Bacillus Subtilis Spore Resistance Towards Low Pressure Plasma Sterilization = Bacillus Subtilis Sporenresistenz Gegenüber Plas

Bacillus subtilis Spore Resistance towards

Low Pressure Plasma Sterilization

Dissertation to obtain the degree Doctor Rerum Naturalium (Dr. rer. nat.) at the Faculty of Biology and Biotechnology Ruhr University Bochum

International Graduate School of Biosciences Ruhr University Bochum (Chair of Microbiology)

Submitted by

Marina Raguse

from KönigsWusterhausen, Germany

Bochum, April 2016

First supervisor: Prof. Dr. Franz Narberhaus

Second supervisor: Prof. Dr. Peter Awakowicz

Bacillus subtilis Sporenresistenz gegenüber

Plasmasterilisation im Niederdruck

Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) der Fakultät für Biologie und Biotechnologie der Ruhr-Universität Bochum

Internationale Graduiertenschule für Biowissenschaften Ruhr-Universität Bochum (Lehrstuhl für Biologie der Mikroorganismen)

Vorgelegt von

Marina Raguse

aus KönigsWusterhausen, Germany

Bochum, April 2016

Erstbetreuer: Prof. Dr. Franz Narberhaus

Zweitbetreuer: Prof. Dr. Peter Awakowicz This work was conducted externally at the German Aerospace Center, Institute for Aerospace Medicine, Department of Radiation Biology, Research Group Astrobiology/Space Microbiology, in 51147, Cologne, Germany, under the supervision of Dr. Ralf Möller from 01.12.2012 until 31.07.2016.

Diese Arbeit wurde extern durchgeführt am Deutschen Zentrum für Luft- und Raumfahrt, Institut für Luft-und Raumfahrtmedizin, Abteilung Strahlenbiologie, Arbeitsgruppe Astrobiologie/Weltraummikrobiologie in 51147, Köln, unter der Betreuung von Dr. Ralf Möller im Zeitrahmen vom 01.12.2012 – 31.07.2016.

Danksagung

Zuerst möchte ich mich herzlich bei meinem Doktorvater Prof. Dr. Franz Narberhaus für die Unterstützung bedanken und für die Möglichkeit auch extern am Lehrstuhl für Biologie der Mikroorganismen der Ruhr-Universität Bochum zu promovieren.

Mein großer Dank gilt ebenfalls meinem Korreferenten Prof. Dr. Peter Awakowicz, für sein allzeit großes Interesse an der Arbeit mit Sporen und die anregenden Diskussionen in den PlasmaDecon- Meetings.

Ganz besonders danken möchte ich meinem Betreuer Dr. Ralf Möller, der mich während der gesamten Arbeit fortwährend unglaublich unterstützt und gepusht hat, immer ein offenes Ohr hatte, und mir tolle Möglichkeiten zur wissenschaftlichen und persönlichen Entwicklung geboten hat. Seine kreativen und wegweisenden Ideen haben wesentlich zum Gelingen dieser Arbeit beigetragen. Ich hoffe, er verrät mir jetzt endlich, warum er keine Schokolade mag.

Ebenfalls danken möchte ich der Abteilung Strahlenbiologie des Deutschen Zentrums für Luft-und Raumfahrt, allen voran Dr. Günther Reitz, Dr. Christine Hellweg, und Dr. Petra Rettberg für die Ermöglichung der experimentellen Durchführung der Arbeit, sowie allen Kollegen für die gute Zusammenarbeit.

Ein riesiges Dankeschön geht an meine Kollegen der Arbeitsgruppe Space Microbiology, Katja Nagler, Andrea Schröder, und Felix Fuchs, sowie meine ehemalige Bachelorstudentin Vanessa Neumann, die Freuden und Ängste gleichermaßen mit mir teilten, immer für eine ausgelassene Stimmung im Labor gesorgt haben, und mir über die Zeit sehr ans Herz gewachsen sind.

Ohne Katharina Stapelmann, Marcel Fiebrandt, und dem Lehrstuhl AEPT wären die Plasmaexperimente und besonders die Interpretation der Daten nicht möglich gewesen. Ich danke euch sehr für eure Unterstützung und die unermüdliche und geduldige Erklärung der Plasmaphysik für „den Biologen“.

Darüber hinaus danke ich meinen zahlreichen Kooperationspartnern, die mich auf Reisen stets überaus freundlich empfangen haben, mir die Möglichkeit gaben, spannende Daten zu generieren, und mir mit ihrer Expertise stets zur Seite standen. Besonderer Dank gilt hier Dr. Patrick Eichenberger von der New York University, Dr. Peter Eaton und Dr. Maria Feio von der Universität Porto, sowie Dr. Ryuichi Okayasu, Dr. Akira Fujimori, Dr. Hiroshi Fujisawa, und Dr. Hirokazu Hirakawa vom National Institute of Radiological Sciences. Desweiteren möchte ich mich bei Dr. Michael Laue und Dr. Kazimierz Madela vom Robert-Koch- Institut für die Anfertigung der Life-Cell-Imaging Daten und das rege Interesse an unserer Forschung bedanken. Mein großer Dank gilt ebenso Dr. Peter Setlow vom UConn Health Center, Dr. Juan Alonso vom Spanish National Research Council, und Dr. Joanne E. Thwaite vom Defence Science and Technology Laboratory für den regen Wissensaustausch und die tatkräftige Unterstützung bei der Manuskripterstellung.

Ebenfalls bedanken möchte ich mich bei der Werkstatt ME, allen voran Christoph Steger, für die aktive Hilfe bei größeren und kleineren Problemen, sowie die unterhaltsamen Mittagspausen.

Ein ganz besonderer Dank gilt meinen Eltern und Brüdern, meinem Verlobten Konrad, und meinen tollen Freunden, allen voran Dani und Nathalie, die immer an mich geglaubt haben und mir stets Mut zugesprochen haben. Ich danke euch aus ganzem Herzen für euren Beistand, die wunderbaren Ablenkungen, und das unglaubliche Video!

Bei der Deutschen Forschungsgemeinschaft DFG bedanke ich mich für die Finanzierung im Rahmen des Projektes „DFG PlasmaDecon“ (PAK 728 to R.M. (MO 2023/2-1)).

A. Introduction ...... 1 1. Nonthermal Plasmas for Sterilization ...... 1 1.1 Motivation for Search of Alternative Sterilization Methods ...... 1 1.2 Plasma – the 4th State of Matter ...... 1 1.3 Fields of Application for Non-thermal Plasmas ...... 3 1.3.1 Application of Low Pressure Plasma for Sterilization ...... 4 1.3.2 Plasma as an Alternative Sterilization Method for Space Hardware ...... 6 1.4 Bacillus Spores as Bioindicators for Sterilization Processes ...... 7 1.5 Plasma Interaction with Living Biological Matter ...... 8 2. Experimental Setup ...... 11 2.1 Very High Frequency-Capacitively Coupled Plasma Reactor ...... 11 2.2 Double Inductively Coupled Plasma Reactor ...... 13 3. Bacillus subtilis - the model organism ...... 14 3.1 Regulation of Bacillus subtilis Endospore Formation and Dormancy ...... 14 3.1.1 Spore Coat Morphogenesis ...... 16 3.2 Bacillus Spore Structure and Role in Spore Resistance ...... 18 3.2.1 Exosporium ...... 19 3.2.2 Spore Coat Layers ...... 19 3.2.3 Outer Membrane ...... 20 3.2.4 Cortex ...... 20 3.2.5 Germ Cell Wall ...... 21 3.2.6 Spore Inner Membrane ...... 21 3.2.7 Spore Core ...... 21 3.3 Time Line of Spore Revival ...... 23 3.3.1 Spore Germination ...... 23 3.3.2 Early and Late Outgrowth Phase ...... 24 3.4 Bacillus subtilis Spore Resistance ...... 26 3.4.1 Ionizing Radiation Resistance ...... 26 3.4.2 UV Resistance ...... 27 3.4.3 Heat Resistance ...... 29 3.4.4 Chemical Resistance ...... 30 3.4.5 DNA Repair in B. subtilis Spore Revival ...... 31 3.4.5.1 Spore Photoproduct Lyase…………………………………...……….…… 32 3.4.5.2 Excision Repair………………………………………………..……..…… 32

3.4.5.3 DNA Double strand Break Repair………………………………….…...... 33

4. Objective ...... 37 B. Utilization of low-pressure plasma to inactivate bacterial spores on stainless steel screws...... 39 C. Resistance of Bacillus subtilis spore DNA to lethal ionizing radiation damage relies primarily on spore core components and DNA repair, with minor effects of oxygen radical detoxification...... 5 D. Improvement of biological indicators by uniformly distributing Bacillus subtilis monolayers to evaluate enhanced spore decontamination technologies...... 57 E. Understanding of the importance of the spore coat structure and pigmentation in the Bacillus subtilis spore resistance to low pressure plasma sterilization...... 66 F. DNA double-strand breaks commit outgrown Bacillus subtilis haploid spore to nonhomologous end joining...... 101 G. Identification of a conserved 5’-dRP lyase activity in bacterial DNA repair ligase D and its potential role in base excision repair...... 134 H. Role of DNA repair in Bacillus subtilis spore resistance towards low pressure plasma sterilization ...... 147 I. Discussion ...... 170 1. Industrial Implementation ...... 170 2. Biological Indicators for Plasma Sterilization ...... 175 3. B. subtilis Spore Inactivation by Low Pressure Plasma Treatment ...... 174 4. Role of Spore Coat in Protection ...... 176 5. DNA Protection and Repair ...... 179 5.1 DNA Protection ...... 179 5.2 Induction of DNA Photoproducts ...... 180 5.3 Induction of DNA Strand Breaks and Base Modification ...... 181 5.4 DNA Double Strand Break Repair in Reviving Spores ...... 184 5.5 Multifunctional Role of LigD in DNA Repair ...... 187 J. Conclusion ...... 189 K. Summary ...... 191 L. Zusammenfassung ...... 194 M. Outlook ...... 197 N. References ...... 199 O. Appendix ...... 216 1. Unpublished Data ...... 216 2. Publications ...... 217 3. Conference Proceedings ...... 219 3.1. Conference Talks ...... 219 3.2. Conference Posters ...... 219 3.3. Awards ...... 220 4. Miscellaneous ...... 220 5. Curriculum vitae ...... 222 6. Contribution of the Integrated Publications and Manuscripts ...... 224 7. Selbstständigkeitserklärung ...... 226

Abbreviations

5’dRP 5’-2-deoxyribose-5-phosphate 6-4PP Pyrimidine 6-4 primidone adduct A Adenine AFM Atomic force microscopy ATP Adenosine triphosphate AP Apurinic/ apyrimidinic B. subtilis Bacillus subtilis BER Base excision repair BI Biological indicator C Cytosine Ca2+-DPA Calcium dipicolinic acid CAP Cold atmospheric plasma CPD Cyclobutane pyrimidine dimer COSPAR Committee of Space Research DBD Dielectric Barrier Discharge DICP Double inductively coupled plasma reactor DNA Deoxyribonucleic acids DSB Double strand breaks E. coli Escherichia coli eV Electron volts GR Germination receptor G Guanine

H2O2 Hydrogen peroxide HPLC-MS/MS High-performance liquid chromatography coupled with tandem mass spectrometry HR Homologous recombination HZE High-energy-charged particles IM Inner membrane IR Ionizing radiation ISS International Space Station LET Linear energy transfer LPP Low pressure plasma NER Nucleotide excision repair NHEJ Nonhomologous end-joining NO• Nitric oxide

OH• Hydroxyl radical

O1 Atomic oxygen (Radical species) 1 O2 Singlet oxygen (Metastable species) OM Outer membrane PG Peptidoglcan PNPase polynucleate phosphorylase rRNA Ribosomal RNA ROS Radical oxygen species SAL Sterility assurance level SAFR-032 Space craft assembly facility isolate 032 SASPs Small acid soluble spore proteins sccm Standard cubic centimeters per minute σ Sigma factor SP 5-thyminyl-5,6-dihydrothymine (Spore photoproduct) sp. Species ss Single strand SSB Single strand break SsbA Single strand binding proteins T Thymine UV Ultraviolet radiation VHF-CCP Very high frequency-capacitively coupled plasma reactor VUV Vacuum ultraviolet radiation

A. Introduction 1. Non-thermal Plasmas for Sterilization 1.1 Motivation for Search of Alternative Sterilization Methods Microbial contamination on surfaces is a recurring problem within health, pharmaceutical and food industry sectors (Abreu et al., 2013, Rutala and Weber, 2013). Surface sterilization is a crucial step to ensure sterility of food processing equipment, minimize spread of pathogens and prevent the transmission of nosocomial infections (Williams et al., 2009). Common sterilization procedures that are widely used for microbial inactivation include heat treatment

(dry and moist heat), chemical disinfection with solutions or gases (H2O2, ethylene oxide), filtration, and exposure to ionizing radiation (reviewed in Rutala and Weber, 2013). While generally effective, most conventional methods suffer from significant drawbacks and restrictions. Currently employed procedures can introduce considerable damage to the treated material due to the exposure to elevated temperatures or aggressive chemicals and often pose a risk to the operator, rendering these methods suboptimal in many applications (Yardimci and Setlow, 2010). These limitations have motivated the search for alternative sterilization methods. Plasma sterilization is a promising alternative to conventional sterilization methods as it offers rapid and efficient microbial inactivation, while being gentle to sensitive and heat- labile materials and very safe to the operating staff. Over the last decade, the application of non-thermal plasmas has gained wide attention in biomedical and nutritional research, as well as in space-flight applications (De Geyter and Morent, 2012, Shimizu et al., 2014; Lerouge, 2000).

1.2 Plasma – the 4th State of Matter In physical sciences, plasma is regarded as the “fourth state of matter” with the highest energy, in line with solid, liquid and gaseous states. It is defined as an ionized gas comprising oppositely charged particles (ions and electrons) with zero net electrical charge and is therefore quasineutral. In addition, plasma discharges contain neutral and excited atoms and molecules, radicals, as well as visible and ultraviolet (UV) photons (De Geyter and Morent, 2012). The term plasma was first introduced by Irving Langmuir in 1928 as the chemical composition of this strongly ionized gas reminded him of blood plasma (Langmuir, 1928). Natural occurring plasmas comprise over 99% of the visible universe in form of stars, solar winds, supernovas, and the outer space in between celestial bodies. Additionally, on earth

1 plasmas exist in the form of lighting or aurora borealis. Technically produced plasmas are not only found in industrial settings but also in technologies of our everyday life, e.g. in displays or in fluorescent lamps (Janzen, 2002). Industrial plasmas are the result of a gas or gas mixture that is subjected to the introduction of electrical energy by an electric field (e.g. between two electrodes) causing the charged particles, predominantly the light-weighted electrons, to accelerate, separate from the nuclei, and collide with atoms and molecules leading to dissociation, excitation, and ionization (Moisan et al., 2001; Laroussi, 2004). Based on the relative temperature of electrons, ions and neutrals, the nature of plasma can be divided into thermal and non-thermal plasmas. Thermal plasmas are significantly ionized and are therefore characterized by high temperatures of electrons and charged and uncharged particles. This thermodynamic equilibrium gives rise to gas temperatures of several thousands of Kelvin and are typically employed in industrial settings for welding, metal cutting, and electronic etching. In contrast, in non-thermal plasmas the degree of ionization is very low (< 1%) and the electron temperature is substantially higher, often by tens of thousands of Kelvin, than the temperature of ions and uncharged particles, leading to non-equilibrium gas discharges with temperatures as low as room temperature and making non-thermal plasma a suitable technique for the treatment of heat-sensitive materials (Moisan et al., 2001, Keudell et al., 2010). Non-thermal plasma discharges can be operated as atmospheric or low pressure, leading to plasma discharges with varying active agents and germicidal properties, therefore, enabling a variety of applications. Cold atmospheric pressure plasmas (CAP) are operated under ambient conditions and are either in direct or indirect contact with the treated sample. They are designed for the sterilization of heat-sensitive materials that are not suitable for sterilization in vacuo, such as food products or liquids. Advantageous is the compact setup of an atmospheric pressure plasma device, for example in form of a plasma jet. However, the size of the plasma discharge is very limited, allowing surface treatments of small areas, only. Additionally, depending on the setup, large gas tanks are required as feed gas for device operation (Bekeschus et al., 2016; Lackmann and Bandow, 2014). The alternative low pressure plasma (LPP) operates under vacuum conditions and is mostly driven by microwave or radio-frequency excitation (Halfmann et al., 2007; Stapelmann, 2013). Plasma operated at low pressure offers a homogeneous discharge allowing for the uniform treatment of complex 3D structures, such as prosthetics, and rapid

2 microbial inactivation at much shorter time scales compared to most CAP treatments. Materials that are vacuum stable, such as glass and metals devices, are well suited for LPP sterilization (Denis et al., 2012). However, LPP operation requires a more complex setup, including a closed vessel and expensive equipment to attain vacuum conditions (Rossi et al., 2008; Halfmann et al., 2007; Denis et al., 2012). The composition of a plasma discharge and therefore its germicidal properties are highly dependent on the reactor setup configuration and discharge operating conditions, i.e. pressure, power, carrier gases, flow rate, and applied field frequencies (Moisan, 2001). Based to these factors the obtained plasma discharge is extremely variable and contains different quantities of highly reactive species (ions, free electrons, radicals, neutral / excited atoms or molecules), alongside ultraviolet (UV) and vacuum ultraviolet (VUV) photons at different wavelengths (Moisan et al., 2001; Lerouge, 2001).

1.3 Fields of Application for Non-thermal Plasmas The versatility of plasma sterilization makes it particularly interesting for very diverse areas of application. Non-thermal plasmas have recently emerged as a powerful tool for the sterilization and surface treatment of polymeric packaging materials in the food processing industries (Pankaj et al., 2014). By modifying the surface properties at the plasma-polymer interface, the surface treatment can be used to enhance barrier characteristics of food packaging polymers towards gases and chemical solvents, enhance the surface functionalization to improve wettability, sealability or alter adhesive properties, and remove contaminating microorganisms (Pankaj et al., 2014; Schneider et al., 2005). Potential applications for non-thermal plasmas also include sterilization of heat-labile food products that are not or only partly suitable for thermal inactivation, such as fruit and vegetables, fish, eggs, and meat. Although, CAP may be the preferred choice to circumvent interruptions in the process chain by phase transitions from atmospheric pressure to low pressure conditions (Schlüter et al., 2013), LPPs have been studied for the successful and efficient inactivation of food-spoilage microorganisms on meat products offering treatment of larger areas in a homogeneous manner (Ulbin-Figlewicz et al., 2015). However, a prominent issue with food products lies on the greatest possible reduction of microbial contaminants while maintaining nutritional value and sensory properties. It has been reported that plant-

3 based products exhibit increased flavonoid content or slight discolorations after plasma treatment (Grzegorzewski et al., 2010; Selcuk et al., 2008). Further, the structure of certain food products can influence the plasma inactivation efficiency due to shielding of microorganisms (Hertwig et al., 2015), indicating the need to determine the optimal operating conditions for this particular application. Utilization of non-thermal plasma in medical care and biomedical research has gained wide attention and has already been implemented in various fields. Plasma has been demonstrated as a promising approach for the treatment of drug-resistant microorganisms as well as bacterial biofilms and biofilm-related infections which constitute an increasingly frequent medical problem with antibiotic resistant strains on the rise (Traba and Liang, 2011; Kvam et al., 2011). In the medical field, CAP is an innovative approach for topical treatment of wounds and skin diseases of bacterial origin. Studies have shown that in addition to the antiseptic effect, plasma treatment of chronic wounds stimulates the proliferation and migration of keratinocytes as well as angiogenesis presumably by activating or inhibiting integrin receptor on cell surfaces encouraging wound healing (Haertel et al., 2014).

1.3.1 Application of Low Pressure Plasma for Sterilization Of particular importance in plasma-based applications is the sterilization of medical devices, such as medical instruments and syringes that can be critical in the transmission of nosocomial infections caused by bacteria, fungi, or prions (Baxter et al., 2006; Khan et al., 2015). The introduction of heat-labile biodegradable materials onto the market, such as thermoplastic polymers for implants, requires suitable methods of sterilization which preserve the mechanical integrity and functionality by reducing the thermal or chemical stress imposed on the material (Lendlein and Langer, 2002). The use of LPP discharges is an emerging procedure that enables the sterilization of innovative heat-sensitive materials, equipment prone to corrosion, and complex electronic instruments. Advantageous of LPP over sterilization procedures using CAP is the considerably faster treatment time to achieve sterilization, the homogeneous discharge that allows the uniform treatment of complex items, and the efficient inactivation of highly resistant bacterial endospores (Moisan et al., 2001, Halfmann et al., 2007a).

4 It has been reported that conventional sterilization methods coupled with cleaning procedures are not sufficient for the removal of residual proteinaceous pyrogens or infective agents (Baxter et al., 2006). Non-thermal plasma discharges do not only offer the fast and efficient sterilization of complex materials, they also aid in the removal of contaminating and potentially infectious or harmful residues, e.g. bacterial endotoxins or prions, from surfaces of medical instruments by etching processes (Rossi et al., 2008). One of the most prominent advantages of sterilization with LPP is the short duration of a sterilization cycle compared to conventional methods as well as the capacity of maintaining low gas temperature during a treatment cycle and the use of non-toxic gases. However, a study by Alder et al. (1998) points out that the initial high acquisition cost of a plasma sterilization device may be an obstacle for many institutions. The costs of the sterilization procedure per sterilizing unit in a plasma-based sterilization system is estimated to be 30% lower compared to procedures involving elaborate ethylene oxide sterilization-cycles, yet, approximately 6 times higher compared to basic steam-based procedures. Nonetheless, in cases where instruments suffer from frequent breakdowns and require high repair costs, plasma sterilization could prove more economical in spite of the high purchase costs. Although, steam sterilization is still the cheapest sterilization method currently available, it is also the method that introduces the greatest level of damage on the sterilized items. Especially re-usable metal-based instruments and tools that undergo frequent sterilization cycles are easily corroded and need to be replaced. In cases where instruments are very costly, plasma sterilization is more cost-effective than steam or chemical sterilization. It is assumed that the costs can be lowered by 20 % when plasma is employed compared to steam sterilization. While some “plasma-assisted” sterilization systems exist (e.g. Sterrad®), which are characterized by the use of a gas mixtures with germicidal properties (in the case of Sterrad® containing hydrogen peroxide components) and subsequent plasma discharge operation for exhaust gas treatment to remove toxic residues, the only pure plasma-based sterilization system implemented in industrial settings until now is the “SKP 100” (Denis et al., 2012; Semmler et al., 2016). This LPP reactor setup offers faster procedures compared to the hydrogen peroxide gas mixtures, has a smaller footprint, introduces less material damage and does not require trained personnel for operation. The equivalent laboratory setup (the double inductively coupled plasma reactor, see section A2.2) is used for this work.

5 1.3.2 Plasma as an Alternative Sterilization Method for Space Hardware A major goal of space exploration is the search for signatures of biomolecules and life forms on other planetary bodies and moons in our solar system. The transfer of microorganisms or biomolecules of terrestrial origin to critical areas of exploration is of particular risk to compromise the development and reliability of life-detection missions on planetary bodies such as Mars and Europa (Nicholson et al., 2009). The international guidelines of planetary protection, established by the Committee of Space Research (COSPAR) in 1967, impose strict regulations on manned and robotic missions to other planets, their moons, asteroids and other celestial bodies and regulate the cleaning and sterilization of a spacecraft and critical hardware components prior to launch in order to eliminate contaminating terrestrial microorganisms and prevent cross contamination of celestial bodies (COSPAR, 2011). Depending on the mission, e.g. for missions to Mars, the bioburden of a spacecraft is restricted to a total bioburden level of ≤ 5 x 105 spores in flyby missions with no direct contact with celestial bodies (Category III), down to a surface bioburden level of ≤ 30 spores on the entire landed spacecraft in missions with direct contract and sampler operation as carried out by landers and probes (COSPAR, 2011). The scientific need to preserve the planetary environment requires extensive sterilization of spacecraft hardware materials to ensure microbial reduction accompanied with spacecraft assembly and testing in bioburden-controlled clean rooms facilities (Rummel, 2001; Demidov et al., 1995; Bruckner et al., 2009; La Duc et al., 2004). Common physical and chemical sterilization methods of are often insufficient for the complete removal of bioburden on advanced heat- labile materials, such as sensitive electronic devices, and are therefore selective for resistant spores. Monitoring of the microbial diversity in clean room facilities and spacecraft-associated components revealed a number of spore-forming bacteria among the cultivable microorganisms that exhibit elevated resistance properties towards heat, UV radiation, and hydrogen peroxide (La Duc et al., 2004; Link et al., 2004). The highly resistant nature of spores enables them to survive common sterilization treatments and possibly even transportation to extraterrestrial environments due to their remarkable resistance to hostile conditions found in interplanetary space such as vacuum and high radiation levels (Horneck et al., 2010). Therefore, space agencies are currently in the process of developing standardized methods that enable reliable sterilization and decontamination of hardware components for the use in future space missions by successfully removing highly resistant spores in short

6 treatment times but at the same time maintaining the integrity of hardware components. Non- thermal plasma has gained wide attention and is extensively studied for its application in space research-related fields (Shimizu et al., 2014).

1.4 Bacillus Spores as Bioindicators for Sterilization Processes In order to ensure the efficiency and to validate the continuous functionality of a disinfection or sterilization procedure, biological testing standards are required. Spores of the genus Bacillus are frequently used as a biological indicator (BI) of sterility, primarily because bacterial spores exhibit elevated resistance properties towards chemical and physical methods of sterilization (Nicholson et al., 2000; Setlow, 2006, Humphreys, 2011; Harberer and Doorne, 2011). Hence, a process that achieves full spore inactivation ensures complete elimination of other contaminating microorganisms. Variations within the performance of a BI have been frequently reported (Sigwarth and Stärk, 2003; Shinati and Akers, 2000; Humphreys, 2011). Besides variations in the intrinsic resistance properties of the microorganisms, e.g. by variations in genetic traits or alteration of sporulation conditions (Nguyen et al. 2011), extrinsic factors may also affect the performance of BIs and consequently the accurate assessment of spore resistance and inactivation. For example, the sterilization results may be altered by poor choices of the carrier material for spore deposition (Coohill and Sagripanti, 2008) and in particular the BI manufacturing procedure (Shintani and Akers, 2000). The method by which spores are mounted on carriers is also extremely important as inconsistencies in the procedure affect the homogeneity of spore deposition (Raguse et al., 2016). In particular the presence of spore clusters and/or layers are likely to influence the sterilization results as shielded spores can exhibit an increased resistance to some treatments, e.g. UV-based inactivation as photons only possess limited penetration capability (Coohill and Sagripanti, 2008). ISO 11138-1 defines BI manufacturing for sterilization procedures. A sterility assurance level (SAL) of 10-6 is required for an initial BI population of 106, indicating a 12 log reduction for successful validation. The D value and the corresponding sterilization exposure required to reach a 12 log reduction are determined only from a linear survival curve (Shintani, 2015). Consequently, clumping and insufficient homogeneity of a spore-based BI impedes the construction of linear inactivation curves and the reliable assessment of

7 inactivation efficiencies. Therefore, adequate control procedures when manufacturing BIs are essential for the demanded quality and reliability. Key factors that affect the BI manufacturing are the standardized BI design and a reproducible spore deposition technique (Humphreys, 2011). In the progressing field of plasma sterilization, it is of particularly high interest to standardize the inactivation process and develop a suitable BI for reliable assessment of the sterilization efficiency, representing an absolute requirement for plasma sterilization devices to be implemented in industrial settings.

1.5 Plasma Interaction with Living Biological Matter Plasma sterilization is a promising alternative to conventional sterilization methods as plasma discharges contain a mixture of free radicals, charged particles, neutral/excited atoms, photons in the ultraviolet (UV) and vacuum ultraviolet (VUV) spectrum which lead to rapid microbial inactivation by interacting with essential cellular components and biomolecules (Fig.1; Rossi et al., 2008; De Geyter and Morent, 2012). The biocidal mechanisms of low pressure or atmospheric pressure plasma sterilization are not yet fully understood. Many different mechanisms have been observed that lead to microbial inactivation, highly dependent on the pressure, reactor type and gas mixture (Laroussi and Leipold, 2004; Keudell et al, 2010; Ehlbeck et al., 2011; Lackmann et al., 2013a). In LPP discharges, the bactericidal effect of high fluence rates of UV and VUV photons has been shown to play a major role in spore inactivation (Lerouge et al., 2000a; Halfmann et al., 2007b; von Keudell et al, 2010; Denis et al., 2012). In contrast, emitted photons only play a minor role in spore inactivation by atmospheric plasma discharges, e.g. by dielectric barrier discharge (DBD) types, as high energetic photons < 300 nm are absorbed by the surrounding oxygen-containing atmosphere and do not reach the sample (Lackmann et al., 2013a, Laroussi and Leipold, 2004). However, in the presence of an inert gas atmosphere, e.g. applied helium gas flow, plasma-emitted (V)UV photons are less absorbed and higher intensities can be reached (Lackmann et al., 2013b). (V)UV photons can cause extensive damage to the genetic material introducing DNA strand breaks and various types of lesions (Setlow, 2006; Donnellan and Setlow, 1965; Douki et al., 2005a; 2005b; Moeller et al., 2007). Consequently, plasma setups and discharge parameters have been optimized to maximize the intensity of (V)UV photons (Halfmann et al., 2007a; 2007b).

8 While UV radiation is a key factor for spore inactivation, the addition of small admixtures of oxygen have been reported to significantly increase the effectiveness of LPP discharges for B. atrophaeus spore inactivation (Keudell et al., 2010; Stapelmann et al., 2008; Benedikt et al., 2008). The presence of chemically reactive species leads to significant erosion of spore surfaces, which can be induced by particle collision and the adsorption of reactive neutral species to the microbial surface, a process termed etching, which leads to chemical reactions and breakage of chemical bonds in biomolecules and the production of volatile compounds (Philip et al., 2002; von Keudell et al., 2010). Reactive oxygen species (ROS) or reactive nitrogen species (RNS) include e.g. atomic radicals, such as atomic oxygen (O1), or molecular radicals, such as hydroxyl ions (OH•) or nitric oxide (NO•), which are highly reactive towards organic matter and cause oxidative stress. Species in the metastable energy 1 state, e.g. singlet oxygen species ( O2) or argon metastables, de-excite by collision, transferring their energy to other particles and are thereby able to break molecular bonds (Moisan et al., 2001). Charged and neutral particles can remove organic substrates by sputtering, a process where ions trigger a collision cascade causing the breaking of bonds in solids by overcoming the binding energy and displacing atoms from the surface (physical sputtering). However, physical sputtering is an unlikely event in plasma-sample interactions as bias voltage is required to increase the energy level of ions to a few hundred electronvolts before sputtering occurs. This energy state is usually not reached naturally in plasma discharges designed for plasma sterilization purposes to prevent damage of sensitive materials (Denis et al., 2012). Yet, in the presence of reactive species, synergistic effects in form of recombination action of reactive particles with open bonds can occur even at low energies, stabilizing the bond breaking event (chemical sputtering) (Große-Kreul et al., 2012; Raballand et al., 2008; Rauscher et al., 2009). Opretzka et al. (2007) mimicked a typical argon and hydrogen plasma by using quantified beams of hydrogen and argon ions, demonstrating that hydrogen atoms alone do not cause spore inactivation, but the simultaneous impact with low energy argon ions causes a perforation of the outer spore layer leading to significant surface alterations, although it is not clear how this affects spore viability. Likewise, the flux of highly energetic (V)UV radiation can contribute to erosion of spore surface structures through intrinsic photodesorption inducing chemical reactions on the surface and producing volatile compounds (Lerouge et al., 2000).

9 The complex nature of plasma makes it difficult to determine single components of a discharge that are particularly bactericidal, it is rather the multifaceted nature of reactions taking place when plasma comes in contact with biological matter that leads to a decrease in survival. Depending on the discharge type various inactivation kinetics have been observed as the plasma is capable of being tuned to provide more chemically active species or more (V)UV radiation (Moisan et al., 2001; Stapelmann et al., 2008; Benedikt et al., 2008). The general inactivation model of LPP sterilization processes is a combined reaction of direct killing of single spores as a result of exposure to highly energetic VUV and UV photons and erosion of surfaces uncovering underlying spores by etching, sputtering, or photodesorption processes thereby exposing previously shielded spores to sporicidal UV photons. Synergistic effects among the different inactivation factors, e.g. UV radiation and heat, increase the inactivation effectiveness (Stapelmann et al., 2014). The effective combination of different agents renders plasma discharges extremely attractive as it is virtually impossible for an organism to develop resistance against all of these different stress factors (Ehlbeck et al., 2011).

Figure 1. Active plasma species produced in LPP discharges and activity towards a biological system.

10 2. Experimental setup The plasma sterilization experiments were performed in within the framework of the DFG Project PlasmaDecon at the German Aerospace Center, Department of Radiation Biology, Cologne, Germany (project leader: Dr. Ralf Möller), in collaboration with the Ruhr-University Bochum, Bochum, Germany, combining longstanding research on Bacillus spore resistance with the strong expertise on plasma physics of the Institute of Electrical Engineering and Plasma Technology (AEPT; project leader: Prof. Dr. P. Awakowicz) and the Faculty for Physics and Astronomy (project leader: Jun.-Prof. Dr. J. Benedikt), as well as the expertise on vegetative cell biology of the Faculty for Biology and Biotechnology Biology (project leader: Prof. Dr. J. Bandow and Prof. Dr. F. Narberhaus). The overall aim of this joined project was the study of low pressure and atmospheric pressure plasma-mediated inactivation of vegetative cells and spores by applying the gathered knowledge of absolutely calibrated measured reactive species fluxes and densities in plasma discharges to evaluate the underlying mechanisms of plasma species interacting with bio-macromolecules in vitro and in vivo. Different atmospheric and low pressure plasma setups have been investigated during this project (Schneider et al., 2011; Lackmann et al., 2015; Denis et al., 2012; Stapelmann et al. 2014). The focus of this work lies on two LPP setups, a very high frequency-capacitively coupled plasma reactor specifically designed for industrial purposes (see section A2.1) and a double inductively coupled plasma reactor (see section A2.2) with characterized fluence rates and particle densities.

2.1 Very High Frequency-Capacitively Coupled Plasma Reactor The very high frequency-capacitively coupled plasma (VHF-CCP) reactor (Fig. 2) is a LPP system that was designed to meet industrial standards. It offers an improved penetration depth allowing for the sterilization of areas that are otherwise difficult to access for plasma species (e.g. capillaries). The discharge chamber is composed of the high performance polymer polyether ether ketone (PEEK) and shaped like a drawer for efficient and practical processing. The chamber is planned to be sealable for storage of sterilized items after plasma treatment and has a volume of 4.5 l. A power of 100 - 500 W at 72 MHz is coupled into the discharge via the driving electrode at the bottom of the drawer. A rotary vane pump is used to evacuate the chamber in order to operate at a pressure of 5 - 25 Pa with a gas flow of 20 sccm

11 Figure 2. The very high frequency-capacitively coupled plasma (VHF-CCP) reactor used for sterilization experiments (kindly provided by Katharina Stapelmann).

of hydrogen, oxygen, and nitrogen. To control the pressure of the discharge two absolutely heated capacitance manometers and a butterfly valve are employed. Measurement of gas temperatures of the various discharge conditions is obtained by a fiber optic temperature monitoring system. The discharge was found to be homogeneous over the entire chamber with small edge effects. Additionally, the setup is equipped with an evaporator which allows the vaporization of small volumes (1 – 5 ml) of liquid (water and/or hydrogen peroxide) into the discharge chamber (Stapelmann, 2013; Stapelmann et al., 2013; Stapelmann et al., 2014). Characterization of the plasma discharges revealed a non-negligible influence of the material of the chamber (PEEK), which modifies the composition and abundance of plasma species by reactions of the plasma (particularly oxygen plasma) with the carbon of the polymeric substance. The produced carbon monoxide offers an additional amount of UV radiation, which may aid in sterilization. Inactivation experiments with spores of the Bacillus and Geobacillus genus showed high reduction rates within few seconds to minutes even when contained inside sealed sterile bags or placed in a process challenge device mimicking the worst case conditions for plasma treatment by challenging the penetration capability of the plasma particles (Stapelmann, 2013).

12 2.2 Double Inductively Coupled Plasma Reactor The double inductively coupled plasma (DICP) setup (Fig. 3) is designed for the LPP sterilization treatment of larger three-dimensional objects, which are in direct contact with the plasma discharge (Halfmann et al., 2007a). The reactor consists of a stainless steel cylinder with a volume of 25 l enclosed by two quartz plates and the discharge is driven by two copper coils at the top and bottom of the DICP. A matchbox splits the maximum power of 5 kW at 13.56 MHz equally to both coils. The vacuum in the vessel is achieved by a combination of a roots pump with a rotary vane fore, which allows a low-pressure environment down to 5 Pa with flows up to 160 sccm (standard cubic centimeters per minute) of argon, hydrogen,

Figure 3. (a) Sketch and (b) cut-away view of the double inductively coupled plasma (DICP) setup used for sterilization experiments, testing spores of B. subtilis as biological indicators for sterilization efficiency. nitrogen or oxygen. The plasma discharge is homogeneous over almost the entire vessel. ICP plasmas produce a dense discharge and offer high (V)UV photon and radical densities (Denis et al., 2012; Halfmann et al., 2007a). Plasma diagnostics were performed in plane with the biological samples, resulting in detailed information about UV fluences from 130 – 380 nm, electron density and temperature, gas and substrate temperature as well as selected radical and

13 ion flux densities (Halfmann et al., 2007 a; unpublished data). This setup has been demonstrated as very effective for the inactivation of Bacillus and Geobacillus spores with a wide range of plasma parameters (Halfmann et al., 2007 a; 2007b) and offers a high amount of photons, specifically in the UV and VUV wavelength spectra (Halfmann et al., 2007a; 2007b).

3. Bacillus subtilis - the model organism Gram-positive bacteria of the family Bacillaceae are widely distributed in natural habitats of soil, sediments, and air as well as in unusual environments such as clean room facilities and the International Space Station (ISS) (Vaishampayan et al., 2010; Mandic-Mulec et al., 2013; Alekhova et al., 2015). The most distinct feature of the genus Bacillus is the ability to form highly-resistant dormant endospores (hereafter referred to as spores) to survive unfavorable conditions, such as nutrient depletion (Claus and Berkeley, 1986). Spores are generally much more resistant than their vegetative counterparts to a variety of treatments and environmental stresses, including heat, UV and gamma irradiation, desiccation, mechanical disruption, and toxic chemicals, such as strong oxidizers or pH-changing agents (reviewed in Setlow, 2006; reviewed in Setlow, 2014). Bacillus subtilis is the best characterized gram-positive spore- forming organism in terms of biochemical characteristics and genetics studies with a fully sequenced genome (Kunst et al., 1997).

3.1 Regulation of Bacillus subtilis Endospore Formation and Dormancy Endospore formation is a process of B. subtilis cell differentiation initiated by conditions that limit cell growth with the main stimulus being nutrient depletion (Piggot and Hilbert

2004). Sporulation is characterized by asymmetric cell division through the construction of a polar septum that divides the cell into a small prespore (also known as forespore) compartment and a larger mother cell compartment (Fig. 4). Subsequently, the forespore is engulfed by the mother cell to form the fully mature spore (Oppenheimer-Shaanan et al., 2011; Piggot and Hilbert, 2004, Errington et al., 2003). The development of the forespore is a highly complex process and temporally controlled by distinct compartment-specific sigma factors (σ) and temporal gene expression (Piggot and Coote, 1976). In the first stage of endospore formation, sigma factor σH and the transcription factor Spo0A initiate the sporulation process and promote septum formation at the terminal pole. Spo0A, the master regulator for entry into sporulation, directly and indirectly controls

14 the expression of several hundred genes, often with regulatory functions, during early stages of spore development (Molle et al., 2003). The accurate transmission of genomic information is a crucial step in sporulation and monitored by several check points to monitor genomic integrity. The integrity scanning protein DisA was found to move dynamically along the bacterial chromosome scanning for DNA lesions with the ability to delay onset of sporulation by inhibiting the action of Spo0A when DNA damage is encountered (Bejerano-Sagie et al., 2006, Oppenheimer-Shaanan et al., 2011). After polar division of forespore and mother cell early compartmentalized gene expression is initiated by the forespore-specific sigma factor σF and σE in the mother cell. Under the regulation of σF the translocation of the chromosome into the forespore is completed and a series of proteins degrade the asymmetric septum and elicit membrane migration around the forespore leading to complete phagocytosis-like engulfment into the mother cell compartment. The forespore is released into the mother cell as a protoplast and cortex formation is initiated by the mother cell compartment via σE. σG becomes activated in the maturing spore and coordinates the expression of universal and spore specific genes essential for spore resistance during dormancy, including genes for DNA repair by the Non-homologous end-joining pathway (NHEJ) and spore photoproduct lyase (SP lyase), as well as the small acid-soluble DNA binding protein family (SASPs) (Wang et al., 2006; Weller et al., 2002). The forespore chromosome is saturated with intercalating α/-type SASPs and remodeled to a ring-like structure (Setlow and Setlow, 1995) facilitating protection of the spore genome from DNA damage by genotoxic events such as environmentally relevant UV radiation and desiccation (Moeller, 2009; reviewed in Setlow, 2014; see section A 3.4). DNA repair proteins required for the repair of DNA lesions accumulated during dormancy are packed in the spore core until spore germination and outgrow events trigger DNA repair (Vlasic et al, 2014; see section A 3.4.5). The expression by σK in the late mother cell initiates transcription of genes involved in building structural features of the spore, specifically the final steps in spore coat formation (see section A 3.2; Eichenberger et al., 2004, McKenney et al., 2013). As a last step σK regulates mother cell lysis and the release of a mature spore into the environment.

Figure 4. B. subtilis endospore formation (adapted from Errington, 2003).

3.1.1 Spore Coat Morphogenesis Spore coat proteins are produced by the mother cell during late sporulation events and localize to the spore surface during engulfment (Eichenberger et al., 2004). Assembly is regulated by the morphogenetic coat proteins CotXYZ, CotE, CotH, CotO, SafA, SpoIVA, SpoVM and SpoVID (McKenney et al., 2013), as these proteins are involved in recruiting different subsets of other proteins into the coat structure (Fig. 5; see also section A 3.2.2). The absence of any of these morphogenetic proteins causes severe defects in coat architecture. The morphogenetic protein SpoIVA is produced in the mother cell early in sporulation, under the control of σE, and is essential for cortex assembly and the attachment of the coat to the forespore outer membrane (Stevens et al., 1992; Henriques and Moran, 2007). Following the localization of SpoIVA, the morphogenetic protein CotE is recruited under the control of σE and assembles in a scaffold ~75 nm from the outer fore spore membrane forming a structure termed precoat (Henriques and Moran, 2007, Eichenberger et al., 2004). The metamorphosis

16 of the precoat into the characteristic layered coat structure is under the control of σK and comprises the assembly of the inner and outer coat layers upon engulfment completion (McKenney et al., 2013; Henriques and Moran, 2007). Assembly of inner and outer coat is regulated by SafA-and CotE-dependent regulatory subnetworks, respectively. Localization of CotE at the edge of the precoat suggests the definition of the nucleation site for assembly of the outer coat (Driks et al., 1994) where at least 24 proteins (40% of the total number of discovered coat constituents) are assembled in a CotE-dependent manner (Kim et al., 2006), including predominantly proteins of the outer coat and to some extent inner coat proteins (Henriques and Moran, 2007). SafA is initially targeted to the forespore surface anchoring in the cortex and binding other coat proteins on the C-terminal domain to form the inner coat (Ozin et al., 2000). The assembly of the outer layer in B. subtilis spores, the crust, is regulated by the

Figure 5. The assembly of the spore coat structures (basement membrane, inner coat, outer coat, crust) is directed by morphogenetic proteins (SpoIVA, SafA, CotE, and CotX CotYZ, respectively). The morphogenetic protein SpoVID is required for encasement of the spore. Spore pigmentation is facilitated by the protein CotA located in the outer coat layer. CotVW is a newly identified protein required for crust formation and dependent on CotX CotYZ (adapted from McKenney et al., 2013).

17 morphogenetic proteins CotX, CotY, and CotZ, which are in turn dependent on CotE (McKenney et al., 2010). Deletions in cotX, cotY, or cotZ lead to spores lacking the crust layer leaving the remaining coat layers intact, whereas mutations of cotE cause severly misassembled outer coat and crust layers, and deletion of safA results in mis-assembly of the inner coat with a loosely attached outer coat (Driks 1999; McKenney et al. 2013). SpoVID promotes a specific stage in coat assembly referred to as spore encasement by coordinating the deposition of subsets of coat fragments on the forespore surface and subsequent encircling of the forespore in successive waves, which appear to proceed in order from basement layer and inner coat to outer coat to crust (McKenney and Eichenberger, 2012). In the absence of SpoVID the cortex structure forms, however, self-assembled coat fragments fail to form a shell around the spore and form swirls dispersed throughout the mother cell compartment (Beall et al., 1993; Henriques and Moran, 2007).

3.2 Bacillus Spore Structure and Role in Spore Resistance The B. subtilis spore architecture and chemical composition differ considerably from those of a vegetative cell and play a major role in the unique spore resistance towards environmental stresses. From outwards to inwards, the spore layers include the exosporium (in some species), spore coat, outer membrane, cortex, germ cell wall, inner membrane, and the central core (Fig. 6, Driks, 1999; McKenney et al., 2013; Henriques and Moran, 2007).

Figure 6. B. subtilis spore structure. A schematic drawing illustrating the multiple layers (left) and the corresponding cross-section as visualized by TEM (modified from McKenney et al., 2010).

18 3.2.1 Exosporium The outermost layer that is present in some species, but not all, is the exosporium. This structure may be an extended version of the outermost coat layer (Redmond et al., 2004). It is principally composed of proteins, lipids, and proteins as well as calcium and magnesium (Matz et al, 1970) and may be involved in pathogenicity but not resistance of the spore (Koshikawa et al, 1989). The exosporium is found in bacterial spores of the B. cereus group and also Clostridia, including the pathogens B. anthracis and C. difficile (Redmond, 2014; Todd et al, 2003), but appears to be absent in B. subtilis (Driks, 1999).

3.2.2 Spore Coat Layers The outermost layer of the B. subtilis spore is a multilayered proteinaceous spore coat (for assembly see section A 3.1.1). The current model, as assessed by SEM and AFM, suggests a four-layer coat structure in B. subtilis. From outermost to innermost, the concentric layers consist of the crust followed by the outer coat, inner coat, and the basement layer (Wang et al., 2005; McKenney et al., 2013; Plomp et al. 2014). The crust layer has been recently identified as the outer structure of B. subtilis spore and, when stained with Ruthenium red and visualized by SEM, appears to follow the contours of the outer coat leaving a small gap between both layers (Wang et al., 2005).The underlying outer spore coat is about 70-200 nm wide and has a coarsely layered appearance. The following inner coat layer is described as having a lamellar-like appearance which can be attributed to a set of proteinaceous sublayers and is about 75 nm wide (Driks, 1999;Warth et al., 1963; Santo and Doi, 1974, Setlow, 2012). The basement layer is located close to the outer membrane and anchors the coat to the surface of the spore (McKenney et al., 2010). The spore coat structure has been studied most thoroughly and about 70 spore coat proteins have been identified, mainly composed of tyrosine- and cysteine-rich proteins (Warth et al., 1963; Kim et al., 2006; Henriques and Moran, 2007). The protein fraction of the coat represents 50 – 80 % of the total spore protein, and can be divided into two separate fractions, soluble and insoluble (Driks, 1999). The complex cross-linked protein meshwork limits the permeability of molecules > 5 kDa (Setlow, 2003; Henriques and Moran, 2007; Driks, 1999), preventing the access of damaging substances to inner spore layers and confers resistance to phagocytosis by predators and exogenous cortex-lytic enzymes, such as lysozyme, in intact dormant spores (Setlow, 2006). However, the coat does not limit the permeability of smaller

19 molecules allowing the permeation of nutrient germinant molecules to the inner spore layers, suggesting a role in spore germination (reviewed in Setlow, 2006; see section A 3.3.1).

3.2.3 Outer Membrane Beneath the spore coat layers the outer membrane (OM) is located. Although, no function as been ascribed to the outer membrane, it appears to be essential for spore morphogenesis (Piggot and Hilbert, 2004). The presence of an intact OM in mature spores is still debated as conclusive morphological evidence is lacking (Popham, 2002; Driks, 1999). However, biochemical analysis revealed membrane components such as cytochromes and enzymes of the electron transport chain in extracts of the outer spore constituents, suggesting the presence of a membranous element other than the inner membrane (Crafts-Lighty and Ellar, 1980). The role in spore resistance is not clear, but as the membrane may not be intact in dormant spores it is likely not a significant permeability barrier (Setlow, 2006).

3.2.4 Cortex Further inwards, the cortex is located. It is composed of a meshwork of peptidoglycan (PG) structure, which is similar to that of vegetative cells, yet, involves several spore-specific modifications (Atrih, 1996). The PG structure in vegetative B. subtilis cells is composed of alternating N-acetylglucosamine and N-acetlymuramic acid residues, that are cross-linked via peptide side chains (40%) and complexed with teichoic acids (2%; Popham and Setlow, 1993; Leggett et al., 2012). In spores, 50% of N-actelymuramic acid residues do not comprise peptide chains and are cyclized to form the spore-specific residue muramic-δ-lactam, which is recognized by cortex lytic enzymes to facilitate cortex degradation but not germ cell wall PG hydrolysis during spore germination and outgrowth (Atrih et al., 1998). Another 25% of residues only possess L-alanine side chains. Hence, both residue patterns prevent the formation of peptide cross links between glycan strands (Warth and Strominger, 1972). The cortex is required for formation of a dormant spore and reduction of the water content in the spore core, although the exact mechanism is not known, it does not appear to be essential for maintaining dormancy (Atrih, 1996; Popham, 2002; reviewed in Setlow, 200). It is proposed that it serves as a retaining structure to withstand turgor pressure as a result of the high concentration of solutes in the spore core (Popham, 2002). In the process of spore revival, degradation of the cortex by endogenous cortex-lytic enzymes is essential for core expansion and outgrowth (Setlow, 2003).

20 3.2.5 Germ Cell Wall The germ cell wall lies beneath the cortex and becomes the cell wall as the spore revives and grows into a vegetative cell. The PG structure differs from cortex PG in the absence of muramic-δ-lactam (Atrih et al., 1998). So far, no role in spore resistance has been determined (reviewed in Setlow, 2014b).

3.2.6 Spore Inner Membrane

The spore inner membrane (IM) is analogous to the cytoplasmic membrane in vegetative cells and will convert into the plasma membrane upon spore revival. Both membranes contain mostly phosphatidylglycerol, cardiolipin, and phosphatidylethanolamine (Griffith and Setlow, 2010). However, despite their composition, the spore IM differs considerably from the vegetative counterpart as it harbors most of the major proteins involved in spore germination and SpoVA proteins, which are absent in vegetative cells (Griffith et al., 2011). The IM constitutes a strong permeability barrier and is impermeable or exhibits low permeability to small molecules such as uncharged lipophilic molecules or even water (Sundae et al., 2009) and plays a major role in resistance to DNA-damaging chemicals by restricting the access of these chemicals to the spore core (reviewed in Setlow, 2014b). Indeed, some oxidizing chemicals, e.g. sodium hypochlorite, appear to inactivate spores by damaging the IM (Setlow, 2006). The low permeability of the IM is dependent on the state of the lipids rather than the lipid composition. It was found that the IM is highly compressed in dormant spores, exhibits an increased viscosity compared to germinated spore’s plasma membrane, and lipids located in the IM are largely immobile (Sundae et al., 2009; Loisan et al., 2013). Upon spore germination the membrane decompresses and increases approximately two-fold in the absence of ATP production, accompanied with a resumed mobility of IM-associated lipids (Cowan et al., 2004).

