G PROTEIN-COUPLED RECEPTOR REGULATION OF ATP RELEASE

FROM ASTROCYTES

by

ANDREW EDWARD BLUM

Thesis advisor: Dr. George R. Dubyak

Submitted in partial fulfillment of the requirements

For the degree of Doctor of Philosophy

Department of Physiology and Biophysics

CASE WESTERN RESERVE UNIVERSITY

May, 2010 CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

______

candidate for the ______degree *.

(signed)______(chair of the committee)

______

______

______

______

______

(date) ______

*We also certify that written approval has been obtained for any proprietary material contained therein. Dedication

I am greatly indebted to my thesis advisor Dr. George Dubyak. Without

his support, patience, and advice this work would not have been possible.

I would also like to acknowledge Dr. Robert Schleimer and Dr. Walter

Hubbard for their encouragement as I began my research career. My

current and past thesis committee members Dr. Matthias Buck, Dr.

Cathleen Carlin, Dr. Edward Greenfield, Dr. Ulrich Hopfer, Dr. Gary

Landreth, Dr. Corey Smith, Dr. Jerry Silver have provided invaluable

guidance and advice for which I am very grateful. A special thanks to all

of the past and present members of the Dubyak lab who made the lab a

home away from home. My gratitude extends to my friends and family

members for their love and support. Finally, I would like to dedicate this

thesis to my parents, David and Natalie Blum.

1 Table of Contents

List of Tables 4 List of Figures 5 List of Abbreviations 8 Abstract 10

1. Introduction

1.1 ATP as an Extracellular signal 13 1.1.1 P2 Receptors and Extracellular ATP 13 1.1.2 Metabolism of Extracellular ATP 14 1.1.3 Compartmentalization of ATP release and 15 Issues of Experimental Measurement

1.2 Functions of ATP signaling in Astrocytes 16 1.2.1 Ca2+ wave Propagation 18 1.2.2 Response to Metabolic Changes and Ischemia 19 1.2.3 Cell Volume Homeostasis 20

1.3 G protein-Coupled Receptors and ATP Release 22 1.3.1 Protease-Activated Receptor (PAR) 23 1.3.2 Lysophosphatidic Acid Receptors (LPAR) 26 1.3.3 Muscarinic Receptors 28 1.3.4 Non G protein-Coupled Receptor Stimulated 28 ATP release

1.4 Pathways of ATP release 30 1.4.1 Conductive Pathways 31 1.4.1.1 Gap-junction Hemichannels 32 1.4.1.2 Maxi-Anion Channels 37 1.4.1.3 Volume-Sensitive Organic Anion Channels 40 1.4.2 Exocytosis 43

1.5 Aims of Study 45

2. Experimental Methods 59

3. Rho-Family GTPases Modulate Ca2+-Dependent ATP Release from Astrocytes ABSTRACT 75 INTRODUCTION 77 RESULTS 81 DISCUSSION 89

2 4. Extracellular Osmolarity Modulates G protein-Coupled Receptor Dependent ATP Release from 1321N1 Astrocytes ABSTRACT 116 INTRODUCTION 118 RESULTS 124 DISCUSSION 131

5. Multiple Pathways of ATP release from 1321N1 cells ABSTRACT 160 INTRODUCTION 161 RESULTS 163 DISCUSSION 165

6. Conclusions and Future Directions 184

References 200

3 Tables

Table 1.1 Agonist Selectivity and Signaling Systems of the 47 P2 Nucleotide Receptors

Table 1.2 Pharmacology of Candidate ATP release Channels 49

Table 4.1. Osmolarities and [NaCl] of basal salt solutions used in 141 ATP release experiments.

4 Figures

Figure 1.1 Structure of adenine nucleotide. 51

Figure 1.2 Pharmacologic inhibitors of Connexin Hemichannels, 53 Pannexin Hemichannels, VSOAC, and maxi-anion channels

Figure 1.3 Release of ATP to Extracellular Compartments. 55

Figure 1.4 Autocrine / Paracrine ATP mediated Ca2+ wave. 57

Figure 3.1 PAR1 mediated ATP release is sensitive to 100 BAPTA and ToxB.

Figure 3.2 Rho-GTPase activity is correlated with thrombin 101 induced ATP release.

Figure 3.3 Inhibition of ROCKI/II and MLCK does not affect 103 thrombin induced ATP release.

Figure 3.4 Effects of ToxB and BAPTA-loading on ATP release 105 from 1321N1 astrocytes in response to LPA and Carbachol.

Figure 3.5 Rho-GTPase activity is correlated with LPA- but not 107 carbachol- induced ATP release.

Figure 3.6 Neither toxin treatment nor BAPTA affect 109 extracellular ATPase activity.

Figure 3.7 ATP release is attenuated by brefeldin A and 111 carbenoxolone.

Figure 3.8 CBX inhibition of thrombin-stimulated ATP release is 113 not correlated with changes in hemichannel activity or PAR1 signaling.

Figure 4.1 Kinetics of basal and thrombin-stimulated ATP 143 release from 1321N1 astrocytes in isotonic or hypertonic media.

Figure 4.2 Basal and thrombin-stimulated ATP release from 145 1321N1 astrocytes is inversely correlated with extracellular osmolarity.

5 Figure 4.3 Concentration-response relationships for 147 thrombin-stimulated ATP release and Ca2+ mobilization in isotonic, hypotonic, or hypertonic media.

Figure 4.4 Concentration-response relationships for 149 thrombin-stimulated ATP release 1321N1 cells preincubated for 30 min in isotonic, hypotonic, or hypertonic media.

Figure 4.5 Differential inhibitory effects of BAPTA and 151 Clostridial Toxin B on ATP release stimulated by thrombin versus strong hypotonic stress.

Figure 4.6 Concentration-inhibition relationships for the effects of 153 dideoxyforskolin or carbenoxolone on ATP release by thrombin versus strong hypotonic stress.

Figure 4.7 Concentration-inhibition relationships for the effects of 155 probenicid on ATP release by thrombin versus strong hypotonic stress.

Figure 4.8 The maxi-anion channel inhibitor Gd3+ does not inhibit 157 thrombin-dependent or hypotonic stress induced ATP release from 1321N1 astrocytes.

Figure 5.1 Transient ATP release induced by Thrombin and 170 Hypotonic Stress Contrasts with Sustained ATP release elicited by LDS.

Figure 5.2 Reduced Temperature inhibits LDS, but not 172 thrombin-dependent or hypotonic stress induced ATP release from 1321N1 astrocytes.

Figure 5.3 1321N1 astrocytes express pannexin 1 and 174 Connexin 43 mRNA.

Figure 5.4 CBX blocks ATP release in response to thrombin, 176 hypotonic stress, or LDS.

Figure 5.5 FFA blocks ATP release in response to thrombin, 178 hypotonic stress, or LDS.

Figure 5.6 PB blocks ATP release in response to thrombin, 178 but not in response to hypotonic stress, or LDS.

Figure 5.7 Gadolinium does not affect ATP release in 182 response to thrombin, hypotonic stress, or LDS.

6 Figure 6.1 Hypothetical scheme of the intracellular signaling 194 pathways contributing to GPCR-induced and osmotically-dependent activation of the putative volume-sensitive organic anion channel (VSOAC) pathway.

Figure 6.2 Intracellular Ca2+ mobilization, but not PKC 196 activation elicits ATP release from 1321N1 astrocytes.

Figure 6.3 Hypotonic stress, but not thrombin elicits 198 ATP release from HEK-293 cells.

7 ABBREVIATIONS

ACh Acetylcholine ADA Adenosine deaminase ADP Adenosine-5’-diphosphate ATP Adenosine-5’-triphosphate AMP Adenosine-5’-monophosphate AMPK AMP-activated protein kinase AVD Apoptotic volume decrease BAPTA 1,2-bis(2-aminophenoxy)ethane-N,N,N’,N’-tetraacetic acid βγ-meATP Beta, gamma-methyleneATP BSS Basal saline solution cAMP Cyclic AMP or 3'-5'-cyclic adenosine monophosphate CBX Carbenoxolone CNS Central nervous system CSD Cortical spreading depression DAG Diacylglycerol DCPIB 4-(2-butyl-6,7-dichloro-2-cyclopentylindan-1-on-5-yl)oxybutyric acid ddF 1,9-dideoxyforskolin DIDS 4,4′-Diisothiocyanatostilbene-2,2′-disulfonic acid ecto-NDPK Ecto-nucleotide diphosphokinase EDG Epidermal differentiation gene FAK Focal adhesion kinase FFA Flufenamic acid GDP Guanosine diphosphate GEF Guanine nucleotide exchange factor GRK G-protein receptor kinase GPCR G protein-coupled receptor GPN Glycylphenylalanine 2-napthylamide GST Glutathione S-transferase GTP Guanosine triphosphate IP3 Inositol triphosphate LDS Low divalent solution LPA Lysophosphatidic acid LPAR Lysophosphatidic acid receptors MAPK Mitogen-activated protein kinase MMP Matrix metalloprotease NMDA N-methyl-D-aspartic acid NPP Ecto-nucleotide pyrophosphatase/phophodiesterase NPPB 5-Nitro-2-(3-phenylpropylamino)benzoic acid NTPD Ecto-nucleotide 5’-triphosphate diphosphohydrolase PAR Protease activated receptor Pi Inorganic phosphate PI3K Phosphoinositide 3-kinases PKC Protein kinase C PLA Phospholipase A

8 PLC Phospholipase C PMA Phorbol myristate acetate PPi Pyrophosphate PTX Pertussis toxin RLU Relative light unit RVD Regulatory volume decrease RVI Regulatory volume increase ROCK Rho-associated coiled-coil-forming protein kinase ROS Reactive oxygen specie RT Room temperature (20-22oC) RT-PCR Reverse transcriptase-polymerase chain reaction SITS 4-Acetamido-4′-isothiocyanato-2,2′-stilbenedisulfonic acid SNAP Soluble NSF attachment protein SNARE Soluble NSF attachment protein receptor TRAP Thrombin receptor activating peptide TRBD Rhotekin Rho-binding domain VDAC Voltage-dependant anion channel VRAC Volume-regulated anion channel VSOAC Volume-sensitive organic anion channel VSOR Volume-sensitive outwardly rectifying anion channels

9 G Protein-Coupled Receptor Regulation of ATP Release from Astrocytes

Abstract

By

ANDREW EDWARD BLUM

Extracellular nucleotides contribute to a complex autocrine /

paracrine signaling network in most tissues by activating members of the

P2 receptor family. While stimulated ATP release has been

demonstrated in a variety of mammalian cells, how ATP is released

remains poorly understood. This dissertation illustrates the ability of G

protein-Coupled Receptor (GPCR) activation to potentiate an

osmosensitive ATP release pathway from 1321N1 human astrocytoma

cells.

Activation of the GPCRs protease-activated receptor-1 (PAR1),

lysophosphatidic acid receptor (LPAR), and M3-muscarinic (M3R)

GPCRs in 1321N1 human astrocytoma cells elicits rapid ATP release that

depends on intracellular Ca2+ mobilization and Rho-family GTPase

signaling. Thrombin (or other PAR1 peptide agonists), LPA, and

carbachol triggered quantitatively similar Ca2+ mobilization responses, but

only thrombin and LPA caused rapid accumulation of active GTP-bound

Rho. The ability to elicit Rho activation correlated with the markedly

higher efficacy of thrombin and LPA, relative to carbachol, as ATP

secretagogues.

10 GPCR-regulated and hypotonic stress mediated ATP release from

1321N1 cells exhibits regulatory and pharmacological properties of

volume-sensitive organic anion channels (VSOAC) type channels.

Notably, PAR1-sensitive ATP export was greatly inhibited in hypertonic

medium and was also potentiated by mild hypotonic stress that by itself

did not stimulate ATP export. In contrast to PAR1-dependent ATP

export, PAR1-independent ATP release triggered by strong hypotonicity

requires neither Ca2+ mobilization nor Rho-GTPase activation. Thus,

GPCR stimulation and hypotonicity drive separate signaling cascades

that converge on an ATP release pathway.

A final group of experiments assessed whether additional ATP

release pathways exist in 1321N1 cells. Reduction of extracellular

divalent cations, which gates the opening of connexin hemichannels,

elicited ATP release from 1321N1 cells that exhibited a graded

attenuation in response to reduced temperature, while the GPCR- and

hypotonic stress- induced ATP release responses were insensitive to

similar temperature reductions. This indicated the presence of multiple

ATP release pathways in 1321N1 cells.

In summary, ATP release is a common response to GPCR

activation, osmotic stress, and gating of non-junctional connexin channels

in astrocytes that permits integration of local environmental stresses to

mediate homeostatic functions.

11

Chapter 1:

INTRODUCTION

12 1.1 ATP as an Extracellular Signal

Due to its universal role as an intracellular energy supply, the

notion that ATP could act as an extracellular signaling molecule was

widely doubted when Dr. Geoffrey Burnstock first described purine

releasing neurons as a component of the autonomic nervous system in

1972 (39, 42) (Figure 1.1). In the intervening four decades, an

overwhelming body of evidence confirmed the role of ATP as a signaling

molecule and its involvement in numerous additional physiologic and

pathophysiologic processes. Essential components of the purinergic

signaling system have been identified: ATP and adenosine sensitive P2 /

P1 family receptors that transduce purinergic signals and ecto-

nucleotidases that terminate purinergic signals. Cells tightly control

extracellular ATP concentration, or “purinergic tone”, through a balance of

ATP release and extracellular metabolism. This dissertation focuses on

understanding the cellular events controlling ATP release and contributes

to our knowledge of this important biological process.

1.1.1 P2 Receptors and Extracellular ATP

The importance of ATP as an extracellular signal is underscored by

the existence of P2 and P1 receptors in invertebrate and lower vertebrate

phyla and G-protein mediated ATP release from Arabidopsis thaliana,

suggesting that purinergic signaling was present early in evolution (44,

286). The first of the eight known mammalian G protein-coupled P2

13 receptors (P2Y1,2,4,6,11-14) was identified in 1993, followed by identification

of the first of the seven known ATP-gated ion channels (P2X) in 1994 (1,

30, 171, 276, 285). P2Y receptor subtypes have different affinities for

various nucleotides, while P2X receptors primarily respond to ATP.

Additionally, adenosine, a breakdown product of ATP hydrolysis, activates

P1 (named: A1, A2A, A2B, and A3) family receptors (223) (Table 1.1).

Together, the widely expressed P2 and P1 receptors mediate the effects

of extracellular ATP (41) (Figure 1.2).

1.1.2 Metabolism of Extracellular ATP

Purinergic tone is influenced by the clearance of extracellular ATP,

which occurs via enzymatic hydrolysis or diffusion. ATP can be de-

phosphorylated by CD39 or ENPP family ecto-nucleotidases to form AMP.

AMP in turn can be dephosphorylated to adenosine by CD73 family of 5’-

ecto-nucleotidases. Adenosine is cleared by adenosine deaminase (ADA)

to inosine and taken up into cells through energy dependent transport.

Extracellular ATP can also accumulate as the result of ecto-kinases that

act in opposition to the ecto-nucleotidases (297, 298).

Purinergic signaling requires coordinated expression of P2 / P1

receptors and ecto-nucleotidases. For example, knock out of murine

CD39 disrupts immunosuppression by T-lymphocytes by reducing the

amount of adenosine generated by regulatory T-lymphocytes. The

resulting excess of P2 activation and diminished P1 activation promotes

14 allograft rejection in vivo (66). Adenosine and pyrophosphate (PPi), two

metabolites of extracellular ATP, are also important biological signals.

Adenosine activates P1 receptors to mediate numerous biological

functions and PPi prevents pathologic calcification by directly increasing

the solubility of calcium and phosphate and blocks the nucleation of

hydroxyapatite crystals (288). The ENPP1 KO mouse, which lacks the

ecto-nucleotidase responsible for generating PPi from ATP, undergoes

extensive spontaneous macrovascular calcification. CD39 family ecto-

nucleotidases, which compete with ENPP1 for ATP, dephosphorylate ATP

without producing PPi and promote calcification. (136). On the other

hand, increased CD39 activity clears ATP and can increase adenosine

concentration. In cardiac valve interstitial cells, P1 activation has been

shown to reduce calcification, an action enhanced by upregulation of total

ectonucleotidase activity (204).

1.1.3 Compartmentalization of ATP Release and Issues of

Experimental Measurement

These three processes – the release, breakdown, and reformation

of ATP – occur in close proximity to the cell surface and the resident P2 /

P1 purinergic receptors. Nucleotide diffusion plays less of a role than

might be first suspected because of the co-localization of nucleotide

release and metabolism. Additionally, the fluid close to the cell surface is

relatively unstirred (17, 137). These factors contribute to the observation

15 that the concentration of ATP in the cell surface microenvironment does

not vary with the volume of extracellular media, but the concentration of

ATP in the bulk media does vary with the volume of extracellular media

(Figure 1.3) (137, 200). Therefore, accurate measurement of ATP release

from samples of the bulk extracellular compartment requires knowledge of

the ecto-nucleotidases expressed in a given experimental tissue or cell

type to allow appropriate choices for pharmacologic inhibition of ecto-

nucleotidases (137, 138). Although not utilized in these studies, cell-

attached luciferase can be employed to accurately assess ATP

concentrations near the cell surface in the absence of ectonucleotidase

inhibition (17, 137, 200).

I used 1321N1 human astrocytoma cells as a model system for

ATP release because the cell line does not express P2 receptors,

eliminating the possibility of confounding autocrine P2 receptor activation

dependent stimulation of ATP release. Functional inhibition of

ectonucleotidases is well characterized in this cell type (>95% by 300μM

βγ-meATP, a substrate inhibitor of ENPP family ectonucleotidases)

enabling accurate and sensitive quantification of ATP release by sampling

of the bulk extracellular media (138). Furthermore, 1321N1 cells express

multiple receptor mediated and mechanosensitive pathways that are

efficiently coupled to ATP release.

1.2 Functions of ATP signaling in Astrocytes:

16 ATP is an autocrine / paracrine mediator that organizes highly

localized tissue responses that lack central coordination by the endocrine

and nervous systems. Furthermore, P2 receptor activation itself

generates many autocrine signals. Extracellular ATP concentrations

increase in response to numerous localized signals, such as mechanical

deformation, osmotic swelling, hypoxia, and receptor activation. Although

not the focus of this dissertation, purinergic signaling has been identified

as an important mode of local cellular communication in numerous and

diverse systems including thrombocyte aggregation and hemostasis (93),

immunomodulation, lymphocyte homing and migration (7, 23, 52, 78),

local regulation of blood flow by vascular endothelial and red blood cells

(79, 222), sensory pathways such as vision, smell, taste and hearing

(124), transduction of physiologic mechanical stress in bone and the

surface of the airway (119, 156), the response to metabolic, inflammatory,

and mechanical challenges in the CNS (265, 273, 278), and calcium wave

propagation, coordination of synaptic networks, and cell volume regulation

by astrocytes (106, 112, 189).

Astrocytes are functionally linked to each other and have numerous

processes positioned adjacent to synaptic terminals and vascular beds.

This astrocytic network integrates local environmental changes and

mediates homeostatic tissue responses. While astrocytes do not produce

action potentials, astrocytes actively modulate intracellular Ca2+ and

release gliotransmitters, including ATP, to propagate signals to

17 neighboring cells (58). In this way astrocytes coordinate synaptic,

metabolic, and inflammatory responses in the brain.

1.2.1 Calcium wave propagation

One of the earliest and best characterized models of ATP release

comes from studies of Ca2+ wave propagation by astrocytes. Ca2+ wave

propagation is a component of cortical spreading depression (CSD), an

important mode of intercellular communication with implications for

migraine and stroke (191). During CSD, a self propagating wave of

intracellular Ca2+ mobilization progresses along the cortex at a rate of

~3.7mm / min. Experimentally, the Ca2+ mobilization is initiated by

mechanical stimulation with a glass pipette in cultured astrocytes. The

Ca2+ wave was demonstrated to be mediated by an extracellular, diffusible

signal because the waves were able to cross cell-free regions of the

culture plate (110). Scavenging extracellular ATP with apyrase or

pharmacologic inhibition of P2Y receptors reduces the intercellular Ca2+

wave, identifying this extracellular signal as ATP (102, 178). Importantly,

pharmacologic and genetic manipulations indicate that connexin

hemichannels (section 1.4.1.1) are the conduits for ATP export during this

process (57). This provides strong evidence for the opening of connexin

hemichannel as a conduit for ATP release in physiologic conditions, i.e. in

response to P2 activation by ATP during wave propagation and in

response to the mechanical stressor that initiates the Ca2+ wave (Figure

1.4).

18

1.2.2 Response to Metabolic Challenges and Ischemia

Astrocytes respond to changes in the synaptic environment,

including fluctuations of extracellular K+ concentration and the presence of

neurotransmitters released from presynaptic vesicles. Astrocyte end-foot

projections envelope synaptic contacts to form a “tri-partite synapse”; a

pre-synaptic neuron, a postsynaptic neuron, and an astrocytic process.

Activation of metabotropic receptors on the astrocyte causes the release

of gliotransmitters, including ATP. Addition of apyrase increases

excitatory synaptic transmission, which suggests that ATP tonically

regulates synaptic activity (300). The effects of astrocyte-derived ATP on

synaptic transmission occurs both presynaptically and postsynaptically.

The P1 receptor expressed presynaptically mediates heterosynaptic

depression of excitatory synaptic transmission, while activation of P2X7 on

the postsynaptic neuron receptor increases quantal efficacy by increasing

the rate of postsynaptic AMPA receptor insertion (101, 210). Importantly,

astrocyte specific expression of dominant negative SNARE (the cytosolic

portion of the SNARE domain of synaptobrevin 2) mimics the effects of

apyrase on excitatory synaptic transmission, strongly implicating Ca2+

dependent exocytosis of ATP containing vesicles as an important mode of

ATP release from astrocytes (210).

19 Astrocytes are also in close physical contact with both neurons and

the vasculature. This allows astrocytes to coordinate local blood flow,

which is driven by increases in synaptic activity, rather than the energy

needs of the cell (11, 217). Astrocytes participate in the response to

ischemia and hypoxia, in part, through release of ATP (166). Indeed,

when the ability of astrocytes to release ATP is impaired, as is seen in the

connexin 43 knock-out mouse, there is increased loss of brain tissue

following middle cerebral artery occlusion (163). The mechanism by

which ATP release preserves tissue following ischemic insult is not

completely understood, but involves P1 receptor mediated vasodilation to

increase blood flow and anti-adrenergic effects to decrease oxygen

demand (5, 75). Furthermore, excitotoxicity, an important cause of cell

death, is mediated by glutamate sensitive NMDA receptors. The ability of

ATP to elicit glutamate release suggests that ATP release in the aftermath

of stroke and other metabolic cellular insults may be associated with

excitotoxic cell death (294).

1.2.3 Cell Volume Homeostasis

Another important role for astrocyte derived extracellular ATP is

acceleration of cell volume regulation in response to osmotic stress.

Clinical manifestations of osmotic disturbances are confined primarily to

the central nervous system, which is especially sensitive to volume

changes because the brain resides in the confined space of the skull

20 (189). Astrocytes, the most numerous cell type in the brain, play a major

role in recovery from the volume disturbances that accompany osmotic or

ischemic shock (227). The general cellular response to changes in

extracellular osmolarity follows a well defined pattern. Water moves down

osmotic gradients with a concurrent change in cell volume, followed by

active adjustment of cellular osmolyte content to oppose the initial

movement of water and restore cellular volume. In response to hypotonic

solutions, cells initially swell due to the influx of water. Almost immediately

a process called regulatory volume decrease (RVD) is initiated to restore

cell volume. RVD involves activation of K+ and Cl- efflux as well as efflux

of small organic osmolytes. Conversely, the rapid efflux of water from a

cell exposed to a hypertonic solution is opposed by a process called

regulatory volume increase (RVI), which primarily involves uptake of Na+

and accumulation of organic osmolytes (120, 180, 257, 274). G Protein-

coupled receptor (GPCR) activation markedly accelerates volume

correction and reduces the osmotic threshold at which osmolyte release

occurs, enabling cells to respond to subtle (< 10%) reductions in

extracellular osmolarity. Swelling-induced increases in extracellular ATP

concentration potentiates cell volume correction by astrocytes and

neurons by activating P2 receptor coupled Cl- current flux and increasing

the efflux of organic osmolytes, such as glutamate and taurine, both in

vivo and in vitro (64, 160, 161, 203, 264, 299). The mechanism of

21 swelling induced ATP release is an active area of investigation, and

addressed in CHAPTER 4.

1.3 G protein-Coupled Receptors and ATP release

GPCRs are the largest family of surface receptors and transduce

extracellular signals through their ability to activate heterotrimeric guanine-

nucleotide binding proteins (G proteins). The human genome encodes

hundreds of G protein-coupled receptors. Accordingly GPCRs are

involved in many processes, and are also the target of many modern

medicinal drugs (123). GPCRs have 7-transmembrane α-helix regions

separated by alternating intracellular and extracellular loops. Ligand

interaction with the extracellular binding pocket causes a conformational

change of the GPCR. This enables the GPCR to act as a guanine

nucleotide exchange factor (GEF) and activate an associated

heterotrimeric G-protein by causing the G-protein’s α-subunit to release

GDP and bind to GTP. Once GTP binding occurs, the G-protein's α-

subunit dissociates from the β and γ subunits, which themselves form a

heterodimeric complex. The dissociated GTP-bound α-subunit and the

dissociated βγ-complex interact with target proteins to elicit cellular

responses. The principal signal transduction pathway, and the ultimate

cellular response, resulting from GPCR activation depends on the α, β and

γ subunit type and the coupling efficiency and localization with specific

downstream effectors. The α-subunit has intrinsic GTPase activity and the

22 hydrolysis of GTP to GDP leads to termination of G-protein signaling and

re-association of the α-subunit with the βγ-complex. Information about

the functional coupling of βγ-subunits is limited. G protein complexes are

classified into four main families according to the identity of the α-subunit:

Gαi/o, Gαs, Gαq/11, and Gα12/13 (219, 230). In many cells one GPCR can

couple to several Gα family members. In general: Gαi/o reduces

intracellular cyclic-AMP by activating phosphodiesterases and inactivating

adenylate cyclases; Gαs increases intracellular [cAMP] by activating

adenylyl cyclases and inactivating phosphodiesterases; Gαq/11 increases

intracellular [Ca2+] and activates PKC by activating phospholipase C; and

Gα12/13 regulate the actin cytoskeleton by activating Rho-GEFs and

downstream Rho-GTPase signaling.

1.3.1 Protease-Activated Receptors (PAR)

The protease-activated receptor (PAR) family consists of four

members (PAR1-4) differentially expressed in a wide variety of tissues,

including cells of the nervous system, immune system, vasculature and

blood. PAR1, PAR3, and PAR4 are activated by the serine protease

thrombin, while PAR2 is activated by trypsin-like serine proteases. Other

proteases, such as matrix-metalloprotease-1 can also activate PAR1 (25).

The receptors mediate many functions, including cell shape, proliferation,

migration, secretion, adhesion, and transcriptional regulation (270).

Active thrombin is generated locally at the site of tissue damage by

proteolytic cleavage and is critically involved in hemostasis and the

23 coagulation cascade. The amount of active thrombin is a tightly regulated

balance of generation rate and inhibition by serine-protease inhibitors.

The ability of thrombin (or trypsin) to activate PAR depends on its

proteolytic activity; specifically, its ability to bind and cleave a portion of

the large extracellular N-terminus of PAR. The new N-terminus revealed

following proteolysis acts as a “tethered ligand” and irreversibly activates

the receptor. Inactivation can only occur by receptor desensitization or

internalization. In this way, the rate of receptor cleavage / activation and

desensitization determines the total number of active receptors at a given

time and permits a graded response to increasing concentration of

thrombin (51, 130, 131, 270).

Extensive information about the signals generated in response PAR

activation have been obtained from studies in many model systems,

including 1321N1 astrocytoma cells, A549 airway epithelial cells, and

freshly isolated platelets where PAR activation has been demonstrated to

elicit ATP release. PAR1 activates multiple G-protein sub-types: Gαi/0,

Gαq, Gα12/13. The βγ subunits of the G-proteins activated by PAR1

activate G-protein receptor kinases (GRKs), K+ channels, and non-

receptor tyrosine kinases (205). In platelets, PAR1 directly couples to

Gαi/0 and activates phospholipase C (PLC) and phosphoinositol-3-kinase

(PI3K), likely through the βγ-subunit. As a consequence, there is

activation of integrin glycoprotein IIb/IIIa, a critical step in platelet

aggregation (282, 289). Gαq and Gα12/13 are also involved in the activation

24 of glycoprotein IIb/IIIa and platelet aggregation through the mobilization of

intracellular Ca2+ and Rho-GTPase respectively (69, 291). Microinjection

of antibodies against Gαq into platelets or genetic deletion of PAR1

attenuates Ca2+ mobilization in response to thrombin, indicating that PAR1

coupled Gαq drives PLC activation and IP3 / DAG generation. Platelets

from the Gαq knockout mice have impaired degranulation of ATP

containing vesicles in response to thrombin. In contrast, these same

platelets display normal thrombin induced cell rounding and pseudopodia

formation (21, 199). Gα12/13 mediates these morphologic effects of

thrombin stimulation via activation of Rho-GEF -> Rho-GTPase -> Rho-

kinase (ROCK) signaling cascades and downstream regulation of the

cytoskeleton (147, 199). Like the G protein-alpha subunit, Rho-GTPases

have intrinsic GTPase activity and activation involves GEF facilitated GDP

release and GTP binding. The Rho-GTPase is then able to interact with

effector proteins (218).

Additionally, the PAR mediated release of ATP and ADP from

platelet dense granules activates glycoprotein IIb/IIIa through Gαi/0 (143).

In this way, PAR activation initiates a purinergic autocrine signal that

amplifies the hemostatic signal initiated by thrombin. The importance of

ATP / ADP secretion in this process is evidenced by the success of

clopidgrel, a competitive P2Y12 antagonist, as an anti-clotting agent (87,

121).

25 PAR1 activation induces a similar cell morphology effect in 1321N1

cells that also involves Gα12/13. There is crosstalk between the Gαq and

Gα12/13 signaling cascades initiated by PAR1 in both 1321N1 cells and

platelets. Specifically, Gαq activation initiates Rho-GTPase dependent

responses. In platelets this involves direct activation of Rho-GTPase by

Gαq, while in 1321N1 cells the effect of Gαq occurs downstream of Rho

activation (135, 240).

In contrast to PAR1 mediated exocytosis of ATP from platelets,

ATP release from A549 airway epithelial cells occurs in response to PAR3

and is channel mediated (likely by connexin or pannexin hemichannels).

ATP release from this system requires co-temporal activation of Gαq and

2+ Gα12/13 signaling cascades, specifically mobilization of intracellular Ca

and activation of Rho / ROCK. Gαi/0 signaling, which is coupled to PAR3,

is not required for ATP release from A549 cells since treatment with

pertussis toxin attenuates forskolin induced cAMP formation, but does not

affect ATP release (247).

1.3.2 Lysophosphatidic Acid Receptors (LPAR)

The first lysophosphatidic acid (LPA) receptors identified were

members of the endothelial differentiation gene receptor family, whose

members are GPCRs responsive to LPA (EDG 2,4,7 or LPA 1-3) or

sphingosine-1-phosphate (EDG 1,3,5,6,8) (172). Interestingly, three

putative members of the P2Y (P2Y 5,9,10) family of purinergic receptors

26 have been recently identified as LPA receptors (LPA 6,4,5) (190, 211,

295). LPA is an autocrine / paracrine regulator primarily generated in

response to inflammatory signals. LPA synthesis can occur by several

synthetic routes. The best characterized synthetic pathway, involves two

steps: conversion of the common membrane lipid phosphatidyl choline to

lysophosphatidyl choline by Phospholipase A2 followed by autotoxin

mediated formation of LPA and choline. Further underscoring the link

between phospholipid and purinergic signaling, the extracellular enzyme

autotoxin is a member of the NPP family of ectonucleotidases with

Phospholipase D activity (197). Typically, LPA mediates morphological

changes, cell proliferation, attachment, and migration. Most LPAR

activate multiple G-proteins. Depending on the subtype, activation of the

receptor can lead to activation of Gαi/o, Gαs, Gαq/11, and Gα12/13. LPA

treatment of human vascular endothelial cells causes Ca2+ mobilization,

RhoA / ROCK / actin cytoskeleton rearrangement, and tyrosine

phosphorylation of cytoskeletal regulators FAK and Paxillin. In this model

system the LPA induced Ca2+ transients were suppressed by suramin, a

non-selective P2Y receptor antagonist, demonstrating autocrine activity of

endogenously released ATP. Furthermore, the documented rise in

extracellular ATP from these cells in response to LPA may be caused, in

part, by autocrine activation of P2 receptors with consequent ATP-induced

ATP release. Gα12/13 activation is a crucial component of LPA induced

ATP release in these cells. Botulinum toxin C3, which ADP-ribosylates

27 Rho-GTPase, attenuates ATP release. Suppression of ROCK or ROCK

dependent tyrosine phosphorylation of focal adhesion kinase (FAK) and

paxillin also suppressed LPA induced ATP release (117, 149).

