cleared from the synapse.

Similarly, hormones such as enkephalins or drugs such as morphine bind to opioid receptors at

the presynaptic membrane and activate Gi/o, releasing Gβγ to inhibit Cav2 channels prior to the

neuronal signal222. In this manner, opioid drugs block neuronal impulses and elicit their pain-

relieving effects.

G proteins also down-regulate neuronal signaling by activating G protein-coupled inwardly

+ 188 rectifying K (GIRK) channels . In this case, the Gβγ released from activation of Gi/o by opioid

and other receptors in the presynaptic membrane binds the cytoplasmic region of GIRK channels

and opens the channels223. The resulting efflux of K+ hyperpolarizes the cell and opposes the

depolarization from action potentials. Thus, Gβγ inhibits neuronal signaling by both inhibiting

Cav2 channels and activating GIRK channels.

In addition to down-regulating neuronal signaling, Gβγ activation of GIRK channels plays an

important role in regulating heart rate. Release of acetylcholine by parasympathetic neurons at

the neuromuscular junction between the vagus nerve and the atrial pacemaker cells of the heart

slows the heart rate by binding to M2 receptors and activating Gi/o. Upon activation, Gβγ opens

GIRK channels and hyperpolarizes the pacemaker cell. Hyperpolarization decreases the firing

rate of the pacemaker cells and slows heart rate.

2.11 Physiology of G protein signaling – insulin section

Type II diabetes mellitus is major health concerns worldwide as obesity prevalence in the

population increases. Diabetes can be avoided by maintaining insulin secretion from pancreatic

beta cells and inhibiting beta cell loss. G protein signaling controls insulin secretion from beta

cells224. Glucose and other nutrients trigger the release of peptide hormones such as glucagon-

like peptide (GLP-1) from the digestive tract that activate the GLP-1 receptor in pancreatic beta

cells. The GLP-1 receptor couples to Gαs and activation of adenylyl cyclase increases cAMP

concentration in beta cells225. This increase in cAMP contributes to insulin secretion and also promotes beta cell proliferation that maintains beta cell mass224. As a result, GLP-1 receptor agonists are effective in treating type II diabetes226.

In contrast, GPCRs coupled to Gαi have been shown to decrease insulin secretion and beta cell

proliferation by inhibiting adenylyl cyclase and decreasing cAMP concentration in beta cells224.

For example, prostaglandin E2 (PGE2), produced in response to inflammation, interacts with the

prostaglandin EP3 receptor in beta cells, resulting in activation of Gαz and inhibition of adenylyl

227 cyclase . Gαz produces prolonged inhibition of the cyclase because the Gαz GTPase rate is

slow, causing extended decreases in cAMP that inhibit insulin secretion and block beta cell

proliferation224. Thus, PGE2 receptor antagonists show promise as potential therapeutics for type

II diabetes227.

These examples are just a few of the many roles of G protein signaling in human physiology.

The pervasiveness of G protein signaling explains why GPCRs are such important therapeutic

targets for treating human disease, ranging from diabetes and cancer to heart disease and

neurological disorders. The wealth of GPCR-based drugs arises from decades of intense research into the mechanisms of G protein signaling, which will continue to produce new and more effective treatments into the foreseeable future.

2.12 Acknowledgements

I hereby acknowledge that the use of this article is compliant with all publishing agreements.

I would like to acknowledge my advisor, Dr. Barry Willardson as a co-author on this paper.

3. Structural and functional analysis of the role of the chaperonin CCT in mTOR complex assembly

Cuéllar, J., Ludlam, W.G., Tensmeyer, N.C. et al. Structural and functional analysis of the role of the chaperonin CCT in mTOR complex assembly. Nat Commun 10, 2865 (2019). https://doi.org/10.1038/s41467-019-10781-1

Abstract

The mechanistic target of rapamycin (mTOR) kinase forms two multi-protein signaling

complexes, mTORC1 and mTORC2, which are master regulators of cell growth, metabolism,

survival and autophagy. Two of the subunits of these complexes are mLST8 and Raptor, β-

propeller proteins that stabilize the mTOR kinase and recruit substrates, respectively. Here we report that the eukaryotic chaperonin CCT plays a key role in mTORC assembly and signaling by folding both mLST8 and Raptor. A high resolution (4.0 Å) cryo-EM structure of the human mLST8-CCT intermediate isolated directly from cells shows mLST8 in a near-native state bound to CCT deep within the folding chamber between the two CCT rings, and interacting mainly with the disordered N- and C-termini of specific CCT subunits of both rings. These findings describe a unique function of CCT in mTORC assembly and a distinct binding site in CCT for mLST8, far from those found for similar β-propeller proteins.

3.1 Introduction

The mTOR (mechanistic target of rapamycin) protein kinase is a master regulator of cell growth, metabolism and survival, and as such, it constitutes a high-value drug target8. mTOR interacts

with mLST8 (mammalian Lethal with SEC13 protein 8) and Raptor (Regulatory associated protein

of mTOR) to form mTOR complex 1 (mTORC1)113, or with mLST8, Rictor (rapamycin-

insensitive companion of mTOR), and mSIN1 (mammalian stress-activated MAP kinase-

interacting protein 1) to form mTOR complex 2 (mTORC2)126. These complexes are functionally

distinct as mTORC1 is activated by growth factors and amino acids to promote protein, lipid and

nucleic acid synthesis and inhibit autophagy, while mTORC2 functions upstream of mTORC1 in

growth factor signaling to activate cell survival pathways by phosphorylating the kinases AKT,

PKC and SGK18.

In order to perform their signaling functions, the mTOR complexes must be assembled from their

nascent polypeptides. Protein complex assembly is often mediated by molecular chaperones that

assist nascent or misfolded proteins to achieve their native structures and assemble into functional

complexes228. Protein folding and complex formation seldom occurs spontaneously in the very

concentrated protein environment of the cell, but requires chaperones to protect proteins from aggregation, to channel their folding pathways and to facilitate their association into multi-protein assemblies228. The mTOR kinase is a 289 kDa protein that requires the Hsp90 chaperone and the

Tel2-Tti1-Tti2 (TTT)-R2TP co-chaperone complex to fold properly229, 230. However, little is

known about how the other mTORC components are folded and brought together with mTOR.

Yeast genetic studies have pointed to a possible role for the cytosolic chaperonin containing TCP-

1 (CCT, also called TRiC) in mTOR complex formation. Over-expression of CCT subunits

suppressed phenotypes associated with temperature sensitive mutations of yeast TOR and LST8,

indicating a genetic interaction between CCT and the yeast TOR complex231, 232. Furthermore,

genetic disruption of CCT ATPase activity resulted in phenotypes similar to those observed with

loss of yeast TOR signaling233. These findings in yeast are consistent with results from human

interactome studies that identified interactions between mLST8 and Raptor with CCT, but not with

the other mTORC components234.

CCT is a eukaryotic member of the chaperonins which are divided in two types: type I, which is

present in eubacteria and in organelles of endosymbiotic origin; and type II, which is present in

archaea and the eukaryotic cytosol. All are large oligomers that form a double-ring structure75, 235.

CCT is the most complex of all chaperonins with each of the two rings composed of eight paralogous subunits (referred to here as CCT 1-8). At the center of each ring is a protein folding chamber measuring approximately 60 Å in diameter236 with a volume large enough to encapsulate

a 70 kDa protein88. Each of the subunits of CCT and the other chaperonins can be divided into three domains: the equatorial domain, which hosts the ATP binding site and most of the intra- and

inter-ring interactions; the apical domain, which is believed to be responsible for substrate

recognition and binding; and the intermediate domain, which acts as a linker between the other

two domains. ATP binding and hydrolysis in the CCT subunits induce conformational changes in

the CCT structure that drive protein folding237, 238. Unfolded polypeptides bind within the folding chamber when CCT is in its open conformation and the nucleotide binding sites are empty1, 239.

As ATP binds and the ATP hydrolysis transition state is achieved, the chamber closes, due to the movement of a long α-helical protrusion in each subunit, and the protein is trapped within the chamber76, 240, 241. This entrapment assists folding by confining the degrees of conformational

freedom of the polypeptide and by influencing the folding trajectory75, 235. After ATP hydrolysis,

the chamber opens and if the protein has achieved a native fold and lost its contacts within the

chamber, it is released.

CCT assists in folding proteins with multiple domains or complex folds and helps to assemble

multi-protein complexes1, 71. Among these, proteins with β-propeller domains are an important class of CCT folding substrates28, 242. β-propeller domains commonly consist of seven WD40

repeat sequences that fold into seven β-sheets that form the blades of a propeller-like circular structure199. β-propellers have a unique folding trajectory that requires the C-terminus to interact

with the N-terminus to make the last β-sheet that closes the β-propeller. CCT may help bring the termini together and assist the β-propeller to close during folding242. These β-propeller domains

have important functional roles from protein-protein interactions to enzymatic catalysis. β- propeller proteins that are folded by CCT include G protein β subunits (Gβ)1, 243, the cdc20 and

cdh1 components of the anaphase promoting complex28, and the protein phosphatase 2A regulatory

subunits66 among others.

Two of the subunits of mTOR complexes, mLST8 and Raptor, contain β-propeller domains113, 244. mLST8 consists entirely of a single β-propeller that binds and stabilizes the mTOR kinase domain113, 244, while Raptor contains a C-terminal β-propeller113, 133 that may bind regulatory

proteins113, 245. The mLST8 β-propeller shows strong structural homology with the β-propeller of

Gβ199, 244, further suggesting that mLST8 may be folded by CCT. To test this possibility, we used functional and structural approaches to investigate the role of CCT in mTORC formation and signaling. Our findings suggest that CCT contributes to mTORC assembly and signaling by folding the mLST8 and Raptor β-propellers. We solved the structure of the mLST8-CCT intermediate in mTORC assembly by cryo-EM to 4.0 Å. At this resolution, the structure shows an almost native mLST8 β-propeller bound to CCT in an unexpected position deep within the folding chamber between the two CCT rings, revealing a unique means by which a β-propeller substrate is recognized by CCT.

3.2 Results

3.2.1 mLST8 and Raptor β-propellers bind CCT

To begin to examine the possible role of CCT in mTORC assembly and function, we sought to

confirm the interaction of mLST8 and Raptor with CCT reported in human interactome

studies234. We ectopically expressed human mLST8 or Raptor in cells and assessed their binding

to endogenous CCT by co-immunoprecipitation. With mLST8, we observed strong co-

immunoprecipitation when either mLST8 or CCT5 was immunoprecipitated, indicating a robust

interaction between mLST8 and CCT (Figure 3-1a-b). Similar results were observed with

human Raptor and CCT5 (Figure 3-1c-d). To determine the domain of Raptor responsible for

the interaction, we expressed Raptor truncations containing the C-terminal β-propeller (residues

1000-1335) or the N-terminal caspase homology and armadillo repeat domains (residues 1-999)

and measured their binding to CCT by co-immunoprecipitation (Figure 3-1e-f). The C-terminal

β-propeller domain bound CCT robustly while the N-terminal domains showed no interaction, indicating that Raptor binds CCT through its β-propeller domain. We also tested the binding of mTOR and the other core components of mTORC2, Rictor and mSIN1 to CCT by co- immunoprecipitation and found no interaction (Appendix A Figure 1). Collectively, these findings demonstrate interactions of the mLST8 and Raptor β-propellers with CCT and suggest that CCT might be involved in their folding.

To further test the possibility that the mLST8 and Raptor β-propellers are folded by CCT, we measured the effect of ATP on their co-immunoprecipitation with CCT. Substrates are known to release from CCT in an ATP-dependent manner246. We incubated our CCT immunoprecipitates

containing mLST8 (Figure 3-1g) or Raptor (Figure 3-1h) with 5 mM ATP and measured the

Figure 3-1. mLST8 and Raptor bind CCT. (a) β-propeller structures of Gβ (PDB 1TBG) and mLST8 (PDB 4JT6). The β-sheets are numbered according to convention with blade 7 containing β-strands from both the N- and C- termini. (b) Co-immunoprecipitation of mLST8 and CCT. HEK-293T cells were transfected with mLST8 or an empty vector (EV), immunoprecipitated and immunoblotted as indicated. Co-immunoprecipitating bands are marked (red asterisks). (c) Raptor structure (PDB 5EF5) with β-sheets numbered as in panel a. (d-f) Co- immunoprecipitation of Raptor and CCT. Cells were transfected with full length HA-tagged Raptor (d), or HA- tagged constructs containing the C-terminal β-propeller (e) or the N-terminal caspase and armadillo domains (f). Control cells were transfected with empty vector as indicated. Cells were immunoprecipitated and immunoblotted as indicated. All blots are representative of at least three separate experiments. (g) ATP causes release of mLST8 from CCT. CCT immunoprecipitates from cells over-expressing mLST8 were treated with 5 mM ATP for the times indicated, washed and immunoblotted for mLST8 and CCT5. The amount of mLST8 remaining is shown as a percent of the no ATP control. Error bars smaller than the symbols are not visible. (h) ATP causes release of Raptor from CCT. The CCT immunoprecipitation experiment was repeated with cells over-expressing Raptor. Source data are provided in the Source Data file.

amount of each that remained bound over time. ATP decreased mLST8 and Raptor binding to

CCT in a time-dependent manner, reaching a steady-state reduction of 60 % with a half-life of 40

min for mLST8 and a steady-state reduction of 50 % with a half-life of 37 min for Raptor, indicating that both are indeed CCT folding substrates. These release rates are significantly slower than the 7 min half-life reported for release of actin from CCT under different in vitro

conditions247, suggesting that slow release may be a common property of WD40 proteins.

3.2.2 CCT contributes to mTORC assembly and signaling

To assess the contribution of CCT to mTOR complex formation, we sought a method to genetically deplete CCT from cells without compromising viability. The CCT complex is essential and cannot be deleted without causing cell death over time. To resolve this issue, we chose a CRISPR approach that decreased expression of CCT in a cell population significantly without completely eliminating it (Figure 3-2a, see Methods). In these cells, CCT expression was reduced by 80 %, resulting in significant decreases in expression of endogenous mTOR (65

%), mLST8 (40 %) and Raptor (50 %) but not Rictor, mSIN1 or the GAPDH control (Figure 3-

2b), indicating that the effect was specific. The changes in expression occurred post- transcriptionally because CCT depletion had no effect on mTOR, mLST8 or Raptor mRNA levels (Appendix A Figure 2a). Thus, the decreases in mLST8 and Raptor expression are most likely due to their inability to fold, while the decrease in mTOR expression may result from an inability to form stable complexes in the absence of CCT.

To examine further the contribution of CCT in mTORC1 assembly, we ectopically expressed mTOR, Raptor and mLST8 in CCT-depleted cells and assessed mTORC1 formation by

Figure 3-2 CCT contributes to mTORC assembly. (a) Workflow of the CCT depletion experiments. Bold letters correspond to the figure panels in which the experimental results are displayed. (b) Effects of CCT depletion on endogenous mTORC subunit expression. Cells were treated with CCT5 sgRNA or control sgRNA and Cas9, lysates were immunoblotted and band intensities were quantified as indicated. Data are shown as a percent of the control. Bars represent the average ± standard error. (c) Effects of CCT depletion on co-immunoprecipitation of mTORC1 subunits. Cells were CRISPR treated and transfected with the indicated mTORC1 subunits and a GFP control. mTOR immunoprecipitates were immunoblotted and quantified as indicated. (d) Lysates from cells in panel c were immunoblotted and quantified for expression of mTORC1 subunits and controls as indicated. (e) Effects of CCT depletion on co-immunoprecipitation of mTORC2 subunits with mTOR. Cells were CRISPR treated and transfected with the indicated mTORC2 components and a GFP control. mTOR immunoprecipitates were immunoblotted and quantified as indicated. (f) Lysates from the cells in panel e were immunoblotted and quantified for expression of mTORC2 subunits and controls as indicated. (g) Effects of CCT depletion on co-immunoprecipitation of Gγ with Gβ. Cells were CRISPR treated and transfected with Gβ, Gγ and a GFP control. Gβ immunoprecipitates were immunoblotted and quantified as indicated. (h) Lysates from the cells in panel g were immunoblotted and quantified for expression of Gβ and Gγ and controls as indicated. (i) Effects of siRNA-mediated CCT depletion on insulin-mediated IRS1 S636/639 phosphorylation or AKT S473 phosphorylation in HEPG2 cells. Cells were treated with siRNAs to CCT1/CCT5, mLST8, Raptor or a non-targeting control, serum starved for 18 hours and then treated with insulin. Cell lysates were immunoblotted as indicated. * p < 0.05, ** p < 0.01, *** p < 0.005.

measuring the co-immunoprecipitation of Raptor and mLST8 with mTOR as well as the cellular

expression of each subunit. CCT depletion resulted in a 65 % decrease in mTOR

immunoprecipitation with corresponding decreases in mLST8 and Raptor co-

immunoprecipitation (Figure 3-2c). This decrease in mTORC1 formation could be attributed to

similar decreases in mTOR, mLST8 and Raptor expression upon CCT depletion (Figure 3-2d).

The effect appeared specific because ectopic expression of GFP or endogenous expression of

GAPDH was unchanged with the loss of CCT (Figure 3-2). The decrease in mTORC1 components upon CCT depletion is similar to that seen with Gβ, a known CCT folding substrate

(Figure 3-2g-h) but less than Gγ, a small 70 amino-acid protein that is rapidly degraded when the Gβγ dimer cannot form32, 243. Collectively, these results suggest that CCT contributes

significantly to mTORC1 formation. When CCT is depleted, mLST8 and Raptor are

destabilized, which results in less mTORC1 assembly and decreased mTOR expression.

In the case of mTORC2, CCT depletion did not change mTOR immunoprecipitation, but it

caused a decrease in mLST8 (50 %) and mSIN1 (30 %) co-immunoprecipitation (Figure 3-2e).

Unexpectedly, Rictor co-immunoprecipitation increased by 70 %. These changes generally paralleled the changes in ectopic expression of the subunits, which showed an increase in mTOR

(40 %), a striking increase in Rictor (300 %), a decrease in mLST8 (50 %) and no change in mSIN1 (Figure 3-2f). The effects appeared specific because expression of the controls was unchanged. These findings suggest that mLST8 incorporation into mTORC2 also depends on

CCT, but that CCT depletion significantly increases Rictor expression and association with mTOR, perhaps as a result of decreased endogenous Raptor, given that Rictor and Raptor are known to compete for mTOR binding248. To test this possibility, we measured the effects of

CRISPR-mediated Raptor depletion on ectopic expression of mTORC2 subunits. Raptor loss resulted in an increase in Rictor expression, while there was little change in the other mTORC2 subunits (Appendix A Figure 2b). These results suggest that CCT depletion decreases Raptor expression, which causes a compensatory increase in Rictor expression under these conditions.

CCT contributions to mTORC assembly should also be reflected in mTOR signaling. To test this possibility, we assessed the effects of CCT depletion on mTOR-dependent phosphorylation downstream of insulin in HEPG2 cells. Cells were siRNA-depleted of CCT and treated with insulin. mTORC1 activity was assessed by IRS1 S636/S639 phosphorylation249, while mTORC2 activity was assessed by AKT S473 phosphorylation163. For comparison, cells were also siRNA- depleted of mLST8 or Raptor. CCT depletion resulted in a 40 % inhibition of both IRS1 and

AKT phosphorylation, which was similar to the decreases observed with mLST8 depletion

(Figure 3-2i). Likewise, Raptor depletion caused a 50 % decrease in IRS1 phosphorylation, but showed no change in AKT phosphorylation as expected (AKT is only a substrate of mTORC2).

These results support the idea that CCT participates in mTOR signaling by assisting in the incorporation of mLST8 and Raptor into mTORC1 and mLST8 into mTORC2.

3.2.3 PhLP1 does not assist in mTORC assembly

The participation of CCT in mTOR complex formation raises the possibility that the CCT co- chaperone PhLP1 may also be involved, especially since PhLP1 is required for Gβ to fold and assemble into the Gβγ dimer32. To test this possibility, we used the same CRISPR strategy to deplete cells of PhLP1 and measure the effects on mTOR subunit expression and assembly.

Unexpectedly, there was no decrease in expression of endogenous mTORC subunits despite a 70%

reduction in PhLP1 (Appendix A Figure 3a). Likewise, there was no change in formation of

mTORC1 and mTORC2 (Appendix A Figure 3b-c). In contrast, this same PhLP1 depletion resulted in a striking 90 % decrease in Gγ association with Gβ, as expected (Appendix A Figure

3f-g). These results argue against a contribution of PhLP1 to mLST8 or Raptor folding and

highlight differences between Gβ and mLST8 folding despite their structural similarities.

3.2.4 cryo-EM structure of the mLST8-CCT assembly intermediate

To investigate the mechanism of mLST8 and Raptor folding by CCT, we sought to isolate CCT-

bound intermediates directly from cells and characterize their structures using cryo-electron

microscopy (cryo-EM) and single-particle 3D reconstruction. We were successful at isolating

human mLST8 bound to endogenous CCT from HEK-293T cells over-expressing mLST8 using a

tandem affinity chromatography strategy without adding exogenous nucleotide (Appendix A

Figure 4a). However, Raptor-CCT complexes could not be readily isolated using a similar

strategy, possibly due to its large N-terminal domain which does not interact with CCT and might

result in a less stable complex. Therefore, we focused our structural characterization efforts on the

mLST8-CCT complex.

The purified mLST8-CCT complex was vitrified on grids and images were recorded with a Titan

Krios electron microscope (Appendix A Figure 4b). A total of 1,769,600 particles were selected

and subjected to 2D classification (Appendix A Figure 4c and Appendix A Table 1). The classes

showed mostly the two typical views, the end-on and side orientations, and the best classes

(1,197,358 particles) were subjected to a set of 3D classifications from which 452,000 particles

were selected for further processing. The angular coverage was very good (Appendix A Figure

4d) and the final 3D reconstruction reached 4.0 Å resolution after post-processing (Appendix A

Figure 4c). The resolution was not isotropic with the central, equatorial domains yielding higher

resolution than the flexible apical domains (Appendix A Figure 4f-g). The reconstruction shows

human CCT in an open conformation with a prominent mass located in the center of the structure

between the two CCT rings (Figure 3-3a). The apical domains have a very asymmetric

arrangement in which the eight subunits in each ring are arranged as a tetramer of dimers as

observed previously for yeast CCT236. Besides the large central mass, the structure is similar to

those of bovine and yeast CCT in their open conformations236, 239, 247, in particular to the structure

described by Zang et al.236 for yeast CCT in the AMP-PNP-bound conformation, despite the fact that the mLST8-CCT was purified in the absence of added nucleotide.

Docking of the atomic model of yeast CCT in the AMP-PNP conformation236 (PDB 5GW5) into

the mLST8-CCT reconstruction confirms the similarity between the two structures (Appendix A

Figure 5a). The docking is almost perfect in the equatorial domains and very good in the

intermediate and the base of the apical domains, which allowed us to unambiguously assign the

different subunits of the chaperonin in the mLST8-CCT complex (Appendix A Figure 5a). The

most important differences in the docking are located in the helical protrusions, which are angled

downward more toward the center of the central cavity in the mLST8-CCT structure (Appendix

A Figure 6). We used the atomic model of the yeast CCT in the AMP-PNP conformation and the

sequences of the human CCT subunits to generate an atomic model that we subjected to flexible

docking into the 3D reconstruction of the mLST8-CCT complex using the program IMODfit250.

This atomic model was subsequently refined applying the real-space refinement protocol in

PHENIX251 and Refmac5 in CCPEM. Regions where density was absent were eliminated from the

63 final model. This structure provides a high-resolution atomic model for human CCT (Figure 3-

3b, Appendix A Figure 5b and Appendix A Table 2).

Figure 3-3. Cryo-EM structure of the mLST8-CCT complex. (a) Top, the two end-on views of the 3D reconstruction of the mLST8-CCT complex. Bottom, side view of the complex, either intact (left) or sliced through the center of the mass (right), to show the presence of the mLST8 molecule (red asterisks). (b) Docking of the human CCT atomic model into mLST8-CCT 3D reconstruction. The color scheme for the CCT subunits is kept the same in all the figures. Bar indicates 50 Å.

3.2.5 Position of mLST8 in the CCT folding cavity

The most striking difference between the human mLST8-CCT structure and CCT structures from

bovine and yeast236, 239, 247 is the presence of the mass in the interior of the cavity, positioned

between the two CCT rings and contacting both rings (asterisks in Figure 3-3). The mass has a

circular shape, indicative of a β-propeller, and docking of the atomic structure of mLST8, as found

in the mTORC1 complex244, is very good (Figure 3-4). The quality of the fit can be clearly seen

when the mass attributable to mLST8 along with the docked mLST8 atomic structure is extracted

from the structure (Figure 3-4c). These observations suggest that the mass corresponds to mLST8

in a stable conformation that resembles the native state. However, some internal mass has been

detected at the level of the equatorial domains in previous 3D reconstructions of substrate-free

CCT236, 252. Thus, to determine if the mass we observed was indeed mLST8, we carried out a 3D

reconstruction of human CCT in the absence of mLST8 and compared the structures. For this, we

isolated substrate-free human CCT from HEK-293T cells without mLST8 over-expression

(Appendix A Figure 7a). The purified CCT was vitrified on grids and images recorded in a Titan

Krios. A total of 504,060 particles were selected and subjected to a 2D classification. The best classes (139,819 particles) were used for a 3D reconstruction, which attained 7.5 Å resolution

(Appendix A Figure 7b and Appendix A Table 1). The resulting volume, albeit at a lower resolution, shows similar structural features to that of the mLST8-CCT complex, with an open and asymmetrical distribution in the apical domains. The major difference between the two 3D reconstructions is the extent and shape of the mass resolved in the cavities of the CCT structure

(Appendix A Figure 7c). The mass in the mLST8-CCT complex is large and accounts for the β- propeller structure of mLST8, while that of the substrate-free CCT is much smaller and can only be explained as part of the N- and C-terminal disordered regions of the CCT subunits known to

reside at the bottom of the folding cavity76, 80. This result reinforces the assignment of the internal mass between the rings to mLST8 in the mLST8-CCT structure.