3.2.7 Spore Core The spore core is the center of the spore, where DNA, RNA, ribosomes and proteins are located (Setlow, 2006). Together with the IM and germ cell wall, the protoplast forms a vegetative cell upon spore revival. Achieved by an unknown mechanism during sporulation, the core exhibits a reduced water content of 25 – 50 % wet weight as opposed to ~75 % wet weight in vegetative cells (Beaman and Gerhardt, 1986), which is associated with enzymatic

21 dormancy as proteins appear to be immobile in the core (Sundae, 2009). Reduced mobility has been demonstrated for many components, including ions (Carstensen et al., 1979), proteins (Cowan et al., 2003), and calcium dipicolinic acid (Ca2+-DPA) (Leuschner and Lillford, 2000). The exact nature of the water in the spore core is still a subject of debate (Sundae et al., 2009; Friedline et al., 2015; Kaieda et al., 2013). Selectively monitoring of water mobility in the spore core corroborated the suggestion that the core is a structured macromolecular framework permeated by mobile water and exists in a gel-like state (Kaieda et al., 2013; Sundae et al., 2009). Friedline et al. (2015), in contrast, suggested the spore water is in a more immobilized state than expected for the gel-like core theory and the spore core exists in a more rigid and glassy state. Nevertheless, the highly dehydrated spore core and the resulting limited molecular motion leading to a decreased aggregation of heat-denatured proteins plays a major role in spore resistance against wet heat and possibly hydrogen peroxdide (Sundae, 2009; reviewed in Setlow, 2006) and is highly dependent on sporulation conditions, the spore core mineral content and accumulation of Ca2+-DPA (Melly et al. 2002b; Beaman and Gerhardt, 1986). DPA chelated 1:1 with divalent ions, predominantly Ca2+, is a highly abundant component of the spore core that constitutes 5-15% of core dry weight (Huang et al., 2007). Accumulation of Ca2+-DPA in the forespore during sporulation contributes to the reduction of core water content (Errington, 2003; Huang et al., 2007) and, besides its role in maintaining dormancy and wet heat resistance as mentioned earlier, is particularly important in protecting spore DNA from DNA-damaging agents and dry heat as well as in altering the DNA photochemistry affecting both the DNA photoreactivity and the nature of occurring photoproducts (see section 3.5.2) (Douki et al., 2005b; reviewed in Setlow, 2001). A unique characteristic of the spore core is the extreme abundance of small-acid soluble spore proteins (SASPs) of the α/-type, which are synthesized in the developing forespore and constitute 3 – 6 % of the total spore protein (Errington, 2003; Setlow, 2006). The 60 – 75-amino-acid proteins bind and saturate the spore chromosome thereby inducing drastic structural changes in the DNA structure from B- to A-conformation therby altering DNA photochemistry (Lee et al., 2008). Saturation with SASPs confers spore resistance to a wide variety of agents targeting the DNA, including genotoxic chemicals, desiccation, dry and wet heat, UV and -irradiation (Setlow and Setlow, 1995; Moeller et al., 2009; Cortezzo et al., 2005), as spores devoid of SASPs are significantly more sensitive to these treatments

22 (reviewed in Setlow, β006). Upon spore germination α/-type SASPs dissociate from spore DNA and are rapidly degraded by a SASP-specific endoprotease, possibly serving as building blocks for de novo protein synthesis (Sanchez-Salas et al., 1992).

3.3 Time Line of Spore Revival Spores of B. subtilis can remain in their dormant state for long periods of time, yet, provided with an appropriate stimulus, can return to life within minutes. Once nutrients become available, dormancy ceases, and the spore enters the revival process which is classically divided into distinct stages: a germination, ripening and outgrowth phase followed by the conversion into a vegetative cell (reviewed in Setlow 2003, Sinai et al, 2015).

3.3.1 Spore Germination Germination is an energy-independent process that takes place in the absence of any detectable metabolism (Paidhungat and Setlow, 2002) and comprises a series of degradative enzymatic steps that lead to the breakdown of spore specific structures accompanied with a rapid loss of resistance properties (Fig. 7; reviewed in Setlow, 2014a). The onset of Bacillus spore germination in a population can be synchronized by subjecting the dormant spores to a sub-lethal heat shock (Keynan and Evenchik et al., 1969). The exact mechanism remains unclear but is thought to be associated with structural modifications in spore germination receptors (GRs) and inner membrane changes (Zhang et al., 2009). A number of molecules (termed germinants) can trigger the process of germination in a spore. Physiological spore germinants include single amino acids (L-alanine, L-valine), sugars + (glucose, fructose) or a combination of L-asparagine, D-glucose, D-fructose and K (AGFK) (Paidhungat and Setlow, β000). Other ‘non-nutrient’ triggers for spore germination are cationic surfactants like dodecylamine, Ca2+-DPA, lysozyme and high pressure (Reineke et al., β01γ). By binding and interacting of germinants with spores’ nutrient GRs localized in clusters, termed germinosome, in the inner spore membrane (Paidhungat and Setlow, 2001) the spore is irreversibly committed to proceed into germination, even if the germinant is removed or displaced from its cognate GR (Yi and Setlow, 2010). After the addition of germinants, individual spores exhibit a lag period before proceeding into germination that varies tremendously in length throughout the spore population. This delay can last from

23 minutes to hours and is mainly ascribed to a varying abundance of GRs in the spore membrane (Kong et al., 2011; Yi and Setlow, 2010). The process of germination itself can proceed within few minutes (Setlow, 2013; Kong et al., 2011). First steps in germination include the release of monovalent cations, Zn2+ and H+ accompanied by a pH change in the spore core from ~6.5 to 7.7 and loss of heat resistance (Jedrzejas and Setlow, 2001; Luu and Setlow, 2014). The 2+ ensuing release of DPA and its associated divalent cations, primarily Ca , from the spore initiates the hydrolysis of the spores’ peptidoglycan cortex by one of the cortex lytic enzymes (CLEs), CwlJ and SleB. Full cortex hydrolysis allows expansion of the germ cell wall and core for water uptake leading to full core hydration (turning the spore phase dark in phase contrast microscopy) allowing protein mobility, and onset of metabolic activities followed by macromolecular synthesis.

3.3.2 Early and Late Outgrowth Phase The onset of growth is termed “ripening”, describing the transition phase of germinating to outgrowing spores (Sinai et al, 2015; Segev et al., 2013). During this period spores appear phase dark and no morphological change is evident as seen in phase contrast microscopy (Segev et al., 2013). This ripening period is characterized by the re-establishment of essential cellular functions and molecular reorganization towards cell elongation, disintegration of the protective spore coat, and subsequent cell division (Fig. 7; Segev et al., 2013; Keijser et al, 2007). Variations in duration were found to be associated with the quality of the spore’s initial rRNA content and ensuing kinetics of rRNA processing upon exiting dormancy (Segev et al., 2013). During early outgrowth ATP is generated by conversion of internal 3- phosphoglycerate accumulated in the spore core during sporulation (Singh et al., 1977). Metabolic analyses have shown that approximately at 15 minutes of spore revival extracellular glucose uptake is initiated, indicating depletion of internally stored energy sources and the subsequent switch to processing exogenous metabolites enabling macromolecular synthesis and initiation of DNA replication (Garrick-Silversmith and Torriani, 1973; Keijser et al, 2007). Protein synthesis in outgrowing Bacillus spores is dependent on de novo transcription (Setlow and Primus, 1975) and involves the temporal expression of at least 30% of the B. subtilis genome (Keijser et al, 2007). In dormant spores 23 spore-specific transcripts have been reported (Keijser et al, 2007). However, it was found that the abundance of these particular transcripts rapidly decreased during Bacillus spore germination and outgrowth,

24 suggesting that degradation of stored mRNA serves as an initial source for nucleotides for de novo RNA synthesis (Setlow and Kronberg, 1970, Keijser et al, 2007). During the first stages of outgrowth (5-30 min), genes involved in transcription, DNA replication, facilitating DNA repair (see section 3.5.5) and exhibiting transport function of various molecules (ions, amino acids, sugars, organic compounds) were found to be overexpressed (Keijser et al, 2007). The following 25 – 50 minutes are characterized by the onset of the first round of DNA replication and lateral cell membrane and wall expansion accompanied with an apparent swelling of the outgrowing spore (Keijser et al, 2007, Segev et al, 2013). Throughout the outgrowth stages the coat is continuously degraded and proteolytic actions gradually introduce nicks into the striated inner coat structure at discrete spaces accompanied with thinning of the outer spore coat (Santo and Doi, 1974). After approximately 70 minutes into revival the outgrowing spore bursts out of the remnants of the inner and outer coat layers and remaining cortex structures (Santo and Doi, 1974; Plomp et al, 2006). The burst coincides with initiation of chromosomal segregation, indicating advanced genome replication stages (Keijser et al, 2007) and at approximately 100 minutes the young vegetative cell has taken the characteristic rod shaped form and completed the second round of cell division.

Figure 7. Scheme of B. subtilis spore germination and outgrowth stages (adapted from Setlow, 2003).

25 3.4 Bacillus subtilis Spore Resistance Owing to their remarkable architecture and sophisticated DNA protection, B. subtilis spores are extremely resistant to physical and chemical stresses which are particularly hostile to other living organisms, including dessication, high temperatures, extreme pH, high salinity, oxidative stress, and radiation (reviewed in Setlow, 2014). In the following section, B. subtilis spore resistance to a variety of stress factors is described.

3.4.1 Ionizing Radiation Resistance Spores exhibit elevated resistance behavior to ionizing radiation (IR) (Moeller et al., 2008; Moeller et al., 2014; reviewed in Nicholson et al., 2000). Due to their extreme resistance, spores of B. subtilis have been used as suitable biological dosimeters for monitoring terrestrial and extraterrestrial ionizing radiation in numerous studies (Blatchley et al., 2005; Horneck, 1994). The damage inflicted by ionizing radiation is complex due to the diversity of targets in the spore. IR can impact the cellular components by depositing energy into biomolecules directly or indirectly by radiolysis of cellular water molecules leading to the formation of highly reactive hydroxyl ions, hydrogen peroxide, and superoxide ions in the presence of dissolved oxygen (Nicholson et al., 2000). The detrimental effects of IR-induced damage has been ascribed to the formation of various types of DNA lesions, including single-strand (SSB) and double-strand breaks (DSB), oxidative lesions, abasic sites, base modification and sugar modifications (Hutchinson, 1985; Goodhead, 1994). The biological effect of IR depends on the type, quality and dose of radiation. The linear energy transfer (LET) describes the amount of energy lost per unit distance as an ionizing particle travels through a material) and is used to quantify the biological consequence of IR (Horneck, 1994; Horneck et al., 2010). Sources of high-LET radiation, e.g. protons and high-energy-charged (HZE) particles, lose most of their energy along a short distance causing dense ionization along their track and cause enormous localized damage within a cell. In contrast, low-LET radiation, e.g. X-rays, gives off less energy along the track and induces ionizing radiation sparsely throughout the cell (Hutchinson, 1985; Sutherland et al., 2000). B. subtilis spores are well protected against IR-inflicted damage, which is partly attributed to the decreased level of core water content, which may reduce the amount of hydroxyl radicals formed by ionizing radiation (Popham et al., 1995; Moeller et al., 2008;

26 Cadet and Wagner, 2013), the abundance of Ca2+-DPA functioning as ROS scavenger (Hutchinson, 1985; Granger et al., 2011), and the presence of α/-type SASPs bound to spore chromosome with the function of stabilizing DNA integrity and possibly also serving as scavenger for IR-induced ROS (Lee et al., 2008; Moeller et al., 2008; Hutchinson, 1985). When spores are exposed to X-rays, IR-induced damage accumulates as it cannot be repaired due to lack of metabolic activity and enzymatic dormancy (Sundae et al., 2009). During spore revival multiple enzymes are involved in the repair of DNA lesions by spore- specific or general repair mechanisms and spores defective in particular DNA repair pathways, e.g. non-homologous end joining, base and nucleotide excision repair, mismatch repair, recombination-mediated repair (see section A 3.4.5), and translesion synthesis, exhibit decreased survival rates when exposed to IR (Moeller et al., 2008; Moeller et al., 2014). DSBs are thought to be the most critical form of damage inflicted in IR-exposed spores that require extensive repair upon revival (Weller et al., 2002; Vlasic et al., 2014). However, full understanding of the spore-specific mechanisms of DSB repair upon spore revival remains elusive (reviewed in Setlow, 2014b).

3.4.2 UV Resistance B. subtilis spores are 10 – 50-fold more resistant than vegetative cells to UV-C radiation at 254 nm (Nicholson et al., 2010; Setlow, 2006, Coohill and Sagripanti, 2009). At higher wavelengths reaching into the UV-B and UV-A spectrum, the increased resistance behavior is still observed but less pronounced (Nicholson et al., 2000). Elevated spore resistance is attributed to the production of a melanin-like carotenoid found in the outer spore coat of some Bacillus species that provides protection against incident to UV-A, UV-B radiation and simulated solar light in B. subtilis (Hullo et al., 2001). The major reason for increased UV resistance, however, is the altered UV photochemistry of DNA in dormant spores along with the efficient and relatively error-free repair of generated photoproducts (Nicholson et al., 2000; Setlow, 2001; Munakata and Rupert, 1972, 1974; Wang and Rupert, 1977). In growing B. subtilis cells the major photoproducts induced by UV-C radiation at 254 nm are cyclobutane pyrimidine dimers between (CPDs) and pyrimidine 6-4 primidone adducts (6-4 PPs) between adjacent pyrimidines (Fig. 8; Douki et al., 2005a; 2005b). Both photoproducts are potentially lethal but can be repaired by relatively error-prone repair mechanisms in growing cells. In spores, however, only very few CPDs and 6-4 PPs are

27 produced in spore DNA upon UV-C irradiation (Douki et al, 2005a; 2005b; Moeller et al., 2007). The major UV photoproduct formed in Bacillus spores is the unique thymine adduct 5- thyminyl-5,6-dihydrothymine (Fig. 8), termed the spore photoproduct (SP; Donnellan and Setlow, 1965). Upon UV-C irradiation at 254 nm the induction of SP formation is 103 more likely compared to UV-B radiation and 106 more likely compared to irradiation with UV-A (Tyrrell, 1978; Lindberg and Horneck, 1992). The major reason for SP formation in spores rather than CPDs or 6-4 PPs is the saturation of spore DNA with α/-type SASPs leading to a conformational change from B- to A-DNA (Donnellan and Stafford, 1968; reviewed in Setlow, 2001). The altered DNA photochemistry resulting from this structural change favors the production of SP (Fairhead and Setlow, 1992; Douki et al., 2005a). However, although α-- spores are significantly less resistant to UV irradiation, SP formation was still observed to some extent in spores deficient in SASPs, suggesting that there are additional factors involved (Setlow and Setlow, 1987; Douki et al., 2005b). Other influencing factors that favor SP-formation are Ca2+-DPA and the low hydration levels in the spore core. Ca2+-DPA, while contributing to the altered spore DNA photochemistry and photosensitizing spore DNA, is also suggested to be involved in a selective triplet-state energy transfer from UV-C-excited Ca2+-DPA to thymine bases, specifically (Douki et al., 2005b). Additionally, the low core water content maintains spore DNA in a more dehydrated state compared to vegetative cells and may contribute to altered DNA photochemistry and reduced induction and migration of ROS within the spore core (Moeller et al., 2009). Although also SP is a potentially lethal photoproduct, it is repaired more efficiently and less-error prone during spore revival compared to other photoproducts. The major DNA repair pathways involved are (i) the spore-specific repair enzyme SP-lyase that monomerizes SP back to two thymine residues (Munakata and Rupert, 1972; 1974) (ii), nucleotide excision repair (NER), which excises the damaged nucleotides and fills the single strand gap (Muankata and Rupert, 1972, 194) and (iii) a repair pathway involving the RecA protein although at a lesser extent (Munakata and Rupert, 1975) (see section A 3.4.5).

Figure 8. Structure of UV-induced thymine dimers. Cyclobutane pyrimidine dimers (CPDs) and pyrimidine 6-4 primidone adducts (6-4 PPs) are formed in DNA upon UV irradiation. The major UV photoproduct formed in Bacillus spores is the unique thymine adduct 5-thyminyl-5,6-dihydrothymine, the spore photoproduct (SP) (kindly provided by Thierry Douki).

3.4.3 Heat Resistance Spores are generally more resistant to wet and dry heat than growing cells, as they are able to endure ~30°C higher temperatures when exposed to dry heat and ~40°C higher temperatures when exposed to wet heat (Nicholson, 2000; Setlow, 2006). However, the heat- inflicted damage differs significantly. While dry heat damages the spore predominantly through DNA strand breaks and depurination (Setlow and Setlow, 1995), moist likely inactivates spores by introducing protein damage and rupture of the spore’s inner membrane (Fairhead et al., 1993; Setlow et al., 2002). The only factor that has been experimentally determined to contribute to protection against dry heat in the dormant state is genome saturation with α/-type SASPs as α-- spores are not only significantly more sensitive to dry heat treatment but also exhibit an increased mutation rate (Setlow and Setlow, 1995; Popham et al., 1995; Moeller et al., 2009). Although the precise nature of dry heat-induced DNA lesions is not well investigated, DNA repair during spore outgrowth, which was suggested to be at least RecA-dependent (Setlow and Setlow, 1996), is a major factor to ensure spore survival (reviewed in Setlow, 2006). In addition, the repair of apurinic/apyrimidinic (AP) sites by the endonucleases Nfo and ExoA have been identified in spore damage repair after dry heat treatment (Salas Pacheco et al., 2005). Also, it has been reported spores impaired in NHEJ- facilitated DSB repair are significantly more sensitive to dry heat (Wang et al., 2006).

29 3.4.4 Chemical Resistance Spores are much more resistant to a range of oxidizing agents than vegetative cells, including sodium hypochlorite, chlorine dioxide, ozone, and peroxynitrite and hydrogen peroxide (reviewed in Setlow, 2014b). The presence of an intact spore coat is a major factor for chemical resistance and spores with defects in coat structures haven been reported to be more susceptible to inactivation by treatment with the common oxidant H2O2 (Riesenmann and Nicholson, 2000). Reasons for the protective function of the coat may be on the one hand the decreased permeation of chemicals through the protein network of several coat layers or the vast amount of coat proteins that nonspecifically react with and detoxify chemicals before they can reach deeper layers and more delicate spore components (reviewed in Henriques and Moran, 2007). On the other hand several enzymes are associated with coat layers which are thought to potentially detoxify toxic chemicals in the dormant spores. The melanine-like pigment produced by CotA may aid in resistance to ROS as melanine is known to stabilize harmful unpaired electrons (Commoner et al., 1954). Moreover, a Mn2+-dependent superoxide dismutase (SodA) as well as two Mn2+ pseudocatalases (CotJC and YjqC) are associated with spore coat structures, however, their role in protection against ROS and other radical species remains unknown (Henriques and Moran, 2007). The major spore-specific catalase that is present in dormant spores of B. subtilis but absent in growing cells was identified as KatX (Casillas-Martinez and Setlow, 1997). Although KatX does not seem to play a role in the protection of the dormant spore, it is accumulated in the spore core during sporulation under the control of σF and has been shown to confer hydrogen peroxide resistance to germinating and outgrowing spores (Bagyan et al., 1998). The spore’s IM constitutes a strong permeability barrier and exhibits low permeability to small molecules (Sundae et al., 2009). It has been reported that changes in the IM structure arising from alterations of the sporulation temperature or mild oxidizing pre-treatment rendered the IM more permeable and sensitized spores to DNA-damaging agents (Cortezzo and Setlow, 2005; Setlow, 2006). Some oxidizing agents appear to inactivate spores by damaging the IM structure (Cortezzo and Setlow, 2005; Griffith and Setlow, 2010; Loshon et al., 1999) leading to rupture of the membrane during spore germination and outgrowth. Although the precise nature of the inflicted damage is not known (Setlow, 2006; reviewed in Setlow 2014b), it is not by oxidation of unsaturated fatty acids (Griffith and Setlow, 2010).

30 Spore resistance against hydrogen peroxide was also reported to be largely affected by the core water content as increased core water sensitized spores to this agent (Popham et al., 1995). Core water content analysis in B. pumilus spores with elevated resistance levels towards hydrogen peroxide indicated a glass-like and rigid state of the spore core possibly limiting diffusion of hydroxyl radicals and peroxide (Friedline et al., 2015). Protection by α/-type SASPs confers resistance to the spore against DNA damage by oxidizing agents, such a hydrogen peroxide, that passed the previous barrier and permeated into the spore core. As a consequence, most chemicals presumably kill spores by oxidizing essential spore components and not by DNA damage, however, it has been reported that α-- spores and spores with defects in base excision repair or RecA-mediated repair (see section A3.4.5) are more sensitive to genotoxic agents and accumulate DNA lesions (Campos et al., 2014; Loshon et al., 1999; Tennen et al., 2000).

3.4.5 DNA Repair in B. subtilis Spore Revival The dormant spore is very well protected against potential DNA damaging environmental influences (reviewed in Setlow 2014b). Passive protection mechanisms include saturation of the negatively supercoiled spore genome with α/-type SASPs, low core water content, accumulation with Ca2+-DPA in the spore core, minimizing genomic damage and altering the DNA photochemistry towards the production of spore-specific photoproducts. Due to their lack of enzymatic and metabolic activity, the dormant spore cannot repair damage to macromolecules such as DNA or protein inflicted by environmental influences (Setlow, 2006). The active repair of DNA lesions is taking place during spore revival when general and spore- specific DNA repair enzymes, which were expressed during sporulation and stored in the dormant spore (Kejiser et al., 2007), exert their function. However, depending on the extent and severity of damage, the stored DNA repair proteins might not be sufficient to repair the imposed damage and de novo expression of DNA repair genes is required during outgrowth ensuring spore survival (Keijser et al., 2007; Errington, 2003; Wang et al., 2006). Spores can repair DNA damage via different pathways; the ones most relevant for this work are discussed below.

31 3.4.5.1 Spore Photoproduct Lyase - a Spore Specific Repair Enzyme The SP is a potentially lethal photoproduct formed in spore DNA upon UV irradiation (Donnellan and Setlow, 1965). The repair of SP lesions is vital for B. subtilis spore survival and a major factor in spore resistance to UV irradiation. A repair pathway unique to outgrowing spores and specifically designed to repair SP lesions utilizes the enzyme termed spore photoproduct lyase, which is synthesized exclusively in the developing forespore by the

expression of splB under the control of σG and stored in the dormant spore until it becomes activated during early spore outgrowth (Nicholson, 2000; Pedraza-Reyes et al., 1994). In vegetative cells, the transcription of splB is not observed and not inducible by DNA damage (Pedraza-Reyes et al., 1994). In early spore outgrowth events spore photoproduct lyase is activated and monomerizes SP back to two thymine residues without backbone cleavage (Munakata and Rupert, 1974; 1972; reviewed in Setlow, 2001). In contrast to the DNA photolyase, which repairs CPDs and 6-4PPS under light (reviewed in Nicholson et al., 2000), the spore photoproduct lyase is light-independent (Donnellan and Stafford, 1968). The enzyme is a member of the S-adenosylmethionine superfamily, contains a Fe-S cluster and appears to operate by the radical S-adenosylmethionine (SAM) chemistry involving the formation of a 5’-adenosyl radical that abstracts a proton from SP. The generated SP radical leads to β-scission of the thyminyl-thymine bond and a final proton transfer from the 5’-adenosyl radical to the thymine, restoring the thymine structure (Reibel et al., 1998; Mehl and Begley, 1999; Yang et al., 2011; reviewed in Yang and Li, 2015).

3.4.5.2 Excision Repair Bulky adducts, cross links or photoproducts introduced into DNA by physical or chemical stress factors that are capable of blocking essential biochemical processes, such as DNA transcription or replication, are excised from the genome and replaced with a functional nucleotide by the action of the nucleotide excision repair (NER) system (Lenhart, 2012). Homologs of the genetic subunits of the excision endonucleases regulating the pathway in Escherichia coli have been identified in B. subtilis, termed UvrA, UvrB, and UvrC (Kunst et al., 1997). The removal of DNA lesions is carried out by endonucleolytic cleavage of ssDNA strands upstream and downstream of the recognized lesion, removal of the lesion-containing

32 ssDNA fragment of 10 – 15 nucleotides, followed by processing and ligation of the lesion through the action of DNA polymerase I and helicase (Friedberg et al., 2006). Base excision repair directs the repair of non-bulky lesions caused by chemical assaults including alkylation, oxidation, depurination/depyrimidation, and deamination that do not compromise the secondary structure of the DNA molecule directly but can ultimately lead to stalling of DNA replication and transcription machineries (Friedberg et al., 2006). Opposed to NER, the BER system only removes damaged bases rather than entire nucleotides or oligonucleotides and is considered the most frequently occurring DNA repair mechanism in vivo (Lenhart et al, 2012). The lesion is detected by a spore specific N-glycosylase that hydrolyzes the N-glycosidic bond and removes the damaged base. The resulting apurinic or apyrimidinic (AP) site in the DNA is specifically recognized by B. subtilis AP endonucleases ExoA and Nfo as well as the DNA polymerase/γ’-5’ exonuclease PolX and further processed in concert with an AP lyase that incise at the 5’- and γ’-end of the AP site, respectively. This excision process leaves ssDNA ends that require further processing by exonucleases at the γ’- end and by a dRPase at the 5’-2-deoxyribose-5-phosphate (5’-dRP) end giving rise to ligatable ends that can be closed by a DNA polymerase and sealed by a DNA ligase (Almeida and Sobol, 2007). Unrepaired AP sites are potentially mutagenic and previous studies have shown that the absence of Nfo, Exo and PolX increases the occurrence of mutations in B. subtilis vegetative cells (Barajas-Ornelas et al.; 2014), The absence of a functional NER system has been reported to significantly reduce spore survival to UV-C and UV-B radiation (Xue and Nicholson, 1996) and BER mediated by Nfo and ExoA AP-endonucleases has been shown to be relevant in spore resistance against UV-C and environmentally relevant UV radiation, oxidative stress, as well as densely and sparsely ionizing radiation (Campos et al., 2014; Moeller et al., 2011).

3.4.5.3 DNA double strand break repair Two major DNA repair pathways are involved in DNA DSB repair in B. subtilis vegetative cells. DSB repair via error-free homologous recombination (HR) occurs during vegetative growth when the replication machinery is active and a homologous chromosome copy is available (Fig. 9; Ayora et al., 2011; Cox, 2007). Alternatively, non-homologous end joining (NHEJ) functions as the alternative way of two-ended DSB repair in which two ends of a broken DNA strand are rejoined directly requiring only minimal end-processing and no

33 homologous template (Fig. 10; Ayora et al., 2011; Wilson et al., 2003). The process of HR is the predominant mechanism in bacteria for repairing single-strand (ss) DNA nicks that collapse the replication fork (one-ended DSB) during exponential growth and two-ended DSBs arising from fractures of the DNA duplex by exogenous agents. A series of complex reactions that require multiple enzymatic steps facilitating DSB recognition, long-range end- processing of a double-strand end, loading of the recombinase RecA on single ssDNA, paring of ssDNA in the presence of an intact homologous DNA segment, forming a crossover junction, and endonucleolytic resolution (Lenhart et al., 2012). First responder to DSB is the damage-inducible recognition protein RecN that recognizes and assembles at damage recognition site (Kidane et al., 2004) and coordinates the repair process by tethering broken ssDNA ends towards a single repair center. In concert with polynucleate phosphorylase (PNPase), RecN promotes basal end processing and removes dirty γ’ overhangs. Long-range resection of 5’-ends is facilitated by AddAB (on naked ssDNA) or RecJ in concert with RecQ, RecS or PcrA.

Figure 9. DNA double strand break repair by homologous recombination in B. subtilis cells (adapated from Ayora et al., 2011).

34 Single strand binding proteins (SsbA) accumulate on exposed single stranded DNA and facilitate loading of the recombinase RecA on SsbA-coated single stranded DNA strands is facilitated with help of its accessory factors RecO, RecR, and RecF. The resulting RecA*ssDNA nucleoprotein filament processes the search for a homologous template, strand invasion and exchange during recombinational repair (Ayora et al., 2011).

HR is the leading repair pathway of DSB in the presence of a homologous genome copy, however, if recombination function is impaired or a homologous DNA template is not available, two-ended DSB are rejoined by NHEJ (Rothkamm et al., 2003). The NHEJ pathway was initially thought to be unique for mammalian cells; however a related repair pathway was eventually Figure 10 DNA doublestrand break repair by discovered in bacteria (Weller et al., nonhomologous end-joining in B. subtilis cells (adapted from Ayora et al., 2011). 2002). The repair process in B. subtilis depends on binding of the single bacterial homodimer Ku (encoded by ykoV), a homolog of the mammalian heterodimer Ku70/Ku80, to double-ended DSB, threading the DNA end through the ring-like structure and thereby protecting the double-stranded ends from nucleases (Weller et al., 2002). An ATP- dependent ligase (LigD, encoded by ykoU) is recruited to the DSB facilitating end processing, polymerization and subsequent ligation of the broken segment (Della et al., 2004). LigD in B. subtilis possesses a polymerase domain (BsuLigD-POL) that fills the gaps between both strands, and an ATP-dependent ligase domain (BsuLigD-LIG) that seals the ends in a final step. In contrast to LigD in other bacterial species, BsuLigD does not exhibit nuclease activity as it lacks the phosphoesterase domain (LigD-PE) that resects γ’-ends in DSB repair, therefore, this function is carried out by other bacterial DNA end-cleaning proteins. NHEJ can either be faithful, if the DNA ends are ligated directly, or error-prone, if the ends are processed

35 by nucleases or polymerases before being sealed by a dedicated DNA ligase (Gong et al., 2005). It has been shown that spore survival considerably depends on NHEJ as a major pathway for the repair of DSB generated by ultrahigh vacuum, mono- and polychromatic UV, and X-rays, during spore revival when only one genome copy is present (Moeller et al., 2008; Moeller et al., 2007). Controversially, the dormant spores lacking RecA and its accessory factors RecO, RecR, and RecF, are significantly sensitized to DSB-inducing sparsely ionizing radiation, indicating a role of RecA-mediated DNA repair in spore resistance although no homologous template is available for DNA repair via strand exchange (Vlasic et al., 2014). However, recognition, processing and commitment to DNA double-strand break repair during the revival of B. subtilis haploid non-replicating spores is poorly understood.

36 4. Objective Numerous studies have been carried out proving that plasma sterilization is very effective in the inactivation of spores of Bacillus species in various plasma sources with different parameters. However, the underlying mechanisms involved in spore inactivation by plasma have been scarcely discussed (Roth et al., 2008; Halfmann et al., 2007b) and little is known about the interaction of plasma species with spore components, primary targets in the spore and which structural features and mechanisms are involved in spore resistance towards plasma-discharges. The aim of this work was to enhance the understanding of LPP sterilization processes and identification of key factors involved in spore resistance to different plasma discharges with defined particle flux densities ((V)UV photons, radicals, charged particles, electrons). The main objectives are the following:

1. Confirmation of the potential application of LPP sterilization as a fast and efficient method for enhanced spore inactivation that meets the imposed requirements for decontamination of spacecraft hardware in the area of space research.

2. Ensure the reliable assessment of the plasma-mediated inactivation efficiency by developing a uniform and reproducible preparation procedure of spore monolayers with respect to the future development of a biological indicator for the verification of plasma sterilization processes designed for industrial applications.

3. Identify morphological attributes that protect the spore from plasma-induced damage and structural components that serve as predominant targets for LPP- discharges. Specifically, the role of the first barrier to environmental influences, the spore coat, was analyzed regarding its significance in spore protection against the LPP sterilization using atomic force microscopy analysis of plasma-treated spores as well as a comparative analysis of the response of isogenic B. subtilis mutant strains with defects in coat layer structures to different plasma parameters.

37 4. The role of spore-specific and universal DNA repair pathways in spore survival and the identification of proteins that are involved in the repair process of plasma- induced lesions during B. subtilis spore germination and outgrowth. An array of isogenic B. subtilis mutant strains with deficiencies in a variety of DNA protection and repair mechanisms was analyzed for their susceptibility to plasma- discharges with different physical and chemical parameters. The relevance of DNA DSB repair after exposure to simulated plasma components was analyzed by tracking the activity of fluorescently-labelled key enzymes in reviving spores using time-course- microscopy. Further, types of plasma-induced DNA modifications in vitro were analyzed using HPLC-MS/MS.

38 Chapter B

Utilization of low-pressure plasma to inactivate bacterial spores on stainless steel screws.

Katharina Stapelmann, Marcel Fiebrandt, Marina Raguse, Peter Awakowicz, Günther Reitz, Ralf Moeller

39 ASTROBIOLOGY Research Articles Volume 13, Number 7, 2013 ª Mary Ann Liebert, Inc. DOI: 10.1089/ast.2012.0949

Utilization of Low-Pressure Plasma to Inactivate Bacterial Spores on Stainless Steel Screws

Katharina Stapelmann,1 Marcel Fiebrandt,1 Marina Raguse,2 Peter Awakowicz,1 Gu¨nther Reitz,2 and Ralf Moeller2

Abstract

A special focus area of planetary protection is the monitoring, control, and reduction of microbial contaminations that are detected on spacecraft components and hardware during and after assembly. In this study, wild- type spores of Bacillus pumilus SAFR-032 (a persistent spacecraft assembly facility isolate) and the laboratory model organism B. subtilis 168 were used to study the effects of low-pressure plasma, with hydrogen alone and in combination with oxygen and evaporated hydrogen peroxide as a process gas, on spore survival, which was determined by a colony formation assay. Spores of B. pumilus SAFR-032 and B. subtilis 168 were deposited with an aseptic technique onto the surface of stainless steel screws to simulate a spore-contaminated spacecraft hardware component, and were subsequently exposed to different plasmas and hydrogen peroxide conditions in a very high frequency capacitively coupled plasma reactor (VHF-CCP) to reduce the spore burden. Spores of the spacecraft isolate B. pumilus SAFR-032 were signiﬁcantly more resistant to plasma treatment than spores of B. subtilis 168. The use of low-pressure plasma with an additional treatment of evaporated hydrogen peroxide also led to an enhanced spore inactivation that surpassed either single treatment when applied alone, which indicates the potential application of this method as a fast and suitable way to reduce spore-contaminated spacecraft hardware components for planetary protection purposes. Key Words: Bacillus spores—Contamination— Spacecraft hardware—Plasma sterilization—Planetary protection. Astrobiology 13, 597–606.

1. Introduction et al., 2010), B. odysseyi (La Duc et al., 2004a), Paenibacillus purispatii (Behrendt et al., 2010), P. pasadenensis (Osman et al., 1.1. Contamination control of spacecraft 2006), P. phoenicis (Benardini et al., 2011), and P. barengoltzii major goal of space exploration is the detection of (Osman et al., 2006). Several of these spore-forming isolates, A biosignatures and traces of life, both past and present, in such as B. pumilus SAFR-032 (spacecraft assembly facility extraterrestrial environments, with the penultimate goal of isolate 032), have exhibited elevated resistance to several returning such samples back to Earth (NASA, 2005; Horneck stressors, for example, UV radiation and hydrogen peroxide et al., 2010). These missions are currently, and have always (Link et al., 2004; Venkateswaran et al., 2004; Kempf et al., 2005; been, subjected to the international standards of planetary Horneck et al., 2012; Vaishampayan et al., 2012). In addition to protection, which were established by the Committee of Space the persistent contamination of spacecraft assembly facilities Research (COSPAR) in 1967 (Rummel, 2001; Bruckner et al., and spacecrafts by spore-forming microorganisms, the highly 2009; COSPAR, 2011). Depending on the specific mission, resistant nature of spores could enable these organisms to planetary protection guidelines are required for the cleaning survive sterilization processes and interplanetary transit and sterilization of a spacecraft and its components to avoid aboard spacecrafts, and lead to deposition and subsequent contamination from terrestrial organisms (Bruckner et al., contamination of extraterrestrial environments, such as Mars 2009; Nicholson et al., 2009). Monitoring of microbial diversity (Wolfson and Craven, 1971; Schuerger et al., 2005; Committee of spacecraft-associated environments over the decades has on Preventing the Forward Contamination of Mars, 2006; identified a number of spore-forming species (La Duc et al., Nicholson et al., 2009; Kerney and Schuerger, 2011; Horneck 2004b) among cultivable microorganisms, which include, for et al., 2012; Vaishampayan et al., 2012). Ergo, the control and example, Bacillus safensis (Satomi et al., 2006), B. nealsonii reduction of bacterial spores is still one of the most difficult (Venkateswaran et al., 2003), B. horneckiae (Vaishampayan problems in sterilization efforts (Venkateswaran et al., 2004;

1Ruhr University Bochum (RUB), Institute for Electrical Engineering and Plasma Technology (AEPT), Bochum, Germany. 2German Aerospace Center (DLR), Institute of Aerospace Medicine, Radiation Biology Department, Cologne (Ko¨ln), Germany.

597 40 598 STAPELMANN ET AL.

Setlow, 2006, 2007). Complete reduction of bacterial spores is components, such as the membrane, proteins, RNA, and often impossible without altering or damaging the sensitive DNA; and (iii) lysis of the microbial cells as a result of the materials, which may contain contaminants such as spacecraft rupture of their membranes due to the electrostatic force electronics (Demidov et al., 1995). Elimination of problematic exerted on them by accumulation of charged particles microbes, such as bacterial spores, will require testing novel coming from the plasma (Yasuda et al., 2010; reviewed in cleaning and sterilization technologies (Demidov et al., 1995) Moisan et al., 2002; Moreau et al., 2008 and references that are not only compatible with modern spacecraft and therein). A considerable number of studies have been per- spacecraft hardware but will also successfully remove or in- formed, mainly with bacterial spores of the biological model activate the most problematic microbial species isolated in systems of B. subtilis, Escherichia coli, and Geobacillus stear- spacecraft assembly facilities. Common test organisms, such othermophilus, to investigate the effectiveness of different as B. subtilis spores, have been used to study the response of plasma sources (for examples see Hury et al., 1998; Benedikt bacterial spores to sporicidal treatments due to their high et al., 2008b; Schuerger et al., 2008; Hong et al., 2009; Morris degree of resistance to various physical and chemical treat- et al., 2009; Kla¨mpfl et al., 2012). ments, their reproducible inactivation response, and their Because spores are highly resistant to a variety of genetic tractability and lack of pathogenicity (Nicholson et al., physical, physicochemical, or thermal treatments (reviewed 2000; Nicholson and Galeano, 2003; Setlow, 2006; Hum- in Nicholson et al., 2000; Setlow, 2006) that may damage phreys, 2011). heat-sensitive devices due to extended treatment times to achieve spore reduction and result in an increase in costs, it is desirable to operate at the lowest possible temperature 1.2. Plasma sterilization: methods and mechanisms and pressure, and for the shortest period of time. Presented Methods for limiting the contamination of problematic here is a technical demonstration of low-pressure hydrogen microorganisms on surfaces are accomplished by chemical, plasma, with and without the utilization of hydrogen physical, mechanical, and thermal processes (e.g., high peroxide as a process gas for the spore inactivation of pressure, high temperature, UV, and gamma irradiation) B. pumilus SAFR-032 and B. subtilis 168 on stainless steel (Moisan et al., 2001; Benedikt et al., 2008a; Kong et al., 2009; screws. Heinlin et al., 2011). The majority of such sterilization methods may induce some level of damage to the material, 2. Material and Methods or they are limiting in their ability to completely sterilize (Benedikt et al., 2008b; Rauscher et al., 2009, 2010; Heinlin 2.1. Bacillus spp. spores, sporulation and purification et al., 2011; De Geyter and Morent, 2012). These processes Spores of wild-type B. pumilus strain SAFR-032 (Link et al., also have the disadvantages of high cost, difficulty of appli- 2004) and B. subtilis strain 168 (DSM 402) (Moeller et al., cation, deposition of residues on surfaces, changing proper- 2006) were obtained by cultivation under vigorous aeration ties of the materials, and increasing resistance of microbes to in 2 · liquid Schaeffer’s sporulation medium under optimal the process (Rutala and Weber, 2001). Plasma sterilization is conditions (Schaeffer et al., 1965). Spores were purified and emerging as an alternative to commonly used sterilization stored as previously described (Nicholson and Setlow, 1990; techniques due to many advantages: cost-effective, fast, effi- Link et al., 2004; Moeller et al., 2010, 2012a, 2012b). Spore cient, safe in terms of thermal, chemical, or irradiation dam- preparations were free ( > 99%) of growing cells, germinated age to spacecraft materials (Ho¨ller et al., 1993; Moisan et al., spores, and cell debris as determined by phase-contrast 2002; Benedikt et al., 2008b; Kong et al., 2009; Ehlbeck et al., microscopy. 2011). Plasma sterilization methods are distinguished by the use of gas or a gas mixture that is partially excited by passing 2.2. Sample preparation through an electromagnetic field. Generally, a plasma consists of different biocidal agents: chemically reactive species, In our study, stainless steel screws were chosen to simu- ions, and (V)UV photons. Depending on the gas or gas late spore-contaminated spacecraft hardware. Spore sus- mixture used, the plasma is capable of being tuned to pro- pensions of the two Bacillus spp. strains were prepared in vide more chemically active species or more (V)UV radiation sterile distilled water to a set final concentration, such that a (Moisan et al., 2001, 2002; Benedikt et al., 2008b; Stapelmann 20 lL aliquot contained 5 · 108 spores. Stainless steel screws et al., 2008; Ehlbeck et al., 2011; Heinlin et al., 2011). Sy- [cross recessed flat head machine screws, steel type H; nergistic effects, such as chemical sputtering, take place at DIN965-M6x30-A2; 30 mm in length, 3 mm in diameter, low ion energies and in the presence of radical flux densities screw head with 11 mm in diameter and a thickness of 5 mm; (Benedikt et al., 2008a; Raballand et al., 2008), or the combi- Aug. Hu¨ lden GmbH & Co. KG, Cologne (Ko¨ln), Germany] nation of UV radiation and heat, among others, plays a were autoclaved (121°C, 30 min) prior to use. Spore- major role in plasma sterilization efficacy (Moisan et al., contaminated screw samples, for plasma sterilization, were 2002; Rauscher et al., 2010; Heinlin et al., 2011). Although the prepared by applying 20 lL aliquots of spores, dropwise, biocidal mechanisms are not yet fully understood, the fol- onto a marked position of the screw (Fig. 1) so that they lowing cellular inactivation mechanisms may be listed: (i) spread out to a defined area of approximately 5 · 5 mm, re- UV radiation [including radiation from the vacuum UV sulting in arrangements of multiple-layer samples each with (VUV) range, below 200 nm] that is capable of damaging a thickness of *25 spore layers. A single set of spore samples nucleic acids (DNA, RNA) and proteins; (ii) the diffusion of was comprised of three identical repetitions with the same highly reactive nitrogen and oxygen species, such as OH spore concentration. Spore samples were air-dried under radicals, within the microorganisms, which leads to local ambient laboratory conditions (20 – 2°C, 40 – 5% relative damage that is most likely an effect of oxidation to cellular humidity).

41 SPORICIDAL EFFECTS OF LOW-PRESSURE PLASMA STERILIZATION 599

FIG. 1. Photograph (A) and scanning electron micrograph images (B–G) of a stainless steel screw contaminated with spores of B. pumilus strain SAFR-032 (B–F) and B. subtilis strain 168 (G). Scale bar: 2 mm (B), 1 mm (C), 100 lm (D), 25 lm (E), and 5 lm (F and G). Color images available online at www.liebertonline.com/ast

2.3. Scanning electron microscopy of 20 sccm), a pressure range of 5–25 Pa, 100–400 W of of spore-contaminated stainless steel screws power, and a hydrogen peroxide concentration of either 30% or 60%, which acted as a process gas. The spore-contaminated For scanning electron microscopy, spore-contaminated screws were treated in a capacitively coupled plasma reactor stainless steel screws were coated with a thin gold layer (of operated at very high frequency (VHF-CCP). The discharge approximately 10 nm), placed in a scanning electron micro- chamber is composed of the high-performance polymer scope [Jeol JSM-6510, Eching/Munich (Mu¨ nchen), Ger- PEEK (polyether ether ketone) and shaped like a drawer many], and investigated with an accelerating voltage of (Fig. 2). The drawer has an inner size of 32 · 22 · 10 kV in high vacuum mode. 6.5 cm, leading to a volume of 4.5 cubic liters. Six ﬂanges with Suprasil2 quartz glass, one at the front, one at the back, and 2.4. Spore exposure to different plasmas two at each side, allow optical emission spectroscopy of the Spore inactivation via plasma treatments was performed plasma process for determining the UV dose (data shown in at the Institute for Electrical Engineering and Plasma Tech- Table 1). A grounded electrode was placed on top of the nology (AEPT), Ruhr University Bochum, Bochum, Germany drawer. A rotary vane pumping system (Trivac D65B with a (www.aept.ruhr-uni-bochum.de). Triplicate samples of air- capacity of 65 m3/h [Oerlikon Leybold Vacuum, Cologne dried spore layers (each sample also in triplicate replications (Ko¨ln), Germany]) was used to evacuate the chamber. To with *5 · 108 spores) were exposed simultaneously to dif- control and monitor the pressure, two heated absolute ca- ferent gas mixtures (hydrogen, oxygen; with a total gas ﬂow pacitance manometers [(1) Baratron 627B, pressure range of

FIG. 2. Sketch of the VHF-CCP used for sterilization experiments to measure inactivation kinetics of spores of B. pumilus strain SAFR-032 and B. subtilis strain 168 on stainless steel screws. On the left, a sketch of the grounded and the driven electrode is given, showing the electrical ﬁeld. Color images available online at www.liebertonline.com/ ast

42 600 STAPELMANN ET AL.

Table 1. Temperature and UV Dose Rates of the Respective Plasma Treatment

UV dose rates [in J/(m2 · s)] Hydrogen peroxide Temperature Plasma Power Pressure concentration increase (in °C)b UVC UVB UVA Total UV (ﬂux in sccm) (in W) (in Pa) (in %)a after 60/300 s (200–280 nm) (280–320 nm) (320–400 nm) (200–400 nm) – – H2 (20 sccm) 100 5 n.a. 40 3/49 5 4.1 0.7 0.7 5.4 – – H2 (20 sccm) 400 5 n.a. 66 5/104 5 6.8 1.3 1.7 9.7 – – H2 (20 sccm) 400 25 n.a. 77 5/88 5 2.7 0.4 0.5 3.6 – – H2/O2 (10:10 400 10 n.a. 77 5/110 5 4.2 2.0 1.8 8.0 sccm) – – H2 (20 sccm) 400 5 30 40 3/49 5 6.8 1.3 1.7 9.8

aFour milliliters of 90°C heated and evaporated hydrogen peroxide in two concentrations (30% and 60%) were used for the spore inactivation. n.a. = not applied. bStarting temperature at time (0 s) was 20 – 2°C.

0.05–100 Pa, (2) 627D, pressure range of 100–1000 Pa, MKS 2001; Moeller et al., 2007, 2009) and resuspended in 1 mL of Instruments, Munich (Mu¨ nchen), Germany] and a butterfly sterile distilled water, resulting in > 95% recovery of the valve [VAT butterfly valve control system Series 612, VAT spores. This procedure does not affect spore viability (Hor- Germany, Grasbrunn/Munich (Mu¨ nchen), Germany] were neck et al., 2001). Spore reduction rates were determined by a attached to the VHF-CCP. Four mass flow controllers [MKS standard colony-formation assay; spore sample dilutions in MFC Type 1179, MKS Instruments, Munich (Mu¨ nchen), distilled water were used to determine colony-forming abil- Germany] were used to deliver constant gas flow of hydro- ity, in terms of colony-forming units (CFU), after incubation gen or oxygen (20 sccm maximum). A fiber optic temperature overnight at 37°C on nutrient broth agar plates (Difco, De- monitoring system (LUXTRON I652 with a Fluoroptic STF troit, USA) as described previously (Horneck et al., 2001; probe, LumaSense Technologies, Frankfurt, Germany) was Moeller et al., 2007, 2009, 2010, 2012a). used to determine gas temperature for different discharge conditions (Table 1). 2.7. Numerical and statistical analysis The spore-surviving fraction was determined from the 2.5. Optical emission spectroscopy quotient N/N , with N = the number of CFU of the plasma/ for determining UV dose 0 hydrogen peroxide–treated sample and N0 that of the non- For determining the UV dose of the applied plasma con- exposed controls. Spore inactivation was plotted as a func- ditions, an absolutely and relatively calibrated grating tion of time with respect to the plasma and/or hydrogen spectrometer QE65000 (Ocean Optics, Ostfildern, Germany), peroxide treatment. To determine the curve parameters, the =- · + attached to the Suprasil2 window at the front of the dis- following relationship was used: ln N/N0 SIC T n, charge chamber, was used. The spectrometer measures in the where SIC is the inactivation constant, T the treatment time, spectral range of k = 200–975 nm, with a spectral resolution of and n the extrapolation number. The SIC was determined 1.3 nm. The measured intensity is obtained in photons/ from the slope of the dose-effect curves as described by (cm3 · nm · s). To achieve the UV dose, the energy of the Moeller et al. (2007, 2009, 2010). All data is expressed as photons is calculated by using the following equation: E = averages – standard deviations of at least triplicate experi- h · f, with energy (E), Planck’s constant (h), and the frequency ments. The results were compared statistically by using the of the photons (f), given by f = c/k, with the speed of light (c), Student t test, values were analyzed in multigroup pairwise and wavelength (k). To obtain the surface UV dose in J/ combinations, and differences with P values of £ 0.05 were (m2 · s), the volume of the chamber needs to be subtracted by considered statistically significant (Moeller et al., 2007, 2009, the surface of the chamber. The results of the calculated UV 2010, 2012b). dose for the applied plasma conditions are given in Table 1. 3. Results 2.6. Survival assay To determine the kinetics of spore reduction, after single With the ignition of plasma, hydrogen peroxide is de- - and combined exposure to low-pressure plasma and hy- composed into hydrogen, oxygen, OH, and other reactive drogen peroxide, stainless steel screws, with air-dried spores oxygen species, so that there is no hydrogen peroxide left on of two Bacillus species, were used (B. pumilus SAFR-032 and the surface. To avoid hydrogen peroxide residue on the B. subtilis 168). surfaces of samples treated solely with hydrogen peroxide, the chamber was pumped down to at least 5 Pa (or lower if 3.1. Effects of low-pressure plasma required). To recover the spores from the stainless steel screws after respective plasma/hydrogen peroxide exposure, The plasma exposure parameters were as follows: power as well as from the control samples, air-dried spore layers of 100 and 400 W; pressure of 5, 10, and 25 Pa; gas mixture of were covered with a 10% aqueous polyvinyl alcohol solution hydrogen and/or oxygen (20 sccm in total); exposure times (PVA); and after subsequent air-drying, the spore-PVA layer of 15, 30, 45, 60, and 300 s. To determine the effects of the was stripped off as previously described (Horneck et al., different plasma parameters on spore reduction, spore

43 SPORICIDAL EFFECTS OF LOW-PRESSURE PLASMA STERILIZATION 601 survivability curves were determined at different time treated in a two-step decontamination process of direct points, inactivation kinetics were plotted, LD90 values and plasma exposure (20 sccm of hydrogen plasma, 400 W, 5 Pa) spore inactivation constants (SICs) were calculated and and vaporized 30% hydrogen peroxide, there was a rapid compared by using the Student t test (Table 2). In a direct spore reduction obtained with the only differences due to comparison, spores of spacecraft assembly facility (SAF) genotype (Fig. 3C). isolate B. pumilus strain SAFR-032 were significantly more resistant to all tested plasma treatments than those of the 4. Discussion laboratory model system B. subtilis strain 168 (Table 2). In- Since the beginning of the development and utilization of dependent of the genotype, plasma treatment, or experi- plasma application for sterilization purposes, a number of mental conditions, no viable (colony-forming) spores were microbiological tests with selected indicator microorganisms detected after a 5 min plasma treatment, indicating a suffi- have been carried out (Moisan et al., 2001, 2002; Rossi et al., cient treatment time for a complete multilayer spore reduc- 2006; Benedikt et al., 2008b; Kong et al., 2009; von Keudell tion on a complex surface (Fig. 1). To study the influence of et al., 2010; Ehlbeck et al., 2011). Low-pressure plasma ster- different parameters, various ranges of power, plasma, and ilization processes have been under intensive study for a pressure compositions have been tested. In Fig. 3A, a rep- number of chemical and biological applications for many resentative graph of the spore survival is shown as a function years due to the effective and efficient generation of cellular- of time of the respective plasma (low-pressure hydrogen damaging radicals and reactive species (Moisan et al., 2001; plasma, 20 sccm, 400 W, 5 Pa). These survival values were Rossi et al., 2006, 2009; Ehlbeck et al., 2011). Although a great used as the basis for data comparison with data from other deal of effort has been taken to investigate plasma steriliza- plasma exposures; spore reduction was affected by a differ- tion, there is only one low-pressure plasma sterilization ent experimental parameter, with power (400 W instead of system commercially available. It is integrated in a phar- 100 W) as the major contributor, whereas pressure (5 Pa in- maceutical filling line as described by Denis et al. (2012) and stead of 25 Pa) and plasma composition (H /O plasma 2 2 recently achieved approval by the European Medicines compared to H plasma) had only minor effects on the spore 2 Agency. Other so-called plasma sterilization systems, that is, reduction (Table 2). Sterrad, Johnson & Johnson, use vaporized hydrogen peroxide as the sterilizing agent (Jacobs and Kowatsch, 1993; 3.2. Effects of hydrogen peroxide as a process gas Rutala et al., 1999; Okpara-Hofmann et al., 2005). The plasma as single or combined low-pressure treatment is ignited between a perforated, powered electrode and the To determine the influence of hydrogen peroxide as an grounded chamber wall; active plasma species can diffuse additional effecter for spore inactivation, two different con- through the perforated electrode (Jacobs and Kowatsch, centrations (30%, 300 g/L and 60%, 600 g/L) of hydrogen 1993), but the mean free path of all radicals at the pressure peroxide were tested in a single treatment, and 30% H2O2 applied is much too short to reach the samples. According to was used as a process gas in a combined low-pressure hy- Lerouge et al. (2000), Sterrad and comparable systems are not drogen plasma treatment. Again, as seen before in the plas- plasma sterilizers but instead involve purely chemical cycles ma treatment without H2O2, B. pumilus strain SAFR-032 that sterilize. However, in the case of this study, we used spores were up to 2.5-fold more resistant to hydrogen per- hydrogen peroxide as a process gas, delivering hydrogen oxide treatments than spores of B. subtilis strain 168 (Fig. 3B, and oxygen species as useful sterilizing agents (e.g., OH Table 2), whereas a 60% H2O2 exposure yielded a more rapid and O radicals). Moreover, the plasma described within spore reduction. When spore-contaminated screws were this contribution is in direct contact with the surface.