1.3.3 Muscarinic Receptors

Five subtypes of muscarinic GPCRs have been identified. Each

muscarinic receptor subtype (M 1-5) primarily couples to a single Gα

subtype. M 1,3,5 couple to Gαq and M 2,4 couple to Gαi/o. All have similar

affinity for the agonist acetylcholine (ACh). Acetylcholine is an important

neurotransmitter of the CNS and PNS. Muscarinic receptors expressed

on multiple cell types in the nervous system, gut and vasculature

controlling K+ and Ca2+ channels, glandular secretion, heart rate,

peristalsis, and blood pressure (47). ATP released in response to

acetylcholine-dependent muscarinic receptor activation functions as a

local regulator of secretion by the exocrine pancreas through its action on

P2Y receptors. (198).

1.3.4 Non G protein-Coupled Receptor stimulated ATP release

Changes in cell volume are initially sensed as changes in ionic

strength, which can directly affect protein conformation and gating of

plasma membrane channels, such as VSOAC (237). Because the cytosol

contains a high concentration of protein, even small changes in water

content lead to large changes in macromolecule concentration and

28 activity, providing a second mechanism for detecting cell volume (38).

There are many mechanical stress activated channels, the best described

of which are the TRP family channels (120). Integrins are another group

of plasma membrane proteins that respond to stretch. Forces exerted on

the plasma membrane of myocytes are detected by integrins, which

activate swelling-induced Cl- current via focal adhesion kinase / Src

kinase. In these cells integrin stretch leads to trans-activation of

angiotensin II receptor and epidermal growth factor receptor that modulate

swelling induced Cl- current via PI3K and ROS. (31-33). Additionally,

MAPK, Phospholipases, RhoGTPases, and Ca2+ are mobilized in

response to cell volume perturbations (120). Hypotonic stress leads to

ATP release from astrocytes (64, 137), while hypertonic stress has been

shown to elicit ATP release from human lymphocytes (170).

Hypoxia occurs when inadequate oxygen is available to meet

cellular energy demand. In response, several independent signaling

cascades are activated, including, hypoxia inducible factor, AMPK,

PI3K/Akt, and either an increase or decrease in ROS (85). ATP release

occurs from cultured mouse astrocytes in response to oxygen-glucose

deprivation and following middle cerebral artery occlusion in rat striatum,

although the signaling mechanisms associated with hypoxia induced ATP

release from astrocytes has not been investigated (166, 181).

Exposure to reduced extracellular divalent cation conditions triggers

the opening of connexin hemichannels, but not pannexin hemichannels,

29 and leads to ATP release (9, 63, 258). Divalent cations, Ca2+ in particular,

stabilize the closed conformation of connexin hemichannels at resting

membrane potentials (279). Removal of divalent cations directly gates

connexin hemichannels, but the ATP release is partially sensitive to

intracellular Ca2+ buffering by BAPTA and depletion of intracellular Ca2+

stores by thapsigargin pre-treatment (9, 65). This Indicates that Ca2+

mobilization from intracellular stores is required for ATP release.

Furthermore, fluorescent dye uptake, indicative of hemichannel gating,

also requires intracellular Ca2+ mobilization. More complete understanding

of the molecular mechanisms of hemichannel gating and ATP release

conduits are required to explain the dependence of low divalent solution

stimulated ATP release on intracellular 2nd messengers.

1.4 Pathways of ATP release:

Astrocytes release ATP, an essential event in purinergic signaling

required for activation of P2 / P1 receptors. Despite significant advances

in understanding of the mechanisms controlling ATP release, the issue is

not completely resolved. Important areas of investigation are the stimuli

controlling ATP release, the cellular signaling pathways by which these

stimuli are transduced, and the actual ATP release conduits on which

these signaling pathways converge. Progress is complicated by the

apparent absence of a universal ATP release pathway. Regulation of ATP

30 release appears to occur by overlapping pathways, but is cell-type and

stimulus specific.

1.4.1 Conductive Pathways of ATP release

Most cells, including 1321N1 cells, do not have obvious Ca2+

stimulated exocytotic pathways. Therefore, regulated ATP release through

a channel or transporter has been a focus of investigation. Due to the

~106 fold difference between the concentration of ATP inside the cell (~5

mM) and outside the cell (~1nM), ATP4- (and MgATP2-) has a large

electrochemical driving force for efflux. Accordingly, several large

conductance channels have been identified as candidate conduits for ATP

release: gap junction hemichannel (either the well-characterized connexin-

family proteins or the recently identified pannexin-family proteins), or the

molecularly undefined channels maxi-anion and volume-sensitive organic

anion channels (VSOAC). Several model systems show attenuated ATP

release in the presence of pharmacologic inhibitor of gap junction

hemichannels, maxi-anion channels, and VSOAC (28, 65, 118, 228, 233,

302). Furthermore, when genetic manipulation of channel expression is

possible (i.e. connexin and pannexin channels), protein expression levels

directly correlate with ATP release (57, 80, 126, 163, 225, 290) (Table

1.2).

The macroscopic conductance attributable to a particular channel

is directly related to 1) the gating, or open probability of the channel

(conformational transition from closed to open state) 2) the unitary

31 conductance of the channel 3) and the number of channels present at the

cell membrane. Each of these three aspects of macroscopic conductance

may be regulated by separate factors, in opposing directions, and at

different times (116). I focused my studies on identifying channels and

signaling events involved in regulated ATP release; these are major

unresolved issues in purinergic signaling.

1.4.1.1 Gap Junction Hemichannels:

Gap junction hemichannels (Hemichannel) exist at the point of cell

contact and serve as aqueous conduits for ions and hydrophilic molecules

smaller than ~1kD. At the molecular level, gap junctions are formed by the

connexin or pannexin family of proteins. The connexin gene family is

expressed only in the phylum Chordata. The pannexin protein family are

homologues of invertebrate gap junctions, but have recently been found in

mammals, including humans. Pannexin and connexin family proteins

have little sequence, but significant structural homology, including 4

transmembrane domains and extracellular disulfide residues important for

intermolecular coupling. The functional unit of an intercellular gap junction

is two interacting homo/heterohexamers which associate in the space

between adjacent cells and form a pathway for small molecules between

the two cytoplasms. A hemichannel, as opposed to an intercellular gap

junction, exists when an unlinked, functional hexamer in the plasma

membrane joins the cytoplasm to the extracellular space rather than the

32 cytoplasm of a neighboring cell (Figure 1.5) (34, 84). Instead of acting to

directly couple metabolism of neighboring cells, the mediators released

through Hemichannel act on cell surface proteins in an autocrine/paracrine

fashion. An important example of this phenomenon is calcium wave

propagation by astrocytes, an ATP dependent process (57).

Connexin hemichannels and pannexin hemichannels have similar

permeability to metabolites and fluorescent dyes (~1kD maximum) –

including ATP. Both channels have large conductances (~500pS).

Furthermore, the selectivity of the connexin based channels also varies by

subtype, highlighting the importance of these channels as conduits for the

transport of intercellular signals (109). For example, connexin 43 based

channels are 10 times more permeable to cAMP than connexin 26 based

channels (139). Connexin 43 and connexin 32 based channels are

inversely selective for ATP and adenosine; connexin 43 based channels

are more permeable to ATP than adenosine, while connexin 32 based

channels are more permeable to adenosine than ATP (99). However, The

effect of connexin isoform on selectivity in hemichannels compared to

gap-junctions has not been investigated with a similar level of detail (84).

Connexins are co-translationally assembled the endoplasmic

reticulum. The protein oligomerizes into a hemichannel in the golgi, after

exiting the endoplasmic reticulum, and is trafficked to defined regions of

the plasma membrane called plaques where the hexamer is available for

gating as a hemichannel or interaction with a neighboring cell to form an

33 intercellular gap-junction. The connexin proteins located at the cell

surface are turned over rapidly (<5 hours for connexin 43). The trafficking

of most connexins is reversibly inhibited by brefeldin A, which disrupts

vesicle recycling by the golgi (84, 153). Connexin 26 does not depend on

the golgi for trafficking to the plasma membrane, but instead requires an

intact microtubule network indicating that the trafficking of connexins is

sub-type specific (82, 96). Recent evidence indicates that pannexin- and

connexin-based channels are also trafficked differently. Pannexin 1 and

Pannexin 3 trafficking is not sensitive to brefeldin A, but the proteins are

transported to the cell surface and may form gap-junction like plaques

(215).

Hemichannels are gated by both intracellular and extracellular

signals. Connexin hemichannels open in response to decreased

extracellular calcium, low extracellular pH, phosphorylation state of the c-

terminus, depolarization, and increased intracellular Ca2+ (16, 65, 162,

216). Connexin hemichannels have two distinct voltage sensors. The

sensor located on the intracellular portion of the protein responds to

transjunctional intercellular potentials (Vj). The sensor on the extracellular

surface responds to the membrane potential (Vm) and the concentration of

extracellular divalent cations, Ca2+ in particular. This latter gating

mechanism is collectively termed “loop gating” (35, 36, 271, 272).

The majority of studies concerning intracellular signaling pathways

and regulation of connexin channels address the effects on gap-junctions

34 rather than hemichannels. It is clear, however, that both connexin-gap

junctions and connexin hemichannels are regulated by the

phosphorylation state of serine/threonine/tyrosine residues, intracellular

2+ IP3, Ca mobilization, and reactive oxygen species (ROS). Connexin 43

physically interacts with zonula occludens-1 and ß-catenin, suggesting

that the actin cytoskeleton may have a role in the regulation of connexin

gap-junctions and hemichannels (292). Indeed, thrombin-dependent

activation of ROCK and PKC in bovine corneal endothelial cells inhibits

gap-junction communication and hemichannel mediated Ca2+ wave

propagation (61, 62). The C-termini of connexin monomers have PKC,

MAPK, and src-kinase phosphorylation sites (84). Phosphorylation by

PKC, receptor and non-receptor tyrosine kinases decrease the open-

probability of the channel (239). By inference, a phosphatase would be

expected to open the channel. GPCR activation in human neutrophils

leads to rapid dephosphorylation of connexin 43 that coincides with ATP

release, consistent with the notion of connexin 43 hemichannel gating

(80). Phosphorylation has additionally been shown to reduce the

conductance of connexin 43 gap junctions (15). In contrast, src

dependent phosphorylation of Pannexin 1 hemichannels increases the

open probability of the channels in response to P2X7 activation (127).

Pannexin hemichannels open in response to hypotonic stress, mechanical

stimulation, or membrane depolarization (63, 225). Since intracellular

Ca2+ has been identified as a mediator of ATP release in most model

35 2+ systems, it is important that intracellular Ca elevation, in response to IP3

or calcium ionophore, leads to connexin hemichannel gating and ATP

release (28, 29, 65, 212). Similarly, P2Y receptor activation gates

2+ pannexin 1 based hemichannel in an IP3, Ca dependent manner (169).

Studies involving genetic manipulation of both connexin and

pannexin subunits provide compelling evidence that these channels can

function as ATP release conduits (57, 80, 163, 225). Gating of pannexin 1

occurs in response to P2X7 receptor activation, and its function as a self

sustaining ATP-gated ATP permeable pore has been demonstrated in

mouse astrocytes with the use of pannexin 1 targeted small interfering

RNAs (siRNA) (126, 214). The majority of experiments exploring connexin

hemichannels as ATP release conduits utilize solutions with low divalent

cation concentration to potentiate release, which strongly indicate that

functional connexin based ATP release channels exist on the surface of

these cells. Initially, the physiologic relevance of these experiments were

questioned, but recently, spontaneous ATP dependent Ca2+ waves were

described in the rat retina, in vivo (152). In addition, during episodes of

extreme neuronal activity, due to ischemia or seizure, levels of

extracellular calcium can drop as low as 100μM, sufficient to increase the

open probability of connexin hemichannels (250, 294).

Pharmacologic inhibitors such as mimetic peptides, licorice oils and

their derivatives (glycyrrhetinic actid (18-GA) and carbenoxolone (CBX)),

flufenamic acid derivatives, lanthanides, aliphatic alcohols, and

36 probenecid all demonstrate rapid and reversible Hemichannel inhibition by

incompletely understood mechanisms (74, 83). A major limitation is that

these compounds lack selectivity for pannexins versus connexins. Also

they may interact with channels or transporters other than hemichannels.

Importantly, the extensively used inhibitor CBX was recently shown to

inhibit VSOAC in addition to connexin and pannexin hemichannels, albeit

with an IC50 ~1 order of magnitude greater (5μM vs. ~75μM) (20, 173,

296).

1.4.1.2 Maxi-anion Channels:

While the maxi-anion channel is well characterized and widely

expressed, the molecular identity of the channel is unknown. A robust

anion-selective conductance is observed by whole-cell electrophysiology

when a wide variety of cells are exposed to osmotically induced cell

swelling, increased extracellular NaCl, and metabolic / ischemic

challenges (235). The channel is distinguished from most anion-selective

chloride channels by its large unitary conductance (~300-400 pS). The

current-voltage relationship is linear and the channel is neither inwardly

nor outwardly rectifying. The open probability displays bell-shaped

voltage dependence (half-maximal open probability ~+/-25 mV). Cl- is

approximately 20 times more permeable through maxi-anion channels

than Na+ and anion permeability is weakly selective for other halides. The

permeability sequence is consistent with Eisenman’s sequence I (I- > Br- >

37 Cl- > F-) (86, 134, 245). Using polyethylene glycol exclusion experiments,

the pore diameter has been estimated to be ~1.2 – 1.4 nM. This pore

diameter is sufficiently large to permit transport of ATP and other large

organic ions (ATP ~0.6nm). Indeed, ATP was able to block maxi-anion

channel currents, revealing a weak binding site for ATP in the pore (Kd

~12-13 mM) (233). The permeability ratio for ATP relative to Cl- is ~0.1

(236). The channel is inhibited by several common chloride channel

blockers, such as NPPB > SITS ~ DIDS. These channel blockers are

non-selective and have relatively low potency (incomplete inhibition of

channel currents ~100 μM). Arachidonate and Gd3+ are highly efficacious

inhibitors of the maxi-anion channel, and Gd3+ permits discrimination

between VSOAC and maxi-anion currents at concentrations of 30-50 μM

(235, 259).

Sabirov et. al. utilized the differential pharmacology of the maxi-

anion channel and VSOAC to first implicate the maxi-anion channel as a

hypotonic stress induced ATP release pathway from C127 mammary

cells. Modification of the patch clamp conditions (inclusion of VSOAC

inhibitors, and obligatory ions) to suppress VSOAC activity revealed an

additional volume sensitive current identified as the maxi-anion channel.

Gd3+, but not the VSOAC inhibitors phloretin or glibenclamide suppressed

hypotonicity induced ATP release from these cells. Since the first

description of maxi-anion channel mediated ATP release from C127 cells

(233), similar evidence has been found in cardiomyocytes (76, 77), cells of

38 macula densa (18), and astrocytes (166, 167). The maxi-anion channel is

a candidate ATP release channel because 1) physiologic stimuli (cell

swelling, metabolic / ischemic insults, etc.) that activate maxi-anion

channels also induce ATP release. 2) Inhibitors of maxi-anion channel

block ATP release in these systems. 3) Its biophysical properties make

the maxi-anion channel well suited to be an ATP release conduit, including

rapid and large conductance of ATP4-. 4) Co-localization of maxi-anion

currents and ATP release sites at the cell surface (76, 235, 259).

Although the precise molecular events leading to maxi-anion

channel gating are unknown, several intracellular signaling cascades are

known to influence the open probability of the channel. Increased

intracellular Ca2+ and cAMP in response to GPCR activation have been

shown to activate this channel (142, 275). Furthermore, gating occurs in

response to a G-protein dependent PLC -> PKC -> PLA2 pathway (183).

Protein tyrosine dephosphorylation, likely by receptor protein tyrosine

phosphatase ξ, is required for channel activation in excised membrane

patches. In contrast, phosphorylation of serine / threonine residues by

okadaic acid sensitive kinase activates the channel (67). Potentially, there

are many G-protein dependent and independent pathways that control

kinase activity and these pathways may act together to determine the

open state of the maxi-anion channel.

The molecular identity of the maxi-anion channel has remained

elusive and successful identification would greatly aid investigations of the

39 physiologic role of this anion channel. The biophysical properties of the

maxi-anion channel are similar, but not identical to those of mitochondrial

porins named Voltage-dependant anion channel (VDAC) expressed in the

plasma membrane and outer mitochondrial membrane. Despite evidence

for involvement of VDAC in ATP release (201), the notion that this family

of proteins is the molecular entity that comprises the maxi-anion channel

was disproven by demonstrating intact maxi-anion currents in VDAC-KO

after the genes for all three (VDAC 1-3) isoforms were disrupted (235,

238).

1.4.1.3 VSOAC:

Activity of volume sensitive organic anion channel (VSOAC), also

known as volume-sensitive outwardly rectifying anion channels (VSOR) or

volume-regulated anion channel (VRAC) is directly correlated with

changes in cell volume and is potentiated or inhibited by hypotonic or

hypertonic challenges respectively (89, 193, 203). Increased

electrophysiological activity in response to hypotonic stress is strongly

correlated with efflux of organic osmolytes, such as taurine and inositol.

There is emerging evidence, however, that there may be multiple distinct

volume sensitive pathways that are regulated by a similar network of

upstream signals and suppressed by an overlapping group of

pharmacological inhibitors (120). VSOAC currents display a unitary

conductance of 50-90 pS at depolarizing potentials and 10 pS under

40 hyperpolarizing potentials. Unlike maxi-anion channels and most gap

junction hemichannels, VSOAC are moderately outwardly rectifying

channels. The channel is permeable to I– > Br– > Cl– > F–, consistent with

Eisenman’s sequence I, which describes permeability based on ionic …….

In addition to inorganic anions, VSOAC also permit the passage of anionic

organic osmolytes and ATP (193). The pore is large enough to

accommodate ATP (pore diameter = ~1.1nm by size exclusion assay) and

ATP displays voltage dependent block of VSOAC currents suggesting that

ATP can permeate the pore (71, 118, 133). Furthermore, channel

activation requires the presence of intracellular ATP, or non-hydrolyzable

ATP analogs (132). The channel is sensitive to low potency blockade by

NPPB, DIDS, SITS, and ddF (193-195). The ethacrynic acid derivative

DCPIB is the most potent and selective inhibitor of VSOAC currents (3).

Hypotonic stress induces VSOAC dependent ATP release from

bovine and human vascular endothelial cells (117, 118, 146, 149).

VSOAC is a candidate ATP release channel because 1) physiologic

stimuli (hypotonic stress / cell swelling) activate VSOAC and also induce

ATP release. 2) Inhibitors of VSOAC block ATP release in this system. 3)

Its biophysical properties make VSOAC well suited to be an ATP release

conduit, including rapid and large conductance of ATP4-. 4) There is

overlap in the regulation of ATP release and VSOAC currents by

intracellular 2nd messengers (Ca2+, Rho-GTPase / ROCK, tyrosine kinase

activity) (46, 117, 149, 196, 203).

41 The trigger for VSOAC activation is not well understood. Reduction

in intracellular ionic strength, which would accompany cell swelling, has

been proposed as a potential mechanism (193). Reduced ionic strength,

even in the absence of membrane stretch or a trans-membrane gradient

of ionic strength activates VSOAC (237). VSOAC may also be activated

under isotonic conditions, such as during apoptosis, suggesting cellular

control by intracellular factors independent of osmolarity (174, 202). A

large variety of GPCRs modulate VSOAC conductance through

generation of specific second messengers; MAPK, ROS, Ca2+, and Rho /

ROCK. These pathways play a permissive role by reducing the threshold

osmolarity required for VSOAC activation, rather than directly activating

VSOAC, allowing VSOAC to respond to even small changes in osmolarity

(203).

The molecular identities of several osmosensitive Cl- channels have

been identified. These channels have overlapping properties, but there

are differences in the electrophysiological and pharmacologic properties

ascribed to VSOAC. The differences may be explained by the possibility

that there is a single, unidentified, molecular identity of VSOAC, that

different cells express multiple VRAC, or that VRAC is differentially

regulated in different cell backgrounds. The VRAC candidates include the

ClC family proteins (72), phospholemman (187, 188), pICln (4, 150), and

bestrophins (33).

42 1.4.2 Exocytosis

ATP is released by neurons, neuroendocrine cells, and platelets by

classic calcium dependent exocytotic mechanisms (44). Fluorescence

measurements of FM-1-43, a lipid sensitive dye used to determine the rate

of membrane turnover, is directly correlated with ATP release in epithelial

and bladder smooth muscle cells suggesting vesicle fusion with the

plasma membrane (94, 267, 277). In some systems ATP release is

sensitive to bafilomycin A, an inhibitor of vesicular proton pumps, and to

brefeldin A, an inhibitor of a golgi GTPase essential for vesicle trafficking.

Quinacrine staining, an agent that binds to ATP, has also been used as

evidence for vesicular ATP release. Quinacrine has a clear punctuate

staining pattern in the cytosol prior to stimulated ATP release, an effect

ablated by bafilomycin A and brefeldin A. Quinacrine, however, will not

only bind to high concentrations of ATP, but also will accumulate in

regions of low pH, such as bafilomycin sensitive vesicles (45). Ca2+-

dependent kiss-and-run exocytosis of ATP from lysosomes has recently

been proposed as a major pathway of ATP release from astrocytes (301).

The recent identification of a vesicular nucleotide transporter in astrocytes

supports this model, but its expression in astrocytic lysosomes has not

been confirmed (243). The protein components required for Ca2+-

dependent exocytosis, including synaptobrevin II, cellubrevin, syntaxin I,

and SNAP-23, exist in astrocytes (186). Indeed, use of tetanus toxin to

cleave synaptobrevin II, or dominant-negative expression of the SNARE

43 domain of synaptobrevin II (dn-SNARE) reveals a role for exocytosis in

ATP release from astrocytes (56, 210). Studies using a mouse in which a

truncated version of the SNARE gene is selectively expressed in

astrocytes demonstrated that ATP release from astrocytes regulates

synaptic strength and plasticity (210). Importantly, studies from our lab

indicate no role for secretory lysosomes or Ca2+ dependent exocytosis in

ATP release from 1321N1 cells based on the inability of GPN (24) or

tetanus toxin to suppress ATP release (Joseph SJ, unpublished data).

44 1.5 Aims of Study

This goal of this research was to understand the signal transduction

pathways and conduits involved in GPCR activation and osmotic stress

induced ATP release. Since the GPCR agonists thrombin (or other PAR1

peptide agonists), LPA, and carbachol triggered quantitatively similar Ca2+

mobilization responses, but thrombin and LPA elicited 4-5 fold greater

ATP release than carbachol, I assessed whether the ability of certain Gq-

coupled receptors to additionally stimulate Rho-GTPases acts to strongly

potentiate a Ca2+-activated ATP release pathway from 1321N1 cells

(Chapter 3). Using Clostridium difficile toxin B and Clostridium botulinum

C3 exoenzyme, which inhibit Rho-GTPases, I determined that the efficacy

of ATP secretagogues depends on their ability to activate Rho-GTPase in

addition to the mobilization of intracellular Ca2+. A unique conduit for ATP

release has not been identified, therefore I tested the hypothesis that a

VSOAC-type channel might comprise a GPCR-regulated pathway for ATP

export from 1321N1 cells (Chapter 4). PAR1-sensitive ATP release from

1321N1 cells is potentiated by hypotonicity but suppressed by hypertonic

conditions. Strong hypotonic stress by itself elicited ATP release and

positively modulated the response to thrombin. Thrombin-dependent ATP

release was also potentiated by mild hypotonic stress that by itself did not

stimulate ATP export. Notably, PAR1-sensitive ATP export was greatly

inhibited in hypertonic medium. Neither the potency nor efficacy of

thrombin as an activator of proximal PAR1 signaling was affected by

45 hypotonicity or hypertonicity. Thus, GPCR-regulated ATP release from

1321N1 astrocytoma cells is remarkably sensitive to both positive and

negative modulation by extracellular osmolarity. 1,9-dideoxyforskolin

(ddF), and carbenoxolone (CBX) similarly attenuated PAR1-dependent

ATP release and suppressed the PAR1-independent ATP release elicited

by strong hypotonic stress. Probenecid (PB) attenuated PAR1-stimulated

ATP release under isotonic but not mild hypotonic conditions and had no

effect on PAR-1 independent release stimulated by strong hypotonicity.

Together, these data indicate that the ATP release pathway from 1321N1

cells has a pharmacologic profile similar to VSOAC-type channels. PAR1-

dependent ATP export under all osmotic conditions required concurrent

signaling by Ca2+ mobilization and Rho-GTPase activation. In contrast,

PAR1-independent ATP release triggered by strong hypotonicity required

neither of these intracellular signals. This supports a model wherein

GPCR stimulation and osmotic stress converge on an ATP release

pathway in astrocytes which exhibits several features of VSOAC-type

channels. Interestingly, ATP released in response to reduced extracellular

Ca2+, which activates gap junction hemichannels, stimulates ATP release

by a process that has distinct pharmacologic and regulatory

characteristics from PAR1 mediated ATP release (Chapter 5). Finally, the

future directions are discussed in Chapter 6.

46 Table 1.1 Agonist Selectivity and Signaling Systems of the P2

Nucleotide Receptors (157).

47 Table 1.1

Receptor Selectivity for Signaling Nucleotide Agonists Mechanism P2X1-7 ATP >> ADP, UTP, UDP Cation channel (Ca2+ influx, depolarization)

P2Y1 ADP > ATP >> UDP, UTP Gαq -> PLC

P2Y2 ATP = UTP >> ADP, UDP Gαq -> PLC

P2Y4 UTP >> ATP, UDP, ADP Gαq -> PLC

P2Y6 UDP > UTP > ADP >>ATP Gαq -> PLC

P2Y11 ADP > ATP >> UDP, UTP Gαq -> PLC

Gαi -> Adenylate cyclase

P2Y12 ADP > ATP >> UDP, UTP Gαi -> Adenylate cyclase

P2Y13 ADP > ATP >> UDP, UTP Gαi -> Adenylate cyclase

P2Y14 UDP-glucose >> UTP, ATP, UDP, ADP Gαi -> Adenylate cyclase

48 Table 1.2 Pharmacologic inhibitors of connexin hemichannels,

pannexin hemichannels, VSOAC, and maxi-anion channels (3, 20, 60,

81, 166, 167, 173, 182 , 252, 253, 258, 269, 287)

49 TABLE 1.2

Cx Px

CBX IC50 ~5μM3, 287 IC50 ~5μM 173, 253 DCPIB not evaluated not evaluated

DIDS NO EFFECT81 IC50 ~10μM173 ddF not evaluated not evaluated

FFA IC50 ~5μM81 NO EFFECT173 Contradictory (YES 3+ Gd glioma)81, 253 not evaluated

NPPB IC50 ~15-50μM81, 247, 248 IC50 ~20-50μM173, 252

PB NO EFFECT247 IC50 ~150-350μM173 252 VSOAC maxi-anion

CBX IC50 ~75μM20 NO EFFECT166

DCPIB >90% at 20μM3 not evaluated

DIDS Partial at 100μM\3 Partial at 100μM166 >90% at 100μM (time

ddF dependent)269 not evaluated

FFA ~90% at 100μM258 >90% 300μM287 3+ Gd NO EFFECT3, 252 IC50 <30μM166, 167

NPPB Partial at 100μM3 Partial at 100μM167

PB not evaluated No at 1mM166

50 Figure 1.1 Structure of adenine nucleotides. A: Adenosine is a

nucleoside composed adenine linked to ribose by a β-N9-glycosidic bond.

B: Adenosine monophosphate (AMP) is a 5’ ester of inorganic phosphate

and adenosine. C: Adenosine diphosphate (ADP) is a 5’ ester of

Pyrophosphate and adenosine. D: Adenosine triphosphate (ATP) is a 5’ ester of

tripolyphosphate and adenosine.

51 FIGURE 1.1

52 Figure 1.2 Major Elements of Intercellular Signaling by Extracellular

Adenine Nucleotides. ATP may be released by lytic, channel-mediated,

or exocytotic pathways. ATP is sequentially de-phosphorylated by CD39

to form ADP, then AMP and two molecules of inorganic phosphate.

Alternatively, NPP family ecto-nucleotidases hydrolyze ATP to form AMP

directly, generating pyrophosphate. AMP in turn can be dephosphorylated

to adenosine by CD73 family of 5’-ecto-nucleotidases. Released

nucleotides activate signaling via the ionotropic P2X family receptors or

the P2Y family G protein–coupled receptors (GPCR). Additionally,

adenosine activates P1 family GPCR, while phosphate and

pyrophosphate have effects on mineral deposition (45).

53 FIGURE 1.2

Major Elements of Exocytotic Regulated Lytic Nucleotide-Based Release Transport Release Intercellular Signaling ATP ATP ATP Sources of Extracellular Nucleotides

ATP CD39/ NTPDs Local Metabolism of CD39/ NTPDs Extracellular Nucleotides ADP NPPs AMP CD73

pyrophosphate adenosine

Recognition / Activation of P2X P2Y Adenosine P2 Receptor Subtypes Channels GPCR GPCR 7 subtypes 8 subtypes 4 subtypes Suppression of Calcification

54 Figure 1.3 Release of ATP to Extracellular Compartments.

Mammalian cells tightly regulate the extracellular concentration of purine

nucleotides by release and extracellular metabolism of ATP. Purine

nucleotide concentration in the bulk extracellular compartment is much

lower than in the cell surface microenvironment due to rapid enzymatic

clearance and relatively slow diffusion of nucleotides away from the cell.

(157).

55 FIGURE 1.3

56 Figure 1.4 Autocrine / Paracrine ATP mediated Ca2+ wave. ATP can be released in response to diverse mechanical stimuli. Extracellular ATP is a diffusible signal that can activate P2 receptors in an autocrine / paracrine manner. P2 receptor activation triggers cytosolic [Ca2+] increase from either mobilization of intracellular stores (P2Y) or influx of extracellular Ca2+ (P2X). In this way highly localized mechanical stimuli affect neighboring cells via “Ca2+ waves” mediated by ATP induced ATP release (45).

57 FIGURE 1.4

58

CHAPTER 2:

Experimental Methods

Portions of this chapter have been published as parts of

1) Blum et al. Am J Physiol Cell Physiol. 2008 Jul;295(1):C231-41. Rho-family

GTPases modulate Ca2+-dependent ATP release from astrocytes

2) Blum et al. Am J Physiol Cell Physiol. 2009 Nov 11. Extracellular Osmolarity

Modulates G protein-Coupled Receptor Dependent ATP Release from

1321N1 Astrocytoma Cells.

59 Reagents

Carbachol, lysophosphatidic acid (LPA), mannitol, phorbol

myristate acetate (PMA), thrombin (1 Unit / mL = 5 nM), βγ-methylene

ATP (βγ-meATP), carbenoxolone, flufenamic acid, gadolinium hydrate,

1,9-dideoxyforskolin, probenecid and lyophilized Firefly Luciferase ATP

Assay Mix (FL-AAM, LUC) containing luciferase, luciferin, MgSO4,

dithiothreitol, EDTA, bovine serum albumin (BSA), and Tricine buffer were

from Sigma-Aldrich. Thrombin Receptor Activating Peptide (SFLLRD-

TRAP) was synthesized by SynPep, Inc. The cytosolic [Ca2+] buffering

agent BAPTA-AM was obtained from Molecular Probes. Wildtype 1321N1

human astrocytoma cells were obtained from Drs. Ken Harden and Jose

Boyer (University of North Carolina – Chapel Hill). Purified Clostridial

Toxin B (ToxB) was obtained from the Tech Lab, Inc. diagnostic test kit.

C3 exoenzyme, the RhoA-“G-LISA” kit, and F-Actin Visualization kit were

from Cytoskeleton, Inc. A cDNA construct of the fusion protein glutathione

S-transferase-Rhotekin Rho-Binding Domain (GST-RBD) was kindly

provided by Dr. Martin Schwartz (University of Virginia). Rabbit polyclonal

antibody to RhoA (sc-119) was obtained from Santa Cruz.

