DOCSLIB.ORG

Xiphinema Elongatum

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Xiphinema Elongatum 13: 45-60, 2004 Xiphinema elongatum 1 2 3 2 4,5 1 2 3 4 5 [email protected] : +886-4-22876712 93 1 25 . 2004. Xiphinema elongatum . 13: 45-60. 1998 2002 10 Xiphinema elongatum 4 4 10 X. elongatum (supplements) 3-4 rDNA 3 (Xelo3 ) ITS-1 ITS-2 (0 1.34 %) X. elongatum rDNA X. elongatum Xiphinema elongatum ribosomal DNA rDNA ITS-1 ITS-2 X. pratense Loos, 1949 4 (syntypes) X. campinense Lordello, 1951 3 Xiphinema elongatum Schuurmans Stekhoven & (topotypes) X. Teunissen, 1938 (type locality) elongatum (synonym) Cohn Sher(5) (Zaire, , Congo) Rutshuru X. truncatum Thorne, 1939 X. elongatum (type host) (27) (12) (19) (5) (12) Heyns Luc Dalmasso (Hawaii) (South Africa) (Surinam)(17) (8,18) (species inquirenda) (20) X. elongatum X. elongatum (12) (holotype) (variability) Heyns Tarjan Luc (27) X. elongatum (20) (morphometrics) L Luc Southey ( ) = 2.089 mm a = 49 b = 6.1 c = 35 c' = 2.5 V 22 = 40 total stylet ( ) = 153 m functional (group) odontostyle ( ) = 94 m odontophore ( ) = 59 m tail ( ) = 59 m Tarjan Luc 46 13 1 2004 Luc Southey (20) (Mauritius) "on the spot" (differentiation) Xu (31) (Zhangzhou) (cockscomb) (2) X.elongatum Wang (30) 100 24 (Shenzhen) (citrus) Pan (22) (Gulangyu Island) (Stemi SV 6, ZEISS, Germany) (Xiamen) 4 3 4 X. elongatum (37% aqueous solution, SIGMA, USA) (replacement odontostyle) (6) X. elongatum (3) (25) (intraspecific variation) Robbins ( Axiolab, ZEISS, Germany) (MC80) (35mm, ISO 100, Elite X. elongatum Chrome, Kodak, USA) (NOVAMAT 150 AFI-M monitor, BRAUN, (parthenogenesis) Germany) (12) (anal body width) (Burundi)(7) X. elongatum (spicule) DNA (ribosomal DNA, rDNA) (molecular markers) (copy numbers) (coding region, 18S, 5.8S, 28S gene) (conserved sequences) (3,6) (universal 10 primers) (noncoding region, internal transcribed spacer 1 or 2, ITS-1, ITS-2) PCR rDNA "concerted evolution" (11) DNA (intraspecific) (interspecific) ITS-1 ITS-2 Xelo1 Xelo3 Xelo8 3 DNA (1,4,9,10,13,14,15,16,21,23,26,28,29) X. elongatum 50 200 rDNA DNA [200 mM Tris-HCl, pH8.5, 250mM NaCl, 25 mM EDTA, 10 rDNA % w/v sodium dodecyl-sulphate plus 0.5 g/ul proteinase K ITS-1 ITS-2 (Roche, Mannheim, Germany) 37 12-14 12000 x g Xiphinema elongatum 47 10 DNA LB (WizardTM DNA Clean-Up Promega Cooperation, Madison, (S-ITS-1 P28S) PCR WI, USA) DNA, rDNA resin 900 g (22-24 ) rDNA (Taipei, Taiwan) 1 spin column DNA 2ml 80 isopropanol spin column rDNA spin column rDNA isopropanol 65 25-50 g Xelo3 (transformated spin column 1 12000 xg clone) Xelo1 Xelo8 3 20 spin column DNA 3 Genetics Computer Group (GCG) DNA -20 SeqWeb 2.1 Pretty program (multiple sequences alignment) (consensus sequence) rDNA rDNA X. Vrain (29) rDNA elongatum rDNA PCR S-ITS-1 18S 3' 7 5' TTGATTACGTCCCTGCCCTTT 3' 3 P28S 28S 5' 5' ITS-1 5.8S ITS-2 TTTCACTCGCCGTTACTAAGG 3' GAP program rDNA ITS-1 ITS-2 5.8S gap weight = 50, length weight = 18S 28S PCR 3 ITS-1 ITS-2 5.8S 50 l 1 M 1.25 ( Taq polymerase (Yeastern Biotech Co. Taipei, Taiwan) 1 ) BestFit program X Taq DNA polymerase buffer A T C G rDNA deoxyribonucleotide (dATP, dTTP dCTP, dGTP) 0.1 mM PCR (BioRad iCycler, Hercules, CA, USA) 94 4 94 30 52 30 72 2 30 72 7 PCR Xiphinema elongatum 4 10 1 X TBE buffer (40 mM Tris, 20 mM Boric acid, and 1 mM EDTA, pH 8.0) 1.5 agarose gel 10 X. elongatum ( ) DNA 3 7 rDNA (Xelo3) PCR PCR-M clean up system (Viogene, 2.31 Taipei, Taiwan) PCR mm 2.15 2.50 mm pGEM-T easy (Promega, USA) yT&A (Xelo8) (Xelo10) 2 (Yeastern Biotech. Taipei, Taiwan) 2.14 2.03 (Escherichia coli, ECOS101, mm a b c 10 Yeastern Biotech. Taipei, Taiwan) c' V 100 l IPTG (5-bromo-4-chloro-3-indoyl- V -D-galactoside, 100 mM) 20 l X-gal (isopropylthio- 39.10 40.42 -D -galactosidase, 50 mg/ml) ampicillin (100 g/ml) 48 13 1 2004 Xiphinema elongatum Table 1. The list of geographical populations of Xiphinema elongatum investigated in this study Code Locality Host Xelo1 Shinshe Shiang, Taichung County Loquat (Eriobotrya japonica Lindl.) Xelo2 Guoshing Shiang, Nantou County Loquat (Eriobotrya japonica Lindl.) Xelo3 Daya Shiang, Taichung County Bermuda-grass (Cynodon dactylon Pers.) (On green of golf course) Xelo4 Taichung City Bermuda-grass (Cynodon dactylon Pers.) (On green of golf course) Xelo5 Wufeng Shiang, Taichung County Bermuda-grass (Cynodon dactylon Pers.) (On green of golf course) Xelo6 Shinhua Jen, Tainan County Bamboo (Bambusa sp.) Xelo7 Taichung City Bamboo (Bambusa sp.) Xelo8 Tsautuen Jen, Nantou County Sweet orange (Citrus sinensis Osb.) Xelo9 Dahu Shiang, Miaoli County Plum (Prunus salicina Lindl.) Xelo10 Taitung City, Taitung County Sugar apple (Annona squamosa L.) X. elongatum ( ) A, B, 2 C, D, E F, (F ) G, H, I J 90 Fig. 1. X. elongatum (female and juvenile) from Taiwan: A, Female habitus; B, Anterior region of two females; C, D, E and F, Female tails (F is abnormal); G, H, I and J, Tails of the first, second, third and fourth stage of juveniles, respectively. Scale bar = 90 m. X. elongatum Table 2. Comparisons on morphometrics of X. elongatum female populations isolated from Taiwan, Zaire, Thailand, Philippines, and Mainland China Locality (Code) Host Character Shinshe (Xelo1) Guoshing (Xelo2) Daya (Xelo3) Taichung (Xelo4) Wufeng (Xelo5) Shinhua (Xelo6) Taichung (Xelo7) Loquat Loquat Bermuda-grass Bermuda-grass Bermuda-grass Bamboo Bamboo n27302825292523 L (mm) 2.02 0.111 1.97 0.13 2.31 0.09 2.19 0.11 2.19 0.11 2.00 0.11 2.06 0.15 (1.82-2.25) (1.72-2.18) (2.15-2.50) (1.89-2.36) (1.99-2.41) (1.77-2.17) (1.74-2.37) a 55.74 2.75 55.53 4.11 60.11 2.39 55.58 2.72 61.64 4.31 57.65 4.87 56.93 5.89 (49.19-61.71) (48.65-68.67) (55.90-64.10) (50.25-61.62) (52.56-69.39) (47.84-65.76) (47.03-72.33) b 6.03 0.36 5.88 0.47 6.96 0.36 6.38 0.35 6.57 0.49 5.99 0.28 6.56 0.61 (5.23-6.74) (5.06-7.21) (6.31-7.78) (5.83-7.10) (5.64-8.03) (5.47-6.42) (5.27-7.90) c 38.27 2.76 36.35 2.73 39.30 1.87 38.81 2.20 37.39 2.24 35.65 1.92 35.56 1.93 (32.61-46.22) (30.88-42.80) (36.45-43.04) (34.71-44.58) (32.54-42.41) (31.00-40.00) (32.22-40.86) c' 2.37 0.23 2.49 0.19 2.56 0.12 2.47 0.17 2.63 0.15 2.55 0.17 2.61 0.16 (1.87-3.00) (2.22-2.85) (2.35-2.78) (2.09-2.96) (2.33-3.00) (2.30-2.86) (2.26-2.90) V % 39.96 1.17 39.44 1.22 39.55 1.43 40.40 1.25 