Table 2. Inactivation Characteristics of B. pumilus SAFR-032 and B. subtilis 168 Spores after Plasma Treatment with and without Hydrogen Peroxide as Process Gas

b c LD90 value (in s) Spore inactivation constant (SIC) Bacillus Bacillus Bacillus Bacillus Power Pressure Hydrogen peroxide pumilus subtilis pumilus subtilis Plasma (ﬂux in sccm) (in W) (in Pa) concentration (in %)a SAFR-032 168 SAFR-032 168

- - H (20 sccm) 100 5 n.a. 184.1 – 12.3* 73.6 – 8.5 (1.2 – 0.1) · 10 2* (3.1 – 0.3) · 10 2 2 - - H (20 sccm) 400 5 n.a. 40.3 – 3.0* 19.7 – 2.3 (5.5 – 0.4) · 10 2* (9.8 – 1.0) · 10 2 2 - - H (20 sccm) 400 25 n.a. 44.5 – 4.7* 29.4 – 3.6 (5.0 – 0.4) · 10 2* (7.3 – 0.6) · 10 2 2 - - H /O (10:10 sccm) 400 10 n.a. 38.7 – 3.8* 23.6 – 2.9 (6.9 – 0.8) · 10 2* (1.1 – 0.2) · 10 1 2 2 - - H (20 sccm) 400 5 30 13.6 – 1.5* 9.2 – 0.8 (1.6 – 0.2) · 10 1* (2.5 – 0.3) · 10 1 2 - - n.a. n.a. n.a. 30 55.1 – 6.7* 19.5 – 2.1 (4.2 – 0.5) · 10 2* (1.1 – 0.2) · 10 1 - - n.a. n.a. n.a. 60 16.7 – 1.8* 11.3 – 1.2 (1.2 – 0.2) · 10 1* (1.7 – 0.2) · 10 1

aFour milliliters of 90°C heated and evaporated hydrogen peroxide in two concentrations (30% and 60%) were used for the spore inactivation. n.a. = not applied. = Data are expressed as averages and standard deviations (n 3). Asterisks indicate LD90 and SIC values that were signiﬁcantly different (P values of £ 0.05) than the respective values obtained from spores of B. subtilis 168. b LD90 value, i.e., time (in seconds) needed to reduce one order of magnitude of the initial spore population. cSpore inactivation constant (SIC) was determined from the slope of the dose-effect curves as described by Moeller et al. (2007, 2009, 2010).

44 602 STAPELMANN ET AL.

and delivered to the treated sample, that is, charged particles (electrons and ions), reactive species (e.g., hydroxyl radicals), photons (UV and visible), and heat. A pure hydrogen discharge offers a high amount of UV radiation, whereas the combination of hydrogen and oxygen leads to more chemically active species. In our investigations, an exclusive effect of UV radiation on the spore inactivation can be ruled out, as the UV dose rates were on average approximately 6 J/ (m2 · s), reaching maximal values of 2000 J/m2 (total UV dose for 200–400 nm) after 5 min exposure time (Table 1). Thermal effects on the spore inactivation should be considered as a potential synergistic effect, as a temperature increase of 20–60°C, depending on the plasma treatment, was determined after 60 s, and high temperatures above 100°C were obtained after 5 min exposure (Table 1). It should be kept in mind that spores have increased heat resistance, compared to their vegetative counterparts; though the deci- mal reduction values may vary due to spore treatment with wet or dry heat, they have approximately a 1000-fold higher dry heat resistance (reviewed in Nicholson et al., 2000; Setlow, 2006). In our studies, we cannot exclude the potential damaging effects of the increased temperature alone or in combination with UV radiation, especially if the generated plasma components induce synergistic effects when reducing the spore bioburden. Due to the high resistance of bacterial spores to sterilization processes and concerns in the biomedical and food- processing industries over their persistent contamination, there is an ongoing interest in studying methods of bacterial spore inactivation and the mechanisms by which spores re- sist the lethal effects of various disinfection treatments. Spores are generally significantly more resistant than growing cells to a wide variety of toxic chemicals, such as hydrogen peroxide (Bagyan et al., 1998; Setlow, 2006, 2007). In growing cells, specific enzymes (e.g., catalases, superoxide dismutase, or hydroperoxides) are sometimes capable of detoxifying chemical agents (Farr and Kogoma, 1991; Reder et al., 2012); however, this appears not to be a factor in dormant spore resistance, presumably because of the inactivity of enzymes in the spore core (Casillas-Martinez and Setlow, 1997; Bagyan et al., 1998; Setlow, 2006). Bioinformatic comparative analysis of the B. pumilus strain SAFR-032 genome (Gioia et al., 2007) with that of B. subtilis strain 168 shows both high similarities [e.g., genes involved in sporulation, especially in spore coat assembly and formation of small, acid-soluble spore proteins (SASP)] as well as significant FIG. 3. Inactivation kinetics of spores of B. subtilis strain 168 differences, for example, in catalase formation. Bacillus sub- (circles) and B. pumilus strain SAFR-032 (squares) on stainless tilis produces two vegetative catalases, KatA and KatE, and steel screws obtained by direct plasma exposure [20 sccm one germination catalase, KatX, which is present in spores A hydrogen plasma, 400 W, 5 Pa ( )], vaporized 30% hydrogen and protects germinating cells from H O (Bagyan et al., peroxide treatment (B), and a two-step decontamination 2 2 1998). Gioia et al. (2007) showed that B. pumilus has no ho- process of direct plasma exposure [20 sccm hydrogen plasma, 400 W, 5 Pa, and vaporized 30% hydrogen peroxide treatment mologue to either vegetative catalase of B. subtilis; however, (C)]. Data are expressed as averages and standard deviations it has two KatX homologues (each with a manganese catalase (n = 3). The open symbols indicate survival below the domain). Checinska et al. (2012) identified two manganese threshold of detection (i.e., complete spore reduction). catalases of B. pumilus strain SAFR-032, both of which are localized in the spore coat layer along with a laccase (a copper-containing oxidase enzyme) and a superoxide dis- Additionally, evaporated hydrogen peroxide was combined mutase. They proposed that the increased resistance of with hydrogen or oxygen as a process gas, to enhance either B. pumilus spores to hydrogen peroxide is due to the syner- UV radiation or oxidation. In our study, hydrogen and ox- gistic activity of both manganese catalases with other coat ygen gases were used for plasma production. Several dif- oxidoreductases; however, further work to prove this syn- ferent components were produced by the plasma discharge ergism is needed. Other (morphological) factors important in

45 SPORICIDAL EFFECTS OF LOW-PRESSURE PLASMA STERILIZATION 603 spore resistance to hydrogen peroxide have been identified, diagnostik, Programm RF-FuW, Teilprogramm 475 (to R.M. while others have been proposed, including the presence of and G.R.). spore coats, the impermeability of the spore core to hydro- philic chemicals, low spore core water content, and protec- Author Disclosure Statement tion of spore DNA by a/b-type SASP (Setlow and Setlow, No competing financial interests exist. 1993; Popham et al., 1995; Paidhungat et al., 2000; Granger et al., 2011). The various layers of proteinaceous spore coats Abbreviations (and possibly the outer spore membrane), which surround the spore cortex, certainly protect the spore from attack by CFU, colony-forming units; PVA, polyvinyl alcohol solu- very large molecules, such as lytic enzymes that can hydro- tion; SAF, spacecraft assembly facility; SASP, small, acid- lyze the spore cortex (Riesenman and Nicholson, 2000; Driks, soluble spore proteins; SIC, spore inactivation constant; 2002). Both the spore coats and the membrane act as per- VHF-CCP, very high frequency capacitively coupled plasma meability barriers to chemicals by direct interaction and thus reactor; VUV, vacuum UV. reduce the amount of toxic agents that are able to attack more-central spore molecules, such as enzymes or DNA, in References the spore core (Nicholson et al., 2000; Setlow, 2006, 2007; Bagyan, I., Casillas-Martinez, L., and Setlow, P. (1998) The katX Griffiths and Setlow, 2009). Popham et al. (1995) found a gene, which codes for the catalase in spores of Bacillus subtilis, decrease in spore resistance to H2O2 with increasing core is a forespore-specific gene controlled by sigmaF, and KatX is water content, whereas the details of the interaction of the essential for hydrogen peroxide resistance of the germinating core water content with hydrogen peroxide are still un- spore. J Bacteriol 180:2057–2062. known. For several types of toxic chemicals, such as H2O2, Behrendt, U., Schumann, P., Stieglmeier, M., Pukall, R., Au- there is strong evidence that one factor in spore resistance is gustin, J., Sproër, C., Schwendner, P., Moissl-Eichinger, C., the protection of spore DNA from attack by the binding of and Ulrich, A. (2010) Characterization of heterotrophic nitri- the major SASP (reviewed in Setlow, 2006, 2007). However, fying bacteria with respiratory ammonification and denitrifi- several of these features are poorly characterized, in partic- cation activity—description of Paenibacillus uliginis sp. nov., an ular their involvement in spore resistance to single and inhabitant of fen peat soil and Paenibacillus purispatii sp. nov., combined parameters of plasma treatments. isolated from a spacecraft assembly clean room. Syst Appl Relatively little work has been done on the role of specific Microbiol 33:328–336. Benardini, J.N., Vaishampayan, P.A., Schwendner, P., Swanner, repair systems or on the nature of the damage caused by an E., Fukui, Y., Osman, S., Satomi, M., and Venkateswaran, K. exposure to different sporicidal plasma treatments. In 2009, (2011) Paenibacillus phoenicis sp. nov., isolated from the Phoe- Roth et al. (2010) showed in their experiments with microwave- nix lander assembly facility and a subsurface molybdenum induced low-pressure, low-temperature nitrogen-oxygen mine. Int J Syst Evol Microbiol 61:1338–1343. plasma that B. subtilis spore reduction is mainly due to DNA Benedikt, J., Flo¨tgen, C., Kussel, G., Raball, V., and von Keudell, and protein damage, as well as deficiencies in the major A. (2008a) Etching of Bacillus atrophaeus by oxygen atoms, SASP formation and spore coat assembly that lead to high molecules and argon ion. J Phys Conf Ser 133, doi:10.1088/ sensitivity. To systematically analyze the roles of all known 1742-6596/133/1/012012. features of the spore morphology, protective mechanisms, Benedikt, J., Raballand, V., Halfmann, H., Awakowicz, P., von and DNA repair pathways and gain a better understanding Keudell, A., Kylian, O., Hasiwa, M., Rossi, F., Muranyi, P., of the processes that lead to spore inactivation or destruction Wunderlich, J., Comoy, E., Schell, J., and Deslys, J.P. (2008b) by low pressure with regard to atmospheric plasma treat- BIODECON—European project on plasma inactivation of ments, there is a need to conduct further experiments with bacteria and biomolecules. GMS Krankenhhyg Interdiszip the astrobiological model system B. subtilis strain 168, due to 3:doc04. Available online at www.egms.de/en/journals/ the availability of different mutant strains (Moeller et al., dgkh/2008-3/dgkh000102.shtml. 2012b, 2012c). Also, further efforts need to be taken to in- Bruckner, J.C., Osman, S., Conley, C., and Venkateswaran, K. vestigate plasma sterilization on thermolabile materials (e.g., (2009) Space microbiology: planetary protection, burden, di- sensitive spacecraft hardware such as electronic component) versity and significance of spacecraft associated microbes. In with a more complex surface geometry (e.g., control circuit Encyclopedia of Microbiology, edited by M. Schaechter, Elsevier, boards) in order to improve the utilization of plasma steril- Oxford, pp 52–65. ization for planetary protection purposes (as indicated by Casillas-Martinez, L. and Setlow, P. (1997) Alkyl hydroperoxide reductase, catalase, MrgA, and superoxide dismutase are not Schuerger et al., 2008; Pottage et al., 2012). involved in resistance of Bacillus subtilis spores to heat or oxidizing agents. J Bacteriol 179:7420–7425. Acknowledgments Checinska, A., Burbank, M., and Paszczynski, A.J. (2012) Pro- tection of Bacillus pumilus spores by catalases. Appl Environ The authors are very grateful to Andrea Schro¨der for her Microbiol 78:6413–6422. skillful technical assistance during parts of this work and Committee on Preventing the Forward Contamination of Mars. Samantha M. Waters for her critical proofreading of the (2006) Preventing the Forward Contamination of Mars, National manuscript. We express thanks to the two anonymous re- Research Council, The National Academies Press, Wa- viewers for insightful comments. This study was supported shington, DC. in part by grants from the German Research Foundation COSPAR. (2011) COSPAR Planetary Protection Policy (20 October (DFG) Paketantrag (PlasmaDecon PAK 728) to P.A. (AW 7/ 2002, as amended to 24 March 2011), COSPAR, Paris. Avail- 3-1), R.M. (MO 2023/2-1), and the German Aerospace Center able online at https://cosparhq.cnes.fr/sites/default/files/ (DLR) grant DLR-FuE-Projekt ISS-Nutzung in der Bio- pppolicy.pdf.

46 604 STAPELMANN ET AL.

De Geyter, N. and Morent, R. (2012) Nonthermal plasma steril- (2012) Resistance of bacterial endospores to outer space for ization of living and nonliving surfaces. Annu Rev Biomed Eng planetary protection purposes—experiment PROTECT of the 14:255–274. EXPOSE-E mission. Astrobiology 12:445–456. Demidov, V.V., Goncharov, A.A., Osipov, V.B., and Trofimov, Humphreys, P.N. (2011) Testing standards for sporicides. J Hosp V.I. (1995) Modern aspects of planetary protection and re- Infect 77:193–198. quirements to sterilization of space hardware. Adv Space Res Hury, S., Vidal, D.R., Desor, F., Pelletier, J., and Lagarde, T. 15:251–255. (1998) A parametric study of the destruction efficiency of Denis, B., Steves, S., Semmler, E., Bibinov, N., Novak, W., and Bacillus spores in low pressure oxygen-based plasmas. Lett Awakowicz, P. (2012) Plasma sterilization of pharmaceutical Appl Microbiol 26:417–421. products: from basics to production. Plasma Process Polym Jacobs, P. and Kowatsch, R. (1993) Sterrad Sterilization System: a 9:619–629. new technology for instrument sterilization. Endosc Surg Allied Driks, A. (2002) Maximum shields: the assembly and function of Technol 1:57–58. the bacterial spore coat. Trends Microbiol 10:251–254. Kempf, M.J., Chen, F., Kern, R., and Venkateswaran, K. (2005) Ehlbeck, J., Schnabel, U., Polak, M., Winter, J., von Woedtke, T., Recurrent isolation of hydrogen peroxide-resistant spores of Brandenburg, R., von dem Hagen, T., and Weltmann, K.D. Bacillus pumilus from a spacecraft assembly facility. Astro- (2011) Low temperature atmospheric pressure plasma sources biology 5:391–405. for microbial decontamination. J Phys D Appl Phys 44, Kerney, K.R. and Schuerger, A.C. (2011) Survival of Bacillus doi:10.1088/0022-3727/44/1/013002. subtilis endospores on ultraviolet-irradiated rover wheels and Farr, S.B. and Kogoma, T. (1991). Oxidative stress responses in Mars regolith under simulated martian conditions. Astro- Escherichia coli and Salmonella typhimurium. Microbiol Rev biology 11:477–485. 55:561–585. Kla¨mpfl, T.G., Isbary, G., Shimizu, T., Li, Y.F., Zimmermann, Gioia, J., Yerrapragada, S., Qin, X., Jiang, H., Igboeli, O.C., J.L., Stolz, W., Schlegel, J., Morfill, G.E., and Schmidt, H.U. Muzny, D., Dugan-Rocha, S., Ding, Y., Hawes, A., Liu, W., (2012) Cold atmospheric air plasma sterilization against Perez, L., Kovar, C., Dinh, H., Lee, S., Nazareth, L., Blyth, P., spores and other microorganisms of clinical interest. Appl Holder, M., Buhay, C., Tirumalai, M.R., Liu, Y., Dasgupta, I., Environ Microbiol 78:5077–5082. Bokhetache, L., Fujita, M., Karouia, F., Eswara Moorthy, P., Kong, M.G., Kroesen, G., Morfill, G., Nosenko, T., Shimizu, T., Siefert, J., Uzman, A., Buzumbo, P., Verma, A., Zwiya, H., van Dijk, J., and Zimmermann, J.L. (2009) Plasma medicine: an McWilliams, B.D., Olowu, A., Clinkenbeard, K.D., New- introductory review. New J Phys 11, doi:10.1088/1367-2630/ combe, D., Golebiewski, L., Petrosino, J.F., Nicholson, W.L., 11/11/115012. Fox, G.E., Venkateswaran, K., Highlander, S.K., and Wein- La Duc, M.T., Satomi, M., and Venkateswaran, K. (2004a) stock, G.M. (2007) Paradoxical DNA repair and peroxide re- Bacillus odysseyi sp. nov., a round-spore-forming Bacillus sistance gene conservation in Bacillus pumilus SAFR-032. PLoS isolated from the Mars Odyssey spacecraft. Int J Syst Evol One 2, doi:10.1371/journal.pone.0000928. Microbiol 54:195–201. Granger, A.C., Gaidamakova, E.K., Matrosova, V.Y., Daly, M.J., La Duc, M.T., Kern, R., and Venkateswaran, K. (2004b) Microbial and Setlow, P. (2011) Effects of Mn and Fe levels on Bacillus monitoring of spacecraft and associated environments. Microb + subtilis spore resistance and effects of Mn2 , other divalent Ecol 47:150–158. cations, orthophosphate, and dipicolinic acid on protein re- Lerouge, S., Wertheimer, M.R., Marchand, R., Tabrizian, M., and sistance to ionizing radiation. Appl Environ Microbiol 77:32–40. Yahia, L. (2000) Effect of gas composition on spore mortality Griffiths, K.K. and Setlow, P. (2009) Effects of modification of and etching during low-pressure plasma sterilization. J Biomed membrane lipid composition on Bacillus subtilis sporulation Mater Res 51:128–135. and spore properties. J Appl Microbiol 106:2064–2078. Link, L., Sawyer, J., Venkateswaran, K., and Nicholson, W.L. Heinlin, J., Isbary, G., Stolz, W., Morfill, G., Landthaler, M., (2004) Extreme spore UV resistance of Bacillus pumilus isolates Shimizu, T., Steffes, B., Nosenko, T., Zimmermann, J., and obtained from an ultraclean spacecraft assembly facility. Mi- Karrer, S. (2011) Plasma applications in medicine with a spe- crob Ecol 47:159–163. cial focus on dermatology. J Eur Acad Dermatol Venereol 25: Moeller, R., Horneck, G., Rettberg, P., Mollenkopf, H.J., Stack- 1–11. ebrandt, E., and Nicholson, W.L. (2006) A method for ex- Ho¨ller, C., Martiny, H., Christiansen, B., Ru¨ den, H., and Gun- tracting RNA from dormant and germinating Bacillus subtilis dermann, K.O. (1993) The efficacy of low temperature plasma strain 168 endospores. Curr Microbiol 53:227–231. (LTP) sterilization, a new sterilization technique. Zentralbl Hyg Moeller, R., Stackebrandt, E., Reitz, G., Berger, T., Rettberg, P., Umweltmed 194:380–391. Doherty, A.J., Horneck, G., and Nicholson, W.L. (2007) Role of Hong, Y.F., Kang, J.G., Lee, H.Y., Uhm, H.S., Moon, E., and Park, DNA repair by nonhomologous-end joining in Bacillus subtilis Y.H. (2009) Sterilization effect of atmospheric plasma on spore resistance to extreme dryness, mono- and polychromatic Escherichia coli and Bacillus subtilis endospores. Lett Appl UV, and ionizing radiation. J Bacteriol 189:3306–3311. Microbiol 48:33–37. Moeller, R., Setlow, P., Reitz, G., and Nicholson, W.L. (2009) Horneck, G., Rettberg, P., Reitz, G., Wehner, J., Eschweiler, U., Roles of small, acid-soluble spore proteins and core water Strauch, K., Panitz, C., Starke, V., and Baumstark-Khan, C. content in survival of Bacillus subtilis spores exposed to envi- (2001) Protection of bacterial spores in space, a contribution to ronmental solar UV radiation. Appl Environ Microbiol 75:5202– the discussion on Panspermia. Orig Life Evol Biosph 31:527– 5208. 547. Moeller, R., Reitz, G., Berger, T., Okayasu, R., Nicholson, W.L., Horneck, G., Klaus, D.M., and Mancinelli, R.L. (2010) Space and Horneck, G. (2010) Astrobiological aspects of the muta- microbiology. Microbiol Mol Biol Rev 74:121–156. genesis of cosmic radiation on bacterial spores. Astrobiology Horneck, G., Moeller, R., Cadet, J., Douki, T., Mancinelli, R.L., 10:509–521. Nicholson, W.L., Panitz, C., Rabbow, E., Rettberg, P., Spry, A., Moeller, R., Reitz, G., Nicholson, W.L., PROTECT Team, and Stackebrandt, E., Vaishampayan, P., and Venkateswaran, K.J. Horneck, G. (2012a) Mutagenesis in bacterial spores exposed

47 SPORICIDAL EFFECTS OF LOW-PRESSURE PLASMA STERILIZATION 605

to space and simulated martian conditions: data from the Raballand, V., Benedikt, J., Wunderlich, J., and von Keudell, A. EXPOSE-E spaceflight experiment PROTECT. Astrobiology (2008) Inactivation of Bacillus atrophaeus and Aspergillus niger 12:457–468. using beams of argon ions, of oxygen molecules and of oxygen Moeller, R., Reitz, G., Li, Z., Klein, S., and Nicholson, W.L. atoms. J Phys D Appl Phys 41, doi:10.1088/0022-3727/41/11/ (2012b) Multifactorial resistance of Bacillus subtilis spores to 115207. high-energy proton radiation: role of spore structural Rauscher, H., Stapelmann, K., Kyliań, O., Denis, B., and Rossi, F. components and the homologous recombination and non- (2009) Monitoring plasma etching of biomolecules by imaging homologous end joining DNA repair pathways. Astrobiology ellipsometry. Vacuum 84:75–78. 12:1069–1077. Rauscher, H., Kyliań, O., Benedikt, J., von Keudell, A., and Rossi, Moeller, R., Schuerger, A.C., Reitz, G., and Nicholson, W.L. F. (2010) Elimination of biological contaminations from (2012c) Protective role of spore structural components in de- surfaces by plasma discharges: chemical sputtering. Chem- termining Bacillus subtilis spore resistance to simulated Mars physchem 11:1382–1389. surface conditions. Appl Environ Microbiol 78:8849–8853. Reder, A., Ho¨per, D., Gerth, U., and Hecker, M. (2012) Con- Moisan, M., Barbeau, J., Moreau, S., Pelletier, J., Tabrizian, M., tributions of individual rB-dependent general stress genes to and Yahia, L.H. (2001) Low-temperature sterilization using oxidative stress resistance of Bacillus subtilis. J Bacteriol 194: gas plasmas: a review of the experiments and an analysis of 3601–3610. the inactivation mechanisms. Int J Pharm 226:1–21. Riesenman, P.J. and Nicholson, W.L. (2000) Role of the spore Moisan, M., Barbeau, J., Crevier, M.C., Pelletier, J., Philip, N., coat layers in Bacillus subtilis spore resistance to hydrogen and Saoudi, B. (2002) Plasma sterilization: methods and peroxide, artificial UV-C, UV-B, and solar UV radiation. Appl mechanisms. Pure Appl Chem 74:349–358. Environ Microbiol 66:620–626. Moreau, M., Orange, N., and Feuilloley, M.G. (2008) Non-thermal Rossi, F., Kyliań, O., and Hasiwa, M. (2006) Decontamination of plasma technologies: new tools for bio-decontamination. Bio- surfaces by low pressure plasma discharges. Process Polym technol Adv 26:610–617. 3:431–442. Morris, A.D., McCombs, G.B., Akan, T., Hynes, W., Laroussi, M., Rossi, F., Kyliań, O., Rauscher, H., Hasiwa, M., and Gilliland, D. and Tolle, S.L. (2009) Cold plasma technology: bactericidal (2009) Low pressure plasma discharges for the sterilization effects on Geobacillus stearothermophilus and Bacillus cereus and decontamination of surfaces. New J Phys 11, doi:10.1088/ microorganisms. J Dent Hyg 83:55–61. 1367-2630/11/11/115017. NASA. (2005) Planetary protection provisions for robotic extra- Roth, S., Feichtinger, J., and Hertel, C. (2010) Characterization terrestrial missions. NPR 8020.12C, April 2005 ed., National of Bacillus subtilis spore inactivation in low-pressure, low- Aeronautics and Space Administration, Washington, DC. temperature gas plasma sterilization processes. J Appl Mi- Nicholson, W.L. and Galeano, B. (2003) UV resistance of Bacillus crobiol 108:521–531. anthracis spores revisited: validation of Bacillus subtilis spores Rummel, J.D. (2001) Planetary protection in the time of astro- as UV surrogates for spores of B. anthracis Sterne. Appl Environ biology: protecting against biological contamination. Proc Natl Microbiol 69:1327–1330. Acad Sci USA 98:2128–2131. Nicholson, W.L. and Setlow, P. (1990) Sporulation, germination, Rutala, W.A. and Weber, D.J. (2001) New disinfection and and outgrowth. In Molecular Biological Methods for Bacillus, sterilization methods. Emerg Infect Dis 7:348–353. edited by C.R. Harwood and S.M. Cutting, John Wiley and Rutala, W.A., Gergen, M.F., and Weber, D.J. (1999) Sporicidal Sons, Sussex, England, pp 391–450. activity of a new low-temperature sterilization technology: Nicholson, W.L., Munakata, N., Horneck, G., Melosh, H.J., and the Sterrad 50 sterilizer. Infect Control Hosp Epidemiol 20:514– Setlow, P. (2000) Resistance of Bacillus endospores to extreme 516. terrestrial and extraterrestrial environments. Microbiol Mol Biol Satomi, M., La Duc, M.T., and Venkateswaran, K. (2006) Bacillus Rev 64:548–572. safensis sp. nov., isolated from spacecraft and assembly-facility Nicholson, W.L., Schuerger, A.C., and Race, M.S. (2009) Mi- surfaces. Int J Syst Evol Microbiol 56:1735–1740. grating microbes and planetary protection. Trends Microbiol Schaeffer, P., Millet, J., and Aubert, J.P. (1965) Catabolic 17:389–392. repression of bacterial sporulation. Proc Natl Acad Sci USA Okpara-Hofmann, J., Knoll, M., Du¨ rr, M., Schmitt, B., and Borneff- 54:704–711. Lipp, M. (2005) Comparison of low-temperature hydrogen per- Schuerger, A.C., Richards, J.T., Hintze, P.E., and Kern, R.G. oxide gas plasma sterilization for endoscopes using various (2005) Surface characteristics of spacecraft components affect Sterrad models. JHospInfect59:280–285. the aggregation of microorganisms and may lead to different Osman, S., Satomi, M., and Venkateswaran, K. (2006) Paeniba- survival rates of bacteria on Mars landers. Astrobiology 5:545– cillus pasadenensis sp. nov. and Paenibacillus barengoltzii sp. 559. nov., isolated from a spacecraft assembly facility. Int J Syst Schuerger, A.C., Trigwell, S., and Calle, C.I. (2008) Use of non- Evol Microbiol 56:1509–1514. thermal atmospheric plasmas to reduce the viability of Bacillus Paidhungat, M., Setlow, B., Driks, A., and Setlow, P. (2000) subtilis on spacecraft surfaces. International Journal of Astro- Characterization of spores of Bacillus subtilis which lack dipi- biology 7:47–57. colinic acid. J Bacteriol 182:5505–5512. Setlow, P. (2006) Spores of Bacillus subtilis: their resistance to Popham, D.L., Sengupta, S., and Setlow, P. (1995) Heat, hydro- and killing by radiation, heat and chemicals. J Appl Microbiol gen peroxide, and UV resistance of Bacillus subtilis spores with 101:514–525. increased core water content and with or without major DNA- Setlow, P. (2007) I will survive: DNA protection in bacterial binding proteins. Appl Environ Microbiol 61:3633–3638. spores. Trends Microbiol 15:172–180. Pottage, T., Macken, S., Giri, K., Walker, J.T., and Bennett, A.M. Setlow, B. and Setlow, P. (1993) Binding of small, acid-soluble (2012) Low-temperature decontamination with hydrogen spore proteins to DNA plays a significant role in the resistance peroxide or chlorine dioxide for space applications. Appl En- of Bacillus subtilis spores to hydrogen peroxide. Appl Environ viron Microbiol 78:4169–4174. Microbiol 59:3418–3423.

48 606 STAPELMANN ET AL.

Stapelmann, K., Kyliań, O., Denis, B., and Rossi, F. (2008) On the Rauscher, H., Sirghi, L., Comoy, E., Dehen, C., Challier, L., application of inductively coupled plasma discharges sus- and Deslys, J.P. (2010) Inactivation of bacteria and biomole- tained in Ar/O2/N2 ternary mixture for sterilization and de- cules by low-pressure plasma discharges. Plasma Process Polym contamination of medical instruments. J Phys D Appl Phys 41, 7:327–352. doi:10.1088/0022-3727/41/19/192005. Wolfson, R.P. and Craven, C.W. (1971) Contamination of planets Venkateswaran, K., Kempf, M., Chen, F., Satomi, M., Nicholson, by nonsterile flight hardware. Environ Biol Med 1:99–120. W.L., and Kern, R. (2003) Bacillus nealsonii sp. nov., isolated Yasuda, H., Miura, T., Kurita, H., Takashima, K., and Mizuno, from a spacecraft-assembly facility, whose spores are gamma- A. (2010) Biological evaluation of DNA damage in bacterio- radiation resistant. Int J Syst Evol Microbiol 53:165–172. phages inactivated by atmospheric pressure cold plasma. Venkateswaran, K., Chung, S., Allton, J., and Kern, R. (2004) Plasma Process Polym 7:301–308. Evaluation of various cleaning methods to remove Bacillus spores from spacecraft hardware materials. Astrobiology 4:377– 390. Address correspondence to: Vaishampayan, P., Probst, A., Krishnamurthi, S., Ghosh, S., Ralf Moeller Osman, S., McDowall, A., Ruckmani, A., Mayilraj, S., and German Aerospace Center (DLR) Venkateswaran, K. (2010) Bacillus horneckiae sp. nov., isolated Institute of Aerospace Medicine from a spacecraft-assembly clean room. Int J Syst Evol Micro- Radiation Biology Department biol 60:1031–1037. Research Group ‘‘Astrobiology’’ Vaishampayan, P.A., Rabbow, E., Horneck, G., and Venka- Linder Hoehe teswaran, K.J. (2012) Survival of Bacillus pumilus spores for a D-51147 Cologne (Ko¨ln) prolonged period of time in real space conditions. Astrobiology Germany 12:487–497. von Keudell, A., Awakowicz, P., Benedikt, J., Raballand, V., E-mail: [email protected] Yanguas-Gil, A., Opretzka, J., Flo¨tgen, C., Reuter, R., Byelykh, L., Halfmann, H., Stapelmann, K., Denis, B., Wunderlich, J., Submitted 16 November 2012 Muranyi, P., Rossi, F., Kyliań, O., Hasiwa, N., Ruiz, A., Accepted 12 April 2013

49 Chapter C

Resistance of Bacillus subtilis spore DNA to lethal ionizing radiation damage relies primarily on spore core components and DNA repair, with minor effects of oxygen radical detoxification.

Ralf Moeller, Marina Raguse, Günther Reitz, Ryuichi Okayasu, Zuofeng Li, Stuart Klein, Peter Setlow, Wayne L. Nicholson

50 Resistance of Bacillus subtilis Spore DNA to Lethal Ionizing Radiation Damage Relies Primarily on Spore Core Components and DNA Repair, with Minor Effects of Oxygen Radical Detoxification

Ralf Moeller, Marina Raguse, Günther Reitz, Ryuichi Okayasu, Zuofeng Li, Stuart Klein, Peter Setlow and Wayne L. Nicholson Appl. Environ. Microbiol. 2014, 80(1):104. DOI: 10.1128/AEM.03136-13. Published Ahead of Print 11 October 2013.

Updated information and services can be found at: http://aem.asm.org/content/80/1/104

These include:

REFERENCES This article cites 46 articles, 21 of which can be accessed free at: http://aem.asm.org/content/80/1/104#ref-list-1

CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

51 Resistance of Bacillus subtilis Spore DNA to Lethal Ionizing Radiation Damage Relies Primarily on Spore Core Components and DNA Repair, with Minor Effects of Oxygen Radical Detoxiﬁcation

Ralf Moeller,a Marina Raguse,a Günther Reitz,a Ryuichi Okayasu,b Zuofeng Li,c Stuart Klein,c Peter Setlow,d Wayne L. Nicholsone ‹German Aerospace Center (DLR e.V.), Institute of Aerospace Medicine, Radiation Biology Department, Cologne, Germanya; International Open Laboratory, National Institute of Radiological Sciences, Chiba-shi, Japanb; University of Florida, Proton Therapy Institute, Jacksonville, Florida, USAc; Department of Molecular, Microbial and Structural Biology, University of Connecticut Health Center, Farmington, Connecticut, USAd; Department of Microbiology and Cell Science, University of Florida, Merritt Island, Florida, USAe

The roles of various core components, including ␣/␤/␥-type small acid-soluble spore proteins (SASP), dipicolinic acid (DPA), core water content, and DNA repair by apurinic/apyrimidinic (AP) endonucleases or nonhomologous end joining (NHEJ), in Bacillus subtilis spore resistance to different types of ionizing radiation including X rays, protons, and high-energy charged iron ions have been studied. Spores deficient in DNA repair by NHEJ or AP endonucleases, the oxidative stress response, or protection by major ␣/␤-type SASP, DPA, and decreased core water content were significantly more sensitive to ionizing radiation than wild-type spores, with highest sensitivity to high-energy-charged iron ions. DNA repair via NHEJ and AP endonucleases appears to be the most important mechanism for spore resistance to ionizing radiation, whereas oxygen radical detoxification via the MrgA-mediated oxidative stress response or KatX catalase activity plays only a very minor role. Synergistic radioprotec- tive effects of ␣/␤-type but not ␥-type SASP were also identified, indicating that ␣/␤-type SASP’s binding to spore DNA is important in preventing DNA damage due to reactive oxygen species generated by ionizing radiation.

pores of Bacillus subtilis have been used extensively as biolog- sources, i.e., the physical path of the applied ionizing radiation Sical indicators for industrial purposes such as sterilization or source in a cell. decontamination. Spores have also been shown to be suitable do- Previous studies have indicated that in both pro- and eukary- simeters for probing terrestrial and extraterrestrial ionizing radi- otic cells or under highly scavenging conditions mimicking those ation in environmental and astrobiological studies (1–3; reviewed for ROS scavenging in the cell, one-fourth of the lesions induced in references 4, 5, 6, and 7). Ionizing radiation can damage cellular in DNA by low-LET radiation can be ascribed to direct effects components through direct transfer of radiation energy into increasing up to 80% for high-LET particles (9, 11, 12). Hydrogen biomolecules (e.g., DNA, RNA, proteins) and indirectly by gener- peroxide (H2O2) and hydroxyl radicals (HO·) are major oxidizing species produced by the radiolysis of water, and superoxide ions ating reactive oxygen species (ROS) from the radiolysis of intra- Ϫ (O2· ) are formed in the presence of dissolved oxygen (12, 13). cellular H2O(8–11). The biological effects of ionizing radiation are thought to arise from the formation of single- and double- Lethal and mutagenic effects induced by ionizing radiation are strand breaks (SSB and DSB) in cellular DNA and clustered DNA thought to be the result of DNA damage caused during the course of irradiation (11, 14–16). Spore DNA resides in the innermost damage, e.g., two or more closely spaced lesions, including abasic spore compartment, the core, and dormant spores of B. subtilis sites, base lesions, SSB, and DSB. The biological effects of ionizing possess a complex arsenal of protective attributes in the core, in radiation depend on the quality and the dose of radiation and on particular a low core water content as well as abundant novel core the cell type (9–11). Linear energy transfer (LET) represents the constituents such as (i) the calcium chelate of dipicolinic acid energy lost per unit distance as an ionizing particle travels through (Ca-DPA), which comprises ϳ25% of core dry weight, and (ii) a material, and it is used to quantify the effects of ionizing radia- small, acid-soluble spore proteins (SASP) of the ␣/␤ type, which tion on biological specimens (5, 10–13). High-LET radiation bind spore DNA and protect it from many types of damage, in- sources include protons, and high-energy-charged (HZE) parti- cluding UV photoproducts, apurinic/apyrimidinic (AP) sites, and cles give densely ionizing radiation, since they lose their energy in oxidative lesions (17, 18, 47; reviewed in references 4, 6, and 19). a small distance and thus cause dense ionization along their tracks Spore DNA is saturated with a group of unique proteins called and can give localized multiple DNA-damaging events. Low-LET ␣/␤-type SASP, which are encoded by multiple genes and synthe- radiation sources, such as X rays, give sparsely ionizing radiation, sized only during sporulation in the developing spore. These ␣/␤- since they produce ionizations sparsely along their track and, hence, almost homogeneously within a cell. The biological effects of high-LET radiation are in general much higher than those of Received 17 September 2013 Accepted 10 October 2013 low-LET radiation of the same energy (10, 12, 13). This is because Published ahead of print 11 October 2013 high-LET radiation deposits most of its energy within the volume Address correspondence to Ralf Moeller, [email protected]. of one cell and the damage to DNA is therefore larger (9–11). This Copyright © 2014, American Society for Microbiology. All Rights Reserved. is attributable to the formation of clusters of damage that result in doi:10.1128/AEM.03136-13 two or more DNA lesions along the tracks of high-LET radiation

104 aem.asm.org Applied and Environmental Microbiology p. 104–109 January 2014 Volume 80 Number 1

52 Spore Resistance to Ionizing Radiation

type SASP are nonspecific DNA-binding proteins that bind to TABLE 1 B. subtilis strains used in this study random-sequence double-strand DNA and comprise approxi- Strain Relevant genotype and phenotype Reference mately 5% of total spore protein (reviewed in references 6 and 18). PS832 Trpϩ revertant of strain 168 (wild type) 40 The high levels of ␣/␤-type SASP in spores are sufficient to satu- PS283a ⌬sspA, SASP-␣Ϫ,Cmr 45 rate the spore DNA, and the DNA within this nucleoprotein com- PS338a ⌬sspB, SASP-␤Ϫ,Cmr 45 plex is protected from a variety of environmental insults (4, 7). PS483a ⌬sspE, SASP-␥Ϫ,Cmr 38 Germinating spores also can detoxify ROS using enzymes such PS356b ⌬sspA ⌬sspB, ␣Ϫ␤Ϫ 22 as catalase (KatX) and superoxide dismutase (SodA), although PS482a ⌬sspA ⌬sspB ⌬sspE, ␣Ϫ␤Ϫ␥Ϫ,Cmr 46 these enzymes play no role in dormant spore resistance to oxidiz- PS1899a ⌬dacB::Cmr 22 ing agents, most likely because enzymes in the spore core are in- PS2211a,b ⌬dacB::Cmr, ␣Ϫ␤Ϫ 22 FB122c,d ⌬sleB::Spcr ⌬spoVF::Tetr, DPAϪ 39 active due to the core’s low water content (20–23). Mechanisms to a,b,c,d r r Ϫ Ϫ Ϫ prevent damage caused by ROS, in particular damage to DNA, PS3664 ⌬sleB::Spc ⌬spoVF::Tet , DPA , ␣ ␤ 47 PS2496a ⌬mrgA::Cmr 21 include protective DNA-binding proteins as well as enzymes such PS2507a,b ⌬mrgA::Cmr, ␣Ϫ␤Ϫ 21 as alkyl hydroperoxide reductases, catalases, and superoxide dis- PS2495a ⌬sodA::Cmr 21 mutases, which can destroy the oxidizing agents alkyl hydroper- PS2506a,b ⌬sodA::Cmr, ␣Ϫ␤Ϫ 21 oxides, hydrogen peroxide, and superoxide, respectively. A study PS2558a ⌬katX::Cmr 21 of the role of oxidative stress responsive proteins such as the DNA- PS2559a,b ⌬katX::Cmr, ␣Ϫ␤Ϫ 21 binding protein MrgA, alkyl hydroperoxide reductase, catalases, PERM454d,e ⌬exoA::Tetr ⌬nfo::Neor 24 and superoxide dismutases in the resistance of B. subtilis spores to PERM450a,b,d,e ⌬exoA::Tetr ⌬nfo::Neor, ␣Ϫ␤Ϫ 24 oxidative stress caused by paraquat and hydrogen peroxide expo- PS3722f ⌬ykoVU::Ermr 25 a,b,f r Ϫ Ϫ sure showed that inactivation of genes coding for the protective PS3751 ⌬ykoVU::Erm , ␣ ␤ 25 enzymes or MrgA had no effect on the spores’ heat or hydrogen a Cmr, resistant to chloramphenicol (5 ␮g/ml). b Ϫ Ϫ peroxide resistance (21). Spore DNA damage can also be repaired ␣ ␤ , spores lack SASP-␣ and -␤ and thus ϳ80% of the spore’s pool of ␣/␤-type SASP (35). during germination via a number of different pathways such as c Spcr, resistant to spectinomycin (100 ␮g/ml). direct reversal, nonhomologous end joining (NHEJ, encoded by d Tetr, resistant to tetracycline (10 ␮g/ml). YkoV and YkoU), base and nucleotide excision repair (BER and e Neor, resistant to neomycin (10 ␮g/ml). NER, respectively), mismatch repair, recombination-mediated f Ermr, resistant to erythromycin (1 ␮g/ml). repair, and translesion synthesis (24–28; reviewed in references 6 and 29). Two AP endonucleases, ExoA and Nfo, have also been implicated in the repair of AP sites caused by oxidizing agents in Therapy Institute (UF-PTI), Jacksonville, Florida, USA, and at the heavy germinating B. subtilis spores (24). However, there has been no ion medical accelerator (HIMAC) facility at the National Institute for systematic study of the relationship between the spore core pro- Radiological Sciences (NIRS) in Chiba, Japan, respectively. Details on the tective features (i.e., ␣/␤/␥-type SASP, DPA, and core hydration), irradiation geometry of the NIRS-HIMAC, DLR-ME, and UF-PTI facilities, beam monitoring, dosimetry, and dose calculations have been de- the oxidative stress response (by MrgA), ROS detoxification (via scribed (34–37). SodA or KatX), and DNA repair (by NHEJ or BER) in spores’ Numerical and statistical analysis. Spore survival was determined ionizing radiation resistance, and this is the subject of the present from appropriate dilutions in distilled water as colony-forming ability work. after incubation overnight at 37°C on nutrient broth (NB) agar plates (Difco, Detroit, MI, USA) (33, 34, 36). The surviving fraction of B. subtilis MATERIALS AND METHODS spores was determined from the ratio N/N0, where N is the number of Bacterial strains, growth, sporulation, and spore purification. The B. CFU of the irradiated sample and N0 that of the nonirradiated controls. subtilis strains used in this work are listed in Table 1, and all are isogenic Spore inactivation curves were obtained as described previously (34). with the wild-type strain PS832. Spores were obtained by cultivation un- Data are reported as D10-values, the dose of ionizing radiation killing 90% der vigorous aeration at 37°C for 7 days in double-strength liquid Schaef- of the initial spore population (34). All data are expressed as averages Ϯ fer sporulation medium (30), and spores were purified and stored as de- standard deviations (n ϭ 3). The significance of the differences in the scribed previously (31–33). When appropriate, chloramphenicol (5 ␮g/ survival rates and relative sensitivities were determined by analysis of vari- ml), neomycin (10 ␮g/ml), spectinomycin (100 ␮g/ml), erythromycin (1 ance (ANOVA), using SigmaPlot software Version 12.0 (Systat Software ␮g/ml), or tetracycline (10 ␮g/ml) was added to the medium. Spore prep- GmbH, Erkrath, Germany). Values were evaluated in multigroup pair- arations consisted of single spores with no detectable clumps and were wise combinations, and differences with P values of Ͻ0.05 were consid- free (Ͼ99%) of growing cells, germinated spores, and cell debris, as seen ered statistically significant (33, 34, 36). in the phase-contrast microscope (32–34). Measurement of spore resistance to ionizing radiation. Preparation RESULTS of spore samples for radiation exposure has been described in detail pre- The importance of the two types of SASP, the DNA-binding ␣/␤ viously (33, 34). In brief, suspensions of spores of the different B. subtilis type and non-DNA-binding ␥ type, alone and in combination strains (Table 1) were prepared in sterile distilled water to a final concen- 8 with various other protective spore core components, including tration of 1 ϫ 10 spores per ml. Triplicate samples of spores in water (100 core water content and DPA, has been assessed to establish their ␮ l) were individually exposed to three different types of ionizing radia- roles as radioprotectants. B. subtilis spores have several additional tion: X rays (200 keV/15 mA), protons (with energy of 218 MeV, LET of 0.4 keV/␮m, and a range of 301 mm in water), and high-energy-charged potential mechanisms for minimizing damage to spore DNA in- iron ions (Fe; with energy of 500 MeV/nucleon, LET of 200 keV/␮m, and cluding BER via AP endonucleases (by ExoA and Nfo), DNA dou- a range of 99 mm in water). X ray, proton, and Fe irradiations were con- ble-strand break repair (via NHEJ by YkoU and V), and radical ducted at the German Aerospace Center, Institute of Aerospace Medicine detoxification (superoxide dismutase SodA and major spore cat- (DLR-ME), in Cologne, Germany, at the University of Florida Proton alase KatX), as well as via the oxidative stress response (DNA-

January 2014 Volume 80 Number 1 aem.asm.org 105

53 Moeller et al.

FIG 1 Spore resistance to irradiation with X rays (A), protons (B), and high-energy charged Fe ions (C). Spores differing in various core components, including major ␣/␤-type SASP, the single ␥-type SASP, and Ca-DPA (due to loss of DPA synthetase encoded by spoVF), or core water content (due to the dacB mutation), with (white bars) and without (gray bars) protection by ␣/␤-type SASP. Spores were irradiated in water, and D10 values are expressed as averages Ϯ standard deviations (n ϭ 3) as described in the text. Lowercase letters above the bars denote groups signiﬁcantly different by ANOVA (P Ͻ 0.05). Note the differences in the y axes of panels A, B, and C. binding protein MrgA); spores of strains lacking these various previously shown to exhibit a 1.6-fold-increased core water con- gene products have been also included in this study. Wild-type tent (52 to 65%) compared to that of wild-type spores (34 to 41%) and mutant spores (Table 1) were subjected to three different (22, 23) Ͼ sleB plus spoVF (which allow isolation of stable spores types of ionizing radiation, X rays, protons, and high-energy Fe that lack Ca-DPA [39]) Ͼ sspE (encoding the only ␥-type SASP; ions. termed ␥Ϫ spores), which is equivalent to the wild type (Fig. 1). Role of spore core components in ionizing radiation resis- Radiation resistance of spores carrying mutations in sspE, tance. Spore structures (e.g., the spore coat and cortex) and com- dacB, or both sleB and spoVF was tested either in a wild-type back- ponents in the spore core (e.g., Ca-DPA, ␣/␤-type SASP) have ground or in an sspA sspB background lacking both major ␣/␤- previously been demonstrated to protect spores from inactivation type SASP (termed ␣Ϫ␤Ϫ spores) (Fig. 2). The combined effects after exposure to various sporicidal treatments such as exposure to on spore sensitivity, from most sensitive to least, were as follows: UV radiation, hydrogen peroxide, or heat (reviewed in references ␣Ϫ␤Ϫ dacB Ͼ␣Ϫ␤Ϫ sleB spoVF Ͼ␣Ϫ␤Ϫ ϾϾ wild-type Ϸ␥Ϫ (Fig. 4, 6, and 7). Spores lacking various spore core components were 2). The results show that spore core dehydration and DPA, but not irradiated with X rays (Fig. 1A), protons (Fig. 1B), or Fe ions (Fig. ␥-type SASP, function in addition to ␣/␤-type SASP as radiopro- 1C). In order, from most to least sensitive, were spores of mutants tectants in the spore core. in sspA (encoding one of two major ␣/␤-type SASP [38]) Ͼ sspB Role of oxidative stress responses and DNA repair in spore (encoding the less abundant major ␣/␤-type SASP [38]) Ͼ dacB, ionizing radiation resistance. Spores of strains defective in ROS

FIG 2 Impact of spore core-speciﬁc components on spore resistance to different types of ionizing radiation: X rays (A), protons (B), and high-energy charged Fe ions (C) with (white bars) and without (gray bars) protection by ␣/␤-type SASP. Relative spore sensitivity was expressed as the ratio of the D10 value of spores Ϫ Ϫ of each mutant strain to the D10 value of spores of the corresponding reference strain (wild-type or ␣ ␤ ) from each irradiation, using data from Fig. 1. Data are averages and standard deviations (n ϭ 3). Actual data values are given above the corresponding columns in Fig. 1. Lowercase letters next to the bars denote groups signiﬁcantly different by ANOVA (P Ͻ 0.05).