Cell Culture

1321N1 human astrocytes were maintained in Dulbecco’s minimal

essential medium (DMEM) containing 10% iron-supplemented bovine calf

serum (Hyclone), penicillin (100 U/mL), and streptomycin (100 μg/mL).

60 For all luciferase-based and Rho activation experiments, 1321N1 cells

were seeded on 35-mm dishes (Falcon) at 3 x 105 cells per dish, or cells

were seeded on 24-well plates at a density of 4 x 104 cells per well. All

experiments were conducted using confluent cell monolayers cultured for

5 to 7 days post-plating followed by serum-starvation for 16 to 24 hours

prior to analysis of ATP release. Serum-free DMEM contained 0.1% BSA,

penicillin (100 U/mL), and streptomycin (100 μg/mL).

Clostridial Toxin Loading

Confluent 1321N1 cell monolayers were treated with a 1:50 dilution

of purified C. difficile Toxin B (ToxB, TechLab, Inc.) for 3-4 hours at 37oC

until significant (>95%) cell rounding was observed (Fig. 3.2A,B).

Alternatively, cell monolayers were treated with 2μg/mL of cell permeant

C3 exoenzyme for 6 hours which did not cause cell rounding (Fig. 3.2C).

Buffering of Cytosolic Calcium

The role of cytosolic [Ca2+] in thrombin-dependent and thrombin-

independent ATP release was studied using 1321N1 cell monolayers

incubated with the cell-permeable Ca2+ chelator 1,2-bis (2-

aminophenoxy)ethane-N,N,N',N'-tetraacetic acid tetrakis acetoxymethyl

ester (BAPTA-AM) for 60 minutes at 37oC.

61 RhoA-GTP-Rhotekin pull-down assay

GST-TRBD protein was expressed (in E. coli BL21 strain) and

purified from bacterial lysate and attached to glutathione beads. The

effects of ToxB on Rho signaling were studied in parallel matched

samples of untreated versus ToxB-loaded 1321N1 cells and analyzed by

RhoA-GTP-Rhotekin pull down assays. A 5 x Mg2+ lysis buffer (MLB) was

made containing: 125 mM HEPES, pH 7.5, 750 mM NaCl, 5% Nonidet

P40, 50 mM MgCl2, 5 mM EDTA, and 10% glycerol. Confluent 35-mm

dishes of serum–starved 1321N1 cells pretreated for 3 hours with or

without ToxB were washed twice and bathed in 1 mL basal saline solution

(BSS) containing: 130 mM NaCl, 5 mM KCl, 1.5 mM CaCl2, 1 mM MgCl2,

25 mM HEPES (pH 7.5), 5 mM glucose, and 0.1% BSA. The cells were

equilibrated at RT (22-25oC) for ~45 min before being treated with 3 μM

TRAP, 100 μM Carbachol or 10 μM LPA for 2 minutes. The BSS was

aspirated and the cells were lysed and scraped on ice in 1 mL of MLB

(plus protease inhibitors). The lysates were then clarified at 14,000 rpm

for 5 min at 4oC. Untreated control samples were separated into 2 x 0.5

mL aliquots on ice. For the GTPγS control, one of these aliquots was

treated with 10 μl of 0.5 mM EDTA to chelate Mg2+ ions. After addition of

10 μM GTPγS, this lysate sample was subsequently incubated at RT for

30 min. Loading was stopped adding 32 μL of 1.0 M MgCl2 and the GTP-

loading control was run to verify pull down of activated RhoA (data not

shown). Along with this positive control, the rest of the samples were

62 aliquoted in 0.5 mL cleared lysate/tube. To each sample ~30 μg of freshly

thawed GST-TRBD-bead slurry was added and the reaction mixtures were

rotated for 45 minutes at 4oC. The beads were washed 3 times with 0.5

mL MLB, the slurries were resuspended in 40 μl 2 x Laemmli buffer, boiled

for 5 minutes then treated with 2 μl of 1.0 M DTT (to ensure dissociation of

bound Rho-GTP from the GSH-beads). Standard western blotting

techniques were then used to probe for activated RhoA using 1:200 rabbit

polyclonal anti-RhoA antibody (Santa Cruz). This antibody also

recognizes RhoB in loading controls (whole cell lysates), but only RhoA

binds to the Rhotekin protein.

ELISA-based RhoA activation assay

RhoA activity was determined in whole cell lysates prepared from

monolayers of 1321N1 cells using the absorbance based-G-LISA RhoA

activation assay kit (Cytoskeleton, inc.) according to the manufacturer’s

instructions. After 2 minutes of stimulation with 10 nM thrombin, cells were

lysed using the supplied cell lysis buffer. Lysates were clarified by

centrifugation at 10,000 rpm at 4 °C for 2 minutes. One portion of the

lysate was used for quantification of protein concentration and the other

portion was used for Rho G-LISA assay. The lysate used in the Rho G-

LISA assay was snap frozen in liquid nitrogen as soon as possible after

cell lysis to prevent GTP hydrolysis by the extracted Rho-GTPase. After

protein quantification the frozen aliquots of cell lysate were rapidly thawed

63 and 0.75 mg/ml protein was used in each well of the supplied 96-well

plate. All subsequent incubation and detection followed the instructions

provided by the manufacturer.

Ca2+ Mobilization Assay

1321N1 cell monolayers on 10-cm plates were trypsinized and

resuspended in isotonic 320 mOsm BSS and loaded with 1 μM fura2-AM

at 37oC for 45 minutes. Aliquots of the fura-loaded cells were then

resuspended in isotonic BSS. For experiments comparing the effects of

different extracellular osmolarity 3-5 minutes prior to experimentation 0.75

mL of fura loaded cells (~7.5x105 cells) was mixed with 0.75 mL of 320

mOsm BSS, 180 mOsm BSS, or 440 mOsm BSS to generate 1.5 mL

isotonic 320 mOsm BSS, hypotonic 250 mOsm BSS, or 380 mOsm BSS

respectively with 5x105 cells / mL. The cells were assayed for changes in

fura2 fluorescence (339-nm excitation and 500-nm emission) triggered by

thrombin (0.3 pM – 10 nM) 3 μM TRAP, 100 μM carbachol, or 10 μM LPA.

Signals were calibrated by permeabilizing the cells with digitonin in the

2+ presence of a saturating concentration of Ca (Fmax) followed by addition

2+ of EGTA, pH 8 (Fmin). Quantification of cytosolic [Ca ] was performed

2+ using the equation [Ca ] = Kd x (F - Fmin) / (Fmax – F) where F is the

fluorescence in arbitrary units and Kd = 224nM (103).

On-line Luciferase-based ATP assay

64 Confluent 1321N1 cell monolayers were washed twice and bathed

in 1 mL BSS. The washed monolayers were then bathed in 0.96 mL BSS

and incubated for ~45 minutes at RT or 32oC, prior to experimental

manipulation. Soluble FL-AAM (Sigma) was reconstituted with 5 mL of

sterile filtered water and stored in frozen 500 μL aliquots. For

experiments, aliquots were thawed at room temperature and diluted 1:25

(40 μL) into the 35 mm dishes prior to start of luminescence recordings. All

extracellular ATP measurements were recorded using a Turner Designs

(TD 20/20) luminometer that accommodates 35 mm culture dishes. ATP-

dependent changes in extracellular luciferase activity were measured as

relative light unit (RLU) values integrated over 5 second photon counting

periods. For all experiments, the luciferase activity was recorded every 2-

minutes for up to 30 minutes. Calibration curves were generated for each

experiment using cell-free dishes pulsed with increasing concentrations of

ATP standards. The limit of ATP detection was 100 fmol per 1 mL assay

volume and luminescence was linear with increasing ATP concentration

up to 1000 nM. After luciferase activity reached steady state, 1321N1

monolayers were treated for up to 15 minutes 10 nM of Thrombin, 3 μM of

the SFLLRD-TRAP, 100 μM carbachol, 10 μM LPA or by strong hypotonic

stress (rapid switch to 215 mOsm by replacing 400 μL isotonic BSS with

400 μL of NaCl-free BSS supplemented with FLAAM and βγ-meATP).

The ecto-ATPase inhibitor βγ-meATP (300 μM) was added either

simultaneously with stimulus, or 15 minutes prior to stimulus addition.

65 Luciferase activity was recorded every 2 minutes during the stimulation

period and every addition to the 1 mL ATP assay volumes was made

using 100- to 1000-fold concentrated stocks of the various test reagents.

At the end of each experiment, cell monolayers were permeabilized using

digitonin (50 μg/mL) and the peak concentrations of digitonin-releasable

ATP were averaged in matched dishes.

Off-line Luciferase-Based ATP Assay

Confluent 1321N1 cell monolayers in 24-well plates were washed

twice and bathed in a final assay volume of 300μL basal saline solution

(BSS) for ~45-60 minutes at RT, prior to experimental manipulation. All

subsequent additions to the sample resulted in less than 1% total change

in volume. Following addition of agonist cells were incubated at RT for 15

minutes. Samples of extracellular media (50μL) were carefully removed at

designated times and boiled immediately for 5 minutes. After a brief (2

min, 1000g) centrifugation step to clarify the samples, ATP content was

quantified using a Turner Designs (TD 20/20) luminometer. For all

measurements, 25uL of sample was added to a mix of 4uL of FLAAM and

71uL of BSS. The final volume was 100uL with a 1:25 dilution of FLAAM.

The solution was added to a 12mm x 50mm disposable plastic cuvette

(Promega, Madison WI) and RLU values were integrated over 5 second

photon counting periods.

66 Assay of ATP Release with Osmolarity Change

Confluent 1321N1 cell monolayers in 24-well plates were removed

from growth media and washed twice with 0.5 mL basal saline solution

(isotonic BSS) containing 130 mM NaCl, 5 mM KCl, 1.5 mM CaCl2, 1 mM

MgCl2, 25 mM NaHEPES (pH 7.5), 5 mM glucose, and 0.1% BSA (320

mOsm final calculated osmolarity). Cells were then allowed to equilibrate

for 30-45 minutes in 250 μL isotonic BSS at 37oC and then rapidly

(complete in 15 sec) switched to test solutions with altered osmolarity by

removal of 100 μL of the isotonic BSS and replacement with 100 μL of

modified BSS to regenerate a final test volume of 250 μL BSS with the

indicated osmolarity. Thus, 215 mOsm BSS (78mM final NaCl) was

generated by replacement with 100 μL NaCl-free BSS; 250 mOsm BSS

(95 mM final NaCl) was generated by replacement with 100μL 43mM NaCl

BSS; 285 mOsm BSS (113 mM final NaCl) was generated by replacement

with 100μL 87mM NaCl BSS; 320 mOsm BSS (130 mM final NaCl,

isotonic control) was generated by replacement with 100 μL 130 mM NaCl

BSS; 350 mOsm BSS (145 mM final NaCl) was generated by replacement

with 100 μL of 168mM NaCl BSS; 380 mOsm BSS (160 mM final NaCl)

was generated by replacement with 100 μL 205mM NaCl BSS. All

replacement solutions contained different concentrations of NaCl but were

otherwise identical to the isotonic BSS. For the experiments in Fig. 2B,

an alternative 380 mOsm BSS was generated by replacing 100 μL isotonic

67 BSS with 100 μL of standard 130 mM NaCl BSS supplemented with 150

mM mannitol to yield 60 mM final mannitol.

320 mOsm BSS - rather than a 300 mOsm BSS – is defined as

isotonic because Cheema et al. have noted that 1321N1 astrocytes are

cultured in high glucose DMEM which has a measured osmolarity of ~330

mOsm. Cultured cells undergo long-term adaptive responses to the

osmolarity of their growth medium that involve accumulation of organic

osmolytes such as taurine (12, 50). Thus, switching cells cultured in high

glucose DMEM to a 300 mOsm ATP release assay medium would per se

comprise a mild hypotonic stress.

The replacement solutions were additionally supplemented (or not)

with various combinations of thrombin, the βγ-meATP ecto-ATPase

inhibitor, and channel inhibitors at 2.5 times the desired final concentration

in the 250 μL test incubation volume. Thus, in most experiments, the cells

were simultaneously challenged by osmotic stress and PAR1 activation.

The final βγ-meATP concentration was 300 μM and final thrombin

concentration was usually 10 nM (2 units/mL) except for concentration-

response analyses. Test incubations were performed at 37oC and

samples of extracellular media (25 μL) were removed for immediate

quantification of ATP at 2.5, 5, 10, and 15 min following the switch to

replacement BSS +/- thrombin. For some experiments 1321N1 cells were

first transferred to BSS with altered osmolarity, but lacking thrombin, and

then incubated for 30 min prior to being challenged with various

68 concentrations of thrombin for an additional 10 min. Each 25 μL sample of

extracellular medium was added to a mix of 2 μL of stock FLAAM

concentrate and 23 μL of isotonic BSS. The final volume was 50 μL with a

1:25 dilution of FLAAM concentration. Measurements of ATP-dependent

bioluminescence were made in 12 mm x 50 mm disposable plastic

cuvettes (Promega, Madison WI) using a Turner Designs (TD 20/20)

luminometer. Luminescence (as relative light units- RLU) was integrated

over a 5 second photon counting period following which the sample was

spiked with known amounts (0.1 - 10 pmol) of standard ATP for calibration

and quantification. All quantifications of ATP release in the BSS

formulations with altered NaCl concentrations were appropriately adjusted

to account for the known inhibitory effects of chloride on the efficiency of

the luciferase reaction. I also observed that elevated probenecid and Gd3+

attenuated luciferase activity. Thus, appropriate control calibrations were

performed to account for the effects of these pharmacological agents on

the luciferase reaction and quantification of ATP in extracellular media

samples.

Stimulation Protocol for Assay of ATP Release with Low Divalent

Cation Solution

Confluent 1321N1 cell monolayers in 35mm dishes or 24-well

plates were removed from growth media and washed twice with 1 mL or

0.5 mL BSS. Cells were then allowed to equilibrate for 30-45 minutes in

0.96 mL or 250 μL isotonic BSS at 37oC and then rapidly (complete in 15

69 sec) switched to test solutions with low divalent cations by removal of 400

μL or 100 μL of the control BSS and replacement with 100 μL of modified

BSS to regenerate a final test volume of 1 mL or 250 μL BSS. Thus, low

divalent solution was generated by replacement with 400 μL or 100 μL

Ca2+ / Mg2+ free BSS (Identical to control BSS, but without Ca2+ or Mg2+

and supplemented with 2 mM EGTA). The final solution is identical to

BSS, but has 0.6 mM Mg2+ and submicromolar Ca2+. The replacement

solutions were additionally supplemented with βγ-meATP ecto-ATPase

inhibitor, and channel inhibitors at 2.5 times the desired final concentration

in the 250 μL test incubation volume, as described above.

Ethidium influx as assay of hemichannel activity

Tyrpsinized, suspended 1321N1 cells were assayed in a stirred

cuvette at 37oC at a concentration of 5x105 cells / mL. Ethidium bromide

(20 μM) was added and fluorescence was measured at 360 nm excitation

/ 575 nm emission before and after stimulation with thrombin (10 nM);

experiments were terminated by addition of digitonin (50 μg/mL) to

permeabilize the cells to permit maximum binding of ethidium to cellular

nucleic acids.

RT-PCR analysis

Total RNA was extracted using TRIzol (Sigma) and 1µg of RNA was

primed with oligo dT primers (Promega) at 65 oC for 10 minutes and incubated

70 with AMV reverse transcriptase (Roche) at 42oC for 60 minutes. Primer pairs

selective for the human pannexin1 are (forward 5’-

CTCAGCAACCTGGTTGTGAA -3’: reverse 5’- TCGCCAGTAACCAGCTTGTA -

3’); human connexin43 are (forward 5’- GGGATCCTGAGAAACGACAG -3’:

reverse 5’- AAAAGTGGGGAGGATTTCGT -3’); and human GAPDH primers

were obtained from Stratagene (La Jolla, California). PCR was performed using

1:1000 dilutions of the RT reactions in 20 µl reaction volumes. PCR conditions

were (92 oC, 1 min; 60 oC, 1 min; 72 oC, 2 min; 35 cycles) The sizes of target

amplicons were: pannexin 1 195 bp; connexin 43 670 bp; GAPDH 560 bp. The

PCR amplicons were separated by 1.5 % agarose gel electrophoresis and

visualized by ethidium bromide staining; the resulting fluorescence images were

recorded with a BioRad Gel Doc 1000 system.

Data Evaluation

Relative luminescence unit (RLU) recordings were downloaded into

Microsoft Excel using the Turner Designs spreadsheet interface software

(version 2.0.1, Sunnyvale, CA). RLU values were converted to ATP

concentrations using calibration curves generated with each experiment.

OD490 absorbance values of GTP-bound RhoA were recorded using a

(Molecular devices) SpectraMax 340 96-well plate reader. Measured

values were normalized to untreated control cells. (GraphPad) Prism

3.0TM software was used to compute the means and standard errors as

well as generate graphs of the calculated [Ca2+], ATP levels, and relative

GTP-bound RhoA from identical, independent experiments. Some figures

71 were also generated using Adobe Illustrator 7.0 TM and Microsoft

PowerPointTM software.

72

CHAPTER 3:

Rho-Family GTPases Modulate Ca2+-Dependent ATP Release

from Astrocytes

Portions of this chapter have been published as part of:

Blum et al. Am J Physiol Cell Physiol. 2008 Jul;295(1):C231-41. Rho-

family GTPases modulate Ca2+-dependent ATP release from astrocytes

73

74 ABSTRACT:

Activation of G protein-coupled receptors (GPCR) in 1321N1

human astrocytoma cells elicits a rapid release of ATP that is partially

2+ dependent on a Gq / PLC / Ca mobilization signaling cascade. In this

study I assessed the role of Rho-family GTPase signaling as an additional

pathway for the regulation of ATP release in response to activation of

PAR1 (protease-activated receptor-1), LPAR (lysophosphatidic acid

receptor), and M3R (M3-muscarinic) GPCRs. Thrombin (or other PAR1

peptide agonists), LPA, and carbachol triggered quantitatively similar Ca2+

mobilization responses, but only thrombin and LPA caused rapid

accumulation of active GTP-bound Rho. The ability to elicit Rho activation

correlated with the markedly higher efficacy of thrombin and LPA, relative

to carbachol, as ATP secretagogues. Clostridium difficile toxin B and

Clostridium botulinum C3 exoenzyme, which inhibit Rho-GTPases,

attenuated the thrombin- and LPA-stimulated ATP release, but did not

decrease carbachol-stimulated release. Thus, the ability of certain Gq-

coupled receptors to additionally stimulate Rho-GTPases acts to strongly

potentiate a Ca2+-activated ATP release pathway. However,

pharmacologic inhibition of Rho kinase I/II or myosin light chain kinase did

not attenuate ATP release. PAR1-induced ATP release was also reduced

2-fold by brefeldin treatment suggesting the possible mobilization of Golgi-

derived, ATP-containing secretory vesicles. ATP release was also

markedly repressed by the gap junction channel inhibitor carbenoxolone

75 (CBX) in the absence of any obvious thrombin-induced change in

membrane permeability indicative of hemichannel (Hemichannel) gating.

76 INTRODUCTION:

Extracellular nucleotides act as autocrine / paracrine signaling

molecules by targeting multiple P2 purinergic receptor subtypes that are

differentially expressed in most tissues (41). Cells are able to tightly

regulate the concentration of ATP and other nucleotides in the

extracellular space through a balance of release and extracellular

metabolism of these nucleotides. The four sources of extracellular

nucleotides are cell lysis, exocytosis, transport mediated ATP release, and

extracellular nucleotide kinases. In non-excitable cells, such as

astrocytes, unequivocal determination of ATP release mechanisms has

remained elusive.

In the brain, ATP can be released by astrocytes, or by other glial

cell types, in response to diverse metabolic, mechanical, or inflammatory

stimuli (40, 43). Extracellular ATP can target glia and neurons, as well as

the smooth muscle cells and endothelial cells that populate

cerebrovascular interfaces (1, 88, 129). Although purinergic signaling is

an important element of the communication network between astrocytes

and surrounding cells, the signaling events upstream of ATP release, as

well as the actual conduits or pathways for the export of ATP, have not

been clearly established. Studies of regulated ATP release in different

astrocyte models have implicated either channel-mediated efflux of

cytosolic ATP or exocytosis of vesicles/organelles containing

compartmentalized ATP as predominant pathways for the export of

77 intracellular ATP pools. Support for exocytotic models of ATP release has

largely been predicated on the inhibitory actions of various reagents, such

as brefeldin A, tetanus toxins, or dominant-negative SNARE proteins, that

target particular steps in the standard Golgi  transport vesicle  vesicle

/ plasma membrane fusion trafficking pathways (45). Secretory

lysosomes have been recently proposed as a source of releasable ATP

from astrocytes based on the ability of glycylphenylalanine 2-napthylamide

(GPN), a substrate for lysosomal cathepsin C, to coordinately collapse

lysosome integrity and repress the ATP release stimulated by metabolic

stress or glutamate receptor activation (301). Studies of conductive

pathways have predominantly focused on non-junctional “gap-junction

hemichannels” comprised of connexin or pannexin subunits that may act

as conduits for stimulated ATP efflux from astrocytes (253) and other cell

types (80, 95, 100, 164, 168, 302). Support for this mode of ATP release

has been based in part on the inhibitory actions of pharmacological

agents, such as glycerrhetinic acid or carbenoxolone (CBX) known to

target gap junction channels. Although CBX was first characterized as an

inhibitor of 11-beta-hydroxysteroid dehydrogenase, it has also been used

extensively to inhibit the activity of intercellular gap-junction channels and

gap-junction hemichannels (73, 98). More recently, CBX has been shown

to inhibit VSOAC (20).

Regardless of whether channel-mediated efflux or vesicle

exocytosis comprises the predominant ATP release mechanism, most (56-

78 58, 137, 186, 206, 221, 301), but not all (284), studies have identified

elevation of cytosolic Ca2+ as an important regulator of nucleotide export

in the different astrocyte model systems. In this regard, I have previously

reported that elevated cytosolic Ca2+ plays a critical role in the ATP

release elicited by stimulation of protease activated receptor 1 (PAR1) or

M3-muscarinic (M3R) GPCR in the 1321N1 human astrocytoma cell line.

PAR1 stimulation induced ATP release was consistently ~4 fold higher

than that induced by M3R stimulation despite equivalent Ca2+ mobilization

responses to either receptor. Experiments with BAPTA-loaded cells

revealed that M3R-induced ATP release was entirely dependent on

elevation of cytosolic Ca2+, while the PAR1-triggered ATP accumulation

involved an additional Ca2+-independent component (137). Brown and

colleagues have demonstrated that while PAR1 and M3R both activate Gq

in 1321N1 cells, only PAR1 additionally couples to G12/13 to regulate Rho

signaling (8, 155, 218). Rho activation and other changes in cytoskeletal

organization have been implicated in the activation or modulation of ATP

release in other model systems (57, 59, 105, 117, 149). Therefore I

hypothesized that Rho activation and subsequent Rho kinase (ROCK)

signaling may synergize with Ca2+ mobilization to increase GPCR-

dependent ATP release. I used Clostridium difficile Toxin B (ToxB) and

Clostridium botulinum Toxin C3 (C3) to demonstrate that Rho family

GTPases potentiate Ca2+ dependent ATP release from 1321N1 human

astrocytoma cells via a ROCK-independent signaling pathway.

79 Experiments with brefeldin-treated cells suggest that this Rho-sensitive

pathway may involve, in part, the mobilization of Golgi-derived, ATP-

containing secretory vesicles. I also observed that CBX suppresses

GPCR-stimulated ATP release in the absence of any obvious changes in

membrane permeability indicative of hemichannel gating.

80 RESULTS:

PAR1-activated ATP release is suppressed by BAPTA-buffering of

cytosolic [Ca2+] or Clostridrial Toxin B-inhibition of Rho family

GTPases

PAR1 activation by either 3 μM TRAP or 10 nM thrombin elicits a

rapid ATP release from 1321N1 astrocytes that is markedly attenuated by

BAPTA-buffering of cytosolic Ca2+ increases as described in our previous

report (Figures 3.1A and 3.1B) (137). To detect steady-state increases in

extracellular ATP in this model it is necessary to include βγ-methylene-

ATP (βγ-meATP) which suppresses the rapid clearance of released ATP

by the predominant ecto-ATPase expressed on 1321N1 astrocytes (138).

PAR1-induced ATP release was also significantly reduced (50-75%) when

these cells were pretreated with Clostridial difficile toxin B (ToxB) for 3 hr.

(Figure 3.1A-B and 3.2C). ToxB catalyzes the transfer of the glucosyl

moiety from UDP-glucose to conserved threonine residues in the effector

targeting domains of RhoA, Rac, and Cdc42 and renders all of these Rho

family GTPases functionally inactive (6). The observed inhibitory action of

ToxB suggests that Rho family GTPases can synergize with elevated Ca2+

to potentiate ATP release in this astrocyte model system.

To verify that PAR1 stimulation elicits a ToxB-sensitive activation of

Rho family GTPases, control or ToxB-treated 1321N1 cells were

stimulated with TRAP for 2 minutes prior to lysis and analysis by a

Rhotekin-based RhoA-GTP pull down assay. ToxB treatment effectively

81 reduced the basal RhoA-GTP content and strongly suppressed the robust

TRAP-activated increase in RhoA-GTP levels observed in control cells

(Figure 3.1C). Use of a quantitative ELISA-based protocol to quantify

RhoA-GTP content similarly indicated that PAR activation triggered a 3.2-

fold increase in Rho-GTP which was reduced by >85% in ToxB-treated

cells (Figure 3.2B). In contrast, ToxB treatment had no effect on the

TRAP-stimulated elevation in cytosolic Ca2+ concentrations (Figure 3.1D).

Therefore, the PAR1-mediated signal transduction pathways leading to

ATP release involve both Rho family GTPase activation and Ca2+

mobilization. Moreover, suppression of Rho family GTPases does not

attenuate Ca2+ mobilization indicating that these responses comprise

parallel signaling pathways that converge on the ATP release process.

ToxB-treated monolayers were characterized by elevated basal

levels of extracellular ATP (relative to control cells) when assayed by the

on-line luciferase assay (Figs. 1A-B) but not the off-line ATP

measurements (Figure 3.2C). This may be due to the repeated movement

of the culture dishes into and out of the luminometer chamber in the

former, but not latter, protocol. This repeated movement may induce

mechanical stimulation dependent ATP release due to enhanced effects of

fluid shear on the rounded-up cells that characterize the ToxB-treated

cultures (Figure 3.2A).

82 Increased Rho-GTP accumulation but not Rho-kinase activity is

correlated with thrombin-induced ATP release

Because ToxB glucosylates and inhibits the Rho, Rac, and Cdc42

members of the Rho-GTPase family, use of this reagent does not reveal

which particular member(s) of this small GTPase family regulates the ATP

release response elicited by PAR1 agonists. Clostridial botulinum C3

toxin is a mono-ADP-ribosyl transferase that selectively inhibits RhoA,

RhoB, and RhoC by covalently modifying the N-41 residue of these

proteins, preventing nucleotide exchange (281). A membrane-permeable

version of C3 toxin was used to test whether Rho subtype GTPases, in

particular, are involved in ATP release. Although ToxB treatment for 3

hours caused uniform rounding of adherent 1321N1 human astrocytes, a

6-hour pre-incubation with 2 μg/mL C3 minimally affected cell shape

(Figure 3.2A). However, this C3 treatment produced a 75% decrease in

thrombin-stimulated Rho-GTP accumulation (Figure 3.2B) which was

comparable to the 85% reduction produced by ToxB. The C3-induced

decrease in Rho activation was correlated with a 57% decrease in

thrombin-triggered ATP release (Figure 3.2C); this compared with the 75%

decrease observed in ToxB-treated cells assayed under identical

conditions. Thus, C3 is only marginally less efficacious than ToxB as an

inhibitor of ATP release despite the ability of ToxB to additionally target

Rac and Cdc42. This indicates that the inhibitory effects of ToxB on

83 stimulated ATP release predominantly reflect the inactivation of Rho-

dependent signals.

I tested whether this Rho-dependent component of regulated ATP

release was related to the well-characterized roles of Rho on cytoskeletal

dynamics. These latter actions of Rho are mediated in part by the

downstream Rho-dependent kinases I/II (ROCK1/2) coupled to myosin

light chain (MLC) phosphorylation. Previous studies have indicated that

PAR1 activation of 1321N1 cells triggers rapid ROCK-dependent changes

in cell shape and organization of the actin cytoskeleton (122, 151, 176,

246). However, treatment of 1321N1 cells with 10 μM of the Y-27632

ROCK inhibitor for 1 hr prior to thrombin stimulation did not attenuate the

rate or peak magnitude of ATP release (Fig. 3A). Likewise, 1321N1

astrocytes treated with 1 μM of the ML-7 MLC-kinase inhibitor exhibited no

changes in their ATP release response to thrombin. These data indicate

that thrombin-dependent ATP release does not involve an obligatory role

for ROCK, MLCK, or major reorganization of actin stress-fibers.

Role for Rho signaling in the ATP release triggered by LPA

receptors, but not muscarinic receptors

The role of Rho as a positive modulator of Ca2+-dependent ATP

release was further analyzed by comparing the responses of 1321N1 cells

to LPA versus carbachol. LPA acts on LPA1R, LPA2R, and LPA3R

(formerly known as EDG-family receptors 2,4,7) (53) which are expressed

84 in 1321N1 cells and, like PAR1, are able to both mobilize intracellular Ca2+

and activate Rho. Carbachol activates M3R, the predominant muscarinic

receptor in 1321N1 cells (10). M3R couple to Gq / PLC and mobilize

2+ intracellular Ca , but do not activate G12/13 / Rho signaling pathways (104).

Similar to PAR1 activation, LPAR stimulation elicited a robust ATP release

that was >3-fold greater than that triggered by carbachol in either the on-

line (Figures 3.4A-B) or off-line (Figures 3.4C-D) luciferase assays. The

LPA-induced ATP release was markedly reduced by BAPTA, ToxB, or C3

toxin while the carbachol-stimulated release was eliminated by BAPTA

loading but not affected by the Rho-directed toxins. As noted previously,

ToxB treatment modestly enhances the basal accumulation of

extracellular ATP in the on-line luciferase assays but not the off-line

assays (compare Figures 3.4B and 3.5B). Thus, the aggregate basal plus

carbachol-induced extracellular ATP accumulation in ToxB-treated cells

was actually greater than in the control monolayers (Figure 3.4B). Again,

this effect of ToxB was not re-capitulated in the off-line ATP assays

(Figure 3.5B).

ToxB and C3 treatment similarly attenuated ATP release in

response to LPA (Figure 3.5A), but not carbachol (Figure 3.5B). I also

confirmed that LPA, but not carbachol, recapitulates the ToxB-sensitive

stimulation of RhoA-GTP accumulation elicited by PAR1 agonists

(compare Figures 3.5D and 3.1C). In contrast, ToxB treatment did not

attenuate the equivalent Ca2+ mobilization responses to either LPA or

85 carbachol (Figures 3.5C). The similar abilities of PAR1 and LPAR, but not

M3R, to coordinately stimulate Ca2+ mobilization, RhoGTP accumulation,

and robust ATP release further supports the hypothesis that Rho-GTPase

activation acts as a strong positive modulator of Ca2+-dependent ATP

release.

Clostridial toxins and BAPTA-loading do not affect 1321N1 cell ecto-

ATPase activity.

Extracellular ATP concentrations reflect a balance between ATP

release and ATP clearance by ecto-nucleotidases. Thus, a decrease in

GPCR-induced extracellular ATP accumulation could reflect an increased

rate of ATP clearance rather than, or in addition to, a reduced rate of ATP

export. Although Βγ-meATP was routinely included to suppress ATP

clearance, it was important to verify that treatment of 1321N1 cells with

Rho-directed toxins or BAPTA-loading did not up-regulate a Βγ-meATP-

insensitive ecto-ATPase. Alternatively, the higher basal (pre-agonist) level

of extracellular ATP observed in ToxB-treated cells assayed by the on-line

luciferase protocol could be indicative of a reduced rate of ATP clearance.

However, direct comparison of the ecto-ATPase activities in control, ToxB-

, C3-, or BAPTA-treated cultures of 1321N1 cells challenged with identical

100 nM pulses of exogenous ATP revealed no differences in nucleotide

clearance (Figures 3.6A-B). Modest differences in the control rates of

86 hydrolysis between the panel A and panel B experiments likely reflect

differences in passage number and/or cell density.