Figure 3-4. Position of mLST8 within the mLST8-CCT complex. (a) Docking of the atomic structure of mLST8 (PDB 4JT6) into the corresponding mass of the 3D reconstruction of the CCT-mLST8 complex. Left, sliced side view, and right, end-on view, show how mLST8 fits in the corresponding density. (b) Detailed views of the CCT subunits of each ring involved in mLST8 interaction, showing how the unstructured N- and C-termini of several subunits contact mLST8. Left, top ring, shows interactions with CCT5, CCT7, CCT8, CCT6 and CCT3, and right, bottom ring, with CCT5´, CCT7´, CCT8´, CCT6 ´and CCT1´. (c) The extracted cryo-EM density from between the rings with mLST8 docked shows the quality of the fit of mLST8 into this density.

In addition to its location between the CCT rings, mLST8 is situated on one side of the central

cavity near the CCT3, 6, and 8 subunits and interacts with the disordered regions belonging to the

N- and C-terminus of several CCT subunits (Figure 3-4b). These interactions involve the termini of CCT5, CCT7, CCT8, CCT6 and CCT3 in one of the rings, and CCT5´, CCT7´, CCT8´, CCT6´ and to a lesser extent CCT1´ in the other ring (Figure 3-4b). Several studies have revealed the presence of two functional hemispheres in the CCT oligomer80, 236, 253, 254, one formed by the

adjacent CCT5, CCT2, CCT4 and CCT1 subunits on one side (the CCT2 hemisphere) and the

other formed by CCT3, CCT6, CCT8 and CCT7 on the opposite side (the CCT6 hemisphere). The

CCT2 hemisphere shows strong ATP binding and hydrolysis while the CCT6 hemisphere shows

much weaker ATP binding and hydrolysis81. Collectively, these structural observations indicate

that the mLST8 molecule is bound between the two chaperonin rings on the low ATP binding side

of the rings (the CCT6 hemisphere) through interactions with the disordered termini of these

subunits.

3.2.6 Crosslinking mass spectrometry

To further assess the location of mLST8 in the CCT folding cavity, we turned to chemical cross-

linking coupled with mass spectrometry (XL-MS), which provides distance constraints that

confirm the position of subunits within protein complexes. We treated the mLST8-CCT

complex with disuccinimyl suberate (DSS), which crosslinks adjacent lysine residues with a

maximal distance of ~ 32 Å between their Cα carbons, taking into account the length of the

lysine side chains and typical peptide backbone flexibility255. The crosslinked complex was protease-digested and the resulting peptides analysed by mass spectrometry (MS). The MS data were searched for cross-linked peptides using the pLink2 search engine256. The analysis detected

196 crosslinks within and between CCT subunits, 5 crosslinks between mLST8 and CCT

subunits, and 8 crosslinks within mLST8 itself (Figure 3-5, Appendix A Table 3). We compared the 48 crosslinks within the conformationally stable equatorial domains to the structural model and found that all fit the distance constraints (Appendix A Table 3), supporting the accuracy of the structural model and the quality of the crosslinking data. The 5 intermolecular links involved K215 of mLST8 crosslinked to lysines in the disordered regions of the N- and C-termini of adjacent CCT subunits (Figure 3-5a). The termini are located at the bottom of the CCT folding cavity near the interface between the CCT rings, extending toward the center of the rings. These crosslinks are consistent with the position of mLST8 between the

CCT rings and support the observation that mLST8 binds to the disordered regions of the N- and

C-termini of the CCT subunits.

Figure 3-5. XL-MS of the mLST8-CCT complex. (a) Intermolecular crosslinks used to orient mLST8 in the cryo-EM density are mapped onto the mLST8-CCT structure. Lysine residues involved in crosslinks are shown as black spheres. (b) Intramolecular mLST8 crosslinks are mapped onto the native structure of mLST8 (PDB 4JT6). The XL-MS pLink output is provided in the Source Data file.

The intermolecular crosslinks were also valuable in docking mLST8 within the cryo-EM density

between the CCT rings. The circular shape of the mLST8 β-propeller allows it to fit the density

in several orientations. However, we were able to identify a preferred orientation by minimizing

crosslinking distances in the docking (Figure 3-5a). Since the links involved the disordered termini of CCT subunits not resolved in our structural model, we used distance constraints to the last ordered residue of the corresponding termini (CCT1 D528, CCT3 S17, CCT4 P30 and CCT6

V13) in the analysis. The docking positioned the mLST8 β-propeller with the K215 side facing the centre of the folding cavity.

The intramolecular mLST8 crosslinks further support the structural observation that mLST8 has achieved a near-native structure while bound to CCT. When the eight mLST8 intralinks were mapped onto the atomic structure of mLST8244, all but two fell within the 32 Å distance

constraint (Figure 3-5b and Appendix A Table 3) when there are 10 of 28 possible crosslinks in the mLST8 crystal structure that exceed the distance constraint. If mLST8 were less folded and highly flexible while bound to CCT, we would have expected more crosslinks incompatible with the crystal structure. These observations suggest that at this late stage of folding by CCT, mLST8 adopts a limited ensemble of structures that closely resembles the native state.

3.2.7 The nucleotide state of CCT in the mLST8-CCT complex

As described above, the mLST8-CCT complex was purified directly from cells without adding

exogenous nucleotide, so the CCT oligomer should only contain tightly bound nucleotide that has

withstood the purification process. The structure of a yeast substrate-free CCT also purified in the

absence of added nucleotide was recently reported236. This structure showed that the nucleotide

binding pocket was empty in five of the subunits, but was fully occupied in CCT6 and CCT8 and

partially occupied in CCT3. The authors termed this state the nucleotide partially preloaded state

(NPP). To determine the nucleotide-binding state of mLST8-CCT, we generated a difference map

of the equatorial region of the mLST8-CCT complex and that of the AMP-PNP-bound state of yeast CCT236, which contains nucleotide in all 16 nucleotide-binding sites (Figure 3-6a). The

difference map would therefore show which nucleotide-binding sites were occupied in the mLST8-

CCT complex (no electron density difference) and those that were unoccupied (an electron density

difference). Based on these differences, all the nucleotide binding sites were empty except the two

CCT8 subunits, CCT6 and partially in CCT6´ (Figure 3-6a). This nucleotide site occupancy is

similar to that of yeast except for CCT3, which was partially occupied in yeast NPP CCT236 and empty in human mLST8-CCT. These findings show that subunits with residual nucleotide binding and low ATP utilization reside on the CCT6 side of the ring, roughly the same side that binds mLST8.

Further examination of the nucleotide binding pocket of either of the CCT8 subunits revealed electron density that is clearly attributable to ADP (Figure 3-6b). The ADP molecule has 93 % of its solvent accessible area (566.6 Å2) buried by contacts with the interacting residues. There are

several residues that are positioned to make important hydrogen bonds (Figure 3-6b). In addition,

K171 is positioned to form a salt bridge with the β phosphate. Hydrophobic interactions also

contribute to the interaction with P49 and I497 flanking the adenine base on either side. All of

these residues are conserved among the eight human CCT subunits. Less conserved interactions

may explain why CCT6 and CCT8 release ADP more slowly than the other subunits. D499 is

unique to CCT6 and CCT8 and sits near the hydroxyl groups of the ribose ring at close hydrogen

Figure 3-6. Nucleotide binding state of the CCT-mLST8 complex. (a) Distribution of nucleotide density in the difference map between the yeast AMP-PNP CCT and the human mLST8-CCT reconstructions. Since all the nucleotide-binding sites of the AMP-PNP CCT reconstruction host a nucleotide, density differences (highlighted in red) indicate unoccupied nucleotide binding pockets in mLST8-CCT complex, and lack of red density indicates the presence of nucleotide in CCT8, CCT8´, CCT6 and partially in CCT6´. (b) ADP binding site in CCT8. The protein ribbon diagram is shown in tan with residues in close contact with the ADP molecule highlighted as sticks. The ADP is also represented in sticks with carbon in yellow, oxygen in red, nitrogen in blue and phosphorous in orange. Hydrogen bonds are depicted as dashed lines. The map contour level is set at 2.5. The figure was produced with Chimera. (c) Alignments of the CCT amino acid sequences adjacent to D499 and Y49 of CCT8 comparing the eight human CCT subunits and CCT6 and CCT8 from different species. Residues identical to D499 of CCT6 and CCT8 and Y49 of CCT8 are highlighted in green. hs – Homo sapiens, bt – Bos taurus, mm – Mus musculus, dm – Drosophila melanogaster, sc – Saccharomyces cerevisiae.

bonding distance. In the other CCT subunits, this position is occupied by E or Q (Figure 3-6b).

The additional length of these side chains would cause steric clashes with the ribose ring, forcing a repositioning of ADP that could decrease its binding affinity. Furthermore, D499 is conserved in CCT6 and CCT8, supporting the idea that this residue is important in high affinity ADP binding.

Y49 is another residue unique to CCT8 that is in position to hydrogen bond with the ribose ring oxygen. All other human CCT subunits have a leucine at that position (Figure 3-6c), which is unable to form the hydrogen bond, suggesting that Y49 also contributes to the higher affinity binding of ADP to CCT8.

3.2.8 Comparison with yeast CCT

Despite the similarities in nucleotide occupancy, a comparison of the mLST8-CCT structure with that of yeast NPP-CCT revealed a notable difference in the CCT2 apical domain. In both structures, the chaperonin assumes an open conformation with very similar structures in the equatorial and intermediate domains. However, in yeast NPP-CCT the intermediate and apical domains of CCT2 adopt a Z-shaped conformation in which its helical protrusion projects sharply outward away from the CCT folding cavity236 (Appendix A Figure 8). This conformation was

not observed in the mLST8-CCT structure, which shows the CCT2 apical domain tilted slightly

inward toward the center of the folding cavity like the other CCT subunits (Appendix A Figure

8). This conformational difference cannot be explained by the presence of substrate because the

Z-shape is not observed in substrate-free human CCT either (Appendix A Figure 7). Moreover, a recent 8 Å structure of bovine CCT shows a similar conformation in the CCT2 apical domain as mLST8-CCT247. Thus, the Z-shaped conformation appears to be unique to the yeast CCT2 apical

domain.

Addition of AMP-PNP to yeast CCT changed the conformation of the CCT2 subunit to one very

similar to mLST8-CCT (Appendix A Figure 6a), but closer inspection revealed that several of the apical domains of mLST8-CCT were tilted more inward and downward toward the center of the folding cavity than with yeast AMP-PNP-CCT, partially closing the folding cavity. These differences were generally greater in those subunits interacting with mLST8 (Appendix A Figure

6b), suggesting that this partially closed conformational may be caused by mLST8 binding.

However, the conformational changes would have to be communicated allosterically from the mLST8 binding site between the rings because there are no direct interactions between the CCT apical domains and mLST8. Such long-range conformational changes are known to occur in CCT when ATP hydrolysis in the equatorial domains results in changes in the apical domains that close the folding cavity241.

3.3 Discussion

The findings reported here provide evidence that the cytosolic chaperonin CCT contributes to

mTOR complex assembly and mTOR signaling by folding the β-propellers of mLST8 and Raptor,

affording a possible explanation for the genetic links between CCT and yeast TOR observed

previously231-233. The high-resolution structure of the mLST8-CCT complex provides insight into

how mLST8 folding may occur. The mLST8 has achieved a near-native state while bound to CCT,

suggesting that the complex represents a late folding intermediate that is ready to bind mTOR upon

release from CCT. The position of mLST8 deep in the CCT structure between the rings is

surprising because this region has not previously been implicated in substrate binding. Most

studies of both type I and type II chaperonins have identified substrate binding sites in the apical

domains far from the N- and C-termini in each ring75, 247, 257-260. These termini are all located at

the bottom of the folding cavity and have been proposed to create a barrier that separates the two

folding cavities76, 80. However, the mLST8-CCT structure shows that the folding cavities are not

separated and that CCT can bind substrates between the rings via interactions with the N- and C- termini. This observation is consistent with other biochemical and structural studies suggesting that the termini can participate in substrate interactions for both type I261-263 and type II66

chaperonins. These interactions appear to involve specific substrates and/or late stage

intermediates in the folding process.

A closer look at the mLST8-CCT reconstruction reveals several thin masses that extend from the equatorial domains of CCT5, CCT7, CCT8, CCT6 and CCT3 in one ring and CCT5´, CCT7´,

CCT8´, CCT6´ and CCT1´ in the other ring to suspend mLST8 between the rings (Figure 3-4b).

These masses likely correspond to the N- and C- termini of the subunits because they are known to extend into the space between the rings80, 246 and several of the termini crosslink to mLST8

(Figure 3-5b and Appendix A Table 3). The disordered nature of these regions does not allow a

more detailed description of the interactions, but a difference map between the mLST8-CCT

reconstruction and the structure of native mLST8 docked into the mass between the rings shows

extra mass, attributable to the termini, that surrounds the bound mLST8 at specific points

(Appendix A Figure 9). These observations suggest that CCT contacts mLST8 almost exclusively

through the termini of the subunits.

CCT is known to fold the β-propellers of other proteins, including G protein β subunits. A

previous, low-resolution cryo-EM structure of the Gβ1-CCT complex, also purified directly from

1 cells , shows that despite its close structural homology to mLST8, Gβ1 interacts with CCT in the

apical domains where other CCT substrates have been shown to bind (Figure 3-7a). A question that arises from these observations is how CCT interacts so differently with structurally homologous β-propellers like Gβ and mLST8. The answer may lie in the N-terminal α-helix of

Gβ, not found in mLST8, which makes a coiled-coil interaction with the G protein γ subunit in the

Gβγ dimer. This helix contacts the apical domain of CCT3 and holds Gβ high in the CCT folding cavity where it can interact with PhLP1, the CCT co-chaperone that releases Gβ from CCT to form the Gβγ dimer1. In contrast, PhLP1 does not assist in mLST8 folding or release (Appendix A

Figure 3), probably because PhLP1 cannot access mLST8 between the CCT rings from its binding

site at the top of the CCT apical domains. In contrast, ATP binding and hydrolysis contribute to

release of mLST8 from its position between the rings (Figure 3-1g), suggesting that the

conformational changes in CCT upon ATP hydrolysis dislodge mLST8 to interact with mTOR.

Interestingly, the mTOR binding site on mLST8 is exposed in the interior of the CCT folding

cavity (Figure 3-7b), suggesting that the mTOR kinase domain could interact with mLST8 while

still bound to CCT.

In the mLST8-CCT structure, mLST8 is located on the CCT6 hemisphere of the ring (Fig. 4a),

associating principally with CCT5, CCT7, CCT8 and CCT6. Gβ also associates with the CCT6

side, despite binding to the apical domains 1. Interestingly, the CCT6 and CCT8 subunits on this

same side of the ring retain their nucleotide throughout the tandem affinity purification. This slow

release from the CCT6 hemisphere explains previous observations that showed poor ATP binding

on the CCT6 side81. An asymmetric ATP-binding and sequential substrate folding mechanism for

CCT was previously proposed in which bound substrates are first released from the CCT2

hemisphere, because of efficient ATP binding and hydrolysis on the CCT2 side, and are then

75 retained on the CCT6 hemisphere because of low ATP utilization81, 264. The positions of mLST8 and Gβ in folded β-propeller structures on the CCT6 side is consistent with this sequential folding mechanism. It is possible that sequential release of β-propeller proteins may facilitate their complex folding trajectory, which requires that the N- and C-termini come together to form the last blade of the β-propeller.

Figure 3-7. The role of CCT in the folding of β-propeller proteins. (a) Differences in the β-propeller location in the CCT cavity. The 3D reconstructions of Gβ-CCT (white)1 and mLST8-CCT (brown) reveal the different location of the two β-propellers. (b) Position of the mTOR binding site on mLST8 in the mLST8-CCT complex. Residues on mLST8 that bind mTOR are shown as yellow spheres. (c) Hypothetical scheme of the chaperones involved in assembly of mTOR complexes, highlighting CCT- dependent folding of mLST8 and Raptor.

These results reveal an important function for CCT in the folding of mLST8 and Raptor in

preparation for their assembly into mTOR complexes. Based on our findings and other studies on

protein folding by CCT, we propose a hypothetical scheme for the assembly of mTOR complexes

(Figure 3-7c). The β-propeller domains of nascent mLST8 and Raptor likely bind to CCT in a

partially folded state either co-translationally or soon thereafter75. They are then folded by CCT

into their β-propeller structures through cycles of ATP binding and hydrolysis and are released to

interact with nascent mTOR and create the mTORC1 complex, while mTOR itself is folded by the

Hsp90 TTT-R2TP co-chaperone complex229, 230. In the case of mTORC2, mLST8 and mTOR are

folded by the same mechanism, but it is currently not known how the other core components,

Rictor and mSIN1, are folded before assembly. There are a number of questions yet to be answered

in mTORC assembly, but this study establishes a key role for CCT in the process. These

contributions of CCT to mTORC assembly may underlie the diseases caused by inactivating CCT mutations265 or the increased CCT activity in cancer cells266, given the essential functions of

mTOR in regulating cell metabolism, growth and survival.

3.4 Methods

3.4.1 Cell Culture

Human embryonic kidney (HEK)-293T cells (ATCC) were grown in 10% fetal bovine serum

(FBS) in DMEM/F12 media, and HepG2 liver hepatocellular carcinoma cells (ATCC) were

grown in DMEM media. Cells were passaged to maintain confluency between 10-90% and passage number was kept under 15.

3.4.2 CRISPR knockdown

Knockdowns were done using the PX459 V2.0 vector (Addgene) containing sgRNAs targeting

CCTε, Raptor or PhLP1. The same vector with a non-targeting sgRNA segment was used as a

negative control. The sgRNA sequences are provided in Supplementary Table 4. These vectors

were transfected into HEK-293T cells at 25-40% confluency with Lipofectamine 3000 (Thermo

Fisher Scientific) and then treated with 1 μg/mL puromycin (Invivogen). 48 hours after

transfection of PX459V2.0, cells were transfected with vectors containing mTORC or Gβγ

components. Cells were harvested for immunoprecipitation and immunoblotting 96 hours after

addition of the sgRNA vector.

3.4.3 Immunoprecipitation

HEK-293T cells were cultured and transfected in six-well plates. Cells were washed in PBS and

lysed in 200 µL of PBS supplemented with either 1 % IGEPAL (for mTORC1 and Gβγ) or 0.3-

0.5 % CHAPS (for CCT and mTORC2), 0.5 mM PMSF and Halt Protease Inhibitor Cocktail

(Sigma P8340). Protein concentrations were determined using the DC protein assay (BioRad

5000116) and equal protein amounts (~ 400 µg) were immunoprecipitated by addition of epitope tag antibodies according to Supplementary Table 4, followed by 30 µL of protein A/G agarose beads (Santa Cruz). Immunoprecipitants were washed three times in lysis buffer, then resuspended in SDS-PAGE loading buffer. Proteins were separated by SDS-PAGE and transferred to nitrocellulose (Biorad Transblot). The nitrocellulose was probed with the indicated primary antibodies and IRDye secondary antibodies (Li-COR) at the dilutions indicated in Supplementary Table 4. Blots were imaged using a LI-COR Odyssey infrared scanner, and proteins were quantified with the LI-COR software.

The effects of ATP on the co-immunoprecipitation of mLST8 and Raptor with CCT was

performed in a cell line expressing a Flag-tagged CCT3 subunit. To insert the Flag tag, we transfected HEK293T cells with Cas9 and sgRNA targeting CCT3 (Addgene px458 vector) along with a double stranded DNA fragment for a donor template containing a Flag tag to be inserted in an external loop between P374 and K375 (synthesized G block by Integrated DNA

Technologies). Cells were sorted into 96-well plates and monoclonal lines were screened via immunoblotting for a Flag-tagged CCT3. The cell line was verified by PCR and sequencing.

These cells were transfected with either mLST8 or Raptor. We then performed an

immunoprecipitation as described above using Flag antibody. After two washes in lysis buffer

containing 0.5 % CHAPS, samples were incubated at 4°C in this buffer for an additional three

hours during which 5 mM ATP was added after 0, 1 or 2 hrs so that samples were incubated in

ATP for a total of 1, 2 or 3 hrs. The zero sample was incubated without ATP for 3 hrs.

Following the incubation, samples were washed two more times and then immunoblotted as

previously described.

3.4.4 Insulin signaling

HepG2 cells were chosen for these experiments because of their robust response to insulin. Cells

were treated with 40 nM of siRNA targeting CCTα/ε, mLST8 or Raptor or a non-targeting

control using Lipofectamine 3000. 72 hours after knockdown, cells were serum starved for 18

hours. Subsequently, the cells were treated with 100 nM insulin for 30 minutes and the lysates

were harvested in 1% IGEPAL in HEPES buffer supplemented with 0.5 mM PMSF, Halt

Protease Inhibitor Cocktail and phosphatase inhibitor (Thermo Fisher). The effects on mTORC1

and mTORC2 signaling were analyzed by immunoblotting the cell lysates for phosphorylation at

IRS1 S636/639 and AKT S473, respectively. Total CCT, mLST8, Raptor, AKT and IRS1 were

also immunoblotted to assess the respective knockdown and expression level. Antibody sources

and dilutions used are indicated in Supplementary Table 4.

3.4.5 qPCR

HEK-293T cells were depleted of CCT using CRISPR as described above and were harvested for

RNA isolation (Zymo RNA isolation kit) 96 hours later. Qiagen one-step RT PCR kit was used for the reverse transcription step. The qPCR was done using IDT PrimeTime assays with predesigned primers for mTOR, Raptor, mLST8 and HPRT as a control (Supplementary Table

4). Real Time PCR was performed using the QuantStudio 5 Real Time PCR system and data were analyzed using the QuantStudio Design and Analysis software.

3.4.6 Statistical Analysis

The statistical analysis was performed using the BootstRatio, a web-based statistical analysis

program which calculates probability that the relative expression, RE ≠1267. BootstRatio allows

calculation of statistical significance when data is normalized to a control sample. The

application can be found at: http://regstattools.net/br.

3.4.7 Isolation of mLST8-CCT

HEK-293T cells were cultured as described above in T-175 flasks. At 80% confluency, each

flask was transfected with 45 μg N-terminal HPC4-Twin Strep-Flag-mLST8 in pcS2+ vector and with 45 μg His6-myc-PhLP1 in pcDNA3.1B+ using 200 μg of polyethylenimine (PEI). The

80 media was replenished with DMEM/F12 after 2-4 hours, and the cells were incubated for 48 additional hours before harvesting. Cells from each T175 were lysed in 2 mL of extraction buffer 1% IGEPAL in PBS with 0.5 mM PMSF and Halt Protease Inhibitor Cocktail. The lysate was cleared by centrifugation at 30,000 x g for 20 minutes. The lysate was then filtered through a 0.45 μm and then a 0.2 μm filter.

The mLST8-CCT complex was purified at 4° C by tandem affinity purification (TAP). The filtered lysate was loaded for 1 hour onto a HisTrap HP 5 mL column (GE17-5248-01) equilibrated with 20 mM HEPES, 20 mM NaCl, 25 mM imidazole, 0.05% CHAPS, 1 mM

TCEP, pH 7.5. The column was washed with 5 column volumes of equilibration buffer. A linear gradient from 25 mM to 500 mM imidazole was then applied over 8 column volumes.

Elution fractions were then analyzed by SDS-PAGE and Coomassie staining. Fractions containing mLST8 and CCT were combined and loaded for 1 hour onto 5 mL of Strep-Tactin resin (Iba 2-1201-010) equilibrated with 20 mM HEPES pH 7.5, 20 mM NaCl. The column was washed twice with one column volume of 20 mM HEPES pH 7.5, 150 mM NaCl, 0.05%

CHAPS, and then twice with one column volume of 20 mM HEPES pH 7.5, 20 mM NaCl,

0.05% CHAPS. The mLST8-CCT complex was eluted with 3 column volumes of 20 mM

HEPES pH 8.0, 20 mM NaCl, 0.05% CHAPS, 2.5 mM D-desthiobiotin and concentrated to 1

µg/µL using a 30 kDa cutoff filter (Amicon UFC803024) and analyzed by SDS-PAGE and

Coomassie staining and immunoblotting. The sample was then flash frozen in liquid nitrogen.

3.4.8 Isolation of substrate-free CCT

HEK-293T cells were cultured in T-175 flasks as described above. At 80% confluency, each

T175 flask was transfected with 90 μg of His6-myc-PhLP1 in pcDNA3.1B+ using 200 μg of polyethylenimine (PEI). The cells were then lysed and loaded onto a HisTrap column as described for mLST8-CCT. The combined HisTrap elution fractions were then loaded for half an hour onto a HiTrap Heparin HP 5 mL column (GE17-0406-01) equilibrated with 20 mM Tris-

HCl pH 7.5, 150 mM NaCl, 2.5 mM MgCl2, 1 mM TCEP. The column was washed with 2

column volumes of equilibration buffer. A linear gradient from 150 mM to 1 M NaCl was then

applied over 8 column volumes. Elution fractions were then analyzed by SDS-PAGE and

Coomassie staining, and fractions containing CCT were combined and concentrated in a 30 kDa

cutoff filter (Amicon UFC803024) to less than 300 μL. The sample was then injected onto a

Superose 6 10/300 GL size exclusion column (SEC) equilibrated in 20 mM HEPES pH 7.5, 150

mM NaCl, 1 mM TCEP mobile phase. One column volume of mobile phase was then run over

the column and fractions were analyzed by SDS-PAGE and Coomassie staining. The sample

was concentrated to 1 µg/µL using a 30 kDa cutoff filter and flash frozen in liquid nitrogen.