106 aem.asm.org Applied and Environmental Microbiology

54 Spore Resistance to Ionizing Radiation

FIG 3 Spore resistance to irradiation with X rays (A), protons (B), and high-energy charged Fe ions (C). Spores deficient in radical detoxification by SodA (superoxide dismutase), KatX (major spore catalase), DNA protection by MrgA (oxidative stress resistance DNA-binding protein), DNA repair by ExoA and Nfo, or YkoV and YkoU (with [white bars] and without [gray bars] protection by ␣/␤-type SASP), were exposed in water, and D10 values are expressed as averages Ϯ standard deviations (n ϭ 3) as described in the text. Lowercase letters above the bars denote groups significantly different by ANOVA (P Ͻ 0.05). Note the differences in the y axes of panels A, B, and C. detoxification, the oxidative stress response DNA-binding protein exposure, the effects of the katX, mrgA, exoA nfo, and ykoVU mu- MrgA, or DNA repair were exposed to X rays, protons, and Fe tations (but not sodA) were all potentiated in the ␣Ϫ␤Ϫ back- ions, and their sensitivities were compared (Fig. 3). Spores defi- ground (Fig. 4B). In response to Fe ions, only the exoA nfo (BER- cient in radical detoxification (sodA or katX spores) were no more deficient) and ykoVU (NHEJ-deficient) mutant spores sensitive than wild-type spores to any type of ionizing radiation demonstrated a significantly enhanced sensitivity in the ␣Ϫ␤Ϫ tested (Fig. 3), as expected given the minimal activity of enzymes background (Fig. 4C). in the spore core. Spores lacking a major oxidative-stress-protective protein (mrgA spores) were significantly more sensitive than DISCUSSION wild-type spores to X rays and Fe ions, but not to protons, which In regard to the characteristic resistance to ionizing radiation, could be due to the different spectra of lesions induced by the spores of the Gram-positive bacterium B. subtilis have often been three types of radiation (9, 11, 15)(Fig. 3). Spores lacking BER used to evaluate sterilization efforts in areas of food preservation, (exoA nfo spores) and double-strand break repair (ykoVU spores) medical sterilization, and decontamination of potential biohaz- were both significantly more sensitive to all types of radiation than ardous materials (3, 4, 6). Ionizing radiation is known to cause wild-type spores (Fig. 3). Comparison of the spore radiation re- damage to numerous targets within the cell, including DNA, due sistance in wild-type and ␣Ϫ␤Ϫ backgrounds showed that in re- both to (i) direct interaction of the radiation with the target mol- sponse to X rays only the ykoVU spores showed an additive effect ecule and to (ii) indirect effects due to the production of reactive with the loss of ␣/␤-type SASP (Fig. 4A). In response to proton species such as oxygen radicals (9, 10, 12, 13, 15). Ionizing radia-

FIG 4 Relative ionizing radiation sensitivities of spores lacking radical detoxiﬁcation by SodA or KatX, DNA protection by MrgA, or DNA repair by ExoA plus Nfo or YkoV plus YkoU to X rays (A), protons (B), and high-energy charged Fe ions (C) with (white bars) and without (gray bars) protection by ␣/␤-type SASP.

Relative spore sensitivity is expressed as the ratio of the D10 value of spores of each mutant strain to the D10 value of spores of the corresponding reference strain (wild-type or ␣Ϫ␤Ϫ) from each irradiation, using data from Fig. 3. Data are averages and standard deviations (n ϭ 3). Actual data values are given above the corresponding columns. Lowercase letters next to the bars denote groups signiﬁcantly different by ANOVA (P Ͻ 0.05).

January 2014 Volume 80 Number 1 aem.asm.org 107

55 Moeller et al. tion induces a large variety of damages to DNA bases and through complement the results from microarray experiments demon- interaction with the sugar moiety can cause formation of DNA strating upregulation of stress-related regulons responding to strand breaks, either SSB or DSB. DNA strand breaks were re- DNA damage (SOS response) and oxidative stress (PerR regulon) ported to be the major lesions in the genome of spores exposed to during germination of spores exposed to space conditions, includ- ionizing radiation (reviewed in references 4 and 7), caused either ing the effects of galactic cosmic radiation (41). directly by the highly energetic photons or accelerated particles or Spores appear to have two possible ways to minimize deleteri- indirectly via interaction of radiation-induced free radicals, e.g., ous effects of ionizing radiation: (i) by protecting dormant spore ROS, with the DNA (9, 13, 15, 16). The results of several radiobi- DNA from damage in the first place (Fig. 1 and 2) and (ii) by ological studies at accelerators and in space experiments lead to ensuring detoxification and repair of direct and indirect damage the assumption that at least two qualitatively different lesions are during spore germination (Fig. 3 and 4). Because ionizing radia- formed depending on the type and energy of the applied ionizing tion causes such a wide spectrum of direct and indirect DNA dam- radiation. The spore’s structure and chemical composition play age, it will be interesting to determine the contributions of addi- major roles in spore resistance (6, 7, 18). The spore’s general struc- tional error-free and error-prone DNA repair pathways (e.g., ture is very different from that of a growing cell, with a number of mismatch repair, translesion synthesis, and homologous recom- features and constituents unique to spores (4). Several of these bination [29, 42–44]), to gain further detailed insights into spore features have been shown to be involved in spore resistance to resistance to ionizing radiation. some chemicals and physical treatments, but little is known of their role in spore resistance to ionizing radiation. Spore DNA is ACKNOWLEDGMENTS saturated with a group of SASP that bind to DNA largely on the We thank Andrea Schröder and Petra Schwendner for their excellent tech- outside of the DNA helix and straighten and stiffen the DNA while nical assistance during parts of this work and Mario Pedraza-Reyes for his changing the DNA to an A-like helix (reviewed in reference 6 and generous donation of B. subtilis strains. We are very grateful to all UF-PTI references therein). As a consequence, DNA properties in spores and HIMAC operators for their excellent support during proton and Fe are dramatically different from those in vegetative cells, e.g., spore ion irradiations. We express gratitude to Thomas Berger and Daniel Mat- DNA complexed with SASP is much more resistant to chemical thiä for their consulting, providing technical data and discussion. attack, thermal degradation, and UV radiation (6, 7, 17, 22, 40), R.M., M.R., and G.R. were supported by DLR grant DLR-FuE-Projekt ISS Nutzung in der Biodiagnostik, Programm RF-FuW, Teilprogramm strongly suggesting that SASP may also be important for spore 475, and DLR Forschungssemester-fellowship (to R.M.). Work in the Set- resistance to ionizing radiation, as indicated in earlier studies test- low lab was supported by a U.S. Department of Defense Multi-University ing mutants lacking a single SASP (17, 33). Research Initiative through the U.S. Army Research Laboratory and the The current work has shown that protective components in the U.S. Army Research Office under contract number W911NF-09-1-0286. spore core are important determinants of spore resistance to X These results will be included in the research reports of the HIMAC ray, proton, and heavy Fe ion bombardment with the order of project 13J302 (hiiSPORES project). importance being as follows: ␣/␤-type SASP ϾϾ core dehydra- REFERENCES tion Ͼ DPA. In contrast, the single major ␥-type SASP does not bind to DNA and plays no protective role in spore ionizing radi- 1. Blatchley ER, Meeusen A, Aronson AI, Brewster L. 2005. Inactivation of ation resistance, as has also been found when spore resistance to Bacillus spores by ultraviolet or gamma radiation. J. Environ. Eng. 131:1245– 1252. http://dx.doi.org/10.1061/(ASCE)0733-9372(2005)131:9(1245). many other agents has been tested (23, 37; reviewed in reference 6) 2. Horneck G. 1994. HZE particle effects in space. Acta Astronaut. 11:749– (Fig. 1 and 2). In the dormant state, spores remain metabolically 755. inactive, and thus substantial DNA, protein, tRNA, and ribosome 3. Niebuhr SE, Dickson JS. 2003. Destruction of Bacillus anthracis strain damage may accumulate, and the spores are incapable of repairing Sterne 34F2 spores in postal envelopes by exposure to electron beam irradiation. Lett. Appl. Microbiol. 37:17–20. http://dx.doi.org/10.1046/j.1472 and/or degrading such damaged DNA and proteins (6, 7, 18). -765X.2003.01337.x. Consequently, damage to DNA, proteins, or other essential com- 4. Nicholson WL, Munakata N, Horneck G, Melosh HJ, Setlow P. 2000. ponents of bacterial spores poses a unique problem, since such Resistance of bacterial endospores to extreme terrestrial and extraterres- repair of such damage does not occur until the processes of ger- trial environments. Microbiol. Mol. Biol. Rev. 64:548–572. http://dx.doi mination and outgrowth, when spores reactivate and prepare to .org/10.1128/MMBR.64.3.548-572.2000. 5. Horneck G, Klaus DM, Mancinelli RL. 2010. Space microbiology. Mi- return to vegetative growth (6, 7, 28). Repair of DSB and base crobiol. Mol. Biol. Rev. 74:121–156. http://dx.doi.org/10.1128/MMBR modification/loss via NHEJ and BER appear to be important .00016-09. mechanisms for spore resistance to ionizing radiation, and the 6. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing by MrgA-mediated oxidative stress response (with effects in wild- radiation, heat and chemicals. J. Appl. Microbiol. 101:514–525. http://dx Ϫ Ϫ .doi.org/10.1111/j.1365-2672.2005.02736.x. type spores for X-ray stress and in ␣ ␤ spores for proton radia- 7. Setlow P. 2007. I will survive: DNA protection in bacterial spores. Trends tion resistance) plays a lesser role. In contrast, ROS detoxification Microbiol. 15:172–180. http://dx.doi.org/10.1016/j.tim.2007.02.004. by catalase or superoxide dismutase appears to play a very minor 8. Cadet J, Delatour T, Douki T, Gasparutto D, Pouget JP, Ravanat JL, role, if any, in spore resistance to ionizing radiation, as is also the Sauvaigo S. 1999. Hydroxyl radicals and DNA base damage. Mutat. Res. case in spore resistance to oxidizing agents such as hydrogen per- 424:9–21. 9. Goodhead DT. 1994. Initial events in the cellular effects of ionizing radi- oxide and superoxide (20, 21)(Fig. 3 and 4). Clearly the data ations: clustered damage in DNA. Int. J. Radiat. Biol. 65:7–17. indicate that spore DNA is a major target of lethal ionizing radia- 10. Hutchinson F. 1985. Chemical changes induced in DNA by ionizing ration damage, based on the observation that the major factors con- diation. Prog. Nucleic Acid Res. Mol. Biol. 32:115–154. tributing significantly to spore survival (Fig. 3 and 4) in response 11. Hada M, Sutherland BM. 2006. Spectrum of complex DNA damages depends on the incident radiation. Radiat. Res. 165:223–230. http://dx.doi to different types of ionizing radiation are known to be important .org/10.1667/RR3498.1. in either DNA protection in spores or DNA repair in spore germi- 12. Sutherland BM, Bennett PV, Sidorkina O, Laval J. 2000. Clustered nation and outgrowth. The findings in this communication thus damages and total lesions induced in DNA by ionizing radiation: oxidized

108 aem.asm.org Applied and Environmental Microbiology

56 Spore Resistance to Ionizing Radiation

bases and strand breaks. Biochemistry 39:8026–8031. http://dx.doi.org growth, p 391–450. In Harwood CR, Cutting SM (ed), Molecular biolog- /10.1021/bi9927989. ical methods for Bacillus. J. Wiley and Sons, Sussex, England. 13. Lomax ME, Gulston MK, O’Neill P. 2002. Chemical aspects of clustered 32. Moeller R, Stackebrandt E, Reitz G, Berger T, Rettberg P, Doherty AJ, DNA damage induction by ionising radiation. Radiat. Prot. Dosimetry Horneck G, Nicholson WL. 2007. Role of DNA repair by non- 99:63–68. http://dx.doi.org/10.1093/oxfordjournals.rpd.a006840. homologous end joining (NHEJ) in Bacillus subtilis spore resistance to 14. Dianov GL, O’Neill P, Goodhead DT. 2001. Securing genome stability by extreme dryness, mono- and polychromatic UV and ionizing radiation. J. orchestrating DNA repair: removal of radiation-induced clustered lesions Bacteriol. 189:3306–3311. http://dx.doi.org/10.1128/JB.00018-07. in DNA. Bioessays 23:745–749. http://dx.doi.org/10.1002/bies.1104. 33. Moeller R, Setlow P, Horneck G, Berger T, Reitz G, Rettberg P, Doherty 15. Yokoya A, Shikazono N, Fujii K, Urushibara A, Akamatsu K, Watanabe AJ, Okayasu R, Nicholson WL. 2008. Roles of the major, small, acid- R. 2008. DNA damage induced by the direct effect of radiation. Radiat. soluble spore proteins and spore-specific and universal DNA repair mech- Phys. Chem. 77:1280–1285. http://dx.doi.org/10.1016/j.radphyschem anisms in resistance of Bacillus subtilis spores to ionizing radiation from .2008.05.021. X-rays and high-energy charged-particle bombardment. J. Bacteriol. 190: 16. Asaithamby A, Chen DJ. 2011. Mechanism of cluster DNA damage repair 1134–1140. http://dx.doi.org/10.1128/JB.01644-07. in response to high-atomic number and energy particles radiation. Mutat. 34. Okayasu R, Okada M, Okabe A, Noguchi M, Takakura K, Takahashi S. Res. 711:87–99. http://dx.doi.org/10.1016/j.mrfmmm.2010.11.002. 2006. Repair of DNA damage induced by accelerated heavy ions in mam- 17. Granger AC, Gaidamakova EK, Matrosova VY, Daly MJ, Setlow P. malian cells proficient and deficient in the non-homologous end-joining 2011. Effects of Mn and Fe levels on Bacillus subtilis spore resistance and pathway. Radiat. Res. 165:59–67. http://dx.doi.org/10.1667/RR3489.1. effects of Mn2ϩ, other divalent cations, orthophosphate, and dipicolinic 35. Moeller R, Reitz G, Li Z, Klein S, Nicholson WL. 2012. Multifactorial acid on protein resistance to ionizing radiation. Appl. Environ. Microbiol. resistance of Bacillus subtilis spores to high-energy proton radiation: role 77:32–40. http://dx.doi.org/10.1128/AEM.01965-10. of spore structural components and the homologous recombination and 18. Leggett MJ, McDonnell G, Denyer SP, Setlow P, Maillard JY. 2012. non-homologous end joining DNA repair pathways. Astrobiology 12: Bacterial spore structures and their protective role in biocide resistance. J. 1069–1077. http://dx.doi.org/10.1089/ast.2012.0890. Appl. Microbiol. 113:485–498. http://dx.doi.org/10.1111/j.1365-2672 36. Su Z, Lopatiuk-Tirpak O, Zeidan O, Sruprisan SI, Meeks SL, Slopsema .2012.05336.x. R, Flampouri S, Li Z. 2012. An experimental investigation into the effect 19. McKenney PT, Driks A, Eichenberger P. 2013. The Bacillus subtilis of periodic motion on proton dosimetry using polymer gel dosimeters and endospore: assembly and functions of the multilayered coat. Nat. Rev. a programmable motion platform. Phys. Med. Biol. 57:649–663. http://dx Microbiol. 11:33–44. .doi.org/10.1088/0031-9155/57/3/649. 20. Bagyan I, Casillas-Martinez L, Setlow P. 1998. The katX gene, which 37. Setlow B, Setlow P. 1993. Binding of small, acid-soluble spore proteins to codes for the catalase in spores of Bacillus subtilis, is a forespore-specific DNA plays a significant role in the resistance of Bacillus subtilis spores to gene controlled by SigmaF, and KatX is essential for hydrogen peroxide hydrogen peroxide. Appl. Environ. Microbiol. 59:3418–3423. resistance of the germinating spore. J. Bacteriol. 180:2057–2062. 38. Hackett RH, Setlow P. 1988. Properties of spores of Bacillus subtilis 21. Casillas-Martinez L, Setlow P. 1997. Alkyl hydroperoxide reductase, cat- strains which lack the major small, acid-soluble protein. J. Bacteriol. 170: alase, MrgA, and superoxide dismutase are not involved in resistance of 1403–1404. Bacillus subtilis spores to heat or oxidizing agents. J. Bacteriol. 179:7420– 39. Magge A, Granger AC, Wahome PG, Setlow B, Vepachedu VR, Loshon 7425. CA, Peng L, Chen D, Li YQ, Setlow P. 2008. Role of dipicolinic acid in 22. Popham DL, Sengupta S, Setlow P. 1995. Heat, hydrogen peroxide, and the germination, stability, and viability of spores of Bacillus subtilis.J. UV resistance of Bacillus subtilis spores with increased core water content Bacteriol. 190:4798–4807. http://dx.doi.org/10.1128/JB.00477-08. and with or without major DNA-binding proteins. Appl. Environ. Micro- 40. Loshon CA, Genest PC, Setlow B, Setlow P. 1999. Formaldehyde kills biol. 61:3633–3638. spores of Bacillus subtilis by DNA damage and small, acid-soluble spore 23. Moeller R, Setlow P, Reitz G, Nicholson WL. 2009. Roles of small, acid- proteins of the alpha/beta-type protect spores against this DNA damage. J. soluble spore proteins and core water content in survival of Bacillus subtilis Appl. Microbiol. 87:8–14. spores exposed to environmental solar UV radiation. Appl. Environ. Micro- 41. Nicholson WL, Moeller R, Team PROTECT, Horneck G. 2012. Tran- biol. 75:5202–5208. http://dx.doi.org/10.1128/AEM.00789-09. scriptomic responses of germinating Bacillus subtilis spores exposed to 1.5 24. Ibarra JR, Orozco AD, Rojas JA, López K, Setlow P, Yasbin RE, years of space parameters and simulated martian conditions on the EX- Pedraza-Reyes M. 2008. Role of the Nfo and ExoA apurinic/apyrimidinic POSE-E experiment PROTECT. Astrobiology 12:469–486. http://dx.doi endonucleases in repair of DNA damage during outgrowth of Bacillus .org/10.1089/ast.2011.0748. subtilis spores. J. Bacteriol. 190:2031–2038. http://dx.doi.org/10.1128/JB 42. Ayora S, Carrasco B, Cárdenas PP, César CE, Cañas C, Yadav T, .01625-07. Marchisone C, Alonso JC. 2011. Double-strand break repair in bacteria: 25. Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, Sato T, Setlow a view from Bacillus subtilis. FEMS Microbiol. Rev. 35:1055–1081. http: P, Losick R, Eichenberger P. 2006. The forespore line of gene expression //dx.doi.org/10.1111/j.1574-6976.2011.00272.x. in Bacillus subtilis. J. Mol. Biol. 358:16–37. http://dx.doi.org/10.1016/j 43. Bolz NJ, Lenhart JS, Weindorf SC, Simmons LA. 2012. Residues in the .jmb.2006.01.059. N-terminal domain of MutL required for mismatch repair in Bacillus sub- 26. Pitcher RS, Brissett NC, Doherty AJ. 2007. Nonhomologous end-joining tilis. J. Bacteriol. 194:5361–5367. http://dx.doi.org/10.1128/JB.01142-12. in bacteria: a microbial perspective. Annu. Rev. Microbiol. 61:259–282. 44. Rivas-Castillo AM, Yasbin RE, Robleto E, Nicholson WL, Pedraza- http://dx.doi.org/10.1146/annurev.micro.61.080706.093354. Reyes M. 2010. Role of the Y-family DNA polymerases YqjH and YqjW in 27. Salas-Pacheco JM, Setlow B, Setlow P, Pedraza-Reyes M. 2005. Role of protecting sporulating Bacillus subtilis cells from DNA damage. Curr. Mi- the Nfo (YqfS) and ExoA apurinic/apyrimidinic endonucleases in protect- crobiol. 60:263–267. http://dx.doi.org/10.1007/s00284-009-9535-3. ing Bacillus subtilis spores from DNA damage. J. Bacteriol. 187:7374– 45. Mason JM, Setlow P. 1986. Essential role of small, acid-soluble spore 7381. http://dx.doi.org/10.1128/JB.187.21.7374-7381.2005. proteins in resistance of Bacillus subtilis spores to UV light. J. Bacteriol. 28. Setlow B, Setlow P. 1996. Role of DNA repair in Bacillus subtilis spore 167:174–178. resistance. J. Bacteriol. 178:3486–3495. 46. Wuytack EY, Boven S, Michiels CW. 1998. Comparative study of pres- 29. Lenhart JS, Schroeder JW, Walsh BW, Simmons LA. 2012. DNA repair sure-induced germination of Bacillus subtilis spores at low and high pres- and genome maintenance in Bacillus subtilis. Microbiol. Mol. Biol. Rev. sures. Appl. Environ. Microbiol. 64:3220–3224. 76:530–564. http://dx.doi.org/10.1128/MMBR.05020-11. 47. Setlow B, Atluri S, Kitchel R, Koziol-Dube K, Setlow P. 2006. Role of 30. Schaeffer P, Millet J, Aubert JP. 1965. Catabolic repression of bacterial dipicolinic acid in resistance and stability of spores of Bacillus subtilis with sporulation. Proc. Natl. Acad. Sci. U. S. A. 45:704–711. or without DNA-protective alpha/beta-type small acid-soluble proteins. J. 31. Nicholson WL, Setlow P. 1990. Sporulation, germination, and out- Bacteriol. 188:3740–3747. http://dx.doi.org/10.1128/JB.00212-06.

January 2014 Volume 80 Number 1 aem.asm.org 109

57 Chapter D

Improvement of biological indicators by uniformly distributing Bacillus subtilis monolayers to evaluate enhanced spore decontamination technologies.

Marina Raguse, Marcel Fiebrandt, Katharina Stapelmann, Kazimierz Madela, Michael Laue, Jan-Wilm Lackmann, Joanne E. Thwaite, Peter Setlow, Peter Awakowicz, Ralf Moeller

58 crossmark

Improvement of Biological Indicators by Uniformly Distributing Bacillus subtilis Spores in Monolayers To Evaluate Enhanced Spore Decontamination Technologies

Marina Raguse,a Marcel Fiebrandt,b Katharina Stapelmann,c Kazimierz Madela,d Michael Laue,d Jan-Wilm Lackmann,b,c Joanne E. Thwaite,e Peter Setlow,f Peter Awakowicz,b Ralf Moellera German Aerospace Center (DLR e.V.), Institute of Aerospace Medicine, Radiation Biology Department, Space Microbiology Research Group, Cologne, Germanya; Ruhr University Bochum, Institute of Electrical Engineering and Plasma Technology, Faculty of Electrical Engineering and Information Technology, Bochum, Germanyb; Ruhr University Bochum, Institute of Electrical Engineering and Plasma Technology, Biomedical Applications of Plasma Technology, Bochum, Germanyc; Robert Koch Institute, Advanced Light and Electron Microscopy, Berlin, Germanyd; Defence Science and Technology Laboratory, Chemical, Biological and Radiological Division, Salisbury, United Kingdome; University of Connecticut Health Center, Department of Molecular Biology and Biophysics, Farmington, Connecticut, USAf

Novel decontamination technologies, including cold low-pressure plasma and blue light (400 nm), are promising alternatives to conventional surface decontamination methods. However, the standardization of the assessment of such sterilization processes remains to be accomplished. Bacterial endospores of the genera Bacillus and Geobacillus are frequently used as biological indicators (BIs) of sterility. Ensuring standardized and reproducible BIs for reliable testing procedures is a significant problem in industrial settings. In this study, an electrically driven spray deposition device was developed, allowing fast, reproducible, and homogeneous preparation of Bacillus subtilis 168 spore monolayers on glass surfaces. A detailed description of the structural design as well as the operating principle of the spraying device is given. The reproducible formation of spore monolayers of up to ؋ 107 spores per sample was verified by scanning electron microscopy. Surface inactivation studies revealed that monolayered 5 spores were inactivated by UV-C (254 nm), low-pressure argon plasma (500 W, 10 Pa, 100 standard cubic cm per min), and blue light (400 nm) significantly faster than multilayered spores were. We have thus succeeded in the uniform preparation of reproducible, highly concentrated spore monolayers with the potential to generate BIs for a variety of nonpenetrating surface decontamination techniques.

icrobial contamination on surfaces is a recurring problem shielded spores can exhibit increased resistance to some treat- Mwithin health, pharmaceutical, and food industry sectors (1, ments (15, 17). Therefore, adequate control procedures when 2, 3). Thus, decontamination is a crucial step to ensure the sterility manufacturing BIs are essential, and key factors that affect the BI of food processing equipment, minimize spread of pathogens, and manufacturing are the standardized BI design and a reproducible prevent the transmission of nosocomial infections (4). Common spore deposition technique (10). decontamination and disinfection procedures that are widely used Emerging methods for improved surface decontamination of for microbial inactivation include high temperatures, chemicals, food packaging, medical instruments, and military equipment (1, or ionizing radiation (reviewed in reference 5). In order to ensure 2, 18) include cold low-pressure plasma and blue light. Photoin- the efﬁciency and to validate the continuous functionality of a activation of vegetative cells and spores using visible light, specif- disinfection or sterilization procedure, biological testing stan- ically short-wave blue light, has become an area of increasing re- dards are required. Bacterial spores are frequently used as a bio- search interest (19). Advantages of this particular light-based logical indicator (BI) of sterility, primarily because bacterial inactivation, in contrast to inactivation by UV-C or ionizing radi- spores exhibit elevated resistance to chemical and physical meth- ation, include improved safety due to lower photon energy and ods of sterilization (6–11). Hence, a process that achieves full reduced photodegradation of materials (20). Photodynamic inac- spore inactivation ensures complete elimination of other contam- tivation is an oxygen-dependent mechanism based on the photo- inating microorganisms. Variations in the performance of a BI have been reported repeatedly (12, 13). Besides variations in the intrinsic resistance Received 8 December 2015 Accepted 14 January 2016 properties of the microorganisms conferred, for instance, by vari- Accepted manuscript posted online 22 January 2016 ations in genetic traits or alteration of sporulation conditions (14), Citation Raguse M, Fiebrandt M, Stapelmann K, Madela K, Laue M, Lackmann J-W, extrinsic factors also may affect the performance of BIs and, sub- Thwaite JE, Setlow P, Awakowicz P, Moeller R. 2016. Improvement of biological Bacillus subtilis sequently, the accurate determination of spore resistance and in- indicators by uniformly distributing spores in monolayers to evaluate enhanced spore decontamination technologies. Appl Environ Microbiol activation. For example, the sterilization results may be altered by 82:2031–2038. doi:10.1128/AEM.03934-15. poor choices of the carrier material for spore deposition (13, 15) Editor: D. W. Schaffner, Rutgers, The State University of New Jersey and, in particular, the BI manufacturing procedure (16). The Address correspondence to Ralf Moeller, [email protected]. method by which spores are mounted on carriers also is extremely Supplemental material for this article may be found at http://dx.doi.org/10.1128 important, as inconsistencies in the procedure affect the homoge- /AEM.03934-15. neity of spore deposition. In particular, the presence of spore clus- Copyright © 2016, American Society for Microbiology. All Rights Reserved. ters and/or layers is likely to inﬂuence the sterilization results, as

April 2016 Volume 82 Number 7 Applied and Environmental Microbiology aem.asm.org 2031

59 Raguse et al.

FIG 1 (A) Sketch of the device used for the aerosol spray deposition of B. subtilis 168 spores. The spraying device consists of the following components: 1, N2 supply; 2, power-driven 3/2 magnetic valve; 3, two-substance nozzle with solenoid valve and power connector; 4, microprocessor-based quartz counter. (B) Computer-aided-design (CAD) drawing of a two-substance nozzle (provided by Schlick, Untersiemau, Germany) with the following components: 1, inletof liquid sample; 2, inlet of pressurized N2; 3, variable nozzle air cap for controlling the spray radius. (C) Circuit sketch of the electrical wiring connecting the microprocessor-based quartz counter with the magnetic valve and two-component nozzle for the synchronized opening of the N2 inlet and liquid inlet, respectively. The power button was added between port 1 and port 2. A voltage of 230 V at 50 Hz was applied to ports 9 and 10. Ports 8 and 10 are interconnected. excitation of microbial porphyrin molecules which act as endog- methods, namely, those employing X rays, UV-C radiation at 254 enous photosensitizers. Excited porphyrin molecules can react nm, blue light, and low-pressure argon plasma, and compared to with oxygen and transfer energy, resulting in the generation of a the treatment of multilayered spore samples. variety of cytotoxic oxygen species, predominately singlet oxygen and hydroxyl radicals (21). An accumulation of induced oxidative MATERIALS AND METHODS damage ultimately leads to cell death. Spore production and puriﬁcation. Bacillus subtilis trpC2 strain 168 The use of low-pressure plasma discharges is a state-of-the-art (DSM 402) was obtained from the German Collection of Microorganisms procedure that enables the sterilization of innovative heat-sensi- and Cell Cultures (DSMZ, Braunschweig, Germany) and routinely culti- tive materials, equipment prone to corrosion, and complex elec- vated on Luria-Bertani (LB) agar plates. Spores were prepared by cultiva- tronic instruments. A combination of highly reactive species (ions, tion in double-strength liquid Schaeffer sporulation medium (27) with vigorous aeration at 37°C for 72 h. Harvested spores were puriﬁed by free electrons, radicals, neutral/excited atoms, or molecules) repeated washing steps using sterile water followed by lysozyme and with UV and vacuum UV (VUV) photons at different wavelengths DNase I treatment for the removal of remaining vegetative cells. After a leads to rapid microbial inactivation by interacting with essential heat inactivation step at 80°C for 10 min to inactivate any remaining cell components (22, 23). UV and VUV photons in particular have vegetative cells or germinated spores, the spores were repeatedly washed been shown to have a major role in the reduction of spore survival with sterile water and checked for purity by phase-contrast microscopy. by plasma (24, 25). However, research to standardize the cold Spore preparations were free (Ͼ99%) of vegetative cells, germinated plasma sterilization process in order to eliminate ambiguous ster- spores, and cell debris. Spores were stored at 4°C until tested. ilization outcomes still is needed (26). Machine setup of the electrically operated spray deposition device. In this report, an electrically operated spray deposition device For homogenous aerosol deposition of B. subtilis spores, an electrically is described that allows for the reproducible and homogeneous operated aerosol deposition unit was developed consisting of a mounting station and three main electric components (Fig. 1A). A high-precision deposition of Bacillus subtilis spore monolayers onto glass sur- two-substance nozzle with a solenoid valve (230 V, 50 Hz; model 970-8; faces. A detailed description of the structural design of the spray Schlick, Untersiemau, Germany) (Fig. 1B) equipped with a standard air deposition device is provided, including the various components cap allows for uniform dispersion of B. subtilis spores on sample carriers. as well as the operating principles. The performance of prepared The nozzle comprises two inlets, one for the pressurized carrier gas and monolayered spore samples was tested by four decontamination one for the liquid sample. Oil-free pressurized N2 functions as a propel-

2032 aem.asm.org Applied and Environmental Microbiology April 2016 Volume 82 Number 7

60 Bacillus Spore Monolayers for Sterilization Assurance

lant gas, preventing unwanted impurities and oxidative reactions. The gas were accelerated with a voltage of 10 keV, and images were recorded at supply is regulated by a pressure gauge and power-driven 3/2 magnetic magnifications of 300 and 3,000. valve (DO35, 230 A/C; Bosch-Rexroth, Munich, Germany) between the Live-cell imaging. Spores (107) were applied to a 35-mm-diameter gas supply and the nozzle air inlet. Liquid throughput is regulated by gas imaging dish with an ibidi standard bottom (ibidi GmbH, Germany) via pressure, cap position, and synchronized nozzle opening time. The simul- spray deposition as described above and air dried in ambient air. Spores taneous opening of the nozzle and the magnetic valve for the N2 supply is were covered with a thin (1-mm) layer of 2% LB-agarose (VWR, Ger- determined by a 220-V A/C microprocessor-based quartz counter (550- many) and imaged at 37°C in a temperature-controlled incubation system 2-C timer; Gefran, Seligenstadt, Germany). A model circuit diagram is by phase-contrast microscopy (TE2000-E Eclipse, 100ϫ Ph3; LM Nikon). displayed in Fig. 1C. The electrical opening of the magnetic valve control- Images were captured with intervals of 5 s for a total of 4 h. To check for an ling N2 flow to the nozzle and the electrical opening of the nozzle liquid even distribution of the spores sprayed on the plastic surface of ibidi inlet are synchronized. The N2 flow allows dispersion of the injected liquid ␮-dishes, samples were sputter-coated with 2 nm of gold-palladium and sample supply through the nozzle outlet. A faceplate 3-digit display allows analyzed by SEM (Leo 1530; Carl Zeiss Microscopy, Germany). Images software configuration of instrument type, output function, operation were recorded with the in-lens secondary electron detector at 3 kV and a mode, and nozzle opening time. In cyclical double operation mode, tim- working distance of about 4 mm. ing for opening and closing both valves is adjustable. Time intervals be- Assay of spore resistance to germicidal 254-nm UV and ionizing tween cyclic operations can be selected and allow fast and serial processing radiation. Spray- and liquid-applied spores were subjected in triplicate to of sample preparation. The continuously variable air cap of the nozzle monochromatic UV-C radiation emitted by a mercury low-pressure lamp allows an adjustable spray radius. The nozzle head and the designated with a major emission line at 254 nm (NN 8/15; Heraeus, Germany). The sample carrier are enclosed in a particle deposition cabinet to prevent fluence (0.7J·mϪ2 ·sϪ1) was measured by a UV-X radiometer fitted with environmental aerosol dispersion. the appropriate calibrated probe at 254 nm (UVP, United Kingdom), and Preparation of aerosol-deposited spores. For spray deposition, B. the exposure time for the indicated UV doses was calculated. UV-C irra- subtilis spores were suspended at variable concentrations in sterile Milli- diation was carried out at room temperature as previously described in pore water (conductivity of 0.056 S/cm). One milliliter was transferred to reference 28. Spray- and liquid-applied samples were exposed in triplicate the filling chamber connected to the nozzle fluid inlet. Commercially to ionizing radiation (200 keV, 15 mA) generated by an X-ray tube available sterilized microscopic slides (VWR, Germany) served as the (RS225; Gulmay, United Kingdom [now X-Strahl, Surrey, United King- sample carrier, with each slide representing one experimental sample. The dom]) at room temperature as described previously in reference 29. clean sample carrier was placed inside the aerosol-tight dispersion cabinet The dosimeter UNIDOSwebline with the ionizing chamber TM30013 and positioned in alignment with the nozzle at a distance of 15 cm along (PTW, Freiburg, Germany) was used for calculating dose and dose rate. surface-engraved grid axes on the removable cabinet unit. The spraying The distance of the samples from the X-ray source was set at 30 cm to process was initiated. The sprayed spore suspension forms a thin film on provide a constant dose rate of 12.2 Gy/min. the microscopic slide that dries rapidly within seconds. The parameters Assay of spore resistance to low-pressure plasma. Low-pressure found to be ideal for aerosol deposition of B. subtilis spores include (i) N2 plasma treatment of spore samples was carried out at the Institute for flow with a pressure of 2.0 ϫ 105 Pa, (ii) a nozzle opening setting of 2 for Electrical Engineering and Plasma Technology (AEPT), Ruhr University a spray radius matching the sample carrier size, (iii) a software configu- Bochum, Bochum, Germany. A double inductively coupled low-pressure ration of the quartz counter to level 0, type 2 (cyclic timer), output func- plasma (DICP) source (see Fig. S1 in the supplemental material) (30, 31) tion 3 (synchronized relays), and logic for digital input 0 (active in clos- was used in this study. The stainless steel cylinder of the DICP vessel is ing), (iv) a nozzle opening time of 0.1 s, and (v) a distance from the nozzle enclosed by two quartz glass plates with enclosed copper coils at the top to the sample carrier of 15 cm. The loaded sample carrier was removed and bottom, which couple a maximum power of 5 kW at 13.56 MHz to the from the cabinet and left to air dry completely. The final load of spores on discharge. A matchbox splits the power equally to both coils. A roots a sample carrier after one spray volume was either 106,107,or5ϫ 107 pump achieves a pressure of 2 to 50 Pa with a gas flow of 100 sccm (stan- depending on the initial spore concentration and machine settings. To dard cubic centimeters per minute) argon. Additionally, if the system is evaluate whether repeated spray deposition on a sample carrier influences not operated, a turbo pump is used for evacuating the system below 5 ϫ spore distribution, 5 spray volumes with 5 ϫ 107 spores each were applied. 10Ϫ4 Pa for maintaining the cleanliness of the system. The plasma dis- For cleaning, the nozzle was rinsed with sterile distilled water, immersed charge is homogeneous over nearly the entire vessel (30). Several flanges in an ultrasonic bath for 15 min, and then autoclaved. For each experi- in the vessel allow different optical and electrical analytical devices to be mental sample, 3 replicates were prepared. coupled to the vessel for plasma diagnostics. Samples were placed in the Preparation of liquid-deposited spores. A common method for BI center of the discharge at the same level as the diagnostic devices and sample preparation is the deposition of B. subtilis spores suspended in exposed to low-pressure argon plasma discharges (total gas flow of 100 water by spot inoculation. To compare the effects of the sample prepara- sccm, pressure of 10 Pa, radio frequency power of 500 W). Under these tion method on spore sensitivity to various decontamination treatments, conditions, the total UV flux from 130 to 400 nm amounts to 0.74 J · mϪ2 · spores also were applied to carriers by liquid deposition. In this work, 50 sϪ1. In addition, argon line emission in the VUV spectra is at 104.8 nm ␮l of a suspension containing 5 ϫ 107 B. subtilis spores in sterile Millipore and 106.7 nm. For each of the performed treatments, three replicates of water was deposited on circular histological glass object slides (VWR, spray- and liquid-applied samples, respectively, were irradiated simulta- Germany) and dried overnight at room temperature. For each experimen- neously per dose. Nontreated samples served as a control and were han- tal sample 3 replicates were prepared. dled equally, excluding plasma treatment. The controls of plasma-treated SEM analysis. The distribution of spores applied to carriers as a spray samples were subjected to 90 s of vacuum (10 Pa) to account for any or in liquid was determined using scanning electron microscopy (SEM). vacuum-induced spore inactivation. Two independent samples each of liquid- or spray-applied spores were Assay of spore resistance to blue light radiation. High-intensity blue used for the analysis. To ensure conductance of spores on glass slides, light was provided by an LED Flood array (Henkel-Loctite, Hemel Hemp- samples were fixed on substrate holders and then coated with gold with stead, United Kingdom). This array utilizes 144 reflectorized LEDs, which the JEOL JFC-1200 fine coater. The chamber of the fine coater was evac- produce a homogeneous illuminated area of 10 cm by 10 cm. At a distance uated below 2 Pa, flushed with Argon up to 80 Pa, and pumped to 7 Pa of 15.5 cm from the target surface, the array produces a uniform light again to ensure a sufficient clean argon atmosphere before coating the irradiance of 600 J · mϪ2 ·sϪ1, measured using a PM100D radiant power samples for 40 s. After venting, the samples were placed in the SEM cham- meter (Thorlabs, Newton, NJ). The fluence rate was calculated accord- ber and analyzed by SEM (JSM 6510; JEOL, Eching, Germany). Electrons ingly. The emission spectrum of the LED array was determined using a

April 2016 Volume 82 Number 7 Applied and Environmental Microbiology aem.asm.org 2033

61 Raguse et al.

QEB0797 spectrophotometer (Ocean Optics, Dunedin, FL); the emission required in specific applications, then larger sample carriers, re- spectrum peaks at 400 nm, with a full-width half-maximum value of Ϯ8.5 peated sprays in close proximity, or subsequent sample pooling nm. Triplicate spray and liquid-inoculated samples were exposed to high- may be used to accomplish this with no increase in multilayered intensity blue light, while nontreated control samples were placed under spores. the lamp wrapped in aluminum foil to account for the heating effect Live-cell imaging. To evaluate whether B. subtilis spores re- during the treatment. main viable after the spraying procedure, spores were deposited Recovery and evaluation of spore survival. After treatment, spore ␮ samples on the carriers were covered with sterile 10% aqueous polyvinyl on the plastic surface of ibidi -dishes and covered with a layer of acetate solution (PVA) and air dried. The dried layer subsequently was LB-agarose, which induces germination. As found with spores de- removed aseptically, transferred to an Eppendorf tube, and dissolved in 1 posited on glass, SEM imaging of spores deposited by spray depo- ml of sterile water. This procedure leads to Ͼ95% recovery of spores and sition on the ibidi ␮-dishes indicated an even distribution of does not affect viability (32). Spore inactivation rates were determined by spores in monolayers with marginal cluster formation (see Fig. S3 a standard colony formation assay in which spores were serially diluted in in the supplemental material). Importantly, sprayed monolayered sterile distilled water and plated on nutrient broth agar plates. After over- spores germinated uniformly and proceeded to outgrowth and night incubation at 37°C, CFU numbers were determined as described subsequent vegetative growth (see Movie S1). previously (32, 33). Spore inactivation by ionizing radiation (X rays), UV-C ra- Numerical and statistical analysis. Spore survival was determined diation, low-pressure argon plasma, and blue light radiation. from the quotient N/N , where N is the average CFU of treated samples 0 Given the differences seen between spore deposition on carriers by and N0 is the average CFU of untreated controls. Spore inactivation is expressed as the lethal dose at which 90% of the treated spore population liquid and spray application, it was of obvious interest to compare the resistance of spores that had been applied by these two proce- is inactivated (LD90) and was plotted as a function of fluence (UV-C and blue light, in joules per square meter), dose (X-ray irradiation, in grays), dures. Mono- and multilayered spores deposited on sterile glass or time (argon plasma treatment, in seconds). All data are expressed as slides by spray and liquid deposition, respectively, were exposed to averages Ϯ standard deviations (n ϭ 3). The slope of semilogarithmic X rays, monochromatic UV-C irradiation at 254 nm, low-pressure survival curves (IC) was determined for each treatment. Significance dif- argon plasma discharge, and blue light at 400 nm. Spore survival ferences in the survival rates were calculated by single-factor analysis of was assessed at various doses (X rays), fluences (UV-C and blue variance (ANOVA). Differences with P values of Ͻ0.05 were considered light), or time points (argon plasma) (Fig. 3), and LD90 values statistically significant (33, 34). were calculated from plotted inactivation curves (Table 1). Liquid- and spray-deposited spores treated with X rays showed RESULTS comparable dose-dependent decreases in survival (Fig. 3A). No Evaluation of the spatial distribution of spores on surfaces. An significant differences in survival rates were found between spore obvious question that arises when spores are deposited on a sur- populations prepared by spray deposition and spore populations face to prepare a BI is what is the exact distribution of spores on prepared by liquid deposition (the P value was 0.17). In contrast to the surface. Are the spores in a dispersed monolayer or in clumps, the results with X rays, spray-deposited spore monolayers were or are they piled on top of one another in multilayered structures? inactivated ϳ4-fold faster by monochromatic UV-C radiation The latter arrangement is extremely important to identify, as (P Ͻ 0.05) than liquid-deposited spores (Fig. 3B). Similar findings spores in lower layers of a multilayered arrangement likely would were obtained for these spores deposited by these two procedures be shielded from damaging effects of agents, such as photons of and exposed to low-pressure argon plasma. Here, monolayered various wavelengths of light. To address this issue, SEM imaging spray-deposited spores were killed ϳ8-fold faster (P Ͻ 0.01) than was performed to determine the deposition patterns given by multilayered spores deposited in liquid (Fig. 3C). Control samples spray and liquid application methods. SEM imaging of samples did not reveal vacuum-induced spore inactivation. Likewise, de- applied by liquid deposition of 5 ϫ 107 spores revealed an in- posited monolayers of spores were inactivated significantly faster creased abundance of spores at the rim of the deposited liquid by visible short-wave light in the blue wavelength range (P Ͻ 0.05) droplet leading to significant numbers of overlapping spores (Fig. than multilayered spores (Fig. 3D). Treated samples exposed only 2A). In contrast, depositing various concentrations of spores by to the elevated temperature produced during blue light treatment spray application produced almost exclusively a spore monolayer showed no significant decrease in survival (data not shown). on a 25- by 75-mm area of a glass slide (Fig. 2B to D). Spray Clearly, there were significant differences in rates of inactiva- deposition of 106 spores reproducibly showed an even distribution of spores deposited by spray and liquid with 3 of the 4 inac- tion of spores across the sample carrier (Fig. 2B). Spray deposition tivating agents tested (Fig. 3B to D). These results show that the of 107 spores also exhibited an even dispersal with some small method of spore deposition and the resulting spore distribution spore clusters, but spores still do not appear stacked (Fig. 2C). pattern have large effects on spore survivability in an experimental SEM imaging of up to 5 ϫ 107 spores revealed a spore monolayer setup for evaluating UV-C-, plasma-, and blue light-mediated in- with increased cluster formation (Fig. 2D). In addition, a closer activation. In addition, there were quite notable differences in the

look at the latter cluster formations revealed that even at this high standard deviations of the calculated inactivation rates (LD90 and sample load the spores did not overlap but accumulated only in a IC) of spray- and liquid-deposited spores after UV-C and plasma monolayer. This monolayer of spray-deposited spores was in con- treatment (Table 1), indicating that the preparation of samples by trast to the multilayered pattern of liquid-deposited spores. spray deposition led to noticeably more consistent and reliable In contrast to the results noted above with spores deposited results with lower variance. with a single spraying, with repeated spraying of large amounts with Ն108 spores added per sample carrier, the spores did start to DISCUSSION overlap due to the increased density (see Fig. S2 in the supplemen- BIs are routinely employed in the pharmaceutical, food, and med- tal material). However, if higher monolayered sample loads are ical industries to monitor the efﬁciency of a variety of sterilization

2034 aem.asm.org Applied and Environmental Microbiology April 2016 Volume 82 Number 7

62 Bacillus Spore Monolayers for Sterilization Assurance

FIG 2 Scanning electron microscopy (SEM) imaging of B. subtilis 168 spores deposited on glass slides at 300ϫ (1) and 3,000ϫ (2) magnification. (A) Spores (5 ϫ 107) inoculated by liquid spot deposition form multilayered clusters. Spores inoculated by spray deposition with 106 (B), 107 (C), and 5 ϫ 107 (D) spores on sample carriers form homogeneous monolayers. Scale bars represent 50 ␮m (1) or 5 ␮m (2). processes. A major problem in decontamination studies assessing edges of the drop, in a ring-like fashion, sometimes referred to as spore survival is the lack of reproducible and standardized exper- the coffee ring effect (37). This accumulation of spore multilayers imental parameters for BI production and performance (15, 35, shields the spores in lower layers against nonpenetrating surface 36). Commonly, spore survival is assessed in the dry state, and dry disinfectant treatments by the upper spore layers. Other factors spore samples frequently are prepared by liquid spot inoculation. hampering the reliability of surface inactivation studies are fre- Spore aggregation results from fluid evaporating from a solid sur- quently used agar and filter surfaces containing microscopic irreg- face leading to a stacked deposition of the spores, especially at the ularities, such as pits and fissures, which may shield deposited

April 2016 Volume 82 Number 7 Applied and Environmental Microbiology aem.asm.org 2035

63 Raguse et al.

FIG 3 Survival curves of 5 ϫ 107 B. subtilis spores inoculated by spray (X, open circles) or liquid (●, closed circles) deposition after exposure to X rays (200 mA, 15 keV) (A), 254-nm UV-C radiation (B), low-pressure argon plasma (500 W, 10 Pa, 100 sccm Ar) (C), and 400-nm blue light (D). spores from the incident treatment and can significantly affect the radiation at 254 nm (P Ͻ 0.05), low-pressure argon plasma (P Ͻ measured spore viability (15). This leads to an apparent reduction 0.01), and blue light at 400 nm (P Ͻ 0.05) than multilayered in the efficiency of the treatment and an artificial overestimation spores. As UV-C is a common disinfecting agent with limited of spore resistance. To counteract these issues, we have developed penetration depth (38), the reliable and reproducible assessment an electrically operated device for reproducible spray deposition of the decontamination efficacy is dependent on the use of mono- of B. subtilis spores that ensures a uniform sample preparation layered samples (15, 17, 36). Indeed, spore clumping and multi- process and produces reproducible, homogeneous samples of layered spore aggregates significantly reduce penetration of UV highly concentrated spore monolayers. radiation at 254 nm to underlying spores (15). Thus, with a bac- When subjecting mono- and multilayered B. subtilis spore terial spore of 1 ␮m in diameter that shields an underlying spore, samples to different surface decontamination methods, striking only 61% of the incident beam is transmitted. Assuming two differences in spore inactivation efficiency were observed, as spores shield a third, only 37% of the incident beam would reach monolayered spores were inactivated significantly faster by UV-C the underlying spore (39). Hence, even minor accumulations of

TABLE 1 Inactivation rates of mono- and multilayered B. subtilis spores after treatment with surface decontamination techniques a a LD90 IC Treatment Monolayer Multilayer Monolayer Multilayer X rays 140.6 Ϯ 18.4 Gy 116.2 Ϯ 10.7 Gy Ϫ1.7 ϫ 10Ϫ2 Ϯ 1.8 ϫ 10Ϫ3 Ϫ1.4 ϫ 10Ϫ2 Ϯ 8.1 ϫ 10Ϫ4 GyϪ1 GyϪ1 UV-C 116.54 Ϯ 4.66J·mϪ2* 695.4 Ϯ 134.20J·mϪ2 Ϫ1.6 ϫ 10Ϫ2 Ϯ 5.2 ϫ 10Ϫ4 Ϫ3.4 ϫ 10Ϫ3 Ϯ 4.5 ϫ 10Ϫ4 J·mϪ2*** J·mϪ2 Blue light 6.1 ϫ 106 Ϯ 1.7 ϫ 105 J·mϪ2* 6.7 ϫ 106 Ϯ 1.1 ϫ 105 J·mϪ2 Ϫ1.2 ϫ 10Ϫ6 Ϯ 1.4 ϫ 10Ϫ7 Ϫ1.04 ϫ 10Ϫ6 Ϯ 2.3 ϫ J·mϪ2 10Ϫ8 J·mϪ2 Argon plasma 7.4 Ϯ 0.6 s** 156.1 Ϯ 18.2 s Ϫ1.6 ϫ 10Ϫ1 Ϯ 2.8 ϫ 10Ϫ3 Ϫ1.5 ϫ 10Ϫ2 Ϯ 1.56 ϫ J·mϪ2*** 10Ϫ3 J·mϪ2 a Shown is a comparison of LD90 values and IC (i.e., slope of semilogarithmic survival curves) of mono- and multilayered B. subtilis 168 spores prepared by spray and liquid deposition, respectively, after treatment with various surface decontamination techniques. Standard deviations and signiﬁcance are given as determined by ANOVA (*, P Ͻ 0.05; **, P Ͻ 0.01; ***, P Ͻ 0.001).