PAR1-stimulated ATP release is reduced by carbenoxolone and

brefeldin-A but not glycylphenylalanine-2-napthylamide

I tested the involvement of Golgi-derived secretory vesicles,

secretory lysosomes, or gap junction hemichannels as possible ATP

release mechanisms by pre-treating 1321N1 monolayers with brefeldin A

(BFA, 5 μg/mL x 90 min), carbenoxolone (CBX, 100 μM x 30 min), or

glycylphenylalanine-2-napthylamide (GPN, 200 μM x 15 min) before

stimulation with thrombin for 15 min (Figure 3.7). ATP release was

reduced by 80% with CBX and by 50% with BFA, but not suppressed in

GPN-treated cells. Given its marked inhibitory actions, I further

characterized the actions of CBX on PAR1-stimulated signaling, ATP

release, and possible hemichannel activity. CBX caused a concentration-

dependent inhibition of thrombin induced ATP release from 1321N1 cells

with ~35% and 80% inhibition by 10 and 100 μM CBX, respectively

(Figure 3.8A). Significantly, activation of PAR receptors with thrombin did

not elicit ethidium bromide uptake, an indicator of non-selective pore

activity (Figure 3.8B). Permeabilization with digitonin verified that maximal

ethidium-dependent fluorescence increases were equivalent in all assays.

Despite its marked suppression of ATP release, CBX did not affect either

87 the Rho-GTP activation (Figure 3.8C) or the Ca2+ mobilization signals that

mediate thrombin-stimulated ATP release (Figure 3.8D).

88 DISCUSSION:

I used 1321N1 astrocytoma cells as a model system to investigate

ATP release in response to GPCR activation. The principal finding is that

activation of Rho signaling markedly potentiates Ca2+-dependent ATP

release in these cells. This extends and clarifies our previous observation

that PAR1 activation in 1321N1 cells leads to greater release of ATP than

is induced by M3R activation even though stimulation of either receptor

leads to equivalent Ca2+ mobilization. However, other findings dissociated

this effect of Rho activation on ATP release from its known actions on

ROCK effector enzymes, actin cytoskeleton dynamics, or cell shape

change. I additionally identified LPA as an efficacious ATP secretagogue

in 1321N1 astrocytes. LPAR activation, similar to PAR1 activation,

triggered both Ca2+ mobilization and Rho activation thus inducing greater

ATP release than was observed with M3R activation. Finally, ATP release

in response to thrombin was markedly repressed by the gap junction

inhibitor carbenoxolone and by brefeldin A, which disrupts the Golgi-

derived exocytotic secretory pathway.

Signaling mechanisms that regulate ATP release

Our observations suggest that the efficacy of a particular GPCR in

inducing ATP release from non-excitable cells will be limited by its

capacity to coordinately couple to both PLC Ca2+ mobilization and

RhoGEF Rho activation pathways. Although this will generally involve

coupling to parallel Gq PLCβ and G12/13 RhoGEF cascades, Gq has

89 been implicated as an upstream inducer of Rho activation in some cell

2+ types and G12/13 may regulate Ca mobilization via Rho-dependent PLCβ

activation in other cellular contexts (125, 241, 244). Additionally, Lbc Rho-

GEF activity can augment Gq signaling via interactions independent of

accumulated active RhoA (240). Thus, cellular responses, such as ATP

2+ release, that require Gq PLC Ca mobilization as necessary signals

may be modulated by Rho signaling via multiple networks. Although

PAR1 activation triggers markedly less inositol phosphate accumulation

than M3R stimulation in 1321N1 astrocytes, both receptors couple to PLC

in these cells via pertussis toxin–insensitive and presumably Gq-mediated

pathways (151, 154, 155). In contrast, LPAR has been reported to elicit

inositol lipid turnover in 1321N1 cells via a PTX-sensitive pathway likely

involving Giβγ regulation of other PLC isoforms (115). Moreover, Citro et.

al. have recently reported that inositol phosphate generation in response

to thrombin, but not LPA or carbachol, depends on primary Rho activation

in cultures of primary rat astrocytes (54). Despite these differences in

GPCR-induced inositol phosphate generation pathways in various

astrocyte models, I observed no differences in maximal Ca2+ mobilization

in response to thrombin, LPA, or carbachol in our 1321N1 model (Figure

3.1D, 3.4C). In contrast, activation of PAR1 and LPAR, but not M3R,

triggered robust accumulation of active Rho-GTPase in these astrocytes.

Similar divergent effects of PAR1 versus M3R on Rho activation, as well

90 as Rho-dependent rounding of 1321N1 cells, have been previously

described (246).

C3 toxin selectively inactivates RhoA, RhoB, and RhoC, while ToxB

non-selectively inactivates all Rho-family GTPases (281). Because both

C3 toxin and ToxB inhibited GPCR-activated ATP release from 1321N1

cells to a similar extent (Figures 3.2C,3.5A-B), RhoA is the most likely

Rho-family GTPase to potentiate Ca2+-dependent ATP release. Rho

activation and regulated ATP release have been linked in previous studies

using other model systems. Inactivation of Rho with C3 toxin attenuates

the ATP release stimulated by hypotonic stress in bovine aortic endothelial

cells (149). Moreover, Hirakawa et al. noted that treatment of human

endothelial cells (HUVEC) with LPA elicited co-temporal RhoA activation,

Ca2+ mobilization, and rapid ATP release (117) similar to our observations

with human astrocytes (Figure 3.4A and 3.5C-D). However, an important

difference between these studies was that GPCR-induced ATP release

from HUVEC was completely suppressed by the ROCK inhibitor Y-27632

while I observed no effect of Y-27632 on PAR1-triggered ATP release

from 1321N1 cells (Figure 3.3). Several factors may underlie this

divergent effect of ROCK inhibition of ATP release in these two cell types.

Interestingly, hypotonic stress-induced Ca2+ mobilization in these HUVEC

was also inhibited by Y-27632, while LPA-induced Ca2+ transients were

suppressed by suramin, a non-selective P2Y receptor antagonist.

Attenuation of regulated ATP release by Y-27632 in these endothelial cells

91 may reflect, in part, autocrine activation of P2 receptors with consequent

ATP-induced ATP release. 1321N1 astrocytes are notable because they

lack endogenous P2 receptor expression (207). Signaling reactions that

affect accumulation of extracellular ATP release in these cells are not

complicated by ATP-induced ATP release.

Previous studies have demonstrated that inhibition of either Rho-

kinases by Y-27632 or myosin light chain kinase by ML-7, will suppress

thrombin-stimulated rounding of 1321N1 cells, as well as remodeling of

actin stress fibers (122, 141, 240). The inability of Y-27632 or ML-7 to

attenuate ATP release (Figure 3.3) dissociates the well-characterized

actions of thrombin on actin cytoskeletal reorganization from its effects on

ATP release in 1321N1 cells. Moreover, neither LPA, a potent ATP

secretagogue, nor carbachol, a weak ATP secretagogue, mimic the ability

of thrombin to induce 1321N1 cell rounding (246). This suggests that the

cytoskeletal reorganization which underlies cell rounding involves a

network of GPCR signals distinct from those that elicit ATP release.

Because inhibition of ROCKs with Y-27632 did not affect ATP

release, Rho signaling must potentiate Ca2+-dependent ATP release via

another effector protein. Significantly, Kreda et al. also found that the

thrombin-stimulated, BAPTA-sensitive release of another nucleotide –

UDP-glucose – from 1321N1 cells was unaffected by concentrations of Y-

27632 that suppressed cell rounding and actin reorganization (151).

Although the ROCKs are the best-characterized downstream targets of

92 active Rho, several other signaling proteins including other

serine/threonine kinases, protein phosphatases, lipid kinases, lipases, and

scaffold proteins, have been implicated as Rho effectors (22). Several

Rho effectors, other than ROCK, provide clear functional intersections of

Ca2+ and Rho signaling that might be involved in GPCR-regulated ATP

release. For example, Rho-sensitive PI-4-P5K is required to prime

exocytotic vesicles of the Ca2+ regulated secretory pathway (111). Other

studies have indicated a role for Rho signaling in the regulation of LPA-

and GTPγS-stimulated glucose transport that involves rapid translocation

of GLUT4 transporters in intracellular membrane pools to the surface

membrane. This regulated mobilization of GLUT4 transporters can be

inhibited by C3 toxin or expression of dominant-negative PKN (protein

kinase N), a RhoA-regulated serine/threonine kinase (255).

ATP release mechanisms

Regardless of the GPCR-dependent signals that induce ATP

release from 1321N1 cells and other astrocyte models, the actual

mechanism(s) by which intracellular ATP is transferred to the extracellular

compartment remain poorly understood. Some studies have indicated

that exocytosis of ATP stored in secretory vesicles or atypical organelles

is the predominant route for ATP release from astrocytes. For example,

Zhang et al. recently reported that stimulation of primary rat astrocytes

with ionomycin, glutamate receptor agonists, or metabolic inhibitors,

triggered an ATP release that involved exocytosis of secretory lysosomes

93 containing compartmentalized ATP. In that system, stimulated ATP export

was abolished by glycylphenylalanine 2-napthylamide (GPN), an agent

that permeabilizes lysosomes (301). However, I found that thrombin-

stimulated ATP release was not suppressed in GPN-treated 1321N1 cells

(Figure 3.7A). This is consistent with other reports indicating that ATP

release from astrocytes is better correlated with the Ca2+ dependent

exocytosis of non-lysosomal vesicles (207, 221). Haydon and colleagues

used an inducible transgenic mouse model selectively expressing

dominant-negative SNARE protein within astrocytes to demonstrate the

requirement of an exocytotic pathway for ATP release and subsequent

extracellular adenosine accumulation that mediates activity-dependent

heterosynaptic depression (210). Similarly, in mixed astrocyte/neuron co-

cultures, astrocyte Ca2+ wave propagation – which depends on paracrine

activation of P2 receptors by released ATP - was found to be sensitive to

BAPTA and bafilomycin, but not to gap junction hemichannel inhibitors

(27, 56).

Of particular relevance to our studies, Kreda et al. recently

described the GPCR-regulated release of UDP-glucose, a nucleotide-

sugar that is the selective agonist of P2Y14 receptors, from 1321N1

astrocytes (48). Those investigators observed that thrombin, but not

carbachol, triggered a rapid export of UDP-glucose that was inhibited by

BAPTA-loading, but was insensitive to the Y-27632 ROCK inhibitor. They

also noted that thrombin-stimulated UDP-glucose release was almost

94 completely suppressed (>95%) by brefeldin A (BFA) which inhibits the

generation of the Golgi-derived transport vesicles used for constitutive

export of new proteins and lipids to the cell surface. Due to its role as a

substrate for protein glycosylation, UDP-glucose is accumulated within the

Golgi and Golgi-derived vesicles. ATP is also compartmentalized within

the Golgi for use by the ATP-dependent chaperone proteins that mediate

protein folding. Similarly, I observed that BFA treatment (5 μg/mL, 2

hours) reduced PAR-1 activated ATP release (Figure 3.7), but to a lesser

extent (50% inhibition) than the UDP-glucose release. Taken together,

our results and those of Kreda et al indicate that ATP is likely co-stored

and co-released with UDP-glucose in mobilizable Golgi-derived vesicles.

The ability of BFA to completely suppress PAR1- activated UDP-

glucose release while only partially attenuating ATP release from 1321N1

cells suggests that ATP is exported by an additional pathway(s) in this

model. In this regard, multiple reports have described strong correlations

between stimulated ATP release and the activation of gap junction

hemichannels. For example, Ca2+-dependent ATP release from C6

glioma cells is markedly increased by connexin overexpression (57, 58,

258). Multiple studies have used various pharmacological blockers of

connexin-based gap junctions and non-junctional hemichannels to probe

the possible role of such channels in ATP export. Carbenoxolone (CBX)

is one such widely used inhibitor of gap junction channels, hemichannels,

and ATP release, Although CBX blocks gap junction channels and non-

95 junctional hemichannels formed by both pannexins and connexins,

hemichannels formed by pannexins have been reported to be more

sensitive to CBX blockade (34). Pelegrin and Surprenant recently reported

that pannexin 1 is endogenously expressed in 1321N1 astrocytes and that

CBX-sensitive hemichannel activity (as assayed by fluorescent dye fluxes)

can be stimulated by extracellular ATP in 1321N1 cells engineered to

express heterologous P2X7 receptors (214). Although CBX markedly

inhibited PAR1- stimulated ATP release from 1321N1 cells (Fig. 7, 8A), I

was unable to correlate these effects with any pannexin-like hemichannel

activity as detected by thrombin-stimulated or CBX-inhibited ethidium

bromide uptake (Figure 3.8B). This does not unequivocally exclude the

possibility that hemichannels mediate ATP efflux because the difference in

charge between ethidium (+1) and ATP (-4) or MgATP (-2) could impact

movement via such channels. Another possibility is that the pore forming

ability of hemichannels is not required for ATP release, but rather that

pannexin or connexin proteins modulate release by other mechanisms

(213). CBX is also known to affect voltage-gated Ca2+ channels and

membrane potential via gap junction channel-independent mechanisms

(231, 280). Similarly, CBX may exert connexin/pannexin-independent

actions on the signal transduction pathways, other high conductance

channels (i.e. VSOAC) or membrane dynamics that regulate non-

conductive, exocytotic ATP release pathways (20). However, I did verify

96 that CBX treatment did not attenuate PAR1-stimulated Ca2+ mobilization

or Rho activation in 1321N1 astrocytes (Figure 3.8C-D).

In summary, our studies indicate that the coordinate induction of

Ca2+- and Rho-GTPase signals are required for maximal ATP release from

astrocytes and that this ATP export reflects in part the mobilization of

Golgi-derived transport vesicles. However, defining the mechanisms that

underlie the brefeldin-insensitive and carbenoxolone-sensitive

components of ATP release remains a challenging area of investigation.

97 Figure 3.1. PAR1 mediated ATP release is sensitive to BAPTA and

ToxB. A. Changes in stimulated extracellular [ATP] were recorded in

control cells () versus cells pre-treated with ToxB (), or BAPTA () as

described in METHODS. On-line ATP measurements were made every 2

minutes after addition of 3 μM TRAP in combination with 300 μM βγ-

meATP for 12 minutes and measured extracellular ATP concentration was

measured via an on-line luciferin / luciferase assay. Data represent the

mean + S.E. of three independent experiments performed in triplicate.

The differences between control and inhibitor treated groups (ToxB and

BAPTA) first became significant (*p < .05) at two minutes after addition of

PAR1 agonist. B: 1321N1 cells were treated with 300 μM βγ-meATP for

12 minutes followed by 10 nM Thrombin for 14 minutes. Extracellular ATP

concentration was measured via an on-line luciferin / luciferase assay.

Data represent the mean + S.E. of three independent experiments

performed in triplicate. The differences between control and the BAPTA

pretreated groups first became significant (*p < .05) at four minutes after

stimulation, while the differences between the control and the ToxB

pretreated groups reached #p < 0.07 at six minutes after stimulation. C:

Stimulation with 3 μM TRAP for 2 minutes leads to RhoA-GTP loading and

ToxB disrupts this process. Aliquots of lysate were subjected to Rhotekin

(TRBD)-RhoA-GTP pull down assays as described in METHODS and

Western blots (WB) were done using anti-RhoA antibody. The data is

representative of two separate experiments. D: Suspended 1321N1 cells

98 were loaded with fura2-AM and treated with 3 μM TRAP to determine that

ToxB-loading had no observable effect on elevations in cytosolic [Ca2+].

The data is representative of two separate experiments.

99 FIGURE 3.1

100 Figure 3.2 Rho-GTPase activity is correlated with thrombin induced

ATP release. A: Photographs were taken of serum-starved 1321N1 cells

maintained treated for 3 hours with 1:50 dilution of ToxB or treated for 6

hours with 2ug/mL C3. B: G-LISA was performed as described in

METHODS. Data represent the mean + S.E. of three independent

experiments in duplicate for Control and C3 groups and two independent

experiments in duplicate for ToxB. *p < 0.05 vs. thrombin treated control.

#p =.06 vs. thrombin treated control. C: 1321N1 cells were treated with

300 μM βγ-meATP for 15 minutes. A sample of the reaction media was

taken for a baseline [ATP] measurement (clear bars) and then cells were

treated with 10 nM thrombin for 15 minutes prior to removing a second

sample of the reaction media (dark bars). Extracellular ATP concentration

was measured via an off-line luciferin / luciferase assay as described in

METHODS. Data represent the mean + S.E. of four independent

experiments in triplicate. *p < 0.001 vs. thrombin treated control.

101 FIGURE 3.2

102

Figure 3.3 Inhibition of ROCKI/II and MLCK does not affect thrombin

induced ATP release. Cells were treated with 300μM βγ-meATP for 10

minutes then stimulated with 10 nM thrombin () or stimulated with 10 nM

Thrombin after 60 minutes pre-treatment with 10μM Y-27632 () or 1μM

ML-7 () as described in METHODS. Measurements were made every

two minutes using an on-line luciferin / luciferase assay. Data represent

the mean + S.E. of three independent experiments performed in triplicate.

103 FIGURE 3.3

104 Figure 3.4 Effects of ToxB and BAPTA-loading on ATP release from

1321N1 astrocytes in response to LPA and Carbachol. Changes in

stimulated extracellular [ATP] were recorded in control () cells versus

ToxB pre-treated (), or BAPTA pre-treated () cells as described under

METHODS. A: On-line ATP measurements were made every 2 minutes

after addition of 300 μM βγ-meATP concurrent with 10 μM LPA. The

differences between control and the BAPTA pretreated groups first

became significant (*p < .05) at two minutes after stimulation, while the

differences between the control and the ToxB pretreated groups became

significant (*p < 0.05) at four minutes after stimulus. B: On-line ATP

measurements were made every 2 minutes after addition of 300 μM βγ-

meATP concurrent with 100 μM carbachol. The differences between

control and the BAPTA pre-treated groups first became significant (*p <

.05) at two minutes after stimulus, while the deviation between the control

and the ToxB pretreated group became significant by ten minutes after

stimulus (*p < 0.05). Data for both panels represent the mean + S.E. of

three independent experiments performed in triplicate.

105 FIGURE 3.4

106 Figure 3.5 Rho-GTPase activity is correlated with LPA- but not

carbachol- induced ATP release. A,B: 1321N1 cells were treated with

300 μM βγ-meATP for 15 minutes. A sample of the reaction media was

taken for a baseline [ATP] measurement (clear bars) and then cells were

treated with 100 μM carbachol or 10 μM LPA for 15 minutes prior to

removing second sample of the reaction media (dark bars). Extracellular

ATP concentration was measured via an off-line luciferin / luciferase assay

as described in METHODS. Data represent the mean + S.E. of four

independent experiments in triplicate. *p < 0.01 vs. thrombin treated

control. #p < 0.05 vs. thrombin treated control. C: Suspended 1321N1

cells were loaded with fura2-AM and treated with 100 μM Carbachol or 10

μM LPA to determine that ToxB-loading had no observable effect on

elevations in cytosolic [Ca2+]. This experiment was performed once. D:

Stimulation with 10 μM LPA for 2 minutes leads to RhoA-GTP loading,

while stimulation with 100 μM carbachol does not. Aliquots of lysate were

subjected to Rhotekin (TRBD)-RhoA-GTP pull down assays as described

in METHODS and Western blots (WB) were done using anti-RhoA

antibody. The data are representative of two separate experiments.

107 FIGURE 3.5

108 Figure 3.6 Neither toxin treatment nor BAPTA affect extracellular

ATPase activity. A,B: Exogenous ATP (100 nM) was added at time = 0

minutes to control (), or 1321N1 cells pre-treated with toxB (), C3 ()

or BAPTA (). Extracellular [ATP] was recorded every two minutes using

an on-line luciferin / luciferase assay. Data represent the mean + S.E. of

three independent experiments performed in triplicate.

109 FIGURE 3.6

110 Figure 3.7 ATP release is attenuated by brefeldin A and

carbenoxolone but not glycylphenylalanine-2-napthylamide.

Extracellular [ATP] was measured in cell monolayers treated with βγ-

MeATP (300μM) alone, or βγ-MeATP added concurrently with thrombin

(10 nM) for 15 minutes. Where indicated, cells were pre-treated with the

following inhibitors prior to the ATP release assay: CBX (100μM) for 30

minutes, BFA (5μg/mL) for 2 hours, and GPN (200μM) for 15 minutes.

Off-line ATP measurements were made using a luciferin / luciferase assay

as described in METHODS. ATP release values were normalized to

thrombin-stimulated ATP export measured in the absence of

pharmacological inhibitors. Data represent the mean + S.E. of three

independent experiments performed in triplicate. *p < 0.05 vs. thrombin

treated control.

111 FIGURE 3.7

112 Figure 3.8 CBX inhibition of thrombin-stimulated ATP release is not

correlated with changes in hemichannel activity or PAR1 signaling.

A: Changes in stimulated extracellular [ATP] were recorded in control cells

() versus cells pre-treated with 0.1μM CBX (), 1μM CBX (), 10μM

CBX (), or 100μM CBX () for 30 minutes. Βγ-MeATP (300μM) was

added 12 minutes prior to thrombin (10 nM). On-line ATP measurements

were made every 2 minutes as described in methods via an on-line

luciferin / luciferase assay as described in METHODS. The differences

between control and CBX (100μM) pretreated groups first became

significant (*p < .05) at four minutes after stimulation. Data represent the

mean + S.E. of three independent experiments performed in triplicate. B:

Suspended 1321N1 cells were incubated in BSS supplemented with

ethidium bromide (20μM) as described in METHODS prior to the addition

of thrombin (10 nM). Experiments were terminated by the addition of

digitonin to permeabilize cells. The data is representative of two separate

experiments. C: G-LISA was performed as described in METHODS.

Data represent one independent experiment in duplicate. D: Suspended

1321N1 cells were loaded with fura2-AM as described in METHODS.

100μM CBX was added 30 minutes prior to thrombin (10 nM) addition.

The data are representative of two separate experiments.

113 FIGURE 3.8

114

CHAPTER 4:

Extracellular Osmolarity Modulates G protein-Coupled Receptor

Dependent ATP Release from 1321N1 Astrocytes

Portions of this chapter have been published as part of

Blum et al. Am J Physiol Cell Physiol. 2009 Nov 11. [Epub ahead of print]

Extracellular Osmolarity Modulates G protein-Coupled Receptor

Dependent ATP Release from 1321N1 Astrocytoma Cells.

115 ABSTRACT:

ATP release from 1321N1 human astrocytoma cells can be

stimulated either by activation of G protein-coupled receptors (GPCR) or

hypotonic stress. In this study, the hypothesis that a VSOAC-type

permeability might comprise a GPCR-regulated pathway for ATP export

was tested by determining whether PAR1-sensitive ATP release from

1321N1 cells is similarly potentiated by hypotonicity but suppressed by

hypertonic conditions. Strong hypotonic stress (35% decrease in

osmolarity) by itself elicited ATP release and positively modulated the

response to thrombin. Thrombin-dependent ATP release was also

potentiated by mild hypotonic stress (10-25% decrease in osmolarity) that

by itself did not stimulate ATP export. Notably, PAR1-sensitive ATP

export was greatly inhibited in hypertonic medium. Neither the potency

nor efficacy of thrombin as an activator of proximal PAR1 signaling was

affected by hypotonicity or hypertonicity. 1,9-dideoxyforskolin (ddF), and

carbenoxolone (CBX) similarly attenuated PAR1-dependent ATP release

and suppressed the PAR1-independent ATP elicited by strong hypotonic

stress. Probenecid (PB) attenuated PAR1-stimulated ATP release under

isotonic but not mild hypotonic conditions and had no effect on PAR-1

independent release stimulated by strong hypotonicity. PAR1-dependent

ATP export requires concurrent signaling by Ca2+ mobilization and Rho-

GTPase activation. In contrast, PAR1-independent ATP release triggered

by strong hypotonicity required neither of these intracellular signals. Thus,

116 I provide the new finding that GPCR-regulated ATP release from 1321N1

astrocytoma cells is remarkably sensitive to both positive and negative

modulation by extracellular osmolarity. This supports a model wherein

GPCR stimulation and osmotic stress converge on an ATP release

pathway in astrocytes which exhibits several features of VSOAC-type

channels.

117 INTRODUCTION:

Regulated release of ATP occurs in most tissues and contributes to

complex autocrine / paracrine signaling networks by activating members

of the P2 receptor family (41, 107). Intracellular ATP can be released to

extracellular compartments by multiple mechanisms that include lysis due

to traumatic injury or regulated exocytosis of ATP-containing vesicles

(157). However, most mammalian cell types exhibit an increased rate of

non-lytic, non-exocytotic ATP release in response to various mechanical

stimuli including direct deformation of the surface membrane,

physiological fluid shear stress, hypotonic stress-induced swelling, or

agonists for G protein-coupled receptors that activate membrane-

cytoskeletal rearrangements. Mechanical stress-triggered ATP release

from multiple cell types has been mechanistically linked to the efflux of

cytosolic ATP pools via three distinct types of nucleotide-permeable

channels: 1) volume-regulated anion channels (VRAC) (118, 203) 2) maxi-

anion channels (77, 167, 233, 234) or 3) hemichannels (253) composed of

connexin (57) or pannexin subunits (126, 168, 225)

VRAC, also known as volume-sensitive outwardly rectifying anion

channels (VSOR) or volume-sensitive organic osmolyte and anion

channels (VSOAC), comprise a widely expressed, but molecularly

undefined, channel activity that gradually develops within the first few

minutes after the initial cell swelling in response to hypotonic stress

(reviewed in (193, 203)). It is an outwardly rectifying, anion-selective

118 current with a single channel conductance of 30-70 pS and an open-state

pore of ~1.1 nm sufficiently large to accommodate ATP4- or MgATP2- (0.6-

0.65 nm radius). Increased VRAC electrophysiological activity triggered

by hypotonic stress is strongly correlated with the efflux of larger organic

osmolytes, such as taurine and inositol. However, there is growing

evidence that VRAC and volume-sensitive organic osmolyte and anion

channels (VSOAC) may represent distinct permeability pathways that are

coordinately activated by a common network of upstream signals and

suppressed by an overlapping group of pharmacological inhibitors (120).

Like VRAC/VSOAC, maxi-anion channels comprise a widely expressed,

molecularly undefined, mechanosensitive permeability pathway for

inorganic and organic anions (reviewed in (235)). They are characterized

by a single channel conductance of 200-400 pS and a pore diameter of

~1.3 nm. Finally, hemichannels composed of pannexin 1 or certain

connexins (connexin 43, connexin 32, connexin 37) have emerged as

strong candidates for ATP release channels (13, 57, 63, 168, 169, 229,

268, 290). Although connexins are generally associated with the

transcellular movement of molecules through gap junction channels,

connexin (and pannexin) hemichannels at non-junctional membrane sites

can also be gated to the open state by diverse stimuli. In contrast to

VRAC/VSOAC and maxi-anion channels, hemichannels are also

permeable to inorganic and organic cations, including ethidium+ and

propidium+ dyes. The role of Panx1 hemichannels as ATP release

119 conduits has received particular attention given their widespread

expression and susceptibility to activation by hypotonicity, direct

mechanical stress, membrane depolarization, and increased cytosolic

Ca2+ (13, 168, 169, 225).

Although VRAC/VSOAC, maxi-anion channels, and hemichannels

have been investigated in various cell types, many studies have utilized

astrocytes as an experimental model. Astrocytes utilize non-exocytotic

conductive mechanisms to release a range of so-called ‘gliotransmitters”

including excitatory amino acids, such as glutamate, aspartate, and

serine, which act as paracrine and autocrine modulators of nearby

neurons, microglia, astroglia, and neurovascular cells. Gliotransmitters

also include ATP released from different astrocyte models and this ATP

release has been ascribed to either maxi-anion channels or hemichannels,

but not VRAC/VSOAC (57, 126, 140, 163, 166, 167). In contrast, there is

considerable experimental support for VRAC/VSOAC as a major

astrocytic pathway for the release of excitatory amino acids in response to

strong hypotonic stress per se or to the activation of various G protein-

coupled receptors (GPCR) under isotonic or mildly hypotonic conditions

(165, 184, 185, 224, 264).

The possible convergence of osmotic regulatory responses and

GPCR signaling at the level of VRAC/VSOAC function and ATP export in

astrocytes has not been directly investigated. However, in previous

studies I have reported that thrombin activation of PAR1 (protease-

120 activated receptor-1) causes ATP release from 1321N1 astrocytoma cells

under isotonic conditions and that PAR1 activation synergizes with

hypotonic stress to elicit even greater ATP release (24, 137). This ability

of PAR1 to induce robust ATP export required coordinate coupling to

2+ GqPLCCa and G12/13RhoGEFRho GTPase signaling pathways

known to modulate membrane/cytoskeletal interactions. 1321N1 cells are

extensively used as a model system for characterizing intracellular

signaling pathways and integrated cellular responses triggered by a wide

range of GPCR agonists that regulate similar functions in primary

astrocytes. Thrombin, acting via PAR1, stimulates similar VRAC/VSOAC-

mediated increases in amino acid permeability in primary astrocytes (224)

and 1321N1 cells (50). 1321N1 cells present an additional advantage for

analysis of the signaling mechanisms that couple GPCR to VRAC/VSOAC

activation (or other GPCR-regulated permeability pathways) because they

lack endogenous expression of G protein-coupled P2Y receptors. This is

germane because P2Y receptors also activate VRAC/VSOAC in primary

astrocytes and other cell types (161, 184, 185, 232). Thus, ATP released

in response to hypotonic stress or other GPCR agonists can act as an

autocrine modulator or amplifier of VRAC/VSOAC and volume regulatory

responses.

That ATP release from 1321N1 cells can be triggered by GPCR

activation or hypotonic stress does not distinguish between hemichannels,

maxi-anion channels, or VRAC/VSOAC as potential ATP conduits

121 because each of these conductance pathways can be activated by

reduced extracellular osmolarity (13, 14, 77, 167, 195, 225). Likewise, the

use of small molecule inhibitors is complicated by the often overlapping

actions of these reagents on the three channel families. Notably, the

functional interaction between GPCR signaling and VRAC/VSOAC activity

is distinguished by two critical features. 1) GPCR activation increases the

efficacy of hypotonic stress stimulation to induce VRAC/VSOAC-mediated

osmolyte and excitatory amino acid efflux in a graded manner depending

on the magnitude of the hypotonic stress, such that significant efflux is

induced even when cells are in isotonic medium. 2) GPCR activation

induces no or only minor osmolyte and excitatory amino acid efflux in the

absence of a permissive or “licensing” signal from a threshold amount of

osmotic stress (49, 50, 114, 159, 165, 184).

Thus, hypertonic extracellular medium can be used as an

alternative to pharmacological reagents to suppress GPCR-triggered

VRAC/VSOAC responses. Fisher and colleagues observed that thrombin

was able to stimulate taurine efflux from 1321N1 astrocytes under isotonic

conditions and that this PAR1-dependent osmolyte release was greatly

increased under hypotonic conditions. Conversely, PAR1-dependent

osmolyte release was abolished in hypertonic medium which causes cell

shrinkage rather than swelling (50). In this study, I tested the hypothesis

that a similar positive and negative modulation of PAR1-dependent ATP

release by hypotonic versus hypertonic conditions might be observed if

122 VRAC/VSOAC comprises a quantitatively significant ATP efflux pathway

in 1321N1 cells. Other experiments compared the effects of

pharmacological inhibitors of VRAC/VSOAC, maxi-anion channels, and

hemichannels. Our major new finding is that thrombin-stimulated ATP

release is remarkably sensitive to extracellular osmolarity. Taken

together, the observations support a model wherein GPCR stimulation and

osmotic stress converge on an ATP release pathway which exhibits

several features of VRAC/VSOAC-type channels.

123 RESULTS:

Extracellular osmolarity modulates thrombin-dependent ATP release

from 1321N1 astrocytes

Activation of PAR1 or exposure to hypotonic stress causes ATP

release from 1321N1 astrocytes and that PAR1 activation in combination

with hypotonic stress leads to greater ATP release than elicited by either

stimulus alone (24, 137). However, these prior studies did not test how

the opposite osmotic perturbation – hypertonicity – might modulate PAR1-

regulated ATP export. Figure 4.1 compares the kinetics of basal versus

thrombin-stimulated ATP release in isotonic (320 mOsm, Figure 4.1A)

versus hypertonic (380 mOsm, Figure 4.1B) media. Consistent with our

previous findings, thrombin (10 nM) rapidly stimulated a time-dependent

release of ATP under isotonic conditions that was near-maximal at 10

minutes following thrombin addition (Figure 4.1A). Notably, this response

to thrombin was completely suppressed at all time points when 1321N1

astrocytes were bathed in hypertonic medium (Figure 4.1B).