40.88 1.46 39.59 1.25 39.29 1.07 (37.30-42.70) (37.50-42.40) (36.30-41.90) (38.00-43.50) (37.90-43.30) (36.30-42.70) (37.00-41.10) Total stylet 147.44 3.07 145.47 3.17 146.25 3.57 147.48 2.82 145.09 3.28 145.07 3.19 143.62 3.44 ( m) (140.80-155.80) (140.00-153.30) (140.80-153.00) (141.70-155.00) (138.30-150.80) (140.00-151.70) (137.50-149.20) Functional 90.09 2.44 88.85 2.53 87.47 3.20 87.96 2.39 87.05 2.78 88.34 2.43 86.90 2.79 odontostyle (85.00-96.60) (84.20-93.40) (80.00-93.30) (84.10-92.50) (81.70-93.30) (83.30-92.50) (83.30-91.60) Xiphinema elongatum ( m) Odontophore 57.35 1.96 56.61 1.50 58.78 1.61 59.53 1.41 58.04 1.98 56.73 1.60 56.71 1.70 ( m) (51.70-61.70) (53.30-60.80) (56.70-62.50) (57.50-62.50) (51.70-60.80) (55.00-61.70) (51.70-60.00) Tail 53.00 5.00 54.00 3.00 59.00 3.00 57.00 4.00 59.00 3.00 56.00 3.00 58.00 4.00 ( m) (43.00-69.00) (48.00-58.00) (54.00-64.00) (48.00-68.00) (52.00-63.00) (51.00-63.00) (51.00-64.00) Anal body 22.00 1.00 22.00 1.00 23.00 1.00 23.00 1.00 22.00 1.00 22.00 1.00 22.00 1.00 width ( m) (19.00-23.00) (20.00-23.00) (22.00-25.00) (22.00-24.00) (20.00-25.00) (20.00-24.00) (19.00-25.00) 49 50 X. elongatum ( ) Table 2. Comparisons on morphometrics of X. elongatum female populations isolated from Taiwan, Zaire, Thailand, Philippines, and Mainland China (Cont'd) Locality (Code) Host Character Tsautuen (Xelo8) Dahu (Xelo9) Taitung (Xelo10) Zaire (holotype)2 Thailand3 Thailand3 Philippines3 Shenzhen, China4 Sweet orange Plum Sugar apple Unknown Asparagus Carnation Sugarcane Citrus n21197 1 85202 L (mm) 2.00 0.08 2.03 0.13 1.91 0.07 2.089 2.15 2.30 2.47 0.18 2.0, 2.1 13 (1.85-2.14) (1.74-2.27) (1.81-2.03) (2.03-2.24) (2.15-2.45) (2.11-2.72) a 59.53 3.60 56.17 4.67 55.77 4.41 49 51.9 51.3 56.1 4.3 56, 72 (49.50-66.33) (50.00-64.24) (50.81-62.67) (48.3-56.9) (47.9-55.7) (49.8-68.2) 1 b 5.71 0.30 6.25 0.46 6.03 0.36 6.1 - - - 5.5, - (5.14-6.30) (5.44-7.09) (5.66-6.55) 2004 c 37.74 2.67 35.14 2.59 35.21 1.51 35 35.7 37.4 34 (n = 8) 33, 37 (33.16-42.04) (30.00-40.20) (32.98-37.60) (32.7-40.3) (37.9-39.6) (32-37) c' 2.50 0.19 2.58 0.22 2.63 0.14 2.3 2.5 2.6 2.8 0.2 2.8, 2.9 (2.13-2.89) (2.13-3.09) (2.41-2.80) (2.3-2.6) (2.5-2.8) (2.6-3.2) V % 40.03 1.20 40.42 1.99 39.10 0.65 40 38.2 38.4 39.9 1.6 39, 39 (37.10-41.70) (37.10-44.60) (38.10-40.10) (36.9-39.5) (35.1-40.5) (37.0-43.0) Total stylet 145.83 1.96 146.22 3.33 142.84 2.76 153 147.5 150 2.2 152 1.5 145, 149 ( m) (141.70-150.00) (140.80-154.20) (140.80-148.30) (146-151) (147-153) (149-154) Functional 88.65 1.74 89.15 2.50 85.93 1.62 94 91.5 2.0 93 1.8 91 2.0 87, 88 odontostyle (85.90-93.30) (85.00-93.30) (84.10-89.10) (89-94) (91-95) (89-97) ( m) Odontophore 57.18 1.27 57.07 1.62 56.91 1.80 59 56 57 1.6 61 2.3 57, 62 ( m) (55.00-60.00) (54.20-61.70) (55.00-59.20) (54-59) (55-59) (56-65) Tail 53.00 3.00 58.00 5.00 54.00 3.00 59 59.5 61.5 64 (n = 8) 57, 61 ( m) (47.00-57.00) (48.00-68.00) (50.00-58.00) (54-64) (58-65) (58-70) Anal body 21.00 1.00 23.00 1.00 21.00 2.00 - - - - 20, 22 width ( m) (19.00-23.00) (21.00-25.00) (19.00-23.00) 1Measurements in the form: mean SD (range), "-" = No data.