2036 aem.asm.org Applied and Environmental Microbiology April 2016 Volume 82 Number 7

64 Bacillus Spore Monolayers for Sterilization Assurance spores in multilayers can dramatically affect the decontamination lar dynamics of spore germination and outgrowth with time-lapse by nonpenetrating agents. In contrast, mono- and multilayered microscopy. Thus, the spraying device proved suitable for repro- spore populations showed comparable sensitivities when exposed ducibly preparing live-cell monolayers, enabling the time-re- to ionizing radiation, as the penetration capability of X rays with solved investigation of highly dynamic events in single organisms. an energy of 200 keV is significantly higher (98.7% of incident As a consequence, the application of this new device may not be intensity is transmitted through 1 mm H2O[40]). Therefore, the limited to bacterial spores but also may include the reproducible greater penetrating power of the X rays makes shielding by one or and homogeneous distribution of vegetative cells and a broad more spore layers minimal. As UV and VUV are major factors in range of biomolecules and nanoparticles on surfaces for a variety spore inactivation mediated by low-pressure argon plasma, the of studies on single cells or particles. impact on spore viability of mono- and multilayered spore popu- ACKNOWLEDGMENTS lations is similar to that with UV-C radiation alone, and low- pressure argon plasma discharges emit photons mainly at wave- We especially thank Andrea Schroeder, Christoph Steger, Birgit Ritter, lengths of 104.8 and 106.7 nm (41). Additionally, impurities in the Karel Marsalek, Tobias Harzen, and Andre Parpart for their excellent technical support. We thank the Schlick company for kindly providing the chamber for plasma generation (N2,O2, and H2O from samples and residual gas after ventilation of the chamber for sample inser- CAD design. The results of this study will be included in the Ph.D. thesis of tion) radiate in the bactericidal range from 120 nm to 380 nm and Marina Raguse. This study was supported in part by grants from the German Aero- produce radicals in the form of atomic oxygen and nitrogen, nitric space Center (DLR-FuE-Projekt ISS-Nutzung in der Biodiagnostik, Pro- oxide, and hydroxyl radicals. In the field of cold plasma for gramm RF-FuW, Teilprogramm 475, to M.R. and R.M.). decontamination purposes, work is still needed to standardize the sterilization process and develop a suitable BI for steriliza- FUNDING INFORMATION tion assurance (26), which is an absolute requirement for plasma Deutsche Forschungsgemeinschaft (DFG) provided funding to Ralf sterilization devices to be adopted in industrial settings. Relative Moeller under grant number MO 2023/2-1. Deutsche Forschungsge- changes within the concentrations of the active species present in meinschaft (DFG) provided funding to Peter Awakowicz under grant a plasma discharge greatly depend on the gas composition, the number AW 7/3-1. device setup, and associated operation settings (such as pressure, REFERENCES power source, or matching conditions). Hence, a highly repro- 1. Abreu AC, Tavares RR, Borges A, Mergulhão F, Simões M. 2013. ducible and quality-controlled BI for the evaluation of plasma Current and emergent strategies for disinfection of hospital environ- sterilization efficiency is crucial for this process to be widely im- ments. J Antimicrob Chemother 68:2718–2732. http://dx.doi.org/10 plemented. .1093/jac/dkt281. The photodynamic inactivation mechanism of short-wave vis- 2. Gómez-López VM, Ragaert P, Debevere J, Devlieghere F. 2008. Decon- tamination methods to prolong the shelf-life of minimally processed veg- ible light in the blue wavelength range is thought not to be caused etables, state-of-the-art. Crit Rev Food Sci Nutr 48:487–495. http://dx.doi by DNA damage but rather by oxidative lesions due to excited .org/10.1080/10408390701638878. endogenous photosensitizers (19–21). However, the vast majority 3. Horneck G, Klaus DM, Mancinelli RL. 2010. Space microbiology. Mi- of this work has been performed on vegetative bacteria, and the crobiol Mol Biol Rev 74:121–156. http://dx.doi.org/10.1128/MMBR detailed mechanism of spore killing remains to be investigated. .00016-09. 4. Williams GJ, Denyer SP, Hosein IK, Hill DW, Maillard JY. 2009. Based on our results, a defined BI with homogeneous single-spore Limitations of the efficacy of surface disinfection in the healthcare setting. layers is required for the accurate determination of spore resis- Infect Control Hosp Epidemiol 30:570–573. http://dx.doi.org/10.1086 tance and inactivation by blue light at 400 nm. /597382. In recent years, various methods have been developed in order 5. Rutala WA, Weber DJ. 2013. Disinfection and sterilization: an overview. Am J Infect Control 41:S2–S5. http://dx.doi.org/10.1016/j.ajic.2012.11 to generate reproducible spore monolayers (42–44). However, the .005. lack of detail concerning the individual instruments installed in 6. Nicholson W, Munakata N, Horneck G, Melosh HJ, Setlow P. 2000. the particular setup or the precise operating principle (42, 43), as Resistance of Bacillus endospores to extreme terrestrial and extraterres- well as elaborate and costly technology (44), makes it difficult to trial environments. Microbiol Mol Biol Rev 64:548–572. http://dx.doi.org recreate the reported spraying devices for sample preparation. In /10.1128/MMBR.64.3.548-572.2000. 7. Henriques AO, Moran CP, Jr. 2007. Structure, assembly, and function of this study, we present a method for easy sample preparation by the spore surface layers. Annu Rev Microbiol 61:555–588. http://dx.doi spray deposition, which was successfully employed for the pro- .org/10.1146/annurev.micro.61.080706.093224. duction of homogeneous B. subtilis spore monolayers. The instru- 8. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing by ment setup is inexpensive and its operation is simple and requires radiation, heat and chemicals. J Appl Microbiol 101:514–525. http://dx .doi.org/10.1111/j.1365-2672.2005.02736.x. minimal effort, but at the same time it offers defined operating 9. Penna TCV, Ishii M, Machoshvili IA, Marques M. 2002. The effect of conditions. The automated but tunable procedure enables the op- bioindicator preparation and storage on thermal resistance of Bacillus erator to adapt the spraying process to the actual sample condition stearothermophilus spores. Appl Biochem Biotechnol 98:525–538. http: or carrier size, for example, by increasing or decreasing the spray- //dx.doi.org/10.1385/ABAB:98-100:1-9:525. ing radius, deposition time, or pressure. Compared to common 10. Humphreys PN. 2011. Testing standards for sporicides. J Hosp Infect 77:193–198. http://dx.doi.org/10.1016/j.jhin.2010.08.011. sample preparation methods, such as spot deposition, this new 11. Haberer K, van Doorne H. 2011. Biological indicators, tools to verify the instrument offers a more reliable assessment of sterilization effi- effect of sterilization processes—position paper prepared on behalf of ciency with extensive application to diverse traditional and inno- group 1 (biological methods and statistical analysis). Pharmeur Bio Sci vative decontamination methods, with particular focus on non- Notes 2:25–39. 12. Reich RR, Morien LL. 1982. Influence of environmental storage relative penetrating surface agents. humidity on biological indicator resistance, viability, and moisture con- This study also has demonstrated the application of monolay- tent. Appl Environ Microbiol 43:609–614. ered spores deposited by spray application for studying the cellu- 13. Sigwarth V, Stärk A. 2003. Effect of carrier materials on the resistance of

April 2016 Volume 82 Number 7 Applied and Environmental Microbiology aem.asm.org 2037

65 Raguse et al.

spores of Bacillus stearothermophilus to gaseous hydrogen peroxide. PDA J AJ, Okayasu R, Nicholson WL. 2008. Roles of the major, small, acid- Pharm Sci Technol 57:3–11. soluble spore proteins and spore-specific and universal DNA repair mech- 14. Nguyen TMH, Durand A, Loison P, Perrier-Cornet JM. 2011. Effect of anisms in resistance of Bacillus subtilis spores to ionizing radiation from X sporulation conditions on the resistance of Bacillus subtilis spores to heat rays and high-energy charged-particle bombardment. J Bacteriol 190: and high pressure. Appl Microbiol Biotechnol 90:1409–1417. http://dx 1134–1140. http://dx.doi.org/10.1128/JB.01644-07. .doi.org/10.1007/s00253-011-3183-9. 30. Halfmann H, Bibinov N, Wunderlich J, Awakowicz P. 2007. A double 15. Coohill TP, Sagripanti JL. 2008. Overview of inactivation by 245 nm inductively coupled plasma for sterilization of medical devices. J Phys D ultraviolet radiation of bacteria with particular relevance to biodefense. Appl Phys 40:4145–4154. http://dx.doi.org/10.1088/0022-3727/40/14 Photochem Photobiol 84:1084–1090. http://dx.doi.org/10.1111/j.1751 /008. -1097.2008.00387.x. 31. Messerer P, Boenigk B, Keil G, Scheubert P, Awakowicz P. 2003. Plasma 16. Shintani H, Akers JE. 2000. On the cause of performance variation of diagnostics in a double inductively coupled source (DICP) for plasma biological indicators used for sterility assurance. PDA J Pharm Sci Technol sterilization. Surf Coat Technol 174-175:570–573. http://dx.doi.org/10 54:332–342. .1016/S0257-8972(03)00630-3. 17. Shintani H. 2014. Important points to attain reproducible sterility 32. Horneck G, Rettberg P, Reitz G, Wehner J, Eschweiler U, Strauch K, assurance. Biochem Physiol 3:135. http://dx.doi.org/10.4172/2168 Panitz C, Starke V, Baumstark-Khan C. 2001. Protection of bacterial -9652.1000135. spores in space, a contribution to the discussion on Panspermia. Orig Life 18. Doona JC, Feeherry FE, Kustin K, Olinger GO, Setlow P, Malkin AJ, Evol Biosph 31:527–547. http://dx.doi.org/10.1023/A:1012746130771. Leighton T. 2015. Fighting Ebola with novel spore decontamination tech- 33. Moeller R, Reitz G, Berger T, Okayasu R, Nicholson WL, Horneck G. nologies for the military. Front Microbiol 6:663. http://dx.doi.org/10.3389 2010. Astrobiological aspects of the mutagenesis of cosmic radiation on /fmicb.2015.00663. bacterial spores. Astrobiology 10:509–521. http://dx.doi.org/10.1089/ast 19. Maclean M, Murdoch LE, MacGregor SJ, Anderson JG. 2013. Sporicidal .2009.0429. effects of high-intensity 405 nm visible light on endospore-forming bac- 34. Moeller R, Setlow P, Reitz G, Nicholson WL. 2009. Roles of small, teria. Photochem Photobiol 89:120–126. http://dx.doi.org/10.1111/j.1751 acid-soluble spore proteins and core water content in survival of Bacillus -1097.2012.01202.x. subtilis spores exposed to environmental solar UV radiation. Appl Environ 20. Maclean M, MacGregor SJ, Anderson JG, Woosley G. 2009. Inactivation Microbiol 75:5202–5208. http://dx.doi.org/10.1128/AEM.00789-09. of bacterial pathogens following exposure to light from a 405-nanometer 35. Sandle T. 17 March 2014. Variations in the resistance of biological indi- light-emitting diode array. Appl Environ Microbiol 75:1932–1937. http: cators used to assess sterilization. J Validation Technol http://www //dx.doi.org/10.1128/AEM.01892-08. .ivtnetwork.com/article/variations-resistance-biological-indicators 21. Hamblin MR, Viveiros J, Yang C, Ahmadi A, Ganz RA, Tolkoff MJ. -used-assess-sterilization. 2005. Helicobacter pylori accumulates photoactive porphyrins and is killed 36. Nicholson WL, Galeano B. 2003. UV resistance of Bacillus anthracis by visible light. Antimicrob Agents Chemother 49:2822–2827. http://dx spores revisited: validation of Bacillus subtilis spores as UV surrogates for .doi.org/10.1128/AAC.49.7.2822-2827.2005. spores of B. anthracis Sterne. Appl Environ Microbiol 69:1327–1330. http: 22. Moisan M, Barbeau J, Moreau S, Pelletier J, Tabrizian M, Yahia L. 2001. //dx.doi.org/10.1128/AEM.69.2.1327-1330.2003. Low temperature sterilization using gas plasmas: a review of the experi- 37. Yunker PJ, Still T, Lohr MA, Yodh AG. 2011. Suppression of the coffee- ments and an analysis of the inactivation mechanisms. Int J Pharm 226: ring effect by shape-dependent capillary interactions. Nature 476:308– 1–21. http://dx.doi.org/10.1016/S0378-5173(01)00752-9. 311. http://dx.doi.org/10.1038/nature10344. 23. Lerouge S, Wertheimer M, Yahia L. 2001. Plasma sterilization: a review 38. Bolton JR. 2000. Terms and definitions in ultraviolet disinfection, p 25– of parameters, mechanisms, and limitations. Plasmas Polym 6:175–188. 40. In Proceedings of Disinfection 2000: disinfection of wastes in the new http://dx.doi.org/10.1023/A:1013196629791. millennium, 15–18 March 2000, New Orleans, LA. Water Environment 24. Halfmann H, Denis B, Bibinov N, Wunderlich J, Awakowicz P. 2007. Federation, Alexandria, VA. Identification of the most efficient VUV/UV radiation for plasma based 39. Coohill TP. 1986. Virus-cell interactions as probes for vacuum ultraviolet inactivation of Bacillus atrophaeus spores. J Phys D Appl Phys 40:5907. radiation damage and repair. Photochem Photobiol 44:359–363. http: http://dx.doi.org/10.1088/0022-3727/40/19/019. //dx.doi.org/10.1111/j.1751-1097.1986.tb04676.x. 25. von Keudell A, Awakowicz P, Benedikt J, Raballand V, Yanguas-Gil A, 40. Hubbell JH, Seltzer SM. 1996. Tables of X-ray mass attenuation coeffi- Opretzka J, Flötgen C, Reuter R, Byelykh L, Halfmann H, Stapelmann cients and mass energy-absorption coefficients from 1 keV to 20 MeV for K, Denis B, Wunderlich J, Muranyi P, Rossi F, Kylián O, Hasiwa N, elements Z ϭ 1 to 92 and 48 additional substances of dosimetric interest. Ruiz A, Rauscher H, Sirghi L, Comoy E, Dehen C, Challier L, Deslys JP. NIST, Gaithersburg, MD. 2010. Inactivation of bacteria and biomolecules by low-pressure plasma 41. Mertmann P, Bibinov N, Halfmann H, Awakowciz P. 2009. Determi- discharges. Plasma Process Polym 7:327–352. http://dx.doi.org/10.1002 nation of argon resonance line emission in an ICP hitting a biological /ppap.200900121. sample. Plasma Sources Sci Technol 7:665–675. 26. Shintani H. 2015. Current mistaken interpretation of microbiological 42. Lee SD, Ryan SP, Synder EG. 2011. Development of an aerosol surface data on gas plasma sterilization. Pharm Regul Aff 4:138. http://dx.doi.org inoculation method for Bacillus spores. Appl Environ Microbiol 77:1638– /10.4172/2167-7689.1000138. 1645. http://dx.doi.org/10.1128/AEM.02237-10. 27. Schaeffer P, Millet J, Aubert JP. 1965. Catabolic repression of bacterial 43. Levy C, Bornard I, Carlin F. 2011. Deposition of Bacillus subtilis spores sporulation. Proc Natl Acad SciUSA54:704–711. http://dx.doi.org/10 using an airbrush-spray or spots to study surface decontamination by .1073/pnas.54.3.704. pulsed light. J Microbiol Methods 84:223–227. http://dx.doi.org/10.1016 28. Moeller R, Douki T, Cadet J, Stackebrandt E, Nicholson WL, Rettberg /j.mimet.2010.11.021. P, Reitz G, Horneck G. 2007. UV-radiation-induced formation of DNA 44. Edmonds JM, Collett P, Valdes ER, Skowronski EW, Pellar GJ, bipyrimidine photoproducts in Bacillus subtilis endospores and their re- Emanuel PA. 2009. Surface sampling of spores in dry-deposition aero- pair during germination. Int Microbiol 10:39–46. sols. Appl Environ Microbiol 75:39–44. http://dx.doi.org/10.1128/AEM 29. Moeller R, Setlow P, Horneck G, Berger T, Reitz G, Rettberg P, Doherty .01563-08.

2038 aem.asm.org Applied and Environmental Microbiology April 2016 Volume 82 Number 7

66 Chapter E

Understanding of the importance of the spore coat structure and pigmentation in the Bacillus subtilis spore resistance to low pressure plasma sterilization.

Marina Raguse, Marcel Fiebrandt, Benjamin Denis, Katharina Stapelmann, Patrick Eichenberger, Adam Driks, Peter Eaton, Peter Awakowicz, Ralf Moeller

In revision

67 Understanding of the importance of the spore coat structure and pigmentation in the Bacillus subtilis spore resistance to low- pressure plasma sterilization

Marina Raguse1, Marcel Fiebrandt2, Benjamin Denis2, Katharina Stapelmann2, Patrick Eichenberger3,

Adam Driks4, Peter Eaton5, Peter Awakowicz2, and Ralf Moeller1,*

1 German Aerospace Center (DLR e.V.), Institute of Aerospace Medicine, Radiation Biology Department,

Space Microbiology Research Group, Cologne (Köln), Germany,

2 Ruhr University Bochum (RUB), Institute for Electrical Engineering and Plasma Technology (AEPT),

Bochum, Germany,

3 Center for Genomics and Systems Biology, Department of Biology, New York University, New York,

New York, USA,

4 Stritch School of Medicine, Loyola University Chicago, Department of Microbiology and Immunology,

Maywood, Illinois, USA.

5 UCIBIO / Requimte, Department of Chemistry and Biochemistry, Faculty of Sciences of the University of Porto, Porto, Portugal

Running title: Coat layers in spore resistance to plasma sterilization.

*Corresponding author. Mailing address: German Aerospace Center (DLR e.V.), Institute of Aerospace

Medicine, Radiation Biology Department, Space Microbiology Research Group, Linder Höhe, D-51147

Cologne (Köln), Germany, Phone +49(2203) 601-3145, Fax +49(2203) 61790, E-mail: [email protected]

68 ABSTRACT

Low-pressure plasmas have been evaluated for their potential in biomedical and defense purposes. The sterilizing effect of plasma can be attributed to several active agents, including (V)UV radiation, charged particles, radical species, neutral and excited atoms and molecules, and the electric field. Spores of Bacillus subtilis were used as a bioindicator and a genetic model system to study the sporicidal effects of low-pressure plasma decontamination. Wild-type spores, spores lacking the major protective coat layers (inner, outer, and crust), pigmentation-deficient spores or spore impaired in encasement (a late step in coat assembly) were systematically tested for their resistance to low-pressure argon, hydrogen, and oxygen plasmas with and without admixtures. We demonstrate that low-pressure plasma discharges of argon and oxygen discharges cause significant physical damage to spore surface structures as visualized by atomic force microscopy. Spore resistance to low-pressure plasma was primarily dependent on the presence of the inner, and outer spore coat layers as well as spore encasement, with minor or less importance of the crust and spore pigmentation, whereas spore inactivation itself was strongly influenced by the gas composition and operational settings.

Keywords: Bacillus subtilis, spore resistance, decontamination, plasma sterilization, spore coat, crust, pigmentation, AFM.

69 1. Introduction The microbial contamination of surfaces is a major source of problems in numerous settings, including food and pharmaceutical industries, hospitals, and spacecraft hardware assembly [1-7]. Various decontamination methods are available and some of them are widely employed, including heat treatment, chemical disinfection with solutions or gases, filtration, and irradiation [reviewed in 8]. Most conventional methods introduce some degree of damage to the treated material or medium by elevated temperatures or aggressive chemicals, making these methods suboptimal in many instances [9]. These limitations have motivated the search for alternative methods [10, 11]. Electric discharges in the form of cold plasmas are a promising alternative technique, as it enables gentle but efficient surface decontamination of a wide variety of equipment, including heat-sensitive materials and complex electronic instruments. Cold plasmas operated at low-pressure have been successfully applied for the sterilization of medical equipment, packaging in the food industry and surface decontamination [12-15]. Plasma sterilization is characterized by the use of a gas or a gas mixture that is partially excited through introduction of an electric or electromagnetic field [16-18]. These non-equilibrium gas discharges contain (V)UV photons, as well as potentially reactive particles such as radicals, ions, and free electrons which are delivered to the exposed surface [18-21]. Gram-positive bacteria of the genus Bacillus are able to form dormant endospores (here: spores) to survive unfavorable conditions, such as nutrient depletion, and which are much more resistant than their vegetative cell counterparts to a variety of treatments and environmental stresses, including heat, UV, gamma irradiation, desiccation, mechanical disruption, and toxic chemicals, such as strong oxidizers or pH-changing agents [22, 25]. It is known that the resistance of spores to a wide range of stressors is determined by a variety of protective mechanisms [reviewed in 22, 23]. Their remarkable resistance has rendered them useful bioindicators for the validation of potential disinfecting and sterilizing agents [24- 26]. While multiple factors contribute to spore resistance, one striking feature is the multilayered, proteinaceous coat that provides protection against many stresses and toxic chemicals [22, 23, 27, 28]. The spore coat is assembled from components synthesized in the mother cell compartment of the sporulating cell, and constitutes the outermost layer of all spores of Bacillus and Clostridium species, except in those species that contain an additional outermost layer, the exosporium [29, 30]. Spore coat structure and assembly have been studied most thoroughly in the model spore-forming bacterium Bacillus subtilis, where about 70 spore coat proteins have been identified [27]. The protein fraction of the coat represents 50-80% of the total spore protein [31] and can be divided into two separate fractions, soluble and insoluble [reviewed in 32]. Most of these coat proteins do not have well-defined roles in spore properties. However, a few coat proteins have been shown to possess enzymatic activity and, importantly, several coat proteins are essential for coat morphogenesis [27, 33]. These so-called morphogenetic

70 proteins include the coat proteins CotX, CotY, CotZ, SafA, CotE, SpoIVA, SpoVM and SpoVID (Figure 1). The absence of any of these morphogenetic proteins causes severe defects in coat architecture, as these proteins are involved in recruiting different subsets of other proteins into the coat to form the individual coat layers [27, 34] and/or promote a specific stage in coat assembly referred to as spore encasement (the role of SpoVID) [34, 35]. Much recent work on the B. subtilis spore coat has focused on determining overall assembly, architecture and function in spore resistance and germination [27-29, 33-37]. The current model, as assessed by SEM and AFM, suggests a four-layer coat structure in B. subtilis. From outermost to innermost, the concentric layers consist of the crust, followed by the outer coat, inner coat, and the basement layer [27, 38]. Several of these individual layers may have sublayers, such as the inner coat, which is made up of multiple lamellae [27, 29, 30]. The spore coat is known to confer resistance to lysozyme and act as a sieve by interfering with the trajectory of disinfectant substances, whose targets of interest, such as the germination receptors, DNA or ribosomes, are located at the spore inner membrane or in the core [36, 39]. Being the first permeability barrier to environmental stressors makes the spore coat particularly important in the study of spore resistance towards novel decontamination techniques. Studying the plasma-mediated inactivation of B. subtilis spores and investigating crucial factors that contribute to spore resistance to atmospheric and low-pressure plasma sterilization have been of recent interest [15, 19, 40, 41]. However, the possible roles of the spore coat, particularly the inner and outer layers, thecrust, and the role of spore pigmentation, in spore resistance to low-pressure plasma decontamination have not been investigated in a systematic manner [41, 23]. Therefore, in this study, we used strains carrying mutations in spoVID, safA, cotE, cotA, cotX cotY, cot Z, cotVW or both safA and cotE to analyze the contributions of each spore coat layer, and CotA-dependent pigmentation, to the resistance of B. subtilis spores to low-pressure plasma sterilization. A direct assessment of individual coat proteins, layers, structures or substructures in general, or specific spore resistance features provides insights in the precise mechanism whereby the coat protects the spore against low-pressure plasma sterilization, and is critical basic knowledge to support needed improvement and optimization of plasma sterilization processes.

Figure 1 The assembly of the spore coat structures (basement membrane, inner coat, outer coat, crust) is directed by morphogenetic proteins (SpoIVA, SafA, CotE, and CotX CotYZ, respectively). The morphogenetic protein SpoVID is required for encasement of the spore. Spore pigmentation is facilitated by the protein CotA located in the outer coat layer. CotVW is required for crust formation and dependent on CotX CotYZ.

72 2. Materials and methods 2.1 Bacterial strains, sporulation and spore purification. All B. subtilis strains used in the present study are derived from the prototrophic laboratory (wild- type) strain PY79. They are listed in Table 1. B. subtilis spores were obtained by cultivation under vigorous aeration at 37°C for 7 days in double-strength liquid Schaeffer sporulation medium [43], and spores were purified and stored as described [44, 45]. Where appropriate, kanamycin (10 µg/ml), tetracycline (10 µg/ml), chloramphenicol (5 µg/ml), erythromycin (1 µg/ml), or neomycin (10 µg/ml) was added to the medium. Spore preparations consisted of a suspension of single spores with no detectable clumps, and were free (> 99 %) of growing cells, germinated spores and cell debris, as seen in the phase-contrast microscope [45].

2.2 Thin-section electron microscopic analysis. For thin-section transmission electron microscopy (TEM), spores were prepared by conventional heavy metal staining, or by fixation with Ruthenium red to visualize the crust, as described previously in [33].

2.3 Plasma Setup. The spore-loaded steel coupons were treated in a double inductively coupled plasma (DICP) reactor [20, 46]. The discharge is driven by two copper coils at the top and bottom of the DICP (see Figure 2). The top and bottom are made of quartz glass plates and the device walls of stainless steel, resulting in a volume of 25 liters. A matchbox splits the maximum power of 5 kW at 13.56 MHz equally to both coils. A roots pump (Edwards EH 500) with a rotary vane fore pump (Pfeiffer Duo 060 A) allows a low-pressure environment down to 5 Pa with flows up to 160 sccm (standard cubic centimeters per minute) of argon, hydrogen, nitrogen or oxygen. Additionally, a turbo pump (Pfeiffer TPH 510) is used to evacuate the chamber below 0.1 Pa ensuring a high system purity. The spore samples were placed axially and radially in the center of the discharge with thin glass sample holders influencing the plasma as less as possible.

2.4 Plasma Diagnostics. Plasma diagnostics were performed in the plane of the biological samples. UV doses from λ = 200 nm to λ = 380 nm were determined with an absolutely calibrated broadband echelle spectrometer (LLA Instruments ESA 3000) with a spectral resolution of Δλ = 0.02 nm at λ = 200 nm and Δλ = 0.06 at λ = 800 nm [47]. In the range from λ = 130 nm to λ = 200 nm a Jobin-Yvon AS50 monochromator equipped with a solar-blind photomultiplier (Hamamatsu PMT R1080) was used for intensity measurements. The grating of the monochromator is aluminum-coated with 1200 grooves per mm, has a

73 radius of curvature of λ = 500 mm and is blazed for λ = 210 nm. The spectrometer was relatively calibrated with the branching-ratio technique of N2(a-X) with a resolution of ∆λ = 0.35 nm [47] and fitted to the echelle spectra in the range from λ = 200 nm to λ = 250 nm for absolute calibration. The -4 monochromator was separated from the plasma with a MgF2 window and evacuated below 1x10 Pa. The echelle spectrometer measured through a quartz window. All spectroscopic measurements were in line-of- sight measurements through the entire vessel. Hence, all densities and (V)UV/UV dose are volume averaged values. Gas temperature and substrate temperature differ significantly in low-pressure applications due to reduced heat transfer. Therefore, substrate temperature was measured with temperature strips (Carl Roth mini- temperature indicators) placed directly on the substrates. Data on UV fluences and substrate temperatures are shown in Table 2.

Figure 2 (a) Sketch and (b) cut-away view of the double inductively coupled plasma (DICP) setup used for sterilization experiments, testing spores of Bacillus subtilis as biological indicators for sterilization efficiency. The thin copper coils at the top and bottom are divided by quartz glass from the chamber. The sample position was axially and radially in the center of the discharge.

74 Atomic Force Microscopy imaging of spore surface structures. Atomic force microscopy (AFM) imaging was used to study the morphological surface changes of B. subtilis 168 wildtype spores after exposure to low-pressure plasma. Sterilized glass slides were coated with Poly-L-lysine (Sigma Aldrich, Darmstadt) to prevent spore shifting during the imaging process. Spores were deposited in homogeneous monolayers on using an electrically operated spraying device as described previously [48] and treated with low-pressure argon and oxygen plasma as described above. Spores exposed to low-pressure at 10 Pa for 300 s served as control. Images were collected using a TT- AFM atomic force microscope (AFMWorkshop, Signal Hill, USA) under ambient conditions. Cantilevers with uncoated silicon tips with a tip radius < 10 nm, a force constant of 13 – 77 N/m and a resonance frequency between 200 – 400 KHz were used (Applied Nanostructures, Santa Clara, USA). Scanning over an area of 2 µm2 was operated in taping mode to minimize possible tip-induced effects on the spore surface structures. All images were captured at a scan rate of 0.5 Hz with a resolution of 512 x 512 points. AFM height and phase images were collected simultaneously. Images with at least 10 spores were recorded per time point and plasma discharge. For image analysis height images were flattened using 2nd order polynomial (quadratic fit) and 0.2 µm2 areas were extracted for quantitative analysis of the root-mean-square roughness (Rrms) profile. Standard deviation and significance as determined by single factor ANOVA. Phase and reconstructed 3D height images were predominantly used for presentation.

2.5 Plasma treatment of spore samples. Spore inactivation via plasma treatment was performed at the Institute for Electrical Engineering and Plasma Technology (AEPT), Ruhr University Bochum, Bochum, Germany. Spore suspensions of the respective B. subtilis strains were prepared in sterile distilled water to a final concentration, such that a 20 µl aliquot contained 1 × 106 spores. V4A stainless steel coupons (7 mm in diameter, thickness of 1.5 mm; Wilms Metallmarkt Lochbleche GmbH & Co. KG, Cologne, Germany) were autoclaved (121°C, 30 min) prior to use. Samples for plasma sterilization were prepared by applying 20 µl aliquots of the respective spore suspension onto a steel coupon, so that they spread in a homogenous manner. Spore samples were air-dried under ambient laboratory conditions (20 ± 2°C, 40 ± 5 % relative humidity). One set of spore samples was composed of three identical samples with the same spore concentration. Triplicate samples of air-dried spore layers were exposed to different gas mixtures. The experiments presented were performed for P (power) = 500 W at p (pressure) = 10 Pa. The following plasma gas compositions have been tested: Ar (100 sccm), Ar:H2 (100:5 sccm), Ar:N2 (100:5 sccm), Ar:O2 (100:5 sccm), Ar:H2:N2:O2 (100:5:5:5 sccm), H2 (20 sccm), O2 (20 sccm), H2:O2 (10:10 sccm). For all combinations, the discharge was in inductively coupled plasma (ICP) mode (H-mode).

2.6 Spore survival assay. Spore inactivation rates were determined by a standard colony formation assay as described in [49]. To recover the spores from the V4A stainless steel coupons after the plasma treatment, air-dried spore layers were covered by a 10 % aqueous polyvinyl alcohol (PVA) solution. After air-drying, the spore- PVA layer was stripped off as described [49], and resuspended in 1 ml sterile distilled water, resulting in > 95% spore recovery. This procedure does not affect spore viability [49]. Spore survival from the aqueous and spore-PVA suspensions were determined from appropriate dilutions in distilled water as the colony forming ability (of vital colony-forming unit (CFU)) after overnight incubation at 37°C on LB agar plates (Difco, Detroit, USA) as described previously [49].

2.7 Numerical and statistical analysis.

The surviving fraction of B. subtilis spores was determined from the ratio N/N0, with N the number of

CFU of the treated sample and N0 that of the untreated controls. Spore inactivation curves were obtained as described previously [49, 50, 51, 52]. Data are reported as LD90-values as time in seconds i.e. the time of treatment killing 90 % of the initial spore population [50, 52]. All data are expressed as averages ± standard deviations (n = 3). The significance of the differences in the survival rates and relative sensitivities were determined by analysis of variance (ANOVA), using SigmaPlot software Version 12.0 (Systat Software GmbH, Erkrath, Germany). Values were evaluated in multigroup pairwise combinations, and differences with P values < 0.05 were considered statistically significant [49, 51, 52].

3. Results To investigate the impact of the major spore coat layers and pigmentation on resistance to low- pressure plasma sterilization wild-type spores, coat-deficient and pigmentation-less mutant spores of B. subtilis were systematically tested for resistance and morphological changes.

3.1 Transmission electron microscopic analysis of wild-type and coat-mutant spores. Thin-section electron microscopic analysis of wild type and mutant spores of Bacillus subtilis (Figure 3) confirmed previous findings, where information about the strain was previously obtained, as in the cases of mutations in spoVID [53], safA [54, 55], cotE [56], cotA [57], and the cotX cotYZ gene cluster [33] (Figure 3c-e, g, h). Wild type spores stained with Ruthenium red reveal the outermost layer, the crust (Figure 3a). We also show, consistent with previous findings, that spores bearing mutations in cotE and safA lack the outer and inner layers, respectively, and the remaining layers are separated from

76 the apparently expanded cortex (Figure 3f), similar to the phenotype of cotE gerE mutant spores [54 - 56, 58]. In spores deficient in CotE or SafA the remaining coat layer seems to have detached from the cortex (Figure 3d,e). The phenotype of cotVW mutant spores was previously unreported. Interestingly, we found that the cotVW spores lack the crust (Figure 3i), consistent with previous work showing that CotW is a crust component [33, 59]. As expected for the cotA mutant strain, there was no defect in coat morphology at the level of electron microscopy (Figure 3(g); 57).

Figure 3 Thin-section electron microscopic analysis of wild type and mutant spores. Samples were prepared using Ruthenium red (RR), a stain that reveals the crust (panels (a), (h), and (i)), or by traditional method (33) used extensively in the past but which does not reveal the crust. (a) PY79 wildtype stained with RR (modified from Preference (33) with permission from Elsevier (Elsevier Inc., Philadelphia, USA)); (b) PY79 wildtype spores; spores deficient in (c) spore encasement (∆spoVID), (d) inner coat (∆safA), (e) outer coat (∆cotE), (f) inner and outer coat (∆safA ∆cotE), (g) outer coat protein responsible for pigmentation (cotA), (h) crust formation (∆cotX ∆cotYZ), and (i) partial crust formation (∆cotVW). Ct, coat; Co, core; Cx, cortex; IC, inner coat; OC, outer coat; Cr, crust. Scale bars represent 500 nm.

77 3.2 Morphological changes of low-pressure plasma-treated spores. B. subtilis wild type spores exposed to vacuum without plasma discharges displayed a surface topography with vein-like coat folding structures characteristic for spores in air-dried states, due to formation of the folds in the coat [60 – 63]. AFM imaging of B. subtilis wild type spores revealed significant morphological changes to outer spore structures after low-pressure-plasma treatment. In recorded height and phase images low-pressure plasma treated spores appeared to have a rougher surface with irregularities in the outer structure compared to spores only exposed to vacuum (Figure 4 and Figure 5). Surface quantitative analysis revealed a significant increase of spore surface roughness profiles after 15 second exposure to low-pressure argon (P < 0.01; Figure 4, Figure 5d-f) and oxygen (P < 0.05) plasma (Figure 4, Figure 5j-l). With increasing treatment time plasma-treated spores revealed significant surface changes with increased surface roughness (P < 0.001 for argon and P < 0.01 for oxygen discharges) and considerable morphological alterations in form of cracks and fissures in the outer layer (Figure 4, Figure 5 g-i and M-O,). Low-pressure plasma particles caused significant damage to the spore surface, possibly affecting spore viability; therefore it was of interest to evaluate the importance of the multilayered proteinaceous coat in spore resistance against low-pressure plasma.

Figure 4 Quantification of root-mean-

square roughness (Rrms), determined from AFM height images, as an indicator for spore surface alterations after exposure to

low-pressure argon and oxygen plasma treatment. Standard deviation and significance as determined by ANOVA (* indicate P < 0.05, ** indicate P < 0.01, *** indicate P < 0.001).

Figure 5 Atomic force microscopy imaging of low pressure-plasma treated B. subtilis wildtype spores. Row (i-iii) represent height images, phase images, and 3D constructions, respectively. Spores were exposed to vacuum as a control (a-c), argon plasma for 15 s (d-f) and 60 s (g-i), as well as oxygen plasma for 15 s (j-l) and 60 s (m-o). Scale bars represent 500 nm.

79 3.3 Features of absolute measured plasma emission. The measured spectra shown in comparison in Figure 6 (individual spectra are displayed in Fig S1 and S2) deviate significantly from each other in absolute intensity as well as in wavelength position of emission depending on the process gas. Ar:H2 emitted nearly continuously in the range from λ = 130 –

400 nm resulting in a low intensity per wavelength but high overall intensity. Furthermore, Ar:H2 emission was present at both inactivation rate maxima determined by [64]. Emission of Ar:N2 was mainly in the VUV range below λ = 200 nm and in the UV-B and UV-A range. In the UV-C, there was only minor emission from NO originating from oxygen residuals in the process chamber. The strong intensity in the VUV coincides with inactivation maximum of [64]. Relevant Ar:O2 emission was only at λ = 130 nm and in the UV-A range originating from water residuals, but not in between. Emission of Ar:H2:N2:O2 was not a median of all single mixtures of argon, as H2, N2, and O2 were dissociated and also formed products such as NO, OH, NH which contributed to the emission. Nearly no continuum emission from H2 was present in the spectra compared to Ar:H2, as well as no N2 emission in the VUV range. Most emission was located in the UV-C, UV-B and UV-A range from NO, OH, NH and N2, coinciding with inactivation maximum of [64] in the UV-C spectrum. Pure argon had nearly no emission in the measured VUV and UV range. Peaks above λ = 200 nm were in most cases caused by noise from the Echelle detector due to its high sensitivity in the visible and infrared. Below λ = 200 nm, where measurements were performed with the monochromator, no noise was visible due to the different detector material which is only sensitive from λ = 115 nm to λ = 320 nm. Small single peaks were visible from residuals of

O2 and N2. H2 and O2 plasmas were similar in shape of the emission compared to their mixtures with argon, as the emission was produced by the molecular gas itself. However, the emission intensity of pure

H2 dropped significantly in the VUV and UV range compared to its admixtures with argon. Similar observations were made for the emission of pure O2 and Ar:O2. The emission intensity increased at λ =

130 nm in the Ar:O2 mixture due to an additional excitation process in the plasmas compared to pure O2.

The H2:O2 plasma mainly emitted in the UV-B range. Similar to the Ar:H2N2:O2 plasma, emission from

H2 was strongly reduced and atomic oxygen primarily emitted in the VUV range at λ = 130 nm.

The spectra presented could only be determined down to λ = 130 nm due to N2(a-X) calibration of the monochromator. Below λ = 130 nm, three intense resonance lines were present which strongly increase the dose in the VUV range. Because they cannot be measured by the system used, the argon lines were calculated previously [65]. The hydrogen resonance line was located at λ = 121 nm and is often the most intense atomic line in low-pressure hydrogen plasmas as it originates from the first excited energy level of hydrogen. Similar applies for argon where two of the first four excited energy levels emitted at λ = 104 nm and λ = 106 nm. This emission is very intense and strongly influences the dose in the VUV range as shown by calculations from [65] for the plasma system used.

80 UV fluence rates calculated from the measured spectra are shown in Table 2. We assumed the discharge to be homogeneous in the whole vessel. By multiplying the surface to volume ratio with the absolute spectra in photons cm-3 nm-1 s-1, we estimated the flux of photons onto a surface in the plasma chamber in photons cm-2 nm-1 s-1. After weighting the photons with their wavelength-depending energy, UV fluence rates in the VUV, UV-C, UV-B, and UV-A was calculated by integrating over the wavelength range.

Figure 6 Absolute measured (V)UV spectra intensity of low pressure plasma discharges. Top panel:

Ar:H2 (purple), Ar:O2 (blue), Ar:N2 (red), Ar:H2 (black). Lower panel: O2 (purple), H2:O2 (blue), H2 (red), Ar (black). Overlaid inactivation rate constant [62] indicates sporicidal effectiveness of particular wavelength spectra from 50 – 300 nm.

81 3.4 Spore resistance to argon plasma and pure molecular gas plasma. Plasma sterilization operates mainly due to its specific active agents, including VUV/UV photons and reactive radical species (Table 2). To compare the effect of different gas compositions at 500 Watt and 10 Pa concerning their sporicidal efficiency, all gas compositions were are analyzed and compared to pure argon plasma. Spore inactivation by Ar (100 sccm), H2 (20 sccm), O2 (20 sccm) and H2:O2 (10/10 sccm) gas mixtures are shown in Figure 7a-d (and Fig S3). The effects of the different plasma parameters on spore survivability were determined at different time points and inactivation kinetics were plotted.

LD90 values were calculated and compared using Student’s t-test. Spores lacking various spore coat layers and pigmentation were treated with Ar (Figure 7a), H2 (Figure 7b), O2 (Figure 7c) and a mixture of H2:O2

(Figure 7d) plasmas. Wild-type B. subtilis PY79 spores were significantly more sensitive to H2 (with a

LD90 value of 45 ± 3 s) and H2:O2 (LD90 value of 58 ± 5 s) than to O2 and Ar plasmas (LD90 values of 72 ± 7 s and 82 ± 8 s, respectively). Spores lacking all coat layers (spoVID), either the outer or inner coat layer (cotE or safA mutant, respectively), were more sensitive to those four types of plasma treatments than wild-type spores. Spores lacking CotA, showing a less pigmented phenotype, were more sensitive only to H2 and H2:O2 plasmas (Figure 7b and 7d), but not to Ar and pure O2 plasma. Spores deficient in crust assembly (cotVW and cotX cotYZ) exhibited wild-type-like resistance levels.

3.5 Effects of low-pressure argon plasma with admixture of hydrogen, nitrogen or oxygen on the spore resistance. In parallel to pure argon plasma treatments, we conducted spore inactivation experiments with Ar

(100 sccm) and an admixture of H2, O2 or N2 (5 sccm each) as well as a combined admixture of all four gases (Ar, H2, O2, N2) (Figure 8, Figure S3). Interestingly, wild-type spores were significantly more sensitive to all tested low-pressure Ar plasmas with admixtures, with the highest sporicidal efficiency for

Ar/N2 with a 3.7-fold inactivation (Figure 8a, Fig. 8b) compared to pure argon. Similarly to the pure argon plasma treatment, spores lacking SpoVID, SafA, CotE, SafA and CotE showed the highest sensitivity (Figure 8a-d). Additionally, spores lacking CotA also had an increased sensitivity compared to pure Ar plasma, suggesting a role not only for the inner and outer coat layers in spore resistance to low- pressure plasma treatment, but also for the protein required for pigmentation. Spores impaired in crust formation (due to mutation in the cotX cotYZ gene cluster) showed only minor differences in the resistance towards low-pressure plasma treatments.

Figure 7 Spore resistance to A) Ar (100 sccm), B) H2 (20 sccm), C) O2 (20 sccm) and D) H2:O2 (10:10 sccm) plasma discharges; in a 500 W power modus at a pressure of 10 Pa. Spores differing in the absence of various spore coat layers and structural properties (the coat layers that are missing or other coat defects, due to mutation of the gene that is stated in parenthesis): wild-type spores, spores deficient in spore encasement (∆spoVID), inner coat (∆safA), outer coat (∆cotE), inner and outer coat (∆safA ∆cotE), outer coat protein responsible for pigmentation (∆cotA), crust formation (∆cotX ∆cotYZ and ∆cotVW). Spores were exposed in the air-dried state and LD90 values (in seconds) are expressed as averages ± standard deviations (n = 3) as described in the text. Lower-case letters above the bars denote groups significantly different by ANOVA (P < 0.05).

Figure 8 Spore resistance to A) Ar:H2 (100:5 sccm), B) Ar:O2 (100:5 sccm), C) Ar:N2 (100:5 sccm) and D) Ar:H2:O2:N2 (100:5:5:5 sccm) plasma discharges; in a 500 W power modus at a pressure of 10 Pa. Spores differing in the absence of various spore coat layers and structural properties: wild-type spores, spores deficient in spore encasement (∆spoVID), inner coat (∆safA), outer coat (∆cotE), inner and outer coat (∆safA ∆cotE), outer coat protein responsible for pigmentation (∆cotA), crust formation (∆cotX ∆cotYZ and ∆cotVW). Spores were exposed in the air-dried state and LD90 values (in seconds) are expressed as averages ± standard deviations (n = 3) as described in the text. Lower-case letters above the bars denote groups significantly different by ANOVA (P < 0.05).

84 4. Discussion The use of spores as biological indicators is crucial to high-quality assessments of microbial decontamination in the industry and, therefore, important for human safety [8, 66]. Elucidating the importance of each spore component to the spore resistance properties will allow a more meaningful interpretation of biological indicators, and could facilitate the creation of improved decontamination methods. In this study we investigated spore resistance towards a novel sterilization technique featuring non-thermal plasma discharges. We analyzed the plasma-induced effect on spore morphology and subsequently survival of B. subtilis spores lacking various coat layers in correspondence to the sporicidal components present in low-pressure plasma discharges.

4.1 Role of (V)UV radiation. The process of low-pressure plasma sterilization is characterized by a combination of highly reactive species (ions, free electrons, radicals, neutral/ excited atoms or molecules), along with ultraviolet (UV) and vacuum ultraviolet (VUV) photons at different wavelengths which lead to rapid microbial inactivation by interacting with essential cell components [10, 11, 42]. UV and VUV photons in particular have been shown to have a major role in reduction of spore survival by plasma [19, 42, 67]. The spore coat has been shown to play a role in spore resistance to environmentally relevant UV wavelengths but not to UV-C radiation at 254 nm [50]. However the mechanism of this effect has not been determined. Wild type spores were found to be more sensitive to H2 plasma and H2 with admixture of O2 than Ar plasma. H2 discharges offer a high amount of VUV and UV radiation due to H2(a-b, C-X, B-X) and atomic Lyman emission resulting in nearly continuous emission from λ = 100 nm to λ = 400 nm. In contrast, Ar emission in the germicidal spectra is only at λ = 104.8 nm and λ = 106.7 nm [65]. Any additional radiation is due to residues present in the system or etching of the biological samples resulting in minor contribution to the overall dose. In O2 plasma, the amount of VUV and UV-radiation is significantly lower compared to H2 plasma and mainly emitted in the VUV around λ = 130 nm. Using Ar as process gas with admixtures of H2, O2 or N2, showed high UV fluence intensities in sporicidal VUV and UV-C spectra [64], leading to elevated inactivation rates of spores compared to argon or molecular gases only. It was found that pure Ar and O2 discharges as well as Ar with O2 admixtures lead to an overall less pronounced spore inactivation. Interestingly, earlier simulation of the Ar resonance lines in the DICP at λ = 104 nm and λ = 106 nm yielded an extremely high dose in pure Ar plasma (λ = 303.4 J/m2s) compared to other plasma discharges (see Table 2; 65), however spore survival was less affected despite the enormous fluence intensities. Based on these observations, a certain trend may be noticed, that high intensities of short-wavelength VUV radiation (Argon: λ = 104.8 and λ = 106.7 nm) in plasma discharges seem to be less effective in spore killing compared to VUV and UV radiation of longer

85 wavelengths. Similar trends were also observed for spores of Bacillus in earlier experiments [42]. Further, Munakata et al. [64] have detected an insensitivity of B. subtilis spores towards simulated UV radiation of λ = 100 and λ = 190 nm, whereas (V)UV radiation of λ = 125 – 175 nm and λ = 220 – 255 nm was highly effective in inactivating spores, indicating that certain wavelengths only weakly penetrate and are possibly absorbed by the outer layers of the spore. Spores lacking the inner, or the outer coat and spores deficient in spore encasement were significantly more sensitive to all plasma treatments, indicating the importance of these major coat layers in resistance against low-pressure plasma. Spores lacking CotA-dependent pigmentation were more sensitive to plasma discharges containing a high degree of environmentally relevant UV radiation. This is in good agreement with Hullo et al. [68] who have demonstrated that Bacillus spores devoid of CotA exhibited increased sensitivity to UV-A radiation at λ = 320 – 400 nm, indicating that the lack of CotA resulted in the loss of the wild-type brown color and increased spore sensitivity to hydrogen peroxide and UV radiation λ > 290 nm. The physiological role of the spore crust in protection against environmental influences has not yet been elucidated, although it only seemed to play a minor role in protection against plasma-mediated inactivation.

4.2 Modification of spore coat layers. The multilayered, proteinaceous spore coat provides protection against environmental stresses and is therefore the first barrier to incoming reactive plasma fluxes of ions, atoms, electrons and UV photons. While there are many factors involved in spore inactivation by plasma discharges, elevated fluences of UV and VUV photons are known to play a major role in introducing damage to spore components [67]. As the spore coat consists of >70 different proteins [27] it is potentially susceptible to plasma- induced photo-ionization. Macromolecules such as proteins are major targets for photo-oxidation due to present endogenous chromophores (amino acids side-chains and bound prosthetic groups) and rapid reactions with other excited state species [69, 70]. The primary route of direct photo-oxidation of a protein arises from absorption of UV radiation < 320 nm by chromophores or amino acid side chains. Excited state species or radicals are generated as a result of photo-ionization [69, 70], which in turn may severely affect neighboring proteins or diffuse into deeper spore layers. That direct photo-oxidation can severely affect the physical and chemical properties of proteins has been shown by Correira et al. [71], who found that continuous UV-B based excitation of whey protein leads to breakage of disulphide bridges, yielding an increase of free thiol groups, and induction of conformational changes. Further, Lackmann et al. [72] demonstrated that tyrosine residues and sulfur-containing amino acids were subjected to modification by atmospheric pressure plasma-emitted photons as well as particles.

86 Although this process is certainly a probability and may contribute to changes in spore morphology in plasma discharges with abundant UV and VUV radiation, it is not presently possible to pinpoint specific target proteins within the coat layers as the detailed molecular and spatial arrangement of coat proteins and their function in spore resistance remain largely unclear [28, 31, 23]. Riesenman and Nicholson [50] have shown that B. subtilis spores with defects in coat structures were significantly more sensitive to the common oxidant H2O2, hence excited state species and radical produced by the plasma discharge itself (e.g. oxygen-containing plasmas) or as a result of photoexcitation of essential spore coat proteins may possibly contribute to spore inactivation as a synergistic mechanism. The melanine-like pigment produced by CotA may aid in resistance to reactive oxygen species (ROS) as melanine is known to stabilize harmful unpaired electrons such as in ROS [73]. Moreover, a Mn2+-dependent superoxide dismutase (SodA) as well as two Mn2+ pseudocatalases (CotJC and YjqC) are associated with spore coat structures. However, their role in protection against ROS and other radical species remains unknown [29]. High resolution imaging by atomic force microscopy enabled analysis of plasma-treated spores without changing their physical properties and reveal native surface structures that arise from the exposure to low-pressure plasma discharges. Low-pressure argon and oxygen plasmas significantly affected spore surface structures after surprisingly short treatment times leading to distinct morphological changes and fissures in the multilayered spore coat. Similar results were obtained by Lerouge et al. [74], who noted considerable changes in B. subtilis spore morphology after oxygen plasma treatment with lower energies. The observed morphological changes in the coat surface after low-pressure plasma treatment as visualized by AFM imaging ranged from global irregularities to complete fractures of the surface. Although, we cannot state that such plasma-induced lesions in the coat have a direct detrimental effect on the spore, damages of the protective coat’s structure might increase the permeability of reactive plasma components, allowing them to reach more delicate spore structures beneath the coat. Possible targets of plasma species may include the outer membrane (if it is present in the mature spore), the modified peptidoglycan layer of the spore cortex, and the inner spore membrane, the latter harboring spore-specific germination receptor clusters that respond to nutrient germinants [75]. However, possible plasma-mediated impairment of these spore components remains to be investigated.