3.4.9 Crosslinking

Approximately 200 μg of mLST8-CCT complex was crosslinked in 25 mM HEPES pH 8.0, 100

mM KCl, and 325 μM of a 50 % mixture of H12/D12 disuccinimidyl suberate (DSS) (Creative

Molecules) at 37°C for half an hour. The reaction was quenched by adding 50 mM ammonium

bicarbonate to the crosslinked sample and incubating at 37°C for 15 minutes. The sample was

dried using a vacuum concentrator, denatured in 100 mM Tris-HCl pH 8.5 and 8 M urea,

reduced with 5 mM TCEP at 37°C for 30 minutes, and alkylated with 10 mM iodoacetamide at

room temperature in the dark for 30 minutes. The sample was diluted with 150 mM ammonium

bicarbonate to bring the urea concentration to 4 M, and proteins were digested with 4 μg of lysyl

endopeptidase (Wako 125-05061) (1:50 enzyme: substrate ratio) at 37°C for two hours.

Subsequently, the urea was diluted to 1 M, and proteins were further digested with trypsin

(Promega V5111) at a 1:50 ratio at 37°C overnight. Peptide fragments were purified on a C18

column (Waters WAT054955), dried, and reconstituted in 35 μL SEC mobile phase (70:30:0.1

water:acetonitrile:TFA). Crosslinked peptide fragments were enriched by SEC using a Superdex

Peptide PC 3.2/30 column at a flow rate of 50 μL/min. The fractions with the highest peptide

concentration were dried and resuspended in 2% formic acid.

3.4.10 Mass spectrometry

The enriched crosslinked peptide samples were separated using a Thermo Fisher Scientific

EASY-nLC 1000 Liquid Chromatograph system with a 15 cm Picofrit column (New Objective) packed with Reprosil-Pur C18-AQ of 3 µm particle size, 120 Å pore size and gradient of 5-95%

acetonitrile in 5% DMSO and 0.1% formic acid over 185 minutes and at a flow rate of 350

µL/min. The column was coupled via electrospray to an Orbitrap Velos Pro mass spectrometer.

The resolution of MS1 was 30,000 over a scan range of 380-2000 m/z. Peptides with a charge

state +3 and greater were selected for HCD fragmentation at a normalized collision energy of

35% with 3 steps of 10% (stepped NEC) and a resolution of 7,500. Dynamic exclusion was

enabled with a 10 ppm mass window and a one-minute time frame. Samples were run in

duplicate.

3.4.11 XL-MS analysis

The XL-MS spectra were analyzed using the pLink 2 software suite256. First, the peptide sequence database was created from the amino acid sequence of human mLST8 and the eight human CCT subunits (UniProt ID: Q9BVC4, P17987, P78371, GenBank: CAA52808.1, P50991,

P48643, P40227, Q99832, P50990 respectively). The sequences of 293 common contaminant

proteins were also added by pLink. The program was then run using the preset DSS

conventional crosslinking (HCD) conditions and a custom heavy DSS linker profile

(LinkerComposition: C(5)H(-2)2H(6)O(2), MonoComposition: C(5)H(6)O(3), LinkerMass:

102.064, MonoMass: 120.075), with trypsin set as the protease and up to 3 missed cleavages

allowed. Peptides were selected with a mass between 600 and 6,000 Da and a length between 6

and 60 amino acids. The precursor and fragment tolerances were ± 20 ppm. The peptides were

searched using carbamidomethyl (C) fixed modifications and phospho Y, T, S and oxidated M

variable modifications. The results were filtered with a filter tolerance of ± 10 ppm and less than

5% FDR.

3.4.12 Cryo-EM grid preparation and data acquisition

Cryo-EM grids were prepared with a Vitrobot Mark IV (FEI) at 22 ºC and 95% humidity.

Aliquots of 4 μl of human CCT-mLST8 complex or apo-CCT were applied to a glow discharged

holey carbon grid (Quantifoil R2/2, 300 mesh). Grids were previously treated with polylysine to

increase the number of side views of the chaperonin, as previously described236. The mLST8-

CCT data acquisition was performed at ESRF Grenoble with a FEI Titan Krios electron

microscope (Krios 1) operating at 300 kV, equipped with a Gatan K2 Summit direct electron

detector mounted on a Gatan Bioquatum LS/967 energy filter. Data collection was carried out

with a nominal magnification of 105,000× (yielding a pixel size of 1.36 Å/pixel), at a defocus

range of −1.5 to −3.0 μm. A total of 5576 movies were recorded and fractionated to 40 frames

with a total exposure of 7 s. The dose rate was 5.2 e-/pixel/s for a total dose of 36 e−/Å2 on the

specimen.

Substrate-free CCT grids were prepared as described above and images were collected on a FEI

Titan Krios electron microscope operating at 300 kV at Diamond Light Source (DLS) electron

Bio-Imaging Centre (eBIC) (Krios 1), at a nominal magnification of 130,000× (corresponding to

a pixel size of 1.06 Å/pixel). A total of 2293 movies (40 frames/movie) were recorded on a

Gatan Quantum K2 Summit direct electron detector operated in counting mode, with a defocus

range of −1.5 to −3.0 μm. Each movie was exposed for 8 s, with an exposure rate of 5.3 e-

/pixel/s, leading to a total accumulated dose of 42 e−/Å2 on the specimen.

3.4.13 Image processing

The 5576 movies of mLST8-CCT complex were aligned using MotionCorr2268 program as part

of the Scipion processing workflow269. The MotionCorr2 output was subjected to CTF

determination using CTFFIND4270. 1,769,600 particles were automatically picked with

Xmipp271 and extracted with a downsampling factor of 3 (4.08 Å/pixel, 68 pixel box size). All

the image processing steps were carried out without any symmetry imposition. A first 2D

classification using Relion 2.0272 (unless otherwise stated Relion 2.0 was used in all subsequent

steps) was performed to exclude bad particles and ice contamination. Some of the best 2D

classes were used as a template to generate an initial model using both EMAN273 and

RANSAC274. In both cases a cylinder with the general dimensions similar to the CCT structure

was obtained, which was subsequently used for the iteration process. One of the models was

low-pass filtered to 60 Å and used for a 3D classification of 1,197,358 particles contained in the

best 2D classes. The 3D classes that showed well-defined CCT features and a mass inside the

cavity (860,453 particles) were subjected to refinement using 3D auto-refine, which generated a

9 Å map. The particles used in this refinement were re-extracted from the 1.36 Å/pixel

micrograph to continue the processing with the original data. A new 3D classification was

performed in which a mask was applied around the mass attributed to the substrate in order to

favor the classification to the substrate contribution and prevent the CCT predominance. Those

particles with a better-defined mLST8 mass (452,000) were finally subjected to auto-refine and a

map was obtained with a final resolution of 4.35 Å. Subsequently, a postprocessing was

performed masking the previous map and enhancing the high frequencies and the resolution

improved to 4.0 Å, as estimated using the gold standard FSC criterion at 0.143275. Local resolution in the 3D structure of the mLST8-CCT complex was estimated using MonoRes276

from Xmipp package and ResMap277. The statistical information is listed in Supplementary

Table 1.

The 3D reconstruction of substrate-free CCT was carried out following a similar procedure. A

total of 2293 movies were aligned with MotionCor2 and CTF corrected. A total of 504,060

particles were automatically selected and extracted with a downsampling factor of 3 (3.18

Å/pixel, 80 pixel box size). Particles were 2D classified using Relion 2.0 and the best classes

(139,819 particles) were subjected to 3D classification. Classes with the best structural features of CCT were further refined, the particles were re-extracted from the original micrographs (1.06

Å/pixel) and after 3D refinement, a final map at 7.5 Å was obtained (gold standard FSC).

3.4.14 Model building

Models for each human CCT chain were generated using SWISS-MODEL homology-modelling server278 using the yeast CCT structure (PDB 5GW5) as a reference. The resulting model was

docked into the cryo-EM density using Chimera279 and further subjected to flexible fitting of the

individual subunits with iMODFIT250. Manual adjustment and real-space refinement were

carried out in COOT280 to increase the quality of the fitting. The resulting model was refined by

several rounds using PHENIX251 and CCP-EM281 software suites. The restraints used in phenix

real-space refinement were both the standard (bond, angle, planarity, chirality, dihedral and

nonbonded repulsion), with some additional restraints (Ramachandran plot, C-beta deviations,

rotamer and secondary structure). A local grid search-based fit was included in the refinement

strategy to resolve side-chain outliers (rotamers or poor map fitting). Validation of the final model was done using the phenix.validation_cryoem module in PHENIX. The final refinement statistics are provided in Supplementary Table 2.

3.4.15 Nucleotide distribution analysis

In order to detect and identify nucleotides in the CCT subunits, the equatorial domain of yeast

CCT ATP-BeF2 (PDB 4D8R) was docked into the human CCT-mLST8 model and the yeast

CCT AMP-PNP model (PDB 5GW5) in order to segment the equatorial domains. A difference map between them was generated using the vop subtract operation implemented in Chimera. A detailed inspection of the nucleotide binding pocket of all the CCT subunits of mLST8-CCT

showed a clear difference between nucleotide-free and nucleotide-bound subunits and allowed

the modelling of an ADP molecule in CCT8. The NCBI Blastp web-based suite was used to

perform an alignment of the eight human CCT subunits (Uniprot ID: P17987, P78371, P49368,

P50991, P48643, P40227, Q99832, P50990) as well as yeast, drosophila, murine, and bovine

CCT6 (Uniprot ID: P39079, Q9VXQ5, P80317, Q3MHL7) and CCT8 (Uniprot ID: P47079,

Q7K3J0, P42932, Q3ZCI9) to identify conserved and unique residues in the ADP binding site.

3.4.16 Data availability

Cryo-EM data have been deposited in the Electron Microscopy Data Bank under accession codes

EMD-4489 and EMD-4503 for the human mLST8-CCT complex and human apo-CCT,

respectively. The associated atomic model for mLST8-CCT has been deposited in the Protein

Data Bank under accession code PDB 6QB8. The raw mass spectrometry data are available on

the MassIVE repository under the ProteomeXchange accession code PXD013975 and the MassIVE

accession number MSV000083839.

3.5 Acknowledgements

I acknowledge that the use of this article is compliant with all publishing agreements.

I would like to acknowledge the many people who contributed to this paper: Jorge Cuellar and

the members of the Valpuesta lab, who performed the Cryo-EM experiments and solved the

structure for both mLST8-CCT and Apo CCT; Grant Ludlam and Takuma Aoba for purifying

the complexes; Madhura Dhavale and Rebecca Plimpton, who performed some of co- immunoprecipitation experiments; the Franklin lab, who helped with the cross-linking experiments; Michael Mann who contributed to my experiments; and Barry Willardson and Jose

Valpuesta as the advisors on this project.

4. Using the peptide CT20P to inhibit CCT-mediated assembly of signaling complexes

Abstract

The chaperonin CCT is a molecular chaperone that is responsible for guiding native and misfolded proteins to achieve their native state and assemble into functional complexes. Some of its important substrates include the cytoskeletal proteins actin and tubulin; several cell cycle checkpoint proteins; the mTOR complexes, which are regulators of cell growth and survival signals; and G proteins, which convey signals from G protein coupled receptors (GPCRs) that

regulate nearly all aspects of cell physiology. Unsurprisingly, due to its role in so many cellular

processes, CCT has been shown to have a role in tumor progression. The novel peptide called

CT20P has been previously shown to inhibit CCT, leading to cancer cell death. In the present study, we sought to further characterize CT20P as a CCT inhibitor and potential therapeutic. We

used a plasmid expressing GFP-CT20P and found that CT20P does inhibit CCT function,

including its role in the assembly of cancer-relevant signaling complexes, mTORC1 and Gβγ.

However, we also found that CCT inhibition by CT20P was not specific to cancer cells as previously suggested. This suggests that CT20P may not prove useful as a therapeutic; however,

GFP-CT20P may be a useful CCT inhibitor for research purposes.

4.1 Introduction

In order for a protein to function, it must be folded into its native shape and, frequently, it must assemble with its appropriate binding partners. Due to the dense cellular environment and

thermodynamic barriers, this process seldom occurs spontaneously. Protein folding requires the

assistance of molecular chaperones, proteins that help other proteins to fold and associate with

their binding partners14. Chaperones can channel the folding pathways to avoid trapped

intermediates and aggregate formation. One such chaperone is the cytosolic chaperonin

containing TCP-1 (CCT, also called TRiC). CCT is a large protein folding machine made up of

eight subunits, each with ATPase activity, that assemble into a ring structure, and two rings

associate with each other to create a 16-subunit, 1 MDa folding complex75. The center of each

ring makes a folding chamber in which proteins are folded by ATP hydrolysis-driven conformational changes in CCT.

CCT is responsible for folding a diverse set of substrates, including proteins involved in many important cellular processes. It is estimated to be responsible for folding up to 10% of the proteome246. The prototypical substrates of CCT are the cytoskeletal proteins actin and tubulin,

which require CCT to be folded61, 90, 282. In addition to these two proteins, CCT is responsible for

the folding of a great number of other known substrates, such as the cdc20 and cdh1 components

of the anaphase promoting complex the Bardet-Biedl syndrome protein 7 (BBS7) subunit of the

BBSome ciliary transport protein complex, protein phosphatase 2A regulatory subunits, the

telomerase co-factor TCAB1, and the TAF5 subunit of the TFIID transcription factor complex28,

29, 64-67. Due to its important protein substrates, CCT is an essential protein, without which cells

cannot survive.

CCT plays a role in the folding and assembly of important signaling complexes. Our lab has

shown that CCT, with the help of its co-chaperone PhLP1, is responsible for folding the G

32 protein subunit β1 (Gβ1) and assembling it with its binding partner, Gγ2 . After their chaperone-

mediated assembly, Gβγ dimers associate with the G protein α subunit (Gα) to form the G

protein heterotrimer that conveys signals from G protein-coupled receptors (GPCR) to effector

enzymes and ion channels that regulate nearly all aspects of cell physiology9. More recently, we

discovered that CCT played an important role in the folding and assembly of mTOR complex

subunits30. The mTOR complexes, identified as mTORC1 and mTORC2, are master regulators

of cell growth, metabolism and survival. As such, they are involved in many disease processes such as diabetes and cancer, and are high-value drug targets 6, 8. In addition to the mTOR kinase,

the core components of mTORC1 include mLST8 and Raptor, both of which require CCT for

proper folding5, 113, while the mTORC2 core components include mTOR, the CCT substrate

mLST8, Rictor (rapamycin-insensitive companion of mTOR), and mSIN1 (mammalian stress-

activated MAP kinase-interacting protein 1) 5, 112.

CCT has been implicated in a number of diseases, including retinopathies, neurodegenerative

diseases and cancer56, 103, 283, 284. Specifically, CCT is often upregulated in cancer, either through

gene duplication events or upregulation of co-chaperones110. This increased chaperone capacity

allows for the folding of many oncogenic proteins106. CCT is responsible for the folding of many

cancer-relevant proteins, such as signal transducer and activator transcription (STAT3), the acute

myeloid leukemia (AML) oncoprotein AML-ETO1, von-Hippel lindau (VHL), cyclins, and p53, among others94, 107-109, 285. Although not usually considered oncogenic proteins, actin and tubulin play an essential role in cancer. The uncontrolled cell growth and division that takes place in cancer requires a higher level of actin and tubulin folding, a deregulation of the normal assembly dynamics that takes place in the cell. The role of CCT in assembling the cytoskeleton makes it

essential to cancer progression56. CCT upregulation is an indicator of a worse prognosis for

cancer patients286, 287. In addition to its role in cancer, CCT is essential for the folding of HIV

and other viral proteins 288-292.

Because of the role of CCT in cancer progression, CCT has been suggested as a potential target

for cancer therapeutics266. A CCT-specific inhibitor could be a potent anti-cancer or anti-viral

agent, similar to the Hsp90 inhibitors 19. Many studies have sought to investigate the

effectiveness of such a strategy. For example, disrupting the interaction between tubulin and

CCT caused apoptosis in cancer cells, whereas it was much less toxic to non-cancerous cells with

normal CCT levels111. Other studies have focused on the peptide inhibitor called CT20P. This

peptide was derived from the C-terminal α helix on the apoptotic protein Bax293 (Figure 4-1a) and was designed with the expectation that the peptide might mimic Bax function, which induces the release of cytochrome C and triggers apoptotic cell death294. However, research into the

mode of CT20P action revealed that the nanoparticle-delivered CT20P peptide exerts its

cytotoxic effects independent of Bax-mediated pathways, and noted that CT20P causes

cytoskeletal disruption295. Later studies suggested that it may induce its cytotoxic effects by

binding to and inhibiting CCT, specifically noting that over-expression of CCT was an indicator

for effectiveness of the peptide296. CT20P was shown to effectively cause cell death in prostate

cancer cells, lung cancer cells and breast cancer cells, while these studies suggest that non-

tumorigenic cell lines are resistant to its effects295, 297, 298. These properties of CT20P piqued our

interest in understanding more details of how it might affect CCT function.

In the present study, we expressed the peptide CT20P in a fusion with GFP so that it could be

transfected and its effects on cells analyzed. We examined the effects of CCT inhibition by GFP-

CT20P on several known substrates of CCT, including tubulin, the mTOR complexes, and

Gβγ and found that GFP-CT20P decreased the function of each of these CCT substrates. These

results indicate that CT20P is an effective inhibitor of CCT that can be used to study CCT

function and to design potential derivatives for therapeutics.

4.2 Results

4.2.1 CT20P binds to CCT

A mass-spectrometry-based proteomic analysis of CT20P interactors previously identified CCT as a major CT20P binding partner296. We sought to confirm this interaction in vitro by measuring binding of CT20P to purified CCT. We added increasing concentrations of the CT20P peptide

(VTIFVAGVLTASLTIWKKMG) with N-terminally tagged biotin to purified human CCT and precipitated the peptide with streptavidin beads. We detected the amount of CCT bound to biotin-CT20P by immunoblotting and generated a binding curve with a Kd of ~8.1 µM. (Figure

4-1b). The fact that binding of CCT to CT20P saturates suggests this binding to be specific. To control for non-specific binding, we added the biotinylated CT20P to purified GFP and attempted to precipitate GFP in a similar experiment. A small GFP band was observed in the sample with no CT20P, but this band did not increase with increasing CT20P concentration, indicating minor non-specific GFP binding to the streptavidin beads. This result indicated that

CT20P does not indiscriminately bind proteins but that it forms a specific interaction with CCT.

Figure 4-1. CT20P binds to CCT. a) Structure of the Bax protein with the CT20P α helix highlighted in yellow. b) Binding curve of biotin-CT20P and purified CCT. Representative immunoblots are shown on the right. Data is normalized to 10 µM data point.

4.2.2 GFP-CT20P inhibits tubulin folding in HEK293T cells

A study by Boohaker et al293 showed that GFP-CT20P had similar death-inducing properties as

the CT20P nanoparticles that were used in most other previous studies involving CT20P. While

the nanoparticles are more useful when studying properties such as cellular uptake of a drug, we

were interested in a plasmid that could be expressed to easily inhibit CCT in cells as a more

accessible tool for assessing CCT function. We sought to validate the possible function of GFP-

CT20P as a CCT inhibitor. We constructed a plasmid expressing CT20P on the C-terminal end

of GFP with a small linker between them. Confocal images of cells expressing GFP-CT20P

show that the construct expresses adequately, and that the protein is mostly cytosolic (Figure 4-

2a). A fraction of the cells (23%) showed some GFP-CT20P aggregation, based on visible puncti in the images. Considering the hydrophobic nature of the peptide, it is not surprising that it is prone to aggregation. However, given that most of the cells did not contain the aggregates, we proceeded to characterize the effect of GFP-CT20P on CCT function.

Figure 4-2. CT20P inhibits tubulin folding . a) Confocal images showing DAPI (blue) and GFP-CT20P (green). Counts of the cells that contained aggregates of GFP-CT20P compared to those that appeared to have diffuse, non-aggregated GFP-CT20P. b) Imaging flow cytometry scatterplot of GFP intensity versus tubulin intensity. GFP-CT20P expressing cells (red) have more cells classified as “Dim Tubulin” than those expressing GFP (green). c) Homogeneity score of GFP expressing cells (green) versus GFP-CT20P expressing cells (red). Plot shows a gate where we defined “High homogeneity” which enriches for cells that are not aggregated. d) Scatterplot of tubulin intensity versus the homogeneity score of GFP expressing cells (green) versus GFP- CT20P expressing cells (red). e) Same as (b) except that cells were first gated for high homogeneity as shown in (c). * p<0.05, ** p<0.01, *** p<0.005 95

We began by expressing GFP-CT20P in HEK-293T cells, examining the expression of tubulin, a prototypical substrate of CCT, by imaging flow cytometry. GFP-CT20P caused a significant decrease in tubulin in the total cell population (Figure 4-2b). To investigate further if a specific cell population was responsible for the decrease in tubulin, we measured homogeneity of the

GFP signal, a measurement which shows that GFP signal is evenly distributed throughout the cell. We first found that the GFP-CT20P cells had a wider distribution of the GFP signal homogeneity score compared to cells expressing GFP alone (Figure 4-2c), confirming that some of the cells form aggregates, as seen on the confocal imaging. We then compared homogeneity to

tubulin intensity and found that the cells with homogeneity (without the aggregates) tended to

have lower tubulin signal (Figure 4-2d), indicating that the aggregated GFP-CT20P was not responsible for the decrease in tubulin expression, but that the soluble GFP-CT20P was. We confirmed this observation by gating for cells with high GFP homogeneity, which results in an even greater decrease in tubulin expression (Figure 4-2e). These results indicate that GFP-

CT20P decreases cellular expression of tubulin most likely by binding and inhibiting tubulin folding by CCT.

4.2.3 CT20P decreases binding of substrates to CCT

One way the CT20P might inhibit CCT is to block the binding of its substrates. Our lab has recently shown that CCT is responsible for folding of the mLST8 and Raptor subunits of the mTOR complexes, master regulators of cell growth and survival, and we had previously shown that CCT folds the G protein β subunit of the heterotrimeric G protein complex responsible for signaling downstream of GPCRs30, 32. Both of these complexes play an integral role in cell

survival pathways which are frequently upregulated in cancer, and they represent high value drug

targets. Understanding the effect of CT20P on the assembly of these complexes is crucial to understanding the impact that it may have on cancer cells. To measure binding of these substrates to CCT, we overexpressed GFP-CT20P or GFP as a control with each of the substrates

(mLST8, Raptor or Gβ) in HEK-293T cells. We then immunoprecipitated CCT and measured

the co-immunoprecipitation of each substrate to CCT by immunoblotting (Figure 4-3a). We found CT20P significantly decreased the binding of each substrate to CCT, with no significant changes in the expression or immunoprecipitation of CCT. We also assessed the co- immunoprecipitation of the co-chaperone PhLP1, which binds to Gβ and CCT and is essential for the proper assembly of the Gβγ dimer. PhLP1 is not a substrate of CCT, meaning that it does not require CCT for its folding, but it does bind to CCT as part of a chaperone complex.

Interestingly, the binding of PhLP1 to CCT is also decreased in the presence of CT20P (Figure

4-3a). The decreases in binding to CCT of each of these proteins also results in a decrease in their expressions levels (Figure 4-3b). While this decrease was expected for the CCT substrates,

Raptor, mLST8 and Gβ, because without proper folding by CCT they are destabilized and degraded, it was unexpected for PhLP1. To verify that the co-expression of CT20P was not simply decreasing the over-expression of all proteins nonspecifically, we overexpressed LRAT, a small 25 kDa protein that is not associated with CCT and does not require CCT for its folding.

As expected, LRAT expression did not change with the co-expression of GFP-CT20P (Figure 4-

3c). While we expect that the decrease in expression of CCT substrates is a result of not being properly folded, we verified that the decrease in protein expression was not a result of a decrease in transcription of their genes. We performed qPCR and found that the mRNA levels of each transcript was not decreased due to the expression of GFP-CT20P (Figure 4-3d). These data

97 suggest the GFP-CT20P is inhibiting the binding of CCT substrates and the co-chaperone PhLP1 and that the inability to bind CCT causes a decrease in their cellular expression.

Figure 4-3. CT20P inhibits substrate binding to CCT. a) Effects of CT20P on binding of CCT substrates and the co- chaperone PhLP1 were analyzed by CCT immunoprecipitation and immunoblotting of the co-immunoprecipitated proteins. b) Expression of the proteins from a, including a GAPDH control. c) Lack of effect of GFP-CT20P on LRAT expression. Protein expression of a non-CCT substrate LRAT was measured by immunoblotting and shown as a percent of the GFP control. d) qPCR experiment showing that the decrease in protein expression is not due to a change in transcription levels. * p<0.05, ** p<0.01, *** p<0.005

4.2.4 CT20P inhibits the assembly of signaling complexes

We next measured the effects of CT20P on the assembly of mTOR and G protein complexes.

Gβ acts in an obligate dimer with its binding partner Gγ, meaning that neither subunit is stable in the cell without the other. Assembly of the heterodimer is necessary for G protein signaling 32.