Load more

Recommended publications
  • Abacca Mosaic Virus
    Annex Decree of Ministry of Agriculture Number : 51/Permentan/KR.010/9/2015 date : 23 September 2015 Plant Quarantine Pest List A. Plant Quarantine Pest List (KATEGORY A1) I. SERANGGA (INSECTS) NAMA ILMIAH/ SINONIM/ KLASIFIKASI/ NAMA MEDIA DAERAH SEBAR/ UMUM/ GOLONGA INANG/ No PEMBAWA/ GEOGRAPHICAL SCIENTIFIC NAME/ N/ GROUP HOST PATHWAY DISTRIBUTION SYNONIM/ TAXON/ COMMON NAME 1. Acraea acerata Hew.; II Convolvulus arvensis, Ipomoea leaf, stem Africa: Angola, Benin, Lepidoptera: Nymphalidae; aquatica, Ipomoea triloba, Botswana, Burundi, sweet potato butterfly Merremiae bracteata, Cameroon, Congo, DR Congo, Merremia pacifica,Merremia Ethiopia, Ghana, Guinea, peltata, Merremia umbellata, Kenya, Ivory Coast, Liberia, Ipomoea batatas (ubi jalar, Mozambique, Namibia, Nigeria, sweet potato) Rwanda, Sierra Leone, Sudan, Tanzania, Togo. Uganda, Zambia 2. Ac rocinus longimanus II Artocarpus, Artocarpus stem, America: Barbados, Honduras, Linnaeus; Coleoptera: integra, Moraceae, branches, Guyana, Trinidad,Costa Rica, Cerambycidae; Herlequin Broussonetia kazinoki, Ficus litter Mexico, Brazil beetle, jack-tree borer elastica 3. Aetherastis circulata II Hevea brasiliensis (karet, stem, leaf, Asia: India Meyrick; Lepidoptera: rubber tree) seedling Yponomeutidae; bark feeding caterpillar 1 4. Agrilus mali Matsumura; II Malus domestica (apel, apple) buds, stem, Asia: China, Korea DPR (North Coleoptera: Buprestidae; seedling, Korea), Republic of Korea apple borer, apple rhizome (South Korea) buprestid Europe: Russia 5. Agrilus planipennis II Fraxinus americana,
    [Show full text]
  • Species Composition of the Free Living Multicellular Invertebrate Animals
    Historia naturalis bulgarica, 21: 49-168, 2015 Species composition of the free living multicellular invertebrate animals (Metazoa: Invertebrata) from the Bulgarian sector of the Black Sea and the coastal brackish basins Zdravko Hubenov Abstract: A total of 19 types, 39 classes, 123 orders, 470 families and 1537 species are known from the Bulgarian Black Sea. They include 1054 species (68.6%) of marine and marine-brackish forms and 508 species (33.0%) of freshwater-brackish, freshwater and terrestrial forms, connected with water. Five types (Nematoda, Rotifera, Annelida, Arthropoda and Mollusca) have a high species richness (over 100 species). Of these, the richest in species are Arthropoda (802 species – 52.2%), Annelida (173 species – 11.2%) and Mollusca (152 species – 9.9%). The remaining 14 types include from 1 to 38 species. There are some well-studied regions (over 200 species recorded): first, the vicinity of Varna (601 spe- cies), where investigations continue for more than 100 years. The aquatory of the towns Nesebar, Pomorie, Burgas and Sozopol (220 to 274 species) and the region of Cape Kaliakra (230 species) are well-studied. Of the coastal basins most studied are the lakes Durankulak, Ezerets-Shabla, Beloslav, Varna, Pomorie, Atanasovsko, Burgas, Mandra and the firth of Ropotamo River (up to 100 species known). The vertical distribution has been analyzed for 800 species (75.9%) – marine and marine-brackish forms. The great number of species is found from 0 to 25 m on sand (396 species) and rocky (257 species) bottom. The groups of stenohypo- (52 species – 6.5%), stenoepi- (465 species – 58.1%), meso- (115 species – 14.4%) and eurybathic forms (168 species – 21.0%) are represented.