4.3 DNA Protection. Despite potential photoionization and erosion of spore proteins, the major target of (V)UV photons is the well-protected spore DNA in the spore core. Bacterial spores exhibit elevated resistance properties towards UV radiation mainly due to a unique alteration in spore DNA photochemistry caused by saturation of α/β-type SASPs to the DNA. In addition, a reduced water content and the high content of calcium dipicolinic acid in the spore core photosensitizes spore DNA to 254 nm UV-C radiation

87 increasing the quantum efficiency for the formation of the major spore photoproduct (SP) 5-thyminyl-5,6- dihydrothymine instead of cyclobutane dimers (CPDs). During spore outgrowth, SP is repaired more rapidly and efficiently as compared to CPDs by different repair systems, where one is specific for SP [reviewed in 22, 23, 76]. The next step in assessing spore resistance towards low-pressure plasma treatment involves the systematic analysis of the role of DNA protection by α/β-type SASPs and calcium dipicolinic acid along with plasma-induced DNA lesions and spore-specific photoproducts as well as the induction of relevant DNA repair pathways, which present a crucial element for spore survival after UV-, heat, or oxidative stress [50, 51, 52, 76].

4.4 Synergistic Effects. Besides the substantial amount of lethal UV and VUV radiation in non- equilibrium plasma discharges, there are other factors potentially contributing to plasma-mediated spore inactivation [17, 18]. For instance, Stapelmann et al. [15] observed an additive effect of broad spectrum UV radiation and sample heating during simulated low-pressure H2 plasma in the decrease of GapDH enzyme activity, indicating a complex synergistic interaction of single emitted plasma components. Characterizations of emitted plasma components, such as particle densities and fluxes as well as electron densities, electron temperatures, have been performed for various low-pressure plasma setups in previous studies [19, 20, 40], however, single and synergistic effects of these components and their biological relevance have yet not been thoroughly tested [23] and will be a promising subject of future studies.

4.5 Conclusion. With this study we aimed to shed some light on the factors involved in spore resistance against plasma treatment and identified the inner and outer coat as well as spore encasement but not the spore crust as structural key factors involved in spore resistance towards low-pressure plasma. Spore pigmentation was only relevant in plasma discharges containing a high degree of environmentally relevant UV radiation.

88 5. Acknowledgments The authors thank Andrea Schröder, Inga Hahn and Mark Khemmani for their excellent technical assistance during parts of this work. A special thank you to Jan Lackmann, Julia Bandow, Franz Narberhaus and Jan Benedikt for their expertise and helpful advice. We thank Tim Chu for preparing and sending the strains used in this study. This work was supported in parts by grants from the German Research Foundation (DFG) Paketantrag (PlasmaDecon PAK 728) to P.A. (AW 7/3-1) and R.M. (MO 2023/2-1), and the German Aerospace Center (DLR) grant DLR-FuE-Projekt ISS-Nutzung in der Biodiagnostik, Programm RF-FuW, Teilprogramm 475 (to R.M. and M.R.). The results of this study will be included in the Ph.D. thesis of Marina Raguse. Peter Eaton was supported by FCT via grant UID/MULTI/04378/2013.

6. Conflict of interest No conflict of interest declared.

7. References

1. Abreu AC, Tavares R R, Borges A, Mergulhão F, Simões M 2013 Current and emergent strategies for disinfection of hospital environments J. Antimicrob. Chemother. 68 2718-2732 2. Sattar S A, Maillard J Y 2013 The crucial role of wiping in decontamination of high-touch environmental surfaces: Review of current status and directions for the future Am J. Infect. Control. 41 97-104 3. Gómez-López V M, Ragaert P, Debevere J, Devlieghere F 2008 Decontamination methods to prolong the shelf-life of minimally processed vegetables, state-of-the-art Crit. Rev. Food. Sci. Nutr. 48 487-95 4. Siani H, Maillard J Y 2014 Best practice in healthcare environment decontamination Eur. J. Clin. Microbiol. Infect. Dis. 34 1-11 5. Horneck G, Klaus D M, Mancinelli R L 2010 Space microbiology Microbiol. Mol. Biol. Rev. 74 121- 56 6. Fraise A 2011 Currently available sporicides for use in healthcare, and their limitations J. Hosp. Infect. 77 210-12 7. Denis B, Steves S, Semmler E, Bibinov N, Novak W, Awakowicz P 2012 Plasma sterilization of pharmaceutical products: from basics to production Plasma Process. Polym. 9 619-629 8. Rutala W A, Weber D J 2013 Disinfection and sterilization: an overview Am. J. Infect. Control 41 2-5 9. Williams G J, Denyer S P, Hosein I K, Hill D W, Maillard J Y 2009 Limitations of the efficacy of surface disinfection in the healthcare setting Infect. Control Hosp. Epidemiol. 30 570-573 10. Moreau M, Orange N, Feuilloley M G J 2008 Non-thermal plasma technologies: new tools for bio- decontamination Biotechnol. Adv. 26 610-17 11. Lerouge S 2001 Non-traditional sterilization techniques for biomaterials and medical devices. In Lerouge S, Simmons A (ed), Sterilisation of Biomaterials and Medical Devices Woodhead Publishing, Witney, Oxford, UK

89 12. Isbary G, Shimizu T, Li Y F, Stolz W, Thomas H M, Morfill G E, Zimmermann J L 2013 Cold atmospheric plasma devices for medical issues Expert. Rev. Med. Devices. 10 367-77 13. Niemira B A 2012 Cold plasma decontamination of foods Annu. Rev. Food. Sci. Technol. 3 125-42 14. Shimizu S, Barczyk S, Rettberg P, Shimizu T, Klaempfl T, Zimmermann J L, Hoeschen T, Linsmeier C, Weber P, Morfill G E, Thomas H M 2014 Cold atmospheric plasma - A new technology for spacecraft component decontamination Planet. Space Sci. 90 60-71 15. Stapelmann K, Fiebrandt M, Raguse M, Awakowicz P, Reitz G, Moeller R 2013 Utilization of low- pressure plasma to inactivate bacterial spores on stainless steel screws Astrobiology 13 597-606 16. Lerouge S, Wertheimer M R, Yahia L 2001 Plasma sterilization: a review of parameters, mechanisms and limitations Plasmas. Polym. 6 175-88 17. Rossi F, Kylián O, Hasiwa M 2006 Decontamination of surfaces by low-pressure plasma discharges Plasma Process. Polym. 3 431-42 18. Rossi F, Kylián O, Rauscher H, Hasiwa M, Gilliland D 2009 Low pressure plasma discharges for the sterilization and decontamination of surfaces New. J. Phys. 11 115017 19. von Keudell A, Awakowicz P, Benedikt J, Raballand V, Yanguas-Gil A, Opretzka J, Flötgen C, Reuter R, Byelykh L, Halfmann H, Stapelmann K, Denis B, Wunderlich J, Muranyi P, Rossi F, Kylián O, Hasiwa N, Ruiz A, Rauscher H, Sirghi L, Comoy E, Dehen C, Challier L, Deslys JP 2010 Inactivation of bacteria and biomolecules by low-pressure plasma discharges Plasma Process. Polym. 7 327-52 20. Halfmann H, Bibinov N, Wunderlich J, Awakowicz P 2007a A double inductively coupled plasma for sterilization of medical devices J. Phys. D. Appl. Phys. 40 4145 21. Kawamura K, Sakuma A, Nakamura Y, Oguri T, Sato N, Kido N 2012 Evaluation of bactericidal effects of low-temperature nitrogen gas plasma towards application to short-time sterilization Microbiol. Immunol. 56 431-40 22. Setlow P 2006 Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals J. Appl. Microbiol. 101 514-25 23. Setlow P 2014 Spore resistance properties Microbiol. Spec. 2 doi:10.1128/microbiolspec.TBS-0003- 2012 24. Serp D, von Stockar U, Marison I W 2002 Immobilized bacterial spores for use as bioindicators in the validation of thermal sterilization processes J. Food. Prot. 65 1134-41 25. von Woedtke T, Haese K, Heinze J, Oloff Ch, Stieber M, Jülich WD 2004 Sporicidal efficacy of hydrogen peroxide aerosol Pharmazie 59 207-11 26. Klämpfl T G, Isbary G, Shimizu T, Li Y F, Zimmermann J L, Stolz W, Schlegel J, Morfill G E, Schmidt H U 2012 Cold atmospheric air plasma sterilization against spores and other microorganisms of clinical interest Appl. Environ. Microbiol. 78 5077-82 27. McKenney P T, Driks A, Eichenberger P 2013 The Bacillus subtilis endospore: assembly and functions of the multilayered coat Nat. Rev. Microbiol. 11 33-44 28. Driks A 2002 Maximum shields: the assembly and function of the bacterial spore coat Trends Microbiol. 10 251-4 29. Henriques A O, Moran Jr C P 2007 Structure, assembly, and function of the spore surface layers Annu. Rev. Microbiol. 61 555-88 30. Setlow P 2012 Dynamics of the assembly of a complex macromolecular structure - the coat of spores of the bacterium Bacillus subtilis Mol. Microbiol. 83 241-4 31. Driks A 1999 Bacillus subtilis spore coat Microbiol. Mol. Biol. Rev. 63 1-20

90 32. Abhyankar W 2014 Spore proteomics: the past, present and the future FEMS Microbiol. Let. 358 137- 44 33. McKenney P T, Driks A, Eskandarian H A, Grabowski P, Guberman J, Wang K H, Gitai Z, Eichenberger P 2010 A distance-weighted interaction map reveals a previously uncharacterized layer of the Bacillus subtilis spore coat Curr. Biol. 20 934-8 34. McKenney P T, Eichenberger P 2012 Dynamics of spore coat morphogenesis in Bacillus subtilis Mol. Microbiol. 83 245-60 35. Wang K H, Isidro A L, Domingues L, Eskandarian H A, McKenney P T, Drew K, Grabowski P, Chua M H, Barry S N, Guan M, Bonneau R, Henriques A O, Eichenberger P 2009 The coat morphogenetic protein SpoVID is necessary for spore encasement in Bacillus subtilis Mol. Microbiol. 74 634-49 36. Ghosh S, Setlow B, Wahome P G, Cowan A E, Plomp M, Malkin A J, Setlow P 2008 Characterization of spores of Bacillus subtilis that lack most coat layers J. Bacteriol. 190 6741-8 37. Setlow P 2012 Resistance of bacterial spores to chemical agents. In Maillard J Y, Fraise A, Sattar S (ed), Russell, Hugo & Ayliffe's: Principles and practice of disinfection, preservation & sterilization, 5th ed. Wiley-Blackwell, Oxford, United Kingdom 38. Plomp M, Carroll A M, Setlow P, Malkin AJ 2014 Architecture and assembly of the Bacillus subtilis spore coat PLoS ONE 9 e108560 39. Setlow B, Yu J, Li Y Q, Setlow P 2013 Analysis of the germination kinetics of individual Bacillus subtilis spores treated with hydrogen peroxide or sodium hypochlorite Lett. Appl. Microbiol. 57 259- 65 40. Opretzka J, Benedikt J, Awakowicz P, Wunderlich J, von Keudell A 2007 The role of chemical sputtering during plasma sterilization of Bacillus atrophaeus J. Phys. D. Appl. Phys. 40 2826-30 41. Roth S, Feichtinger J, Hertel C 2010 Characterization of Bacillus subtilis spore inactivation in low- pressure, low-temperature gas plasma sterilization processes J. Appl. Microbiol. 108 521-31 42. Halfmann H, Denis B, Bibinov N, Wunderlich J, Awakowicz P 2007b Identification of the most efficient VUV/UV radiation for plasma based inactivation of Bacillus atrophaeus spores J. Phys. D. Appl. Phys. 40 5907 43. Schaeffer P, Millet J, Aubert J P 1965 Catabolic repression of bacterial sporulation Proc. Natl. Acad. Sci. USA 45 704-11 44. Nicholson W L, Setlow P 1990 Sporulation, germination, and outgrowth, 391-450. In Harwood CR and Cutting SM (ed.), Molecular biological methods for Bacillus. John Wiley and Sons, Sussex, England 45. Nagler K, Setlow P, Li Y Q, Moeller R 2014 High salinity alters the germination behavior of Bacillus subtilis spores with nutrient and nonnutrient germinants Appl. Environ. Microbiol. 80 1314-21 46. Messerer P, Boenigk B, Keil G, Scheubert P, Awakowicz P 2003 Plasma diagnostics in a double inductively coupled source (DICP) for plasma sterilization Surf. Coat. Tech. 174-175 570-3 47. Bibinov N K, Bolshukhin D O, Kokh D B, Pravilov A M, Vinogradov I P, Wiesemann K 1997 Absolute calibration of the efficiency of a VUV-monochromator/detector system in the range 110- 450 nm Meas. Sci. Technol. 8 773-81 48. Raguse M, Fiebrandt M, Stapelmann K, Madela K, Laue M, Lackmann J W, Thwaite J E, Setlow P, Awakowicz P, Moeller R 2016 Improvement of biological indicators by uniformly distributing B. subtilis spores in monolayers to evaluate enhanced spore decontamination technologies Appl. Environ. Microbiol. 82 doi:10.1128/AEM.03934-15

91 49. Moeller R, Setlow P, Reitz G, Nicholson W L 2009 Roles of small, acid-soluble spore proteins and core water content in survival of Bacillus subtilis spores exposed to environmental solar UV radiation Appl. Environ. Microbiol. 75 5202-8 50. Riesenman P J, Nicholson W L 2000 Role of the spore coat layers in Bacillus subtilis spore resistance to hydrogen peroxide, artificial UV-C, UV-B, and solar UV radiation Appl. Environ. Microbiol. 66 620-6 51. Moeller R, Vlašić I, Reitz G, Nicholson W L 2012 Role of altered rpoB alleles in Bacillus subtilis sporulation and spore resistance to heat, hydrogen peroxide, formaldehyde, and glutaraldehyde Arch. Microbiol. 194 759-67 52. Moeller R, Raguse M, Reitz G, Okayasu R, Li Z, Klein S, Setlow P, Nicholson W L 2014 Resistance of Bacillus subtilis spore DNA to lethal ionizing radiation damage relies primarily on spore core components and DNA repair, with minor effects of oxygen radical detoxification Appl. Environ. Microbiol. 80 104-9 53. Beall B A, Driks A, Losick R, Moran Jr C P 1993 Cloning and characterization of a gene required for assembly of the Bacillus subtilis spore coat J. Bacteriol. 175 1705-16 54. Takamatsu H, Kodama T, Nakayama T, Watabe K 1999 Characterization of the yrbA gene of Bacillus subtilis, involved in resistance and germination of spores J. Bacteriol. 181 4986-94 55. Ozin A J, Henriques A O, Yi H, Moran Jr C P 2000 Morphogenetic proteins SpoVID and SafA form a complex during assembly of the Bacillus subtilis spore coat J. Bacteriol. 182 1828-33 56. Zheng W L, Donovan W P, Fitz-James P C, Losick R 1988 Gene encoding a morphogenic protein required in the assembly of the outer coat of the Bacillus subtilis endospore Genes Dev. 2 1047-54 57. Donovan W P, Zheng W L, Sandman K, and Losick R 1987 Genes encoding spore coat polypeptides from Bacillus subtilis J. Mol. Biol. 196 1-10 58. Driks A, Roels S, Beall B, Moran Jr C P, Losick R 1994 Subcellular localization of proteins involved in the assembly of the spore coat of Bacillus subtilis Genes Dev. 8 234-4 59. Imamura D, Kuwana R, Takamatsu H, Watabe K 2011 Proteins involved in formation of the outermost layer of Bacillus subtilis spores J. Bacteriol. 193 4075-80 60. Plomp M, Leighton T J, Wheeler K E, Malkin A J 2005 The high-resolution architecture and structural dynamics of Bacillus spores Biophys. J. 88 603-8 61. Chada V G, Sastad E A, Wang R, Driks A 2003 Morphogenesis of Bacillus spore surface J. Bacteriol. 185 6255-61 62. Driks A 2003 The dynamic spore PNAS 100 3007-9 63. Sahin O, Yong E H, Driks A, Mahadevan L 2012 Physical basis for the adaptive flexibility of Bacillus spore coats J. R. Soc. Interface 9 3156-60 64. Munakata N, Saito M, Hieda K 1991 Inactviation action spectra of Bacillus subtilis spores in extended ultraviolet wavelengths (50-300nm) obtained with synchrotron radiation. J. Photochem. Photobiol. 54 761-8 65. Mertmann P, Bibinov N, Halfmann H, Awakowciz P 2009 Determination of argon resonance line emission in an ICP hitting a biological sample Plasma Sources. Sci. Technol. 7 665-75 66. Penna T C, Ishii M, Machoshvili I A, Marques M 2002 The effect of bioindicator preparation and storage on thermal resistance of Bacillus stearothermophilus spores Appl. Biochem. Biotechnol. 98- 100 525-38 67. Lerouge S, Fozza A C, Wertheimer M R, Marchand R, Yahia L 2000 Sterilization by low-pressure plasma: the role of vacuum-ultraviolet radiation Plasmas Polym. 5 31-46

92 68. Hullo M F, Moszer I, Danchin A, Martin-Verstraete I 2001 CotA of Bacillus subtilis is a copper- dependent laccase J. Bacteriol. 183 5426-30 69. Davies M J, Truscott, R J W 2001 Photo-oxidation of proteins and its role in cataractogenesis J. Photochem. Photobiol. 63 114-25 70. Benasson R V, Land E J, Truscott T G 1983 Pulse radiolysis and flash photolysis: Contribution to the chemistry of biology and medicine Pergamon press, Oxdord 71. Correia M, Neves-Petersen T, Parracino A, di Gennaro A K, Petersen S B 2012 Photophysics, photochemistry and energetics of UV light induced disulphide bridge disruption in apo-alpha- lactalbumin J. Flouresc. 22 323-37 72. Lackmann J W, Edengeiser E, Schneider S, Benedikt J, Havenith M, Bandow J E 2013 Effects of the

effluent of a microscale atmospheric pressure plasma-jet operate with He/O2 gas on bovine serum albumin Plasma Medicine 3 115-124 73. Commoner B, Townsens J, Pake G E 1954 Free radicals in biological materials Nature 174 689-91 74. Lerouge S, Wertheimer M R, Marchand R, Tabrizian M, Yahia L H 2000 Effect of gas composition on spore mortality and etching during low-pressure plasma sterilization J. Biomed. Mater. Res. 51 128-35 75. Setlow P 2014 Germination of spores of Bacillus species: What we know and do no not know Appl. Environ. Microbiol. 196 1297-305 76. Setlow P 2001 Resistance of spores of Bacillus species to ultraviolet light Env. Mol. Mut. 38 97-104 77. Lenhart J S , Schroeder J W, Walsh B W, Simmons L A 2012 DNA repair and genome maintenance in Bacillus subtilis Microbiol. Mol. Biol. Rev. 76 530-564 78. Eichenberger P, Fujita M, Jensen S T, Conlon E M, Rudner D Z, Wang S T, Ferguson C, Haga K, Sato T, Jiu J S, Losick R 2004 The program of gene transcription for a single differentiating cell type during sporulation in Bacillus subtilis PLoS Biol. 2 1664 – 83

93 TABLES

Table 1. Bacillus subtilis strains used in this study.

Strain Genotype and/or Missing spore coat Source (reference) phenotypea component PE594 Wild type (prototroph) None Laboratory stock [34] (PY79) PE697 spoVID::kan, KanR all coat layers (spore coat Laboratory stock [34] morphogenetic protein, promotes encasement of the spore) PE277 safA::tet, TetR Inner coat Laboratory stock [34] (morphogenetic protein associated with SpoVID, major organizer of the inner spore coat) PE618 cotE::cat, CmR Outer coat (outer spore Laboratory stock [34] coat morphogenetic protein, controls the assembly of the outer spore coat layer) PE1720 safA::tet, TetR cotE::cat, Inner and outer coat PE618 → PE277 CmR (transformation) 1S101 trpC2, cotA::cat, CmR Pigmentation (located in BGSC the outer coat) MR06 cotA::cat, CmR Pigmentation (located in 1S101 → PE594 the outer coat) (transformation) PE620 cotX cotYZ::neo, NeoR Crust (outermost layer of Laboratory stock [34] the spore coat) PE566 cotVW::erm, ErmR Crust (outer spore coat Laboratory stock [78] proteins (insoluble fraction), formation of the outer section of the spore crust) a CmR, chloramphenicol (5 µg/ml), ErmR, erythromycin (1 µg/ml), KanR, kanamycin (10 µg/ml), NeoR, neomycin (10 µg/ml), TetR, tetracycline (10 µg/ml). b BGSC, Bacillus Genetic Stock Center.

94 Table 2. Parameters of plasma reactor (DICP) and low pressure plasma characteristics.

UV fluence Substrate (J/m²s) temperature a Gas composition Ar (°C) VUV UV-C UV-B UV-A total UV (flow in sccm) resonance after 104.8 nm b (130-200 nm) (200-280 nm) (280-320 nm) (320-400 nm) (130-400 nm) 30 s 60 s 90 s + 106.7 nm

Ar (100) 303.4 0.25 0.18 0.06 0.25 0.74 44 63 82

H2 (20) n.d. 5.04 3.11 0.54 0.33 9.02 28 48 70

O2 (20) n.d. 0.70 0.09 0.06 0.01 0.86 68 79 91

H:O2 (10:10) n.d. 1.03 0.32 2.65 0.12 4.12 58 88 116

Ar:H 2 12.32 14.05 15.72 4.05 2.03 35.85 46 70 95 (100:5)

Ar:O2 (100:5) 0.67 11.47 2.16 2.56 0.82 17.01 59 81 104

Ar:N2 (100:5) 9.48 24.80 3.83 5.88 11.52 46.03 64 81 96 Ar:H :O :N 2 2 2 n.d. 5.35 9.68 14.67 3.70 33.40 56 79 104 (100:5:5:5) a Data determined by extrapolation of temperature measurements. b obtained from Mertmann et al. (65). n.d not determinable

95 1

1 Understanding of the importance of the spore coat structure and

2 pigmentation in the Bacillus subtilis spore resistance to low-

3 pressure plasma sterilization

5 Marina Raguse1, Marcel Fiebrandt2, Benjamin Denis2, Katharina Stapelmann2, Patrick Eichenberger3,

6 Adam Driks4, Peter Eaton5, Peter Awakowicz2, and Ralf Moeller1,*

8 1 German Aerospace Center (DLR e.V.), Institute of Aerospace Medicine, Radiation Biology Department,

9 Space Microbiology Research Group, Cologne (Köln), Germany,

10 2 Ruhr University Bochum (RUB), Institute for Electrical Engineering and Plasma Technology (AEPT),

11 Bochum, Germany,

12 3 Center for Genomics and Systems Biology, Department of Biology, New York University, New York,

13 New York, USA,

14 4 Stritch School of Medicine, Loyola University Chicago, Department of Microbiology and Immunology,

15 Maywood, Illinois, USA.

16 5 UCIBIO / Requimte, Department of Chemistry and Biochemistry, Faculty of Sciences of the University

17 of Porto, Porto, Portugal

19 Running title: Coat layers in spore resistance to plasma sterilization.

21 *Corresponding author. Mailing address: German Aerospace Center (DLR e.V.), Institute of Aerospace

22 Medicine, Radiation Biology Department, Space Microbiology Research Group, Linder Höhe, D-51147

23 Cologne (Köln), Germany, Phone +49(2203) 601-3145, Fax +49(2203) 61790, E-mail:

24 [email protected]

96 2

25 SUPPLEMENTAL INFORMATION

27 FIGURE LEGENDS

29 Figure S1 Single spectra of Ar, H2, H2:O2 and O2 plasma.

31 Figure S2 Single spectra of Ar:H2, Ar:N2, and Ar:O2 and Ar:H2:N2:O2

33 Figure S3 Relative sensitivities of spores to low pressure plasma treatment which lack various

34 spore coat layers (all coat layers (spoVID), inner coat (safA), outer coat (cotE), crust (cotX cotYZ,

35 cotVW)) and spore pigmentation (cotA)). Relative spore sensitivity is expressed as the ratio of the

36 LD90 value of spores of each mutant strain with respect to the LD90 value of spores of the

37 corresponding reference strain (wild-type) from each plasma sterilization experiment (Panel A:

38 argon (white bar), hydrogen (shaded white bar), oxygen (grey bar), and hydrogen/oxygen

39 (shaded grey bar) plasma discharges, and Panel B: argon (white bar), argon/hydrogen (shaded

40 white bar), argon/oxygen (grey bar), argon/nitrogen (shaded grey bar), and

41 argon/hydrogen/oxygen/nitrogen (dark grey bar) plasma discharges) using data from Figs. 2 and

42 3. Data are averages and standard deviations (n = 3). Actual data values are given above the

43 corresponding columns. Asterisk denotes difference significant at P < 0.05.

97 3

45 FIGURES

47 Figure S1

98 4

49 Figure S2

99 5

51 Figure S3

100 Chapter F

DNA double-strand breaks commit outgrown Bacillus subtilis haploid spore to non-homologous end joining.

Marina Raguse, Patrick Eichenberger, Juan Alonso, Ralf Moeller

In preparation

101 DNA double-strand breaks commit outgrown Bacillus subtilis haploid spore to nonhomologous end joining

Marina Raguse1, Patrick Eichenberger2, Juan Alonso3, and Ralf Moeller1,*

1 German Aerospace Center (DLR e.V.), Institute of Aerospace Medicine, Radiation Biology Department, Space Microbiology Research Group, Linder Hoehe, D-51147 Cologne (Köln), Germany, 2 Center for Genomics and Systems Biology, Department of Biology, New York University, NY 10003, New York, USA, 3Department of Microbial Biotechnology, Centro Nacional de Biotecnología, CSIC, 3 Darwin, 28049 Cantoblanco, Madrid, Spain

Running title: DSB repair in Bacillus subtilis reviving spores

*Corresponding author at: German Aerospace Center, Cologne, Germany. E-mail: [email protected]

102 ABSTRACT Recognition, processing and commitment to DNA double-strand break (DSB) repair during the revival of Bacillus subtilis haploid non-replicating spores are poorly understood. The contribution of Ku (non-homologous end joining, NHEJ) and RecA (homologous recombination) proteins to spore survival after ionizing radiation (IR) exposure resulting in DSBs induction was investigated. Basal processing (by PNPase), rather than end recognition (by RecN), might contribute to pathway choice by NHEJ during spore survival. Time-course microscopy of fusions proteins with fluorescent proteins was used to study the fate of Ku and RecA by means of monitoring their accumulation in germinating, ripening and outgrowing spores after exposure to IR. In unperturbed spores, Ku-GFP expression and foci formation was marginally affected, but RecA-YFP increased with time from spore outgrowth to exponential growth. DNA damage-induced Ku-GFP foci formation increased up to 90 % in early outgrowing spores compared to untreated spores and the fluorescent signal among foci varied less than 2-fold, whereas RecA-YFP foci formation increased with revival time and the fluorescent signal is highly variable. We proposed that increased Ku and no DNA replication dictate DSB repair via NHEJ, but increased RecA, DNA replication and low Ku levels contribute to a different pathway choice, via homologous recombination.

Keywords: Bacillus subtilis, haploid spore, ripening, outgrowth, DNA repair, nonhomologous end joining, homologous recombination

103 1. Introduction

A DNA double-strand break (DSB) is one of the most cytotoxic forms of DNA damage [1, 2]. A two-ended DSB, in which the phosphate backbones of the two complementary DNA strands are broken either simultaneously or two nicks are present in complementary DNA strands within one helical turn, is generated upon exposure to mutagens (e.g., ionizing radiation, IR). IR causes few single-strand nicks for each two-ended DSB and it often leaves “dirty ends” that cannot be ligated without processing [3, 4]. DSBs require faithful repair to maintain genome stability, and four mechanistically distinct sets of pathways have evolved to repair DSBs: template-dependent homologous recombination (HR) and three template- independent avenues: non-homologous end joining (NHEJ), annealing of homologous short patches (single strand annealing, SSA) or patches of microhomology (alternative end joining, alt-EJ) [4-14]. Error-free HR is regulated to occur mainly during the S and G2 stage of eukaryotic cell cycle or throughout the cell cycle in exponentially growing bacteria [5-7, 10- 12, 15, 16]. Under this conditions, the first responders to DSB is the damage recognition Mre11-Rad50-Xrs2 (Nbs1) complex in eukaryotes or RecN in concert with a 3’-single- stranded (ss) DNA exonuclease (e.g., polynucleotide phosphorylase, PNPase) in bacteria [6, 7, 11, 12, 14, 16]. Basal end-resection, which is required to remove dirty ends, optimizes the substrate for both NHEJ and for long-range end resection via the AddAB complex (counterpart of Escherichia coli RecBCD or Mycobacterium tuberculosis AdnAB) and/or RecJ in concert with a DNA helicase (RecQ or RecS) and SsbA (in the case of HR, SSA or alt-EJ). Long-range end resection of the 5’ termini prevails when an intact homologous template (a sister chromatid or a homologous chromosome) is available, representing a key step in the choice of HR [12, 14, 17]. This processing is crucial because it generates 3’-tailed duplex DNA that serves as the substrate for assembly of a RecA/Rad51 nucleoprotein filament that searches for DNA homology, and it inhibits NHEJ [5-7, 10-12, 15, 18]. When long-range end-processing is inhibited, the broken ends - after processing by basal resection and/or polymerization activities - can be simply re-joined by NHEJ [8, 9, 13, 19]. NHEJ occurs throughout the cell cycle in eukaryotes, but it is especially important in the G1 stage, when a key initial step in HR, the long-range 5’  3’ resection of DSB ends, is blocked [20, 21]. Similarly, NHEJ plays a crucial role in bacterial haploid non-replicating cells (e.g., mature spores) [22, 23] or in the absence of HR, suggesting that replicating cells attempt to initiate end resection before end joining by NHEJ [8, 9, 13, 16, 19, 24]. The mechanisms that block HR, activate NHEJ, or control the pathway choice between template-dependent and

104 template-independent DSB repair are poorly understood in bacteria. It is proposed that damage recognition might be common between HR and NHEJ, followed by basal resection and commitment to a given pathway of DNA repair. We hypothesize that Bacillus subtilis spores, which contain a single non-replicating genome, could offer a special temporal window to study the commitment towards template-independent NHEJ pathway. Indeed, under these conditions HR is constrained by the lack of an intact homologous template, and SSA and alt- EJ pathways are constrained by the low involvement of long-range end processing [23]. Under stressful conditions such as nutrient limitation, B. subtilis forms endospores that can remain dormant for prolonged periods of time and revive upon the encounter of growth- favourable conditions [25, 26]. Once nutrients become available, dormancy ceases, and the spore rapidly undergoes germination, ripening and outgrowth stages until they enter into vegetative growth [25-27]. No morphological change is evident 60 min into the revival process: with germination taking place during the first 15 min, and the ripening process, where the core components of the transcriptional and translational machineries are produced, and the energy generation machineries are readily detected, the remaining fraction of time [28, 29]. At 90 min, spore size increases indicating the initiation of outgrowth (60 – 150 min) [29]. At this point, the spore is capable of generating the complete set of molecules, essential for cell elongation, as all DNA metabolic proteins required to repair the damaged genome and to carry out replication are available at this point [28, 29]. At 150 min the spore accomplishes the conversion into a rod-shaped vegetative cell [25-27]. Low levels of RecA and very low concentrations of Ku (also termed YkoV) were reported during spore outgrowth [22, 30-33], but very little is known about their kinetic of synthesis. The aim of this work was to study whether damage recognition and/or basal end resection contribute to pathway choice and to investigate the time-resolved activity of Ku and RecA and their contribution to spore survival after DSBs generated by IR treatment. We report that PNPase exonuclease/polymerase, rather than RecN, contributes to spore survival. PNPase is also involved in aiding in the pathway choice in exponentially growing B. subtilis cells [34]. From these and previous data we propose that: i) an unknown factor(s) might down-regulate long-range end resection, as proposed for eukaryotic cells; ii) a signal probably linked to DNA replication, rather than to DNA damage recognition or long-range end resection, might down-regulate Ku and up-regulates RecA expression; and iii) Ku contributes to DSB repair and RecA plays a role in delaying DNA replication to cope with DNA replication stress [see 23].

105 2. Material and methods 2.1 Bacterial strains, sporulation and spore purification All B. subtilis strains used in the present study are derived from the laboratory wild-type (wt) PY79 or BG214 strains listed in supplementary Table S1. The recA and ku gene fused to the yfp and gfp genes, respectively, were previously described [22, 35]. In a second step the wt recA and ku genes had been replaced by recA-yfp and ku-gfp fusion variants [22, 35]. The strains were routinely cultivated on Luria Bertani (LB; Merck Millipore, Darmstadt, Germany) agar plates. Spores were prepared by cultivation in double-strength liquid Schaeffer sporulation medium [36] with vigorous aeration for 72 hours at 37 °C. Harvested spores were purified by repeated washing steps using sterile water followed by polyethylene glycol 4000 purification treatment for removal of remaining vegetative cells and cell debris as described previously [23]. Spore preparations were free (>99%) of vegetative cells, germinated spores, and cell debris as verified by phase-contrast microscopy. Spores were stored at 4 °C until required.

2.2 Treatment with IR Spores were diluted to give the desired final concentration, aliquoted, and exposed to ionizing radiation (200 keV; 15 mA) generated by an X-ray tube (RS225, X-Strahl, Surrey, UK) at room temperature as described previously [37]. The dosimeter UNIDOS webline with the ionizing chamber TM30013 (PTW, Freiburg, Germany) was used for measuring dose and dose rate. The distance of the samples to the X-ray source was set at 30 cm to provide a constant dose rate of 12.2 Gy/min.

2.3 Recovery and evaluation of spore survival After IR treatment, spore inactivation rates of wt and DNA repair deficient strains listed in Table S1 were determined by a standard colony forming unit (CFU) assay. Treated spores were serially diluted in sterile distilled water and plated on nutrient broth agar plates. After overnight incubation at 37°C CFUs were determined, and. spore survival was derived from the quotient N/N0, with N = average CFU of treated samples and N0 = average CFU of untreated controls. Spore inactivation is expressed as the lethal dose at which 90% of the treated spore population is inactivated (LD90) and was plotted as a function of dose (Gy). All data are expressed as averages ± standard deviations (n = 3). Significances of differences in the survival rates were calculated by analysis of variance (single factor ANOVA). Differences with P values <0.05 were considered statistically significant [37].

106

2.4 Time-course microscopy To address the level of RecA and Ku proteins after treatment with IR, we measured RecA-YFP and Ku-GFP focus formation in reviving B. subtilis spores. Untreated and treated spores, bearing the recA-yfp or ku-gfp variant, with IR were synchronized for 30 min at 70 °C and germinated in double-strength LB medium supplemented with 100 mmol/L L-alanine at 37 °C under vigorous aeration. In 30 min intervals samples were drawn from the culture, rapidly centrifuged for 1 min and the pellet was resuspended in phosphate buffered saline. Cell membranes and nucleic acids were stained with FM4-64 (Molecular Probes, USA) and 4’,6-diamidino-2-phenylindole (DAPI; Sigma, USA), respectively. Images were captured immediately using Nikon Eclipse 90i microscope and NIS-elements AR 3.00, SP7, Hotfix8 (Build 548) imaging software at 100x magnification, using the appropriate filters for imaging of GFP, YFP, FM4-64, and DAPI. Additionally, a phase contrast image was recorded. Exposure times were 20 ms for phase contrast and DAPI and 500 ms for GFP, YFP and FM4- 64. To verify that the synchronization step did not influence GFP and YFP activity, non- synchronized spores were analysed for comparable foci formation in the same manner. Images were processed and foci counts were evaluated using Image J software and the Bio- Format plugin. To calculate percentage of foci formation at least 300 reviving spores were calculated for each germination time point, treatment condition and replicate. Foci intensity (gray value) and size (pixel distance) was measured using ImageJ plot profiles. Non- fluorescent cells were used for background subtraction. Mean values, standard deviations and significances were calculated.

3. Results and discussion 3.1 Spore survival to IR depends on Ku and RecA B. subtilis dormant spores efficiently protect their chromosome from DNA damage by multiple mechanisms [38, 39]. The mechanisms used by dormant haploid B. subtilis spores to remove two-ended DSBs generated by IR (e.g., X-rays) upon spore ripening and outgrowth are poorly understood [38, 39]. Thus, template-dependent HR should be non-operative due to the absence of an intact homologous template. The signal required for commitment towards template-independent DSB repair and the pathway choice during spore outgrowth is poorly understood. Previously it was shown that inactivation of long-range end resection does not affect spore survival to IR-induced two-ended DSB [23]. It is likely that end resection might be

107 inhibited or is non-active during spore revival as NHEJ should otherwise be non-active during outgrowth. This is consistent with the observation that expression of the addAB, recJ, recQ, recS gene was reduced >4-fold during spore outgrowth [31, 32]. Similarly, in eukaryotic cells end resection is blocked during DSB repair via NHEJ [21, 40]. Furthermore, the putative SSA and alt-EJ template-independent DSB repair avenues, as suggested for other bacterial phyla [41, 42], should play a minor role, if at all, in B. subtilis spore survival to IR-induced DSBs, because these repair pathways are constrained by the absence of long range end resection [23]. Effective repair of two-ended DSBs requires Ku, which binds to blunt or near-blunt DNA ends, protects the broken ends from long-range end-resection, recruits LigD and triggers an orchestrated downstream repair process in outgrowing spores [22, 23, 43]. LigD from other bacteria contains a phosphoesterase domain to remove dirty ends [8, 9], but B. subtilis LigD lacks this activity [43, 44], suggesting that basal end-resection by a poorly characterized mechanism might optimizes the substrate for both NHEJ and long-range end resection [24, 45]. To understand the contribution of DNA damage recognition (RecN) and basal resection and/or polymerization (PNPase) of DNA ends, null recN or pnpA mutant spores were exposed to increased doses of IR (Fig. 1A-B). Treatment with IR caused a similar dose- dependent decrease in survival of wt, recN [23] or pnpA spores as determined by CFU assays (Fig.1A). Previously it was shown that inactivation of RecA, RecO, RecF or RecX, and in minor extent blockage of the SOS response, reduced spore survival [23]. Since, HR is constrained by the requirement for an intact homologous template, it was assumed that some HR functions might be required to overcome a DNA replicative stress upon sealing of IR-induced broken ends by NHEJ [23]. To gain further insight into the contribution of damage recognition and basal resection and/or polymerization of the ends, null pnpA recA, pnpA ku, recN ku, recN recA, and recN pnpA mutant spores were exposed to increasing doses of IR (Fig. 1A-B). As control the recA, ku and recA ku strains were also treated with IR. Spores lacking either Ku [22] or RecA [46] were considerably more sensitive to IR relative to wt spores (Fig. 1A-B) [23]. A significant decrease in the LD90-value was observed in the double recA ku mutant spores relative to the more sensitive single mutants variant (Fig. 1B) [23]. Spores lacking RecN and Ku or RecA were as sensitive as the more sensitive

108 single mutant strain (Fig. 1A-B). Spores lacking PNPase and Ku were as sensitive as the more sensitive single mutant, but spores lacking PNPase and RecA showed a moderate decrease in spore survival. It is likely, therefore, that inactivation of PNPase, rather than RecN, contribute to NHEJ during spore survival. Similarly, PNPase was epistatic with Ku in exponentially growing cells upon exposure to IR or H2O2 [24, 45].

Figure 1. Survival of B. subtilis spores deficient in DSB recognition and basal end processing after IR treatment in the dormant state. (A) IR dose dependent survival of wt (○), ku-gfp (■), ΔrecN (), ΔpnpA (), Δku (), ΔpnpA ΔrecN (◊), ΔrecN Δku (▲), and ΔpnpA Δku mutant (▼) mutant spores. The wt and ΔrecN spores were used as controls. (B) IR dose dependent survival of wt (○), recA-yfp (■), ΔrecA (), ΔpnpA (), ΔrecN (), ΔrecA ΔpnpA (▲), ΔrecA ΔrecN (▼) and ΔrecA Δku (◊) mutant spores. The wt and ΔrecA and ΔrecA Δku spores were used as controls.

3.2 Ku accumulates during early stages of spore revival after IR The signal(s) that commit(s) spores to two-ended DSB repair via NHEJ is unknown. The role of NHEJ in DSB repair by means of monitoring the accumulation of the Ku protein in ripening and outgrowing spores after exposure to IR was studied (Fig. 2A-B). B. subtilis spores bearing ku-gfp or recA-yfp constructs showed survival curves similar to the wt strain after IR challenge (Fig. 1A-B), indicating the presence of functional fusion proteins.

109 Upon exposure to an array of molecules, which trigger germination, the spore undergoes rehydration and among other stages transition from a phase-bright spore to a phase-dark cell, as manifested by light microscopy (supplementary Fig. S1A and S2A). No morphological change was evident 60 min into spore revival (germination and ripening period), but at 90 min into revival, spore and nucleoid size increased (outgrowth period) (Fig. S1A-D) [29]. Untreated spores exhibit a very faint diffuse level of fluorescent Ku-GFP signal during spore ripening and outgrowth (Fig. 2A and S1A) [22]. Discrete Ku-GFP foci of comparable size could be detected in 6 to 8% of total unperturbed spores with 2-fold decreasing intensity at the late outgrowth period (Fig. 2B, Table 1). Time-course fluorescence microscopy revealed that IR readily induced Ku expression during spore ripening and outgrowth (Fig. S1B-D). At a low IR dose, Ku-GFP foci formation was induced during spore ripening and early time of outgrowth, compared to non-irradiated controls, and decreased when reaching exponential growth phase (bell-shaped curve) (Fig. 2A-B and S1B-D). The foci showed a relative comparable size (<2-fold variation), and a fluorescence signal varying <3-fold from one focus to another (Fig. S1B-D). The focus localized in the center of the spore core, where the DNA is located (Fig. 2A, S1B-D). Ku-GFP foci formation was observed in spores treated with all tested doses of IR and increased dose- dependently (Fig. 2B). At high doses of IR, spore ripening, outgrowth, and cell elongation with subsequent cell division was observed to be slightly delayed compared to untreated spores (Fig. S1A and S1D). After irradiation with the highest dose (1,000 Gy), the Ku-GFP fluorescence forms a discrete focus that occupied >80% of the nucleoid in ~90% of ripening spores at 30 min (Fig. 2D). At later stages the nucleoid is enlarged and the Ku-GFP fluorescence maintained the comparable size of the discrete focus. The fluorescent intensity was found to increase up to 2.8-fold compared to non-irradiated controls, indicating increased expression levels of Ku during spore revival. The proportion of nucleoid carrying a Ku-GFP focus formation was found to decrease during the late period of outgrowth at IR dose of 100 or 500 Gy, but at a higher dose 70% of the spores contained Ku-GFP foci (Fig. 2B).

110

Figure 2. Time-course microscopy of Ku-GFP activity during spore revival after challenged with IR. (A) Ku-GFP localization in outgrowing B. subtilis spores in untreated or IR challenged dormant spores. Ku-GFP is shown in green, the cell membrane stained with FM4-64 in red, and nucleic acids stained with DAPI in blue. Scale bars represent 2 µm. (B) Comparison of percentage of cells showing Ku-GFP foci in untreated spores (white bars) or after treatment with 100 (light grey), 500 (dark grey) and 1,000 Gy (black) of IR in the dormant state. P-values of ˂0.05 (*), ˂0.01 (**) and ˂0.001 (***) are indicated.

111 3.3 RecA accumulates during spore outgrowth The contribution of RecA in recombination-dependent DNA replication by means of monitoring the accumulation of RecA in ripening and outgrowing spores after exposure to IR was studied. Time-course fluorescence microscopy revealed RecA-YFP foci increased with progressing ripening and outgrowth in untreated spores (Fig. 3A and S2A), indicating the crucial role of RecA in genome replication [23]. The single RecA-YFP focus localized in the center of the outgrowing spore core, where the DNA is located (Fig. 3A and S2A). The discrete foci have a variable size (>3 fold-variation) and a fluorescent signal varied in intensity >8-fold from one focus to another during early outgrowth (Table 1). Up to 50% of total untreated spores showed a discrete RecA-YFP focus at the late revival period (150 min) with the fluorescent signal increased in intensity >13-fold compared to an early outgrowth stage (Fig. 3 and S2A, Table 1). It is likely, therefore, that during spores outgrowth the replication machinery should be stalled, and the ssDNA region should induce the SOS response in a fraction of cells. This is consistent with the observation that: i) low levels of RecA were detected in dormant spores (Table 1) [30], and de novo RecA synthesis in unperturbed reviving spores was detected at 90 min [29] and increased activity of RecA in outgrowing spores at 150 min of revival (considering that ~50% of total cells contain a RecA focus increased in size); and ii) inactivation of RecA, RecO, RecF and RecX plays a crucial role in spore survival, and SOS induction, albeit in minor extent, also contribute to spore survival upon IR treatment [23]. Exposure to IR readily induced RecA-YFP foci formation, in a time-dependent manner, during spore ripening and outgrowth (Fig. 3A and S3A-D). RecA-YFP foci formation was observed in spores treated with all tested doses of IR, and increased dose-dependently (Fig. 3B and S3A-D). Here, we have assumed that the RecA-YFP fluorescent signal was independent of long-range end resection, otherwise NHEJ and DNA replication should be blocked. After irradiation with the highest dose (1,000 Gy) the maximum accumulation of RecA- YFP was observed in ~50 % of all reviving spores after 30 min time with up to 2.5-fold increase in intensity compared to foci in non-irradiated controls. The RecA-YFP fluorescence exhibited high variability in size (>2 fold) and intensity (>8 fold) among foci (Fig. S3D, Table 1). This suggests that the SOS response is operative as early as during the ripening period. However, low levels of RecA were detected in dormant spores, and de novo RecA synthesis in unperturbed reviving spores was detected at 90 min [29, 30].

112

Figure 3. Time-course microscopy of RecA-YFP activity during spore revival after challenged with IR. (A) RecA-YFP localization in outgrowing B. subtilis spores in untreated or IR challenged dormant spores. RecA-YFP is shown in yellow, the cell membrane stained with FM4-64 in red, and nucleic acids stained with DAPI in blue. Scale bars represent 2 µm. . (B) Comparison of percentage of cells showing RecA-YFP foci in untreated spores (white bars) or after treatment with 100 (light grey), 500 (dark grey) and 1,000 Gy (black) of IR in the dormant state. P-values of ˂0.05 (*) and ˂0.01 (**) are indicated.

113 Continuous RecA-YFP foci formation was observed in all treated samples with increasing foci formation in the course of spore outgrowth and > 2-fold changes in fluorescent intensity compared to foci formation in non-irradiated controls (Fig. 3B; Table 1). The dose- and time- dependent accumulation of RecA reflects its importance in recombination-dependent DNA replication and a discrete focus per nucleoid indicated its relevance even during unperturbed cell proliferation (Fig. S3A-D).

4. Conclusion The kinetic of Ku-GFP and RecA-YFP foci formation show opposite profiles. A DSB is detected very quickly by an unknown DSB sensor proteins that subsequently directs signalling and repair via NHEJ during ripening and early stage of spore outgrowth. As reported previously [8, 9], Ku is a low abundant protein that binds free DNA ends, and served to recruit LigD. During revival <10% of the unperturbed spores show a discrete Ku-GFP focus, but RecA-YFP foci formation increased in a time-dependent manner (Fig. 2A, 3A, Table 1). Damage-induced Ku-GFP foci formation occurred at early stages during spore ripening to decrease at a late spore outgrowth stage (Fig. 2B). The Ku-GFP fluorescent signal also increased in haploid and non-replicating natural competence cells [48]. A correlation between Ku accumulation and absence of DNA replication could be inferred. This is consistent with the observation that NHEJ might occur throughout the B. subtilis cell cycle, but it plays a very minor role during exponential growth [16]. Block of initiation of resection is a critical determinant for repair pathway choice, because processed DNA ends are a poor substrate for Ku binding, and cells will be committed to HR (Fig. 4). The pathway choice in bacteria is poorly understood. The first responder to DSB is the damage recognition RecN, in concert with PNPase, followed by long-range end resection (by AddAB or RecJ-RecQ/S-SsbA), RecN-mediated tethering of the damaged DNA ends and indirect blockage of NHEJ, because a 3’-tailed substrate can be used by RecA rather than Ku (Fig. 4A-B) [16, 18]. During spore ripening and outgrowth, the more economical assumption is that increased levels of Ku increase the efficiency of template independent repair of two-ended DSBs, and indirectly decrease the probability of long-range end resection (Fig. 4B). This is consistent with the observation that in reviving spores expression of genes involved in NHEJ (ku and ligD) increased upon damage or after over-expression of the G subunit of the RNA polymerase [22, 31, 32]. At present, the molecular basis of the factor(s)

114 that: i) down regulate(s) expression of long-range end processing genes; ii) increase Ku-GFP expression at early and decrease it at late time of revival; and iii) modulate the interrelationship between DNA replication and Ku expression remain poorly characterized. Similarly, long-range end resection is regulated during the eukaryotic cell cycle to ensure that the commitment is coordinated with DNA replication, and occurs primarily in S and G2 phases of the cell cycle when a sister chromatid is available for HR [20, 49]. In unperturbed spores, the increase RecA-YFP fluorescent signal suggests that RecA accumulates during the late stage during spore revival, and it correlates with the time of DNA replication. It is likely, that the ssDNA regions accumulated during replication fork stalling, in 50% of total reviving spore, are crucial for assembly of RecA in response to replication stress and necessary for SOS induction [16, 18]. However, damage-induced RecA-YFP foci formation might also occur at early stages during spore ripening. Conversely, RecA-GFP focus formation, following IR challenge, occurs in response to DSBs but it does not require or result in SOS induction in exponentially growing B. subtilis cells [50].

Figure 4. DSB repair pathway choices and their regulation. The four DSB repair pathways (NHEJ, HR, SSA and alt-EJ) are depicted. (A) During exponential growth DNA damage recognition, basal and long-range resection process both ends that are preferentially utilized by HR, with long-range resection indirectly inhibiting NHEJ. SSA and Alt-EJ were reported in other bacteria phyla (see text). (B) Competition between RecN and Ku might take place directly on DNA ends. Ku, perhaps in concert with PNPase, can process, bind and join ligatable DNA ends under condition that HR is not operating due to the absence of a homologous template.