Similarly, mLST8 and Raptor have no intrinsic catalytic function, instead, they bind to the 98

mTOR kinase and support its activity. Therefore, we were interested in the effect of CT20P on

the assembly of the Gβγ dimer and the mTOR complex 1 which contains Raptor, mLST8 and mTOR. We first over-expressed Gβ1 and Gγ2 in HEK293-T with GFP-CT20P or with GFP as a

control and immunoprecipitated Gβ1 to assess its binding to Gγ2 via immunoblot of the

immunoprecipitate. We found that, while there was a moderate decrease in Gβ1 expression,

there was a dramatic decrease in Gγ2 binding to Gβ1, as well as a similar decrease in its

expression (Figure 4-4a-b). This result is similar to that observed when CCT or PhLP1 is

depleted from cells and indicates that GFP-CT20P is inhibiting Gβγ assembly32, 243. Without

assembly with Gβ1, Gγ2 is destabilized and degraded much more quickly than Gβ1. We

performed a similar experiment in which we over-expressed the components of mTORC1 with

GFP-CT20P or GFP as a control. We immunoprecipitated mTOR and then measured binding of

mLST8 and Raptor. Immunoprecipitation of the entire mTOR, mLST8 and Raptor complex was

decreased in the presence of GFP-CT20P (Figure 4-4c) as was the cellular expression of each component of the complex (Figure 4-4d). Presumably, loss of mTOR, which does not bind CCT, occurs because without the stabilizing effects of mLST8, mTOR is destabilized and its expression decreases. These results are similar to those seen with cellular depletion of CCT and indicate that GFP-CT20P is inhibiting CCT-mediated assembly of these important signaling complexes30.

4.2.5 GFP-CT20P decreases endogenous expression of signaling proteins

Thus far, our experiments had been performed using ectopically expressed proteins. We were

interested in the effects of GFP-CT20P on endogenous protein levels. Because expression of

Figure 4-4. CT20P inhibits assembly of signaling complexes. a) CT20P inhibits co-immunoprecipitation of the Gβγ dimer. We immunoprecipitated Gβ and measured the binding of Gγ in the presence or absence of GFP-CT20P. b) Expression levels of the proteins from the experiment in (a). c) CT20P inhibits co-immunoprecipitation of mTORC1. We immunoprecipitated mTOR and tested binding of Raptor and mLST8 in the presence of absence of GFP-CT20P. d) Expression levels of the proteins from the experiment in c. e) Expression levels of endogenous G proteins and PhLP1 in cells expressing GFP-CT20P compared to GFP control. f) Expression levels of endogenous mTOR subunits in cells expressing GFP-CT20P compared to GFP control. * p<0.05, ** p<0.01, *** p<0.005

GFP-CT20P eventually leads to cell death, we harvested HEK293T cells expressing GFP-CT20P

(or GFP control) 24 hours after transfection, allowing time for expressed CT20P to affect endogenous protein levels without causing cell death. We found that expression of GFP-CT20P does decrease expression of endogenous Gβγ (Gβ1and Gγ5), PhLP1, and mTORC1 subunits

(mLST8, Raptor, and mTOR) compared to cells expressing GFP (Figure 4-4e-f). These

100

decreases were moderate compared to the effects of GFP-CT20P on over-expressed proteins, especially in the case of the Gβγ and PhLP1. A reduced effect on the endogenous proteins is not unexpected given that it takes time for the turnover of endogenous proteins and because, without the demands of over-expression, residually active CCT is likely to be able to accommodate much of the newly expressed proteins.

4.2.6 CT20P inhibits CCT function in multiple cell types

Given that CCT is an important mediator of cancer progression, it seems promising that a CT20P analog could be used as a therapeutic. The resistance of healthy cells to the effects of a drug is crucial in any cancer treatment. Previous studies using CT20P loaded nanoparticles suggested that CT20P had a much stronger effect in cancerous cells with over-expressed CCT than with non-cancerous cells293. Specifically, previous studies on CT20P have looked at the differences

between MDA-MB-231 cells, a triple negative breast cancer cell line, and MCF-10A cells, a

non-tumorigenic epithelial cell line. Therefore, we sought to examine the differences in the

effects of GFP-CT20P on these two cells types. We overexpressed the G protein heterodimer,

PhLP1, or mTORC1 subunits in MDA-MB-231 cells with GFP-CT20P or GFP as a control. As

expected, the expression level of these proteins was decreased by the inhibitor GFP-CT20P

(Figure 4-5a-b). We then performed the same experiments in MCF-10A cells. We found that the

expression levels of each of the examined proteins was also decreased (Figure 4-5c-d). This

result is contrasting to previous results showing that MCF-10A cells are resistant to the effects of

CT20P296. An important distinction between our experiment and the previous study in these cell

types is that we used a transfected plasmid of GFP-CT20P instead of nano-particle delivered

CT20P peptides; therefore, the previously observed differences in effects of CT20P could have

101

been caused by a difference in nanoparticle uptake of the two cell types, rather than a difference in the effects of the CT20P inhibition of CCT. However, these results are important in showing that CT20P is exhibiting an effect on the folding of these important signaling molecules in non-

cancerous cells. These results suggest that CT20P may have broader cytotoxic than previously

proposed.

Figure 4-5. CT20P inhibits CCT in multiple cell types. a) Expression of mTOR subunits in MDA-MB-231 cells expressing GFP- CT20P compared to GFP control. b) Expression of G proteins and PhLP1 in MDA-MB-231 cells expressing GFP-CT20P compared to GFP control. c) Expression of mTOR subunits in MCF-10A cells expressing GFP-CT20P compared to GFP control. d) Expression of G proteins and PhLP1 in MCF-10A cells expressing GFP-CT20P compared to GFP control. * p<0.05, ** p<0.01, *** p<0.005

4.2.7 GFP-CT20P inhibits mTOR signaling

We next tested the effects of GFP-CT20P on mTOR signaling. mTOR is a Ser/Thr kinase that

acts as a master regulator of cell growth and survival, which frequently gets upregulated in

cancer. Many of the desired effects of a CCT inhibitor could derive from inhibition of mTOR

102

signaling. We therefore tested the effects of GFP-CT20P on mTOR signaling by examining the phosphorylation of mTOR substrates AKT (a cell-survival kinase downstream of mTORC2) and

S6K (downstream of mTORC1) in response to insulin stimulation. We performed these experiments in MDA-MB-231 cells because we felt that the effects on mTOR signaling in cancerous cells were more relevant and because AKT phosphorylation has a robust response to insulin in these cells. We found that cells expressing GFP-CT20P had a decrease in phosphorylation of AKT and S6K in response to insulin (Figure 4-6a-b). While the decreases are somewhat moderate, it is important to note that transfection efficiency is relatively low in these cells (~35%) (Figure 4-6C). Therefore, the decreases in mTOR substrate phosphorylation likely represent a significant decrease in insulin response in the cells that were transfected and express GFP-CT20P.

Figure 4-6. CT20P inhibits mTOR signaling. a) Insulin-stimulated AKT phosphorylation by mTORC2 at S473 is inhibited by GFP-CT20P. b) Insulin-stimulated S6K phosphorylation by mTORC1 at T389 is inhibited by GFP-CT20P. Representative blots show that there is no change in S6K or AKT expression. c) Flow cytometry histogram showing that MDA-MB-231 cells transfected with GFP are transfected at about 35% efficiency. * p<0.05, ** p<0.01, *** p<0.005

103

Figure 4-7. CT20P does not inhibit the ATPase cycle. a) Schematic showing the steps of the ATPase cycle in substrate folding. b) Immunoprecipitated mLST8-CCT complexes were incubated with or without ATP in the presence of absence of CT20P to show the effects on the release of mLST8 from CCT.

4.2.8 GFP-CT20P does not inhibit the ATPase cycle of CCT

After seeing that GFP-CT20P was able to inhibit the function of CCT, we were interested in determining its mode of inhibition. One possibility was that it could inhibit the ATPase cycle of

CCT. ATP binding and release is essential for the folding capabilities of CCT. While substrate is bound, CCT hydrolyzes ATP, creating a conformational change that closes the apical domains of

CCT, releasing the substrate into the cavity. After the substrate is folded, it is released along with

104

ADP and inorganic phosphate (Figure 4-7a). Therefore, incubation of substrate-bound CCT with ATP causes the release of substrate. We performed an experiment where we over-expressed mLST8 and GFP-CT20P or GFP control and then immunoprecipitated CCT. The immunoprecipitates were then incubated with or without ATP for an hour. Binding of mLST8 to

CCT was then measured by immunoblot. While binding of mLST8 to CCT was dramatically decreased in the presence of GFP-CT20P as expected, incubation with ATP decreased binding of mLST8 to CCT by approximately half in both conditions (Figure 4-7b). This suggests that

CT20P is not affecting the ATPase cycle but is inhibiting CCT by some other way. We have shown that it inhibits CCT function by reducing binding of substrates to CCT; however, more studies will need to be done to determine exactly how CT20P does this.

4.3 Discussion

CCT has been implicated in tumor progression and the assembly of HIV viral proteins266, 285, 299-

301. Because of this, CCT inhibitors could be developed as potential therapeutics, for which there

is a recognized need302. Our data help to characterize the peptide inhibitor of CCT, CT20P.

Previous data had suggested that CT20P acts through CCT to exert its cytotoxic effects296. We

confirmed this idea, first looking at the specific binding of biotinylated CT20P to purified CCT.

We found a Kd of approximately 5 µM (Figure 4-1B). While this peptide is potent enough to inhibit CCT in cells, the binding affinity is too low for a therapeutic. Any derivative of CT20P would need to be optimized for a much higher binding affinity.

Previous studies involving CT20P had used nanoparticle-delivered peptides293, 295, 296. We were

interested in looking at a more accessible version of the peptide for research purposes. We

105

cloned a construct that added CT20P to the C-terminal end of GFP and transfected it into cells.

We determined that this GFP-CT20P construct acted as an inhibitor of CCT by testing its effects on the formation of tubulin, a bona fide CCT substrate (Figure 4-2e), and that GFP-CT20 could be used to test cellular responses to CT20P. Having an available inhibitor of CCT is especially useful because CCT function can be somewhat difficult to study due to the fact that CCT is an essential gene and knockout cell lines cannot be generated. GFP-CT20P allows for the possibility of easily inhibiting CCT to better understand its function. We note that GFP-CT20P does form some aggregates in the cells, determined by both confocal imaging (Figure 4-2a) and the homogeneity score from imaging flow cytometry (Figure 4-2c). However, we showed that these aggregates did not cause the CCT inhibiting effects, but rather the aggregated GFP-CT20P appeared to be inactive (Figure 4-2d). The fact that CT20P is aggregation prone may result in a decrease in the overall efficacy of CT20P, as well as off-target effects. These results suggest that the designing derivatives of CT20P should include decreasing the tendency to form aggregates.

While further studies should be done to assess the off-target effects of these aggregates, these results suggest that CT20P is a specific inhibitor of CCT.

We also looked into the effects of GFP-CT20P on the signaling complexes, mTOR complexes and Gβγ, which are known substrates of CCT. The mTOR kinase is an important regulator of cell growth and survival, responsible for the phosphorylation of survival kinases, such as AKT, and protein synthesis and growth mediators, such as S6K8. As a result, it is involved in many pathological processes including cancer, type II diabetes, chronic inflammation, and neurodegeneration6. In the case of Gβγ, it acts downstream of GPCRs. GPCR signaling is

relevant to many aspects of physiology and has proven to be an excellent target for therapeutics;

106

approximately 30 % of all current pharmaceuticals target GPCRs and their signaling pathways10.

Because these CCT substrates are relevant to diseases such as cancer, we hypothesized that some

of the cytotoxic effects of CT20P could be from the inhibition of these signaling complexes.

Indeed, GFP-CT20P inhibited binding of these substrates to CCT (Figure 4-3a-b), which

resulted in a decrease in expression levels and assembly of these complexes (Figure 4-4a-d), and

a subsequent decrease in insulin-stimulated mTOR signaling, as shown by AKT phosphorylation

(mTORC2 substrate) and S6K phosphorylation (mTORC1 substrate) (Figure 4-6a-b). Our

results demonstrate that GFP-CT20P is effective in inhibiting the formation of signaling complexes that are important in cancer biology. Inhibition of these complexes is crucial for any

CT20P-based therapeutic. Furthermore, it appears that CT20P is non-discriminating in its inhibition of substrate folding by CCT, suggesting that it likely inhibits proper folding of most of

CCT’s substrates. This is in contrast to the only other inhibitor of CCT, N-iodoacetyl-tryptophan

(I-Trp), which inhibits only tubulin folding111, 303. These properties make CT20P useful for

studying CCT function, including discovering new CCT substrates.

Previous studies showed that nanoparticle-encapsulated CT20P more efficiently killed cancer

cells than non-cancerous cell lines, suggesting that CT20P could be an effective cancer

therapeutic295-298. We wanted to examine how GFP-CT20P affected the expression of signaling proteins in various cell types. We compared triple negative breast cancer cell line, MDA-MB-

231 cells, and non-tumorigenic epithelial cell line, MCF-10A cells, and found that GFP-CT20P decreased the expression of Gβγ subunits and mTOR complex subunits almost equivalently in both cell types (Figure 4-5). This result suggests that CT20P is inhibiting CCT-mediated complex assembly in both cancerous and non-cancerous cell lines. This finding is important to

107

recognize when considering a CT20P analog as a cancer therapeutic. While many have suggested

that a CCT inhibitor could be a beneficial cancer-treatment, further studies need to be done to

ensure a specific effect on cancer cells. Regardless of its potential as a therapeutic, this research

suggests that GFP-CT20P can be used as an inhibitor of CCT in many cell types, which would be

beneficial for research use in further understanding the role of CCT.

To understand the mechanism of inhibition, we hypothesized the CT20P could either inhibit

binding of substrates to CCT or folding and release from CCT. We found that co-

immunoprecipitation of substrates with CCT was decreased in the presence of GFP-CT20P

(Figure 4-3a), but that the ATP-mediated release of substrate was not decreased in the presence

of GFP-CT20P (Figure 4-7b). This suggests that CT20P is not inhibiting the ATPase cycle of

CCT, rather the ability of CCT to bind substrates. It is possible that the hydrophobic CT20P binds to hydrophobic residues of the substrate binding sites on CCT to inhibit binding. It is

1, 30 important to note, however, that Gβ1 and mLST8 bind to CCT in different parts of the cavity ,

so it is likely that CT20P inhibits substrate binding by some other mechanism. Further structural

studies will be required to identify where CT20P binds CCT and how that inhibits substrate

binding. Such studies would also provide a structural basis for refinement of the peptide to create

a more potent, cell-permeable inhibitor.

The characterization of CT20P in this study has demonstrated it to be an effective inhibitor of

CCT. While we point out many issues regarding drug development of CT20P or analogues, we

determined that it specifically inhibits CCT function, which will be useful in future research

studies regarding CCT function in cancer and the discovery of new CCT substrates.

108

4.4 Materials and Methods

4.4.1 Cell Culture

Human embryonic kidney (HEK)-293T cells (ATCC) were grown in 10% fetal bovine serum

(FBS) in DMEM/F12 media. MDA-MB-231 cells (ATCC) were grown in 10% FBS in DMEM.

MCF-10A cells were grown in DMEM/F12 containing 5% Horse Serum, 20 ng/mL EGF, 0.5

mg/mL Hydrocortisone, 100 ng/mL Cholera Toxin, 10 µg/ml insulin, 1X Pen/Strep. Cells were

passaged to maintain confluency between 20-90% and passage number was kept under 15.

4.4.2 Biotin pulldown

We purchased N-terminally tagged Biotin-CT20P (VTIFVAGVLTASLTIWKKMG) from

GenScript. Pulldown experiments were performed in 100 µl 2% IGEPAL in 1X PBS with 2 µg

of purified CCT complex and varying concentrations of Biotin-CT20P. Samples were incubated

at room temperature for 30 minutes to prevent CT20P precipitation and then 35 µl streptavidin was add. Samples were incubated for 30 minutes and then washed 4 times with wash buffer and then resuspended in SDS-PAGE loading buffer. Proteins were separated by SDS-PAGE and transferred to nitrocellulose (Biorad Transblot). The nitrocellulose was probed with the indicated primary antibodies and IRDye secondary antibodies (Li-COR). Blots were imaged using a LI-COR Odyssey infrared scanner, and proteins were quantified with the LI-COR software. Data was normalized to the 10 µM data point, and the non-specific binding from the

0 µM data point was subtracted. A curve was generated using Prism, with an R2 value of 0.94

and a Hill co-efficient of 1.3.

109

4.4.3 Confocal Microscopy

Cells were seeded onto acid-etched coverslips and transfected with GFP-CT20P before fixation.

Cells were washed with ice cold PBS and fixed with 4% paraformaldehyde (PFA) for 10 minutes. Between subsequent steps, three 5-minute washes were performed with ice cold 0.1%

Tween/PBS (PBS-T). After fixation, the cells were permeabilized with 0.1% triton X-100/PBS for 15 minutes. The cells were subsequently blocked with SEA BLOCK blocking buffer

(Thermo Scientific) for 1 hour, aspirated, and immediately (no washing) incubated overnight with 1:250 diluted anti-tubulin mouse (Abcam) in blocking buffer with gentle rocking at 4˚C.

The next day, the cells were incubated with 1:500 diluted anti-mouse AlexaFluor 633 (Thermo

Fisher) in PBS at room temperature for 1 hour with gentle rocking. The cells were then stained with 1.43 µM DAPI for 5 minutes, washed, mounted to microscope slides using Prolong

Diamond Antifade Mounting reagent (Thermo Scientific), and cured overnight at room temperature in the dark. Images were acquired on a LEICA TCS SP8 confocal microscope fitted with a HC PL APO 63X/1.4 Oil CS3 objective and a HyD detection system (Leica

Microsystems).

4.4.4 Imaging Flow Cytometry

HEK293T cells were transfected with either GFP-CT20P or GFP in T25 flasks. After 24 hours, the cells were washed and then trypsinized (0.05%) for 5 minutes at 37˚C. After resuspension in

10% FBS/DMEM, the cells were pelleted by centrifugation (400 x g, 5 minutes), the supernatant aspirated, and resuspended in 100 µL of 1% PFA for a 10-minute fixation at room temperature.

110

The cells were then diluted and mixed with 1 mL of ice cold PermWash buffer (PBS containing

0.1% triton X-100,2% FBS, and 0.1% sodium azide) and centrifuged at 400 x g. After aspiration,

the fixed cells were incubated with 100 µL of PermWash buffer containing 1:100 diluted mouse

anti-tubulin antibody (abcam) for 45 minutes at room temperature. The cells were then diluted

with 1 mL of PermWash, mixed, centrifuged, aspirated, and resuspended in 100 µL of 1:200

diluted anti-mouse AlexaFluor 568 for an incubation period of 30 minutes at room temperature.

The cells were again diluted, mixed, centrifuged, aspirated and then resuspended in 30-50 µL of

2% FBS/PBS and placed in 1.5 mL microcentrifuge tubes. The cells were then analyzed on an

ImageStreamx Mark II (Luminex, Seattle, WA) at 60X magnification using the 488 nm and 561 nm lasers set at 200 mW and 50 mW, respectively. Channels 1, 2, and 4 were used for

Brightfield, GFP, and AF568, respectively. 10,000 events were collected for each replicate. All

data analysis was performed using IDEAS software (Luminex, Seattle, WA). The experiment

was performed in triplicate.

4.4.5 Immunoprecipitation

HEK-293T cells were cultured and transfected in six-well plates. Cells were washed in PBS and

lysed in 200 µL of PBS supplemented with 1% IGEPAL, 0.5 mM PMSF and Halt Protease

Inhibitor Cocktail (Sigma P8340). Protein concentrations were determined using the DC protein assay (BioRad 5000116) and equal protein amounts (~ 400 µg) were immunoprecipitated by

addition of epitope tag antibodies, followed by 30 µL of protein A/G agarose beads (Santa Cruz).

Immunoprecipitants were washed three times in lysis buffer, then immunoblotted as described

above.

111

4.4.6 ATP release experiment

The effects of ATP and CT20P on the co-immunoprecipitation of mLST8 with CCT was

Technologies). Cells were sorted into 96-well plates and monoclonal lines were screened via immunoblotting for a Flag-tagged CCT3. The cell line was verified by PCR and sequencing.

These cells were transfected with mLST8. We then performed an immunoprecipitation as described above using Flag antibody. After two washes in lysis buffer containing 0.5 % CHAPS, samples were incubated at 4°C in this buffer for an additional one hour during which 5 mM ATP was added to the ATP-containing samples. Following the incubation, samples were washed two more times and then immunoblotted as previously described.

4.4.7 Insulin signaling

MDA-MB-231 cells were chosen for these experiments because of their robust response to insulin. Cells were transfecting with either GFP-CT20P or GFP only using Lipofectamine 3000.

Three hours after transfection, cells were serum starved for 10 hours. Subsequently, the cells were treated with 100 nM insulin for 30 minutes and the lysates were harvested in 1% IGEPAL in HEPES buffer supplemented with 0.5 mM PMSF, Halt Protease Inhibitor Cocktail and phosphatase inhibitor (Thermo Fisher). The effects on mTORC1 and mTORC2 signaling were

112 analyzed by immunoblotting the cell lysates for phosphorylation at P70 S6K T389 and AKT

S473, respectively. Total GAPDH, AKT and S6K were also immunoblotted to check for equivalent expression level.

4.4.8 Flow cytometry

Cells were transfected with GFP or pcDNA3.1 as an empty vector control. They were then harvested in Ringers solution and run on the CytoFlex flow cytometer. Data was analyzed in

FlowJo 10.6.2. Gates were created for living cells (FSA vs SSA) and singlets (FSA vs FSH). A gate for GFP positive cells was created using the cells not expressing GFP as a control and the percentage of the cells expressing GFP was determined. The plot was generated using the

FlowJo 10.6.2 software.

4.4.9 qPCR

HEK-293T cells were depleted of CCT using CRISPR as described above and were harvested for

(Supplementary Table 4). Real Time PCR was performed using the QuantStudio 5 Real Time

PCR system and data were analyzed using the QuantStudio Design and Analysis software.

4.4.10 Statistical Analysis

The statistical analysis was performed using the BootstRatio, a web-based statistical analysis program which calculates probability that the relative expression, RE ≠1267. BootstRatio allows

113

calculation of statistical significance when data is normalized to a control sample. The

application can be found at: http://regstattools.net/br.

4.4.6 Isolation of substrate-free CCT

HEK-293T cells were cultured in T-175 flasks. At 80% confluency, each T175 flask was

transfected with 90 μg of His6-myc-PhLP1 in pcDNA3.1B+ using 200 μg of polyethylenimine

(PEI). The cells were then lysed and loaded onto a HisTrap column. The combined HisTrap

elution fractions were then loaded for half an hour onto a HiTrap Heparin HP 5 mL column

(GE17-0406-01) equilibrated with 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 2.5 mM MgCl2, 1

mM TCEP. The column was washed with 2 column volumes of equilibration buffer. A linear gradient from 150 mM to 1 M NaCl was then applied over 8 column volumes. Elution fractions were then analyzed by SDS-PAGE and Coomassie staining, and fractions containing CCT were

combined and concentrated in a 30 kDa cutoff filter (Amicon UFC803024) to less than 300 μL.

The sample was then injected onto a Superose 6 10/300 GL size exclusion column (SEC)

equilibrated in 20 mM HEPES pH 7.5, 150 mM NaCl, 1 mM TCEP mobile phase. One column

volume of mobile phase was then run over the column and fractions were analyzed by SDS-

PAGE and Coomassie staining. The sample was concentrated to 1 µg/µL using a 30 kDa cutoff

filter and flash frozen in liquid nitrogen. These samples were then used for the biotin pull down.

4.5 Acknowledgements

I would like to thank the other contributors to this paper: Collin Nelson who has helped with many of the experiments, including the qPCR and co-immunoprecipitation experiments; Colten

McEwan who performed the confocal imaging and the imaging flow; Michael Mann who created

114 the DNA constructs; Grant Ludlam, who provided the purified CCT complex; and my advisor

Dr. Barry Willardson.

115

APPENDIX A. Supplemental Materials

Appendix A Figure 1. mTOR, Rictor and mSIN1 do not bind CCT. Co-immunoprecipitation experiments testing for possible interactions of mTOR (a), Rictor (b), and mSIN1 (c) with CCT. The absence of co-immunoprecipitating bands is marked (red X). Representative blots are shown from three separate repeats.

116

Appendix A Figure 2. Raptor loss increases Rictor expression. (a) Effects of CCT loss on mTORC1 subunit mRNA levels. Cells were treated with CCT5 sgRNA or non-targeting sgRNA as in Fig. 2, and endogenous mTOR, Raptor, and mLST8 mRNA levels were measured by qPCR. Data are shown as a percent of the control. (b) Effects of Raptor depletion on ectopic expression of mTORC2 subunits. Cells were treated with Raptor sgRNA or non-targeting sgRNA as in Fig. 2 and were transfected with mTORC2 subunits and a GFP control. Lysates were immunoblotted and quantified for expression of mTORC2 subunits and control proteins as indicated. Results are shown as a percent of the control. * p < 0.05, *** p < 0.005. Source data are provided in the Source Data file.