    [Show full text]
  • Pest List for the Importation of Fresh Commercial Citrus Fruit: Grapefruit (Citrus × Paradisi); Lime (C
    Pest List for the Importation of Fresh Commercial Citrus Fruit: Grapefruit (Citrus × paradisi); Lime (C. aurantiifolia); Mandarin Orange, Tangerine, or Hybrids (C. reticulata); Sweet Orange (C. sinensis); and Tangelo (C. × tangelo) from Peru into the Continental United States November 2, 2012 Version 1 Agency Contact: Plant Epidemiology and Risk Analysis Laboratory Center for Plant Health Science and Technology United States Department of Agriculture Animal and Plant Health Inspection Service Plant Protection and Quarantine 1730 Varsity Drive, Suite 300 Raleigh, NC 27606 Ver. 1 (Original) November 2, 2012 i Executive Summary The Animal and Plant Health Inspection Service (APHIS) of the United States Department of Agriculture (USDA) prepared this pest list to examine plant pest risks associated with importing commercially produced fresh Citrus fruit for consumption from all areas of Peru into the continental United States. This request (SENASA-Peru, 2011) is for the following species: grapefruit (Citrus × paradisi Macfad.); lime (C. aurantiifolia [Christm.] Swingle); mandarin orange, tangerine, or hybrids (C. reticulata Blanco); sweet orange (C. sinensis [L.] Osbeck); and tangelo (Citrus × tangelo J.W. Ingram & H.E. Moore) (Rutaceae). An earlier risk assessment was developed for exports of citrus from five production regions, and market access was established (USDA, 2003). Here, considering expansion of the export area from Peru to the entire country, we considered the pathway to include the following processes and conditions: phytosanitary
    [Show full text]
  • Nematoda, Dorylaimida
    ZOOSYSTEMATICA ROSSICA, 21(1): 3–9 25 JULY 2012 A new species of the genus Calodorylaimus (Nematoda, Dorylaimida) from highly mineralised rivers of the Elton Lake basin, Russia Новый вид рода Calodorylaimus (Nematoda, Dorylaimida) из высокоминерализованных рек бассейна озера Эльтон, Россия V.G. GAGARIN & V.A. GUSAKOV В.Г. ГАГАРИН, В.А. ГУСАКОВ V.G. Gagarin & V.A. Gusakov, Institute for Biology of Inland Waters, Russian Academy of Sciences, Borok, Yaroslavl Prov., 152742, Russia. E-mail: [email protected] A new species of free-living nematode (Calodorylaimus salinus sp. nov.), found in sediment of the highly mineralised rivers of the Elton lake basin (Russia), is described and illustrated. This species is close to C. mongolicus Andrássy, 1988, but differs from the latter in having a wider labial region, a stouter tail in females and a greater number of separate precloacal supplements in males. A dichotomic key for identification of valid species of the genus Calodorylaimus An- drássy, 1986 is given. Calodorylaimus densus Andrássy, 1988 is assigned to the genus Laimydorus Siddiqi, 1969. Представлены описание и рисунки нового вида свободноживущих нематод (Calodorylai- mus salinus sp. nov.), обнаруженного в осадках высокоминерализованных рек бассейна озера Эльтон, Россия. Этот вид морфологически близок к C. mongolicus Andrássy, 1988, но отличается от него более широкой областью губ, более толстым хвостом у самок и большим числом свободнолежащих преклоакальных супплементов у самцов. Приведен дихотомический ключ для определения валидных видов рода Calodorylaimus Andrássy, 1986. Calodorylaimus densus Andrássy, 1988 отнесен к роду Laimydorus Siddiqi, 1966. Key words: freshwater free-living nematodes, morphology, highly mineralised rivers, Dory- laimida, Dorylaimidae, Calodorylaimus, new species Ключевые слова: пресноводные свободноживущие нематоды, морфология, высокоми- нера лизо ванные реки, Dorylaimida, Dorylaimidae, Calodorylaimus, новый вид INTRODUCTION 3–40 km with a water salinity of 7–32 gl-1.
