13: 45-60, 2004
Xiphinema elongatum
1 2 3 2 4,5
1 2 3 4 5 [email protected] : +886-4-22876712 93 1 25
. 2004. Xiphinema elongatum . 13: 45-60.
1998 2002 10 Xiphinema elongatum 4
4 10 X. elongatum
(supplements) 3-4 rDNA 3 (Xelo3 ) ITS-1 ITS-2 (0 1.34 %) X. elongatum
rDNA X. elongatum
Xiphinema elongatum ribosomal DNA rDNA ITS-1 ITS-2
X. pratense Loos, 1949 4 (syntypes) X. campinense Lordello, 1951 3 Xiphinema elongatum Schuurmans Stekhoven & (topotypes) X. Teunissen, 1938 (type locality) elongatum (synonym) Cohn Sher(5) (Zaire, , Congo) Rutshuru X. truncatum Thorne, 1939 X. elongatum (type host) (27) (12) (19) (5) (12) Heyns Luc Dalmasso (Hawaii) (South Africa) (Surinam)(17) (8,18) (species inquirenda) (20) X. elongatum X. elongatum (12) (holotype) (variability) Heyns Tarjan Luc (27) X. elongatum (20) (morphometrics) L Luc Southey ( ) = 2.089 mm a = 49 b = 6.1 c = 35 c' = 2.5 V 22 = 40 total stylet ( ) = 153 m functional (group) odontostyle ( ) = 94 m odontophore ( ) = 59 m tail ( ) = 59 m Tarjan Luc 46 13 1 2004
Luc Southey (20) (Mauritius) "on the spot" (differentiation) Xu (31) (Zhangzhou) (cockscomb) (2) X.elongatum Wang (30) 100 24 (Shenzhen) (citrus) Pan (22) (Gulangyu Island) (Stemi SV 6, ZEISS, Germany) (Xiamen) 4 3 4 X. elongatum (37% aqueous solution, SIGMA, USA)
(replacement odontostyle) (6) X. elongatum
(3)
(25) (intraspecific variation) Robbins ( Axiolab, ZEISS, Germany) (MC80) (35mm, ISO 100, Elite X. elongatum Chrome, Kodak, USA) (NOVAMAT 150 AFI-M monitor, BRAUN, (parthenogenesis) Germany) (12) (anal body width) (Burundi)(7) X. elongatum (spicule) DNA (ribosomal DNA, rDNA) (molecular markers) (copy numbers) (coding region,
18S, 5.8S, 28S gene) (conserved sequences) (3,6) (universal 10 primers) (noncoding region, internal transcribed spacer 1 or 2, ITS-1, ITS-2) PCR rDNA "concerted evolution" (11) DNA (intraspecific) (interspecific) ITS-1 ITS-2 Xelo1 Xelo3 Xelo8 3 DNA (1,4,9,10,13,14,15,16,21,23,26,28,29)
X. elongatum 50 200 rDNA DNA [200 mM Tris-HCl, pH8.5, 250mM NaCl, 25 mM EDTA, 10 rDNA % w/v sodium dodecyl-sulphate plus 0.5 g/ul proteinase K ITS-1 ITS-2 (Roche, Mannheim, Germany) 37 12-14 12000 x g Xiphinema elongatum 47
10 DNA LB (WizardTM DNA Clean-Up Promega Cooperation, Madison, (S-ITS-1 P28S) PCR WI, USA) DNA, rDNA resin 900 g (22-24 ) rDNA (Taipei, Taiwan) 1 spin column DNA 2ml 80 isopropanol spin column rDNA spin column rDNA isopropanol 65 25-50 g Xelo3 (transformated spin column 1 12000 xg clone) Xelo1 Xelo8 3 20 spin column DNA 3 Genetics Computer Group (GCG) DNA -20 SeqWeb 2.1 Pretty program (multiple sequences alignment) (consensus sequence) rDNA rDNA X. Vrain (29) rDNA elongatum rDNA PCR S-ITS-1 18S 3' 7 5' TTGATTACGTCCCTGCCCTTT 3' 3 P28S 28S 5' 5' ITS-1 5.8S ITS-2 TTTCACTCGCCGTTACTAAGG 3' GAP program rDNA ITS-1 ITS-2 5.8S gap weight = 50, length weight = 18S 28S PCR 3 ITS-1 ITS-2 5.8S 50 l 1 M 1.25 ( Taq polymerase (Yeastern Biotech Co. Taipei, Taiwan) 1 ) BestFit program X Taq DNA polymerase buffer A T C G rDNA deoxyribonucleotide (dATP, dTTP dCTP, dGTP) 0.1 mM PCR (BioRad iCycler, Hercules, CA, USA) 94 4 94 30 52 30 72 2 30 72 7 PCR Xiphinema elongatum 4 10 1 X TBE buffer (40 mM Tris, 20 mM Boric acid, and 1 mM EDTA, pH 8.0) 1.5 agarose gel 10 X. elongatum ( ) DNA 3 7 rDNA (Xelo3) PCR PCR-M clean up system (Viogene, 2.31 Taipei, Taiwan) PCR mm 2.15 2.50 mm pGEM-T easy (Promega, USA) yT&A (Xelo8) (Xelo10) 2 (Yeastern Biotech. Taipei, Taiwan) 2.14 2.03 (Escherichia coli, ECOS101, mm a b c 10 Yeastern Biotech. Taipei, Taiwan) c' V 100 l IPTG (5-bromo-4-chloro-3-indoyl- V -D-galactoside, 100 mM) 20 l X-gal (isopropylthio- 39.10 40.42 -D -galactosidase, 50 mg/ml) ampicillin (100 g/ml) 48 13 1 2004
Xiphinema elongatum Table 1. The list of geographical populations of Xiphinema elongatum investigated in this study Code Locality Host Xelo1 Shinshe Shiang, Taichung County Loquat (Eriobotrya japonica Lindl.) Xelo2 Guoshing Shiang, Nantou County Loquat (Eriobotrya japonica Lindl.) Xelo3 Daya Shiang, Taichung County Bermuda-grass (Cynodon dactylon Pers.) (On green of golf course) Xelo4 Taichung City Bermuda-grass (Cynodon dactylon Pers.) (On green of golf course) Xelo5 Wufeng Shiang, Taichung County Bermuda-grass (Cynodon dactylon Pers.) (On green of golf course) Xelo6 Shinhua Jen, Tainan County Bamboo (Bambusa sp.) Xelo7 Taichung City Bamboo (Bambusa sp.) Xelo8 Tsautuen Jen, Nantou County Sweet orange (Citrus sinensis Osb.) Xelo9 Dahu Shiang, Miaoli County Plum (Prunus salicina Lindl.) Xelo10 Taitung City, Taitung County Sugar apple (Annona squamosa L.)