I further defined the modulation of PAR1-stimulated ATP release by

extracellular osmolarity by comparing the magnitudes of thrombin-

independent versus thrombin-dependent ATP accumulation (assayed at

10 min post-stimulation) over a broad range of osmotic conditions (Figure

4.2A). In the absence of thrombin, extracellular ATP accumulation was

similarly very low (> 5 nM in 10 min) in hypertonic, isotonic, and

moderately hypotonic (250-300 Osm) media and increased ATP release

124 was induced only by severe hypotonicity (<250 mOsm). No significant

thrombin-induced ATP release was observed when cells were bathed in

strongly (380 mOsm) or moderately hypertonic (350 mOsm) salines. This

contrasted with the ~8 fold increase in thrombin-stimulated ATP release in

isotonic saline and this progressive potentiation of ATP export response

by decreasing extracellular osmolarity. Because the hypertonic salines

were generated by increasing extracellular NaCl concentrations, the

possibility exists that increased ionic strength, rather than increased

osmolarity, was the cause of the markedly attenuated ATP release

response to thrombin. However, an identical suppression was observed

when mannitol was used to generate the hypertonic 380 mOsm test saline

(Figure 4.2B).

The experiments in Figures 4.1 and 4.2 were performed using 10

nM thrombin which were previously demonstrated as the maximally active

concentration for stimulation of ATP release under isotonic conditions

(137). I further characterized the concentration-response relationships

describing thrombin (15 pM-15 nM) stimulation of ATP release in 1321N1

cells bathed in moderately hypotonic (250 mOsm), isotonic (320 mOsm),

or hypertonic (380 mOsm) salines (Figure 4.3A). The major changes were

a marked increase in thrombin efficacy by hypotonic stress over the entire

range of thrombin concentrations. Hypertonic conditions effectively

suppressed PAR1-dependent ATP release over the entire range of tested

thrombin concentrations. Thrombin-induced ATP efflux was a maximal at

125 ~5 nM in isotonic saline versus 1.5 nM in hypotonic saline. The EC50 was

~1.5 nM under isotonic conditions versus ~500 pM for the hypotonic

medium. Taken together, these data indicate that the potency and

efficacy of thrombin as an ATP secretagogue varies inversely with the

extracellular osmolarity (Figure 4.1-4.3).

Most of our experiments involved simultaneous stimulation by

altered osmolarity and thrombin for 10 min following a 30 minute

preincubation in isotonic BSS. I additionally measured thrombin-

dependent ATP release in 1321N1 cells which were preincubated for 30

minutes in the hypertonic 380 mOsm, isotonic 320 mOsm, or hypotonic

250 mOsm salines before being stimulated by various concentrations of

thrombin for an additional 10 min (Figure 4.4). Similar osmolarity-induced

changes in thrombin efficacy and potency as an ATP release stimulus

were observed under these experimental conditions. This suggests that

the positive and negative modulatory effects of hypotonic versus

hypertonic status on PAR1-dependent ATP release reflect stably

maintained changes in the coupling of these receptors to the downstream

ATP release machinery. However, an alternative possibility is that the

altered osmotic conditions modulate the ability of thrombin to trigger the

upstream signals (increased Ca2+, Rho-GTPase activation) required for

activation of the downstream ATP release pathways (24, 137). I

compared the concentration-response relationships for thrombin-

dependent changes in intracellular Ca2+ mobilization in cells bathed in

126 moderately hypotonic (250 mOsm), isotonic (320 mOsm), or hypertonic

(380 mOsm) salines. The EC50 values (~50 pM) and the peak magnitudes

of the Ca2+ transients were identical in the three groups of cells (Figure

4.3B). These observations established that PAR1 activation and its

coupling to proximal second messenger pathways was not affected by

changes in extracellular osmolarity,

Rho-GTPase activation and Ca2+ mobilization are required for

stimulation of ATP release in response to PAR1 activation but not

strong hypotonic stress

Our previous studies established that activation of thrombin-

dependent ATP release from 1321N1 cells in isotonic saline requires

coincident input from Rho-GTPase signals and increased cytosolic Ca2+.

Therefore, I investigated the roles of these second messengers in the ATP

release responses to strong hypotonic stress in the absence of thrombin,

or to co-stimulation by thrombin and modest hypotonic stress, by pre-

treating cells with either BAPTA-AM for 60 minutes or Clostridial difficile

toxin B (ToxB) for 4 hours before stimulation. BAPTA buffering blunts the

increases in cytosolic Ca2+ triggered by PAR1 while ToxB glucosylates

Rho family GTPases and prevents their activation by upstream PAR1-

regulated GTP/GDP exchange factors. BAPTA produced similar 72, 62,

and 60% decreases in thrombin-activated ATP release in isotonic, mild

hypotonic, and strong hypotonic salines, respectively, but had no effect on

127 the thrombin-independent ATP efflux induced by strong hypotonic stress

(Figure 4.5A). Likewise, ToxB caused 56, 54, and 64% reductions in

PAR1-dependent ATP release under isotonic, mild hypotonic, and strong

hypotonic conditions, respectively, while producing no inhibition of the

response to strong hypotonicity (Figure 4.5B).

Comparative effects of VRAC/VSOAC, hemichannel, and maxi-anion

channel inhibitors on ATP release responses to PAR1 activation or

strong hypotonic stress

The strong inhibitory effect of hypertonicity on thrombin-induced

ATP release is very similar to its suppressive action on GPCR-dependent

release of organic osmolytes and excitatory amino acids described in

previous studies of astrocyte VRAC/VSOAC function. I also compared

the effects of the VRAC/VSOAC inhibitor 1,9-dideoxyforskolin (ddF) on the

ATP release responses to PAR1-activation in isotonic and mild hypotonic

salines (Figure 4.6A) versus exposure to strong hypotonic stress (Figure

4.6B). Notably, ddF attenuated thrombin-dependent and thrombin-

independent ATP release with similar efficacy (maximal ~68% inhibition)

and potency (IC50 ~50 μM) regardless of the osmotic conditions.

I next tested the effects of carbenoxolone (CBX) on the ATP

release responses under isotonic and mildly hypotonic conditions (Figure

4.6C) versus strong hypotonic stress (Figure 4.6D). Although CBX is a

widely used inhibitor of connexin and pannexin based hemichannels, it

128 also blocks VRAC currents and VSOAC-mediated export of organic

osmolytes in astrocytes (20, 296) CBX attenuated thrombin-dependent

and thrombin-independent ATP release with similar efficacy (maximal

~66% inhibition) and potency (IC50 ~50 μM) regardless of the osmotic

conditions.

Another set of experiments characterized the effects of probenecid

(PB), an efficacious inhibitor of Panx-1 hemichannel function (54), on the

ATP release responses to PAR1-activation in 1321N1 cells. I observed no

inhibitory effect of PB (0.1 – 3 mM) on ATP efflux from 1321N1 cells

challenged by strong hypotonicity (Figure 4.7B). In contrast, PB produced

a dose-dependent attenuation (IC50 ~1.3 mM, ~55% maximal efficacy) of

thrombin-stimulated ATP release under isotonic conditions (Figures 4.7A

and 4.7C). PB (2.5 mM) did not inhibit thrombin-induced Ca2+ mobilization

(Figure 4.7D). Surprisingly, the inhibitory action of PB (2 mM) on PAR1-

dependent ATP release was not observed when 1321N1 cells were

bathed in progressively hypotonic salines that positively modulated

thrombin-triggered ATP efflux (Figure 4.7C).

Finally, I compared the effects of Gd3+, an inhibitor of maxi-anion

channels, on the ATP release responses to PAR1-activation in isotonic

saline (Figure 4.8A) and exposure to strong hypotonic stress (Figure

4.8B). 50 μM Gd3+, a concentration which inhibits swelling-induced ATP

release in other astrocyte models (166, 167), had no effect on ATP

release from 1321N1 cells in response to strong hypotonic stress or

129 PAR1-activation. Taken together with the strong inhibitory effect of

hypertonicity, these pharmacological experiments support the hypothesis

that VRAC/VSOAC-type permeability pathways may mediate the

increased ATP release elicited by thrombin-dependent and thrombin

independent stimuli in the 1321N1 astrocytoma model.

130 DISCUSSION:

This study demonstrates that GPCR-regulated ATP release in

1321N1 astrocytes is an osmotically-sensitive response wherein

hypertonic stress suppresses and hypotonic stress potentiates PAR1-

stimulated ATP export in the absence of effects on receptor activation and

downstream Ca2+ mobilization (Figures 4.1-4.3). Importantly, the

observed attenuation of thrombin-dependent ATP release by hypertonic

conditions is very similar to the previously established hypertonic

suppression of thrombin-stimulated taurine efflux in the 1321N1 cell model

(50). Other studies have shown that hypertonicity suppresses, and

hypotonicity potentiates, P2Y receptor-induced release of aspartate from

rat primary astrocytes (184, 185) and B2-bradykinin receptor receptor-

activated glutamate release from mouse primary astrocytes (165); both of

these latter responses have been ascribed to VRAC/VSOAC activation.

Notably, glutamate efflux from primary mouse astrocytes is stimulated by

thrombin-activated PAR1 under isotonic conditions and this response is

further potentiated by mild hypotonicity. Thus, our data indicate that

GPCR-dependent ATP release from astrocytes involves mechanisms that

appear to be common to the GPCR-dependent release of other

gliotransmitters and organic osmolytes. Our pharmacological studies also

support, but do not prove, a role for VRAC or VSOAC, rather than

connexin / pannexin hemichannels or maxi-anion channels, as the conduit

for GPCR-stimulated ATP release from 1321N1 human astrocytoma. This

131 conclusion is necessarily tentative given: 1) the modest and often

overlapping selectivity of the existing pharmacological probes for

VRAC/VSOAC, maxi-anion channels, and hemichannels; and 2) the

molecularly undefined nature of VRAC. .

VRAC/VSOAC exhibit several characteristics required of

osmotically sensitive ATP release pathway because they are widely

expressed, permeable to organic metabolites, and develop an outwardly

rectifying current (single channel conductance of 30-70 pS at +120 mV)

within minutes in response to hypotonic stress (193, 259). However, it is

important to stress that the electrophysiologically defined VRAC Cl-

conductance and the VSOAC that mediate the efflux of the organic

osmolytes taurine and inositol, as well as the excitatory amino acids, may

represent distinct permeability pathways with overlapping regulation and

pharmacology (120). VRAC-mediated Cl- currents are inhibited in the

presence of extracellular nucleotides (at millimolar concentrations)

indicating that nucleotides can enter the permeability pore of the channels

(70). Furthermore, several intracellular signaling pathways and second

messengers, while not required for VRAC/VSOAC activation, modulate

VRAC/VSOAC activity either by reducing the threshold for activation by

hypotonic stress or by increasing the conductance of the gated channels.

Significantly, these signaling systems include Rho-GTPase and

phospholipase C (PLC). This is consistent with the notion that PAR1-

dependent stimulation of these two pathways triggers ATP release by

132 reducing the threshold for VRAC/VSOAC gating by osmotic stress and/or

increasing the intrinsic ATP permeability of gated VRAC/VSOAC (Figure

4.3A) (203). Similar to PAR1-dependent ATP release from 1321N1

astrocytes, GPCR-dependent ATP release and volume-sensitive ATP

release from endothelial cells (HUVEC) and from A549 airway epithelial

cells is synergistically controlled by Rho-GTPase activation and Ca2+

mobilization (149, 247). Although the second messengers controlling ATP

release in response to either GPCR activation or hypotonic stress overlap

in those endothelial and epithelial systems, they do not overlap in 1321N1

cells (Figure 4.5). Indeed, I found that the ability of strong hypotonic stress

induced ATP release from these astrocytes was independent of these two

signaling pathways (Figure 4.6). Several factors may underlie these

divergent effects of Rho-GTPase and Ca2+ as modulators of hypotonic

stress-induced ATP release in these two cell types. One likely factor is a

difference in the contribution of autocrine P2 receptor activation by initially

released ATP with consequent induction of a secondary phase of ATP-

induced ATP release. 1321N1 astrocytes are notable because they lack

endogenous P2Y receptor expression (207). In contrast, autocrine P2Y

receptor induced ATP release accounts for over 80% of the total ATP

release triggered by hypotonic stress stimuli in A549 cells. This

secondary ATP-induced ATP release may involve both Ca2+-dependent

exocytotic mechanisms and induction of additional nucleotide permeability

pathways (266, 267). Notably, addition of apyrase to A549 cells

133 stimulated by thrombin partially attenuates inositol phosphate production

in response to PAR activation (247). Thus, 1321N1 cells provide a unique

and useful model system for studying the coupling of hypotonic stress

signals to ATP release channels in the absence of confounding signals

from autocrine G protein-coupled P2Y receptors. While the hypotonic

stress and PAR1 stimuli in 1321N1 cells are transduced by different

signaling pathways, it is likely that the two stimuli overlap in their activation

of a common ATP release conduit because the two stimuli together exert

a synergistic rather than simply additive response. Moreover, both the

Ca2+ and Rho-GTPase second messengers are known to modulate

VRAC/VSOAC activities (120, 203).

The ATP release pathway elicited by PAR1 activation and

hypotonic stress in 1321N1 cells exhibited a pharmacologic profile

consistent with an involvement of VRAC/VSOAC. VRAC-mediated Cl-

currents and VSOAC-mediated release osmolytes and excitatory amino

acids are sensitive to inhibition by a broad range of reagents including

ddF, flufenamic acid (FFA), and CBX, but excluding Gd3+ (3, 20, 81, 195).

The observed Gd3+ insensitivity of the ATP release responses in 1321N1

cells argues against a likely role for maxi-anion channels in this model

(Figure 4.9A,B) (166, 167, 235). In contrast, the pharmacologic profile of

both basal and thrombin stimulated ATP release was similar with respect

to the non-selective VRAC/VSOAC inhibitors ddF and CBX (Figures 4.6A-

D). ddF, which is an inactive analogue of forskolin with respect to adenylyl

134 cyclase activation, blocks volume-sensitive anion currents carried by the

molecularly undefined VRAC channels, the VSOAC-mediated release of

organic osmolytes, and – as demonstrated for the first time in this report –

ATP (195, 242). To our knowledge, ddF has not been directly investigated

as a hemichannel blocker. However, 50 μM ddF did not mimic the ability

of forskolin (acting as an adenylyl cyclase activator) to decrease gap

junction channel coupling in neural cells (303). It is important to

emphasize that the 50 μM IC50 characterizing the inhibitory effect of CBX

on both PAR1- and hypotonicity-induced ATP release from 1321N1 cells

(Figure 4.6) is higher than the 2-5 μM IC50 values reported for the

suppressive effects of CBX on the ionic currents carried by Panx1

hemichannels expressed in Xenopus oocytes (34) or HEK293 cells (173).

Moreover, 10 μM CBX was sufficient for near-total blockade of Panx1

dependent ATP release responses in airway epithelial cells (173, 225). A

limitation of our study is that I did not determine whether thrombin-

stimulated ATP release was directly correlated with PAR1 activation of

bona fide VRAC ionic currents in 1321N1 cells. However, Cheema et al

used identical experimental conditions to demonstrate that PAR1

regulation of volume-sensitive taurine efflux from 1321N1 cells exhibited a

pharmacological profile characteristic of VSOAC (50).

Because the use of CBX as a probe of Panx-1 or other connexin-

based hemichannels is complicated by its overlapping inhibitory effects on

VRAC/VSOAC-type conductances (20, 226, 296), I also tested the effects

135 of probenecid (PB) which is a highly efficacious inhibitor of Panx1

currents and Panx1-dependent ATP release in other cell models (173,

225). Although PB alters the excretion of many compounds (e.g., uric

acid) from the kidney through its action on organic anion transporters, it

also blocks Panx-, but not connexin- based hemichannels (252). Notably,

recent studies used both siRNA knockdown and PB-mediated blockade to

demonstrate an important role for Panx1 hemichannels in the ATP release

responses of human airway epithelial cells to strong hypotonic stress

(225) or thrombin stimulation (via PAR3 rather than PAR1) (247). Effects

of PB on VRAC/VSOAC or maxi-anion channels have not been reported.

I found that PB did not block ATP release elicited by strong hypotonic

stress in 1321N1 cells. This stands in contrast to findings in airway

epithelia wherein PB markedly attenuates hypotonicity-induced ATP

release and mimics the actions of Panx1 siRNA treatment (225). Thus, it

appears unlikely that Panx1 hemichannels play a major role in hypotonic

stress-stimulated ATP release in the 1321N1 cell model. However, PB did

attenuate thrombin-induced ATP efflux from the 1321N1 cells (Figure 4.6)

but with an IC50 of 1.3 mM that was higher than the 150-350 μM IC50

values reported for the suppressive effects of PB on recombinant Panx1

hemichannel currents in Xenopus oocytes (252) or HEK293 cells (173).

Importantly, there was no obvious effect of 2.5 mM PB on thrombin-

induced Ca2+ mobilization (Figure 4.7D).

136 I initially expected that Panx1 hemichannels would comprise the

major GPCR-dependent ATP release pathway in the 1321N1 model given

the role for this pathway in other cell types and because 1321N1 cells

express Panx1 mRNA ((214) and our data not shown). Pelegrin and

Surprenant also found that natively expressed Panx1 hemichannels

mediated ATP-stimulated YoPro dye influx in 1321N1 cells engineered to

express recombinant P2X7 receptors (214). Panx1 hemichannels provide

the major conduit for the ATP release stimulated by P2X7 receptor

activation in primary mouse astrocytes (126). However, our observations

regarding the inhibitory actions of CBX and PB on thrombin-stimulated or

hypotonic stress-stimulated ATP release from these astrocytoma cells

were clearly different – with regard to potencies and efficacies – from the

inhibitory effects of these reagents on molecularly defined Panx1

hemichannel activities in other cell types. I also found that the potency

and efficacy of PB as an inhibitor of thrombin-stimulated ATP release was

greatly reduced when the 1321N1 cells were bathed in mildly hypotonic

medium (Figure 4.3A). The reason for this loss of PB efficacy under

hypotonic conditions is unclear but may reflect conformational changes in

the ATP release channel (or channel complex) by swelling-associated

changes in membrane organization or by reduced ionic strength.

Regardless of mechanism, our atypical findings regarding CBX and PB

action in 1321N1 cells are difficult to reconcile with canonical Panx1

hemichannel function in the observed GPCR-dependent ATP release.

137 This is further supported by our previous observation that thrombin-

triggered ATP efflux was not correlated with influx of ethidium+ dye; this is

inconsistent with the permeability of conventional Panx1-based

hemichannels to small (<900 Da) organic cations (24).

The pharmacological and permeability characteristics of Panx1

hemichannels may vary with cellular background due to the interaction of

Panx1 with other membrane proteins. Bunse et al recently reported that

the efficacies and potencies of CBX and PB as inhibitors of recombinant

Panx1 hemichannel currents were markedly attenuated when Panx1 was

co-expressed with the potassium channel subunit Kvβ3 (37). Thus, it

remains possible that the osmotically sensitive, GPCR-gated ATP release

channels in 1321N1 cells (and other cell types) are comprised of Panx1

hemichannels complexed with other modulatory proteins. The molecular

compositions of VRAC, VSOAC, and maxi-anion channels have remained

undefined despite significant efforts to identify candidate gene products. It

is tempting to speculate that these functionally defined conductance

pathways may be composed of Panx hemichannels in cell-type specific

combinations with other membrane proteins or signaling proteins. This is

an important experimental question for future studies.

The observed sensitivity of PAR1-dependent ATP release to the

osmotic status of 1321N1 astrocytes is remarkably similar to that

characterizing the effects of PAR1on taurine efflux from 1321N1 cells

(50) and glutamate efflux from primary mouse astrocytes (224). As

138 demonstrated for ATP release, increased Ca2+ mobilization was also a

requisite signal for taurine release in response to PAR1 activation but not

strong hypotonic stress alone. Ca2+ mobilization in response to thrombin

results from a Gq  PLC signaling cascade shown to affect regulatory

volume decrease (RVD) responses in astrocytes (19, 218). A common

and defining feature of the ATP release and taurine release responses

was that GPCR activation induced only minor efflux of these organic

anions in the absence of a permissive or licensing signal from a threshold

amount of osmotic stress. The mechanism whereby osmotic stress and

consequent volume perturbation is transduced to the gating of

VRAC/VSOAC or other osmotically-sensitive channels is poorly

understood (203) However, subtle cell swelling- or shrinkage-induced

changes in the sub-plasma membrane cytoskeleton or organization of

cytoskeletal-membrane lipid- channel protein complexes have been

proposed (120, 148). This is certainly consistent with the roles of Ca2+

and Rho-GTPase as major 2nd messengers in the modulation of

VRAC/VSOAC function and PAR1-activated ATP release from 1321N1

cells.

In summary, I conclude that the thrombin-dependent ATP release

pathway from 1321N1 cells is remarkably sensitive to osmotic conditions

and, by implication, to cell volume. Our results add to a growing literature

describing ATP release from different cell model systems in response to

various types of mechanical stimuli and support the involvement of

139 multiple, mechanistically distinct ATP release pathways with overlapping

pharmacology and regulation. Regardless of the molecular conduit for

ATP release, the observed synergy between GPCR activation and

hypotonic stress in regulating that response has likely physiological

significance. One role of extracellular ATP is to accelerate cellular volume

correction in response to changes in extracellular osmolarity. For

example, autocrine activation of P2 receptors in astrocytes, hepatocytes,

or airway epithelial cells by endogenous ATP released in response to

hypotonic stress accelerates the efflux of Cl- and organic osmolytes that

facilitate RVD responses. Scavenging of extracellular ATP by added

nucleotidases or blockade of P2 receptors during exposure to hypotonic

stress can interrupt these purinergic autocrine loops and attenuate cell

volume recovery from swelling (55, 64, 91, 160, 161, 177, 200, 283, 299).

Protease-activated receptors and other sensors of local tissue damage/

stress can modulate brain injury. Low concentrations of thrombin have

been shown to attenuate brain cell death elicited by a number of different

insults that result in cell swelling in vitro and in vivo (293). Our

observation that PAR1-dependent ATP release was progressively

potentiated by graded reductions in extracellular osmolarity, but markedly

suppressed by increased extracellular osmolarity, may have important

implications for the physiologic regulation of brain volume and response to

injury.

140 Table 4.1 Osmolarities and [NaCl] of basal salt solutions used in ATP

release experiments. 1321N1 cell monolayers in 24-well plates were

allowed to equilibrate for 30-45 minutes in 250 μL isotonic 320 mOsm BSS

at 37oC and then rapidly switched to test solutions with altered osmolarity

by removal of 100 μL of the isotonic BSS and replacement with 100 μL of

modified BSS with different [NaCl] to regenerate a final test volume of 250

μL BSS with the indicated osmolarity and [NaCl].

141 TABLE 4.1 Osmolarities and [NaCl] of basal salt solutions used in

ATP release experiments

Osmolarity / Volume: Volume: [NaCl]:

[NaCl]: Final Test Replacement Replacement

Final Test BSS BSS BSS

BSS

215 mOsm / 250 μl 100 μl 0 mM

78 mM

250 mOsm / 250 μl 100 μl 43 mM

95 mM

285 mOsm / 250 μl 100 μl 87 mM

113 mM

320 mOsm / 250 μl 100 μl 130 mM

130 mM

350 mOsm / 250 μl 100 μl 168 mM

145 mM

380 mOsm / 250 μl 100 μl 205 mM

160 mM

142 Figure 4.1 Kinetics of basal and thrombin-stimulated ATP release

from 1321N1 astrocytes in isotonic or hypertonic media. Time

courses of ATP release in the presence () versus absence () of 10 nM

thrombin in 1321N1 cells bathed in A: 320 mOsm isotonic or B: 380

mOsm hypertonic BSS. Data represent the mean + S.E. of four

independent experiments performed in duplicate; *p < .05.

143 FIGURE 4.1

144 Figure 4.2 Basal and thrombin-stimulated ATP release from 1321N1

astrocytes is inversely correlated with extracellular osmolarity. A:

Extracellular ATP at 10 min following transfer to BSS with the indicated

osmolarities in the absence () or presence () of 10 nM thrombin. Data

represent the mean + S.E. of four independent experiments performed in

duplicate; *p < .05. B: Basal and thrombin-activated ATP release in

isotonic 320 mOsm saline or 380 mOsm hypertonic BSS generated by

addition of 60 mM mannitol or 30 mM NaCl. Data represent the mean +

S.E. of eight independent experiments performed in duplicate (320

mOsm); Data represent the mean + S.E. of four independent experiments

performed in supplicate (380 mOsm) ; *p < .05.

145 FIGURE 4.3

146 Figure 4.3 Concentration-response relationships for thrombin-

stimulated ATP release and Ca2+ mobilization in isotonic, hypotonic,

or hypertonic media. A: Thrombin (0-15 nM) stimulated ATP release in

1321N1 astrocytes incubated in BSS of 250 mOsm (), 320 mOsm (),

and 380 mOsm ().Data represent the mean + S.E. of three independent

experiments performed in triplicate.. B: Fura2-loaded 1321N1 cells were

suspended in BSS with the indicated osmolarity and stimulated with 0-15

nM thrombin. Peak changes in cytosolic [Ca2+] were determined. Data

represent the mean + S.E. of three independent experiments.

147 FIGURE 4.3

148 Figure 4.4 Concentration-response relationships for thrombin-

stimulated ATP release 1321N1 cells preincubated for 30 min in

isotonic, hypotonic, or hypertonic media. 1321N1 astrocytes were

preincubated for 30 min in media of 250 mOsm (), 320 mOsm (), and

380 mOsm () as described in METHODS. Extracellular ATP was then

measured at 10 min following stimulation 0-15 nM thrombin; all test

salines also contained 300 μM βγ-meATP to suppress ecto-ATPases.

Data represent the mean + S.E. of three independent experiments

performed in triplicate.

149 FIGURE 4.4

150 Figure 4.5 Differential inhibitory effects of BAPTA and Clostridial

Toxin B on ATP release stimulated by thrombin versus strong

hypotonic stress. A: Basal and 10 nM thrombin-stimulated ATP release

from 1321N1 cells loaded with () or without () BAPTA in BSS with the

indicated osmolarity. Data represent the mean + S.E. of four independent

experiments performed in duplicate; *p < .05. B: Basal and 10 nM

thrombin-stimulated ATP release from 1321N1 cells treated with () or

without () toxin B (ToxB) in media with the indicated osmolarity. Data

represent the mean + S.E. of four independent experiments performed in

duplicate; *p < .05.

151 FIGURE 4.5

152 Figure 4.6 Concentration-inhibition relationships for the effects of

dideoxyforskolin or carbenoxolone on ATP release by thrombin

versus strong hypotonic stress. A,C: 1321N1 monolayers bathed in

isotonic 320 mOsm or modestly hypotonic 250 mOsm BSS were

stimulated for 10 min with 10 nM thrombin in the presence of 0-300μM

dideoxyforskolin (ddF) in panel A or 0-300μM carbenoxolone (CBX) in

panel C. B, D: 1321N1 monolayers were stimulated by transfer to

strongly hypotonic 215 mOsm BSS for 10 min in the presence of 0-300μM

ddF (panel B) or 0-300μM CBX (panel D). All panels: ATP release in the

presence of ddF or CBX was normalized to the maximal release in the

absence of inhibitors. Data represent the mean + S.E. of four independent

experiments performed in duplicate; *p < .05.

153 Figure 4.6

154 Figure 4.7 Concentration-inhibition relationships for the effects of

probenicid on ATP release by thrombin versus strong hypotonic

stress. A: 1321N1 monolayers bathed in isotonic 320 mOsm () or

modestly hypotonic 250 mOsm () BSS were stimulated for 10 min with

10 nM thrombin in the presence of 0-3 mM probenecid (PB). ATP release

in the presence of PB was normalized to the maximal release in the

absence of PB. B: 1321N1 monolayers were stimulated by transfer to

strongly hypotonic 215 mOsm BSS (●) for 10 min in the presence of 0-3

mM PB. ATP release in the presence of PB was normalized to the

maximal release in the absence of PB. C: 1321N1monolayers were

bathed in BSS with the indicated osmolarity and then incubated for 10 min

with no other additions (), with 10 nM thrombin alone (), or with 10 nM

thrombin plus 2 mM PB (▒). A, B, C. Data represent the mean + S.E. of

four independent experiments performed in duplicate. *p < .05. D: Fura2-

loaded 1321N1 cells were suspended in BSS with or without 2.5 mM PB

and then stimulated with 10 nM thrombin. Peak changes in cytosolic [Ca2+]

were determined. Values are the average + range; n=2.

155 FIGURE 4.7

156 Figure 4.8 The maxi-anion channel inhibitor Gd3+ does not inhibit

thrombin-dependent or hypotonic stress induced ATP release from

1321N1 astrocytes. A: Changes in extracellular [ATP] in unstimulated

cells () versus cells stimulated with 10 nM thrombin in the absence ()

or presence () of 50μM Gd3+ were recorded on-line every 4 min. B:

Changes in extracellular [ATP] in cells bathed in isotonic (320 mOsm) ()

versus hypotonic (215 mOsm) BSS in the absence () or presence ()

50μM Gd3+ were recorded on-line every 4 min. Both panels: Data

represent the mean + S.E. of seven independent experiments.

157 FIGURE 4.8

158

CHAPTER 5:

Multiple Pathways of ATP release from 1321N1 cells

Portions of this chapter have been published as part of

Blum et al. Am J Physiol Cell Physiol. 2009 Nov 11.[Epub ahead of print]

Extracellular Osmolarity Modulates G protein-Coupled Receptor

Dependent ATP Release from 1321N1 Astrocytoma Cells.

159

ABSTRACT:

ATP release from 1321N1 cells may be initiated in response to

diverse metabolic, mechanical, or inflammatory stimuli. Previously, I

determined that GPCR and osmotic stress activate a common ATP

release pathway with similar properties to the volume-sensitive organic

anion channel (VSOAC) in 1321N1 cells. Here, I compare the effect of

channel inhibitors and variations in temperature on three different modes

of ATP release in order to determine the relative contribution of potential

ATP release pathways. Reduction of extracellular divalent cations (i.e.

exposure to a low divalent cation solution (LDS)) activates gating of

connexin gap-junction hemichannels and also elicits ATP release from

1321N1 cells. ATP release in response to LDS exhibited a graded

reduction in response to reduced temperature, whereas GPCR and

hypotonic stress induced ATP release was insensitive to similar

temperature reductions. Furthermore, Carbenoxolone (CBX) and

Flufenamic acid (FFA) were able to inhibit ATP release in response to

LDS, thrombin, and hypotonic stress. Probenecid was able to inhibit ATP

release in response to thrombin, but not in response to reduced osmolarity

or reduced divalent cation concentration. In contrast, Gd3+ was unable to

inhibit ATP release in response to any of the ATP release stimuli

examined. Together, this data set indicates that ATP release in response

160 to LDS occurs by a different pathway than GPCR or hypotonic stress

induced ATP release.

INTRODUCTION:

Extracellular ATP and other nucleotides act as autocrine / paracrine

signaling molecules in the brain by targeting 15 known P2 receptors and 4

known P1 receptors (41). Since ATP release from astrocytes is an

essential component of purinergic signaling, the mechanism of ATP

release is an active area of investigation (44). Neurons and other

excitable cells release ATP through exocytosis. However, most non-

excitable cells, such as 1321N1 astrocytoma cells, do not have obvious

ATP containing granules. In the apparent absence of a secretory

pathway, focus has been directed toward discovery of a conductive

pathway for ATP release (45) Identification of a unique conduit for ATP

release from astrocytes has remained elusive. While several channels

associated with ATP release have been identified based on functional,

pharmacologic, and genetic manipulations, the results vary depending on

the model system and stimulus. For example, differences between mouse

strains may account for the observation that hypoxia elicits ATP release

from mouse astrocytes via either the maxi-anion channel or connexin 43

hemichannels (163, 167). Also, the multidrug resistance protein (MRP)

and maxi-anion channel have been identified as the conduit for regulated

ATP release in response to osmotic swelling from rat astrocytes or mouse

161 astrocytes respectively (64, 167). Furthermore, I found evidence that

VSOAC, rather than connexin / pannexin hemichannels or maxi-anion

channels are the likely conduit for GPCR/osmotic stress induced ATP

release from 1321N1 cells (Chapter 4).