117

Appendix A Figure 3. PhLP1 does not contribute to mTORC formation. (a) Effects of PhLP1 depletion on endogenous mTORC subunit expression. Cells were treated with PhLP1 sgRNA or non-targeting sgRNA and Cas9 as in Fig. 2. Lysates were immunoblotted and band intensities were quantified as indicated. Results are shown as a percent of control cells. Bars represent the average ± standard error. (b) Effects of PhLP1 depletion on co-immunoprecipitation of mTORC1 subunits with mTOR. Cells were CRISPR treated and transfected with the indicated mTORC1 subunits and a GFP control. mTOR immunoprecipitates were immunoblotted and quantified as indicated. (c) Lysates from the cells in panel b were immunoblotted and quantified for expression of mTORC1 subunits and control proteins as indicated. (d) Effects of PhLP1 depletion on co-immunoprecipitation of mTORC2 subunits with mTOR. Cells were CRISPR treated and transfected with the indicated mTORC2 subunits and a GFP control. mTOR immunoprecipitates were immunoblotted and quantified as indicated. (e) Lysates from the cells in panel d were immunoblotted and quantified for expression of mTORC2 subunits and control proteins as indicated. (f) Effects of PhLP1 depletion on co-immunoprecipitation of Gγ with Gβ. Cells were CRISPR treated and transfected with Gβ, Gγ and a GFP control. Gβ immunoprecipitates were immunoblotted and quantified as indicated. (g) Lysates from the cells in panel f were immunoblotted and quantified for expression of Gβ and Gγ and control proteins as indicated. *** p < 0.005

118

Appendix A Figure 4. Cryo-EM image analysis of the mLST8-CCT complex. (a) Electrophoretic analysis of the purified mLST8-CCT complex, showing an SDS gel (left) and immunoblots for mLST8 and CCT2. (b) An EM field of mLST8-CCT particles. Bar indicates 500 Å. (c) Maximum-likelihood 2D classification of the particles. Particles represented by the red-boxed classes were discarded from further processing. (d) Angular coverage of the particles used for the 3D reconstruction of the mLST8-CCT complex. (e) Plot of the FSC coefficients vs. Resolution between two independent reconstructions for the mLST8- CCT complex using the gold-standard method. The resolution obtained for a signal to noise ratio (SNR) of 0.143 (4.0 Å) is indicated. (f) Local resolution map of the mLST8-CCT complex. Three views of the mLST8-CCT complex color coded according to the level of resolution (left). Images correspond to the side (left), end on (center) and sliced end on (right) views. The position of the slice is indicated in the cartoon at the top. Images were obtained with MonoRes. (g) Histogram with the resolution reached for each voxel of the 3D reconstruction.

119

Appendix A Figure 5. Atomic model of the human CCT complex. (a) Docking of the atomic structure of yeast apo-CCT (PDB 5GW5) into the 3D reconstruction of the mLST8-CCT complex. (b) Atomic model of the human apo-CCT generated by homology- modelling from the yeast apo-CCT and subjected to flexible fitting and refinement.

120

Appendix A Figure 6. Comparison of yeast AMP-PNP CCT and human mLST8-CCT. (a) Superimposition of yeast AMP-PNP CCT (EMD 9541, green) and human mLST8-CCT (yellow) reconstructions. (b) Angular differences between the apical domains of the eight CCT subunits from the two structures (color coded as in panel a). Rotation angles were calculated with Chimera using the hinge colored in red as a reference axis.

121

Appendix A Figure 7. Comparison of substrate-free CCT and mLST8-CCT. (a) Electrophoretic analysis of the purified substrate-free CCT complex, showing an SDS gel (left) and an immunoblot for CCT2 (right). (b) Three different views of the 3D reconstruction of substrate-free CCT (7.5 Å resolution), showing end-on (left), side (center) and cut away side views (right). The arrow indicates a mass in the interior of the cavity much smaller than that of mLST8. (c) Left, cut away side view of the mLST8- CCT complex with the resolution limited to that of substrate free CCT. The atomic structure of mLST8 (PDB 4JT6) is docked into the mass located between the CCT rings. Center, an over-lay of mLST8-CCT and substrate-free CCT in the same cut-away view. Right, the same view of the substrate-free CCT structure with the mLST8 molecule positioned at the same place as in the mLST8- CCT structure, showing a lack of density attributable to mLST8 in the substrate-free structure.

122

Appendix A Figure 8. Comparison of yeast apo-CCT and human CCT-mLST8. (a) Superimposition of yeast NPP-CCT (EMD 9540, pink) and human mLST8-CCT (yellow) 3D reconstructions. The Z-shaped conformation of the CCT2 subunits in the yeast CCT is marked with circles (side view) or an arrow (end-on view). (b) Angular differences between the apical domains of the eight CCT subunits from the two structures (color coded as in panel a). Rotation angles were calculated with Chimera using the hinge colored in red as a reference axis.

123

Appendix A Figure 9. Location of the mLST8 molecule at the center of the CCT cavity. Left – The position of mLST8 (red) docked between the CCT rings (tan) is shown, filtered to the resolution of the mLST8-CCT complex, in a cut -away side view (top) and the two end-on views (middle and bottom). Right – Images are the same but with the mLST8 structure subtracted from the reconstruction, showing the small amount of remaining mass surrounding the mLST8 molecule.

124

Data collection CCT-mLST8 Apo-CCT

Microscope Titan Krios Titan Krios

Voltage (keV) 300 300

Nominal magnification 105,000x 130,000x

Detector K2 Summit K2 Summit

Pixel size (Å) 1.36 1.06

Defocus range (µm) -1.5 to -3.0 -1.5 to -3.0

Electron dose (e-/Å2) 36 42

Initial particles (no.) 1,769,600 504,060

Final particles (no.) 452,000 139,819

Global resolution (Å) 4.0 7.5

Local Resolution (Å)

Range 3.7-11.9

Mean 5.57

Median 4.6

Table 1. Data Collection and 3D reconstruction parameters

125

Table 2. Model Refinement and Statistics

126

Protein 1 Lysine Protein 2 Lysine Distance Charge Sequence of Highest scoring pLink Mass error Mass error

Residue Residue (Å) peptide Score (Da) (ppm)

mLST8-CCT crosslinks

CCT1 532 mLST8 215 < 29.8 6 IDDLIKLHPESK(6)- 4.55E-02 0.000539 0.217298

TKIPAHTR(2)

CCT1 538 mLST8 215 < 29.8 5 LHPESKDDK(6)-TKIPAHTR(2) 3.57E-03 -0.000953 -0.4476

CCT3 20 mLST8 215 30.7 4 KVQSGNINAAK(1)- 2.82E-02 0.001497 0.683488

TKIPAHTR(2)

CCT4 21 mLST8 215 < 35.9 5 TKIPAHTR(2)-GKGAYQDR(2) 3.15E-01 0.000893 0.453963

CCT6 10 mLST8 215 < 42.0 5 TLNPKAEVAR(5)-TKIPAHTR(2) 3.24E-01 0.002596 1.202281

mLST8 intralinks mLST8 215 mLST8 245 14.6 4 FSPDSTLLATCSADQTCKIWR(1 1.18E-08 0.019661 5.569954

8)-TKIPAHTR(2) mLST8 245 mLST8 305 16.9 4 FSPDSTLLATCSADQTCKIWR(1 1.48E-03 0.004665 1.170661

8)-LWCVETGEIKR(10) mLST8 261 mLST8 305 17.5 4 TSNFSLMTELSIKSGNPGESSR(1 1.66E-03 -0.019372 -4.990237

3)-LWCVETGEIKR(10) mLST8 215 mLST8 261 24.9 4 TSNFSLMTELSIKSGNPGESSR(1 2.00E-09 0.002241 0.658588

3)-TKIPAHTR(2) mLST8 215 mLST8 305 31.1 5 LWCVETGEIKR(10)- 1.39E-07 -0.006529 -2.65041

TKIPAHTR(2) mLST8 86 mLST8 215 31.6 5 MYDLNSNNPNPIISYDGVNKNI 7.07E-06 0.015888 3.436474

ASVGFHEDGR(20)-

TKIPAHTR(2) mLST8 215 mLST8 313 34.6 6 EYGGHQKAVVCLAFNDSVLGG 3.37E-04 0.003628 0.868343

GEDQVDPR(7)-TKIPAHTR(2) mLST8 86 mLST8 305 37.3 5 MYDLNSNNPNPIISYDGVNKNI 4.25E-03 0.021766 4.285961

ASVGFHEDGR(20)-

LWCVETGEIKR(10)

CCT Equatorial Domain crosslinks

CCT1 515 CCT1 126 8.7 4 SLKFATEAAITILR(3)- 1.90E-09 0.005438 2.077575

LACKEAVR(4)

127

CCT1 466 CCT1 494 9.6 4 SLLVIPNTLAVNAAQDSTDLVA 2.45E-02 0.027026 6.567223

KLR(23)-WIGLDLSNGKPR(10)

CCT2 40 CCT2 50 10.3 4 LTSFIGAIAIGDLVKSTLGPK(15) 2.00E-07 0.026236 7.655668

-GMDKILLSSGR(4)

CCT6 502 CCT6 127 10.4 5 KQLLHSCTVIATNILLVDEIMR( 1.93E-03 0.020263 5.000424

1)-IITEGFEAAKEK(10)

CCT4 497 CCT4 55 10.5 4 KGGISNILEELVVQPLLVSVSAL 3.77E-05 0.014153 3.201701

TLATETVR(1)-

TSLGPKGMDK(6)

CCT6 129 CCT6 426 10.6 5 EKALQFLEEVK(2)- 3.11E-04 0.014272 5.998304

HKPSVKGR(2)

CCT6 424 CCT6 129 10.7 6 NAIDDGCVVPGAGAVEVAMAE 2.95E-09 0.016085 3.483539

ALIKHKPSVK(25)-

EKALQFLEEVK(2)

CCT5 64 CCT2 522 10.8 5 MMVDKDGDVTVTNDGATILS 9.82E-04 0.018384 4.088701

MMDVDHQIAK(5)-

VDNIIKAAPR(6)

CCT8 490 CCT8 466 10.8 5 NVGLDIEAEVPAVKDMLEAGIL 4.60E-03 0.017852 3.562845

DTYLGK(14)-

ANEVISKLYAVHQEGNK(7)

CCT6 502 CCT6 138 10.9 5 KQLLHSCTVIATNILLVDEIMR( 3.13E-05 0.033682 8.144915

1)-ALQFLEEVKVSR(9)

CCT3 424 CCT3 127 11.3 5 NVLLDPQLVPGGGASEMAVAH 8.11E-06 0.043247 10.286559

ALTEKSK(26)-

KALDDMISTLK(1)

CCT2 431 CCT2 119 11.5 3 TPGKEAVAMESYAK(4)- 1.48E-17 0.005806 2.21651

EAESLIAKK(8)

CCT8 62 CCT7 77 11.5 6 MVINHLEKLFVTNDAATILR(8)- 4.90E-05 0.035406 8.329895

LLDVVHPAAKTLVDIAK(10)

CCT2 431 CCT2 120 11.5 4 TPGKEAVAMESYAK(4)- 1.12E-13 0.009521 3.120935

KIHPQTIIAGWR(1)

128

CCT8 421 CCT8 138 12.2 5 LVPGGGATEIELAKQITSYGETC 3.42E-01 0.074538 14.109687

PGLEQYAIK(14)-

KAHEILPNLVCCSAK(1)

CCT7 109 CCT7 440 12.7 5 QVKPYVEEGLHPQIIIR(3)- 4.69E-06 0.023175 5.700544

QQLLIGAYAKALEIIPR(10)

CCT7 55 CCT7 47 13.3 4 GKATISNDGATILK(2)- 8.34E-09 0.00581 2.20961

GMDKLIVDGR(4)

CCT3 506 CCT3 137 13.7 3 LQTYKTAVETAVLLLR(5)- 5.99E-16 0.024719 7.717751

ALDDMISTLKK(10)

CCT6 129 CCT6 430 14.2 5 EKALQFLEEVK(2)- 4.26E-07 0.001455 0.611514

HKPSVKGR(6)

CCT7 521 CCT7 77 14.6 5 INALTAASEAACLIVSVDETIKN 1.72E-07 0.017946 3.904248

PR(22)-

LLDVVHPAAKTLVDIAK(10)

CCT4 126 CCT5 42 15.9 5 LLQKGIHPTIISESFQK(4)- 2.45E-05 0.00088 0.245193

SHIMAAKAVANTMR(7)

CCT4 497 CCT1 126 16.3 4 KGGISNILEELVVQPLLVSVSAL 4.93E-02 0.047152 10.88096

TLATETVR(1)-LACKEAVR(4)

CCT2 441 CCT2 119 16.3 3 EAVAMESYAKALR(10)- 3.81E-09 0.011506 4.486883

EAESLIAKK(8)

CCT3 43 CCT6 430 16.4 5 TCLGPKSMMK(6)- 4.56E-01 0.002584 1.175528

HKPSVKGR(6)

CCT4 143 CCT4 489 16.6 5 ALEKGIEILTDMSRPVELSDR(4) 6.60E-11 0.025127 6.439322

-HAQGEKTAGINVR(6)

CCT1 33 CCT3 20 16.8 4 SQNVMAAASIANIVKSSLGPVG 7.41E-03 0.026584 7.090765

LDK(15)-KVQSGNINAAK(1)

CCT7 440 CCT1 111 17.6 5 QQLLIGAYAKALEIIPR(10)- 4.40E-05 -0.001158 -0.327852

QKIHPTSVISGYR(2)

CCT8 476 CCT8 138 17.8 6 LYAVHQEGNKNVGLDIEAEVP 2.04E-06 0.021018 4.689015

AVK(10)-

KAHEILPNLVCCSAK(1)

CCT5 529 CCT5 535 17.9 3 MILKIDDIR(4)-KPGESEE(1) 1.62E-04 0.009456 4.632734

129

CCT7 106 CCT1 111 18.4 5 SQDAEVGDGTTSVTLLAAEFLK 1.48E-02 0.007903 1.86822

QVK(22)-QKIHPTSVISGYR(2)

CCT5 439 CCT5 150 18.5 5 VVYGGGAAEISCALAVSQEAD 1.74E-06 0.000605 0.108505

KCPTLEQYAMR(22)-

VAIEHLDKISDSVLVDIK(8)

CCT8 466 CCT1 494 18.6 5 ANEVISKLYAVHQEGNK(7)- 5.81E-05 0.014709 4.319987

WIGLDLSNGKPR(10)

CCT2 441 CCT2 120 18.7 4 EAVAMESYAKALR(10)- 2.88E-04 0.044872 14.919072

KIHPQTIIAGWR(1)

CCT5 496 CCT2 135 19.4 4 EMNPALGIDCLHKGTNDMK(13 9.87E-02 0.002926 0.962644

)-EATKAAR(4)

CCT4 55 CCT1 126 19.7 3 TSLGPKGMDK(6)- 2.65E-14 -0.000055 -0.025979

LACKEAVR(4)

CCT2 119 CCT2 119 19.8 3 EAESLIAKK(8)-EAESLIAKK(8) 9.79E-02 0.011129 5.234047

CCT8 459 CCT3 20 20.3 4 ALAENSGVKANEVISK(9)- 1.59E-02 -0.004585 -1.576333

KVQSGNINAAK(1)

CCT4 139 CCT5 483 20.8 5 GIHPTIISESFQKALEK(13)- 7.83E-06 0.028625 7.339527

QVKEMNPALGIDCLHK(3)

CCT5 35 CCT1 111 20.9 5 LMGLEALKSHIMAAK(8)- 5.37E-04 0.02193 6.777368

QKIHPTSVISGYR(2)

CCT4 143 CCT5 483 21.2 6 ALEKGIEILTDMSRPVELSDR(4) 1.32E-07 0.029521 6.767379

-QVKEMNPALGIDCLHK(3)

CCT2 120 CCT2 522 21.9 5 KIHPQTIIAGWR(1)- 1.68E-10 0.006754 2.533759

VDNIIKAAPR(6)

CCT1 466 CCT8 466 22.3 5 SLLVIPNTLAVNAAQDSTDLVA 5.32E-05 0.026221 5.627385

KLR(23)-

ANEVISKLYAVHQEGNK(7)

CCT6 449 CCT6 426 24.8 5 AQLGVQAFADALLIIPKVLAQN 1.56E-05 0.019209 4.410273

SGFDLQETLVK(17)-HKPSVK(2)

CCT2 120 CCT2 135 25.0 3 KIHPQTIIAGWR(1)- 7.90E-01 -0.013529 -5.676667

EATKAAR(4)

130

CCT1 111 CCT1 126 25.6 5 QKIHPTSVISGYR(2)- 2.00E-05 0.006848 2.665222

LACKEAVR(4)

CCT2 40 CCT2 119 26.2 4 LTSFIGAIAIGDLVKSTLGPK(15) 8.79E-13 0.040814 12.601075

-EAESLIAKK(8)

CCT3 47 CCT3 506 27.9 5 TCLGPKSMMKMLLDPMGGIV 5.36E-01 0.05183 9.748527

MTNDGNAILR(10)-

LQTYKTAVETAVLLLR(5)

CCT2 40 CCT2 120 28.0 5 LTSFIGAIAIGDLVKSTLGPK(15) 6.97E-06 0.032506 8.856775

-KIHPQTIIAGWR(1)

Table 3. XL-MS Crosslinks

131 sgRNA Target Sequence

Non-targeting GGTCTTCGAGAAGACCT

CCT5 TGGAGATGGAACCACAGGAG

PhLP1 CACCCTTGATGATAAGTTGC

PhLP1 AGAAGCTGTCAATGACTTGC

CCT3 CCTGCACCATTCTCCTCCGG

Raptor CCACGTCTGCAGGTCGTATA

Raptor CCCGTTCCTCCTTGGCGTTC

Raptor GTCTACGACTGTTCCAATGC

siRNA Target Vendor Product Number

Non-Targeting Thermo Fisher AM4635 mLST8 Qiagen SI00425474 mLST8 Qiagen SI04213923

Raptor Dharmacon L-004107-00-0005

CCT1 Dharmacon L-012749-00-0005

CCT5 Dharmacon L-012797-00-0005

qPCR PrimeTime Assay (IDT) Product Number

HPRT1 196118969

RPTOR 196118965

MTOR 201378535

MLST8 196118974

Table 4. sgRNA, siRNA and qPCR information.

132

Antibody Target Vendor Product Number Dilution

AKT Cell Signaling 9272 1:500 WB

AKT P-Ser473 Cell Signaling 4060 1:500 WB c-Myc Invitrogen 13-2500 1:1000 WB

CCT2 Abcam Ab92746 1:10000 WB

CCT4 Abcam Ab129072 1:5000 WB

CCT5 Abcam Ab129016 1:10000 WB

CCT5 BioRAD MCA2178 1:100 IP

Flag Sigma F3165 1:2000 WB 1:100 IP

GAPDH BioRAD MCA4740 1:2000 WB

GFP Abcam Ab6556 1:5000 WB

HA Roche 11867423001 1:500 WB 1:50 IP

His Thermo Fisher MA1-21315 1:1000 WB

IRS-1 Cell Signaling 2390 1:500 WB

IRS-1 P- Cell Signaling 2388 1:500 WB mLST8 Cell Signaling 3274 1:500 WB mSin1 Cell Signaling D7G1A 1:500 WB mTOR Cell Signaling 2972 1:500 WB

PhLP1 (N-term) BMW Lab 1:2000 WB

Raptor Cell Signaling 2280 1:500 WB

Rictor Cell Signaling 2150 1:500 WB

Strep Genscript A01732 1:5000 WB

V5 Invitrogen R960-25 1:2000 WB 1:100 IP

133

IRDye 680RD Goat LI-COR 926-68071 1:5000

Anti-Rabbit

IRDye 800CW Goat LI-COR 926-32211 1:5000

Anti-Rabbit

IRDye 680RD Goat LI-COR 926-68070 1:5000

Anti-Mouse

IRDye 800CW Goat LI-COR 926-32210 1:5000

Anti-Mouse

IRDye 800CW Goat LI-COR 926-32219 1:5000

Anti-Rat

IRDye 800CW LI-COR 926-32215 1:5000

Donkey Anti-Goat

Table 5. Antibody information

134

References

1. Plimpton, R. L.; Cuellar, J.; Lai, C. W.; Aoba, T.; Makaju, A.; Franklin, S.; Mathis, A. D.; Prince, J. T.; Carrascosa, J. L.; Valpuesta, J. M.; Willardson, B. M., Structures of the Gbeta-CCT and PhLP1-Gbeta-CCT complexes reveal a mechanism for G-protein beta-subunit folding and Gbetagamma dimer assembly. Proc Natl Acad Sci U S A 2015, 112 (8), 2413-8.

2. Kim, Y. E.; Hipp, M. S.; Bracher, A.; Hayer-Hartl, M.; Hartl, F. U., Molecular Chaperone Functions in Protein Folding and Proteostasis. 2013, 82 (1), 323-355.

3. Hartl, F. U.; Bracher, A.; Hayer-Hartl, M., Molecular chaperones in protein folding and proteostasis. Nature 2011, 475 (7356), 324-332.

4. Kim, S. G.; Buel, G. R.; Blenis, J., Nutrient regulation of the mTOR complex 1 signaling pathway. Mol Cells 2013, 35 (6), 463-73.

5. Kim, Y. C.; Guan, K. L., mTOR: a pharmacologic target for autophagy regulation. J Clin Invest 2015, 125 (1), 25-32.

6. Laplante, M.; Sabatini, D. M., mTOR Signaling in Growth Control and Disease. Cell 2012, 149 (2), 274-93.

7. Cobbold, S. P., The mTOR pathway and integrating immune regulation. Immunology 2013, 140 (4), 391-8.

8. Saxton, R. A.; Sabatini, D. M., mTOR Signaling in Growth, Metabolism, and Disease. Cell 2017, 169 (2), 361-371.

9. Wettschureck, N.; Offermanns, S., Mammalian G proteins and their cell type specific functions. Physiol. Rev. 2005, 85 (4), 1159-204.

10. Luttrell, L. M.; Maudsley, S.; Bohn, L. M., Fulfilling the Promise of "Biased" G Protein- Coupled Receptor Agonism. Mol Pharmacol 2015, 88 (3), 579-88.

135

11. Samant, R. S.; Livingston, C. M.; Sontag, E. M.; Frydman, J., Distinct proteostasis circuits cooperate in nuclear and cytoplasmic protein quality control. Nature 2018, 563 (7731), 407-411.

12. Balchin, D.; Hayer-Hartl, M.; Hartl, F. U., In vivo aspects of protein folding and quality control. Science 2016, 353 (6294), aac4354.

13. Brockwell, D. J.; Radford, S. E., Intermediates: ubiquitous species on folding energy landscapes? Curr Opin Struct Biol 2007, 17 (1), 30-7.

14. Saibil, H., Chaperone machines for protein folding, unfolding and disaggregation. Nat Rev Mol Cell Biol 2013, 14 (10), 630-642.

15. Díaz-Villanueva, J. F.; Díaz-Molina, R.; García-González, V., Protein Folding and Mechanisms of Proteostasis. Int J Mol Sci 2015, 16 (8), 17193-230.

16. Ellis, R. J., Revisiting the Anfinsen cage. Fold Des 1996, 1 (1), R9-15.

17. Martin, J., Chaperonin function--effects of crowding and confinement. J Mol Recognit 2004, 17 (5), 465-72.

18. Motojima, F.; Fujii, K.; Yoshida, M., Chaperonin facilitates protein folding by avoiding initial polypeptide collapse. J Biochem 2018, 164 (5), 369-379.

19. Pearl, L. H., Review: The HSP90 molecular chaperone-an enigmatic ATPase. Biopolymers 2016, 105 (8), 594-607.

20. Fernández-Fernández, M. R.; Valpuesta, J. M., Hsp70 chaperone: a master player in protein homeostasis. F1000Res 2018, 7.

21. Labbadia, J.; Morimoto, R. I., The biology of proteostasis in aging and disease. Annu Rev Biochem 2015, 84, 435-64.

22. Kampinga, H. H.; Hageman, J.; Vos, M. J.; Kubota, H.; Tanguay, R. M.; Bruford, E. A.; Cheetham, M. E.; Chen, B.; Hightower, L. E., Guidelines for the nomenclature of the human heat shock proteins. Cell Stress Chaperones 2009, 14 (1), 105-11.

136

23. Mogk, A.; Bukau, B.; Kampinga, H. H., Cellular Handling of Protein Aggregates by Disaggregation Machines. Mol Cell 2018, 69 (2), 214-226.

24. Hoter, A.; El-Sabban, M. E.; Naim, H. Y., The HSP90 Family: Structure, Regulation, Function, and Implications in Health and Disease. Int J Mol Sci 2018, 19 (9).

25. Hartl, F. U., Unfolding the chaperone story. Mol Biol Cell 2017, 28 (22), 2919-2923.

26. Sahlan, M.; Zako, T.; Yohda, M., Prefoldin, a jellyfish-like molecular chaperone: functional cooperation with a group II chaperonin and beyond. Biophys Rev 2018, 10 (2), 339- 345.

27. Ricketts, M. D.; Marmorstein, R., A Molecular Prospective for HIRA Complex Assembly and H3.3-Specific Histone Chaperone Function. J Mol Biol 2017, 429 (13), 1924- 1933.

28. Camasses, A.; Bodganova, A.; Shevchenko, A.; Zachariae, W., The CCT chaperonin promotes activation of the anaphase-promoting complex through the generation of functional Cdc20. Mol. Cell 2003, 12, 87-100.

29. Antonova, S. V.; Haffke, M.; Corradini, E.; Mikuciunas, M.; Low, T. Y.; Signor, L.; van Es, R. M.; Gupta, K.; Scheer, E.; Vos, H. R.; Tora, L.; Heck, A. J. R.; Timmers, H. T. M.; Berger, I., Chaperonin CCT checkpoint function in basal transcription factor TFIID assembly. Nat Struct Mol Biol 2018, 25 (12), 1119-1127.

30. Cuéllar, J.; Ludlam, W. G.; Tensmeyer, N. C.; Aoba, T.; Dhavale, M.; Santiago, C.; Bueno-Carrasco, M. T.; Mann, M. J.; Plimpton, R. L.; Makaju, A.; Franklin, S.; Willardson, B. M.; Valpuesta, J. M., Structural and functional analysis of the role of the chaperonin CCT in mTOR complex assembly. Nature Communications 2019, 10 (1), 2865.

31. Howlett, A. C.; Gray, A. J.; Hunter, J. M.; Willardson, B. M., Role of Molecular Chaperones in G protein b5/Regulator of G protein Signaling Dimer Assembly and G protein bg Dimer Specificity J. Biol. Chem. 2009, 284, 16386–16399.