X. elongatum ( ) A, B, 2 C, D, E F, (F ) G, H, I J 90 Fig. 1. X. elongatum (female and juvenile) from Taiwan: A, Female habitus; B, Anterior region of two females; C, D, E and F, Female tails (F is abnormal); G, H, I and J, Tails of the first, second, third and fourth stage of juveniles, respectively. Scale bar = 90 m. Xiphinema elongatum 49 3.44 5.89 1.93 1.07 2.79 1.70 4.00 1.00 0.61 0.16 0.15 3.19 143.62 4.87 56.93 1.92 35.56 1.25 39.29 2.43 86.90 1.603.00 56.71 1.00 58.00 22.00 0.11 2.06 0.28 6.56 0.17 2.61 3.28 145.07 4.31 57.65 2.24 35.65 1.46 39.59 2.78 88.34 1.983.00 56.73 1.00 56.00 22.00 0.11 2.00 0.49 5.99 0.15 2.55 2.82 145.09 2.72 61.64 2.20 37.39 1.25 40.88 2.39 87.05 1.414.00 58.04 1.00 59.00 22.00 0.11 2.19 0.35 6.57 0.17 2.63 Host Locality (Code) 3.57 147.48 1.87 38.81 1.43 40.40 3.20 87.96 1.61 59.53 3.00 57.00 1.00 23.00 2.39 55.58 0.09 2.19 0.36 6.38 0.12 2.47 female populations isolated from Taiwan, Zaire, Thailand, Philippines, and Mainland China female populations isolated from Taiwan, 3.17 146.25 4.11 60.11 2.73 39.30 1.22 39.55 2.53 87.47 1.503.00 58.78 1.00 59.00 23.00 0.13 2.31 0.47 6.96 0.19 2.56 X. elongatum 1.97 1 3.07 145.47 2.75 55.53 2.76 36.35 1.17 39.44 2.44 88.85 1.96 56.61 5.00 54.00 1.00 22.00 0.11 0.36 5.88 0.23 2.49 (49.19-61.71)6.03 (48.65-68.67)(32.61-46.22) (55.90-64.10) (30.88-42.80) (50.25-61.62)(37.30-42.70) (36.45-43.04) (52.56-69.39) (37.50-42.40) (34.71-44.58) (47.84-65.76) (36.30-41.90) (32.54-42.41) (47.03-72.33) (38.00-43.50) (31.00-40.00) (37.90-43.30) (32.22-40.86) (36.30-42.70) (37.00-41.10) (5.23-6.74)38.27 (5.06-7.21)(1.87-3.00) (6.31-7.78) (2.22-2.85) (5.83-7.10) (2.35-2.78) (5.64-8.03) (2.09-2.96) (5.47-6.42) (2.33-3.00) (5.27-7.90) (2.30-2.86) (2.26-2.90) Shinshe (Xelo1)Loquat Guoshing (Xelo2) Daya (Xelo3) (Xelo4) Taichung Loquat (Xelo5) Wufeng Shinhua (Xelo6) Bermuda-grass (Xelo7) Taichung Bermuda-grass Bermuda-grass Bamboo Bamboo (1.82-2.25)55.74 (1.72-2.18) (2.15-2.50) (1.89-2.36) (1.99-2.41) (1.77-2.17) (1.74-2.37) X. elongatum m) (19.00-23.00) (20.00-23.00) (22.00-25.00) (22.00-24.00) (20.00-25.00) (20.00-24.00) (19.00-25.00) m) m)m) (51.70-61.70) (53.30-60.80) (43.00-69.00) (48.00-58.00) (56.70-62.50) (57.50-62.50) (54.00-64.00) (48.00-68.00) (51.70-60.80) (52.00-63.00) (55.00-61.70) (51.00-63.00) (51.70-60.00) (51.00-64.00) m) (140.80-155.80) (140.00-153.30) (140.80-153.00) (141.70-155.00) (138.30-150.80) (140.00-151.70) (137.50-149.20) ( ( ( width ( ( otal stylet 147.44 ail 53.00 odontostyle (85.00-96.60) (84.20-93.40) (80.00-93.30) (84.10-92.50) (81.70-93.30) (83.30-92.50) (83.30-91.60) b c'T 2.37 c V % 39.96 Functional 90.09 Odontophore 57.35 T Anal body 22.00 n27302825292523 L (mm) 2.02 Character a able 2. Comparisons on morphometrics of T 50 13 1 2004 4 Shenzhen, China 3 0.18 2.0, 2.1 4.3 56, 72 1.6 39, 39 1.5 145, 149 0.2 2.8, 2.9 2.0 87, 88 2.3 57, 62 Philippines 3 2.2 152 1.8 91 1.6 61 Thailand 3 ) 2.0 93 ( Thailand 2 Host Locality (Code) 2.76 153 147.5 150 4.41 491.51 35 51.90.65 40 51.3 56.1 35.71.62 94 37.41.80 38.23.00 59 34 (n = 8) 38.42.00 59 91.5 33, 37 - 39.9 56 59.5 57 - 61.5 64 (n = 8) - 57, 61 - 20, 22 0.07 2.0890.36 6.1 2.150.14 2.30 2.3 - 2.47 2.5 - 2.6 - 2.8 5.5, - female populations isolated from Taiwan, Zaire, Thailand, Philippines, and Mainland China (Cont'd) female populations isolated from Taiwan, 3.33 142.84 4.67 55.77 2.59 35.21 1.99 39.10 2.50 85.93 1.625.00 56.91 1.00 54.00 21.00 0.13 1.91 0.46 6.03 0.22 2.63 X. elongatum SD (range), "-" = No data. 1.96 146.22 3.60 56.17 2.67 35.14 1.20 40.42 1.74 89.15 1.273.00 57.07 1.00 58.00 23.00 0.08 2.03 0.30 6.25 0.19 2.58 sautuen (Xelo8) Dahu (Xelo9) (Xelo10) Taitung Zaire (holotype) ., 1996 (30) (2.13-2.89) (2.13-3.09) (2.41-2.80) (2.3-2.6) (2.5-2.8) (2.6-3.2) T (33.16-42.04) (30.00-40.20) (32.98-37.60) (32.7-40.3) (37.9-39.6) (32-37) Sweet orange Plum Sugar apple(5.14-6.30)37.74 Unknown (5.44-7.09) Asparagus (5.66-6.55) Carnation Sugarcane Citrus (1.85-2.14)59.53 (49.50-66.33) (1.74-2.27)5.71 (50.00-64.24) (1.81-2.03) (50.81-62.67)(37.10-41.70) (37.10-44.60) (48.3-56.9) (2.03-2.24) (38.10-40.10) (47.9-55.7) (2.15-2.45) (49.8-68.2) (2.11-2.72) (36.9-39.5) (35.1-40.5) (37.0-43.0) et al X. elongatum m) (19.00-23.00) (21.00-25.00) (19.00-23.00) m)m) (141.70-150.00) (140.80-154.20)m) (140.80-148.30)m) (55.00-60.00) (47.00-57.00) (54.20-61.70) (48.00-68.00) (55.00-59.20) (146-151) (50.00-58.00) (147-153) (149-154) (54-59) (54-64) (55-59) (58-65) (56-65) (58-70) ( ( width ( ( ( ail 53.00 otal stylet 145.83 odontostyle (85.90-93.30) (85.00-93.30) (84.10-89.10) (89-94) (91-95) (89-97) V % 40.03 Character c' 2.50 2171 85202 n21197 L (mm) 2.00 c Functional 88.65 Odontophore 57.18 T Anal body 21.00 a b T able 2. Comparisons on morphometrics of Reference: Luc, M. & Southey, J. F. 1980 (20) J. F. Reference: Luc, M. & Southey, Reference: Wang, Measurements in the form: mean A. C. & Luc, M., 1963 (27) Reference: Tarjan T 1 2 3 4 Xiphinema elongatum 51
X. elongatum (Xelo4) A, B, C, D E, (E ) 90 Fig. 2. X. elongatum (male) from Taiwan (Xelo4): A, Male habitus; B, Anterior region of male; C, D and E, Tails of males (E is abnormal); Scale bar = 90 m.
53 59 m Xelo3 Xelo7 X. elongatum ( Xelo8 A) ( B) Xelo8 2 3 (conoid) (anus) 2.5 ( ( C, D, E) ( F) , G, H, I, J) (anal body width) X. elongatum 10 Xelo10 9 4 X. elongatum ( ) 10 X. elongatum (Xelo4) 8 ( ) Xelo3 Xelo4 Xelo5 3 7 a b c 10 c' ( , A) (spicule) 3 4 (supplements)( , C, D, E) 4 ( , E) 52 13 1 2004 2.53 2.99 1.84 3.02 1.79 2.37 3.00 1.00 0.12 0.47 0.17 1.80) 6.00) 3.39) 2.92 53.63 1.24 26.58 2.37 73.01 1.40 48.61 4.20 88.02 2.00 58.00 1.00 19.00 3.03 121.62 0.07 1.54 0.42 5.04 0.25 3.07 00) (44.29-54.29) (48.33-58.00) 02) (18.91-23.40) (24.38-30.51) .00) (14.00-18.00) (18.00-21.00) 2.74 48.08 0.98 20.98 2.79 58.07 1.44 40.83 3.00 54.00 1.00 16.00 2.71 71.20 3.14 98.90 3.00) (51.00-60.00) (52.00-64.00) 6.70) (38.30-43.30) (45.00-50.80) 0.06 1.13 0.24 4.62 0.24 3.34 7.50-91.70) (93.30-105.00) (116.70-125.80) (42.50-55.90) (52.50-63.30) (68.40-79.20) (51.70-64.20) (65.00-78.30) (82.50-92.50) ) ) 1.95 41.55 0.84 16.83 1.73 45.77 1.30 34.92 1.29 57.11 3.00 50.00 1.00) 14.00 1.91 80.69 0.03 0.83 0.20 4.03 0.27 3.68 2.93 62.03 3.34 34.42 1.41 14.63 2.24 32.91 1.67 29.12 3.15 45.08 3.00 44.00 1.00 12.00 0.10 0.64 0.34 3.72 0.18 3.80 2.24 122.47 4.02 49.98 0.71 26.23 1.48 73.35 1.10 49.12 2.11 91.33 3.00 56.00 1.00 19.00 0.05 1.48 0.25 4.84 0.19 2.97 Host Locality (Code) 2.83 45.18 1.12 20.33 1.50 59.65 0.76 42.14 1.95 75.64 3.00 54.00 1.00 16.00 1.68 101.79 0.04 1.10 0.29 4.35 0.22 3.38 4.05 39.53 0.73 16.88 1.02 46.10 0.85 36.24 0.80 61.73 2.00 49.00 1.00 14.00 1.27 82.34 0.04 0.83 0.31 4.05 0.29 3.65 isolated from Taiwan and Philippines isolated from Taiwan 2.75 63.04 3.42 35.28 2.00 13.87 2.19 34.16 1.01 28.87 2.03 45.68 2.00 43.00 1.00 11.00 0.11 0.60 0.42 3.55 0.14 3.96 X. elongatum 2.28 124.59 3.56 48.90 1.15 27.77 1.67 74.64 1.28 49.94 6.98 91.97 3.00 54.00 1.00 21.00 0.31 4.95 0.22 2.63 0.04 1.50 5181416212523191818 2.42 43.56 1.01 20.55 1.42 60.65 1.31 42.40 2.09 73.61 1.00 54.00 1.00 17.00 2.12 103.05 0.05 1.11 0.29 4.36 0.26 3.26 0.85 1 2.33 40.34 0.68 17.38 1.38 46.16 0.90 36.41 1.01 62.33 3.00 49.00 1.00 14.00 1.53 82.56 0.04 0.30 4.12 0.37 3.52 X. elongatum Shinshe (Xelo1)Loquat Guoshing (Xelo2) Loquat Daya (Xelo3) Bermuda-grass (0.54-0.68) (0.79-0.96) (1.03-1.16) (1.29-1.66)(3.00-4.25) (0.54-0.69) (3.73-4.63) (0.76-0.90) (3.89-5.00) (1.03-1.23) (4.23-5.59)(3.17-4.60) (1.29-1.68) (3.11-4.06) (2.94-4.00) (0.58-0.68) (3.57-4.53) (2.94-3.63) (0.76-0.97) (3.81-5.13) (2.41-2.94) (1.03-1.27) (4.21-5.55) (3.54-4.30) (1.42- (3.41-4.25) (3.29-4.08) (3.67-4.55) (2.94-3.73) (3.55-5.38) (2.63-3.32) (4.24- (3.33-4.40) (3.27-4.08) (2.94-3.73) (2.76- 31.67 14.15 3.67 (27.00-34.12) (34.44-44.00) (38.15-50.43) (43.00-55.33) (30.00-45.38) (34.17-44.74) (39.26-52.00)(13.13-15.26) (44.06-56.96) (15.77-19.59) (18.42-22.60) (30.53-38.13) (22.63-30.74) (38.50-50. (13.02-15.13) (15.66-19.11) (19.27-22.24) (23.45-29.26) (13.64-16.84) (15.29-19. m) (10.00-13.00) (13.00-17.00) (15.00-19.00) (18.00-23.00) (10.00-13.00) (12.00-15.00) (14.00-18.00) (17.00-20.00) (10.00-13.00 (12.00-16 ( m) (28.30-30.80) (34.20-38.30) (40.00-45.00) (48.30-51.70) (27.50-30.00) (35.00-38.30) (40.00-45.00) (45.00-51.70) (25.80-31.70) (31.70-3 m) m) m) (38.00-48.00) (47.00-52.00) (48.00-58.00) (50.00-58.00) (39.00-47.00) (45.00-53.00) (49.00-62.00) (50.00-63.00) (37.00-48.00) (44.00-5 m) (60.80-66.70) (79.20-85.80) (99.20-107.50) (119.20-129.20) (61.70-65.00) (80.00-86.70) (97.50-106.70) (118.30-130.80) (58.30-65.00) (7 ( width ( ( ( ( otal stylet 62.86 able 3. Comparisons on morphometrics of the 4 juvenile stages ail 43.00 odontostyle (32.50-37.50) (43.40-48.40) (58.30-65.00) (70.90-78.40) (32.50-35.80) (44.10-48.40) (56.70-62.50)odontostyle (69.20-79.10) (45.00-48.30) (30.00-35.90 (59.20-67.50) (69.20-77.50) (87.50-95.00) (44.20-46.70) (58.30-66.70) (71.70-80.80) (85.80-98.30) (41.70-47.50 a c T T Character Functional 33.76 Odontophore 29.09 T Anal body 12.00 b c' 3.70 Replacement 46.36 L (mm) 0.61 Stagesn14161 J1 J2 J3 J4 J1 J2 J3 J4 J1 J2 J3 J4 Xiphinema elongatum 53 2.79 2.38 1.78 1.77 1.78 3.38 4.00 1.00 0.12 0.22 0.22 1.68) 5.32) 3.50) 3.08 51.41 1.28 26.20 2.93 121.77 2.08 73.02 1.52 48.75 2.33 89.97 2.00 57.00 1.00 19.00 0.07 1.49 0.24 4.85 0.15 2.94 (41.74-52.50) (46.97-56.79) ) 16) (18.46-23.21) (23.77-29.46) 11 2.70 46.79 1.07 20.04 2.04 98.96 1.23 58.07 1.35 40.89 2.47 72.90 2.00 53.00 1.00 16.00 5.00) (15.00-17.00) (18.00-22.00) 8.30) (38.30-43.30) (44.20-51.70) 2.00) (48.00-57.00) (47.00-63.00) 0.06 1.06 0.15 4.20 0.22 3.39 8.30-85.00) (92.50-104.20) (116.70-126.70) (43.30-48.30) (53.30-62.50) (70.80-76.70) (55.80-64.20) (70.00-76.70) (80.00-95.80) ) ) 2.41 38.20 0.62 16.42 1.30 81.29 1.36 45.64 0.81 35.65 0.88 60.75 2.00 49.00 1.00 14.00 0.03 0.80 0.23 3.84 0.27 3.57 3.26 62.32 3.01 33.89 1.70 14.02 2.53 33.38 1.20 28.94 2.77 44.42 3.00 42.00 1.00 11.00 0.10 0.59 0.40 3.53 0.18 3.88 ) 3.48 55.62 1.76 26.85 3.15 120.17 3.15 71.61 1.56 48.56 2.60 88.87 5.00 58.00 2.00 19.00 0.09 1.56 0.37 5.06 0.44 3.07 ( Host Locality (Code) 2.38 49.10 0.65 20.54 2.49 99.08 2.09 57.94 0.84 41.14 3.00 56.00 1.00 16.00 2.12 73.92 0.06 1.15 0.28 4.54 0.28 3.50 isolated from Taiwan and Philippines (Cont'd 1) isolated from Taiwan 3.82 41.12 1.18 16.87 1.43 79.29 1.12 44.13 1.13 35.16 1.04 58.11 3.00 49.00 1.00 13.00 0.03 0.83 0.25 4.07 0.43 3.70 X. elongatum 1.91 61.78 3.55 34.54 2.06 14.86 1.65 33.33 1.25 28.46 2.49 44.84 2.00 42.00 1.00 11.00 0.13 0.62 0.40 3.62 0.21 3.83 2.85 124.45 3.32 50.12 1.37 27.44 2.19 70.05 1.54 50.40 2.67 90.43 4.00 58.00 1.00 21.00 0.08 1.60 0.33 5.23 0.26 2.82 2.39 45.51 0.89 20.83 1.41 102.06 2.45 58.81 1.22 43.25 1.74 75.43 2.00 56.00 1.00 17.00 0.04 1.16 0.20 4.43 0.25 3.32 1.84 37.80 0.74 16.47 1.17 80.74 1.16 45.09 1.03 36.21 1.18 60.19 2.00 50.00 1.00 14.00 0.04 0.83 0.25 3.94 0.25 3.70 X. elongatum aichung (Xelo4) (Xelo5) Wufeng Shinhua (Xelo6) T Bermuda-grass Bermuda-grass Bamboo 31.53 13.88 (0.56-0.69) (0.78-0.89) (1.03-1.32) (1.34-1.82)(3.17-4.06) (0.57-0.69) (3.71-4.26) (0.72-0.91) (3.89-5.17) (4.59-6.21) (1.02-1.35)(3.42-4.50) (1.30-1.72) (3.32-4.06) (3.20-4.25) (0.54-0.66) (3.60-4.55) (2.89-3.81) (0.69-0.89) (2.39-3.39) (3.92-5.27) (0.96-1.23) (4.06-5.73) (3.08-4.50) (1.26- (3.22-4.07) (3.07-4.08) (3.62-4.22) (2.89-4.85) (3.88-4.78) (2.75-3.33) (4.48- (3.33-4.50) (3.20-3.85) (3.12-3.67) (2.50- (29.00-34.71) (33.60-43.00) (40.00-51.90) (43.85-57.67) (30.50-46.15) (37.89-46.47)(12.44-15.61) (41.20-56.67) (15.45-18.26) (48.15-59.64) (18.62-22.80) (29.47-38.82) (23.93-30.18) (31.74-42. (13.26-17.11) (15.92-18.75) (17.46-24.55) (23.64-29.29) (12.86-15.26) (14.68-18. 