    [Show full text]
  • JOURNAL of NEMATOLOGY Morphological And
    JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2019-029 e2019-29 | Vol. 51 Morphological and molecular characterization of Labronema montanum sp. n. (Dorylaimida, Dorylaimidae) from Spain R. Peña-Santiago* and J. Abolafia Departamento de Biología Abstract Animal, Biología Vegetal y Ecología, Universidad de Jaén, Campus “Las A new species of the genus Labronema, collected in a natural Lagunillas” s/n, 23071-Jaén, Spain. mountain habitat of the southern Iberian Peninsula, in Spain, is studied, including its morphological and morphometric charac- *E-mail: [email protected] terization, SEM observations, and D2-D3 28S-rRNA sequences. This paper was edited by Zafar Labronema montanum sp. n. is distinguishable by its 1.56 to Ahmad Handoo. 2.08 mm long body, with lip region being offset by constriction Received for publication March 26, and 19 to 24 µm broad, odontostyle 21 to 29 µm long, neck 417 to 2019. 551 µm long, pharyngeal expansion 205 to 272 µm long, the pres- ence of three cardiac lobes at the pharyngo-intestinal junction, a long and tripartite uterus, longitudinal vulva (V = 57-60), a short and rounded caudal region (19–35 µm, c = 56-86, c = 0.5-0.8), spicules 65 to 76 µm long, and 20 to 25 nearly contiguous ventromedian supplements with hiatus. Key words Description, Dorylaims, Labronema, LSU, Morphology, New species, SEM, Taxonomy. The genus Labronema Thorne, 1939 is a worldwide Material and methods dorylaimid (order Dorylaimida) group with about 41 valid species of intricate taxonomy (cf. Andrássy, Nematode extraction and processing 2009) and predator feeding habits (Thorne, 1939, 1974).
    [Show full text]
  • Biodiversity, Abundance and Prevalence of Kleptoparasitic Nematodes Living Inside the Gastrointestinal Tract of North American Diplopods
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 12-2017 Life where you least expect it: Biodiversity, abundance and prevalence of kleptoparasitic nematodes living inside the gastrointestinal tract of North American diplopods Gary Phillips University of Tennessee, [email protected] Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Recommended Citation Phillips, Gary, "Life where you least expect it: Biodiversity, abundance and prevalence of kleptoparasitic nematodes living inside the gastrointestinal tract of North American diplopods. " PhD diss., University of Tennessee, 2017. https://trace.tennessee.edu/utk_graddiss/4837 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Gary Phillips entitled "Life where you least expect it: Biodiversity, abundance and prevalence of kleptoparasitic nematodes living inside the gastrointestinal tract of North American diplopods." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Entomology,
    [Show full text]
  • Taxonomy Assignment Approach Determines the Efficiency of Identification of Metabarcodes in Marine Nematodes
    Taxonomy assignment approach determines the efficiency of identification of metabarcodes in marine nematodes Oleksandr Holovachov1, Quiterie Haenel2, Sarah J. Bourlat3 and Ulf Jondelius1 1Department of Zoology, Swedish Museum of Natural History, Stockholm, Sweden 2Zoological Institute, University of Basel, Switzerland 3Department of Marine Sciences, University of Gothenburg, Sweden Abstract: Precision and reliability of barcode-based biodiversity assessment can be affected at several steps during acquisition and analysis of the data. Identification of barcodes is one of the crucial steps in the process and can be accomplished using several different approaches, namely, alignment-based, probabilistic, tree-based and phylogeny-based. Number of identified sequences in the reference databases affects the precision of identification. This paper compares the identification of marine nematode barcodes using alignment-based, tree-based and phylogeny-based approaches. Because the nematode reference dataset is limited in its taxonomic scope, barcodes can only be assigned to higher taxonomic categories, families. Phylogeny-based approach using Evolutionary Placement Algorithm provided the largest number of positively assigned metabarcodes and was least affected by erroneous sequences and limitations of reference data, comparing to alignment- based and tree-based approaches. Key words: biodiversity, identification, barcode, nematodes, meiobenthos. 1 1. Introduction Metabarcoding studies based on high throughput sequencing of amplicons from marine samples have reshaped our understanding of the biodiversity of marine microscopic eukaryotes, revealing a much higher diversity than previously known [1]. Early metabarcoding of the slightly larger sediment-dwelling meiofauna have mainly focused on scoring relative diversity of taxonomic groups [1-3]. The next step in metabarcoding: identification of species, is limited by the available reference database, which is sparse for most marine taxa, and by the matching algorithms.