Because 1321N1 cells express the gap junction protein connexin

43, I hypothesized that an additional ATP release pathway may exist in

these cells. Gating of these channels by reduction in extracellular divalent

cation concentration will lead to ATP release by a pathway distinct from

the GPCR / osmotic stress induced ATP release pathway (261). In this

chapter I demonstrate that ATP release from 1321N1 cells has different

temperature dependence and pharmacologic sensitivity depending on the

stimulus used. In response to GPCR or hypotonic stress a channel that

has properties similar to VRAC seems to mediate ATP release, while a

connexin hemichannel likely mediates ATP release in response to low

divalent solutions.

162 RESULTS:

Differences in kinetics and temperature sensitivity

Cells allowed to equilibrate for ~45 minutes in control BSS (320

mOsm, 1.5mM Ca2+, 1.0mM Mg2+) have an extracellular ATP

concentration of 1-2nM. Addition of βγ-MeATP (300μM), an inhibitor of

the predominant ectonucleotidase expressed on the surface of 1321N1

cells (NPP1), shifts the equilibrium of ATP release and extracellular

hydrolysis (137). In the absence of additional stimulation the new

concentration of extracellular ATP is 5-10 nM. Treatment with thrombin

(10nM) or hypotonic stress (215 mOsm, 35% hypotonicity), leads to rapid,

but transient increase in increase in ATP release rate. In contrast, a low

divalent cation solution (LDS) stimulates continuous ATP release that

does not abate within 20 minutes (Figure 5.1). ATP release in response to

thrombin and hypotonic stress are insensitive to changes in temperature

over the range of 20oC to 37oC, while LDS induced ATP release shows a

graded reduction in response to reduced temperatures (figure 5.2).

Possible ATP release Pathways

A number of possible ATP release pathways have been suggested.

I performed RT-PCR analysis to assay the expression of candidate

pathways that may play a role in the release of ATP from 1321N1 cells.

Cells maintained in high-glucose DMEM for seven days, and assayed by

RT-PCR yielded amplified cDNA fragments with identical expected sizes

for human pannexin 1 and connexin 43 (Figure 5.3). Additionally,

163 previous studies in our lab have additionally identified connexin 26,

connexin 30, and connexin 37 expressed in 1321N1 cells by an identical

method, but not connexin 32, 36, or 47 (Joseph, unpublished data). Next,

I tested the sensitivity of LDS induced ATP release to various inhibitors of

large conductance channels. 1321N1 cells, when exposed to thrombin,

hypotonic stress, or LDS in the absence of inhibitor releases ATP as

observed before. ATP release in response to thrombin, reduced

osmolarity, and LDS is sensitive to CBX and FFA, non-selective inhibitors

of hemichannels and VRAC (figures 5.4,5.5) (20, 296). PB, an inhibitor of

organic anion transporters, that is also a selective inhibitor of pannexin

versus connexin hemichannels, reduces thrombin induced ATP release

>50%, but does not affect ATP release in response to hypotonic stress or

LDS (figure 5.6) (173). Gd3+ the maxi-anion channel inhibitor did not

reduce ATP release in response to thrombin, hypotonic stress, or LDS

(figure 4.8 A,B; 5.7) (235).

164 DISCUSSION:

From the results presented in this chapter it is concluded that ATP

release from 1321N1 may occur via more than one possible release

pathway. The ATP release pathway stimulated by thrombin and hypotonic

stress is activated transiently and has sensitivity to CBX and FFA, but not

Gd3+. Thrombin induced ATP release is pharmacologically distinct from

hypotonic stress based on its sensitivity to PB. LDS induced ATP release,

on the other hand, is pharmacologically similar to the hypotonic stress

induced ATP release pathway, but has different kinetics and temperature

sensitivity.

A gap-junction channel, which is located at the direct contact zone

between two adjacent cells, is an assembly of two hemichannels, each

comprised of a hexameric complex of six connexin or pannexin

monomers. The two hemichannels join together end-to-end to form a gap-

junction channel that acts as a signal-gated conduit connecting the

cytoplasms of the two adjacent cells. In contrast to these very well-

characterized gap junction channels, non-junctional hemichannels

comprised of the same connexin or pannexin hexamers can also be gated

by diverse signals and thereby act as a low resistance conduit from the

cytoplasm to the extracellular space of the cell. Although hemichannel

open under certain conditions, they must remain closed in order to

preserve ionic gradients and keep the permeability barrier of the plasma

membrane intact. The presence of extracellular divalent cations,

165 principally Ca2+, maintains connexin hemichannel in a closed conformation

at resting membrane potential. This form of gating is also called “loop

gating” (84, 254, 271, 279). Extracellular solutions with a low

concentration of divalent cations (LDS) are known to gate Hemichannel

composed of connexin subunits and LDS induces ATP release from

several astrocyte cell systems (57, 163). This is the first report of LDS

induced ATP release from 1321N1 cells. Importantly, Suadicani et. al.

report no change in extracellular ATP levels after exposing 1321N1 cells

to a Ca-free saline solution (260, 261). The most relevant differences

between our two studies is that my study used longer treatment time (20

minutes vs. 2 minutes - which may have been insufficient time for

extracellular ATP to accumulate) and I utilized βγ-meATP to inhibit ecto-

nucleotidase activity (260).

The difference in kinetics between the three ATP release stimuli,

i.e. the transient ATP release in response to thrombin and hypotonic

stress and continuous ATP release in response to LDS, likely reflects

differences in the termination of the ATP release signal. Protease

activated receptors are a family of four GPCRs activated by thrombin and

other proteases. In 1321N1 cells PAR1 mediates the effects of thrombin

as an ATP secretagogue (137). Like other GPCRs, PAR1 generates 2nd

messengers while bound to agonist, but it is inactivated rapidly by G-

protein receptor kinases and β-arrestins and therefore the signal is short-

lived (205). Similarly, the osmolyte efflux pathways activated in response

166 to hypotonic stress are terminated following volume correction (120).

Although the kinetics of cell volume regulation have not been documented

in 1321N1 cells, cultured rat astrocytes recover ~85% within 15 minutes

following osmotic swelling (209). In contrast, exposure to LDS causes

gating of connexin hemichannels through its effect on loop gating. It is not

known how long the connexin hemichannels will remain open under these

conditions. There are several mechanisms by which the number of open

hemichannels could be reduced even in the continued presence of LDS,

such as increased retrieval of the channels from the plasma membrane to

reduce the total number of channels or phosphorylation by intracellular

kinases to reduce open probability or conductance. However, the results

indicate that there is no reduction in ATP release rate. This stands in

contrast the kinetics of LDS induced ATP release from mouse astrocytes

which rapidly reach peak extracellular ATP concentration (30 sec), which

is maintained for 5 minutes (258).

Temperature is an independent determinant of conductance in non-

junctional hemichannel composed of connexin 26 and decreased

temperature reduces connexin 43 gap-junction channel conductance

(256). Reduced temperature (20-27oC) has been shown to reduce

exocytotic ATP release from A549 airway epithelial cells and to attenuate

ATP release from rat aortic smooth muscle cells, which occurs by an

unknown mechanism (26, 220). To my knowledge, no report

demonstrates an effect of temperature on channel mediated ATP release

167 or LDS stimulated ATP release. In addition to osmolarity, the release of

ATP as a paracrine modulator of neuronal and glial function might be

further tuned by other biophysical conditions such as mild hypothermia

which is now an established brain protective therapy (68). However,

under our defined in vitro conditions, the rate and extent of thrombin-

stimulated ATP release from 1321N1 cells was identical at 37oC or 32oC,

and only modestly slowed at 20oC (figure 5.2).

Several channels and transporters have been proposed as conduits

for regulated, non-exocytotic ATP release from astrocytes. In agreement

with previous studies the present RT-PCR study demonstrated expression

of pannexin 1 and connexin 43 (Fig 5.3) (214). The pharmacologic

sensitivity of LDS induced ATP release is consistent with the notion that it

is mediated by connexin hemichannel. Carbenoxolone (CBX) and

flufenamic acid (FFA) are non-selective inhibitors of gap-junction

hemichannel and VSOAC. Probenecid (PB) inhibits organic anion

transporters and also blocks pannexin, but not connexin- based

hemichannels (252). The inability of PB to inhibit LDS induced ATP

release supports the notion that LDS activates connexin hemichannels

and thereby elicits ATP release. The ability of PB to modulate VRAC or

maxi-anion channels has not been reported. PB does inhibit thrombin

induced ATP release, but not hypotonicity induced ATP release from

1321N1 cells, which may indicate that these two stimuli cause ATP

release via distinct channels, or that the pharmacology of a common ATP

168 release pathway is modified under hypotonic conditions, as discussed

previously (chapter 4, fig 4.7). Gd3+ insensitivity of the LDS induced ATP

release argues against a likely role for maxi-anion channels (203).

These results have implications for the study of ATP release, which

has largely identified single pathways for ATP release from a particular

cell type and stimulus. It is possible that 1321N1 cells are not unique in

their ability to release ATP by multiple pathways.

169 Figure 5.1 Transient ATP release induced by thrombin and hypotonic

stress contrasts with sustained ATP release elicited by LDS. A:

Changes in extracellular [ATP] were recorded in untreated control cells

() versus cells stimulated with 10nM thrombin (). On-line ATP

measurements were made every 4 minutes after stimulation in

combination with 300 μM βγ-meATP for 20 minutes. B: Changes in

extracellular [ATP] were recorded in untreated (320 mOsm) cells ()

versus cells stimulated with 215 mOsm solution (). On-line ATP

measurements were made every 4 minutes after adjustment to 215 mOsm

extracellular solution in combination with 300 μM βγ-meATP for 20

minutes. C: Changes in extracellular [ATP] were recorded in untreated

cells () versus cells stimulated with LDS (). On-line ATP

measurements were made every 4 minutes after adjustment to LDS in

combination with 300 μM βγ-meATP for 20 minutes. Extracellular ATP

concentration was quantified via an on-line luciferin / luciferase assay as

described in METHODS. Data represent the mean + S.E. of seven

independent experiments.

170 FIGURE 5.1

A. No Thrombin 75 Thrombin

50

25 +Thrombin Extracellular ATP (nM) ATP Extracellular 0 -10 -5 0 5 10 15 20 minutes B. 75 320 mOsm 215 mOsm

50

25 +215 mOsm Extracellular ATP (nM) ATP Extracellular 0 -10 -5 0 5 10 15 20 minutes C. 75 No LDS LDS

50

25 +LDS Extracellular ATP (nM) ATP Extracellular 0 -10 -5 0 5 10 15 20 minutes

171 Figure 5.2 Reduced temperature inhibits LDS, but not thrombin-

dependent or hypotonic stress induced ATP release from 1321N1

astrocytes. Changes in extracellular [ATP] were recorded in cells treated

at 20oC (), 32oC (), or 37oC (). On-line ATP measurements were

made every 4 minutes after addition of 300 μM βγ-meATP, with or without

A: 10nM thrombin, B: 215mOsm, or C: LDS. Extracellular ATP

concentration was quantified via an on-line luciferin / luciferase assay as

described in METHODS. Data represent the mean + S.E. of seven

independent experiments.

172

FIGURE 5.2

A. 100 o 20 C Thrombin 32oC 75 37oC

50

25 Extracellular ATP (nM) ATP Extracellular 0 0 5 10 15 minutes B. 100 o 20 C 215 mOsm 32oC 75 37oC

50

25 Extracellular ATP (nM) 0 0 5 10 15 minutes C. 100 20oC LDS 32oC 75 37oC

50

25 Extracellular ATP (nM) ATP Extracellular 0 0 5 10 15 minutes

173 Figure 5.3 1321N1 astrocytes express pannexin 1 and connexin 43

mRNA. Expression of pannexin 1 (Px1), Connexin 43 (Cx43), or GAPDH

was assayed by RT-PCR from 1321N1 cells as described in METHODS.

174 FIGURE 5.3

175 Figure 5.4 CBX blocks ATP release in response to thrombin,

hypotonic stress, or LDS. A: Changes in extracellular [ATP] were

recorded in untreated control cells () versus cells stimulated with 10nM

thrombin (), or 10nM thrombin plus 100μM CBX (). On-line ATP

measurements were made every 4 minutes after stimulation in

combination with 300 μM βγ-meATP for 16 minutes. B: Changes in

extracellular [ATP] were recorded in untreated (320 mOsm) cells ()

versus cells stimulated with 215 mOsm solution (), or 215 mOsm plus

100μM CBX (). On-line ATP measurements were made every 4 minutes

after adjustment to 215 mOsm extracellular solution in combination with

300 μM βγ-meATP for 16 minutes. C: Changes in extracellular [ATP]

were recorded in untreated cells () versus cells stimulated with LDS (),

or LDS plus 100μM CBX (). On-line ATP measurements were made

every 4 minutes after adjustment to LDS in combination with 300 μM βγ-

meATP for 16 minutes. Extracellular ATP concentration was quantified

via an on-line luciferin / luciferase assay as described in METHODS. Data

represent the mean + S.E. of seven independent experiments. Significant

(*p < .05) differences in ATP between the indicated test conditions are

noted.

176 FIGURE 5.4

A.

75 No Thrombin Thrombin Thrombin +CBX 50

25 +Thrombin * Extracellular ATP (nM) ATP Extracellular 0 -10 -5 0 5 10 15 B. minutes

320 mOsm 75 215 mOsm 215 mOsm +CBX 50

25 +215 mOsm

Extracellular ATP (nM) ATP Extracellular * 0 -10 -5 0 5 10 15

C. minutes

75 No LDS LDS 50 LDS +CBX

25 * +LDS Extracellular ATP (nM) ATP Extracellular 0 -10 -5 0 5 10 15 minutes

177 Figure 5.5 FFA blocks ATP release in response to thrombin,

hypotonic stress, or LDS. A: Changes in extracellular [ATP] were

recorded in untreated control cells () versus cells stimulated with 10nM

thrombin (), or 10nM thrombin plus 100μM FFA (). On-line ATP

measurements were made every 4 minutes after stimulation in

combination with 300 μM βγ-meATP for 16 minutes. B: Changes in

extracellular [ATP] were recorded in untreated (320 mOsm) cells ()

versus cells stimulated with 215 mOsm solution (), or 215 mOsm plus

100μM FFA (). On-line ATP measurements were made every 4 minutes

after adjustment to 215 mOsm extracellular solution in combination with

300 μM βγ-meATP for 16 minutes. C: Changes in extracellular [ATP]

were recorded in untreated cells () versus cells stimulated with LDS (),

or LDS plus 100μM FFA (). On-line ATP measurements were made

every 4 minutes after adjustment to LDS in combination with 300 μM βγ-

meATP for 16 minutes. Extracellular ATP concentration was quantified

via an on-line luciferin / luciferase assay as described in METHODS. Data

represent the mean + S.E. of seven independent experiments. Significant

(*p < .05) differences in ATP between the indicated test conditions are

noted.

178 FIGURE 5.5

A. -Thrombin 75 +Thrombin +Thrombin +FFA 50

25 +Thrombin Extracellular ATP (nM) 0 -10 -5 0 5 10 15 minutes B. 320 mOsm 75 215 mOsm 215 mOsm +FFA 50

25 +215 mOsm

Extracellular ATP (nM) * 0 -10 -5 0 5 10 15 minutes C.

75 No LDS LDS 50 LDS +FFA

25 +LDS * Extracellular ATP (nM) 0 -10 -5 0 5 10 15 minutes

179 Figure 5.6 PB blocks ATP release in response to thrombin, but not in

response to hypotonic stress, or LDS. A: Changes in extracellular

[ATP] were recorded in untreated control cells () versus cells stimulated

with 10nM thrombin (), or 10nM thrombin plus 2.5mM PB (). On-line

ATP measurements were made every 4 minutes after stimulation in

combination with 300 μM βγ-meATP for 16 minutes. B: Changes in

extracellular [ATP] were recorded in untreated (320 mOsm) cells ()

versus cells stimulated with 215 mOsm solution (), or 215 mOsm plus

2.5mM PB (). On-line ATP measurements were made every 4 minutes

after adjustment to 215 mOsm extracellular solution in combination with

300 μM βγ-meATP for 16 minutes. C: Changes in extracellular [ATP]

were recorded in untreated cells () versus cells stimulated with LDS (),

or LDS plus 2.5mM PB (). On-line ATP measurements were made

every 4 minutes after adjustment to LDS in combination with 300 μM βγ-

meATP for 16 minutes. Extracellular ATP concentration was quantified

via an on-line luciferin / luciferase assay as described in METHODS. Data

represent the mean + S.E. of seven independent experiments. Significant

(*p < .05) differences in ATP between the indicated test conditions are

noted.

180 FIGURE 5.6

A.

75 No Thrombin Thrombin Thrombin +PB 50

25 +Thrombin * Extracellular ATP (nM) ATP Extracellular 0 -10 -5 0 5 10 15 minutes B. 320 mOsm 75 215 mOsm 215 mOsm +PB 50

25 +215 mOsm Extracellular ATP (nM) ATP Extracellular 0 -10 -5 0 5 10 15 minutes C. 75 No LDS LDS 50 LDS +PB

25 +LDS Extracellular ATP (nM) ATP Extracellular 0 -10 -5 0 5 10 15 minutes

181 Figure 5.7 Gadolinium does not affect ATP release in response to

LDS. C: Changes in extracellular [ATP] were recorded in untreated cells

() versus cells stimulated with LDS (), or LDS plus 50μM Gd3+ ().

On-line ATP measurements were made every 4 minutes after adjustment

to LDS in combination with 300 μM βγ-meATP for 16 minutes.

Extracellular ATP concentration was quantified via an on-line luciferin /

luciferase assay as described in METHODS. Data represent the mean +

S.E. of seven independent experiments.

182 FIGURE 5.7

No LDS 75 LDS LDS +Gd

50

25 +Thrombin Extracellular ATP (nM) 0 -10 -5 0 5 10 15 minutes

183

CHAPTER 6:

Conclusions and Future Directions

184 In this thesis I examine regulated ATP release from 1321N1

astrocytoma cells. The general theme of these studies is that integration

of environmental stimuli can occur at any level of the cellular response;

including multiple stimuli, such as osmotic status and ligand availability

production of multiple second messengers, such as intracellular Ca2+

concentration and Rho-GTPase activation, and convergence of signaling

pathways on similar effector proteins. In this way the magnitude of ATP

release may reflect a wide range of environmental conditions permitting

the purinergic tone to reflect changes in the homeostatic cellular milieu.

My studies demonstrate that Ca2+ mobilization alone is insufficient for

maximal ATP release in response to GPCR activation. Instead, the

magnitude of ATP release is enhanced ~4 fold by GPCR agonists that

coordinately activate Ca2+ and Rho-GTPase (Chapter 3). PAR1 mediated

ATP release is further modulated by extracellular osmolarity, which affects

both the potency and efficacy of thrombin as an ATP secretagogue

(Chapter 4). Furthermore, 1321N1 cells have multiple ATP release

conduits that are differentially activated depending on the stimulus

(chapter 5).

Astrocytes Integrate Environmental Stimuli and Release ATP

185 Rapid, graded responses to osmotic stress enable maintenance of

normal brain volume. The central nervous system is especially sensitive

to cellular volume changes because the brain resides in the confined

space of the skull (189). The experimental design used in this thesis, like

most studies of osmotic stress, involves abrupt alteration of extracellular

osmolarity, which is associated with cell volume change. It is important to

note that gradual changes in osmolarity (2.5 mOsm/min) do not cause

volume changes in hippocampal slices, even in response to a 50%

decrease in osmolarity; however, a similar volume regulation program is

activated in both experimental models (92, 208). As described previously

(Chapter 1.2.3), G protein-coupled receptor (GPCR) activation markedly

accelerates volume correction and reduces the osmotic threshold at which

osmolyte release occurs. This enables cells to respond to subtle,

physiologic perturbations in extracellular osmolarity. Given the confined

space defined by the skull and the close proximity of astrocyte processes

to the pre-synapse and post-synapse, astrocytes must respond rapidly

and with minimal volume change to fluctuations in extracellular ion and

neurotransmitter concentrations, both of which affect cell volume. The

extracellular ATP that accumulates in the context of cell swelling and cell

volume regulation, activates osmolyte efflux, triggers additional ATP

release, and participates in an autocrine loop that accelerates volume

correction. Therefore, the results reported here suggest that an additional

way GPCR activation can participate in the response to osmotic stress is

186 by increasing the rate of ATP release, thereby potentiating autocrine

signaling loops involved in the volume regulation program.

While proteinase and purinergic signaling mediate physiologic

responses in the CNS, PAR and purinergic receptor activation can also

mediate CNS responses to injury. In response to insults such as trauma,

stroke, and status epilepticus, astrocytes proliferate and undergo

phenotypic and biochemical changes characterized by elongated cellular

processes and increased expression of an intermediate filament called

glial fibrillary acidic protein in a process called reactive gliosis. Reactive

gliosis can be both protective and harmful (108). The reactive astrocytes

eventually form a rubbery scar that sequesters the site of injury and

prevents axon regeneration (251). Multiple lines of evidence implicate

PAR1 signaling in reactive gliosis both in vivo and in vitro. PAR1-/- mice

show reduced proliferation and glial fibrillary acidic protein expression

following cortical stab wound and reduced proliferation in response to

PAR-1 peptide agonists in vitro highlighting the importance of PAR

signaling in response to brain injury (192). P2 receptor activation also

mediates reactive gliosis (2) When intact, the blood-brain barrier permits

diffusion of select small molecules, but excludes most blood components

from the brain parenchyma. However, following subdural hematoma,

thrombin levels in the CSF increase from 100 pM to 25 nM and remain

elevated for 1 week (262). Blocking PAR receptors in humans is an

impractical intervention give their role in peripheral hemostasis. Targeting

187 cellular responses downstream of PAR activation, such as ATP release

P2 receptor activation, may provide a useful tool for modulating the effects

of thrombin in the CNS.

A critical unanswered question regarding the physiology of volume

regulation, is how osmotic stimuli and GPCR activation are integrated by

the cell. Since GPCR activation, via G-proteins, and osmotic stress, via

an unknown osmosensory mechanism, cooperatively activate ATP efflux

channel(s), I tested the possibility that the two stimuli modulate similar 2nd

messenger cascades (i.e. that hypotonic stress and GPCR activation

would produce higher levels relevant signals in combination rather than

alone). This seems unlikely to be the case for 1321N1 cells because I

demonstrated that, in contrast to GPCR-mediated ATP release (Chapter

3), hypotonic stress induced ATP release depends on neither intracellular

Ca2+ mobilization nor Rho-GTPase activation (Figure 4.5). Furthermore,

PAR1 activation is unaffected by osmotic challenge (Figure 4.3). The

observations described above are consistent with studies of other

astrocyte systems that indicate two distinct signaling mechanisms control

GPCR and hypotonic stress mediated osmolyte efflux (90).

The majority of studies addressing the question of which 2nd

messenger cascades are involved in the astrocyte response to GPCR

activation and osmotic stress do so by monitoring VSOAC activity and

efflux of traditional osmolytes, such as aspartate, glutamate, taurine and

188 inositol (90, 91). I found that the ATP release conduit in 1321N1 cells is

similar to the osmolyte efflux conduit in 1321N1, and other astrocyte cell

models in terms of its sensitivity to inhibitors of VSOAC and suppression

or potentiation by hypertonic or hypotonic stress (Chapter 4). Therefore it

is useful to compare the relevant signaling cascades reported here with

studies that address either ATP release or osmolyte release from

astrocytes. In astrocytes GPCR-regulated, but not swelling-activated,

efflux of osmolytes depends on Ca2+ and PKC activity (113, 185). Indeed,

using 1321N1 astrocytes, Cheema et. al. demonstrated that VRAC

dependent osmosensitive release of taurine is enhanced in response to

PAR1 activation by thrombin (50). In contrast to ATP release, taurine

release in response to PAR1 activation depends in part upon PKC

activation. The absence of an effect of PMA on ATP release from 1321N1

cells indicates that there is a difference in the control of ATP release

versus taurine release despite similarities in the regulation of the release

pathway (Figure 6.2). I found that ionomycin (1 μM), but not phorbol

myristate acetate (PMA) (100 nM) can potentiate ATP release

(extracellular osmolarity 300 mOsm). The ability of ionomycin to cause

ATP release – albeit less than thrombin stimulated ATP release - is

consistent with the notion that thrombin mediated ATP release depends

on intracellular calcium and an additional 2nd messenger Rho-GTPase

(Chapter 3).

189 Another way that cells may integrate GPCR activation and osmotic

stress stimuli is via the activation of distinct 2nd messenger signaling

cascades coupled to ATP release channels. For example, A significant

body of evidence has linked receptor and non-receptor tyrosine kinase

activity to hypotonicity-induced VSOAC activity (90). A role for tyrosine

kinase activity in ATP release from astrocytes has not been demonstrated.

However, GPCR-dependent VSOAC activation and aspartate release from

cultured rat astrocytes was sensitive to tyrosine kinase inhibition (185).

The role of tyrosine kinases in ATP release from astrocytes is a topic for

future investigation and it should be noted that phosphorylation by tyrosine

kinases can also gate hemichannels and maxi-anion channels.

Given the differences in the second messengers required to

activate osmolyte efflux and ATP release it is unlikely that any of them

directly gate VSOAC. In fact, intracellular 2nd messengers have not been

unambiguously shown to activate VSOAC. Instead, they play a

permissive role in channel gating by reducing the osmotic threshold for

activation or increasing current density for a given osmotic stress (203).

Therefore, an alternative mechanism for stimulus integration may be direct

modification of channel gating, channel conductance, or channel

trafficking by intracellular 2nd messengers and direct activation of the

channel by osmotic stress (Figure 6.1; Chapter 1.4.1.3).

Preliminary work has shown that while HEK-293 cells

endogenously express functional PAR receptors, there is no detectable

190 ATP release in response to thrombin (Figure 6.3). On the other hand, I

demonstrated ATP release from HEK-293 cells in response to strong

hypotonic stress (Figure 6.3). Based on these data, I propose that the

discrepancy between HEK-293 cells and 1321N1 astrocytes in terms of

thrombin induced ATP release reflects differences in the threshold

permissive osmolarity for VSOAC gating and ATP release. Therefore, the

first experiment will be to replicate Figure 4.2A using HEK-293 cells to

determine if GPCR activation can elicit ATP release at reduced osmolarity.

HEK-293 cells are useful as a recombinant system. Overexpression of

hemichannel proteins to test whether they influence osmosensitive ATP

release from HEK cells as they do in other cell types will provide a useful

model to examine if the presence of multi-protein channel complexes with

different molecular participants and therefore different pharmacologic and

regulatory profiles in different cell backgrounds may explain, in part, the

difficulty in identifying ATP release conduits.

VSOAC Mediated ATP Release During Apoptosis?

While the role of extracellular ATP as an immunomodulatory signal

has been extensively characterized, two recent studies have uncovered a

role for extracellular ATP as a critical participant in the interaction between

the immune system and apoptotic cells. Elliot et. al. identified extracellular

ATP and UTP as chemoattractant signals that facilitate phagocytosis of

191 apoptotic cells in vivo, via activation of P2Y receptors (78). Ghiringhelli et.

al. found that activation of P2X7 receptors on dendritic cells enhances the

immune response to apoptotic cancer cells and promotes tumor clearance

in vivo (97). Of particular interest, both of these studies demonstrate the

release of ATP during apoptosis of cancer cells. In a subsequent study,

ATP release was observed during tumor cell apoptosis initiated by a wide

range of conventional chemotherapeutic agents (179).

Cell shrinkage is a hallmark of apoptosis, which occurs under

normotonic conditions and requires efflux of intracellular osmolytes. This

morphologic change, called apoptotic volume decrease (AVD), involves a

similar pattern of channel activation as swelling induced RVD (chapter

1.2.3), leading to efflux of KCl and organic osmolytes followed by

obligated water. AVD is further characterized by inhibition of RVI causing

persistent cell shrinkage, which is a sufficient apoptotic stimulus in HeLa

human epithelial cells (174, 175, 202, 248). Fas ligand, TNFα and

staurosporine trigger volume sensitive Cl- currents, with characteristics of

VSOAC, which are required for caspase dependent apoptosis in HeLa

cells and Jurkat T-lymphocytes. Furthermore, inhibition of VSOAC by

chloride channel blockers prevented cell shrinkage and apoptosis in these

cells (174, 249, 263). Similar studies implicate VSOAC as a critical

component of neuronal apoptosis using an in vivo model of ischemia

(128). Also, VSOAC activity mediates the apoptotic response to the

chemotherapeutic drug cisplatin in a human cancer cell line (158).

192 Since an intimate link exists between VSOAC activity and AVD, I

hypothesize that the osmotically sensitive ATP release conduit from

1321N1 astrocytoma cells, that has characteristics of VSOAC, mediates

ATP release during apoptosis. In order to test this hypothesis I will initially

utilize TNFα and cycloheximide treated 1321N1 cells, which are known to

undergo caspase dependent cell-death (144, 145). If ATP release occurs

via VSOAC then it will be sensitive to appropriate pharmacologic inhibitors

(Table 1.2). Additionally, if AVD induced ATP release is mediated by

VSOAC it is expected that ATP release will be augmented by reductions in

extracellular osmolarity and attenuated by increased extracellular

osmolarity. The kinetics of cell shrinkage and osmolyte efflux should

coincide with rises in extracellular ATP if they are both mediated by

VSOAC. As discussed above (Chapter 1.2.3), P2 receptors and other

GPCRs participate in RVD. Therefore it is tempting to speculate that

extracellular ATP and other GPCR agonists may facilitate AVD, such that

PAR1 activation may alter AVD induced ATP release or affect the

apoptotic program.

193 Figure 6.1 Hypothetical scheme of the intracellular signaling

pathways contributing to GPCR-induced and osmotically-dependent

activation of the putative volume-sensitive organic anion channel

(VSOAC) pathway. GPCR and osmolarity regulate VSOAC via distinct

signaling pathways and separate mechanisms. 1) GPCR couple to Gαq

and Gα12, and via a phospholipase C (PLC)/inositol 1,4,5-trisphosphate

and Rho-GEF signaling pathway respectively, release Ca2+ from

intracellular stores and activate Rho-GTPase. Ca2+ and Rho-GTPase

cooperatively modulate VSOAC activity, directly or via associated

regulatory protein(s) represented as "X?". 2) Cell swelling activates VRAC

via a separate Ca2+/Rho-independent signaling pathway involving an

unknown osmosensing mechanism and unknown regulatory protein(s)

represented as "Y?". Adapted from (185).

194 FIGURE 6.1

195 Figure 6.2 Intracellular Ca2+ mobilization, but not PKC activation elicits ATP release from 1321N1 astrocytes. Extracellular ATP at 10 min following transfer to BSS with the indicated stimuli and 300 μM βγ- meATP: 1 μM ionomycin, 100nM PMA. Data represent the mean + S.E. of four independent experiments performed in duplicate; *p < .05 relative to untreated control samples.

196 FIGURE 6.2 15 * * 10

5 Extracellular ATP (nM) 0 Control Iono PMA Iono + PMA

197 FIGURE 6.3 Hypotonic stress, but not thrombin elicits ATP release from HEK-293 cells. Changes in extracellular [ATP] were recorded in untreated control cells () versus cells stimulated with 10nM thrombin (), or cells stimulated with 215 mOsm solution (). On-line ATP measurements were made every 2 minutes for 12 minutes after stimulation in the presence of 100 μM βγ-meATP. Data represent one experiment performed in triplicate +/- standard deviation.