3.51 m) (10.00-13.00) (12.00-16.00) (15.00-19.00) (18.00-23.00) (10.00-13.00) (12.00-15.00) (13.00-19.00) (18.00-21.00) (10.00-12.00) (13.00-1 m) (60.00-64.70) (79.20-83.30) (95.00-107.50)m) (120.80-128.30) (59.20-63.30) (75.00-83.30)m) (90.80-104.20) (115.00-125.80) (60.00-64.20) (28.30-31.70) (7 (34.20-38.30) (40.80-45.80) (47.50-52.50) (25.80-30.00)m) (33.30-36.70) (38.30-44.20) (40.00-49.00) (46.70-50.00) (46.00-55.00) (50.00-61.00) (27.50-30.00) (55.00-64.00) (33.30-3 (37.00-45.00) (43.00-53.00) (50.00-68.00) (54.00-62.00) (38.00-46.00) (43.00-5 m) ( ( ( width( ( ( able 3. Comparisons on morphometrics of the 4 juvenile stages otal stylet 62.58 ail 43.00 odontostyle (30.80-35.00) (42.50-45.80) (54.20-63.30) (71.70-77.50) (30.80-35.00) (40.00-47.50) (51.60-63.40) (66.70-75.80) (30.80-35.80 Stagesn221821232015171518211526 J1 J2 J3 J4 J1 J2 J3 J4 J1 J2 J3 J4 Character odontostyle (44.20-48.30) (57.50-63.30) (71.70-83.30) (85.00-95.00) (43.30-46.70) (54.20-61.70) (68.30-78.30) (85.00-95.80) (43.30-45.80 Replacement 45.91 Anal body 11.00 Odontophore 29.71 T L (mm) 0.60 T a c T c' 3.86 b Functional 32.87 54 13 1 2004 2.79 1.26 3.64 1.88 1.66 2.52 4.00 1.00 0.26 0.09 0.29 1.74) 5.72) 3.67) 2.43 123.17 0.95 25.87 3.89 51.69 1.37 73.23 1.31 49.93 3.41 90.48 3.00 61.00 1.00 20.00 0.26 3.09 0.08 1.58 0.46 5.12 19.65 50) (39.26-52.17) (44.69-57.60) 2.61 46.22 0.76 2.21 101.62 2.14 59.57 1.59 42.05 1.81 75.53 3.00 58.00 2.00 17.00 8.30) (39.20-45.00) (46.70-54.20) 1.00) (51.00-63.00) (52.00-69.00) 7.00) (15.00-18.00) (18.00-23.00) 0.30 3.50 0.07 1.14 0.47 4.51 5.80-85.80) (97.50-106.70) (118.30-129.20) (40.00-48.30) (56.70-61.70) (69.10-76.70) (57.50-63.30) (70.00-84.20) (85.00-95.00) (15.09-17.76) (17.76-21.13) (23.77-28.21) ) ) 0.96 40.82 0.95 16.48 1.66 80.71 1.27 45.09 1.22 35.61 1.47 60.31 4.00 52.00 1.00 14.00 0.39 3.71 0.04 0.86 0.29 4.10 3.96 63.81 3.54 35.67 1.51 14.83 3.36 34.56 1.46 29.26 3.42 46.81 4.00 43.00 1.00 11.00 0.19 3.85 0.10 0.63 0.39 3.60 ) 3.27 121.38 3.95 53.89 1.12 27.25 3.20 72.55 0.87 48.82 1.65 89.81 2.00 55.00 1.00 18.00 0.24 3.00 0.04 1.50 0.27 5.00 ( Host Locality (Code) 4.52 47.63 1.58 20.52 1.90 101.58 3.89 59.65 2.00 41.93 4.29 74.84 3.00 55.00 1.00 16.00 0.36 3.54 0.10 1.13 0.43 4.20 2.43 41.21 1.21 16.96 1.46 80.16 1.46 45.48 0.71 35.89 1.32 61.68 3.00 49.00 1.00 13.00 isolated from Taiwan and Philippines (Cont'd 2) isolated from Taiwan 0.37 3.76 0.03 0.83 0.21 3.90 X. elongatum 2.34 62.83 4.23 32.69 2.04 14.25 2.06 33.86 1.14 28.96 3.36 46.14 5.00 42.00 1.00 10.00 0.28 4.03 0.08 0.59 0.38 3.37 2.54 121.48 3.68 51.73 1.13 25.42 2.40 72.75 1.21 48.73 4.61 89.57 3.00 58.00 2.00 19.00 0.26 3.01 0.08 1.47 0.40 5.01 22 23 14 17 10 17 7 14 19 26 1.67 44.84 0.64 19.64 1.05 100.87 1.16 59.62 0.95 41.25 3.23 75.17 2.00 55.00 1.00 16.00 0.17 3.38 0.04 1.08 0.27 4.34 3.42 38.38 0.97 16.02 2.64 79.74 2.32 43.78 1.20 35.95 0.79 60.91 1.00 50.00 0.00 13.00 0.24 3.71 0.03 0.79 0.19 3.82 X. elongatum aichung (Xelo7) (Xelo8) Tsautuen Dahu (Xelo9) 4.21 4.29 T Bamboo Sweet orange Plum (0.57-0.66) (0.74-0.87) (0.99-1.29) (1.34-1.66)(3.44-4.06) (3.35-4.16) (0.54-0.64) (0.70-1.12) (3.48-5.00) (1.06-1.21) (4.50-6.08) (1.35-1.66) (3.06-3.76) (3.35-4.89) (0.60-0.72) (3.77-4.68) (0.77-1.00) (1.03-1.31) (4.45-5.59) (1.43- (3.39-4.24) (3.43-4.89) (3.76-5.46) (4.55- (12.39-15.35) (15.10-17.11) (17.68-21.60) (21.06-28.68)(3.58-4.18) (12.56-16.32) (3.36-4.00) (13.73-21.13) (18.62-22.41) (2.78-3.87) (24.55-29.25) (2.45-3.50) (13.26-16.32) (3.38-4.70) (3.44-4.80) (3.12-3.87) (2.75-3.37) (3.45-4.60) (3.24-4.17) (3.00-3.93) (2.48- 3.78 (31.00-41.33) (35.22-40.95) (37.41-54.00) (43.75-61.74) (27.00-36.88) (33.91-53.33) (44.17-55.00) (48.13-58.40) (33.68-36.47) (37.14-45. m) (11.00-12.00) (12.00-15.00) (15.00-19.00) (18.00-23.00) (10.00-13.00) (10.00-16.00) (15.00-17.00) (17.00-20.00) (10.00-13.00) (12.00-1 m) (58.30-66.70) (78.30-81.70)m) (96.70-106.70) (118.30-125.80) (60.80-65.00) (76.70-83.30)m) (97.50-108.30) (114.20-126.70) (60.80-65.80) (26.70-30.80) (7 (35.00-38.30)m) (38.30-44.20) (46.70-50.80) (27.50-30.00)m) (33.30-41.70) (40.00-43.30) (43.00-46.00) (46.70-50.80) (45.00-53.00) (48.00-63.00) (28.30-30.80) (31.70-3 (49.00-66.00) (38.00-47.00) (43.00-55.00) (52.00-58.00) (48.00-64.00) (38.00-48.00) (48.00-6 ( ( ( ( width ( ( able 3. Comparisons on morphometrics of the 4 juvenile stages otal stylet 62.03 ail 44.00 odontostyle (44.20-46.70) (57.50-69.20) (69.20-89.20) (85.00-97.50) (43.30-48.30) (56.70-75.80) (72.50-77.50) (82.50-95.00) (44.20-49.20 a3 c1 c' 3.75 T Character Replacement 45.24 Anal body 12.00 Odontophore 28.43 T b odontostyle (31.60-38.40) (41.60-45.80) (55.00-64.20) (69.10-75.80) (31.60-36.70) (40.90-59.10) (55.80-65.80) (65.90-78.40) (32.50-35.90 T L (mm) 0.63 Stagesn713 J1 J2 J3 J4 J1 J2 J3 J4 J1 J2 J3 J4 Functional 33.60 Xiphinema elongatum 55
X. elongatum ( ) Table 3. Comparisons on morphometrics of the 4 juvenile stages of X. elongatum isolated from Taiwan and Philippines (Cont'd 3) Locality (Code) Host Character Taitung (Xelo10) Philippines2 Sugar apple Sugarcane Stages J1 J3 J4 J1 J2 J3 J4 n6 5 14913 15 14 L (mm) 0.59 0.03 1.05 0.08 1.36 0.06 0.66 0.06 0.87 0.04 1.29 0.11 1.79 0.26 (0.56-0.64) (0.98-1.18) (1.23-1.48) (0.53-0.72) (0.81-0.94) (1.19-1.64) (1.32-2.17) a 35.49 3.00 48.21 3.63 54.98 6.17 - - - - (32.94-39.33) (42.61-51.43) (41.00-62.86) b 3.46 0.16 4.13 0.21 4.66 0.25 - - - - (3.29-3.76) (3.92-4.37) (4.30-5.19) c 13.85 0.66 19.32 0.54 25.55 1.33 - - - - (12.73-14.55) (18.85-20.20) (23.04-27.92) c' 4.18 0.17 3.64 0.30 3.14 0.15 4.4 0.1 4.4 0.6 3.6 0.3 3.5 0.3 (4.00-4.40) (3.25-4.07) (2.94-3.50) (4.2-4.5) (3.5-5.0) (3.1-4.1) (3.1-4.0) Total stylet 62.08 1.25 99.86 2.73 119.05 3.12 - - - - ( m) (60.00-63.30) (96.70-104.20) (114.20-124.20) Functional 32.92 0.46 60.86 3.98 71.11 2.19 34 1.9 46 1.3 62 1.9 74 2.8 odontostyle (32.50-33.40) (58.30-67.50) (66.70-75.00) (31-37) (44-47) (59-65) (71-78) ( m) Odontophore 29.17 1.06 39.00 2.96 47.94 1.75 29 2.2 37 1.5 44 1.6 51 2.3 ( m) (27.50-30.00) (35.00-41.70) (44.20-50.00) (25-31) (35-40) (41-47) (47-53) Replacement 45.27 1.46 74.16 2.86 86.53 2.09 46 1.4 63 2.4 79 2.3 93 3.7 odontostyle (43.30-47.50) (71.70-78.30) (80.80-88.30) (44-47) (59-68) (75-83) (86-97) ( m) Tail 43.00 2.00 54.00 5.00 53.00 3.00 - - - - ( m) (40.00-44.00) (49.00-61.00) (49.00-58.00) Anal body 10.00 0.00 15.00 2.00 17.00 1.00 - - - - width ( m) (10.00-11.00) (13.00-17.00) (16.00-18.00) 1Measurements in the form: mean SD (range), "-" = No data 2Reference: Luc, M. & Southey, J. F. 1980 (20)
X. elongatum rDNA GenBank AY524971
Xelo1 Xelo3 Xelo8 PCR rDNA Xiphinema elongatum 2083 2078 2083 (12,20) (base pair, bp) ITS-1 5.8S ITS-2 3 10 X. Xelo3 ITS-2 elongatum 5 ITS-1 (Xelo3, 4, 5) 0.55 ITS-2 1.34 5.8S Xelo3 2.41 2.50 mm 1 0.63 18S 28S 10 ( ) X. elongatum rDNA ITS-1 5.8S ITS-2 56 13 1 2004
X. elongatum 10 X. elongatum 2 (Xelo3, 4, 5 Xelo1, 2, 6, 7, 8, 9, 10) 2 Table 4. Comparisons on morphometrics of males of X. 4 elongatum isolated from Taiwan, South Africa and Brundi 2 Xelo3 Locality (code) Host Xelo1, 8 3 rDNA Character Taichung (Xelo4) South Africa1 Brundi2 2 Xelo3 Bermuda-grass Unknown Maize Xelo1 Xelo8 ITS-1 n8 31 1085 bp 0.55 3 L (mm) 2.01 0.16 2.59, 2.29, 2.30 2.45 ITS-2 5.8S Xelo3 (1.78-2.24) 2 ITS-1 a 55.68 5.39 47, 57, 43 61 Xelo3 (48.11-63.33) b 6.06 0.73 7.0, 6.7, 8.2 5.8 4 rDNA (5.24-7.54) 10 c 42.21 6.90 52, 46, 46 41.1 (33.58-52.37) X. elongatum c' 1.88 0.19 1.5, 2.0, 1.6 1.9 (1.52-2.04) Total stylet 146.56 2.10 158, 148, 150 168 (5) ( m) (144.20-150.00) Functional 89.15 1.86 101, 92, 94 102 X. elongatum odontostyle (87.50-91.60) a ( m) Odontophore 57.41 0.93 57, 56, 56 66 ( ) Luc Southey ( m) (56.70-59.20) (20) 22 X. Tail 48.00 6.00 50, 51, 50 53 elongatum "short-tailed" ( m) (38.00-53.00) 48 54 m Anal body 26.00 1.00 - 27.5 164 m width( m) (25.00-27.00) 59 67 m Spicule 47.06 2.89 50, 47, 53 53.5 161 m ( m) (42.50-50.00) 10 X. elongatum 1Reference: Heyns, J. 1974, (12) 2Reference: Coomans, et al., 1990, (7) 3Measurements in the form: mean SD (range), "-" = No data.