    [Show full text]
  • A Very Rare Malformation Affecting the Female Genital System of One Labronema Specimen (Dorylaimida, Dorylaimidae)
    JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2019-017 e2019-17 | Vol. 51 A Very Rare Malformation Affecting the Female Genital System of one Labronema Specimen (Dorylaimida, Dorylaimidae) Reyes Peña-Santiago Departamento de Biología Animal, Biología Vegetal y Ecología, Universidad de Jaén, Campus “Las Lagunillas,” Jaén, 23071, Spain. E-mail: [email protected] This paper was edited by Erik J. Ragsdale. Received for publication September 10, 2018. Several kinds of abnormalities or malformations affect- phic-opisthodelphic condition, total or partial reduction ing the female genital system of Dorylaimid nematodes of one genital branch, and the existence of two (or even have been repeatedly reported in longidorid forms, three) vulvae (see Table 1 for a compendium of previous more occasionally in free-living taxa. These anomalies records). Radivojević (2005) described and discussed include total or partial duplication of the system, a didel- with some detail the nature of these anomalies. Figure 1: Light micrographs of Labronema sp. A–E and G–I, abnormal female; F, normal female. A: anterior region in median lateral view; B: posterior genital branch (arrow pointing at the supposed position of vulva); C, E: genital system (arrow pointing at the supposed position of vulva); F: posterior genital branch; G: lip region in lateral surface view; H: entire body; I: caudal region (arrow pointing at anus). (Scale bars: A, G, I = 10 µm; B, D = 50 µm; C, E, F = 100 µm). © 2019 Author. This is an Open Access article licensed under the Creative 1 Commons CC BY 4.0 license, https://creativecommons.org/licenses/by/4.0/ A Very Rare Malformation Affecting the Female Genital System of one Labronema Specimen (Dorylaimida, Dorylaimidae) Table 1.
    [Show full text]
  • Cosmopolitanism and Endemism in Free-Living Nematodes
    Biogeographia – The Journal of Integrative Biogeography 33 (2018): 33–39 Cosmopolitanism and endemism in free-living nematodes ALDO ZULLINI Università di Milano-Bicocca, Piazza della Scienza 2, 20126 Milan, Italy e-mail corresponding author: [email protected] Keywords: biogeography, cosmopolitanism, endemism, soil and freshwater Nematoda. SUMMARY Most free-living nematodes should have a global distribution if they would follow general tendencies of microbial organisms. Information on free-living nematodes presented in this review demonstrates that this cosmopolitanism is less common than assumed by theory. While very large distribution ranges are observed in a number of nematode species, various examples of endemism are described for isolated units like islands, extreme environments and ancient pre-Quaternary lakes. Endemism is generally rare among microorganisms, but a typical observation for larger organisms. The biogeography of nematodes thus reflects their intermediate position between macro- and microorganisms and future studies on this interesting group may help identifying why the positive relationship between body size and range size observed in large animals shifts to a negative relationship in microbial organisms. INTRODUCTION Fenchel and Finlay 2004, Martiny et al. 2006, Fontaneto 2011). Traditionally, zoogeography is based on the While the distribution ranges of big geographic distribution of macro-organisms, mainly organisms tend to be proportional to their size mammals and birds. Little knowledge is available (larger animals having larger range sizes), on the distribution of small terrestrial species (e.g. contrasting biogeographic tendencies have been insects, mites, worms) as those are often difficult to suggested for very small (microscopic) organisms detect and to identify. While many micro- and (Finlay 2002, Jenkins et al.
    [Show full text]
  • Longidoridae and Trichodoridae (Nematoda: Dorylaimida and Triplonchida). Lincoln, N.Z.: Landcare Research
    2 Xu & Zhao (2019) Longidoridae and Trichodoridae (Nematoda: Dorylaimida and Triplonchida) EDITORIAL BOARD Dr M. J. Fletcher, NSW Agricultural Scientific Collections Unit, Forest Road, Orange, NSW 2800, Australia Prof. G. Giribet, Museum of Comparative Zoology, Harvard University, 26 Oxford Street, Cambridge, MA 02138, U.S.A. Dr R. J. B. Hoare, Manaaki Whenua - Landcare Research, Private Bag 92170, Auckland, New Zealand Mr R. L. Palma, Museum of New Zealand Te Papa Tongarewa, P.O. Box 467, Wellington, New Zealand Dr C. J. Vink, Canterbury Museum, Rolleston Ave, Christchurch, New Zealand CHIEF EDITOR Prof Z.-Q. Zhang, Manaaki Whenua - Landcare Research, Private Bag 92170, Auckland, New Zealand Associate Editors Dr T. R. Buckley, Dr R. J. B. Hoare, Dr R. A. B. Leschen, Dr D. F. Ward, Dr Z. Q. Zhao, Manaaki Whenua - Landcare Research, Private Bag 92170, Auckland, New Zealand Honorary Editor Dr T. K. Crosby, Manaaki Whenua - Landcare Research, Private Bag 92170, Auckland, New Zealand Fauna of New Zealand 79 3 Fauna of New Zealand Ko te Aitanga Pepeke o Aotearoa Number / Nama 79 Longidoridae and Trichodoridae (Nematoda: Dorylaimida and Triplonchida) by Yu-Mei Xu Agronomy College, Shanxi Agricultural University, Taigu 030801, China Email: [email protected] Zeng-Qi Zhao Manaaki Whenua - Landcare Research, 231 Morrin Road, Auckland, New Zealand Email: [email protected] Auckland, New Zealand 2019 4 Xu & Zhao (2019) Longidoridae and Trichodoridae (Nematoda: Dorylaimida and Triplonchida) Copyright © Manaaki Whenua - Landcare Research New Zealand Ltd 2019 No part of this work covered by copyright may be reproduced or copied in any form or by any means (graphic, elec- tronic, or mechanical, including photocopying, recording, taping information retrieval systems, or otherwise) without the written permission of the publisher.