32. Lukov, G. L.; Hu, T.; McLaughlin, J. N.; Hamm, H. E.; Willardson, B. M., Phosducin- like protein acts as a molecular chaperone for G protein bg dimer assembly. EMBO J 2005, 24, 1965-1975.

137

33. Omura, T., Mitochondria-targeting sequence, a multi-role sorting sequence recognized at all steps of protein import into mitochondria. J Biochem 1998, 123 (6), 1010-6.

34. Endow, J. K.; Singhal, R.; Fernandez, D. E.; Inoue, K., Chaperone-assisted Post- translational Transport of Plastidic Type I Signal Peptidase 1. J Biol Chem 2015, 290 (48), 28778-91.

35. Schopf, F. H.; Biebl, M. M.; Buchner, J., The HSP90 chaperone machinery. Nat Rev Mol Cell Biol 2017, 18 (6), 345-360.

36. Xing, Q.; Shi, K.; Portaliou, A.; Rossi, P.; Economou, A.; Kalodimos, C. G., Structures of chaperone-substrate complexes docked onto the export gate in a type III secretion system. Nat Commun 2018, 9 (1), 1773.

37. Natarajan, K.; Jiang, J.; Margulies, D. H., Structural aspects of chaperone-mediated peptide loading in the MHC-I antigen presentation pathway. Crit Rev Biochem Mol Biol 2019, 54 (2), 164-173.

38. Bose, D.; Chakrabarti, A., Substrate specificity in the context of molecular chaperones. 2017, 69 (9), 647-659.

39. Tiwari, S.; Atluri, V.; Kaushik, A.; Yndart, A.; Nair, M., Alzheimer's disease: pathogenesis, diagnostics, and therapeutics. Int J Nanomedicine 2019, 14, 5541-5554.

40. Jimenez-Sanchez, M.; Licitra, F.; Underwood, B. R.; Rubinsztein, D. C., Huntington's Disease: Mechanisms of Pathogenesis and Therapeutic Strategies. Cold Spring Harb Perspect Med 2017, 7 (7).

41. Bush, K. T.; Goldberg, A. L.; Nigam, S. K., Proteasome inhibition leads to a heat-shock response, induction of endoplasmic reticulum chaperones, and thermotolerance. J Biol Chem 1997, 272 (14), 9086-92.

42. Mattoo, R. U. H.; Goloubinoff, P., Molecular chaperones are nanomachines that catalytically unfold misfolded and alternatively folded proteins. Cell Mol Life Sci 2014, 71 (17), 3311-3325.

43. Glover, J. R.; Lindquist, S., Hsp104, Hsp70, and Hsp40: a novel chaperone system that rescues previously aggregated proteins. Cell 1998, 94 (1), 73-82.

138

44. Demand, J.; Alberti, S.; Patterson, C.; Höhfeld, J., Cooperation of a ubiquitin domain protein and an E3 ubiquitin ligase during chaperone/proteasome coupling. Curr Biol 2001, 11 (20), 1569-77.

45. Lüders, J.; Demand, J.; Höhfeld, J., The ubiquitin-related BAG-1 provides a link between the molecular chaperones Hsc70/Hsp70 and the proteasome. J Biol Chem 2000, 275 (7), 4613-7.

46. Kandasamy, G.; Andréasson, C., Hsp70-Hsp110 chaperones deliver ubiquitin-dependent and -independent substrates to the 26S proteasome for proteolysis in yeast. J Cell Sci 2018, 131 (6).

47. Bandyopadhyay, U.; Kaushik, S.; Varticovski, L.; Cuervo, A. M., The chaperone- mediated autophagy receptor organizes in dynamic protein complexes at the lysosomal membrane. Mol Cell Biol 2008, 28 (18), 5747-5763.

48. Hayer-Hartl, M.; Bracher, A.; Hartl, F. U., The GroEL–GroES Chaperonin Machine: A Nano-Cage for Protein Folding. Trends in Biochemical Sciences 2016, 41 (1), 62-76.

49. Ellis, R. J.; Van Der Vies, S. M., The Rubisco subunit binding protein. Photosynth Res 1988, 16 (1-2), 101-15.

50. Cheng, M. Y.; Hartl, F. U.; Horwich, A. L., The mitochondrial chaperonin hsp60 is required for its own assembly. Nature 1990, 348 (6300), 455-8.

51. Klumpp, M.; Baumeister, W., The thermosome: archetype of group II chaperonins. FEBS Letters 1998, 430 (1), 73-77.

52. Ditzel, L.; Löwe, J.; Stock, D.; Stetter, K. O.; Huber, H.; Huber, R.; Steinbacher, S., Crystal structure of the thermosome, the archaeal chaperonin and homolog of CCT. Cell 1998, 93 (1), 125-38.

53. Horwich, A. L.; Fenton, W. A.; Chapman, E.; Farr, G. W., Two Families of Chaperonin: Physiology and Mechanism. Annual Review of Cell and Developmental Biology 2007, 23 (1), 115-145.

54. Kusmierczyk, A. R.; Martin, J., Chaperonins – keeping a lid on folding proteins. FEBS Letters 2001, 505 (3), 343-347.

139

55. Fujiwara, K.; Ishihama, Y.; Nakahigashi, K.; Soga, T.; Taguchi, H., A systematic survey of in vivo obligate chaperonin-dependent substrates. Embo j 2010, 29 (9), 1552-64.

56. Vallin, J.; Grantham, J., The role of the molecular chaperone CCT in protein folding and mediation of cytoskeleton-associated processes: implications for cancer cell biology. Cell Stress and Chaperones 2019, 24 (1), 17-27.

57. Pappenberger, G.; Wilsher, J. A.; Roe, S. M.; Counsell, D. J.; Willison, K. R.; Pearl, L. H., Crystal structure of the CCTgamma apical domain: implications for substrate binding to the eukaryotic cytosolic chaperonin. J Mol Biol 2002, 318 (5), 1367-79.

58. Archibald, J. M.; Blouin, C.; Doolittle, W. F., Gene duplication and the evolution of group II chaperonins: implications for structure and function. J Struct Biol 2001, 135 (2), 157-69.

59. McLaughlin, J. N.; Thulin, C. D.; Hart, S. J.; Resing, K. A.; Ahn, N. G.; Willardson, B. M., Regulatory interaction of phosducin-like protein with the cytosolic chaperonin complex. Proc. Natl. Acad. Sci. U.S.A. 2002, 99 (12), 7962-7.

60. Dekker, C.; Stirling, P. C.; McCormack, E. A.; Filmore, H.; Paul, A.; Brost, R. L.; Costanzo, M.; Boone, C.; Leroux, M. R.; Willison, K. R., The interaction network of the chaperonin CCT. Embo j 2008, 27 (13), 1827-39.

61. Gao, Y.; Thomas, J. O.; Chow, R. L.; Lee, G. H.; Cowan, N. J., A cytoplasmic chaperonin that catalyzes beta-actin folding. Cell 1992, 69 (6), 1043-50.

62. Yaffe, M. B.; Farr, G. W.; Miklos, D.; Horwich, A. L.; Sternlicht, M. L.; Sternlicht, H., TCP1 complex is a molecular chaperone in tubulin biogenesis. Nature 1992, 358 (6383), 245-8.

63. Willison, K. R., The substrate specificity of eukaryotic cytosolic chaperonin CCT. 2018, 373 (1749), 20170192.

64. Willardson, B. M.; Tracy, C. M., Chaperone-mediated assembly of G protein complexes. Sub-cellular biochemistry 2012, 63, 131-53.

65. Seo, S.; Baye, L. M.; Schulz, N. P.; Beck, J. S.; Zhang, Q.; Slusarski, D. C.; Sheffield, V. C., BBS6, BBS10, and BBS12 form a complex with CCT/TRiC family chaperonins and mediate BBSome assembly. Proceedings of the National Academy of Sciences of the United States of America 2010, 107 (4), 1488-93.

140

66. Herzog, F.; Kahraman, A.; Boehringer, D.; Mak, R.; Bracher, A.; Walzthoeni, T.; Leitner, A.; Beck, M.; Hartl, F. U.; Ban, N.; Malmstrom, L.; Aebersold, R., Structural probing of a protein phosphatase 2A network by chemical cross-linking and mass spectrometry. Science 2012, 337 (6100), 1348-52.

67. Freund, A.; Zhong, F. L.; Venteicher, A. S.; Meng, Z.; Veenstra, T. D.; Frydman, J.; Artandi, S. E., Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Cell 2014, 159 (6), 1389-403.

68. McClellan, A. J.; Scott, M. D.; Frydman, J., Folding and quality control of the VHL tumor suppressor proceed through distinct chaperone pathways. Cell 2005, 121, 739-748.

69. Sot, B.; Rubio-Muñoz, A.; Leal-Quintero, A.; Martínez-Sabando, J.; Marcilla, M.; Roodveldt, C.; Valpuesta, J. M., The chaperonin CCT inhibits assembly of α-synuclein amyloid fibrils by a specific, conformation-dependent interaction. Sci Rep 2017, 7, 40859.

70. Grantham, J., The Molecular Chaperone CCT/TRiC: An Essential Component of Proteostasis and a Potential Modulator of Protein Aggregation. Front Genet 2020, 11, 172.

71. Yam, A. Y.; Xia, Y.; Lin, H. T.; Burlingame, A.; Gerstein, M.; Frydman, J., Defining the TRiC/CCT interactome links chaperonin function to stabilization of newly made proteins with complex topologies. Nature structural & molecular biology 2008, 15 (12), 1255-62.

72. Jain, B. P.; Pandey, S., WD40 Repeat Proteins: Signalling Scaffold with Diverse Functions. Protein J 2018, 37 (5), 391-406.

73. Leitner, A.; Joachimiak, L. A.; Bracher, A.; Mönkemeyer, L.; Walzthoeni, T.; Chen, B.; Pechmann, S.; Holmes, S.; Cong, Y.; Ma, B.; Ludtke, S.; Chiu, W.; Hartl, F. U.; Aebersold, R.; Frydman, J., The molecular architecture of the eukaryotic chaperonin TRiC/CCT. Structure (London, England : 1993) 2012, 20 (5), 814-825.

74. Cong, Y.; Baker, M. L.; Jakana, J.; Woolford, D.; Miller, E. J.; Reissmann, S.; Kumar, R. N.; Redding-Johanson, A. M.; Batth, T. S.; Mukhopadhyay, A.; Ludtke, S. J.; Frydman, J.; Chiu, W., 4.0-A resolution cryo-EM structure of the mammalian chaperonin TRiC/CCT reveals its unique subunit arrangement. Proceedings of the National Academy of Sciences of the United States of America 2010, 107 (11), 4967-72.

75. Lopez, T.; Dalton, K.; Frydman, J., The Mechanism and Function of Group II Chaperonins. J Mol Biol 2015, 427 (18), 2919-30.

141

76. Dekker, C.; Roe, S. M.; McCormack, E. A.; Beuron, F.; Pearl, L. H.; Willison, K. R., The crystal structure of yeast CCT reveals intrinsic asymmetry of eukaryotic cytosolic chaperonins. EMBO J 2011, 30 (15), 3078-90.

77. Gestaut, D.; Limatola, A.; Joachimiak, L.; Frydman, J., The ATP-powered gymnastics of TRiC/CCT: an asymmetric protein folding machine with a symmetric origin story. Current opinion in structural biology 2019, 55, 50-58.

78. Muñoz, I. G.; Yébenes, H.; Zhou, M.; Mesa, P.; Serna, M.; Park, A. Y.; Bragado- Nilsson, E.; Beloso, A.; de Cárcer, G.; Malumbres, M.; Robinson, C. V.; Valpuesta, J. M.; Montoya, G., Crystal structure of the open conformation of the mammalian chaperonin CCT in complex with tubulin. Nature structural & molecular biology 2011, 18 (1), 14-19.

79. Dekker, C.; Roe, S. M.; McCormack, E. A.; Beuron, F.; Pearl, L. H.; Willison, K. R., The crystal structure of yeast CCT reveals intrinsic asymmetry of eukaryotic cytosolic chaperonins. The EMBO journal 2011, 30 (15), 3078-3090.

80. Kalisman, N.; Schroder, G. F.; Levitt, M., The crystal structures of the eukaryotic chaperonin CCT reveal its functional partitioning. Structure 2013, 21 (4), 540-9.

81. Reissmann, S.; Joachimiak, L. A.; Chen, B.; Meyer, A. S.; Nguyen, A.; Frydman, J., A gradient of ATP affinities generates an asymmetric power stroke driving the chaperonin TRIC/CCT folding cycle. Cell Rep 2012, 2 (4), 866-77.

82. Zang, Y.; Jin, M.; Wang, H.; Cui, Z.; Kong, L.; Liu, C.; Cong, Y., Staggered ATP binding mechanism of eukaryotic chaperonin TRiC (CCT) revealed through high-resolution cryo-EM. Nature Structural &Amp; Molecular Biology 2016, 23, 1083.

83. Berger, J.; Berger, S.; Li, M.; Jacoby, A. S.; Arner, A.; Bavi, N.; Stewart, A. G.; Currie, P. D., In Vivo Function of the Chaperonin TRiC in α-Actin Folding during Sarcomere Assembly. Cell Rep 2018, 22 (2), 313-322.

84. Cong, Y.; Schröder, G. F.; Meyer, A. S.; Jakana, J.; Ma, B.; Dougherty, M. T.; Schmid, M. F.; Reissmann, S.; Levitt, M.; Ludtke, S. L.; Frydman, J.; Chiu, W., Symmetry- free cryo-EM structures of the chaperonin TRiC along its ATPase-driven conformational cycle. Embo j 2012, 31 (3), 720-30.

85. Douglas, N. R.; Reissmann, S.; Zhang, J.; Chen, B.; Jakana, J.; Kumar, R.; Chiu, W.; Frydman, J., Dual action of ATP hydrolysis couples lid closure to substrate release into the group II chaperonin chamber. Cell 2011, 144 (2), 240-52.

142

86. Stemp, M. J.; Guha, S.; Hartl, F. U.; Barral, J. M., Efficient production of native actin upon translation in a bacterial lysate supplemented with the eukaryotic chaperonin TRiC. Biol Chem 2005, 386 (8), 753-7.

87. Balchin, D.; Miličić, G.; Strauss, M.; Hayer-Hartl, M.; Hartl, F. U., Pathway of Actin Folding Directed by the Eukaryotic Chaperonin TRiC. Cell 2018, 174 (6), 1507-1521.e16.

88. Russmann, F.; Stemp, M. J.; Monkemeyer, L.; Etchells, S. A.; Bracher, A.; Hartl, F. U., Folding of large multidomain proteins by partial encapsulation in the chaperonin TRiC/CCT. Proceedings of the National Academy of Sciences of the United States of America 2012, 109 (52), 21208-15.

89. Vainberg, I. E.; Lewis, S. A.; Rommelaere, H.; Ampe, C.; Vandekerckhove, J.; Klein, H. L.; Cowan, N. J., Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell 1998, 93 (5), 863-73.

90. Geissler, S.; Siegers, K.; Schiebel, E., A novel protein complex promoting formation of functional alpha- and gamma-tubulin. Embo j 1998, 17 (4), 952-66.

91. Leroux, M. R.; Fändrich, M.; Klunker, D.; Siegers, K.; Lupas, A. N.; Brown, J. R.; Schiebel, E.; Dobson, C. M.; Hartl, F. U., MtGimC, a novel archaeal chaperone related to the eukaryotic chaperonin cofactor GimC/prefoldin. Embo j 1999, 18 (23), 6730-43.

92. Martín-Benito, J.; Boskovic, J.; Gómez-Puertas, P.; Carrascosa, J. L.; Simons, C. T.; Lewis, S. A.; Bartolini, F.; Cowan, N. J.; Valpuesta, J. M., Structure of eukaryotic prefoldin and of its complexes with unfolded actin and the cytosolic chaperonin CCT. Embo j 2002, 21 (23), 6377-86.

93. Stein, K. C.; Kriel, A.; Frydman, J., Nascent Polypeptide Domain Topology and Elongation Rate Direct the Cotranslational Hierarchy of Hsp70 and TRiC/CCT. Mol Cell 2019, 75 (6), 1117-1130.e5.

94. Melville, M. W.; McClellan, A. J.; Meyer, A. S.; Darveau, A.; Frydman, J., The Hsp70 and TRiC/CCT chaperone systems cooperate in vivo to assemble the von Hippel-Lindau tumor suppressor complex. Mol Cell Biol 2003, 23 (9), 3141-51.

95. Cuéllar, J.; Martín-Benito, J.; Scheres, S. H.; Sousa, R.; Moro, F.; López-Viñas, E.; Gómez-Puertas, P.; Muga, A.; Carrascosa, J. L.; Valpuesta, J. M., The structure of CCT-Hsc70 NBD suggests a mechanism for Hsp70 delivery of substrates to the chaperonin. Nat Struct Mol Biol 2008, 15 (8), 858-64.

143

96. Stirling, P. C.; Cuéllar, J.; Alfaro, G. A.; El Khadali, F.; Beh, C. T.; Valpuesta, J. M.; Melki, R.; Leroux, M. R., PhLP3 modulates CCT-mediated actin and tubulin folding via ternary complexes with substrates. J Biol Chem 2006, 281 (11), 7012-21.

97. Stirling, P. C.; Srayko, M.; Takhar, K. S.; Pozniakovsky, A.; Hyman, A. A.; Leroux, M. R., Functional interaction between phosducin-like protein 2 and cytosolic chaperonin is essential for cytoskeletal protein function and cell cycle progression. Mol Biol Cell 2007, 18 (6), 2336-45.

98. Lane, C. A.; Hardy, J.; Schott, J. M., Alzheimer's disease. Eur J Neurol 2018, 25 (1), 59- 70.

99. McColgan, P.; Tabrizi, S. J., Huntington's disease: a clinical review. Eur J Neurol 2018, 25 (1), 24-34.

100. Beitz, J. M., Parkinson's disease: a review. Front Biosci (Schol Ed) 2014, 6, 65-74.

101. Kalia, L. V.; Lang, A. E., Parkinson's disease. Lancet 2015, 386 (9996), 896-912.

102. Pavel, M.; Imarisio, S.; Menzies, F. M.; Jimenez-Sanchez, M.; Siddiqi, F. H.; Wu, X.; Renna, M.; O’Kane, C. J.; Crowther, D. C.; Rubinsztein, D. C., CCT complex restricts neuropathogenic protein aggregation via autophagy. Nature Communications 2016, 7, 13821.

103. Brehme, M.; Voisine, C.; Rolland, T.; Wachi, S.; Soper, J. H.; Zhu, Y.; Orton, K.; Villella, A.; Garza, D.; Vidal, M.; Ge, H.; Morimoto, R. I., A chaperome subnetwork safeguards proteostasis in aging and neurodegenerative disease. Cell Rep 2014, 9 (3), 1135-50.

104. Campanella, C.; Pace, A.; Caruso Bavisotto, C.; Marzullo, P.; Marino Gammazza, A.; Buscemi, S.; Palumbo Piccionello, A., Heat Shock Proteins in Alzheimer's Disease: Role and Targeting. Int J Mol Sci 2018, 19 (9).

105. Ou, J. R.; Tan, M. S.; Xie, A. M.; Yu, J. T.; Tan, L., Heat shock protein 90 in Alzheimer's disease. Biomed Res Int 2014, 2014, 796869.

106. Calderwood, S. K.; Khaleque, M. A.; Sawyer, D. B.; Ciocca, D. R., Heat shock proteins in cancer: chaperones of tumorigenesis. Trends Biochem Sci 2006, 31 (3), 164-72.

144

107. Trinidad, A. G.; Muller, P. A.; Cuellar, J.; Klejnot, M.; Nobis, M.; Valpuesta, J. M.; Vousden, K. H., Interaction of p53 with the CCT complex promotes protein folding and wild- type p53 activity. Mol Cell 2013, 50 (6), 805-17.

108. Won, K. A.; Schumacher, R. J.; Farr, G. W.; Horwich, A. L.; Reed, S. I., Maturation of human cyclin E requires the function of eukaryotic chaperonin CCT. Mol Cell Biol 1998, 18 (12), 7584-9.

109. Kasembeli, M.; Lau, W. C.; Roh, S. H.; Eckols, T. K.; Frydman, J.; Chiu, W.; Tweardy, D. J., Modulation of STAT3 folding and function by TRiC/CCT chaperonin. PLoS Biol 2014, 12 (4), e1001844.

110. Boudiaf-Benmammar, C.; Cresteil, T.; Melki, R., The cytosolic chaperonin CCT/TRiC and cancer cell proliferation. PloS one 2013, 8 (4), e60895.

111. Liu, Y. J.; Kumar, V.; Lin, Y. F.; Liang, P. H., Disrupting CCT-β : β-tubulin selectively kills CCT-β overexpressed cancer cells through MAPKs activation. Cell Death Dis 2017, 8 (9), e3052.

112. Karuppasamy, M.; Kusmider, B.; Oliveira, T. M.; Gaubitz, C.; Prouteau, M.; Loewith, R.; Schaffitzel, C., Cryo-EM structure of Saccharomyces cerevisiae target of rapamycin complex 2. Nat Commun 2017, 8 (1), 1729.

113. Aylett, C. H.; Sauer, E.; Imseng, S.; Boehringer, D.; Hall, M. N.; Ban, N.; Maier, T., Architecture of human mTOR complex 1. Science 2016, 351 (6268), 48-52.

114. Dumont, F. J.; Su, Q., Mechanism of action of the immunosuppressant rapamycin. Life Sci 1996, 58 (5), 373-95.

115. Hwang, Y.; Kim, L. C.; Song, W.; Edwards, D. N.; Cook, R. S.; Chen, J., Disruption of the Scaffolding Function of mLST8 Selectively Inhibits mTORC2 Assembly and Function and Suppresses mTORC2-Dependent Tumor Growth In Vivo. Cancer Res 2019, 79 (13), 3178-3184.

116. Schalm, S. S.; Fingar, D. C.; Sabatini, D. M.; Blenis, J., TOS motif-mediated raptor binding regulates 4E-BP1 multisite phosphorylation and function. Curr Biol 2003, 13 (10), 797- 806.

117. Nojima, H.; Tokunaga, C.; Eguchi, S.; Oshiro, N.; Hidayat, S.; Yoshino, K.; Hara, K.; Tanaka, N.; Avruch, J.; Yonezawa, K., The mammalian target of rapamycin (mTOR) partner,

145

raptor, binds the mTOR substrates p70 S6 kinase and 4E-BP1 through their TOR signaling (TOS) motif. J Biol Chem 2003, 278 (18), 15461-4.

118. Sancak, Y.; Thoreen, C. C.; Peterson, T. R.; Lindquist, R. A.; Kang, S. A.; Spooner, E.; Carr, S. A.; Sabatini, D. M., PRAS40 is an insulin-regulated inhibitor of the mTORC1 protein kinase. Mol Cell 2007, 25 (6), 903-15.

119. Catena, V.; Fanciulli, M., Deptor: not only a mTOR inhibitor. J Exp Clin Cancer Res 2017, 36 (1), 12.

120. Jacinto, E.; Loewith, R.; Schmidt, A.; Lin, S.; Rüegg, M. A.; Hall, A.; Hall, M. N., Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol 2004, 6 (11), 1122-8.

121. Sarbassov, D. D.; Ali, S. M.; Kim, D. H.; Guertin, D. A.; Latek, R. R.; Erdjument- Bromage, H.; Tempst, P.; Sabatini, D. M., Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol 2004, 14 (14), 1296-302.

122. Jebali, A.; Dumaz, N., The role of RICTOR downstream of receptor tyrosine kinase in cancers. Mol Cancer 2018, 17 (1), 39-39.

123. Jacinto, E.; Facchinetti, V.; Liu, D.; Soto, N.; Wei, S.; Jung, S. Y.; Huang, Q.; Qin, J.; Su, B., SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell 2006, 127 (1), 125-37.

124. Pearce, L. R.; Huang, X.; Boudeau, J.; Pawłowski, R.; Wullschleger, S.; Deak, M.; Ibrahim, A. F.; Gourlay, R.; Magnuson, M. A.; Alessi, D. R., Identification of Protor as a novel Rictor-binding component of mTOR complex-2. Biochem J 2007, 405 (3), 513-22.

125. Gan, X.; Wang, J.; Wang, C.; Sommer, E.; Kozasa, T.; Srinivasula, S.; Alessi, D.; Offermanns, S.; Simon, M. I.; Wu, D., PRR5L degradation promotes mTORC2-mediated PKC- δ phosphorylation and cell migration downstream of Gα12. Nat Cell Biol 2012, 14 (7), 686-696.

126. Chen, X.; Liu, M.; Tian, Y.; Li, J.; Qi, Y.; Zhao, D.; Wu, Z.; Huang, M.; Wong, C. C. L.; Wang, H. W.; Wang, J.; Yang, H.; Xu, Y., Cryo-EM structure of human mTOR complex 2. Cell Res 2018, 28 (5), 518-528.

146

127. Morita, M.; Gravel, S. P.; Hulea, L.; Larsson, O.; Pollak, M.; St-Pierre, J.; Topisirovic, I., mTOR coordinates protein synthesis, mitochondrial activity and proliferation. Cell Cycle 2015, 14 (4), 473-80.

128. Ben-Sahra, I.; Manning, B. D., mTORC1 signaling and the metabolic control of cell growth. Current opinion in cell biology 2017, 45, 72-82.

129. Sancak, Y.; Bar-Peled, L.; Zoncu, R.; Markhard, A. L.; Nada, S.; Sabatini, D. M., Ragulator-Rag complex targets mTORC1 to the lysosomal surface and is necessary for its activation by amino acids. Cell 2010, 141 (2), 290-303.