198 FIGURE 6.3 50 215 mOsm 40 Thrombin Untreated 30

20

10 Extracellular ATP (nM) 0 -5 0 5 10 minutes

199 REFERENCES

1. Abbracchio MP, Burnstock G, Boeynaems JM, Barnard EA, Boyer JL, Kennedy C, Knight GE, Fumagalli M, Gachet C, Jacobson KA, and Weisman GA. International Union of Pharmacology LVIII: update on the P2Y G protein-coupled nucleotide receptors: from molecular mechanisms and pathophysiology to therapy. Pharmacol Rev 58: 281-341, 2006. 2. Abbracchio MP and Verderio C. Pathophysiological roles of P2 receptors in glial cells. Novartis Found Symp 276: 91-103; discussion 103-112, 275-181, 2006. 3. Abdullaev IF, Rudkouskaya A, Schools GP, Kimelberg HK, and Mongin AA. Pharmacological comparison of swelling-activated excitatory amino acid release and Cl- currents in cultured rat astrocytes. J Physiol 572: 677-689, 2006. 4. Ackerman MJ, Krapivinsky GB, Gordon E, Krapivinsky L, and Clapham DC. Characterization of a native swelling-induced chloride current, ICl.swell, and its regulatory protein, pICln, in Xenopus oocytes. Jpn J Physiol 44 Suppl 2: S17-24, 1994. 5. Adair TH. Growth regulation of the vascular system: an emerging role for adenosine. Am J Physiol Regul Integr Comp Physiol 289: R283-R296, 2005. 6. Aktories K, Schmidt G, and Just I. Rho GTPases as targets of bacterial protein toxins. Biol Chem 381: 421-426, 2000. 7. Alves LA, Coutinho-Silva R, and Savino W. Extracellular ATP: a further modulator in neuroendocrine control of the thymus. Neuroimmunomodulation 6: 81-89, 1999. 8. Aragay AM, Collins LR, Post GR, Watson AJ, Feramisco JR, Brown JH, and Simon MI. G12 requirement for thrombin-stimulated gene expression and DNA synthesis in 1321N1 astrocytoma cells. J Biol Chem 270: 20073-20077, 1995. 9. Arcuino G, Lin JH, Takano T, Liu C, Jiang L, Gao Q, Kang J, and Nedergaard M. Intercellular calcium signaling mediated by point-source burst release of ATP. Proc Natl Acad Sci U S A 99: 9840-9845, 2002. 10. Ashkenazi A, Peralta EG, Winslow JW, Ramachandran J, and Capon DJ. Functional role of muscarinic acetylcholine receptor subtype diversity. Cold Spring Harb Symp Quant Biol 53 Pt 1: 263-272, 1988. 11. Attwell D and Iadecola C. The neural basis of functional brain imaging signals. Trends Neurosci 25: 621-625, 2002. 12. Bader P and Weingart R. Pitfalls when examining gap junction hemichannels: interference from volume-regulated anion channels. Pflugers Arch 452: 396-406, 2006. 13. Bao L, Locovei S, and Dahl G. Pannexin membrane channels are mechanosensitive conduits for ATP. FEBS Lett 572: 65-68, 2004. 14. Bao L, Sachs F, and Dahl G. Connexins are mechanosensitive. Am J Physiol Cell Physiol 287: C1389-1395, 2004. 15. Bao X, Lee SC, Reuss L, and Altenberg GA. Change in permeant size selectivity by phosphorylation of connexin 43 gap-junctional hemichannels by PKC. Proc Natl Acad Sci U S A 104: 4919-4924, 2007. 16. Barrio LC, Suchyna T, Bargiello T, Xu LX, Roginski RS, Bennett MV, and Nicholson BJ. Gap junctions formed by connexins 26 and 32 alone and in combination are differently affected by applied voltage. Proc Natl Acad Sci U S A 88: 8410-8414, 1991.

200 17. Beigi R, Kobatake E, Aizawa M, and Dubyak GR. Detection of local ATP release from activated platelets using cell surface-attached firefly luciferase. Am J Physiol 276: C267-278, 1999. 18. Bell PD, Lapointe JY, Sabirov R, Hayashi S, Peti-Peterdi J, Manabe K, Kovacs G, and Okada Y. Macula densa cell signaling involves ATP release through a maxi anion channel. Proc Natl Acad Sci U S A 100: 4322-4327, 2003. 19. Bender AS, Neary JT, and Norenberg MD. Role of phosphoinositide hydrolysis in astrocyte volume regulation. J Neurochem 61: 1506-1514, 1993. 20. Benfenati V, Caprini M, Nicchia GP, Rossi A, Dovizio M, Cervetto C, Nobile M, and Ferroni S. Carbenoxolone inhibits volume-regulated anion conductance in cultured rat cortical astroglia. Channels (Austin) 3, 2009. 21. Benka ML, Lee M, Wang GR, Buckman S, Burlacu A, Cole L, DePina A, Dias P, Granger A, Grant B, and et al. The thrombin receptor in human platelets is coupled to a GTP binding protein of the G alpha q family. FEBS Lett 363: 49-52, 1995. 22. Bishop AL and Hall A. Rho GTPases and their effector proteins. Biochem J 348 Pt 2: 241-255, 2000. 23. Blackburn MR, Vance CO, Morschl E, and Wilson CN. Adenosine receptors and inflammation. Handb Exp Pharmacol: 215-269, 2009. 24. Blum AE, Joseph SM, Przybylski RJ, and Dubyak GR. Rho-family GTPases modulate Ca(2+) -dependent ATP release from astrocytes. Am J Physiol Cell Physiol 295: C231-241, 2008. 25. Boire A, Covic L, Agarwal A, Jacques S, Sherifi S, and Kuliopulos A. PAR1 is a matrix metalloprotease-1 receptor that promotes invasion and tumorigenesis of breast cancer cells. Cell 120: 303-313, 2005. 26. Boudreault F and Grygorczyk R. Cell swelling-induced ATP release is tightly dependent on intracellular calcium elevations. J Physiol 561: 499-513, 2004. 27. Bowser DN and Khakh BS. Vesicular ATP is the predominant cause of intercellular calcium waves in astrocytes. J Gen Physiol 129: 485-491, 2007. 28. Braet K, Aspeslagh S, Vandamme W, Willecke K, Martin PE, Evans WH, and Leybaert L. Pharmacological sensitivity of ATP release triggered by photoliberation of inositol-1,4,5-trisphosphate and zero extracellular calcium in brain endothelial cells. J Cell Physiol 197: 205-213, 2003. 29. Braet K, Vandamme W, Martin PE, Evans WH, and Leybaert L. Photoliberating inositol-1,4,5-trisphosphate triggers ATP release that is blocked by the connexin mimetic peptide gap 26. Cell Calcium 33: 37-48, 2003. 30. Brake AJ, Wagenbach MJ, and Julius D. New structural motif for ligand-gated ion channels defined by an ionotropic ATP receptor. Nature 371: 519-523, 1994. 31. Browe DM and Baumgarten CM. Angiotensin II (AT1) receptors and NADPH oxidase regulate Cl- current elicited by beta1 integrin stretch in rabbit ventricular myocytes. J Gen Physiol 124: 273-287, 2004. 32. Browe DM and Baumgarten CM. EGFR kinase regulates volume- sensitive chloride current elicited by integrin stretch via PI-3K and NADPH oxidase in ventricular myocytes. J Gen Physiol 127: 237-251, 2006. 33. Browe DM and Baumgarten CM. Stretch of beta 1 integrin activates an outwardly rectifying chloride current via FAK and Src in rabbit ventricular myocytes. J Gen Physiol 122: 689-702, 2003.

201 34. Bruzzone R, Barbe MT, Jakob NJ, and Monyer H. Pharmacological properties of homomeric and heteromeric pannexin hemichannels expressed in Xenopus oocytes. J Neurochem 92: 1033-1043, 2005. 35. Bukauskas FF, Elfgang C, Willecke K, and Weingart R. Biophysical properties of gap junction channels formed by mouse connexin40 in induced pairs of transfected human HeLa cells. Biophys J 68: 2289-2298, 1995. 36. Bukauskas FF and Verselis VK. Gap junction channel gating. Biochim Biophys Acta 1662: 42-60, 2004. 37. Bunse S, Locovei S, Schmidt M, Qiu F, Zoidl G, Dahl G, and Dermietzel R. The potassium channel subunit Kvbeta3 interacts with pannexin 1 and attenuates its sensitivity to changes in redox potentials. FEBS J 276: 6258- 6270, 2009. 38. Burg MB. Macromolecular crowding as a cell volume sensor. Cell Physiol Biochem 10: 251-256, 2000. 39. Burnstock G. Geoffrey Burnstock: most highly cited scientist. Mol Interv 4: 192-195, 2004. 40. Burnstock G. Physiology and pathophysiology of purinergic neurotransmission. Physiol Rev 87: 659-797, 2007. 41. Burnstock G. Purine and pyrimidine receptors. Cell Mol Life Sci 64: 1471-1483, 2007. 42. Burnstock G. Purinergic nerves. Pharmacol Rev 24: 509-581, 1972. 43. Burnstock G. Purinergic signalling--an overview. Novartis Found Symp 276: 26-48; discussion 48-57, 275-281, 2006. 44. Burnstock G. Unresolved issues and controversies in purinergic signalling. J Physiol 586: 3307-3312, 2008. 45. Burnstock G and Arnett TR. The Roles of Nucleotides in the Regulation of Bone Formation and Resoption: CRC Press, 2006. 46. Carton I, Trouet D, Hermans D, Barth H, Aktories K, Droogmans G, Jorgensen NK, Hoffmann EK, Nilius B, and Eggermont J. RhoA exerts a permissive effect on volume-regulated anion channels in vascular endothelial cells. Am J Physiol Cell Physiol 283: C115-125, 2002. 47. Caulfield MP and Birdsall NJ. International Union of Pharmacology. XVII. Classification of muscarinic acetylcholine receptors. Pharmacol Rev 50: 279-290, 1998. 48. Chambers JK, Macdonald LE, Sarau HM, Ames RS, Freeman K, Foley JJ, Zhu Y, McLaughlin MM, Murdock P, McMillan L, Trill J, Swift A, Aiyar N, Taylor P, Vawter L, Naheed S, Szekeres P, Hervieu G, Scott C, Watson JM, Murphy AJ, Duzic E, Klein C, Bergsma DJ, Wilson S, and Livi GP. A G protein-coupled receptor for UDP-glucose. J Biol Chem 275: 10767- 10771, 2000. 49. Cheema TA, Pettigrew VA, and Fisher SK. Receptor regulation of the volume-sensitive efflux of taurine and iodide from human SH-SY5Y neuroblastoma cells: differential requirements for Ca(2+) and protein kinase C. J Pharmacol Exp Ther 320: 1068-1077, 2007. 50. Cheema TA, Ward CE, and Fisher SK. Subnanomolar concentrations of thrombin enhance the volume-sensitive efflux of taurine from human 1321N1 astrocytoma cells. J Pharmacol Exp Ther 315: 755-763, 2005. 51. Chen J, Ishii M, Wang L, Ishii K, and Coughlin SR. Thrombin receptor activation. Confirmation of the intramolecular tethered liganding hypothesis and discovery of an alternative intermolecular liganding mode. J Biol Chem 269: 16041-16045, 1994.

202 52. Chen Y, Corriden R, Inoue Y, Yip L, Hashiguchi N, Zinkernagel A, Nizet V, Insel PA, and Junger WG. ATP release guides neutrophil chemotaxis via P2Y2 and A3 receptors. Science 314: 1792-1795, 2006. 53. Chun J, Goetzl EJ, Hla T, Igarashi Y, Lynch KR, Moolenaar W, Pyne S, and Tigyi G. International Union of Pharmacology. XXXIV. Lysophospholipid receptor nomenclature. Pharmacol Rev 54: 265-269, 2002. 54. Citro S, Malik S, Oestreich EA, Radeff-Huang J, Kelley GG, Smrcka AV, and Brown JH. Phospholipase Cepsilon is a nexus for Rho and Rap- mediated G protein-coupled receptor-induced astrocyte proliferation. Proc Natl Acad Sci U S A 104: 15543-15548, 2007. 55. Clarke LL and Boucher RC. Chloride secretory response to extracellular ATP in human normal and cystic fibrosis nasal epithelia. Am J Physiol 263: C348-356, 1992. 56. Coco S, Calegari F, Pravettoni E, Pozzi D, Taverna E, Rosa P, Matteoli M, and Verderio C. Storage and release of ATP from astrocytes in culture. J Biol Chem 278: 1354-1362, 2003. 57. Cotrina ML, Lin JH, Alves-Rodrigues A, Liu S, Li J, Azmi-Ghadimi H, Kang J, Naus CC, and Nedergaard M. Connexins regulate calcium signaling by controlling ATP release. Proc Natl Acad Sci U S A 95: 15735-15740, 1998. 58. Cotrina ML, Lin JH, Lopez-Garcia JC, Naus CC, and Nedergaard M. ATP-mediated glia signaling. J Neurosci 20: 2835-2844, 2000. 59. Cotrina ML, Lin JH, and Nedergaard M. Cytoskeletal assembly and ATP release regulate astrocytic calcium signaling. J Neurosci 18: 8794-8804, 1998. 60. D'Hondt C, Ponsaerts R, De Smedt H, Bultynck G, and Himpens B. Pannexins, distant relatives of the connexin family with specific cellular functions? Bioessays 31: 953-974, 2009. 61. D'Hondt C, Ponsaerts R, Srinivas SP, Vereecke J, and Himpens B. Thrombin inhibits intercellular calcium wave propagation in corneal endothelial cells by modulation of hemichannels and gap junctions. Invest Ophthalmol Vis Sci 48: 120-133, 2007. 62. D'Hondt C, Srinivas SP, Vereecke J, and Himpens B. Adenosine opposes thrombin-induced inhibition of intercellular calcium wave in corneal endothelial cells. Invest Ophthalmol Vis Sci 48: 1518-1527, 2007. 63. Dahl G and Locovei S. Pannexin: to gap or not to gap, is that a question? IUBMB Life 58: 409-419, 2006. 64. Darby M, Kuzmiski JB, Panenka W, Feighan D, and MacVicar BA. ATP released from astrocytes during swelling activates chloride channels. J Neurophysiol 89: 1870-1877, 2003. 65. De Vuyst E, Decrock E, Cabooter L, Dubyak GR, Naus CC, Evans WH, and Leybaert L. Intracellular calcium changes trigger connexin 32 hemichannel opening. EMBO J 25: 34-44, 2006. 66. Deaglio S, Dwyer KM, Gao W, Friedman D, Usheva A, Erat A, Chen JF, Enjyoji K, Linden J, Oukka M, Kuchroo VK, Strom TB, and Robson SC. Adenosine generation catalyzed by CD39 and CD73 expressed on regulatory T cells mediates immune suppression. J Exp Med 204: 1257-1265, 2007. 67. Diaz M, Bahamonde MI, Lock H, Munoz FJ, Hardy SP, Posas F, and Valverde MA. Okadaic acid-sensitive activation of Maxi Cl(-) channels by triphenylethylene antioestrogens in C1300 mouse neuroblastoma cells. J Physiol 536: 79-88, 2001.

203 68. Diller KR and Zhu L. Hypothermia therapy for brain injury. Annu Rev Biomed Eng 11: 135-162, 2009. 69. Dorsam RT, Kim S, Jin J, and Kunapuli SP. Coordinated signaling through both G12/13 and G(i) pathways is sufficient to activate GPIIb/IIIa in human platelets. J Biol Chem 277: 47588-47595, 2002. 70. Droogmans G, Maertens C, Prenen J, and Nilius B. Sulphonic acid derivatives as probes of pore properties of volume-regulated anion channels in endothelial cells. Br J Pharmacol 128: 35-40, 1999. 71. Droogmans G, Prenen J, Eggermont J, Voets T, and Nilius B. Voltage-dependent block of endothelial volume-regulated anion channels by calix[4]arenes. Am J Physiol 275: C646-652, 1998. 72. Duan D, Winter C, Cowley S, Hume JR, and Horowitz B. Molecular identification of a volume-regulated chloride channel. Nature 390: 417-421, 1997. 73. Duax WL, Ghosh D, and Pletnev V. Steroid dehydrogenase structures, mechanism of action, and disease. Vitam Horm 58: 121-148, 2000. 74. Dubyak GR. Both sides now: multiple interactions of ATP with pannexin- 1 hemichannels. Focus on "A permeant regulating its permeation pore: inhibition of pannexin 1 channels by ATP". Am J Physiol Cell Physiol 296: C235-241, 2009. 75. Dunwiddie TV, Diao L, and Proctor WR. Adenine nucleotides undergo rapid, quantitative conversion to adenosine in the extracellular space in rat hippocampus. J Neurosci 17: 7673-7682, 1997. 76. Dutta AK, Korchev YE, Shevchuk AI, Hayashi S, Okada Y, and Sabirov RZ. Spatial distribution of maxi-anion channel on cardiomyocytes detected by smart-patch technique. Biophys J 94: 1646-1655, 2008. 77. Dutta AK, Sabirov RZ, Uramoto H, and Okada Y. Role of ATP- conductive anion channel in ATP release from neonatal rat cardiomyocytes in ischaemic or hypoxic conditions. J Physiol 559: 799-812, 2004. 78. Elliott MR, Chekeni FB, Trampont PC, Lazarowski ER, Kadl A, Walk SF, Park D, Woodson RI, Ostankovich M, Sharma P, Lysiak JJ, Harden TK, Leitinger N, and Ravichandran KS. Nucleotides released by apoptotic cells act as a find-me signal to promote phagocytic clearance. Nature 461: 282-286, 2009. 79. Ellsworth ML, Ellis CG, Goldman D, Stephenson AH, Dietrich HH, and Sprague RS. Erythrocytes: oxygen sensors and modulators of vascular tone. Physiology (Bethesda) 24: 107-116, 2009. 80. Eltzschig HK, Eckle T, Mager A, Kuper N, Karcher C, Weissmuller T, Boengler K, Schulz R, Robson SC, and Colgan SP. ATP release from activated neutrophils occurs via connexin 43 and modulates adenosine- dependent endothelial cell function. Circ Res 99: 1100-1108, 2006. 81. Eskandari S, Zampighi GA, Leung DW, Wright EM, and Loo DD. Inhibition of gap junction hemichannels by chloride channel blockers. J Membr Biol 185: 93-102, 2002. 82. Evans WH, Ahmad S, Diez J, George CH, Kendall JM, and Martin PE. Trafficking pathways leading to the formation of gap junctions. Novartis Found Symp 219: 44-54; discussion 54-49, 1999. 83. Evans WH and Boitano S. Connexin mimetic peptides: specific inhibitors of gap-junctional intercellular communication. Biochem Soc Trans 29: 606-612, 2001. 84. Evans WH, De Vuyst E, and Leybaert L. The gap junction cellular internet: connexin hemichannels enter the signalling limelight. Biochem J 397: 1- 14, 2006.

204 85. Fahling M. Cellular oxygen sensing, signalling and how to survive translational arrest in hypoxia. Acta Physiol (Oxf) 195: 205-230, 2009. 86. Falke LC and Misler S. Activity of ion channels during volume regulation by clonal N1E115 neuroblastoma cells. Proc Natl Acad Sci U S A 86: 3919-3923, 1989. 87. Feliste R, Delebassee D, Simon MF, Chap H, Defreyn G, Vallee E, Douste-Blazy L, and Maffrand JP. Broad spectrum anti-platelet activity of ticlopidine and PCR 4099 involves the suppression of the effects of released ADP. Thromb Res 48: 403-415, 1987. 88. Fields RD and Burnstock G. Purinergic signalling in neuron-glia interactions. Nat Rev Neurosci 7: 423-436, 2006. 89. Fischmeister R and Hartzell HC. Volume sensitivity of the bestrophin family of chloride channels. J Physiol 562: 477-491, 2005. 90. Fisher SK, Cheema TA, Foster DJ, and Heacock AM. Volume- dependent osmolyte efflux from neural tissues: regulation by G-protein-coupled receptors. J Neurochem 106: 1998-2014, 2008. 91. Franco R, Panayiotidis MI, and de la Paz LD. Autocrine signaling involved in cell volume regulation: the role of released transmitters and plasma membrane receptors. J Cell Physiol 216: 14-28, 2008. 92. Franco R, Quesada O, and Pasantes-Morales H. Efflux of osmolyte amino acids during isovolumic regulation in hippocampal slices. J Neurosci Res 61: 701-711, 2000. 93. Gachet C. P2 receptors, platelet function and pharmacological implications. Thromb Haemost 99: 466-472, 2008. 94. Gatof D, Kilic G, and Fitz JG. Vesicular exocytosis contributes to volume-sensitive ATP release in biliary cells. Am J Physiol Gastrointest Liver Physiol 286: G538-546, 2004. 95. Genetos DC, Kephart CJ, Zhang Y, Yellowley CE, and Donahue HJ. Oscillating fluid flow activation of gap junction hemichannels induces ATP release from MLO-Y4 osteocytes. J Cell Physiol 212: 207-214, 2007. 96. George CH, Kendall JM, and Evans WH. Intracellular trafficking pathways in the assembly of connexins into gap junctions. J Biol Chem 274: 8678-8685, 1999. 97. Ghiringhelli F, Apetoh L, Tesniere A, Aymeric L, Ma Y, Ortiz C, Vermaelen K, Panaretakis T, Mignot G, Ullrich E, Perfettini JL, Schlemmer F, Tasdemir E, Uhl M, Genin P, Civas A, Ryffel B, Kanellopoulos J, Tschopp J, Andre F, Lidereau R, McLaughlin NM, Haynes NM, Smyth MJ, Kroemer G, and Zitvogel L. Activation of the NLRP3 inflammasome in dendritic cells induces IL-1beta-dependent adaptive immunity against tumors. Nat Med 15: 1170-1178, 2009. 98. Ghosh D, Wawrzak Z, Pletnev V, Erman M, Duax WL, Pangborn W, Zhu DW, Labrie F, and Lin SX. Molecular mechanism of inhibition of steroid dehydrogenases by licorice-derived steroid analogs in modulation of steroid receptor function. Ann N Y Acad Sci 761: 341-343, 1995. 99. Goldberg GS, Moreno AP, and Lampe PD. Gap junctions between cells expressing connexin 43 or 32 show inverse permselectivity to adenosine and ATP. J Biol Chem 277: 36725-36730, 2002. 100. Gomes P, Srinivas SP, Van Driessche W, Vereecke J, and Himpens B. ATP release through connexin hemichannels in corneal endothelial cells. Invest Ophthalmol Vis Sci 46: 1208-1218, 2005.

205 101. Gordon GR, Baimoukhametova DV, Hewitt SA, Rajapaksha WR, Fisher TE, and Bains JS. Norepinephrine triggers release of glial ATP to increase postsynaptic efficacy. Nat Neurosci 8: 1078-1086, 2005. 102. Grafstein B, Liu S, Cotrina ML, Goldman SA, and Nedergaard M. Meningeal cells can communicate with astrocytes by calcium signaling. Ann Neurol 47: 18-25, 2000. 103. Grynkiewicz G, Poenie M, and Tsien RY. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260: 3440- 3450, 1985. 104. Guizzetti M, Costa P, Peters J, and Costa LG. Acetylcholine as a mitogen: muscarinic receptor-mediated proliferation of rat astrocytes and human astrocytoma cells. Eur J Pharmacol 297: 265-273, 1996. 105. Guo Y, Satpathy M, Wilson G, and Srinivas SP. Benzalkonium chloride induces dephosphorylation of Myosin light chain in cultured corneal epithelial cells. Invest Ophthalmol Vis Sci 48: 2001-2008, 2007. 106. Halassa MM, Fellin T, and Haydon PG. Tripartite synapses: roles for astrocytic purines in the control of synaptic physiology and behavior. Neuropharmacology 57: 343-346, 2009. 107. Halassa MM, Fellin T, and Haydon PG. Tripartite synapses: Roles for astrocytic purines in the control of synaptic physiology and behavior. Neuropharmacology, 2009. 108. Hamill CE, Goldshmidt A, Nicole O, McKeon RJ, Brat DJ, and Traynelis SF. Special lecture: glial reactivity after damage: implications for scar formation and neuronal recovery. Clin Neurosurg 52: 29-44, 2005. 109. Harris AL. Connexin specificity of second messenger permeation: real numbers at last. J Gen Physiol 131: 287-292, 2008. 110. Hassinger TD, Guthrie PB, Atkinson PB, Bennett MV, and Kater SB. An extracellular signaling component in propagation of astrocytic calcium waves. Proc Natl Acad Sci U S A 93: 13268-13273, 1996. 111. Hay JC, Fisette PL, Jenkins GH, Fukami K, Takenawa T, Anderson RA, and Martin TF. ATP-dependent inositide phosphorylation required for Ca(2+)-activated secretion. Nature 374: 173-177, 1995. 112. Haydon PG and Carmignoto G. Astrocyte control of synaptic transmission and neurovascular coupling. Physiol Rev 86: 1009-1031, 2006. 113. Heacock AM, Dodd MS, and Fisher SK. Regulation of volume-sensitive osmolyte efflux from human SH-SY5Y neuroblastoma cells following activation of lysophospholipid receptors. J Pharmacol Exp Ther 317: 685-693, 2006. 114. Heacock AM, Kerley D, Gurda GT, VanTroostenberghe AT, and Fisher SK. Potentiation of the osmosensitive release of taurine and D-aspartate from SH-SY5Y neuroblastoma cells after activation of M3 muscarinic cholinergic receptors. J Pharmacol Exp Ther 311: 1097-1104, 2004. 115. Hernandez M, Barrero MJ, Crespo MS, and Nieto ML. Lysophosphatidic acid inhibits Ca2+ signaling in response to epidermal growth factor receptor stimulation in human astrocytoma cells by a mechanism involving phospholipase C(gamma) and a G(alphai) protein. J Neurochem 75: 1575-1582, 2000. 116. Herve JC, Derangeon M, Bahbouhi B, Mesnil M, and Sarrouilhe D. The connexin turnover, an important modulating factor of the level of cell-to-cell junctional communication: comparison with other integral membrane proteins. J Membr Biol 217: 21-33, 2007.

206 117. Hirakawa M, Oike M, Karashima Y, and Ito Y. Sequential activation of RhoA and FAK/paxillin leads to ATP release and actin reorganization in human endothelium. J Physiol 558: 479-488, 2004. 118. Hisadome K, Koyama T, Kimura C, Droogmans G, Ito Y, and Oike M. Volume-regulated anion channels serve as an auto/paracrine nucleotide release pathway in aortic endothelial cells. J Gen Physiol 119: 511-520, 2002. 119. Hoebertz A, Arnett TR, and Burnstock G. Regulation of bone resorption and formation by purines and pyrimidines. Trends Pharmacol Sci 24: 290-297, 2003. 120. Hoffmann EK, Lambert IH, and Pedersen SF. Physiology of cell volume regulation in vertebrates. Physiol Rev 89: 193-277, 2009. 121. Hollopeter G, Jantzen HM, Vincent D, Li G, England L, Ramakrishnan V, Yang RB, Nurden P, Nurden A, Julius D, and Conley PB. Identification of the platelet ADP receptor targeted by antithrombotic drugs. Nature 409: 202-207, 2001. 122. Honma S, Saika M, Ohkubo S, Kurose H, and Nakahata N. Thromboxane A2 receptor-mediated G12/13-dependent glial morphological change. Eur J Pharmacol 545: 100-108, 2006. 123. Horn F, Weare J, Beukers MW, Horsch S, Bairoch A, Chen W, Edvardsen O, Campagne F, and Vriend G. GPCRDB: an information system for G protein-coupled receptors. Nucleic Acids Res 26: 275-279, 1998. 124. Housley GD, Bringmann A, and Reichenbach A. Purinergic signaling in special senses. Trends Neurosci 32: 128-141, 2009. 125. Hubbard KB and Hepler JR. Cell signalling diversity of the Gqalpha family of heterotrimeric G proteins. Cell Signal 18: 135-150, 2006. 126. Iglesias R, Dahl G, Qiu F, Spray DC, and Scemes E. Pannexin 1: the molecular substrate of astrocyte "hemichannels". J Neurosci 29: 7092-7097, 2009. 127. Iglesias R, Locovei S, Roque A, Alberto AP, Dahl G, Spray DC, and Scemes E. P2X7 receptor-Pannexin1 complex: pharmacology and signaling. Am J Physiol Cell Physiol 295: C752-760, 2008. 128. Inoue H, Ohtaki H, Nakamachi T, Shioda S, and Okada Y. Anion channel blockers attenuate delayed neuronal cell death induced by transient forebrain ischemia. J Neurosci Res 85: 1427-1435, 2007. 129. Inoue K, Koizumi S, and Tsuda M. The role of nucleotides in the neuron--glia communication responsible for the brain functions. J Neurochem 102: 1447-1458, 2007. 130. Ishii K, Chen J, Ishii M, Koch WJ, Freedman NJ, Lefkowitz RJ, and Coughlin SR. Inhibition of thrombin receptor signaling by a G-protein coupled receptor kinase. Functional specificity among G-protein coupled receptor kinases. J Biol Chem 269: 1125-1130, 1994. 131. Ishii K, Hein L, Kobilka B, and Coughlin SR. Kinetics of thrombin receptor cleavage on intact cells. Relation to signaling. J Biol Chem 268: 9780- 9786, 1993. 132. Jackson PS, Morrison R, and Strange K. The volume-sensitive organic osmolyte-anion channel VSOAC is regulated by nonhydrolytic ATP binding. Am J Physiol 267: C1203-1209, 1994. 133. Jackson PS and Strange K. Characterization of the voltage-dependent properties of a volume-sensitive anion conductance. J Gen Physiol 105: 661-676, 1995.

207 134. Jalonen T. Single-channel characteristics of the large-conductance anion channel in rat cortical astrocytes in primary culture. Glia 9: 227-237, 1993. 135. Jin J, Mao Y, Thomas D, Kim S, Daniel JL, and Kunapuli SP. RhoA downstream of G(q) and G(12/13) pathways regulates protease-activated receptor-mediated dense granule release in platelets. Biochem Pharmacol 77: 835-844, 2009. 136. Johnson K, Polewski M, van Etten D, and Terkeltaub R. Chondrogenesis mediated by PPi depletion promotes spontaneous aortic calcification in NPP1-/- mice. Arterioscler Thromb Vasc Biol 25: 686-691, 2005. 137. Joseph SM, Buchakjian MR, and Dubyak GR. Colocalization of ATP release sites and ecto-ATPase activity at the extracellular surface of human astrocytes. J Biol Chem 278: 23331-23342, 2003. 138. Joseph SM, Pifer MA, Przybylski RJ, and Dubyak GR. Methylene ATP analogs as modulators of extracellular ATP metabolism and accumulation. Br J Pharmacol 142: 1002-1014, 2004. 139. Kanaporis G, Mese G, Valiuniene L, White TW, Brink PR, and Valiunas V. Gap junction channels exhibit connexin-specific permeability to cyclic nucleotides. J Gen Physiol 131: 293-305, 2008. 140. Kang J, Kang N, Lovatt D, Torres A, Zhao Z, Lin J, and Nedergaard M. Connexin 43 hemichannels are permeable to ATP. J Neurosci 28: 4702-4711, 2008. 141. Katoh K, Kano Y, Amano M, Kaibuchi K, and Fujiwara K. Stress fiber organization regulated by MLCK and Rho-kinase in cultured human fibroblasts. Am J Physiol Cell Physiol 280: C1669-1679, 2001. 142. Kawahara K and Takuwa N. Bombesin activates large-conductance chloride channels in Swiss 3T3 fibroblasts. Biochem Biophys Res Commun 177: 292-298, 1991. 143. Kim S, Foster C, Lecchi A, Quinton TM, Prosser DM, Jin J, Cattaneo M, and Kunapuli SP. Protease-activated receptors 1 and 4 do not stimulate G(i) signaling pathways in the absence of secreted ADP and cause human platelet aggregation independently of G(i) signaling. Blood 99: 3629-3636, 2002. 144. Kim SG, Gao ZG, Soltysiak KA, Chang TS, Brodie C, and Jacobson KA. P2Y6 nucleotide receptor activates PKC to protect 1321N1 astrocytoma cells against tumor necrosis factor-induced apoptosis. Cell Mol Neurobiol 23: 401-418, 2003. 145. Kim SG, Soltysiak KA, Gao ZG, Chang TS, Chung E, and Jacobson KA. Tumor necrosis factor alpha-induced apoptosis in astrocytes is prevented by the activation of P2Y6, but not P2Y4 nucleotide receptors. Biochem Pharmacol 65: 923-931, 2003. 146. Kimura C, Koyama T, Oike M, and Ito Y. Hypotonic stress-induced NO production in endothelium depends on endogenous ATP. Biochem Biophys Res Commun 274: 736-740, 2000. 147. Klages B, Brandt U, Simon MI, Schultz G, and Offermanns S. Activation of G12/G13 results in shape change and Rho/Rho-kinase-mediated myosin light chain phosphorylation in mouse platelets. J Cell Biol 144: 745-754, 1999. 148. Klausen TK, Hougaard C, Hoffmann EK, and Pedersen SF. Cholesterol modulates the volume-regulated anion current in Ehrlich-Lettre ascites cells via effects on Rho and F-actin. Am J Physiol Cell Physiol 291: C757-771, 2006.