115 5. Acknowledgement The authors thank Andrea Schröder for her excellent technical assistance. We would also like to thank Lyle A. Simmons for providing the LAS72 strain. MR and RM were supported in parts by the DLR grant DLR-FuE-Projekt “ISS-Nutzung in der Biodiagnostik” (“Use of the ISS for biodiagonstics”), “Programm RF-FuW, Teilprogramm 475” and the German Research Foundation (DFG) Paketantrag (PlasmaDecon PAK 728) grant (MO 2023/2-1 to RM) and BFU2015-67065-P to JCA. The results of this study will be included in the PhD thesis of the first author MR.

References [1] T. Lindahl, Instability and decay of the primary structure of DNA, Nature, 362 (1993) 709-715. [2] A. Ciccia, S.J. Elledge, The DNA damage response: making it safe to play with knives, Molecular cell, 40 (2010) 179-204. [3] D.T. Goodhead, Initial events in the cellular effects of ionizing radiations: clustered damage in DNA, Int J Radiat Biol, 65 (1994) 7-17. [4] L.H. Thompson, Recognition, signaling, and repair of DNA double-strand breaks produced by ionizing radiation in mammalian cells: the molecular choreography, Mutat Res, 751 (2012) 158-246. [5] S.C. Kowalczykowski, D.A. Dixon, A.K. Eggleston, S.D. Lauder, W.M. Rehrauer, Biochemistry of homologous recombination in Escherichia coli, Microbiol Rev, 58 (1994) 401-465. [6] F. Pâques, J.E. Haber, Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae, Microbiol Mol Biol Rev, 63 (1999) 349-404. [7] C. Wyman, R. Kanaar, DNA Double-Strand Break Repair: All's Well that Ends Well, Annu Rev Genet, 40 (2006) 363-383. [8] S. Shuman, M.S. Glickman, Bacterial DNA repair by non-homologous end joining, Nat Rev Microbiol, 5 (2007) 852-861. [9] R.S. Pitcher, N.C. Brissett, A.J. Doherty, Nonhomologous end-joining in bacteria: a microbial perspective, Annu Rev Microbiol, 61 (2007) 259-282. [10] M.M. Cox, Regulation of bacterial RecA protein function, Crit Rev Biochem Mol Biol, 42 (2007) 41-63.

116 [11] J. San Filippo, P. Sung, H. Klein, Mechanism of eukaryotic homologous recombination, Annu Rev Biochem, 77 (2008) 229-257. [12] D. Branzei, M. Foiani, Maintaining genome stability at the replication fork, Nat Rev Mol Cell Biol, 11 (2010) 208-219. [13] M.R. Lieber, The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway, Annu Rev Biochem, 79 (2010) 181-211. [14] L.S. Symington, J. Gautier, Double-strand break end resection and repair pathway choice, Annu Rev Genet, 45 (2011) 247-271. [15] S.C. West, Molecular views of recombination proteins and their control, Nat Rev Mol Cell Biol, 4 (2003) 435-445. [16] S. Ayora, B. Carrasco, P.P. Cardenas, C.E. Cesar, C. Canas, T. Yadav, C. Marchisone, J.C. Alonso, Double-strand break repair in bacteria: a view from Bacillus subtilis, FEMS Microbiol Rev, 35 (2011) 1055-1081. [17] A. Rodrigue, M. Lafrance, M.C. Gauthier, D. McDonald, M. Hendzel, S.C. West, M. Jasin, J.Y. Masson, Interplay between human DNA repair proteins at a unique double- strand break in vivo, EMBO J, 25 (2006) 222-231. [18] J.C. Alonso, P.P. Cardenas, H. Sanchez, J. Hejna, Y. Suzuki, K. Takeyasu, Early steps of double-strand break repair in Bacillus subtilis, DNA Repair (Amst), 12 (2013) 162-176. [19] S. Burma, B.P. Chen, D.J. Chen, Role of non-homologous end joining (NHEJ) in maintaining genomic integrity, DNA Repair (Amst), 5 (2006) 1042-1048. [20] Y. Aylon, B. Liefshitz, M. Kupiec, The CDK regulates repair of double-strand breaks by homologous recombination during the cell cycle, EMBO J, 23 (2004) 4868-4875. [21] G. Ira, A. Pellicioli, A. Balijja, X. Wang, S. Fiorani, W. Carotenuto, G. Liberi, D. Bressan, L. Wan, N.M. Hollingsworth, J.E. Haber, M. Foiani, DNA end resection, homologous recombination and DNA damage checkpoint activation require CDK1, Nature, 431 (2004) 1011-1017. [22] S.T. Wang, B. Setlow, E.M. Conlon, J.L. Lyon, D. Imamura, T. Sato, P. Setlow, R. Losick, P. Eichenberger, The forespore line of gene expression in Bacillus subtilis, J Mol Biol, 358 (2006) 16-37. [23] I. Vlasic, R. Mertens, E.M. Seco, B. Carrasco, S. Ayora, G. Reitz, F.M. Commichau, J.C. Alonso, R. Moeller, Bacillus subtilis RecA and its accessory factors, RecF, RecO, RecR and RecX, are required for spore resistance to DNA double-strand break, Nucleic Acids Res, 42 (2014) 2295-2307.

117 [24] J. Mascarenhas, H. Sanchez, S. Tadesse, D. Kidane, M. Krishnamurthy, J.C. Alonso, P.L. Graumann, Bacillus subtilis SbcC protein plays an important role in DNA inter- strand cross-link repair, BMC Mol Biol, 7 (2006) 20. [25] P. Stragier, R. Losick, Molecular genetics of sporulation in Bacillus subtilis, Annu Rev Genet, 30 (1996) 297-241. [26] J. Errington, Regulation of endospore formation in Bacillus subtilis, Nat Rev Microbiol, 1 (2003) 117-126. [27] P. Setlow, Spore germination, Curr Opin Microbiol, 6 (2003) 550-556. [28] B.J. Keijser, A. Ter Beek, H. Rauwerda, F. Schuren, R. Montijn, H. van der Spek, S. Brul, Analysis of temporal gene expression during Bacillus subtilis spore germination and outgrowth, J Bacteriol, 189 (2007) 3624-3634. [29] L. Sinai, A. Rosenberg, Y. Smith, E. Segev, S. Ben-Yehuda, The molecular timeline of a reviving bacterial spore, Molecular cell, 57 (2015) 695-707. [30] B. Setlow, P. Setlow, Role of DNA repair in Bacillus subtilis spore resistance, J Bacteriol, 178 (1996) 3486-3495. [31] J.M. Buescher, W. Liebermeister, M. Jules, M. Uhr, J. Muntel, E. Botella, B. Hessling, R.J. Kleijn, L. Le Chat, F. Lecointe, U. Mader, P. Nicolas, S. Piersma, F. Rugheimer, D. Becher, P. Bessieres, E. Bidnenko, E.L. Denham, E. Dervyn, K.M. Devine, G. Doherty, S. Drulhe, L. Felicori, M.J. Fogg, A. Goelzer, A. Hansen, C.R. Harwood, M. Hecker, S. Hubner, C. Hultschig, H. Jarmer, E. Klipp, A. Leduc, P. Lewis, F. Molina, P. Noirot, S. Peres, N. Pigeonneau, S. Pohl, S. Rasmussen, B. Rinn, M. Schaffer, J. Schnidder, B. Schwikowski, J.M. Van Dijl, P. Veiga, S. Walsh, A.J. Wilkinson, J. Stelling, S. Aymerich, U. Sauer, Global network reorganization during dynamic adaptations of Bacillus subtilis metabolism, Science, 335 (2012) 1099-1103. [32] P. Nicolas, U. Mader, E. Dervyn, T. Rochat, A. Leduc, N. Pigeonneau, E. Bidnenko, E. Marchadier, M. Hoebeke, S. Aymerich, D. Becher, P. Bisicchia, E. Botella, O. Delumeau, G. Doherty, E.L. Denham, M.J. Fogg, V. Fromion, A. Goelzer, A. Hansen, E. Hartig, C.R. Harwood, G. Homuth, H. Jarmer, M. Jules, E. Klipp, L. Le Chat, F. Lecointe, P. Lewis, W. Liebermeister, A. March, R.A. Mars, P. Nannapaneni, D. Noone, S. Pohl, B. Rinn, F. Rugheimer, P.K. Sappa, F. Samson, M. Schaffer, B. Schwikowski, L. Steil, J. Stulke, T. Wiegert, K.M. Devine, A.J. Wilkinson, J.M. van Dijl, M. Hecker, U. Volker, P. Bessieres, P. Noirot, Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis, Science, 335 (2012) 1103-1106.

118 [33] J. Muntel, V. Fromion, A. Goelzer, S. Maabeta, U. Mader, K. Buttner, M. Hecker, D. Becher, Comprehensive absolute quantification of the cytosolic proteome of Bacillus subtilis by data independent, parallel fragmentation in liquid chromatography/mass spectrometry (LC/MS(E)), Mol Cell Proteomics, 13 (2014) 1008-1019. [34] P.P. Cardenas, T. Carzaniga, S. Zangrossi, F. Briani, E. Garcia-Tirado, G. Deho, J.C. Alonso, Polynucleotide phosphorylase exonuclease and polymerase activities on single- stranded DNA ends are modulated by RecN, SsbA and RecA proteins, Nucleic Acids Res, 39 (2011) 9250-9261. [35] L.A. Simmons, A.D. Grossman, G.C. Walker, Replication is required for the RecA localization response to DNA damage in Bacillus subtilis, Proc Natl Acad Sci U S A, 104 (2007) 1360-1365. [36] P. Schaeffer, J. Millet, J.P. Aubert, Catabolic repression of bacterial sporulation, Proc Natl Acad Sci U S A, 54 (1965) 704-711. [37] R. Moeller, P. Setlow, G. Horneck, T. Berger, G. Reitz, P. Rettberg, A.J. Doherty, R. Okayasu, W.L. Nicholson, Roles of the major, small, acid-soluble spore proteins and spore-specific and universal DNA repair mechanisms in resistance of Bacillus subtilis spores to ionizing radiation from X rays and high-energy charged-particle bombardment, J Bacteriol, 190 (2008) 1134-1140. [38] P. Setlow, Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals, J Appl Microbiol, 101 (2006) 514-525. [39] P. Setlow, I will survive: DNA protection in bacterial spores, Trends Microbiol, 15 (2007) 172-180. [40] Y. Zhang, E.Y. Shim, M. Davis, S.E. Lee, Regulation of repair choice: Cdk1 suppresses recruitment of end joining factors at DNA breaks, DNA Repair (Amst), 8 (2009) 1235- 1241. [41] R. Gupta, D. Barkan, G. Redelman-Sidi, S. Shuman, M.S. Glickman, Mycobacteria exploit three genetically distinct DNA double-strand break repair pathways, Mol Microbiol, 79 (2011) 316-330. [42] R. Chayot, B. Montagne, D. Mazel, M. Ricchetti, An end-joining repair mechanism in Escherichia coli, Proc Natl Acad Sci U S A, 107 (2010) 2141-2146. [43] M. de Vega, The Minimal Bacillus subtilis Nonhomologous End Joining Repair Machinery, PLoS One, 8 (2013) e64232. [44] A. de Ory, O. Zafra, M. de Vega, Efficient processing of abasic sites by bacterial nonhomologous end-joining Ku proteins, Nucleic Acids Res, 42 (2014) 13082-13095.

119 [45] P.P. Cardenas, B. Carrasco, H. Sanchez, G. Deikus, D.H. Bechhofer, J.C. Alonso, Bacillus subtilis polynucleotide phosphorylase 3'-to-5' DNase activity is involved in DNA repair, Nucleic Acids Res, 37 (2009) 4157-4169. [46] R. Moeller, E. Stackebrandt, G. Reitz, T. Berger, P. Rettberg, A.J. Doherty, G. Horneck, W.L. Nicholson, Role of DNA repair by nonhomologous-end joining in Bacillus subtilis spore resistance to extreme dryness, mono- and polychromatic UV, and ionizing radiation, J Bacteriol, 189 (2007) 3306-3311. [47] P.P. Cardenas, C. Gandara, J.C. Alonso, DNA double strand break end-processing and RecA induce RecN expression levels in Bacillus subtilis, DNA Repair (Amst), 14 (2014) 1-8. [48] D. Kidane, B. Carrasco, C. Manfredi, K. Rothmaier, S. Ayora, S. Tadesse, J.C. Alonso, P.L. Graumann, Evidence for different pathways during horizontal gene transfer in competent Bacillus subtilis cells, PLoS Genet, 5 (2009) e1000630. [49] J.H. Barlow, M. Lisby, R. Rothstein, Differential regulation of the cellular response to DNA double-strand breaks in G1, Molecular cell, 30 (2008) 73-85. [50] L.A. Simmons, A.I. Goranov, H. Kobayashi, B.W. Davies, D.S. Yuan, A.D. Grossman, G.C. Walker, Comparison of responses to double-strand breaks between Escherichia coli and Bacillus subtilis reveals different requirements for SOS induction, J Bacteriol, 191 (2009) 1152-1161.

120 TABLES

Table 1. Size and intensity of Ku-GFP and RecA-YFP foci in B. subtilis spores during early and late outgrowth revival upon IR treatment

Foci 0 Gy 100 Gy 1,000 Gy Revival Sizea Intensityb Size Intensity Size Intensity (min) 30 10 ± 1.0 14.7 ± 3.3 8 ± 1.8 14.2 ±5.2 11 ± 1.9 39.0 ± 10.4c Ku-GFP 150 8 ±1.6 7.9 ± 6.1 7 ± 0.8 11.2 ± 5.2 8 ± 1.9 22.7 ± 9.2c 30 8 ± 1.5 3.4 ± 2.5 8 ± 3.3 7.0 ± 6.0d 10 ± 3.0 8.5 ± 4.4e RecA-YFP 150 14 ± 5.4 46.5 ± 17.2 13 ± 5.7 42.5 ± 9.4 14 ± 4.7 44.9 ± 18.0 aVariation focus size; bvariation of focus signal intensity; cmeaning of three asterisks; dmeaning of one asterisks; emeaning of three asterisks,

121 SUPPLEMENTAL MATERIAL

DNA double-strand breaks commit outgrown Bacillus subtilis haploid spore to nonhomologous end joining

Marina Raguse1, Patrick Eichenberger2, Juan Alonso3, and Ralf Moeller1,*

1 German Aerospace Center (DLR e.V.), Institute of Aerospace Medicine, Radiation Biology

Department, Space Microbiology Research Group, Linder Hoehe, D-51147 Cologne (Köln),

Germany,

2 Center for Genomics and Systems Biology, Department of Biology, New York University,

New York, USA,

3 Department of Microbial Biotechnology, Centro Nacional de Biotecnología, CSIC, 3

Darwin, 28049 Cantoblanco, Madrid, Spain

122

Table S1 Bacillus subtilis strains list.

Strain genotype Source or reference PY79 prototroph Laboratory stock PE959 + ku-gfp, SpecR [1] LAS72 + recA-yfpmut2 [2] BG214 trpCE metA5 amyE1 ytsJ1 rsbV37 xre1 xkdA1 attSPß attICEBs1 Laboratory stock BG809 + ∆ku [3] BG190 + ∆recA [4] BG277 + ∆recN [5] BG993 + ∆pnpA [6] BG1010 + ∆pnpA ∆ku [6] BG995 + ∆pnpA ∆recA [6] BG849 + ∆recA ∆ku [3] BG843 + ∆recN ∆ku [3] BG1063 + ∆recN ∆pnpA [6] BG1529 + ∆recN ∆recA this work

123 FIGURES LEGENDS

Fig. S1. Micrograph of DNA-end-binding protein Ku-GFP localization in outgrowing B. subtilis spores. (A) untreated, and (B-D) after exposure to increasing dose of IR in the dormant state (100 Gy [B], 500 [C], and 1000 Gy [D]). Ku-GFP is shown in green, the cell membrane stained with FM4-64 in red, and nucleic acids stained with DAPI in blue. Scale bars represent 2 µm.

Fig. S2. Micrograph of RecA-YFP localization in outgrowing B. subtilis spores. (A) untreated, and (B-D) after exposure to increasing dose of IR in the dormant state (100 Gy [B], 500 [C], and 1000 Gy [D]). Ku-YFP is shown in yellow, the cell membrane stained with FM4-64 in red, and nucleic acids stained with DAPI in blue. Scale bars represent 2 µm.

Fig. S3. Comparison of induced Ku-GFP (white bars) and RecA-YFP (black bars) activity during spore revival. B. subtilis spores with treatment (A), or after treatment with 100 (B), 500 (C) and 1,000 Gy (D) of IR in the dormant state. P-values of ˂0.05 (*) are indicated.

124 Figure S1

125 B

126 C

127 D

128 Figure S2

129 B

130 C

131 D

132 Fig. S3

References

[1] S.T. Wang, B. Setlow, E.M. Conlon, J.L. Lyon, D. Imamura, T. Sato, P. Setlow, R. Losick, P. Eichenberger, The forespore line of gene expression in Bacillus subtilis, J Mol Biol, 358 (2006) 16-37. [2] L.A. Simmons, A.D. Grossman, G.C. Walker, Replication is required for the RecA localization response to DNA damage in Bacillus subtilis, Proc Natl Acad Sci U S A, 104 (2007) 1360-1365. [3] J. Mascarenhas, H. Sanchez, S. Tadesse, D. Kidane, M. Krishnamurthy, J.C. Alonso, P.L. Graumann, Bacillus subtilis SbcC protein plays an important role in DNA inter-strand cross-link repair, BMC Mol Biol, 7 (2006) 20. [4] P. Ceglowski, G. Luder, J.C. Alonso, Genetic analysis of recE activities in Bacillus subtilis, Mol Gen Genet, 222 (1990) 441-445. [5] J.C. Alonso, G. Luder, R.H. Tailor, Characterization of Bacillus subtilis recombinational pathways, J Bacteriol, 173 (1991) 3977-3980. [6] P.P. Cardenas, B. Carrasco, H. Sanchez, G. Deikus, D.H. Bechhofer, J.C. Alonso, Bacillus subtilis polynucleotide phosphorylase 3'-to-5' DNase activity is involved in DNA repair, Nucleic Acids Res, 37 (2009) 4157-4169.

133 Chapter G

Identification of a conserved 5’-dRP lyase activity in bacterial DNA repair ligase D and its potential role in base excision repair

Ana de Ory, Katja Nagler, Begoña Carrasco, Marina Raguse, Olga Zafra, Ralf Moeller

134 Erstellt mit einer Testversion von PDF Annotator - www.PDFAnnotator.de

Nucleic Acids Research Advance Access published January 29, 2016 Nucleic Acids Research, 2016 1 doi: 10.1093/nar/gkw054 Identiﬁcation of a conserved 5′-dRP lyase activity in bacterial DNA repair ligase D and its potential role in base excision repair Ana de Ory1, Katja Nagler2, Begona˜ Carrasco3, Marina Raguse2, Olga Zafra1, Ralf Moeller2,* and Miguel de Vega1,*

1Centro de Biolog´ıa Molecular ‘Severo Ochoa’ (Consejo Superior de Investigaciones Cient´ıﬁcas-Universidad Autonoma´ de Madrid), Nicolas´ Cabrera 1, 28049 Madrid, Spain, 2Radiation Biology Department, German Aerospace Center (DLR), Institute of Aerospace Medicine, Linder Hoehe, D-51147 Cologne, Germany and 3Centro Nacional de Biotecnolog´ıa (Consejo Superior de Investigaciones Cient´ıﬁcas), Darwin 3, 28049 Madrid, Spain

Received August 07, 2015; Revised January 18, 2016; Accepted January 20, 2016

ABSTRACT genome integrity (1). As bacterial cells often contain multiple partially replicated chromosomes during their vegeta- Bacillus subtilis is one of the bacterial members tive growth, an intact copy of the chromosome is usually provided with a nonhomologous end joining (NHEJ) available to repair DSBs through the faithful homologous system constituted by the DNA-binding Ku homod- recombination pathway in which the information of the in- imer that recruits the ATP-dependent DNA Ligase tact duplex is used as template for DNA synthesis across D(BsuLigD) to the double-stranded DNA breaks the break (2). However, many bacterial species spend much (DSBs) ends. BsuLigD has inherent polymerization of their life cycle in stationary phase during which only a and ligase activities that allow it to fill the short single copy of the chromosome is present. In most of these gaps that can arise after realignment of the broken cases the bacterium is also endowed with a two-component ends and to seal the resulting nicks, contributing nonhomologous end-joining (NHEJ) system (3) that mends to genome stability during the stationary phase and DSBs through the direct joining of the DNA ends (3,4). Bacterial NHEJ is composed of the homodimer Ku, homol- germination of spores. Here we show that BsuLigD ′ ogous to the eukaryotic counterpart (5,6), and the dedicated also has an intrinsic 5 -2-deoxyribose-5-phosphate multifunctional ATP-dependent DNA ligase D (LigD). Ex- (dRP) lyase activity located at the N-terminal ligase tensive characterization of these proteins both in vitro and domain that in coordination with the polymerization in vivo has allowed envisioning how NHEJ operates in bac- ′ and ligase activities allows efficient repairing of 2 - teria (7–10). Briely, the NHEJ repair process starts with the deoxyuridine-containing DNA in an in vitro reconsti- recognition and binding of Ku to both sides of the DSB by tuted Base Excision Repair (BER) reaction. The re- threading the DNA through its open-ring structure. LigD quirement of a polymerization, a dRP removal and is further recruited by Ku to mediate the synapsis event re- a final sealing step in BER, together with the joint quired for end-joining. LigD often has a phosphoesterase ′ participation of BsuLigD with the spore specific AP (PE) activity that heals 3 -ends (11,12); a polymerase activ- endonuclease in conferring spore resistance to ul- ity that ills the gaps that arise after the synapsis; and an intrinsic ATP-dependent ligase activity that inally seals the trahigh vacuum desiccation suggest that BsuLigD ends (3,4). Due to the processing of the ends by nucleolytic could actively participate in this pathway. We demon- and/or polymerization activities before inal ligation, this strate the presence of the dRP lyase activity also in pathway is often mutagenic (8,13,14). the homolog protein from the distantly related bac- Base excision repair (BER) is the most frequently used terium Pseudomonas aeruginosa, allowing us to ex- DNA repair pathway in vivo and responsible for the repair pand our results to other bacterial LigDs. of a broad spectrum of non-bulky and non-helix distorting lesions. The increasing number of proteins involved in BER INTRODUCTION has led to deine multiple branches of this repair pathway [see review in (15)]. The general BER process starts with DNA double strand breaks (DSBs) are the most danger- the detection and further removal of the lesion by a spe- ous lesions whose repair is essential for maintenance of

*To whom correspondence should be addressed. Tel: +34 911964717; Fax: +34 911964420; Email: [email protected] Correspondence may also be addressed to Ralf Moeller. Tel: +49 2203 601 3145; Fax: +49 2203 61790; Email: [email protected]

C The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.

135 2 Nucleic Acids Research, 2016 ciic N-glycosylase. The resultant AP site is recognized and endonuclease. Altogether the results lead us to surmise that processed by AP endonucleases or AP lyases that incise at BsuLigD with a forespore AP endonuclease could consti- the 5′ and 3′ sides of the AP site, respectively, requiring fur- tute a new branch of the BER pathway to mend AP sites ther cleaning of the 3′-end by exonucleases and the 5′-dRP during spore germination. terminus by dRPases to leave ligatable 3′-OH and 5′-P termini. A DNA polymerase then closes the gap and a DNA ligase seals the inal nick. Bacillus subtilis is a Gram+ spore-forming bacterium MATERIALS AND METHODS with a NHEJ system constituted by Ku (BsuKu) and LigD Proteins and reagents (BsuLigD) and whose genes are expressed in the developing spore (16). Deletion of those genes sensitizes B. sub- Unlabeled nucleotides were purchased from GE Health- 32 ′ 32 tilis cells to ionizing radiation in the stationary phase (10) care. [␣ P]-Cordycepin (3 -dATP) and [␥ P]-ATP were and their spores to several DNA-damaging treatments that obtained from Perkin Elmer Life Sciences. Substrates were ′ 32 cause DSBs (16–18). BsuKu interacts functionally with and radiolabeled at the 3 endwith[␣ P]-Cordycepin and ter- ′ stimulates BsuLigD enabling it to generate synaptic inter- minal deoxynucleotidyl transferase (TdT) or at the 5 end 32 mediates to repair DSBs through the coordinated action of with [␥ P]-ATP and T4 polynucleotide kinase (T4PNK). the polymerization and ligase activities (19). Unlike other TdT, T4PNK, human AP endonuclease I (hAPE1), E. coli bacterial LigDs, BsuLigD does not have nuclease activity Uracil DNA Glycosylase (UDG) and E. coli EndoIII, were as it lacks the PE domain. Therefore, in this case other bac- from New England Biolabs. Thrombin was obtained from terial DNA end-cleaning proteins could heal the 3′-ends. Novagen. BsuLigD was puriied as described (19). Besides its DNA-binding and BsuLigD recruitment roles, BsuKu is also provided with an AP/5′-dRP lyase activity that makes this protein able to process ends with near termi- Preparation of the DNA substrates nal AP sites during the NHEJ pathway (20). The presence of the AP lyase activity in the ortholog from the Gram− bac- To prepare a blunt DNA with an internal 2′-deoxyuridine, a terium Pseudomonas aeruginosa suggests that this activity 34-mer oligonucleotide containing 2′-deoxyuridine at posi- could be a general feature of bacterial Ku (20), and similar tion 16 (oligo 1: 5′-CTGCAGCTGATGCGCUGTACGG to that of the eukaryotic homolog (21–23). ATCCCCGGGTAC) was either 3′-or5′-labeled, as indi- Although classically repair of AP sites has relied on the cated, and annealed to its complementary oligonucleotide recognition and incision of the abasic site by the BER AP (oligo 2: 5′-GTACCCGG GGATCCGTACGGCGCAT endonucleases and further release of the 5′-dRP moiety by CAGCTGCAG). A gap-illed BER substrate mimicking the lyase activity of a specialized DNA polymerase, as the the situation prior to 5′-dRP release was prepared by hy- eukaryotic polymerases ␤ (24), ␫ (25), ␭ (26)and␪ (27), bridizing a templating oligonucleotide (oligo 3: 5′-CCG there is an increasing number of proteins provided with TACTGCGCATCAGCTGATCACAGTGAGTAC) to a a5′-dRP lyase activity that could participate in protect- downstream 3′-labeled oligonucleotide (oligo 4: 5′-P-UAG ing cells against AP sites, a fact that could relect the im- CTGATGCGCAGTACGG) and either to the upstream portance for processing such an abundant and deleterious oligonucleotide 5 (5′-GTACTCACTGTGATC) (hybrid A) DNA damage [reviewed in (28)]. Thus, in addition to the or 6 (5′-GTACTCACTGTGATddC) (hybrid B). The 5′- DNA repair polymerases mentioned above, the Escherichia lapped structures were obtained after hybridization of coli DNA polymerase I has been shown to have a dRP- the templating oligonucleotide 7 (5′-CTGCAGCTGATGC lyase activity although its biological signiicance has not GCGTACTCACTGTGATC) to upstream oligonucleotide been established (29). Proteins involved in the nucleotide 8(5′-GATCACAGTGAGTAC) and either to the 3′- excision repair (NER) pathway as UvrA, have also been labeled 34-mer downstream oligonucleotide 9 (5′-GTACC demonstrated to interact with AP-sites, pointing to a poten- CGGGGATCCGTACUGCGCATCAGCTGCAG), that tial role of NER as a back-up pathway of AP-sites repair in contains 2′-deoxyuridine at position 19 (hybrid C) or bacteria (30). Mammalian glycosylases NEIL-1, -2 and -3 to the 3′-labeled 34-mer downstream oligonucleotide areabletoremove5′-dRP lesions at a similar extent of Pol 10 (5′-GTACCCGGGGATCCGTACHGCGCATCAGC ␤, and can substitute for Pol ␤ 5′-dRP lyase in an in vitro TGCAG), that harbors a THF (H) at position 19 (hybrid BER assay (31). The mammalian high mobility group pro- D). Templating oligonucleotide 3 was hybridized to the teins HMGA, which are chromatin architectural factors, ef- downstream 3′-labeled oligonucleotide 11 (5′-CTGUAGC iciently remove 5′-dRP groups, protecting cells from DNA TGATGCGCAGTACGG) and to the upstream oligonu- damaging agents that cause AP sites (32). Other proteins in- cleotide 5 to obtain another 5′-lapped structure (hybrid volved in regulation of the eukaryotic BER as PARP-1 and E). The 3′-labeled oligonucleotide 10 was annealed to its -2 also show a 5′-dRP lyase although much weaker than the complementary oligonucleotide (oligo 12: 5′-CTGCAGC one of Pol ␤, which is the main processor of 5′-dRP ends TGATGCGCAGTACGGATCCCCGGGTAC) to obtain during eukaryotic BER (33,34). a blunt substrate harboring a THF at position 19. To pre- Here we show that BsuLigD, besides its polymerization pare the nicked molecule (hybrid F), a 28-mer templating and ligase activities has an inherent and novel 5′-dRP lyase oligonucleotide (oligo 13: 5′-ACTGGCCGTCGTTGTAC activity. This enables the protein to eficiently perform the TCACTGTGATC) was hybridized to the 5′-labeled 15-mer gap-illing, 5′-dRP-release and inal sealing on a DNA sub- downstream oligonucleotide 8 and to a 13-mer upstream strate containing an AP site previously incised by an AP oligonucleotide (oligo 14: 5′-pAACGACGGCCAGT).

136 Nucleic Acids Research, 2016 3

In vitro reconstitution of single-nucleotide BER reaction buffer for 1 h at 20◦C in a total volume of 15 ␮l. Af- ter incubation for 30 min on ice, samples were analyzed by Oligonucleotide 1, 3′ or 5′-radiolabeled was hybridized to 10% SDS-PAGE followed by Coomassie blue staining and oligonucleotide 2 to obtain a 34-mer double- stranded DNA autoradiography of the dried gel. When indicated 4.1 nM substrate. Reactions (12.5 ␮l) contained 0.53 nM of the hy- of the 3′-labeled hybrid E was used as substrate. The hybrid brid, 30 mM Hepes, pH 7.5, 4% glycerol (v/v), 27 nM E. was treated with 27 nM E. coli UDG for 15 min at 37◦Cin coli UDG, 5 nM hAPE1, 0.64 mM MnCl and the indi- 2 thepresenceof30mMHepes,pH7.5,4%glycerol.4nMof cated concentration of the corresponding nucleotide. Reac- the resulting DNA was incubated with either 100 nM of pu- tions were initiated by adding 57 nM puriied BsuLigD, as riied BsuLigD or PaeLigD or 147 nM of LigDom. Samples indicated. Samples were incubated at 30◦C for 30 min. Af- were processed as mentioned above. ter incubation freshly prepared NaBH4 was added to a inal concentration of 100 mM, and the reactions were further incubated for additional 20 min on ice. Stabilized (reduced) AP lyase activity assay on 2′-deoxyuridine or THF contain- DNA products were ethanol-precipitated in the presence of ing substrates 0.2 ␮g/ml tRNA, resuspended in water and analyzed by 8 A concentration of 0.53 nM of the 2′-deoxyuridine- M urea-20% PAGE and autoradiography. containing hybrids C or D was treated with 27 nM E. coli ◦ ′ UDG for 15 min at 37 C in the presence of 30 mM Hepes, 5 -dRP lyase activity on gap-illed BER intermediates pH 7.5, 4% glycerol. After incubation the mixture was sup- A concentration of 0.96 nM of the indicated hybrid A plemented with 3.5 nM of EndoIII, 5 nM hAPE1 or the ′ indicated increasing concentrations of BsuLigD. Samples (upstream primer DNA with a 3 -dCMP) or B (upstream ◦ primer DNA with a 3′-ddCMP) was treated with 27 nM were incubated at 30 C for 30 min and reactions were pro- E. coli UDG for 15 min at 37◦C in the presence of 30 mM cessed as described in the single-nucleotide BER assay Hepes, pH 7.5, 4% glycerol. After incubation the mixture was supplemented with 3.5 nM of EndoIII or 60 nM of the Cloning and overexpression of P.aeruginosa LigD (PaeLigD) indicated LigD or 228 nM of the BsuLigDom in the absence The P.aeruginosa gene PA2138 encoding PaeLigD was syn- or presence of 0.64 mM MnCl2, as indicated. Samples were incubated at 30◦C for 30 min and reactions were processed thesized by the GenScript Corporation and cloned between as described in the single-nucleotide BER assay. the NdeI and BamHI of bacterial expression vector pET- 16b that allows expression of the recombinant protein fused to a N-terminal (His)10-tag followed by a thrombin target. Steady-state kinetic parameters of the dRP lyase reaction E. coli BL21(DE3) cells were transformed with the recombi- To quantify the kinetic parameters of the 5′-dRP lyase ac- nant expression plasmid pET-16PaeLigD and grown in LB ◦ tivity, 5′-dRP release was measured as a function of 5′-dRP medium at 37 C in the presence of ampicillin until the A600 site concentration, as described in (35,36). Thus, increasing reached 0.6. Expression of the His-tagged PaeLigD pro- concentrations (0–2000 nM) of hybrid B (upstream primer tein was induced with 0.5 mM IPTG and further incubation DNA with a 3′-ddCMP) were treated extensively with E. for 20 h at 15◦C, as described (37). Cells were thawed and coli UDG (as described above) to render the 5′-dRP group, ground with alumina at 4◦C. The slurry was resuspended and further incubated with 50 nM BsuLigD. After incuba- in Buffer A (50 mM Tris-HCl, pH 7.5, 0.7 M NaCl, 7 mM tion for 20 min at 30◦C, reaction products were stabilized ␤-mercaptoethanol, 5% glycerol) and centrifuged for 5 min ◦ by incubation with 100 mM of freshly prepared NaBH4 at 6506 x g,at4 C to remove alumina and intact cells. The for 20 min on ice. Stabilized (reduced) DNA products were recombinant PaeLigD protein was soluble under these con- ethanol-precipitated in the presence of 0.2 ␮g/ml tRNA, re- ditions, since it remained in the supernatant after a new cen- suspended in water and analyzed by 8 M urea-20% PAGE trifugation for 20 min at 234306 x g, to separate insoluble −1 and autoradiography. The kobs (min ) was plotted against proteins from the soluble extract. The soluble extracts were the DNA concentration. Michaelis–Menten constant Km loaded onto a Ni-NTA column (QIAgen) pre-equilibrated and kcat were obtained by least-squares nonlinear regression with Buffer A (0.7 M NaCl, 4 mM imidazole). The bound to a rectangular hyperbola using Prism 5 software. The val- protein was eluted with 200 mM imidazole in Buffer A (0.7 ues plotted are the mean of three independent experiments. M NaCl) and further diluted with Buffer A (1 mM EDTA) without NaCl to get a inal 0.3 M NaCl. The sample was applied to a phosphocellulose column preequilibrated with NaBH trapping assay 4 Buffer A (0.3 M NaCl, 1 mM EDTA). The bound protein The 3′ labeled-1/2 hybrid was treated with 27 nM E. coli was eluted with Buffer A (0.4 M NaCl, 1 mM EDTA). The UDG for 15 min at 37◦C in the presence of 30 mM Hepes, puriied protein was inally dialyzed against a buffer con- pH 7.5, 4% glycerol. After incubation, the mixture was sup- taining 0.25 M NaCl and 50% glycerol and stored at −20◦C. plemented with 5 nM hAPE1 and 1 mM MnCl2 and incubated at 37◦C for 30 min. A concentration of 2.6 nM of Overexpression of BsuLigD Ligase domain (LigDom) the resulting DNA was incubated with 95 nM of puriied BsuLigD and 10 ␮M of CTP during 2.5 min, forming a The recombinant expression plasmid pET28-BsuLigD (19) Schiff base intermediate which is trapped by the addition of was used as template to introduce a stop codon at po- 100 mM NaCl or freshly prepared NaBH4. When indicated, sition 320 with the QuikChange site-directed mutage- BsuLigD was pre-incubated with 0.05 U of Thrombin in its nesis kit provided by Stratagene resulting in plasmid

137 4 Nucleic Acids Research, 2016 pET28-LigDom. Cells, previously transformed with plas- 3′ primer with a SacI site. The EcoRV-SacII digested neo mid pET28-LigDom, were grown overnight in LB medium gene was cloned between the ykoU (or ykoUE184A)and at 37◦C in the presence of kanamycin. Cells were diluted ykoT genes in the above pUC18 plasmid. Plasmid-borne ◦ into the same media and incubated at 30 C until the A600 ykoU neo ykoT or ykoUE184A neo ykoT operon was used to reached 0.6. Then, IPTG (Sigma) was added to a inal con- transform B. subtilis (strain BG214) competent cells, as pre- centration of 0.5 mM and incubation was continued for 2 h viously described (38). NeoR transformants were sequenced at 30◦C. Cells were thawed and ground with alumina at 4◦C. to select those with the chromosomal-encoded neo gene be- The slurry was resuspended in Buffer A (50 mM Tris-HCl, tween wild type (wt) ykoU and ykoT genes (strain BC1000) pH 7.5, 0.5 M NaCl, 7 mM ␤-mercaptoethanol, 5% glyc- or between ykoUE184A and ykoT genes (strain BC1001) erol) and centrifuged for 5 min at 6506 x g,at4◦Ctoremove (Supplementary Table S1). GP1502 DNA was used to trans- alumina and intact cells. The recombinant LigDom was sol- form BC1000 strain to render the BC1002 strain. Plasmid- uble under these conditions, since it remained in the super- borne ykoUE184A neo ykoT operon was used to transform natant after a new centrifugation for 20 min at 234306 x g, the B. subtilis BC1002 strain (Δnfo) to get strain BC1003 to separate insoluble proteins from the soluble extract. The (Supplementary Table S1). soluble extracts were diluted with Buffer A without salt to a inal 0.25 M NaCl concentration and further loaded onto a Ni-NTA column (QIAgen) pre-equilibrated with Buffer A Bacterial strains and spore preparation (0.25 M NaCl, 5 mM imidazole). The bound protein was All bacterial strains used in this study are derivatives of 168 eluted with 200 mM imidazole in Buffer A (0.25 M NaCl) strains and are listed in Supplementary Table S1. Spores and further dialyzed against Buffer A (0.3 M NaCl, 50% were obtained by cultivation under vigorous aeration in glycerol, 1 mM EDTA, 0.05% Tween) and stored at −20◦C. double-strength liquid Schaeffer sporulation medium (39), and spores were puriied and stored as described previously Ligation assay to a 5′-dRP end (18,40,41). When appropriate, chloramphenicol (5 ␮g/ml), kanamycin (10 ␮g/ml),orerythromycin(2␮g/ml) was 3′-labeled hybrid 10/12 was treated with hAPE1 for 30 min added to the medium. Spore preparations consisted of sin- at 37◦C in the presence of 30 mM Hepes, pH 7.5, 4% glycerol gle spores with no detectable clumps and were free (99%) of and 1mM MnCl2. The resulting DNA was column puriied growing cells, germinated spores and cell debris, as seen with and 0.53 nM of the nicked substrate was further treated ei- a phase-contrast microscope (18,40,41). The puriied spores ther with BsuLigD or T4 DNA ligase in the presence of 30 were resuspended in 5 ml of distilled water and stored until mM Hepes, pH 7.5, 4%glycerol. Different concentrations of inal usage at 4◦C. MnCl2 were assayed, in the absence or presence of 0.1 mM ATP. Samples were incubated at 30◦ C for 30 min and reactions were stopped by adding EDTA up to 10 mM and Assaying spore resistance to extreme dryness [ultrahigh vac- analyzed by 8M urea-20% PAGE and autoradiography. uum (UHV)] Spore samples consisted of air-dried spore monolayers im- Site-Directed mutagenesis of BsuLigD mobilized on 7-mm in diameter stainless steel discs and were exposed 7 days to UHV produced by an ion-getter pumping BsuLigD mutants K24A, K189A, K206A, K208A and system (400l/s; Varian SpA, Torino, Italy) reaching a inal E184A were made by using the QuickChange site-directed pressure of 3 × 10−6 Pa (18,41,42). The spores immobilized mutagenesis kit (Agilent Technologies). Plasmid pET28a- on quartz discs were recovered by 10% aqueous polyvinyl BsuLigD containing the BsuLigD gene was used as tem- alcohol solution as described previously (18,42). The ap- plate for the reaction (19). The presence of the mutation and propriate dilutions of treated and untreated spore samples the absence of additional ones were determined by sequenc- were plated on NB agar plates in order to count CFUs as ing the entire gene. BsuLigD mutants were expressed in E. TM a measure of spore survival. The CFUs of untreated spore coli SoluBL21 cells (Genlantis) and further puriied as samples were represented as 100% survival. The UHV ex- described for the wild-type BsuLigD (19). periment was performed in triplicate. The CFUs of UHV- treated spores were divided with the average CFU-value of Construction of B. subtilis strains expressing the BsuLigD untreated spore samples in order to obtain the survival af- E184A mutant ter UHV. The data presented are expressed as average values with standard deviations. The percentage of survivals of BsuLigD gene (ykoU) containing the mutation E184A was treated spores was compared statistically using Student’s t- ampliied from plasmid pET-BsuLigD-E184A (see above) ′ ′ test and differences with P-values of ≤0.05 were considered with a 5 primer containing an XmaI site and a 3 primer statistically signiicant (18,41,42). containing an EcoRV and XbaI sites. The ampliied fragment was cloned into the XmaI-XbaI sites of a pUC18 plasmid. ykoT gene, placed downstream of ykoU was ampliied RESULTS ′ from the B. subtilis chromosome with a 5 primer containing ′ BsuLigD removes 5 -dRP groups an XbaI and a SacII restriction sites, and a 3′ primer with a PstI site. This gene was cloned into the above plasmid. The Previous studies showed the ability of the BsuLigD to ac- pUB110 derived neomicin resistant (NeoR)geneneo (38) commodate to preformed short gaps 1–2 nt long achiev- was ampliied with a 5′ primer containing an EcoRV and a ing their eficient illing mediated by speciic recognition of

138 Nucleic Acids Research, 2016 5 the 5′-P group at the distal margin of the gap and further Altogether the results imply that BsuLigD ills the gap sealing of the resultant nick (19). B. subtilis AP endonucle- restoring the original (repaired) nucleotide, disclosing a new ases have been reported to be required to repair the AP sites activity of the protein, the ability to release the dangling that accumulate during spore dormancy (43–45). This fact 5′-dRP group to generate a canonical and ligatable nick suggests that BER should be active during spore germina- with 3′-OH and 5′-P ends, further sealed by the inherent tion and outgrowth, and consequently the 1-nt gaps result- ligase activity of the enzyme. It is noteworthy that unlike ing from the action of the AP endonucleases on the abasic other polymerases involved in gap-illing and 5′-dRP re- sites should be illed by a polymerization activity to allow lease during BER as eukaryotic polymerases ␤ (24), ␫ (25), further sealing of the break. The expression of BsuLigD in ␭ (26)and␪ (27), BsuLigD is not able to act on the dRP- the forespore (16) prompted us to gauge the competence moiety directly on this substrate (see lane c in Figure 1B). of the enzyme to resume gap-illing in BER intermediates The prior illing step requirement would indicate that the where the gap is lanked by a 3′-OH and a 5′-dRP group. To optimal substrate for this activity requires the upstream 3′ this end, a double-stranded oligonucleotide with a dUMP end to be placed adjacent to the last phosphodiester bond at position 16 of the 32P-5′-labeled strand (see left panel in of the downstream strand. In agreement with this hypoth- top of Figure 1,lanea in Figure 1A) was treated with E. esis, the negligible 5′-dRP release observed in the presence coli UDG to render an AP site. Further incubation with of ddCTP (<9%; Figure 1B, lane d) would be due to the hAPE1 released a nicked molecule with a 5′-dRP end (op- low primer extension activity observed with this nucleotide posite to dGMP in the template strand, lane b in Figure (Figure 1A, lane d). 1A). As observed, BsuLigD catalyzed eficient template directed addition of both dCMP (lane e) and CMP (lane f), ′ Excision of 5 -dRP groups by BsuLigD proceeds through a extending the 75% and 90% of the primer molecules, re- ␤-elimination mechanism spectively, discriminating against ddCMP insertion (lane d; 29% of the primer molecules extended) as here the forma- In the above assays the requirement of Mn2+ ions for the tion of the network of direct and water-mediated contacts gap-illing step prevented the analysis of the metal depen- between the protein and the ribose O2′ and O3′ is precluded dency of the 5′-dRP release by BsuLigD. Therefore, sim- (46). Intriguingly, besides the expected +1 (16-mer) elonga- ilar experiments were conducted using a DNA hybrid as tion product, the enzyme gave rise to a 34-mer product with substrate mimicking the situation previous to the dRP re- CTP (corresponding to the 33% of the primer molecules). lease, with the 3′-OH end of the upstream strand adjacent Direct ligation of the 3′-OH and the 5′-dRP ends can be to the last phosphodiester bond between the penultimate ruled out as no ligation products were detected in the ab- 5′ nucleotide and the terminal 5′-dRP group of the down- sence of nucleotides (lane c), being tempting to speculate stream strand (see scheme at the top of Figure 2). Under that BsuLigD could remove the 5′-dRP moiety and seal these conditions, the absence of divalent cations did not im- the resulting 5′-P with the 3′-OH group of the elongated pede the release of the 5′-dRP group by BsuLigD (Figure 2, primer strand. To test this hypothesis the 3′-end of the U- lane c), pointing to a metal independent dRP lyase activity. containing strand was labeled (see right panel in top of Fig- Although unnecessary, the addition of Mn2+ to the reaction ure 1,lanea in Figure 1B). The 5′-dRP end that resulted af- improved the dRPase activity of BsuLigD (Figure 2,laned). ter treatment with E. coli UDG and hAPE1 remained stable Maybe the presence of this metal ion (the preferred cation throughout the assay (Figure 1B, lane b). As shown, once for both the polymerization and ligase activities of BsuLigD the gap is illed after insertion of either the deoxy- (lane e) (19)) assists the stable/proper binding of the protein to the or the ribonucleotide (lane f), BsuLigD removes 47% and DNA substrate, as described for the 5′-dRP lyase activity the 68%, respectively, of the 5′-dRP groups as detected by of Pol ␤ (24,36). As shown, further addition of alkali did the size reduction of the labeled substrate (19-mer 5′-P), in not hydrolyze the 34-mer product, supporting the notion good agreement with the presence of a dRPase activity in that the repaired DNA was not the result of a direct ligation the enzyme. In addition, illing with CTP allowed inal liga- of the upstream strand to the 5′-dRP group (Figure 2,lane tion of the nick (49% of the 19-mer 5′-P molecules) to yield e). Similar results were obtained with a substrate bearing a a repaired 35-mer long molecule (the 3′-labeling excludes ddNMP at the 3′ end of the upstream strand (see Figure 2, that the 35-mer product is the outcome of the complete right panel). As expected, in this case no ligation products replication of the template by BsuLigD), relecting a strong were observable. These results indicate that the dRP-release propensity of the enzyme for sealing nicks with a monori- activity is not the result of an in-line attack of the last phos- bonucleotide on the 3′ end of the break, a functional signa- phodiester bond by the 3′-OH group that could mimic the ture of bacterial NHEJ ligases that distinguishes them from mode of action of DNA ligases (47). the other polynucleotide ligases (47,48). In this sense, it has 5′-dRP release by DNA polymerases ␤, ␫, ␭, ␪ and ␥ been speculated that bacterial NHEJ ligases could be un- proceeds through ␤-elimination, a mechanism that involves able to distort the DNA 3′-OH terminus into the RNA-like generation of a Schiff-base intermediate and that allowed A conformation observed in other ATP-dependent DNA categorizing the activity as a 5′-dRP lyase (24–27,35). To ligases that do not discriminate between DNA and RNA elucidate whether this was also the case with BsuLigD, we ′ in the 3 -OH strand (47). Such a distortion would not be took advantage of the ability of NaBH4 to reduce a Schiff- required with a 3′-monoribonucleotide, facilitating produc- base intermediate to form a covalent protein-DNA com- tive ligation by bacterial LigDs (48). plex. Therefore, if the mechanism of catalysis of BsuLigD involves a Schiff-base intermediate, addition of NaBH4 to the gap-illing reaction described above should permit trap-

139 6 Nucleic Acids Research, 2016

Figure 1. BsuLigD performs complete repair of a BER substrate. Top: schematic representation of the formation of a BER substrate indicating the lengths of the original substrate (32P-5′-labeled in left panel or ␣ 32P-cordycepin-3′ labeled in right panel) and products after incubation with E. coli UDG and hAPE1. Bottom: autodiagrams illustrating the ability of BsuLigD to repair a BER intermediate. Experiments were performed as described in Materials and Methods. When indicated reactions were incubated in the presence of 57 nM BsuLigD and either 300 ␮MddCTP,10␮MdCTPor10␮M CTP. After incubation for 30 min at 30◦C, samples were analyzed by 8 M urea-20% PAGE and autoradiography. Position of products is indicated. The igure is a composite image made from different parts of the same experiment. ping of a DNA-protein complex that would be detected by although cleavage generally occurs at a very low eficiency autoradiography after separation by SDS-PAGE. As shown (50). To ascertain that the 5′-dRP lyase activity exhibited in Figure 3A, BsuLigD forms a stable adduct with the 3′ by LigD was indeed catalytic the activity was assayed unlabeled 5′-dRP-containing 19-mer strand that was depen- der steady-state conditions as described in (35,36)onthe dent on both, addition of NaBH4 andpresenceofanAP above DNA hybrid. The apparent Km for this DNA and the −1 site in the DNA (Figure 3B). These results indicate that kcat were 2 ± 0.65 ␮M and 0.88 ± 0.17 min , respectively ′ the 5 -dRP removal activity of BsuLigD proceeds through (see Supplementary Figure S1). Therefore, BsuLigD kcat is ␤-elimination. Removal of the fused N-terminal His-tag 5-fold lower than that of Pol ␤ assayed on preincised AP- −1 from BsuLigD after incubation with thrombin gave rise to DNA (4.5 min )(36), but still 3-fold higher than the kcat DNA-BsuLigD adducts whose faster migration paralleled of the 5′-dRP lyase activity of Pol ␭ (0.26 min−1)(35). These the electrophoretical pattern of the puriied protein, indi- results, together with the coupling of the 5′-dRP lyase activ- cating that the 5′-dRP lyase activity is intrinsic to BsuLigD ity to polymerization and its improvement in the presence (Figure 3A) and ruling out the presence of a contaminant of Mn2+ ions, lead us to conclude that the 5′-dRP lyase of AP lyase from the expression bacteria E. coli. BsuLigD is catalytic. The presence of nonenzymatic AP lyase activity has The capacity of BsuLigD to release a 5′-dRP group led been described in basic cellular macromolecules such as us to evaluate its ability to recognize and incise an internal polyamines or histones and in other basic molecules includ- AP site, as traditionally 5′-dRP lyases have been considered ing tripeptides such as Lys-Trp-Lys and Lys-Tyr-Lys (49), a subset of AP lyases (51). To this end, the lapped DNA

140 Nucleic Acids Research, 2016 7

log resistant to the ␤-elimination reaction (24,28) inhibited the BsuLigD activity (Figure 4, right panel).