130. Bar-Peled, L.; Chantranupong, L.; Cherniack, A. D.; Chen, W. W.; Ottina, K. A.; Grabiner, B. C.; Spear, E. D.; Carter, S. L.; Meyerson, M.; Sabatini, D. M., A Tumor suppressor complex with GAP activity for the Rag GTPases that signal amino acid sufficiency to mTORC1. Science 2013, 340 (6136), 1100-6.

131. Rabanal-Ruiz, Y.; Korolchuk, V. I., mTORC1 and Nutrient Homeostasis: The Central Role of the Lysosome. Int J Mol Sci 2018, 19 (3).

132. Inoki, K.; Li, Y.; Xu, T.; Guan, K. L., Rheb GTPase is a direct target of TSC2 GAP activity and regulates mTOR signaling. Genes Dev 2003, 17 (15), 1829-34.

133. Yang, H.; Jiang, X.; Li, B.; Yang, H. J.; Miller, M.; Yang, A.; Dhar, A.; Pavletich, N. P., Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40. Nature 2017, 552 (7685), 368-373.

134. Menon, S.; Dibble, C. C.; Talbott, G.; Hoxhaj, G.; Valvezan, A. J.; Takahashi, H.; Cantley, L. C.; Manning, B. D., Spatial control of the TSC complex integrates insulin and nutrient regulation of mTORC1 at the lysosome. Cell 2014, 156 (4), 771-85.

135. Demetriades, C.; Plescher, M.; Teleman, A. A., Lysosomal recruitment of TSC2 is a universal response to cellular stress. Nat Commun 2016, 7, 10662.

136. Inoki, K.; Li, Y.; Zhu, T.; Wu, J.; Guan, K. L., TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 2002, 4 (9), 648-57.

137. Gingras, A. C.; Gygi, S. P.; Raught, B.; Polakiewicz, R. D.; Abraham, R. T.; Hoekstra, M. F.; Aebersold, R.; Sonenberg, N., Regulation of 4E-BP1 phosphorylation: a novel two-step mechanism. Genes Dev 1999, 13 (11), 1422-37.

147

138. Sonenberg, N.; Hinnebusch, A. G., Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 2009, 136 (4), 731-45.

139. Thoreen, C. C.; Chantranupong, L.; Keys, H. R.; Wang, T.; Gray, N. S.; Sabatini, D. M., A unifying model for mTORC1-mediated regulation of mRNA translation. Nature 2012, 485 (7396), 109-13.

140. Raught, B.; Peiretti, F.; Gingras, A. C.; Livingstone, M.; Shahbazian, D.; Mayeur, G. L.; Polakiewicz, R. D.; Sonenberg, N.; Hershey, J. W., Phosphorylation of eucaryotic translation initiation factor 4B Ser422 is modulated by S6 kinases. Embo j 2004, 23 (8), 1761-9.

141. Magnuson, B.; Ekim, B.; Fingar, D. C., Regulation and function of ribosomal protein S6 kinase (S6K) within mTOR signalling networks. Biochem J 2012, 441 (1), 1-21.

142. Michels, A. A.; Robitaille, A. M.; Buczynski-Ruchonnet, D.; Hodroj, W.; Reina, J. H.; Hall, M. N.; Hernandez, N., mTORC1 directly phosphorylates and regulates human MAF1. Mol Cell Biol 2010, 30 (15), 3749-57.

143. Ben-Sahra, I.; Howell, J. J.; Asara, J. M.; Manning, B. D., Stimulation of de novo pyrimidine synthesis by growth signaling through mTOR and S6K1. Science 2013, 339 (6125), 1323-8.

144. Ben-Sahra, I.; Hoxhaj, G.; Ricoult, S. J. H.; Asara, J. M.; Manning, B. D., mTORC1 induces purine synthesis through control of the mitochondrial tetrahydrofolate cycle. Science 2016, 351 (6274), 728-733.

145. Porstmann, T.; Santos, C. R.; Griffiths, B.; Cully, M.; Wu, M.; Leevers, S.; Griffiths, J. R.; Chung, Y.-L.; Schulze, A., SREBP activity is regulated by mTORC1 and contributes to Akt-dependent cell growth. Cell Metab 2008, 8 (3), 224-236.

146. Kim, J.; Kundu, M.; Viollet, B.; Guan, K. L., AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol 2011, 13 (2), 132-41.

147. Zhao, J.; Zhai, B.; Gygi, S. P.; Goldberg, A. L., mTOR inhibition activates overall protein degradation by the ubiquitin proteasome system as well as by autophagy. Proceedings of the National Academy of Sciences of the United States of America 2015, 112 (52), 15790-7.

148. Hemmings, B. A.; Restuccia, D. F., PI3K-PKB/Akt pathway. Cold Spring Harb Perspect Biol 2012, 4 (9), a011189-a011189.

148

149. Yang, G.; Murashige, D. S.; Humphrey, S. J.; James, D. E., A Positive Feedback Loop between Akt and mTORC2 via SIN1 Phosphorylation. Cell Rep 2015, 12 (6), 937-43.

150. Liu, P.; Gan, W.; Chin, Y. R.; Ogura, K.; Guo, J.; Zhang, J.; Wang, B.; Blenis, J.; Cantley, L. C.; Toker, A.; Su, B.; Wei, W., PtdIns(3,4,5)P3-Dependent Activation of the mTORC2 Kinase Complex. Cancer Discov 2015, 5 (11), 1194-1209.

151. Berchtold, D.; Walther, T. C., TORC2 plasma membrane localization is essential for cell viability and restricted to a distinct domain. Mol Biol Cell 2009, 20 (5), 1565-75.

152. Knudsen, J. R.; Fritzen, A. M.; James, D. E.; Jensen, T. E.; Kleinert, M.; Richter, E. A., Growth Factor-Dependent and -Independent Activation of mTORC2. Trends Endocrinol Metab 2020, 31 (1), 13-24.

153. Zinzalla, V.; Stracka, D.; Oppliger, W.; Hall, M. N., Activation of mTORC2 by association with the ribosome. Cell 2011, 144 (5), 757-68.

154. Betz, C.; Stracka, D.; Prescianotto-Baschong, C.; Frieden, M.; Demaurex, N.; Hall, M. N., Feature Article: mTOR complex 2-Akt signaling at mitochondria-associated endoplasmic reticulum membranes (MAM) regulates mitochondrial physiology. Proceedings of the National Academy of Sciences of the United States of America 2013, 110 (31), 12526-34.

155. Boulbés, D. R.; Shaiken, T.; Sarbassov dos, D., Endoplasmic reticulum is a main localization site of mTORC2. Biochem Biophys Res Commun 2011, 413 (1), 46-52.

156. Betz, C.; Hall, M. N., Where is mTOR and what is it doing there? J Cell Biol 2013, 203 (4), 563-74.

157. Frias, M. A.; Thoreen, C. C.; Jaffe, J. D.; Schroder, W.; Sculley, T.; Carr, S. A.; Sabatini, D. M., mSin1 Is Necessary for Akt/PKB Phosphorylation, and Its Isoforms Define Three Distinct mTORC2s. Current Biology 2006, 16 (18), 1865-1870.

158. Kamimura, Y.; Xiong, Y.; Iglesias, P. A.; Hoeller, O.; Bolourani, P.; Devreotes, P. N., PIP3-Independent Activation of TorC2 and PKB at the Cell's Leading Edge Mediates Chemotaxis. Current Biology 2008, 18 (14), 1034-1043.

159. Hoffman, Nolan J.; Parker, Benjamin L.; Chaudhuri, R.; Fisher-Wellman, Kelsey H.; Kleinert, M.; Humphrey, Sean J.; Yang, P.; Holliday, M.; Trefely, S.; Fazakerley, Daniel J.; Stöckli, J.; Burchfield, James G.; Jensen, Thomas E.; Jothi, R.; Kiens, B.; Wojtaszewski,

149

Jørgen F. P.; Richter, Erik A.; James, David E., Global Phosphoproteomic Analysis of Human Skeletal Muscle Reveals a Network of Exercise-Regulated Kinases and AMPK Substrates. Cell Metab 2015, 22 (5), 922-935.

160. Shah, O. J.; Wang, Z.; Hunter, T., Inappropriate activation of the TSC/Rheb/mTOR/S6K cassette induces IRS1/2 depletion, insulin resistance, and cell survival deficiencies. Curr Biol 2004, 14 (18), 1650-6.

161. Pópulo, H.; Lopes, J. M.; Soares, P., The mTOR signalling pathway in human cancer. International journal of molecular sciences 2012, 13 (2), 1886-1918.

162. Murray, J. T.; Campbell, D. G.; Morrice, N.; Auld, G. C.; Shpiro, N.; Marquez, R.; Peggie, M.; Bain, J.; Bloomberg, G. B.; Grahammer, F.; Lang, F.; Wulff, P.; Kuhl, D.; Cohen, P., Exploitation of KESTREL to identify NDRG family members as physiological substrates for SGK1 and GSK3. Biochem J 2004, 384 (Pt 3), 477-88.

163. Sarbassov, D. D.; Guertin, D. A.; Ali, S. M.; Sabatini, D. M., Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 2005, 307 (5712), 1098-101.

164. Greer, E. L.; Brunet, A., FOXO transcription factors at the interface between longevity and tumor suppression. Oncogene 2005, 24 (50), 7410-7425.

165. Di Cristofano, A., SGK1: The Dark Side of PI3K Signaling. Curr Top Dev Biol 2017, 123, 49-71.

166. Dai, H.; Thomson, A. W., The "other" mTOR complex: New insights into mTORC2 immunobiology and their implications. Am J Transplant 2019, 19 (6), 1614-1621.

167. Pollizzi, K. N.; Patel, C. H.; Sun, I.-H.; Oh, M.-H.; Waickman, A. T.; Wen, J.; Delgoffe, G. M.; Powell, J. D., mTORC1 and mTORC2 selectively regulate CD8⁺ T cell differentiation. The Journal of clinical investigation 2015, 125 (5), 2090-2108.

168. Huang, S. C.-C.; Smith, A. M.; Everts, B.; Colonna, M.; Pearce, E. L.; Schilling, J. D.; Pearce, E. J., Metabolic Reprogramming Mediated by the mTORC2-IRF4 Signaling Axis Is Essential for Macrophage Alternative Activation. Immunity 2016, 45 (4), 817-830.

169. Zoncu, R.; Efeyan, A.; Sabatini, D. M., mTOR: from growth signal integration to cancer, diabetes and ageing. Nat Rev Mol Cell Biol 2011, 12 (1), 21-35.

150

170. Newgard, C. B.; An, J.; Bain, J. R.; Muehlbauer, M. J.; Stevens, R. D.; Lien, L. F.; Haqq, A. M.; Shah, S. H.; Arlotto, M.; Slentz, C. A.; Rochon, J.; Gallup, D.; Ilkayeva, O.; Wenner, B. R.; Yancy, W. S., Jr.; Eisenson, H.; Musante, G.; Surwit, R. S.; Millington, D. S.; Butler, M. D.; Svetkey, L. P., A branched-chain amino acid-related metabolic signature that differentiates obese and lean humans and contributes to insulin resistance. Cell Metab 2009, 9 (4), 311-26.

171. Hanahan, D.; Weinberg, R. A., Hallmarks of cancer: the next generation. Cell 2011, 144 (5), 646-74.

172. Gkountakos, A.; Pilotto, S.; Mafficini, A.; Vicentini, C.; Simbolo, M.; Milella, M.; Tortora, G.; Scarpa, A.; Bria, E.; Corbo, V., Unmasking the impact of Rictor in cancer: novel insights of mTORC2 complex. Carcinogenesis 2018, 39 (8), 971-980.

173. Hua, H.; Kong, Q.; Zhang, H.; Wang, J.; Luo, T.; Jiang, Y., Targeting mTOR for cancer therapy. Journal of hematology & oncology 2019, 12 (1), 71-71.

174. Guichard, S. M.; Curwen, J.; Bihani, T.; D'Cruz, C. M.; Yates, J. W.; Grondine, M.; Howard, Z.; Davies, B. R.; Bigley, G.; Klinowska, T.; Pike, K. G.; Pass, M.; Chresta, C. M.; Polanska, U. M.; McEwen, R.; Delpuech, O.; Green, S.; Cosulich, S. C., AZD2014, an Inhibitor of mTORC1 and mTORC2, Is Highly Effective in ER+ Breast Cancer When Administered Using Intermittent or Continuous Schedules. Mol Cancer Ther 2015, 14 (11), 2508-18.

175. Hall, C. P.; Reynolds, C. P.; Kang, M. H., Modulation of Glucocorticoid Resistance in Pediatric T-cell Acute Lymphoblastic Leukemia by Increasing BIM Expression with the PI3K/mTOR Inhibitor BEZ235. Clin Cancer Res 2016, 22 (3), 621-32.

176. Gazi, M.; Moharram, S. A.; Marhäll, A.; Kazi, J. U., The dual specificity PI3K/mTOR inhibitor PKI-587 displays efficacy against T-cell acute lymphoblastic leukemia (T-ALL). Cancer Lett 2017, 392, 9-16.

177. Syrovatkina, V.; Alegre, K. O.; Dey, R.; Huang, X.-Y., Regulation, Signaling, and Physiological Functions of G-Proteins. Journal of molecular biology 2016, 428 (19), 3850-3868.

178. Katritch, V.; Cherezov, V.; Stevens, R. C., Structure-function of the G protein-coupled receptor superfamily. Annu Rev Pharmacol Toxicol 2013, 53, 531-56.

151

179. Rask-Andersen, M.; Masuram, S.; Schioth, H. B., The druggable genome: Evaluation of drug targets in clinical trials suggests major shifts in molecular class and indication. Annu Rev Pharmacol Toxicol 2014, 54, 9-26.

180. Rasmussen, S. G.; DeVree, B. T.; Zou, Y.; Kruse, A. C.; Chung, K. Y.; Kobilka, T. S.; Thian, F. S.; Chae, P. S.; Pardon, E.; Calinski, D.; Mathiesen, J. M.; Shah, S. T.; Lyons, J. A.; Caffrey, M.; Gellman, S. H.; Steyaert, J.; Skiniotis, G.; Weis, W. I.; Sunahara, R. K.; Kobilka, B. K., Crystal structure of the beta2 adrenergic receptor-Gs protein complex. Nature 2011, 477 (7366), 549-55.

181. Noel, J. P.; Hamm, H. E.; Sigler, P. B., The 2.2 A crystal structure of transducin-alpha complexed with GTP gamma S. Nature 1993, 366 (6456), 654-63.

182. Lambright, D. G.; Noel, J. P.; Hamm, H. E.; Sigler, P. B., Structural determinants for activation of the alpha-subunit of a heterotrimeric G protein. Nature 1994, 369 (6482), 621-8.

183. Lambright, D. G.; Sondek, J.; Bohm, A.; Skiba, N. P.; Hamm, H. E.; Sigler, P. B., The 2.0 A crystal structure of a heterotrimeric G protein. Nature 1996, 379 (6563), 311-9.

184. Coleman, D. E.; Berghuis, A. M.; Lee, E.; Linder, M. E.; Gilman, A. G.; Sprang, S. R., Structures of active conformations of Gi alpha 1 and the mechanism of GTP hydrolysis. Science 1994, 265 (5177), 1405-12.

185. Wall, M. A.; Coleman, D. E.; Lee, E.; Iniguez-Lluhi, J. A.; Posner, B. A.; Gilman, A. G.; Sprang, S. R., The structure of the G protein heterotrimer Gia1b1g2. Cell 1995, 83, 1047- 1058.

186. Sadana, R.; Dessauer, C. W., Physiological roles for G protein-regulated adenylyl cyclase isoforms: insights from knockout and overexpression studies. Neurosignals 2009, 17 (1), 5-22.

187. Gresset, A.; Sondek, J.; Harden, T. K., The phospholipase C isozymes and their regulation. Subcell Biochem 2012, 58, 61-94.

188. Luscher, C.; Slesinger, P. A., Emerging roles for G protein-gated inwardly rectifying potassium (GIRK) channels in health and disease. Nat Rev Neurosci 2010, 11 (5), 301-15.

189. Proft, J.; Weiss, N., G protein regulation of neuronal calcium channels: back to the future. Mol Pharmacol 2015, 87 (6), 890-906.

152

190. Krispel, C. M.; Chen, D.; Melling, N.; Chen, Y.-J.; Martemyanov, K. A.; Quillinan, N.; Arshavsky, V. Y.; Wensel, T. G.; Chen, C.-K.; Burns, M. E., RGS Expression Rate-Limits Recovery of Rod Photoresponses. Neuron 2006, 51, 409-416.

191. Angleson, J. K.; Wensel, T. G., A GTPase-accelerating factor for transducin, distinct from its effector cGMP phosphodiesterase, in rod outer segment membranes. Neuron 1993, 11 (5), 939-49.

192. Berman, D. M.; Wilkie, T. M.; Gilman, A. G., GAIP and RGS4 are GTPase-activating proteins for the Gi subfamily of G protein alpha subunits. Cell 1996, 86 (3), 445-52.

193. Tesmer, J. J.; Berman, D. M.; Gilman, A. G.; Sprang, S. R., Structure of RGS4 bound to AlF4--activated G(i alpha1): stabilization of the transition state for GTP hydrolysis. Cell 1997, 89 (2), 251-61.

194. Slep, K. C.; Kercher, M. A.; He, W.; Cowan, C. W.; Wensel, T. G.; Sigler, P. B., Structural determinants for regulation of phosphodiesterase by a G protein at 2.0 A. Nature 2001, 409, 1071-1077.

195. Downes, G. B.; Gautam, N., The G protein subunit gene families. Genomics 1999, 62 (3), 544-52.

196. Dingus, J.; Wells, C. A.; Campbell, L.; Cleator, J. H.; Robinson, K.; Hildebrandt, J. D., G Protein betagamma dimer formation: Gbeta and Ggamma differentially determine efficiency of in vitro dimer formation. Biochemistry 2005, 44 (35), 11882-90.

197. Makino, E. R.; Handy, J. W.; Li, T.; Arshavsky, V. Y., The GTPase activating factor for transducin in rod photoreceptors is the complex between RGS9 and type 5 G protein beta subunit. Proc. Natl. Acad. Sci. U. S. A. 1999, 96, 1947-1952.

198. Khan, S. M.; Min, A.; Gora, S.; Houranieh, G. M.; Campden, R.; Robitaille, M.; Trieu, P.; Petrin, D.; Jacobi, A. M.; Behlke, M. A.; Angers, S.; Hebert, T. E., Gbeta4gamma1 as a modulator of M3 muscarinic receptor signalling and novel roles of Gbeta1 subunits in the modulation of cellular signalling. Cell Signal 2015, 27 (8), 1597-608.

199. Sondek, J.; Bohm, A.; Lambright, D. G.; Hamm, H. E.; Sigler, P. B., Crystal structure of a G-protein beta gamma dimer at 2.1A resolution. Nature 1996, 379 (6563), 369-74.

153

200. Sondek, J.; Lambright, D. G.; Noel, J. P.; Hamm, H. E.; Sigler, P. B., GTPase mechanism of Gproteins from the 1.7-A crystal structure of transducin alpha-GDP-AIF-4. Nature 1994, 372 (6503), 276-9.

201. Lyon, A. M.; Dutta, S.; Boguth, C. A.; Skiniotis, G.; Tesmer, J. J., Full-length Galpha(q)-phospholipase C-beta3 structure reveals interfaces of the C-terminal coiled-coil domain. Nat Struct Mol Biol 2013, 20 (3), 355-62.

202. Tesmer, J. J.; Sunahara, R. K.; Gilman, A. G.; Sprang, S. R., Crystal structure of the catalytic domains of adenylyl cyclase in a complex with Gsalpha.GTPgammaS. Science 1997, 278 (5345), 1907-16.

203. Waldo, G. L.; Ricks, T. K.; Hicks, S. N.; Cheever, M. L.; Kawano, T.; Tsuboi, K.; Wang, X.; Montell, C.; Kozasa, T.; Sondek, J.; Harden, T. K., Kinetic scaffolding mediated by a phospholipase C-beta and Gq signaling complex. Science 2010, 330 (6006), 974-80.

204. Ford, C. E.; Skiba, N. P.; Bae, H.; Daaka, Y.; Reuveny, E.; Shekter, L. R.; Rosal, R.; Weng, G.; Yang, C. S.; Iyengar, R.; Miller, R. J.; Jan, L. Y.; Lefkowitz, R. J.; Hamm, H. E., Molecular basis for interactions of G protein bg subunits with effectors. Science 1998, 280, 1271-1274.

205. Higgins, J. B.; Casey, P. J., In vitro processing of recombinant G protein gamma subunits. Requirements for assembly of an active beta gamma complex. J Biol Chem 1994, 269 (12), 9067-73.

206. Lai, C. W.; Kolesnikov, A. V.; Frederick, J. M.; Blake, D. R.; Jiang, L.; Stewart, J. S.; Chen, C. K.; Barrow, J. R.; Baehr, W.; Kefalov, V. J.; Willardson, B. M., Phosducin-Like Protein 1 is Essential for G-Protein Assembly and Signaling in Retinal Rod Photoreceptors. J Neurosci 2013, 33 (18), 7941-7951.

207. Gabay, M.; Pinter, M. E.; Wright, F. A.; Chan, P.; Murphy, A. J.; Valenzuela, D. M.; Yancopoulos, G. D.; Tall, G. G., Ric-8 proteins are molecular chaperones that direct nascent G protein alpha subunit membrane association. Sci Signal 2011, 4 (200), ra79.

208. Willardson, B. M.; Pou, B.; Yoshida, T.; Bitensky, M. W., Cooperative binding of the retinal rod G-protein, transducin, to light-activated rhodopsin. J Biol Chem 1993, 268 (9), 6371- 82.

154

209. Chung, K. Y.; Rasmussen, S. G.; Liu, T.; Li, S.; DeVree, B. T.; Chae, P. S.; Calinski, D.; Kobilka, B. K.; Woods, V. L., Jr.; Sunahara, R. K., Conformational changes in the G protein Gs induced by the beta2 adrenergic receptor. Nature 2011, 477 (7366), 611-5.

210. Van Eps, N.; Preininger, A. M.; Alexander, N.; Kaya, A. I.; Meier, S.; Meiler, J.; Hamm, H. E.; Hubbell, W. L., Interaction of a G protein with an activated receptor opens the interdomain interface in the alpha subunit. Proc Natl Acad Sci U S A 2011, 108 (23), 9420-4.

211. Carpenter, B.; Nehme, R.; Warne, T.; Leslie, A. G.; Tate, C. G., Structure of the adenosine A(2A) receptor bound to an engineered G protein. Nature 2016, 536 (7614), 104-7.

212. Nishiguchi, K. M.; Sandberg, M. A.; Kooijman, A. C.; Martemyanov, K. A.; Pott, J. W.; Hagstrom, S. A.; Arshavsky, V. Y.; Berson, E. L.; Dryja, T. P., Defects in RGS9 or its anchor protein R9AP in patients with slow photoreceptor deactivation. Nature 2004, 427 (6969), 75-8.

213. Soundararajan, M.; Willard, F. S.; Kimple, A. J.; Turnbull, A. P.; Ball, L. J.; Schoch, G. A.; Gileadi, C.; Fedorov, O. Y.; Dowler, E. F.; Higman, V. A.; Hutsell, S. Q.; Sundstrom, M.; Doyle, D. A.; Siderovski, D. P., Structural diversity in the RGS domain and its interaction with heterotrimeric G protein alpha-subunits. Proc Natl Acad Sci U S A 2008, 105 (17), 6457-62.

214. Nance, M. R.; Kreutz, B.; Tesmer, V. M.; Sterne-Marr, R.; Kozasa, T.; Tesmer, J. J., Structural and functional analysis of the regulator of G protein signaling 2-galphaq complex. Structure 2013, 21 (3), 438-48.

215. Choe, H. W.; Kim, Y. J.; Park, J. H.; Morizumi, T.; Pai, E. F.; Krauss, N.; Hofmann, K. P.; Scheerer, P.; Ernst, O. P., Crystal structure of metarhodopsin II. Nature 2011, 471 (7340), 651-5.

216. Masu, M.; Iwakabe, H.; Tagawa, Y.; Miyoshi, T.; Yamashita, M.; Fukuda, Y.; Sasaki, H.; Hiroi, K.; Nakamura, Y.; Shigemoto, R.; et al., Specific deficit of the ON response in visual transmission by targeted disruption of the mGluR6 gene. Cell 1995, 80 (5), 757-65.

217. Nawy, S., The metabotropic receptor mGluR6 may signal through G(o), but not phosphodiesterase, in retinal bipolar cells. J Neurosci 1999, 19 (8), 2938-44.

218. Xu, Y.; Orlandi, C.; Cao, Y.; Yang, S.; Choi, C. I.; Pagadala, V.; Birnbaumer, L.; Martemyanov, K. A.; Vardi, N., The TRPM1 channel in ON-bipolar cells is gated by both the alpha and the betagamma subunits of the G-protein Go. Sci Rep 2016, 6, 20940.

155

219. Cao, Y.; Pahlberg, J.; Sarria, I.; Kamasawa, N.; Sampath, A. P.; Martemyanov, K. A., Regulators of G protein signaling RGS7 and RGS11 determine the onset of the light response in ON bipolar neurons. Proc Natl Acad Sci U S A 2012, 109 (20), 7905-10.

220. Ikeda, S. R., Voltage-dependent modulation of N-type calcium channels by G-protein beta gamma subunits. Nature 1996, 380 (6571), 255-8.

221. Herlitze, S.; Garcia, D. E.; Mackie, K.; Hille, B.; Scheuer, T.; Catterall, W. A., Modulation of Ca2+ channels by G-protein beta gamma subunits. Nature 1996, 380 (6571), 258- 62.

222. Bourinet, E.; Soong, T. W.; Stea, A.; Snutch, T. P., Determinants of the G protein- dependent opioid modulation of neuronal calcium channels. Proc Natl Acad Sci U S A 1996, 93 (4), 1486-91.