208 149. Koyama T, Oike M, and Ito Y. Involvement of Rho-kinase and tyrosine kinase in hypotonic stress-induced ATP release in bovine aortic endothelial cells. J Physiol 532: 759-769, 2001. 150. Krapivinsky GB, Ackerman MJ, Gordon EA, Krapivinsky LD, and Clapham DE. Molecular characterization of a swelling-induced chloride conductance regulatory protein, pICln. Cell 76: 439-448, 1994. 151. Kreda SM, Seminario-Vidal L, Heusden C, and Lazarowski ER. Thrombin-promoted release of UDP-glucose from human astrocytoma cells. Br J Pharmacol 153: 1528-1537, 2008. 152. Kurth-Nelson ZL, Mishra A, and Newman EA. Spontaneous glial calcium waves in the retina develop over early adulthood. J Neurosci 29: 11339- 11346, 2009. 153. Laird DW. The life cycle of a connexin: gap junction formation, removal, and degradation. J Bioenerg Biomembr 28: 311-318, 1996. 154. LaMorte VJ, Harootunian AT, Spiegel AM, Tsien RY, and Feramisco JR. Mediation of growth factor induced DNA synthesis and calcium mobilization by Gq and Gi2. J Cell Biol 121: 91-99, 1993. 155. LaMorte VJ, Kennedy ED, Collins LR, Goldstein D, Harootunian AT, Brown JH, and Feramisco JR. A requirement for Ras protein function in thrombin-stimulated mitogenesis in astrocytoma cells. J Biol Chem 268: 19411- 19415, 1993. 156. Lazarowski ER and Boucher RC. Purinergic receptors in airway epithelia. Curr Opin Pharmacol 9: 262-267, 2009. 157. Lazarowski ER, Boucher RC, and Harden TK. Mechanisms of release of nucleotides and integration of their action as P2X- and P2Y-receptor activating molecules. Mol Pharmacol 64: 785-795, 2003. 158. Lee EL, Shimizu T, Ise T, Numata T, Kohno K, and Okada Y. Impaired activity of volume-sensitive Cl- channel is involved in cisplatin resistance of cancer cells. J Cell Physiol 211: 513-521, 2007. 159. Lee YK, Kim HL, Kim YL, and Im DS. Multiple actions of dimethylsphingosine in 1321N1 astrocytes. Mol Cells 23: 11-16, 2007. 160. Li G and Olson JE. Extracellular ATP activates chloride and taurine conductances in cultured hippocampal neurons. Neurochem Res 29: 239-246, 2004. 161. Li G and Olson JE. Purinergic activation of anion conductance and osmolyte efflux in cultured rat hippocampal neurons. Am J Physiol Cell Physiol 295: C1550-1560, 2008. 162. Li H, Liu TF, Lazrak A, Peracchia C, Goldberg GS, Lampe PD, and Johnson RG. Properties and regulation of gap junctional hemichannels in the plasma membranes of cultured cells. J Cell Biol 134: 1019-1030, 1996. 163. Lin JH, Lou N, Kang N, Takano T, Hu F, Han X, Xu Q, Lovatt D, Torres A, Willecke K, Yang J, Kang J, and Nedergaard M. A central role of connexin 43 in hypoxic preconditioning. J Neurosci 28: 681-695, 2008. 164. Litvin O, Tiunova A, Connell-Alberts Y, Panchin Y, and Baranova A. What is hidden in the pannexin treasure trove: the sneak peek and the guesswork. J Cell Mol Med 10: 613-634, 2006. 165. Liu HT, Akita T, Shimizu T, Sabirov RZ, and Okada Y. Bradykinin- induced astrocyte-neuron signalling: glutamate release is mediated by ROS- activated volume-sensitive outwardly rectifying anion channels. J Physiol 587: 2197-2209, 2009.

209 166. Liu HT, Sabirov RZ, and Okada Y. Oxygen-glucose deprivation induces ATP release via maxi-anion channels in astrocytes. Purinergic Signal 4: 147-154, 2008. 167. Liu HT, Toychiev AH, Takahashi N, Sabirov RZ, and Okada Y. Maxi- anion channel as a candidate pathway for osmosensitive ATP release from mouse astrocytes in primary culture. Cell Res 18: 558-565, 2008. 168. Locovei S, Bao L, and Dahl G. Pannexin 1 in erythrocytes: function without a gap. Proc Natl Acad Sci U S A 103: 7655-7659, 2006. 169. Locovei S, Wang J, and Dahl G. Activation of pannexin 1 channels by ATP through P2Y receptors and by cytoplasmic calcium. FEBS Lett 580: 239- 244, 2006. 170. Loomis WH, Namiki S, Ostrom RS, Insel PA, and Junger WG. Hypertonic stress increases T cell interleukin-2 expression through a mechanism that involves ATP release, P2 receptor, and p38 MAPK activation. J Biol Chem 278: 4590-4596, 2003. 171. Lustig KD, Shiau AK, Brake AJ, and Julius D. Expression cloning of an ATP receptor from mouse neuroblastoma cells. Proc Natl Acad Sci U S A 90: 5113-5117, 1993. 172. Lynch KR and Macdonald TL. Structure-activity relationships of lysophosphatidic acid analogs. Biochim Biophys Acta 1582: 289-294, 2002. 173. Ma W, Hui H, Pelegrin P, and Surprenant A. Pharmacological characterization of pannexin-1 currents expressed in mammalian cells. J Pharmacol Exp Ther 328: 409-418, 2009. 174. Maeno E, Ishizaki Y, Kanaseki T, Hazama A, and Okada Y. Normotonic cell shrinkage because of disordered volume regulation is an early prerequisite to apoptosis. Proc Natl Acad Sci U S A 97: 9487-9492, 2000. 175. Maeno E, Takahashi N, and Okada Y. Dysfunction of regulatory volume increase is a key component of apoptosis. FEBS Lett 580: 6513-6517, 2006. 176. Majumdar M, Seasholtz TM, Goldstein D, de Lanerolle P, and Brown JH. Requirement for Rho-mediated myosin light chain phosphorylation in thrombin-stimulated cell rounding and its dissociation from mitogenesis. J Biol Chem 273: 10099-10106, 1998. 177. Mall M, Wissner A, Gonska T, Calenborn D, Kuehr J, Brandis M, and Kunzelmann K. Inhibition of amiloride-sensitive epithelial Na(+) absorption by extracellular nucleotides in human normal and cystic fibrosis airways. Am J Respir Cell Mol Biol 23: 755-761, 2000. 178. Martins-Ferreira H, Nedergaard M, and Nicholson C. Perspectives on spreading depression. Brain Res Brain Res Rev 32: 215-234, 2000. 179. Martins I, Tesniere A, Kepp O, Michaud M, Schlemmer F, Senovilla L, Seror C, Metivier D, Perfettini JL, Zitvogel L, and Kroemer G. Chemotherapy induces ATP release from tumor cells. Cell Cycle 8, 2009. 180. McManus ML, Churchwell KB, and Strange K. Regulation of cell volume in health and disease. N Engl J Med 333: 1260-1266, 1995. 181. Melani A, Turchi D, Vannucchi MG, Cipriani S, Gianfriddo M, and Pedata F. ATP extracellular concentrations are increased in the rat striatum during in vivo ischemia. Neurochem Int 47: 442-448, 2005. 182. Meyer K and Korbmacher C. Cell swelling activates ATP-dependent voltage-gated chloride channels in M-1 mouse cortical collecting duct cells. J Gen Physiol 108: 177-193, 1996.

210 183. Mitchell CH, Zhang JJ, Wang L, and Jacob TJ. Volume-sensitive chloride current in pigmented ciliary epithelial cells: role of phospholipases. Am J Physiol 272: C212-222, 1997. 184. Mongin AA and Kimelberg HK. ATP potently modulates anion channel- mediated excitatory amino acid release from cultured astrocytes. Am J Physiol Cell Physiol 283: C569-578, 2002. 185. Mongin AA and Kimelberg HK. ATP regulates anion channel-mediated organic osmolyte release from cultured rat astrocytes via multiple Ca2+-sensitive mechanisms. Am J Physiol Cell Physiol 288: C204-213, 2005. 186. Montana V, Malarkey EB, Verderio C, Matteoli M, and Parpura V. Vesicular transmitter release from astrocytes. Glia 54: 700-715, 2006. 187. Moorman JR, Ackerman SJ, Kowdley GC, Griffin MP, Mounsey JP, Chen Z, Cala SE, O'Brian JJ, Szabo G, and Jones LR. Unitary anion currents through phospholemman channel molecules. Nature 377: 737-740, 1995. 188. Moorman JR and Jones LR. Phospholemman: a cardiac taurine channel involved in regulation of cell volume. Adv Exp Med Biol 442: 219-228, 1998. 189. Mulligan SJ and MacVicar BA. VRACs CARVe a path for novel mechanisms of communication in the CNS. Sci STKE 2006: pe42, 2006. 190. Murakami M, Shiraishi A, Tabata K, and Fujita N. Identification of the orphan GPCR, P2Y(10) receptor as the sphingosine-1-phosphate and lysophosphatidic acid receptor. Biochem Biophys Res Commun 371: 707-712, 2008. 191. Nedergaard M, Cooper AJ, and Goldman SA. Gap junctions are required for the propagation of spreading depression. J Neurobiol 28: 433-444, 1995. 192. Nicole O, Goldshmidt A, Hamill CE, Sorensen SD, Sastre A, Lyuboslavsky P, Hepler JR, McKeon RJ, and Traynelis SF. Activation of protease-activated receptor-1 triggers astrogliosis after brain injury. J Neurosci 25: 4319-4329, 2005. 193. Nilius B and Droogmans G. Amazing chloride channels: an overview. Acta Physiol Scand 177: 119-147, 2003. 194. Nilius B, Eggermont J, Voets T, and Droogmans G. Volume-activated Cl- channels. Gen Pharmacol 27: 1131-1140, 1996. 195. Nilius B, Oike M, Zahradnik I, and Droogmans G. Activation of a Cl- current by hypotonic volume increase in human endothelial cells. J Gen Physiol 103: 787-805, 1994. 196. Nilius B, Voets T, Prenen J, Barth H, Aktories K, Kaibuchi K, Droogmans G, and Eggermont J. Role of Rho and Rho kinase in the activation of volume-regulated anion channels in bovine endothelial cells. J Physiol 516 ( Pt 1): 67-74, 1999. 197. Noguchi K, Herr D, Mutoh T, and Chun J. Lysophosphatidic acid (LPA) and its receptors. Curr Opin Pharmacol 9: 15-23, 2009. 198. Novak I. ATP as a signaling molecule: the exocrine focus. News Physiol Sci 18: 12-17, 2003. 199. Offermanns S, Toombs CF, Hu YH, and Simon MI. Defective platelet activation in G alpha(q)-deficient mice. Nature 389: 183-186, 1997. 200. Okada SF, Nicholas RA, Kreda SM, Lazarowski ER, and Boucher RC. Physiological regulation of ATP release at the apical surface of human airway epithelia. J Biol Chem 281: 22992-23002, 2006. 201. Okada SF, O'Neal WK, Huang P, Nicholas RA, Ostrowski LE, Craigen WJ, Lazarowski ER, and Boucher RC. Voltage-dependent anion channel-1

211 (VDAC-1) contributes to ATP release and cell volume regulation in murine cells. J Gen Physiol 124: 513-526, 2004. 202. Okada Y, Maeno E, Shimizu T, Dezaki K, Wang J, and Morishima S. Receptor-mediated control of regulatory volume decrease (RVD) and apoptotic volume decrease (AVD). J Physiol 532: 3-16, 2001. 203. Okada Y, Sato K, and Numata T. Pathophysiology and puzzles of the volume-sensitive outwardly rectifying anion channel. J Physiol 587: 2141-2149, 2009. 204. Osman L, Chester AH, Amrani M, Yacoub MH, and Smolenski RT. A novel role of extracellular nucleotides in valve calcification: a potential target for atorvastatin. Circulation 114: I566-572, 2006. 205. Ossovskaya VS and Bunnett NW. Protease-activated receptors: contribution to physiology and disease. Physiol Rev 84: 579-621, 2004. 206. Pangrsic T, Potokar M, Stenovec M, Kreft M, Fabbretti E, Nistri A, Pryazhnikov E, Khiroug L, Giniatullin R, and Zorec R. Exocytotic release of ATP from cultured astrocytes. J Biol Chem 282: 28749-28758, 2007. 207. Parr CE, Sullivan DM, Paradiso AM, Lazarowski ER, Burch LH, Olsen JC, Erb L, Weisman GA, Boucher RC, and Turner JT. Cloning and expression of a human P2U nucleotide receptor, a target for cystic fibrosis pharmacotherapy. Proc Natl Acad Sci U S A 91: 13067, 1994. 208. Pasantes-Morales H, Franco R, Torres-Marquez ME, Hernandez- Fonseca K, and Ortega A. Amino acid osmolytes in regulatory volume decrease and isovolumetric regulation in brain cells: contribution and mechanisms. Cell Physiol Biochem 10: 361-370, 2000. 209. Pasantes-Morales H, Murray RA, Lilja L, and Moran J. Regulatory volume decrease in cultured astrocytes. I. Potassium- and chloride-activated permeability. Am J Physiol 266: C165-171, 1994. 210. Pascual O, Casper KB, Kubera C, Zhang J, Revilla-Sanchez R, Sul JY, Takano H, Moss SJ, McCarthy K, and Haydon PG. Astrocytic purinergic signaling coordinates synaptic networks. Science 310: 113-116, 2005. 211. Pasternack SM, von Kugelgen I, Aboud KA, Lee YA, Ruschendorf F, Voss K, Hillmer AM, Molderings GJ, Franz T, Ramirez A, Nurnberg P, Nothen MM, and Betz RC. G protein-coupled receptor P2Y5 and its ligand LPA are involved in maintenance of human hair growth. Nat Genet 40: 329-334, 2008. 212. Pearson RA, Dale N, Llaudet E, and Mobbs P. ATP released via gap junction hemichannels from the pigment epithelium regulates neural retinal progenitor proliferation. Neuron 46: 731-744, 2005. 213. Pelegrin P and Surprenant A. Pannexin-1 couples to maitotoxin- and nigericin-induced interleukin-1beta release through a dye uptake-independent pathway. J Biol Chem 282: 2386-2394, 2007. 214. Pelegrin P and Surprenant A. Pannexin-1 mediates large pore formation and interleukin-1beta release by the ATP-gated P2X7 receptor. EMBO J 25: 5071-5082, 2006. 215. Penuela S, Bhalla R, Gong XQ, Cowan KN, Celetti SJ, Cowan BJ, Bai D, Shao Q, and Laird DW. Pannexin 1 and pannexin 3 are glycoproteins that exhibit many distinct characteristics from the connexin family of gap junction proteins. J Cell Sci 120: 3772-3783, 2007. 216. Peracchia C. Chemical gating of gap junction channels; roles of calcium, pH and calmodulin. Biochim Biophys Acta 1662: 61-80, 2004.

212 217. Petzold GC, Albeanu DF, Sato TF, and Murthy VN. Coupling of neural activity to blood flow in olfactory glomeruli is mediated by astrocytic pathways. Neuron 58: 897-910, 2008. 218. Post GR, Collins LR, Kennedy ED, Moskowitz SA, Aragay AM, Goldstein D, and Brown JH. Coupling of the thrombin receptor to G12 may account for selective effects of thrombin on gene expression and DNA synthesis in 1321N1 astrocytoma cells. Mol Biol Cell 7: 1679-1690, 1996. 219. Preininger AM and Hamm HE. G protein signaling: insights from new structures. Sci STKE 2004: re3, 2004. 220. Prosdocimo DA, Douglas DC, Romani AM, O'Neill WC, and Dubyak GR. Autocrine ATP release coupled to extracellular pyrophosphate accumulation in vascular smooth muscle cells. Am J Physiol Cell Physiol 296: C828-839, 2009. 221. Pryazhnikov E and Khiroug L. Sub-micromolar increase in [Ca(2+)](i) triggers delayed exocytosis of ATP in cultured astrocytes. Glia 56: 38-49, 2008. 222. Ralevic V. Purines as neurotransmitters and neuromodulators in blood vessels. Curr Vasc Pharmacol 7: 3-14, 2009. 223. Ralevic V and Burnstock G. Receptors for purines and pyrimidines. Pharmacol Rev 50: 413-492, 1998. 224. Ramos-Mandujano G, Vazquez-Juarez E, Hernandez-Benitez R, and Pasantes-Morales H. Thrombin potently enhances swelling-sensitive glutamate efflux from cultured astrocytes. Glia 55: 917-925, 2007. 225. Ransford GA, Fregien N, Qiu F, Dahl G, Conner GE, and Salathe M. Pannexin 1 Contributes to ATP Release in Airway Epithelia. Am J Respir Cell Mol Biol, 2009. 226. Reyes JP, Hernandez-Carballo CY, Perez-Flores G, Perez-Cornejo P, and Arreola J. Lack of coupling between membrane stretching and pannexin-1 hemichannels. Biochem Biophys Res Commun 380: 50-53, 2009. 227. Risher WC, Andrew RD, and Kirov SA. Real-time passive volume responses of astrocytes to acute osmotic and ischemic stress in cortical slices and in vivo revealed by two-photon microscopy. Glia 57: 207-221, 2009. 228. Romanello M and D'Andrea P. Dual mechanism of intercellular communication in HOBIT osteoblastic cells: a role for gap-junctional hemichannels. J Bone Miner Res 16: 1465-1476, 2001. 229. Romanov RA, Rogachevskaja OA, Bystrova MF, Jiang P, Margolskee RF, and Kolesnikov SS. Afferent neurotransmission mediated by hemichannels in mammalian taste cells. EMBO J 26: 657-667, 2007. 230. Rosenbaum DM, Rasmussen SG, and Kobilka BK. The structure and function of G-protein-coupled receptors. Nature 459: 356-363, 2009. 231. Rouach N, Segal M, Koulakoff A, Giaume C, and Avignone E. Carbenoxolone blockade of neuronal network activity in culture is not mediated by an action on gap junctions. J Physiol 553: 729-745, 2003. 232. Rudkouskaya A, Chernoguz A, Haskew-Layton RE, and Mongin AA. Two conventional protein kinase C isoforms, alpha and betaI, are involved in the ATP-induced activation of volume-regulated anion channel and glutamate release in cultured astrocytes. J Neurochem, 2008. 233. Sabirov RZ, Dutta AK, and Okada Y. Volume-dependent ATP- conductive large-conductance anion channel as a pathway for swelling-induced ATP release. J Gen Physiol 118: 251-266, 2001. 234. Sabirov RZ and Okada Y. ATP release via anion channels. Purinergic Signal 1: 311-328, 2005.

213 235. Sabirov RZ and Okada Y. The maxi-anion channel: a classical channel playing novel roles through an unidentified molecular entity. J Physiol Sci 59: 3- 21, 2009. 236. Sabirov RZ and Okada Y. Wide nanoscopic pore of maxi-anion channel suits its function as an ATP-conductive pathway. Biophys J 87: 1672-1685, 2004. 237. Sabirov RZ, Prenen J, Tomita T, Droogmans G, and Nilius B. Reduction of ionic strength activates single volume-regulated anion channels (VRAC) in endothelial cells. Pflugers Arch 439: 315-320, 2000. 238. Sabirov RZ, Sheiko T, Liu H, Deng D, Okada Y, and Craigen WJ. Genetic demonstration that the plasma membrane maxianion channel and voltage-dependent anion channels are unrelated proteins. J Biol Chem 281: 1897-1904, 2006. 239. Saez JC, Retamal MA, Basilio D, Bukauskas FF, and Bennett MV. Connexin-based gap junction hemichannels: gating mechanisms. Biochim Biophys Acta 1711: 215-224, 2005. 240. Sagi SA, Seasholtz TM, Kobiashvili M, Wilson BA, Toksoz D, and Brown JH. Physical and functional interactions of Galphaq with Rho and its exchange factors. J Biol Chem 276: 15445-15452, 2001. 241. Sah VP, Seasholtz TM, Sagi SA, and Brown JH. The role of Rho in G protein-coupled receptor signal transduction. Annu Rev Pharmacol Toxicol 40: 459-489, 2000. 242. Sanchez-Olea R, Morales M, Garcia O, and Pasantes-Morales H. Cl channel blockers inhibit the volume-activated efflux of Cl and taurine in cultured neurons. Am J Physiol 270: C1703-1708, 1996. 243. Sawada K, Echigo N, Juge N, Miyaji T, Otsuka M, Omote H, Yamamoto A, and Moriyama Y. Identification of a vesicular nucleotide transporter. Proc Natl Acad Sci U S A 105: 5683-5686, 2008. 244. Scemes E. Components of astrocytic intercellular calcium signaling. Mol Neurobiol 22: 167-179, 2000. 245. Schwiebert EM, Mills JW, and Stanton BA. Actin-based cytoskeleton regulates a chloride channel and cell volume in a renal cortical collecting duct cell line. J Biol Chem 269: 7081-7089, 1994. 246. Seasholtz TM, Radeff-Huang J, Sagi SA, Matteo R, Weems JM, Cohen AS, Feramisco JR, and Brown JH. Rho-mediated cytoskeletal rearrangement in response to LPA is functionally antagonized by Rac1 and PIP2. J Neurochem 91: 501-512, 2004. 247. Seminario-Vidal L, Kreda S, Jones L, O'Neal W, Trejo J, Boucher RC, and Lazarowski ER. Thrombin promotes release of ATP from lung epithelial cells through coordinated activation of Rho- and Ca2+-dependent signaling pathways. J Biol Chem, 2009. 248. Shimizu T, Maeno E, and Okada Y. Prerequisite role of persistent cell shrinkage in apoptosis of human epithelial cells. Sheng Li Xue Bao 59: 512-516, 2007. 249. Shimizu T, Numata T, and Okada Y. A role of reactive oxygen species in apoptotic activation of volume-sensitive Cl(-) channel. Proc Natl Acad Sci U S A 101: 6770-6773, 2004. 250. Silver IA and Erecinska M. Intracellular and extracellular changes of [Ca2+] in hypoxia and ischemia in rat brain in vivo. J Gen Physiol 95: 837-866, 1990. 251. Silver J and Miller JH. Regeneration beyond the glial scar. Nat Rev Neurosci 5: 146-156, 2004.

214 252. Silverman W, Locovei S, and Dahl G. Probenecid, a gout remedy, inhibits pannexin 1 channels. Am J Physiol Cell Physiol 295: C761-767, 2008. 253. Spray DC, Ye ZC, and Ransom BR. Functional connexin "hemichannels": a critical appraisal. Glia 54: 758-773, 2006. 254. Srinivas M, Calderon DP, Kronengold J, and Verselis VK. Regulation of connexin hemichannels by monovalent cations. J Gen Physiol 127: 67-75, 2006. 255. Standaert M, Bandyopadhyay G, Galloway L, Ono Y, Mukai H, and Farese R. Comparative effects of GTPgammaS and insulin on the activation of Rho, phosphatidylinositol 3-kinase, and protein kinase N in rat adipocytes. Relationship to glucose transport. J Biol Chem 273: 7470-7477, 1998. 256. Steffens M, Gopel F, Ngezahayo A, Zeilinger C, Ernst A, and Kolb HA. Regulation of connexons composed of human connexin26 (hCx26) by temperature. Biochim Biophys Acta 1778: 1206-1212, 2008. 257. Sterns RH and Silver SM. Brain volume regulation in response to hypo- osmolality and its correction. Am J Med 119: S12-16, 2006. 258. Stout CE, Costantin JL, Naus CC, and Charles AC. Intercellular calcium signaling in astrocytes via ATP release through connexin hemichannels. J Biol Chem 277: 10482-10488, 2002. 259. Strange K, Emma F, and Jackson PS. Cellular and molecular physiology of volume-sensitive anion channels. Am J Physiol 270: C711-730, 1996. 260. Suadicani SO, Brosnan CF, and Scemes E. P2X7 receptors mediate ATP release and amplification of astrocytic intercellular Ca2+ signaling. J Neurosci 26: 1378-1385, 2006. 261. Suadicani SO, Flores CE, Urban-Maldonado M, Beelitz M, and Scemes E. Gap junction channels coordinate the propagation of intercellular Ca2+ signals generated by P2Y receptor activation. Glia 48: 217-229, 2004. 262. Suzuki M, Ogawa A, Sakurai Y, Nishino A, Venohara K, Mizoi K, and Yoshimoto T. Thrombin activity in cerebrospinal fluid after subarachnoid hemorrhage. Stroke 23: 1181-1182, 1992. 263. Szabo I, Lepple-Wienhues A, Kaba KN, Zoratti M, Gulbins E, and Lang F. Tyrosine kinase-dependent activation of a chloride channel in CD95- induced apoptosis in T lymphocytes. Proc Natl Acad Sci U S A 95: 6169-6174, 1998. 264. Takano T, Kang J, Jaiswal JK, Simon SM, Lin JH, Yu Y, Li Y, Yang J, Dienel G, Zielke HR, and Nedergaard M. Receptor-mediated glutamate release from volume sensitive channels in astrocytes. Proc Natl Acad Sci U S A 102: 16466-16471, 2005. 265. Takano T, Oberheim N, Cotrina ML, and Nedergaard M. Astrocytes and ischemic injury. Stroke 40: S8-12, 2009. 266. Tatur S, Groulx N, Orlov SN, and Grygorczyk R. Ca2+-dependent ATP release from A549 cells involves synergistic autocrine stimulation by coreleased uridine nucleotides. J Physiol 584: 419-435, 2007. 267. Tatur S, Kreda S, Lazarowski E, and Grygorczyk R. Calcium- dependent release of adenosine and uridine nucleotides from A549 cells. Purinergic Signal 4: 139-146, 2008. 268. Thompson RJ, Zhou N, and MacVicar BA. Ischemia opens neuronal gap junction hemichannels. Science 312: 924-927, 2006.

215 269. Tominaga M, Tominaga T, Miwa A, and Okada Y. Volume-sensitive chloride channel activity does not depend on endogenous P-glycoprotein. J Biol Chem 270: 27887-27893, 1995. 270. Trejo J. Protease-activated receptors: new concepts in regulation of G protein-coupled receptor signaling and trafficking. J Pharmacol Exp Ther 307: 437-442, 2003. 271. Trexler EB, Bennett MV, Bargiello TA, and Verselis VK. Voltage gating and permeation in a gap junction hemichannel. Proc Natl Acad Sci U S A 93: 5836-5841, 1996. 272. Trexler EB, Bukauskas FF, Kronengold J, Bargiello TA, and Verselis VK. The first extracellular loop domain is a major determinant of charge selectivity in connexin46 channels. Biophys J 79: 3036-3051, 2000. 273. Tu J and Wang LP. Therapeutic potential of extracellular ATP and P2 receptors in nervous system diseases. Neurosci Bull 25: 27-32, 2009. 274. Upadhyay A, Jaber BL, and Madias NE. Incidence and prevalence of hyponatremia. Am J Med 119: S30-35, 2006. 275. Vaca L and Kunze DL. cAMP-dependent phosphorylation modulates voltage gating in an endothelial Cl- channel. Am J Physiol 264: C370-375, 1993. 276. Valera S, Hussy N, Evans RJ, Adami N, North RA, Surprenant A, and Buell G. A new class of ligand-gated ion channel defined by P2x receptor for extracellular ATP. Nature 371: 516-519, 1994. 277. van der Wijk T, Tomassen SF, Houtsmuller AB, de Jonge HR, and Tilly BC. Increased vesicle recycling in response to osmotic cell swelling. Cause and consequence of hypotonicity-provoked ATP release. J Biol Chem 278: 40020-40025, 2003. 278. Verkhratsky A, Krishtal OA, and Burnstock G. Purinoceptors on neuroglia. Mol Neurobiol 39: 190-208, 2009. 279. Verselis VK and Srinivas M. Divalent cations regulate connexin hemichannels by modulating intrinsic voltage-dependent gating. J Gen Physiol 132: 315-327, 2008. 280. Vessey JP, Lalonde MR, Mizan HA, Welch NC, Kelly ME, and Barnes S. Carbenoxolone inhibition of voltage-gated Ca channels and synaptic transmission in the retina. J Neurophysiol 92: 1252-1256, 2004. 281. Vogelsgesang M, Pautsch A, and Aktories K. C3 exoenzymes, novel insights into structure and action of Rho-ADP-ribosylating toxins. Naunyn Schmiedebergs Arch Pharmacol 374: 347-360, 2007. 282. Voss B, McLaughlin JN, Holinstat M, Zent R, and Hamm HE. PAR1, but not PAR4, activates human platelets through a Gi/o/phosphoinositide-3 kinase signaling axis. Mol Pharmacol 71: 1399-1406, 2007. 283. Wang Y, Roman R, Lidofsky SD, and Fitz JG. Autocrine signaling through ATP release represents a novel mechanism for cell volume regulation. Proc Natl Acad Sci U S A 93: 12020-12025, 1996. 284. Wang Z, Haydon PG, and Yeung ES. Direct observation of calcium- independent intercellular ATP signaling in astrocytes. Anal Chem 72: 2001-2007, 2000. 285. Webb TE, Simon J, Krishek BJ, Bateson AN, Smart TG, King BF, Burnstock G, and Barnard EA. Cloning and functional expression of a brain G- protein-coupled ATP receptor. FEBS Lett 324: 219-225, 1993. 286. Weerasinghe RR, Swanson SJ, Okada SF, Garrett MB, Kim SY, Stacey G, Boucher RC, Gilroy S, and Jones AM. Touch induces ATP release

216 in Arabidopsis roots that is modulated by the heterotrimeric G-protein complex. FEBS Lett 583: 2521-2526, 2009. 287. Wehner F, Numata T, Subramanyan M, Takahashi N, and Okada Y. Signalling events employed in the hypertonic activation of cation channels in HeLa cells. Cell Physiol Biochem 20: 75-82, 2007. 288. Weissen-Plenz G, Nitschke Y, and Rutsch F. Mechanisms of arterial calcification: spotlight on the inhibitors. Adv Clin Chem 46: 263-293, 2008. 289. Wettschureck N and Offermanns S. Mammalian G proteins and their cell type specific functions. Physiol Rev 85: 1159-1204, 2005. 290. Wong CW, Christen T, Roth I, Chadjichristos CE, Derouette JP, Foglia BF, Chanson M, Goodenough DA, and Kwak BR. Connexin37 protects against atherosclerosis by regulating monocyte adhesion. Nat Med 12: 950-954, 2006. 291. Woulfe DS. Platelet G protein-coupled receptors in hemostasis and thrombosis. J Thromb Haemost 3: 2193-2200, 2005. 292. Wu JC, Tsai RY, and Chung TH. Role of catenins in the development of gap junctions in rat cardiomyocytes. J Cell Biochem 88: 823-835, 2003. 293. Xi G, Reiser G, and Keep RF. The role of thrombin and thrombin receptors in ischemic, hemorrhagic and traumatic brain injury: deleterious or protective? J Neurochem 84: 3-9, 2003. 294. Xiong ZG and MacDonald JF. Sensing of extracellular calcium by neurones. Can J Physiol Pharmacol 77: 715-721, 1999. 295. Yanagida K, Ishii S, Hamano F, Noguchi K, and Shimizu T. LPA4/p2y9/GPR23 mediates rho-dependent morphological changes in a rat neuronal cell line. J Biol Chem 282: 5814-5824, 2007. 296. Ye ZC, Oberheim N, Kettenmann H, and Ransom BR. Pharmacological "cross-inhibition" of connexin hemichannels and swelling activated anion channels. Glia 57: 258-269, 2009. 297. Yegutkin GG, Henttinen T, and Jalkanen S. Extracellular ATP formation on vascular endothelial cells is mediated by ecto-nucleotide kinase activities via phosphotransfer reactions. FASEB J 15: 251-260, 2001. 298. Yegutkin GG, Henttinen T, Samburski SS, Spychala J, and Jalkanen S. The evidence for two opposite, ATP-generating and ATP-consuming, extracellular pathways on endothelial and lymphoid cells. Biochem J 367: 121- 128, 2002. 299. Zeng JW, Liu XH, He WJ, Du L, Zhang JH, Wu XG, and Ruan HZ. Inhibition of ATP-induced glutamate release by MRS2179 in cultured dorsal spinal cord astrocytes. Pharmacology 82: 257-263, 2008. 300. Zhang JM, Wang HK, Ye CQ, Ge W, Chen Y, Jiang ZL, Wu CP, Poo MM, and Duan S. ATP released by astrocytes mediates glutamatergic activity- dependent heterosynaptic suppression. Neuron 40: 971-982, 2003. 301. Zhang Z, Chen G, Zhou W, Song A, Xu T, Luo Q, Wang W, Gu XS, and Duan S. Regulated ATP release from astrocytes through lysosome exocytosis. Nat Cell Biol 9: 945-953, 2007. 302. Zhao HB, Yu N, and Fleming CR. Gap junctional hemichannel-mediated ATP release and hearing controls in the inner ear. Proc Natl Acad Sci U S A 102: 18724-18729, 2005. 303. Zsiros V and Maccaferri G. Noradrenergic modulation of electrical coupling in GABAergic networks of the hippocampus. J Neurosci 28: 1804-1815, 2008.

217