4 a
X. elongatum ( ) (12) 4 (7) X. elongatum 10 25 25 2.35 mm 7 2.78 mm (144 178 m) rDNA Xelo3, 4, 5 2.73 mm 3 Razak Loof (24) 3 6 (138 177 7 m) Xiphinema elongatum 57
X. elongatum rDNA (ITS-1, 5.8S, ITS-2) Table 5. The size of rDNA ITS-1, 5.8S, ITS-2 and the pairwise percentage nucleotide dissimilarities among the three geographical populations of X. elongatum in Taiwan ITS-1 5.8S ITS-2 Population No. of No. of No. of (Code) Xelo1 Xelo3 Xelo1 Xelo3 Xelo1 Xelo3 bases bases bases Xelo1 1085 - 160 - 530 - Xelo3 1085 0.55 - 160 0.63 - 525 1.34 - Xelo8 1085 0.55 0.00 160 0.00 0.63 530 0.76 0.57 84 110 m 54 67 m Wang (30) 2 X. 4 5 elongatum 5 Xelo4 3 ( ) Pan (22) 4 3 X. elongatum rDNA Luc Southey (ITS-1 ITS-2) PCR 2 Xelo1 Xelo8 6 rDNA (1.82, 1.84 mm) c' ( ) (2.2,2.1) (90, 92 m) Xelo3 2 (53, 51 m) 3 (0 1.34%) (50, 50 m) X. elongatum rDNA X. elongatum X. elongatum 4 (20) ( ) 10 X. elongatum
c' 3 rDNA 4
4 X. elongatum (Xelo4) X. elongatum
(2.01 2.19 mm) c' (1.88 2.47) (48 57 rDNA m) (26 23 m) X. elongatum Xelo4
3 4 X. 1. . 2003. elongatum rDNA-RFLP 3 3 X. elongatum . 12: 235-241 (12) 2. . 1972. . 61 ( ) 3. Alkemada, J. R. M., and Loof, P. A. A. 1989. (7) Observations on the ontogeny of some Xiphinema species 168 m 143 158.5 m (Nematoda: Dorylaimida). Med. Fac. Landbouww. 58 13 1 2004
Rijksuniv. Gent. 54: 1177-1186. Phenotypic variations and genetic characterization of 4. Bulman, S. R., and Marshall, J. W. 1997. Differentiation Xiphinema populations from Slovakia (Nematoda: of Australasian potato cyst nematode (PCN) populations Dorylaimida). Nematol. Medit. 27: 261-275. using the polymerase chain reaction (PCR). New Zealand 17. Loof, P. A. A., and Maas, P. W. Th. 1972. The genus J. Crop and Horti. Sci. 25, 123-129. Xiphinema (Dorylaimida) in Surinam. Nematologica 5. Cohn, E., and Sher, S. A. 1972. A contribution to the 18:92-119. taxonomy of the genus Xiphinema Cobb, 1913. J. 18. Loof, P. A. A., and Sharma, R. D. 1979. Plant parasitic Nematol. 4:36-65. nematodes from Bahia State, Brazil: The genus 6. Coomans, A., and De Coninck, L. 1963. Observations on Xiphinema Cobb, 1913 (Dorylaimoidea). Nematologica spear-formation in Xiphinema. Nematologica 9:85-96. 25:111-127. 7. Coomans, A., Rashid, F. M., and Luc, M. 1990. 19. Luc, M., and Dalmasso, A. 1975. Considerations on the Observation on Xiphinema vitis Heyns, 1974, X. genus Xiphinema Cobb, 1913 (Nematoda, Longidoridae) elongatum Schuurmans Stekhoven & Teunissen, 1938, X. and a "lattice" for the identification of species. Cah. fatikae fatikae Bos & Loof, 1985, and description of X. ORSTOM, Ser. Biol. 10:303-327. fatikae eburnense subsp. n. (Nemata: Longidoridae), from 20. Luc, M., and Southey, J. F. 1980. Study of biometrical Africa. Revue Nematol. 13:239-248. variability in Xiphinema insigne Loos, 1949, and X. 8. Ferraz, L. C. C. B. 1980. Observations on some elongatum Schuurmans Stekhoven & Teunissen, 1938; Xiphinema species found in Brazil (Nematoda: description of X. savanicola n. s.p (Nematoda: Dorylaimoidea). Nematol. Medit. 8:141-151. Longidoridae) and comments on thelytokous species. 9. Ferris, V. R., Ferris, J. M., and Faghihi, J. 1993. Variation Revue Nematol. 3:243-269. in spacer ribosomal DNA in some cyst-forming species of 21. Newton, L. A., Chilton, N. B., Beveridge, I., and Gasser, plant parasitic nematodes. Fund. Appl. Nematol. 16: 177- R. B. 1998. Genetic evidence indicating that Cooperia 184. surnabada and Cooperia oncophora are one species. Int. 10. Ferris, V. R., Ferris, J. M., Faghihi, J., and Ireholm, A. J. Parasitol. 28: 331-336. 1994. Comparisons of isolates of Heterodera avenae 22. Pan, C., Zheng, J., Zhou, X., Neilson, R., and Brown, D. using 2-D PAGE protein patterns and ribosomal DNA. J. J. F. 2000. Preliminary assessment of the occurrence of Nematol. 26: 144-151. longidorid and trichodorid nematodes (Nematoda: 11. Gerbi, S. A. 1986. The evolution of eukaryotic ribosomal Longidoridae and Trichodoridae) in Xiamen, Fujian DNA. BioSystems 19: 247-258. Province, China. Russian J. Nematol. 8:153-159. 12. Heyns, J. 1974. The genus Xiphinema in South Africa II. 23. Powers, T. O., Todd, T. C., Burnell, A. M., Murray, P. C. X. elongatum-group (Nematoda: Dorylaimida). B., Fleming, C. C., Szalanski, A. L., Adams, B. A., and Phytophylactica 6: 249-260. Harris, T. S. 1997. The rDNA internal transcribed spacer 13. Hoste, H., Chilton, N. B., Beveridge, I., and Gasser, R. B. region as a taxonomic marker for nematodes. J. Nematol. 1998. Differences in the first internal transcribed spacer 29: 441-450. of ribosomal DNA among five species of 24. Razak, A. R., and Loof, P. A. A. 1998. The genus Trichostrongylus. Int. J. Parasitol. 