223. Whorton, M. R.; MacKinnon, R., X-ray structure of the mammalian GIRK2-betagamma G-protein complex. Nature 2013, 498 (7453), 190-7.

224. Kimple, M. E.; Neuman, J. C.; Linnemann, A. K.; Casey, P. J., Inhibitory G proteins and their receptors: emerging therapeutic targets for obesity and diabetes. Exp Mol Med 2014, 46, e102.

225. Drucker, D. J.; Philippe, J.; Mojsov, S.; Chick, W. L.; Habener, J. F., Glucagon-like peptide I stimulates insulin gene expression and increases cyclic AMP levels in a rat islet cell line. Proc Natl Acad Sci U S A 1987, 84 (10), 3434-8.

226. Gallwitz, B., New therapeutic strategies for the treatment of type 2 diabetes mellitus based on incretins. Rev Diabet Stud 2005, 2 (2), 61-9.

227. Kimple, M. E.; Keller, M. P.; Rabaglia, M. R.; Pasker, R. L.; Neuman, J. C.; Truchan, N. A.; Brar, H. K.; Attie, A. D., Prostaglandin E2 receptor, EP3, is induced in diabetic islets and negatively regulates glucose- and hormone-stimulated insulin secretion. Diabetes 2013, 62 (6), 1904-12.

228. Kim, Y. E.; Hipp, M. S.; Bracher, A.; Hayer-Hartl, M.; Hartl, F. U., Molecular chaperone functions in protein folding and proteostasis. Annu Rev Biochem 2013, 82, 323-55.

229. Kim, S. G.; Hoffman, G. R.; Poulogiannis, G.; Buel, G. R.; Jang, Y. J.; Lee, K. W.; Kim, B. Y.; Erikson, R. L.; Cantley, L. C.; Choo, A. Y.; Blenis, J., Metabolic stress controls

156 mTORC1 lysosomal localization and dimerization by regulating the TTT-RUVBL1/2 complex. Mol Cell 2013, 49 (1), 172-85.

230. Takai, H.; Xie, Y.; de Lange, T.; Pavletich, N. P., Tel2 structure and function in the Hsp90-dependent maturation of mTOR and ATR complexes. Genes Dev 2010, 24 (18), 2019-30.

231. Kabir, M. A.; Kaminska, J.; Segel, G. B.; Bethlendy, G.; Lin, P.; Della Seta, F.; Blegen, C.; Swiderek, K. M.; Zoladek, T.; Arndt, K. T.; Sherman, F., Physiological effects of unassembled chaperonin Cct subunits in the yeast Saccharomyces cerevisiae. Yeast 2005, 22 (3), 219-39.

232. Schmidt, A.; Kunz, J.; Hall, M. N., TOR2 is required for organization of the actin cytoskeleton in yeast. Proc Natl Acad Sci U S A 1996, 93 (24), 13780-5.

233. Amit, M.; Weisberg, S. J.; Nadler-Holly, M.; McCormack, E. A.; Feldmesser, E.; Kaganovich, D.; Willison, K. R.; Horovitz, A., Equivalent mutations in the eight subunits of the chaperonin CCT produce dramatically different cellular and gene expression phenotypes. J Mol Biol 2010, 401 (3), 532-43.

234. Huttlin, E. L.; Bruckner, R. J.; Paulo, J. A.; Cannon, J. R.; Ting, L.; Baltier, K.; Colby, G.; Gebreab, F.; Gygi, M. P.; Parzen, H.; Szpyt, J.; Tam, S.; Zarraga, G.; Pontano- Vaites, L.; Swarup, S.; White, A. E.; Schweppe, D. K.; Rad, R.; Erickson, B. K.; Obar, R. A.; Guruharsha, K. G.; Li, K.; Artavanis-Tsakonas, S.; Gygi, S. P.; Harper, J. W., Architecture of the human interactome defines protein communities and disease networks. Nature 2017, 545 (7655), 505-509.

235. Skjaerven, L.; Cuellar, J.; Martinez, A.; Valpuesta, J. M., Dynamics, flexibility, and allostery in molecular chaperonins. FEBS Lett 2015, 589 (19 Pt A), 2522-32.

236. Zang, Y.; Jin, M.; Wang, H.; Cui, Z.; Kong, L.; Liu, C.; Cong, Y., Staggered ATP binding mechanism of eukaryotic chaperonin TRiC (CCT) revealed through high-resolution cryo-EM. Nat Struct Mol Biol 2016, 23 (12), 1083-1091.

237. Cong, Y.; Schroder, G. F.; Meyer, A. S.; Jakana, J.; Ma, B.; Dougherty, M. T.; Schmid, M. F.; Reissmann, S.; Levitt, M.; Ludtke, S. L.; Frydman, J.; Chiu, W., Symmetry- free cryo-EM structures of the chaperonin TRiC along its ATPase-driven conformational cycle. EMBO J 2011, 31 (3), 720-30.

157

238. Llorca, O.; MartÍn-Benito, J.; Grantham, J.; Ritco-Vonsovici, M.; Willison, K.; Carrascosa, J. L.; Valpuesta, J. M., The 'sequential allosteric ring' mechanism in the eukaryotic chaperonin-assisted folding of actin and tubulin. EMBO J 2001, 20, 4065-4075.

239. Muñoz, I. G.; Yébenes, H.; Zhou, M.; Mesa, P.; Serna, M.; Park, A. Y.; Bragado- Nilsson, E.; Beloso, A.; de Cárcer, G.; Malumbres, M.; Robinson, C. V.; Valpuesta, J. M.; Montoya, G., Crystal structure of the open conformation of the mammalian chaperonin CCT in complex with tubulin. Nat Struct Mol Biol 2011, 18 (1), 14-9.

240. Booth, C. R.; Meyer, A. S.; Cong, Y.; Topf, M.; Sali, A.; Ludtke, S. J.; Chiu, W.; Frydman, J., Mechanism of lid closure in the eukaryotic chaperonin TRiC/CCT. Nat. Struct. Mol. Biol. 2008, 15 (7), 746-53.

241. Meyer, A. S.; Gillespie, J. R.; Walther, D.; Millet, I. S.; Doniach, S.; Frydman, J., Closing the folding chamber of the eukaryotic chaperonin requires the transition state of ATP hydrolysis. Cell 2003, 113 (3), 369-81.

242. Valpuesta, J. M.; Martin-Benito, J.; Gomez-Puertas, P.; Carrascosa, J. L.; Willison, K., Structure and function of a protein folding machine: the eukaryotic cytosolic chaperonin CCT. FEBS Lett. 2002, 529, 11-16.

243. Lukov, G. L.; Baker, C. M.; Ludtke, P. J.; Hu, T.; Carter, M. D.; Hackett, R. A.; Thulin, C. D.; Willardson, B. M., Mechanism of assembly of G protein bg subunits by protein kinase CK2-phosphorylated phosducin-like protein and the cytosolic chaperonin complex. J Biol Chem 2006, 281, 22261-22274.

244. Yang, H.; Rudge, D. G.; Koos, J. D.; Vaidialingam, B.; Yang, H. J.; Pavletich, N. P., mTOR kinase structure, mechanism and regulation. Nature 2013, 497 (7448), 217-23.

245. Sancak, Y.; Peterson, T. R.; Shaul, Y. D.; Lindquist, R. A.; Thoreen, C. C.; Bar-Peled, L.; Sabatini, D. M., The Rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Science 2008, 320 (5882), 1496-501.

246. Dekker, C.; Stirling, P. C.; McCormack, E. A.; Filmore, H.; Paul, A.; Brost, R. L.; Costanzo, M.; Boone, C.; Leroux, M. R.; Willison, K. R., The interaction network of the chaperonin CCT. EMBO J. 2008, 27 (13), 1827-39.

247. Balchin, D.; Milicic, G.; Strauss, M.; Hayer-Hartl, M.; Hartl, F. U., Pathway of Actin Folding Directed by the Eukaryotic Chaperonin TRiC. Cell 2018, 174 (6), 1507-1521 e16.

158

248. Sarbassov, D. D.; Ali, S. M.; Kim, D. H.; Guertin, D. A.; Latek, R. R.; Erdjument- Bromage, H.; Tempst, P.; Sabatini, D. M., Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Current biology : CB 2004, 14 (14), 1296-302.

249. Tzatsos, A., Raptor binds the SAIN (Shc and IRS-1 NPXY binding) domain of insulin receptor substrate-1 (IRS-1) and regulates the phosphorylation of IRS-1 at Ser-636/639 by mTOR. J Biol Chem 2009, 284 (34), 22525-34.

250. Lopez-Blanco, J. R.; Chacon, P., iMODFIT: efficient and robust flexible fitting based on vibrational analysis in internal coordinates. J Struct Biol 2013, 184 (2), 261-70.

251. Adams, P. D.; Afonine, P. V.; Bunkoczi, G.; Chen, V. B.; Davis, I. W.; Echols, N.; Headd, J. J.; Hung, L. W.; Kapral, G. J.; Grosse-Kunstleve, R. W.; McCoy, A. J.; Moriarty, N. W.; Oeffner, R.; Read, R. J.; Richardson, D. C.; Richardson, J. S.; Terwilliger, T. C.; Zwart, P. H., PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 2010, 66 (Pt 2), 213-21.

252. Llorca, O.; Smyth, M. G.; Carrascosa, J. L.; Willison, K. R.; Radermacher, M.; Steinbacher, S.; Valpuesta, J. M., 3D reconstruction of the ATP-bound form of CCT reveals the asymmetric folding conformation of a type II chaperonin. Nat. Struct. Biol. 1999, 6 (7), 639-42.

253. Leitner, A.; Joachimiak, L. A.; Bracher, A.; Monkemeyer, L.; Walzthoeni, T.; Chen, B.; Pechmann, S.; Holmes, S.; Cong, Y.; Ma, B.; Ludtke, S.; Chiu, W.; Hartl, F. U.; Aebersold, R.; Frydman, J., The molecular architecture of the eukaryotic chaperonin TRiC/CCT. Structure 2012, 20 (5), 814-25.

254. Chagoyen, M.; Carrascosa, J. L.; Pazos, F.; Valpuesta, J. M., Molecular determinants of the ATP hydrolysis asymmetry of the CCT chaperonin complex. Proteins 2014, 82 (5), 703-7.

255. Matthew Allen Bullock, J.; Schwab, J.; Thalassinos, K.; Topf, M., The Importance of Non-accessible Crosslinks and Solvent Accessible Surface Distance in Modeling Proteins with Restraints From Crosslinking Mass Spectrometry. Mol Cell Proteomics 2016, 15 (7), 2491-500.

256. Yang, B.; Wu, Y. J.; Zhu, M.; Fan, S. B.; Lin, J.; Zhang, K.; Li, S.; Chi, H.; Li, Y. X.; Chen, H. F.; Luo, S. K.; Ding, Y. H.; Wang, L. H.; Hao, Z.; Xiu, L. Y.; Chen, S.; Ye, K.; He, S. M.; Dong, M. Q., Identification of cross-linked peptides from complex samples. Nat Methods 2012, 9 (9), 904-6.

159

257. Joachimiak, L. A.; Walzthoeni, T.; Liu, C. W.; Aebersold, R.; Frydman, J., The structural basis of substrate recognition by the eukaryotic chaperonin TRiC/CCT. Cell 2014, 159 (5), 1042-55.

258. Clare, D. K.; Bakkes, P. J.; van Heerikhuizen, H.; van der Vies, S. M.; Saibil, H. R., Chaperonin complex with a newly folded protein encapsulated in the folding chamber. Nature 2009, 457 (7225), 107-10.

259. Natesh, R.; Clare, D. K.; Farr, G. W.; Horwich, A. L.; Saibil, H. R., A two-domain folding intermediate of RuBisCO in complex with the GroEL chaperonin. Int J Biol Macromol 2018, 118 (Pt A), 671-675.

260. Albert, A.; Yunta, C.; Arranz, R.; Pena, A.; Salido, E.; Valpuesta, J. M.; Martin- Benito, J., Structure of GroEL in complex with an early folding intermediate of alanine glyoxylate aminotransferase. J Biol Chem 2010, 285 (9), 6371-6.

261. Chen, D. H.; Madan, D.; Weaver, J.; Lin, Z.; Schroder, G. F.; Chiu, W.; Rye, H. S., Visualizing GroEL/ES in the act of encapsulating a folding protein. Cell 2013, 153 (6), 1354-65.

262. Weaver, J.; Jiang, M.; Roth, A.; Puchalla, J.; Zhang, J.; Rye, H. S., GroEL actively stimulates folding of the endogenous substrate protein PepQ. Nat Commun 2017, 8, 15934.

263. Weaver, J.; Rye, H. S., The C-terminal tails of the bacterial chaperonin GroEL stimulate protein folding by directly altering the conformation of a substrate protein. J Biol Chem 2014, 289 (33), 23219-32.

264. Rivenzon-Segal, D.; Wolf, S. G.; Shimon, L.; Willison, K. R.; Horovitz, A., Sequential ATP-induced allosteric transitions of the cytoplasmic chaperonin containing TCP-1 revealed by EM analysis. Nat Struct Mol Biol 2005, 12 (3), 233-7.

265. Pereira, J. H.; McAndrew, R. P.; Sergeeva, O. A.; Ralston, C. Y.; King, J. A.; Adams, P. D., Structure of the human TRiC/CCT Subunit 5 associated with hereditary sensory neuropathy. Sci Rep 2017, 7 (1), 3673.

266. Roh, S. H.; Kasembeli, M.; Bakthavatsalam, D.; Chiu, W.; Tweardy, D. J., Contribution of the Type II Chaperonin, TRiC/CCT, to Oncogenesis. Int J Mol Sci 2015, 16 (11), 26706-20.

160

267. Cleries, R.; Galvez, J.; Espino, M.; Ribes, J.; Nunes, V.; de Heredia, M. L., BootstRatio: A web-based statistical analysis of fold-change in qPCR and RT-qPCR data using resampling methods. Comput Biol Med 2012, 42 (4), 438-45.

268. Zheng, S. Q.; Palovcak, E.; Armache, J. P.; Verba, K. A.; Cheng, Y.; Agard, D. A., MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat Methods 2017, 14 (4), 331-332.

269. de la Rosa-Trevin, J. M.; Quintana, A.; Del Cano, L.; Zaldivar, A.; Foche, I.; Gutierrez, J.; Gomez-Blanco, J.; Burguet-Castell, J.; Cuenca-Alba, J.; Abrishami, V.; Vargas, J.; Oton, J.; Sharov, G.; Vilas, J. L.; Navas, J.; Conesa, P.; Kazemi, M.; Marabini, R.; Sorzano, C. O.; Carazo, J. M., Scipion: A software framework toward integration, reproducibility and validation in 3D electron microscopy. J Struct Biol 2016, 195 (1), 93-9.

270. Rohou, A.; Grigorieff, N., CTFFIND4: Fast and accurate defocus estimation from electron micrographs. J Struct Biol 2015, 192 (2), 216-21.

271. Abrishami, V.; Zaldivar-Peraza, A.; de la Rosa-Trevin, J. M.; Vargas, J.; Oton, J.; Marabini, R.; Shkolnisky, Y.; Carazo, J. M.; Sorzano, C. O., A pattern matching approach to the automatic selection of particles from low-contrast electron micrographs. Bioinformatics 2013, 29 (19), 2460-8.

272. Kimanius, D.; Forsberg, B. O.; Scheres, S. H.; Lindahl, E., Accelerated cryo-EM structure determination with parallelisation using GPUs in RELION-2. Elife 2016, 5.

273. Tang, G.; Peng, L.; Baldwin, P. R.; Mann, D. S.; Jiang, W.; Rees, I.; Ludtke, S. J., EMAN2: an extensible image processing suite for electron microscopy. J Struct Biol 2007, 157 (1), 38-46.

274. Vargas, J.; Alvarez-Cabrera, A. L.; Marabini, R.; Carazo, J. M.; Sorzano, C. O., Efficient initial volume determination from electron microscopy images of single particles. Bioinformatics 2014, 30 (20), 2891-8.

275. Scheres, S. H.; Chen, S., Prevention of overfitting in cryo-EM structure determination. Nat Methods 2012, 9 (9), 853-4.

276. Vilas, J. L.; Gomez-Blanco, J.; Conesa, P.; Melero, R.; Miguel de la Rosa-Trevin, J.; Oton, J.; Cuenca, J.; Marabini, R.; Carazo, J. M.; Vargas, J.; Sorzano, C. O. S., MonoRes: Automatic and Accurate Estimation of Local Resolution for Electron Microscopy Maps. Structure 2018, 26 (2), 337-344 e4.

161

277. Kucukelbir, A.; Sigworth, F. J.; Tagare, H. D., Quantifying the local resolution of cryo- EM density maps. Nat Methods 2014, 11 (1), 63-5.

278. Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F. T.; de Beer, T. A. P.; Rempfer, C.; Bordoli, L.; Lepore, R.; Schwede, T., SWISS- MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res 2018, 46 (W1), W296-W303.

279. Pettersen, E. F.; Goddard, T. D.; Huang, C. C.; Couch, G. S.; Greenblatt, D. M.; Meng, E. C.; Ferrin, T. E., UCSF Chimera--a visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25 (13), 1605-12.

280. Emsley, P.; Lohkamp, B.; Scott, W. G.; Cowtan, K., Features and development of Coot. Acta Crystallogr D Biol Crystallogr 2010, 66 (Pt 4), 486-501.

281. Burnley, T.; Palmer, C. M.; Winn, M., Recent developments in the CCP-EM software suite. Acta Crystallogr D Struct Biol 2017, 73 (Pt 6), 469-477.

282. Llorca, O.; Martín-Benito, J.; Ritco-Vonsovici, M.; Grantham, J.; Hynes, G. M.; Willison, K. R.; Carrascosa, J. L.; Valpuesta, J. M., Eukaryotic chaperonin CCT stabilizes actin and tubulin folding intermediates in open quasi-native conformations. The EMBO journal 2000, 19 (22), 5971-5979.

283. Minegishi, Y.; Sheng, X.; Yoshitake, K.; Sergeev, Y.; Iejima, D.; Shibagaki, Y.; Monma, N.; Ikeo, K.; Furuno, M.; Zhuang, W.; Liu, Y.; Rong, W.; Hattori, S.; Iwata, T., CCT2 Mutations Evoke Leber Congenital Amaurosis due to Chaperone Complex Instability. Sci Rep 2016, 6, 33742.

284. Minegishi, Y.; Nakaya, N.; Tomarev, S. I., Mutation in the Zebrafish cct2 Gene Leads to Abnormalities of Cell Cycle and Cell Death in the Retina: A Model of CCT2-Related Leber Congenital Amaurosis. Invest Ophthalmol Vis Sci 2018, 59 (2), 995-1004.

285. Roh, S. H.; Kasembeli, M.; Galaz-Montoya, J. G.; Trnka, M.; Lau, W. C.; Burlingame, A.; Chiu, W.; Tweardy, D. J., Chaperonin TRiC/CCT Modulates the Folding and Activity of Leukemogenic Fusion Oncoprotein AML1-ETO. J Biol Chem 2016, 291 (9), 4732- 41.

286. Cui, X.; Hu, Z.-P.; Li, Z.; Gao, P.-J.; Zhu, J.-Y., Overexpression of chaperonin containing TCP1, subunit 3 predicts poor prognosis in hepatocellular carcinoma. World J Gastroenterol 2015, 21 (28), 8588-8604.

162

287. Qian, E. N.; Han, S.-Y.; Ding, S.-Z.; Lv, X., Expression and diagnostic value of CCT3 and IQGAP3 in hepatocellular carcinoma. Cancer Cell Int 2016, 16, 55-55.

288. Knowlton, J. J.; Fernandez de Castro, I.; Ashbrook, A. W.; Gestaut, D. R.; Zamora, P. F.; Bauer, J. A.; Forrest, J. C.; Frydman, J.; Risco, C.; Dermody, T. S., The TRiC chaperonin controls reovirus replication through outer-capsid folding. Nat Microbiol 2018, 3 (4), 481-493.

289. Inoue, Y.; Aizaki, H.; Hara, H.; Matsuda, M.; Ando, T.; Shimoji, T.; Murakami, K.; Masaki, T.; Shoji, I.; Homma, S.; Matsuura, Y.; Miyamura, T.; Wakita, T.; Suzuki, T., Chaperonin TRiC/CCT participates in replication of hepatitis C virus genome via interaction with the viral NS5B protein. Virology 2011, 410 (1), 38-47.

290. Zhou, H.; Xu, M.; Huang, Q.; Gates, A. T.; Zhang, X. D.; Castle, J. C.; Stec, E.; Ferrer, M.; Strulovici, B.; Hazuda, D. J.; Espeseth, A. S., Genome-scale RNAi screen for host factors required for HIV replication. Cell Host Microbe 2008, 4 (5), 495-504.

291. Hong, S.; Choi, G.; Park, S.; Chung, A. S.; Hunter, E.; Rhee, S. S., Type D retrovirus Gag polyprotein interacts with the cytosolic chaperonin TRiC. J Virol 2001, 75 (6), 2526-34.

292. Jager, S.; Cimermancic, P.; Gulbahce, N.; Johnson, J. R.; McGovern, K. E.; Clarke, S. C.; Shales, M.; Mercenne, G.; Pache, L.; Li, K.; Hernandez, H.; Jang, G. M.; Roth, S. L.; Akiva, E.; Marlett, J.; Stephens, M.; D'Orso, I.; Fernandes, J.; Fahey, M.; Mahon, C.; O'Donoghue, A. J.; Todorovic, A.; Morris, J. H.; Maltby, D. A.; Alber, T.; Cagney, G.; Bushman, F. D.; Young, J. A.; Chanda, S. K.; Sundquist, W. I.; Kortemme, T.; Hernandez, R. D.; Craik, C. S.; Burlingame, A.; Sali, A.; Frankel, A. D.; Krogan, N. J., Global landscape of HIV-human protein complexes. Nature 2011, 481 (7381), 365-70.

293. Boohaker, R. J.; Zhang, G.; Lee, M. W.; Nemec, K. N.; Santra, S.; Perez, J. M.; Khaled, A. R., Rational development of a cytotoxic peptide to trigger cell death. Mol Pharm 2012, 9 (7), 2080-93.

294. Pawlowski, J.; Kraft, A. S., Bax-induced apoptotic cell death. Proceedings of the National Academy of Sciences 2000, 97 (2), 529-531.

295. Lee, M. W.; Bassiouni, R.; Sparrow, N. A.; Iketani, A.; Boohaker, R. J.; Moskowitz, C.; Vishnubhotla, P.; Khaled, A. S.; Oyer, J.; Copik, A.; Fernandez-Valle, C.; Perez, J. M.; Khaled, A. R., The CT20 peptide causes detachment and death of metastatic breast cancer cells by promoting mitochondrial aggregation and cytoskeletal disruption. Cell Death Dis 2014, 5 (5), e1249.

163

296. Bassiouni, R.; Nemec, K. N.; Iketani, A.; Flores, O.; Showalter, A.; Khaled, A. S.; Vishnubhotla, P.; Sprung, R. W., Jr.; Kaittanis, C.; Perez, J. M.; Khaled, A. R., Chaperonin Containing TCP-1 Protein Level in Breast Cancer Cells Predicts Therapeutic Application of a Cytotoxic Peptide. Clin Cancer Res 2016, 22 (17), 4366-79.

297. Flores, O.; Santra, S.; Kaittanis, C.; Bassiouni, R.; Khaled, A. S.; Khaled, A. R.; Grimm, J.; Perez, J. M., PSMA-Targeted Theranostic Nanocarrier for Prostate Cancer. Theranostics 2017, 7 (9), 2477-2494.

298. Carr, A. C.; Khaled, A. S.; Bassiouni, R.; Flores, O.; Nierenberg, D.; Bhatti, H.; Vishnubhotla, P.; Manuel, J. P.; Santra, S.; Khaled, A. R., Targeting chaperonin containing TCP1 (CCT) as a molecular therapeutic for small cell lung cancer. Oncotarget 2017, 8 (66), 110273-110288.

299. Yin, H.; Miao, X.; Wu, Y.; Wei, Y.; Zong, G.; Yang, S.; Chen, X.; Zheng, G.; Zhu, X.; Guo, Y.; Li, C.; Chen, Y.; Wang, Y.; He, S., The role of the Chaperonin containing t- complex polypeptide 1, subunit 8 (CCT8) in B-cell non-Hodgkin's lymphoma. Leuk Res 2016, 45, 59-67.

300. Zhang, Y.; Wang, Y.; Wei, Y.; Wu, J.; Zhang, P.; Shen, S.; Saiyin, H.; Wumaier, R.; Yang, X.; Wang, C.; Yu, L., Molecular chaperone CCT3 supports proper mitotic progression and cell proliferation in hepatocellular carcinoma cells. Cancer Lett 2016, 372 (1), 101-9.

301. Qiu, X.; He, X.; Huang, Q.; Liu, X.; Sun, G.; Guo, J.; Yuan, D.; Yang, L.; Ban, N.; Fan, S.; Tao, T.; Wang, D., Overexpression of CCT8 and its significance for tumor cell proliferation, migration and invasion in glioma. Pathol Res Pract 2015, 211 (10), 717-25.

302. Brandvold, K. R.; Morimoto, R. I., The Chemical Biology of Molecular Chaperones-- Implications for Modulation of Proteostasis. J Mol Biol 2015, 427 (18), 2931-47.

303. Lin, Y. F.; Tsai, W. P.; Liu, H. G.; Liang, P. H., Intracellular beta-tubulin/chaperonin containing TCP1-beta complex serves as a novel chemotherapeutic target against drug-resistant tumors. Cancer Res 2009, 69 (17), 6879-88.

164