    [Show full text]
  • The Genus Dorylaimoides Thorne and Swanger, 1936
    Fundarn. appl. Nernawl., 1997,20 (3),243-251 The genus Dorylaimoides Thorne & Swanger, 1936 (Nematoda: Dorylaimida). 1. Taxonomy and variability Reyes PENA SA.NTIAGO* and Manuel PERALTA** e' Universidad de Jacn. Deparlarnenlo de Biologia Animal, Vegelal)' Ecologia. Paraje "Las Lagu.mllas "s/n, Edificio n" 5, 23071jaen, Spain and ,,;, 1. B. "Auringis ", Avda. de Andaluda s/n, 23005jaen, Spain. Accepted for publication ] 3 May] 996. Summary -A general revision of differenr aspects of the morphology and taxonomy of the genus DOly/airnoides Thome & Swanger, 1936 is presenred. Variabiliry ofthe morphological features is described and illustrated, and their taxonomic value is briefly discussed. The taxonomical position of the genus, its relationships with other genera and its intrageneric taxonomy are likewise treated. A list of the species is also given. Reswne - Le genre Dorylaimoides Thome & Swanger, 1936 (Nematoda: Dorylairnida). 1. Taxinornie et variabilite­ Une revision generale des differenrs aspects de la morphologie et de la taxonomie du genre Dorytairnoides Thome & Swanger, 1936 est presentee. La variabilite des caraeteristiques morphologiques est decrite et illustree, et !eur valeur taxonomique est discuree brievemenr. La position taxonomique du genre, ses relations avec d'autres genres et la taxonomie intragenerique sont ega!emenr traitees. Une liste des especes est donnee. Key words: D01ylairnoides, nematodes, taxonomy. Dorylalmoldes Thorne & Swanger, 1936 is one espe­ body diameter at neck base; tapering also, towards the cially interesting dorylaimid nematode genus due to its posterior extremity more or less according to the tail intricate taxonomy and its relatively wide morphological shape. In general, body slender since de Man's " a " variability. At present, it contains more than 60 species, ratio usually varies from 30 to 40 but may exceed the some of which have been described from a small num­ latter value.
    [Show full text]
  • Impact of Trophic Ecologies on the Whereabouts of Nematodes in Soil
    Impact of trophic ecologies on the whereabouts of nematodes in soil Casper W. Quist Thesis committee Promotor Prof. Dr Jaap Bakker Professor of Nematology Wageningen University & Research Co-promotor Dr Johannes Helder Associate professor, Laboratory of Nematology Wageningen University & Research Other members Prof. Dr Wietse de Boer, Wageningen University & Research Dr Sofie Derycke, Royal Belgian Institute of Natural Sciences, Brussels, Belgium Prof. Dr Michael Bonkowski, University of Cologne, Germany Dr Christien Ettema, CEO Shades of Green This research was conducted under the auspices of the C.T. de Wit Graduate School of Production Ecology and Resource Conservation Impact of trophic ecologies on the whereabouts of nematodes in soil Casper W. Quist Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus, Prof. Dr A.P.J Mol, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Friday 19 May 2017 at 1:30 p.m. in the Aula. Casper W. Quist Impact of trophic ecologies on the whereabouts of nematodes in soil, 130 pages. PhD thesis, Wageningen University, Wageningen, the Netherlands (2017) With references, with summary in English. ISBN 978-94-6343-081-4 DOI http://dx.doi.org/ 10.18174/403954 Contents Chapter 1 General introduction 7 Chapter 2 Selective alteration of soil food web components by 17 invasive giant goldenrod Solidago gigantea in two distinct habitat types (published in Oikos 2014, 123, 837-845)
    [Show full text]