28: 1251-1260. Xiphinema Cobb, 1913 (Nematoda: Longidoridae) in 14. Hoste, H., Chilton, N. B., Gasser, R. B., and Beveridge, I. western Malaysia. Fund. Appl. Nematol. 21:413-428. 1995. Differences in the second internal transcribed 25. Robbins, R. T., Brown, D. J. F., Halbrendt, M., and Vrain, spacer (ribosomal DNA) between five species of T. C. 1996. Compendium of juvenile stages of Xiphinema Trichostrongylus (Nematoda: Trichostrongylidae). Int. J. species (Nematoda: Longidoridae). Russian J. Nematol. Parasitol. 25: 75-80. 4:163-171. 15. Ibrahim, S. K., Baldwin, J. G., Roberts, P. A., and Hyman, 26. Szalanski, A. L., Sui, D. D., Harris, T. S., and Powers, T. B. C. 1997. Genetic variation in Nacobbus aberrans: an O. 1997. Identification of cyst nematodes of agronomic approach toward taxonomic resolution. J. Nematol. 29: and regulatory concern with PCR-RFLP of ITS-1. J. 241-249. Nematol. 29: 255-267. 16. Lamberti, F., Sabova, M., DE Luca, F., Molinari, S., 27. Tarjan, A. C., and Luc, M. 1963. Observations on Agostinelli, A., Coiro, M. I., and Valocka, B. 1999. Xiphinema insigne Loos, 1949 and Xiphinema elongatum Xiphinema elongatum 59
Schuurmans Stekhoven & Teunissen, 1938 (Nematoda: americanum group. Fund. Appl. Nematol. 15: 563-573. Dorylaimidae). Nematologica 9:163-172. 30. Wang, S., Chiu, W. F., Yu, C., Li, C., and Robbins, R. T. 28. Thiery, M., and Mugniery, D. 1996. Interspecific rDNA 1996. The occurrence and geographical distribution of restriction fragment length polymorphism in Globodera longidorid and trichodorid nematodes associated with species, parasites of Solanaceous plants. Fund. Appl. vineyards and orchards in China. Russian J. Nematol. Nematol. 19: 471-479. 4:145-153. 29. Vrain, T. C., Wakarchuk, D. A., Levesque, C. A., and 31. Xu, J., Fu, P., and Cheng, H. 1995. A taxonomic study on Hamilton, R. I. 1992. Intraspecific rDNA restriction species of Xiphinema from seven provinces of China fragment length polymorphism in the Xiphinema (Nemata: Longidoridae). J. Nanjing Agri. Uni.18: 37-42. 60 13 1 2004
ABSTRACT
Chen, D. Y1, Ni, H. F.2, Yen, J. H.3 ,Cheng, Y. H.2, and Tsay, T. T.4, 5. 2004. Variability within Xiphinema elongatum populations in Taiwan. Plant Pathol. Bull. 13: 45-60. (1 Plant Pathology Division, Taiwan Agricultural Research Institute, Wufeng, Taichung, Taiwan, R.O.C.; 2 Department of Plant Protection, Chia Yi Agricultural Experiment Station, TARI, Taiwan; R.O.C.; 3Agricultural Extension Center, National Chung Hsing University, Taichung, Taiwan, R.O.C.; 4 Department of Plant Pathology, National Chung Hsing University, Taichung, Taiwan, R.O.C.; 5 Corresponding author, E-mail: [email protected], Fax: +886-4- 22876712)
Ten geographical populations of X. elongatum were collected successively from different area in Taiwan using modified Baermann funnel method during 1998 to 2002. Comparing the morphometrics of female and juveniles among these 10 populations, only the length item of female and the third and fourth stage of juveniles isolated from the Bermuda-grass were longer than the other population, however, the rest of morphometrics were almost identical. Based on the matchable length of the replacement odontostyle and functional odontostyle, and also the evident gap of the replacement odontostyle and total stylet length, between the four successive stages of juveniles and its female in each population, it assured that each population was not mix with other morphologically similar Xiphinema species. Most parts of the morphometrics of male were identical with female, the only difference showed in the tail shape with more variance. The dissimilarity within each population (except for Xelo3) and between the three representative populations (Xelo1, 3, 8) of the rDNA (ITS-1 & ITS-2) sequence alignment was not evident (only from 0 to 1.34 %); therefore, it was feasible to develop the species-specific primers. Taiwan, the southeast part of Mainland China, and the Southeast Asia were geographically close, the morphometrics of X. elongatum, according to the worldwide reported data, of these areas were more similar to each other than to that of X. elongatum of the South Africa and South America. Whether the variance occurred among the above areas belongs to the intraspecific or interspecific variation, more morphometric data of the juveniles, males and the sequences of rDNA were needed, so we could be more acknowledged about the variability of this cosmopolitan species.
Key words: Variability, Xiphinema elongatum, ribosomal DNA, rDNA, internal transcribed spacer, ITS-1, ITS-2