The presence of a 5′-dRP lyase activity is conserved in other bacterial LigDs The unforeseen presence of a 5′-dRP lyase activity in BsuLigD led us to analyze whether this activity is speciic to the B. subtilis protein or, by the contrary if its presence can be extended to other bacterial LigDs. To this end, we puriied the 94 kDa Pseudomonas aeruginosa LigD (PaeLigD; see Materials and Methods) since (i) it has been used as model for bacterial LigDs for years (3,4), (ii) shows a con- iguration different from BsuLigD because it contains an additional N-terminal PE domain and (iii) it comes from aGram− bacterium. As shown in Figure 5 (left panel), the puriied PaeLigD possesses a non metal-dependent 5′- dRP lyase activity since it releases the 5′dRP moiety from the 3′-labeled substrate yielding the 19-mer 5′P product Figure 2. BsuLigD performs non-metal-dependent release of the 5′-dRP moiety. Top: schematic representation of the substrates used in the as- that is adenylated at some extent by the proportion of the say and corresponding to a illed gap with a dangling 5′-dRP group in AMP-PaeLigD complexes coming from the expression bac- the downstream strand and either a 3′-OH (left) or dideoxy (right) ter- terium, as described (20,48,53). In the presence of Mn2+ minus. Bottom: autodiagrams showing the release of the 5′-dRP group by ions PaeLigD rendered a repaired 34-mer ligation product. BsuLigD. Reactions were performed as described in Materials and Meth- ods in the presence of either 3.5 nM EndoIII (lanes b and g)or57nM As shown in Supplementary Figure S3, puriied PaeLigD is BsuLigD (lanes c, d, e, h and i). After incubation during 30 min at 30◦C, cross-linked to the DNA after reduction with NaBH4. Alto- samples were analyzed by 8 M urea-20% PAGE and autoradiography.Posi- gether, the results allow us to widen the presence of a 5′-dRP tion of products is indicated. Alk, alkaline hydrolysis of the 5′-dRP moiety. lyase activity to other bacterial LigDs. Lanes a and f, original substrate; lanes c and h, reactions performed in the absence of metal ions; lanes d and i, reactions performed in the presence ′ of 0.64 mM MnCl2; lane e, reaction carried out in the presence of 0.64 The 5 -dRP lyase activity of BsuLigD is located at the N- mM MnCl2 and further incubation with alkali. Ctrl lane corresponds to terminal ligase domain a control of the initial DNA before starting the reaction. The igure is a composite image made from different parts of the same experiment. Previous studies on ATP-dependent DNA ligases from bacteriophages T4 and T7 as well as from the human mitochondria showed that those enzymes were endowed with an intrinsic 5′-dRP lyase activity (54,55). As mentioned above, structure depicted in left panel of Figure 4 and contain- BsuLigD is a bimodular enzyme with an N-terminal ATP- ing a 2′-deoxyuridine at position 19 of the 35-mer down- dependent DNA ligase catalytic domain (residues 1–331) stream oligonucleotide was used as substrate. This DNA linked to a C-terminal polymerase domain (residues 332– was previously treated with E. coli UDG to get a natu- 611). Thus, it was reasonable to speculate that the BsuLigD ral AP site. Incubation of this substrate with hAPE1 ren- 5′-dRP lyase activity could reside at the N-terminal portion dered a 16-mer product with a 5′-dRP end (Figure 4,left of the enzyme. To test this hypothesis, the ligase domain of panel) as this enzyme is a metal-dependent AP endonucle- BsuLigD (LigDom) was cloned and puriied (see Materi- ase that hydrolyzes the phosphodiester bond 5′ to the AP als and Methods). As shown in Figure 5 (right panel), the site [(52) and references therein]. Conversely, E. coli EndoIII LigDom released the 5′-dRP group from the substrate in a incised at the 3′ side by its AP lyase activity leaving a prod- metal-independent manner, giving rise to a ligation product that migrates faster due to the presence of a 5′-P [(52) uct in the presence of Mn2+. As shown in Supplementary and references therein]. As shown in Figure 4 (left panel), Figure S3, LigDom is also cross-linked to the DNA follow- in the absence of divalent cations incubation of the AP site- ing reduction with NaBH4. These results indicate that the containing DNA with increasing amounts of BsuLigD ren- catalytic site responsible for BsuLigD AP lyase activity is dered a product with the same electrophoretical mobility placed at the LigDom. to that produced by EndoIII, consistent with a cleavage at In contrast to T4 DNA ligase, BsuLigD is unable to seal the 3′ side to the AP site in a metal-independent manner. the 3′-OH and 5′-dRP ends to regenerate an internal AP In this sense, the presence of the AP cleavage activity after site (see Supplementary Figure S4, in this case, the sub- incubating the protein overnight with up to 100 mM EDTA strate harbors a THF to prevent the ␤-elimination). It has (see Supplementary Figure S2), allows us to rule out metal been predicted that once regenerated, T4 DNA ligase could traces as responsible for such an activity, in agreement with recognize the internal AP site and exert its AP lyase activ- the metal independent 5′dRP lyase activity described above. ity introducing an incision at the 3′ side (54). As a conse- These results lead us to infer the presence of an intrinsic AP quence, the resulting 3′-phospho-␣,␤-unsaturated aldehyde lyase activity in BsuLigD that exerts its reaction through a end should be processed by additional nucleolytic activities ␤-elimination mechanism. In support of this, replacement to regenerate an elongatable 3′-OH group. Therefore, pre- of the AP site with tetrahydrofuran (THF), a stable AP ana- vention of direct ligation by BsuLigD could represent an ad-

141 8 Nucleic Acids Research, 2016

Figure 3. Formation of BsuLigD-DNA adducts. (A) Dependence of BsuLigD-DNA cross-link on NaBH4. Reactions were performed as described in Materials and Methods, incubating 95 nM BsuLigD with 2.6 nM of the 3′ [␣32P]3′-dAMP labeled DNA substrate depicted on top of the igure, in the presence of 10 ␮M CTP, 0.64 mM MnCl2 and either 100 mM NaBH4 or NaCl (as indicated). Left panel: Coomassie blue staining after SDS–PAGE of puriied BsuLigD. Right panel: autoradiography of corresponding protein-DNA adducts after the SDS–PAGE separation shown in left panel. When indicated, protein was previously incubated with 0.05 U of thrombin at 20◦C for 60 min. (B) Adduct formation is dependent on the presence of an abasic site. Reactions were performed as in described in (A) but using as substrate 3.6 nM of the 3′ [␣32P]3′-dAMP labeled oligonucleotide without removing the uracil (absence of AP site) or after treatment with E. coli UDG (presence of AP site), in the presence of either 100 mM NaBH4 or NaCl (as indicated). Autoradiography of corresponding protein-DNA adduct after the SDS–PAGE separation is shown. vantage as the enzyme is compelled to accomplish previous Spore resistance after UHV treatment depends on BsuLigD 5′-dRP release, precluding the need for additional activities. and Nfo The formation of a stable protein–DNA substrate adduct Previous studies showed that deletion of B. subtilis AP en- between BsuLigD and 5′-dRP-containing DNA in the pres- donucleases sensitized spores to desiccation in agreement ence of a reducing agent is consistent with the AP lyase with the induction of single-stranded nicks (43). In addi- active site lysine residue forming a Schiff base intermedi- tion, ultrahigh vacuum (UHV) desiccation also decreased ate with the open-ring form of the abasic site. Thus, to de- the survivability of the ligD mutant spores, which was termine whether the ligase and the lyase activities use the consistent with the induction also of DSBs in DNA. In or- same active site we have changed into alanine the BsuLigD der to determine a potential relationship between BsuLigD residues Lys24 (mutant K24A), Lys189 (mutant K189A), and the BER pathway, B. subtilis mutant spores lacking Lys206 (mutant K206A) and Lys208 (mutant K208A) as BsuLigD (ligD), the spore-speciic AP endonuclease IV their homologous residues Lys481, Lys618, Lys635 and Nfo (nfo)andligDnfo were subjected to UHV desic- Lys637 of Mycobacterium tuberculosis LigD (MtuLigD) cation treatment. As shown in Figure 6, ligD single mu- have been shown to form part of the ligation active site (56). tation caused a 4-fold reduction in spore survival. Simi- In addition, BsuLigD Glu184, the counterpart of the metal larly, deletion of the spore AP endonuclease Nfo caused ligand Glu613 of MtuLigD, one of the catalytic residues re- a 2-fold increase of the sensitivity of the spores. These responsible for the ligation activity (56) was also mutated to sults indicate the involvement of both B. subtilis proteins alanine (mutant E184A). As shown in Supplementary Fig- in the DNA repair in spores after UHV exposure for 7 ure S5, all the mutant derivatives were deicient in the liga- days. Interestingly, B. subtilis LigD and Nfo do not ap- tion activity, as expected, but retained a 5′-dRP lyase activ- pear to contribute additively to spore resistance after UHV ity similar to that of the wild-type enzyme. These results led treatment as ligDnfo rendered spores with a sensitivity us to conclude that both activities are not sharing the same statistically similar to that displayed by the single mutant active site. ligD, suggesting a functional interaction between both repair proteins. Similar results were obtained after testing the effects of the ligase-inactivating BsuLigD E184A mu-

142 Nucleic Acids Research, 2016 9

Figure 4. BsuLigD is endowed with an AP lyase activity. (A) Analysis of the capacity of BsuLigD to incise an internal natural abasic site. The [␣32P]3′- labeled 2′-deoxyuridine-containing substrate was treated with 27 nM E. coli UDG (lane c), leaving an intact AP site. The resulting AP-containing DNA was incubated in the presence of either 5 nM hAPE1 that cleaves 5′ to the AP site, 3.5 nM EndoIII that incises 3′ to the AP site, or increasing concentrations of BsuLigD (0, 29, 57 and 114 nM) for 1 h at 30◦C, as described in Materials and Methods. After incubation samples were analyzed by 8 M urea-20% PAGE and autoradiography. Position of products is indicated. (B) Analysis of the capacity of BsuLigD to incise an internal tetrahydrofuran (H). The 3′ [␣32P]3′-dAMP labeled oligonucleotide containing the lyase-resistant analogue tetrahydrofuran (H) was incubated in the presence of either hAPE1, EndoIII or increasing concentrations of BsuLigD as described above. Position corresponding to the products 16-mer 5′-dRP and 16-mer 5′-P is indicated. The igure is a composite image made from different parts of the same experiment.

Figure 5. Left: PaeLigD is endowed with a 5′-dRP lyase activity. The assay was performed as indicated in Materials and Methods in the presence of either ◦ 3.5 nM of EndoIII or 60 nM of the indicated LigD in the absence (−) or presence (+) of 0.64 mM MnCl2. After incubation during 30 min at 30 C samples were analyzed by 8 M urea-20% PAGE and autoradiography. Position of products is indicated. Alk, alkaline hydrolysis of the 5′-dRP moiety. Right: the 5′-dRP lyase activity of BsuLigD resides in the ligase domain. The assay was performed as in left panel in the presence of 216 nM LigDom. After incubation during 30 min at 30◦C samples were analyzed by 8 M urea-20% PAGE and autoradiography. Position of products is indicated. The igure is a composite image made from different parts of the same experiment.

143 10 Nucleic Acids Research, 2016

renders a gap lanked by 3′-OH and a 5′-dRP ends. Accom- plishment of AP site repair would require a polymerization step to close the gap, a 5′-dRPase to render a ligatable 5′-P and a ligase activity to seal the inal nick. B. subtilis ykoU gene codes for BsuLigD and forms part of a regulon under the control of both, the RNA-polymerase sigma factor ␴G and the DNA-binding protein SpoVT, and whose expression is turned on in the forespore (16). We have shown here that BsuLigD could potentially participate in BER since the enzyme (i) eficiently ills a single nucleotide gap on preincised AP-DNA, (ii) removes the 5′-dRP group by an intrinsic lyase activity rendering a nick with ligatable 3′-OH and 5′-P ends, (iii) seals the break and (iv) seems to participate together with the B. subtilis spore AP endonuclease Nfo in the repair of DNA lesions induced by UHV desiccation. The ability of BsuLigD to ill the gap prior to dRP-release, ′ ′ Figure 6. Survival of B. subtilis spores deicient in BsuLigD and/or Nfo as well as its failure to seal 3 -OH and 5 -dRP ends would AP endonuclease. The assay was performed as described in Materials and guarantee the repair of the lesion without loss of sequence Methods. The CFUs of UHV-treated spores were divided with the average information. The absence in our reconstitution assays of ac- CFU-value of untreated spore samples in order to obtain the survival after cessory factors indicates that the polymerization, dRP lyase UHV. The data presented are expressed as average values ± SD, N = 3. Asterisks indicate UHV survival values that were signiicantly different (P- and ligation functions of BsuLigD could be necessary and values ≤ 0.05) from values for wild-type (wt) spores. suficient for ‘short patch’ BER of AP sites during spore germination and outgrowth together with the B. subtilis AP endonucleases Nfo and/or ExoA. Therefore, although apri- tation on the repair eficiency of the UHV induced lesions ori the bacterial BsuLigD complex had been exclusively in- (see Supplementary Figure S6). Altogether, the results sup- volved in the repair of DSBs through the NHEJ pathway, port the presence of a spore speciic BER pathway to repair the results presented here are suggestive of a potential par- abasic lesions during spore germination, in which BsuLigD ticipation of this protein in bacterial BER as well, a hypoth- plays a pivotal role. esis that could be extended to the rest of bacteria in the light of the results obtained with the LigD from P. aeruginosa, and maybe to the recently reported archaeal NHEJ DNA DISCUSSION Lig (60). Altogether, our observations suggest that the role B. subtilis spores are continuously exposed to environmen- of the ATP-dependent ligase domain is not restricted to the tal conditions that cause the accumulation of potentially inal strand closure, paving the way to future works aimed lethal and mutagenic DNA lesions such as the spore pho- to decipher the in vivo and in vitro interplay with other DNA toproduct, strand breaks, cyclobutane pyrimidine dimers, repair proteins of the BER pathway. Interestingly, recent re- altered bases and AP sites (57). In addition, AP sites can sults have implied a Ku-independent role of Pseudomonas be also generated during spore germination and outgrowth putida LigD in stationary-phase mutagenesis that led au- either after removal of a damaged base by a speciic glycosy- thors to surmise the involvement of LigD in other DNA lase (58) or after spontaneous breakage of the N-glycosidic metabolism-related processes that use translesion synthesis bond under physiological conditions (59). Therefore, the and/or gap-illing on damaged DNA (61). A dual role of spore should be provided with the machinery required NHEJ protein factors has been also documented in eukary- to recognize and repair those lesions during germination otes where polymerases responsible for NHEJ contribute to and outgrowth to prevent mutagenesis as well as potential a short-patch BER that repairs damage-associated chromo- stalling of the replication and transcriptional machineries some breaks (62). Recently it has been shown how deletion that could lead to chromosome breakage (52). In this sense, of the mice Ku70 or Ku80 results in different sensitivities B. subtilis gene nfo, which encodes for AP endonuclease IV of cells to genotoxicants that provoke DNA lesions as alky- (Nfo), is expressed under the control of the ␴G transcrip- lated and oxidized bases and single-strand breaks that are tion factor late in sporulation (43) and the protein is present repaired by the BER pathway (63,64). in mature spores. In addition, the levels of ␤-galatosidase We have shown that the active site responsible for the AP from an exoA-lacZ translational fusion showed that expres- lyase activity resides in the N-terminal ligase domain. The sion of exoA which codes for AP endonuclease ExoA also presence of a 5′-dRP lyase activity was previously described takes place during sporulation (43), although in this case in the ATP-dependent DNA ligases from bacteriophages it remains to be determined whether the protein is present T4 and T7 (54) as well as from the human mitochondria in the dormant spore. The absence of ExoA and/or Nfo in (55). Evolutionary studies suggest that all ATP-dependent deletion mutant strains of B. subtilis sensitized the spores DNA ligases descend from a common ancestor and show to treatments that damage spore DNA through generation six conserved sequence motifs (I, III, IIIa, IV, V-VI) that de- of AP sites and strand breaks, suggesting that BER should ine a family of related nucleotidyltransferases [reviewed in be active to repair the lesions during spore germination and (65)]. The occurrence of a 5′-dRP lyase activity in the ATP- outgrowth that have accumulated during spore dormancy dependent ligase domain of bacterial LigD led us to venture (43–45). The action of these AP endonucleases on AP sites

144 Nucleic Acids Research, 2016 11

the presence of an AP lyase activity as a general feature of 10. Weller,G.R., Kysela,B., Roy,R., Tonkin,L.M., Scanlan,E., Della,M., at least the ATP-dependent DNA ligases. Devine,S.K., Day,J.P., Wilkinson,A., d’Adda di Fagagna,F. et al. (2002) Identiication of a DNA nonhomologous end-joining complex in bacteria. Science, 297, 1686–1689. ′ SUPPLEMENTARY DATA 11. Zhu,H. and Shuman,S. (2005) Novel 3 -ribonuclease and 3′-phosphatase activities of the bacterial non-homologous Supplementary Data are available at NAR Online. end-joining protein, DNA ligase D. J. Biol. Chem., 280, 25973–25981. 12. Zhu,H. and Shuman,S. (2006) Substrate speciicity and structure-function analysis of the 3′-phosphoesterase component of ACKNOWLEDGEMENTS the bacterial NHEJ protein, DNA ligase D. J. Biol. Chem., 281, 13873–13881. We are grateful to J.C. Alonso for critical reading of the 13. Aniukwu,J., Glickman,M.S. and Shuman,S. (2008) The pathways and outcomes of mycobacterial NHEJ depend on the structure of the manuscript, to J.M. Lazaro´ for his outstanding technical broken DNA ends. Genes Dev., 22, 512–527. assistance during protein puriication, to A. Schroeder for 14. Wright,D., DeBeaux,A., Shi,R., Doherty,A.J. and Harrison,L. (2010) her excellent skillful technical assistance during the sam- Characterization of the roles of the catalytic domains of ple preparation and analyses and to Aidan J. Doherty and Mycobacterium tuberculosis ligase D in Ku-dependent error-prone Fabian M. Commichau for their generous donation of the DNA end joining. Mutagenesis, 25, 473–481. 15. Almeida,K.H. and Sobol,R.W. (2007) A uniied view of base excision strains. repair: lesion-dependent protein complexes regulated by post-translational modiication. DNA Repair (Amst.), 6, 695–711. 16. Wang,S.T., Setlow,B., Conlon,E.M., Lyon,J.L., Imamura,D., Sato,T., FUNDING Setlow,P., Losick,R. and Eichenberger,P. (2006) The forespore line of gene expression in Bacillus subtilis. J. Mol. Biol., 358, 16–37. Spanish Ministry of Economy and Competitiveness 17. Lenhart,J.S., Schroeder,J.W., Walsh,B.W. and Simmons,L.A. (2012) [BFU2014-53791-P to M.V.]; German Aerospace Center DNA repair and genome maintenance in Bacillus subtilis. Microbiol. [DLR-FuE-Projekt ISS-Nutzung in der Biodiagnostik, Mol. Biol. Rev., 76, 530–564. Programm RF-FuW, Teilprogramm 475 to R.M.]; German 18. Moeller,R., Stackebrandt,E., Reitz,G., Berger,T., Rettberg,P., Doherty,A.J., Horneck,G. and Nicholson,W.L. (2007) Role of DNA Research Foundation [DFG Paketantrag (PlasmaDe- repair by nonhomologous-end joining in Bacillus subtilis spore con PAK 728) (MO 2023/2-1) to R.M.]; Fundacion´ resistance to extreme dryness, mono- and polychromatic UV, and Ramon´ Areces (Institutional Grant to the Centro de ionizing radiation. J. Bacteriol., 189, 3306–3311. Biolog´ıa Molecular ‘Severo Ochoa’). A.O. is a holder of 19. de Vega,M. (2013) The minimal Bacillus subtilis nonhomologous end a Formacion´ de Personal Investigador fellowship (BES- joining repair machinery. PLoS One, 8, e64232. 20. de Ory,A., Zafra,O. and de Vega,M. (2014) Eficient processing of 2012-053642) from the Spanish Ministry of Economy abasic sites by bacterial nonhomologous end-joining Ku proteins. and Competitiveness. Funding for open access charge: Nucleic Acids Res., 42, 13082–13095. Spanish Ministry of Economy and Competitiveness 21. Roberts,S.A., Strande,N., Burkhalter,M.D., Strom,C., Havener,J.M., [BFU2014-53791-P to M.V.]. Hasty,P. and Ramsden,D.A. (2010) Ku is a 5′-dRP/AP lyase that excises nucleotide damage near broken ends. Nature, 464, 1214–1217. Conlict of interest statement. None declared. 22. Strande,N., Roberts,S.A., Oh,S., Hendrickson,E.A. and Ramsden,D.A. (2012) Speciicity of the dRP/AP lyase of Ku promotes nonhomologous end joining (NHEJ) idelity at damaged REFERENCES ends. J. Biol. Chem., 287, 13686–13693. 1. Lieber,M.R. (2010) The mechanism of double-strand DNA break 23. Strande,N.T., Carvajal-Garcia,J., Hallett,R.A., Waters,C.A., Roberts,S.A., Strom,C., Kuhlman,B. and repair by the nonhomologous DNA end-joining pathway. Annu. Rev. ′ Biochem., 79, 181–211. Ramsden,D.A. (2014) Requirements for 5 dRP/AP lyase activity in 2. Kuzminov,A. (1999) Recombinational repair of DNA damage in Ku. Nucleic Acids Res., 42, 11136–11143. Escherichia coli and bacteriophage lambda. Microbiol. Mol. Biol. 24. Matsumoto,Y. and Kim,K. (1995) Excision of deoxyribose phosphate Rev., 63, 751–813. residues by DNA polymerase beta during DNA repair. Science, 269, 3. Shuman,S. and Glickman,M.S. (2007) Bacterial DNA repair by 699–702. 25. Bebenek,K., Tissier,A., Frank,E.G., McDonald,J.P., Prasad,R., non-homologous end joining. Nat. Rev. Microbiol., 5, 852–861. ′ 4. Pitcher,R.S., Brissett,N.C. and Doherty,A.J. (2007) Nonhomologous Wilson,S.H., Woodgate,R. and Kunkel,T.A. (2001) 5 -Deoxyribose end-joining in bacteria: a microbial perspective. Annu. Rev. phosphate lyase activity of human DNA polymerase iota in vitro. Microbiol., 61, 259–282. Science, 291, 2156–2159. 26. Garcia-Diaz,M., Bebenek,K., Kunkel,T.A. and Blanco,L. (2001) 5. Aravind,L. and Koonin,E.V. (2001) Prokaryotic homologs of the ′ eukaryotic DNA-end-binding protein Ku, novel domains in the Ku Identiication of an intrinsic 5 -deoxyribose-5-phosphate lyase protein and prediction of a prokaryotic double-strand break repair activity in human DNA polymerase lambda: a possible role in base system. Genome Res., 11, 1365–1374. excision repair. J. Biol. Chem., 276, 34659–34663. 27. Prasad,R., Longley,M.J., Sharief,F.S., Hou,E.W., Copeland,W.C. and 6. Doherty,A.J., Jackson,S.P. and Weller,G.R. (2001) Identiication of ′ bacterial homologues of the Ku DNA repair proteins. FEBS Lett., Wilson,S.H. (2009) Human DNA polymerase theta possesses 5 -dRP 500, 186–188. lyase activity and functions in single-nucleotide base excision repair in 7. Brissett,N.C., Pitcher,R.S., Juarez,R., Picher,A.J., Green,A.J., vitro. Nucleic Acids Res., 37, 1868–1877. Dafforn,T.R., Fox,G.C., Blanco,L. and Doherty,A.J. (2007) Structure 28. Khodyreva,S. and Lavrik,O.I. (2011) New players in recognition of of a NHEJ polymerase-mediated DNA synaptic complex. Science, intact and cleaved AP sites: implication in DNA repair in mammalian 318, 456–459. cells. In: Chen,CC (ed). InSelected Topics in DNA Repair. 8. Gong,C., Bongiorno,P., Martins,A., Stephanou,N.C., Zhu,H., InTechd.o.o., Rijeka, pp. 305–330. Shuman,S. and Glickman,M.S. (2005) Mechanism of 29. Pinz,K.G. and Bogenhagen,D.F. (2000) Characterization of a nonhomologous end-joining in mycobacteria: a low-idelity repair catalytically slow AP lyase activity in DNA polymerase gamma and system driven by Ku, ligase D and ligase C. Nat. Struct. Mol. Biol., other family A DNA polymerases. J. Biol. Chem., 275, 12509–12514. 12, 304–312. 30. Snowden,A., Kow,Y.W. and Van Houten,B. (1990) Damage 9. Gong,C., Martins,A., Bongiorno,P., Glickman,M. and Shuman,S. repertoire of the Escherichia coli UvrABC nuclease complex includes abasic sites, base-damage analogues, and lesions containing adjacent (2004) Biochemical and genetic analysis of the four DNA ligases of ′ ′ mycobacteria. J. Biol. Chem., 279, 20594–20606. 5 or 3 nicks. Biochemistry, 29, 7251–7259.

145 12 Nucleic Acids Research, 2016

31. Grin,I.R., Khodyreva,S.N., Nevinsky,G.A. and Zharkov,D.O. (2006) of bacterial DNA ligase D. Proc. Natl. Acad. Sci. U.S.A., 103, Deoxyribophosphate lyase activity of mammalian endonuclease 1711–1716. VIII-like proteins. FEBS Lett., 580, 4916–4922. 47. Shuman,S. (2009) DNA ligases: progress and prospects. J. Biol. 32. Summer,H., Li,O., Bao,Q., Zhan,L., Peter,S., Sathiyanathan,P., Chem., 284, 17365–17369. Henderson,D., Klonisch,T., Goodman,S.D. and Droge,P. (2009) 48. Zhu,H. and Shuman,S. (2008) Bacterial nonhomologous end joining HMGA2 exhibits dRP/AP site cleavage activity and protects cancer ligases preferentially seal breaks with a 3′-OH monoribonucleotide. J. cells from DNA-damage-induced cytotoxicity during chemotherapy. Biol. Chem., 283, 8331–8339. Nucleic Acids Res., 37, 4371–4384. 49. Bailly,V. and Verly,W.G. (1988) Possible roles of beta-elimination and 33. Khodyreva,S.N., Ilina,E.S., Kutuzov,M.M., Sukhanova,M.V. and delta-elimination reactions in the repair of DNA containing AP Lavrik,O.I. (2010) Poly(ADP-ribose) polymerase 1 interaction with (apurinic/apyrimidinic) sites in mammalian cells. Biochem. J., 253, apurinic/apyrimidinic sites. Dokl. Biochem. Biophys., 431, 69–72. 553–559. 34. Kutuzov,M.M., Ilina,E.S., Sukhanova,M.V., Pyshnaya,I.A., 50. Lindahl,T. and Andersson,A. (1972) Rate of chain breakage at Pyshnyi,D.V., Lavrik,O.I. and Khodyreva,S.N. (2011) Interaction of apurinic sites in double-stranded deoxyribonucleic acid. Biochemistry, poly(ADP-ribose) polymerase 1 with apurinic/apyrimidinic sites 11, 3618–3623. within clustered DNA damage. Biochemistry (Mosc), 76, 147–156. 51. Piersen,C.E., McCullough,A.K. and Lloyd,R.S. (2000) AP lyases and 35. Longley,M.J., Prasad,R., Srivastava,D.K., Wilson,S.H. and dRPases: commonality of mechanism. Mutat. Res., 459, 43–53. Copeland,W.C. (1998) Identiication of 5′-deoxyribose phosphate 52. Krwawicz,J., Arczewska,K.D., Speina,E., Maciejewska,A. and lyase activity in human DNA polymerase gamma and its role in Grzesiuk,E. (2007) Bacterial DNA repair genes and their eukaryotic mitochondrial base excision repair in vitro. Proc. Natl. Acad. Sci. homologues: 1. Mutations in genes involved in base excision repair U.S.A., 95, 12244–12248. (BER) and DNA-end processors and their implication in mutagenesis 36. Prasad,R., Beard,W.A., Strauss,P.R. and Wilson,S.H. (1998) Human and human disease. Acta Biochim. Pol., 54, 413–434. DNA polymerase beta deoxyribose phosphate lyase. Substrate 53. Zhu,H. and Shuman,S. (2007) Characterization of Agrobacterium speciicity and catalytic mechanism. J. Biol. Chem., 273, 15263–15270. tumefaciens DNA ligases C and D. Nucleic Acids Res., 35, 3631–3645. 37. Zhu,H. and Shuman,S. (2005) A primer-dependent polymerase 54. Bogenhagen,D.F. and Pinz,K.G. (1998) The action of DNA ligase at function of Pseudomonas aeruginosa ATP-dependent DNA ligase abasic sites in DNA. J Biol. Chem., 273, 7888–7893. (LigD). J. Biol. Chem., 280, 418–427. 55. Pinz,K.G. and Bogenhagen,D.F. (1998) Eficient repair of abasic sites 38. Maciag,I.E., Viret,J.F. and Alonso,J.C. (1988) Replication and in DNA by mitochondrial enzymes. Mol. Cell Biol., 18, 1257–1265. incompatibility properties of plasmid pUB110 in Bacillus subtilis. 56. Akey,D., Martins,A., Aniukwu,J., Glickman,M.S., Shuman,S. and Mol. Gen. Genet., 212, 232–240. Berger,J.M. (2006) Crystal structure and nonhomologous end-joining 39. Schaeffer,P., Millet,J. and Aubert,J.P. (1965) Catabolic repression of function of the ligase component of Mycobacterium DNA ligase D. J. bacterial sporulation. Proc. Natl. Acad. Sci. U.S.A., 54, 704–711. Biol. Chem., 281, 13412–13423. 40. Nicholson,W.L. and Setlow,P. (1990) In: Harwood,CR and 57. Setlow,B. and Setlow,P. (1995) Small, acid-soluble proteins bound to Cutting,SM (eds). Molecular Biological Methods for Bacillus. J. Wiley DNA protect Bacillus subtilis spores from killing by dry heat. Appl. & Sons, Chichester, pp. 391–450. Environ. Microbiol., 61, 2787–2790. 41. Vlasic,I., Mertens,R., Seco,E.M., Carrasco,B., Ayora,S., Reitz,G., 58. Lindahl,T. (1993) Instability and decay of the primary structure of Commichau,F.M., Alonso,J.C. and Moeller,R. (2014) Bacillus subtilis DNA. Nature, 362, 709–715. RecA and its accessory factors, RecF, RecO, RecR and RecX, are 59. Dalhus,B., Laerdahl,J.K., Backe,P.H. and Bjoras,M. (2009) DNA required for spore resistance to DNA double-strand break. Nucleic base repair–recognition and initiation of catalysis. FEMS Microbiol. Acids Res., 42, 2295–2307. Rev., 33, 1044–1078. 42. Horneck,G. (1993) Responses of Bacillus subtilis spores to space 60. Bartlett,E.J., Brissett,N.C. and Doherty,A.J. (2013) Ribonucleolytic environment: results from experiments in space. Orig. Life Evol. resection is required for repair of strand displaced nonhomologous Biosph., 23, 37–52. end-joining intermediates. Proc. Natl. Acad. Sci. U.S.A., 110, 43. Salas-Pacheco,J.M., Setlow,B., Setlow,P. and Pedraza-Reyes,M. E1984–E1991. (2005) Role of the Nfo (YqfS) and ExoA apurinic/apyrimidinic 61. Paris,U., Mikkel,K., Tavita,K., Saumaa,S., Teras,R. and Kivisaar,M. endonucleases in protecting Bacillus subtilis spores from DNA (2015) NHEJ enzymes LigD and Ku participate in stationary-phase damage. J. Bacteriol., 187, 7374–7381. mutagenesis in Pseudomonas putida. DNA Repair (Amst.), 31, 11–18. 44. Salas-Pacheco,J.M., Urtiz-Estrada,N., Mart´ınez-Cadena,G., 62. Ramsden,D.A. (2011) Polymerases in nonhomologous end joining: Yasbin,R.E. and Pedraza-Reyes,M. (2003) YqfS from Bacillus subtilis building a bridge over broken chromosomes. Antioxid. Redox Signal., is a spore protein and a new functional member of the type IV 14, 2509–2519. apurinic/apyrimidinic-endonuclease family. J. Bacteriol., 185, 63. Choi,Y.J., Li,H., Son,M.Y., Wang,X.H., Fornsaglio,J.L., Sobol,R.W., 5380–5390. Lee,M., Vijg,J., Imholz,S., Dolle,M.E. et al. (2014) Deletion of 45. Urtiz-Estrada,N., Salas-Pacheco,J.M., Yasbin,R.E. and individual Ku subunits in mice causes an NHEJ-independent Pedraza-Reyes,M. (2003) Forespore-speciic expression of Bacillus phenotype potentially by altering apurinic/apyrimidinic site repair. subtilis yqfS, which encodes type IV apurinic/apyrimidinic PLoS One, 9, e86358. endonuclease, a component of the base excision repair pathway. J. 64. Li,H., Marple,T. and Hasty,P. (2013) Ku80-deleted cells are defective Bacteriol., 185, 340–348. at base excision repair. Mutat. Res., 745–746, 16–25. 46. Zhu,H., Nandakumar,J., Aniukwu,J., Wang,L.K., Glickman,M.S., 65. Martin,I.V. and MacNeill,S.A. (2002) ATP-dependent DNA ligases. Lima,C.D. and Shuman,S. (2006) Atomic structure and Genome Biol., 3, reviews3005. nonhomologous end-joining function of the polymerase component

146 Chapter H

Role of DNA repair in Bacillus subtilis spore resistance towards low pressure plasma sterilization.

Marina Raguse, Marcel Fiebrandt, Thierry Douki, Fabian Commichau, Peter Setlow, Ralf Moeller

In preparation

147 Role of DNA Repair in Bacillus subtilis Spore Resistance towards Low Pressure

Plasma Sterilization.

Marina Raguse1, Marcel Fiebrandt2, Peter Awakowicz2, Thierry Douki3, Fabian

Commichau4, Peter Setlow5, Ralf Moeller1*

1German Aerospace Center (DLR e.V.), Institute of Aerospace Medicine, Department of

Radiation Biology, Cologne, Germany

2Ruhr-University Bochum, Institute of Electrical Engineering and Plasma Technology,

Faculty of Electrical Engineering and Information Technology, Bochum, Germany

3Département de Recherche Fondamentale sur la Matière Condensée CEA-Grenoble,

Service de Chimie Inorganique et Biologique, Grenoble, France

4Georg-August-University Göttingen, Institute for Microbiology and Genetics, Department of General Biology, Göttingen, Germany

5UConn Health, Department of Molecular Biology and Biophysics, Farmington,

Connecticut, USA

*Corresponding author. Mailing address: German Aerospace Center (DLR), Institute of

Aerospace Medicine, Radiation Biology Department, Space Microbiology Research

Group, Linder Hoehe, D-51147 Cologne, Germany, Phone 49(2203) 601-3145, Fax

49(2203) 61790, E-mail: [email protected]

148 ABSTRACT Low pressure plasma (LPP) sterilization is a promising alternative to conventional decontamination methods. However, the underlying mechanisms leading to inactivation are not fully understood. Highly resistant spores of Bacillus subtilis are used as biological indicators to investigate fundamental factors contributing to plasma-mediated inactivation. Here, LPP-induced DNA damage was investigated in vivo and in vitro in comparison to UV-C radiation at 254 nm. Spores deficient in DNA repair by homologous recombination (recA), nonhomologous end-joining (ku ligD), spore photoproduct lyase (splB), nucleotide excision repair (uvrAB) and base excision repair (nfo exoA) were significantly more sensitive to LPP discharges dependent on the employed gas composition of Ar, O2, and

Ar:O2. LPP was found to induce photoproduct formation, predominately the spore photoproduct in plasmid DNA (pBR322) in vitro. Gel electrophoresis of LPP-treated pBR322 revealed the induction of single and double strand breaks and progressive fragmentation. Studies on the transformation efficiency of treated pBR322 into E. coli DH5α demonstrate, that LPP-treated plasmid DNA is at least in part structurally or functionally impaired. The results indicate that unfiltered LPP discharges significantly damage plasmid DNA in vitro by introducing photoproducts and strand breaks and demonstrate that multiple DNA repair pathways are involved in spore resistance against plasma treatment, suggesting that various plasma-induced lesions are introduced into spore DNA that require repair upon spore revival.

Key words: Plasma, sterilization, spore resistance, Bacillus subtilis, DNA repair, UV, HR, NHEJ, SP lyase

149 1. INTRODUCTION Plasma sterilization is a promising alternative to conventional sterilization methods as plasma discharges contain a mixture of active agents, including free radicals, charged particles, neutral/excited atoms, as well as photons in the ultraviolet (UV) and vacuum ultraviolet (VUV) spectrum which lead to rapid microbial inactivation by interacting with essential cellular components and macromolecules (DNA, RNA, Protein) (Rossi et al., 2008; De Geyter and Morent, 2012). The underlying biocidal mechanism of plasma is still under investigation (Yardimci and Setlow, 2001). Bacterial spores of Bacillus subtilis exhibit elevated resistance to chemical and physical methods of sterilization and are therefore frequently used as a biological indicator of sterility to verify the functionality of a sterilization procedure (Humphrey, 2011; Raguse et al., 2016). Several different mechanisms that lead to spore inactivation have been observed, however, the results are highly dependent on the pressure, reactor type and gas mixture (Laroussi and Leipold, 2004; Keudell et al, 2010; Ehlbeck et al., 2011; Lackmann et al., 2013). In low pressure plasma (LPP) discharges, the bactericidal effect of high fluence rates of UV and VUV photons has been reported to play a major role in the reduction of spore survival (Halfmann et al., 2007b; von Keudell et al, 2010; Denis et al., 2012). (V)UV photons can cause substantial damage to the genetic material by introducing various types of lesions (Donnellan and Setlow, 1965; Douki et al., 2005a; 2005b; Moeller et al., 2007; reviewed in Setlow, 2006). Consequently, plasma setups and discharge parameters have been optimized to maximize the intensity of (V)UV photons (Halfmann et al., 2007a; 2007b). B. subtilis spores are 10–50-fold more resistant UV-C radiation at 254 nm than their vegetative counterpart (Nicholson et al., 2010; Setlow, 2006, Coohill and Sagripanti, 2009). UV-C at 254 nm generates two major photoproduct in growing B. subtilis cells, cyclobutane pyrimidine dimers between (CPDs) and pyrimidine 6-4 primidone adducts (6- 4 PPs) between adjacent pyrimidines (Douki et al., 2005a; 2005b). Both photoproducts are potentially lethal but can be repaired by relatively error-prone repair mechanisms in growing cells. In contrast, only very few CPDs and 6-4 PPs are generated in the DNA of dormant spores upon UV-C irradiation (Douki et al, 2005a; 2005b; Moeller et al., 2007). The dominant DNA photolesion formed in UV-irradiated Bacillus spores is the unique thymine adduct 5-thyminyl-5,6-dihydrothymine, termed the spore photoproduct (SP; Donnellan and Setlow, 1965; reviewed in Setlow and Li, 2015). Upon UV-C irradiation at 254 nm the induction of SP formation is 103 more likely compared to UV-B radiation and 106 more likely compared to irradiation with UV-A (Tyrrell, 1978; Lindberg and Horneck,

150 1992). Formation of SP rather than CPDs or 6-4 PPs in spores is due to the unique condition of the spore core, specifically the low hydration levels, Ca2+-DPA accumulation, and the saturation of spore DNA with α/β-type SASPs leading to a conformational change from B- to A-DNA (Donnellan and Stafford, 1968; reviewed in Setlow, 2001). This induced structural change in combination with the photosensitizing effect of Ca2+-DPA (Douki et al., 2005b) and the maintained dehydrated state of spore DNA contribute to the altered spore DNA photochemistry favoring the production of SP (Fairhead and Setlow, 1992; Douki et al., 2005a). Spores deficient in α/β-type SASPs are significantly more sensitive to UV-C irradiation (Setlow and Setlow, 1987; Moeller et al., 2007). However, SP formation was still observed to some extent in spores deficient in α/β-type SASPs, suggesting that there are additional factors involved (Setlow and Setlow, 1987; Moeller et al., 2007). Spores are in a dormant state with no detectable metabolism (Setlow and Kronberg, 1970). Hence, generated DNA lesions accumulate and must be repaired in the early stages of spore outgrowth to assure spore survival (Keijser et al., 2007; reviewed in Setlow, 2014). Although also SP is a potentially lethal photoproduct, it is repaired more efficiently and less-error prone during spore revival compared to other photoproducts. The major DNA repair pathways involved in the removal of photoproducts are (i) the spore-specific repair enzyme SP-lyase (encoded by the splB gene) that monomerizes SP back to two thymine residues, a highly conserved process among spores (Munakata and Rupert, 1972;1974; reviewed in Yang and Li, 2015) (ii), nucleotide excision repair (NER), which excises the damaged nucleotides and fills the single strand gap (Muankata and Rupert, 1972, 194) and (iii) a repair pathway involving the RecA protein of although at a lesser extent (Munakata and Rupert, 1975). Excision repair via NER is also required for the removal of bulky adducts, e.g. cross links, and is directed by the enzymes UrA and UvrB (Lenhart et al., 2012). Base excision repair (BER) is designated to remove damaged bases arising from oxidation, depurination/depyrimidation, and deamination that do not directly compromise the secondary structure of the DNA molecule directly but can ultimately lead to stalling of DNA replication and transcription machineries (Friedberg et al., 2006). The resulting apurinic or apyrimidinic (AP) site is specifically recognized and further processed by the B. subtilis AP endonucleases ExoA and Nfo in concert with the DNA polymerase/3’-5’ exonuclease PolX. Unrepaired AP sites are potentially mutagenic and can potentially cause strand breaks (reviewed in Lenhart et al., 2012) and previous studies have shown that the

151 absence of Nfo, Exo and PolX increase the occurrence of mutations in B. subtilis vegetative cells (Barajas-Ornelas et al.; 2014). LigD was also suggested to play a potential role in BER (De Ory et al., 2016). Two major DNA repair pathways are involved in DNA double strand break (DSB) repair in Bacillus subtilis cells. DSB repair via error-free homologous recombination (HR), mediated by major regulator RecA, occurs during vegetative growth when the replication machinery is active and a homologous chromosome copy is available (reviewed in Ayora et al., 2011; Cox, 2007). Alternatively, non-homologous end joining (NHEJ), mediated by DNA end-binding protein Ku and the ligase LigD, functions as the alternative way of two-ended DSB repair in which two ends of a broken DNA strand are rejoined directly requiring only minimal end-processing and no homologous template (reviewed in Ayora et al., 2011; Weller et al., 2002; Wilson et al., 2003). In this work we used a double inductively coupled plasma reactor (DICP) operating at low pressure of 10 Pa to study the effect of LPP-emitted active species on the survival of B. subtilis spores deficient in various DNA repair systems in vivo and on dehydrated plasmid DNA (pBR322) in vitro regarding photoproduct formation, strand breaks, and transformation efficiency. The results indicate that unfiltered LPP discharges significantly damage plasmid DNA in vitro by introducing photoproducts, predominately SP, along with strand breaks and demonstrate that multiple DNA repair pathways are involved in spore resistance against plasma treatment, suggesting that various plasma-induced lesions are introduced into spore DNA that require repair upon spore revival.

2. MATERIAL AND METHODS 2.1 Bacterial strains, sporulation and spore purification. All B. subtilis strains used in the present study are derived from the tryptophan auxotroph laboratory (wild-type) strain 168. Strains used are listed in Table 1. B. subtilis spores were obtained by cultivation under vigorous aeration at 37°C for 7 days in double-strength liquid Schaeffer sporulation medium (Schaeffer et al., 1965), and spores were purified and stored as described previously [Raguse et al., 2016; Nagler et al., 2014]. Spore preparations consisted of a suspension of single spores with no detectable clumps, and were free (> 99 %) of growing cells, germinated spores and cell debris, as seen in the phase-contrast microscope.

152 Table 1 B. subtilis strain list used

Strain Genotype Reference 168 wildtype trpC DSM402, DSMZ GP1175 +ΔuvrAB::erm Gunka et al. (2012) BP130 +ΔsplB::spec Provided by F. Commichau WN1087 +ΔykoVU:erm Weller et al. (2002) WN463 +ΔrecA::erm MLSa Moeller et al. (2007) GP1503 +ΔexoA::kan Δnfo::cat Gunka et al. (2012) a MLS, resistant to lincomycin (25 µg/ml) and erythromycin (1 µg/ml);

2.2 Plasma Setup Spore inactivation via low pressure plasma treatment was performed at the Institute for Electrical Engineering and Plasma Technology (AEPT), Ruhr University Bochum, Bochum, Germany in a double inductively coupled plasma (DICP) reactor (Halfmann et al., 2007a/b; Denis et al., 2012; Raguse et al., 2016). The reactor consists of a stainless steel cylinder with a volume of 25 l enclosed by two quartz plates and the discharge is driven by two copper coils at the top and bottom of the DICP (Fig. 1). A matchbox splits the maximum power of 5 kW at 13.56 MHz equally to both coils. The vacuum in the vessel is achieved by a combination of a roots pump (Edwards EH 500) with a rotary vane fore pump (Pfeiffer Duo 060 A) which allows a low-pressure environment down to 5 Pa with flows up to 160 sccm (standard cubic centimeters per minute) of argon and oxygen.

Figure 1 (a) Sketch and (b) cut- away view of the double inductively coupled plasma (DICP) setup used for sterilization experiments, testing spores of Bacillus subtilis as biological indicators for sterilization efficiency. The thin copper coils at the top and bottom are divided by quartz glass from the chamber. The sample position was axially and radially in the center of the discharge (Raguse et al., 2016)

153 2.3 Plasma diagnostics Plasma diagnostics were performed in the plane of the biological samples. UV doses of

Ar, O2 and Ar:O2 plasma discharges from λ = 200 nm to λ = 380 nm were determined using an absolutely calibrated broadband echelle spectrometer (LLA Instruments ESA 3000) with a spectral resolution of Δλ = 0.02 nm at λ = 200 nm and Δλ = 0.06 at λ = 800 nm (Bibinov et al., 1997). A Jobin-Yvon AS50 monochromator equipped with a solar-blind photomultiplier (Hamamatsu PMT R1080) was used for intensity measurements in the range from λ = 130 nm to λ = 200 nm. The grating of the monochromator is aluminum-coated with 1200 grooves per mm, has a radius of curvature of λ = 500 mm and is blazed for λ = 210 nm. The spectrometer was relatively calibrated with the branching-ratio technique of N2(a-X) with a resolution of ∆λ = 0.35 nm (Bibinov et al. 1997) and fitted to the echelle spectra in the range from λ = 200 nm to λ = 250 nm for absolute calibration. The monochromator was separated from the plasma with a MgF2 window and evacuated below 1x10-4 Pa and the echelle spectrometer measured through a quartz window. All spectroscopic measurements were in line-of-sight measurements through the entire vessel. Hence, all densities and (V)UV/UV dose are volume averaged values.

2.4 Plasma and UV-C treatment of spore samples and plasmid DNA. Spore suspensions of the respective B. subtilis strains were prepared in sterile distilled water to a final concentration, such that a 20 µl aliquot contained 1 × 106 spores. V4A stainless steel coupons (7 mm in diameter, thickness of 1.5 mm; Wilms Metallmarkt Lochbleche GmbH & Co. KG, Cologne, Germany) were autoclaved (121°C, 30 min) prior to use. Spores samples for plasma sterilization were prepared by applying 20 µl aliquots of the respective spore suspension onto a steel coupon and left to air dry under ambient laboratory conditions (20 ± 2°C, 40 ± 5 % relative humidity). The pBR322 plasmid DNA (Fisher Thermo Scientific, Germany) was used for in vitro studies of low pressure plasma- induced DNA lesions. Aliquots of 500 ng plasmid DNA and GeneRuler 1 kb ladder (Thermo Fisher Scientific, Germany) marker DNA were spotted on sterile glass slides and air dried. Triplicate samples of air-dried spore layers, plasmid DNA and DNA ladder were exposed in a low pressure plasma reactor setup (DICP) to different gas mixtures. The experiments presented were performed at a power of 500 W at a pressure of 10 Pa. The following plasma gas compositions have been tested: Ar (100 sccm), Ar:O2 (100:5 sccm),

O2 (20 sccm). The samples were placed axially and radially in the center of the discharge with thin glass sample holders influencing the plasma as less as possible.

154 Likewise, spore and plasmid DNA samples were subjected to monochromatic UV-C radiation emitted by a mercury low-pressure lamp with a major emission line at 254 nm (NN 8/15; Heraeus, Germany). The fluence (0.7 J · m-2 · s-2) was measured by a UV-X radiometer fitted with the appropriate calibrated probe at 254 nm (UVP, United Kingdom), and the exposure time for the indicated UV doses was calculated. UV-C irradiation was carried out at room temperature as previously described (Raguse et al., 2016; Moeller et al., 2008).

2.5 Spore survival assay. Spore inactivation rates were determined by a standard colony formation assay as described in (Moeller et al., 2009). To recover the spores from the V4A stainless steel coupons after the plasma treatment, air-dried spore layers were covered by a 10 % aqueous polyvinyl alcohol (PVA) solution. After air-drying, the spore-PVA layer was stripped off as described previously (Raguse et al., 2016; Moeller et al., 2009) and resuspended in 1 ml sterile distilled water, resulting in > 95% spore recovery. This procedure does not affect spore viability (Moeller et al., 2009). Spore survival from the aqueous and spore-PVA suspensions were determined from appropriate dilutions in distilled water as the colony forming ability (of vital colony-forming unit (CFU)) after overnight incubation at 37°C on LB agar plates (Difco, Detroit, USA) as described previously (Moeller et al., 2009).

2.6 Numerical and statistical analysis of spore survival.

The surviving fraction of B. subtilis spores was determined from the ratio N/N0, with N the number of CFU of the treated sample and N0 that of the untreated controls. Spore inactivation curves were obtained as described previously (Moeller et al., 2009; Raguse et al., 2016; Moeller et al., 2014). Data are reported as LD90-values as time in seconds i.e. the time of treatment killing 90 % of the initial spore population (Moeller et al., 2014). All data are expressed as averages ± standard deviations (n = 3). The significance of the differences in the survival rates and relative sensitivities were determined by analysis of variance (ANOVA), using SigmaPlot software Version 12.0 (Systat Software GmbH, Erkrath, Germany). Values were evaluated in multigroup pairwise combinations, and differences with P values < 0.05 were considered statistically significant.

2.7 Gel electrophoresis and transformation of plasmid DNA The pBR322 plasmid DNA treated with plasma or UV-C radiation was resuspended in 20 µL sterile DNase-free water, the duplicate samples were pooled, and the concentration was checked by Nanodrop spectrophotometer (Peqlab). Agarose gelelectrophoresis was

155 performed in a 1% gel using 150 ng of the treated plasmid DNA per slot. Untreated hydrated plasmid DNA and plasmid DNA exposed to the vacuum of 10 Pa for 300 s only served as control. Treated samples of 4 ng were transformed into chemically competent Escherichia coli DH5α (Life Technologies, Darmstadt, Germany), following the provided protocol. Transformed cells were selected on Tetracycline-containing (10 µg/ml) LB plates and incubated overnight at 37 °C. Based on the colony forming units (CFU) the transformation efficiency was calculated.

2.8 Quantitation of generated bipyrimidine DNA photoproduct Plasmid DNA samples treated with various low pressure plasma discharges and UV-C radiation were analyzed for the nature and abundance of photolesions introduced by the respective treatments, as described previously (Douki et al., 2005a). Briefly, plasmid DNA samples were digested with nuclease P1 and phosphodiesterase I and the digested samples were analyzed by high-performance liquid chromatography coupled with tandem mass spectrometry (HPLC-MS/MS). Dimeric photoproducts involving adjacent pyrimidines are detected as they are released as modified dinucleoside monophosphates. The following photoproducts were quantified: Cyclobutane dimers (CPD) of thymine-thymine (TT CPD), thymine-cytosine (TC CPD), cytosine-thymine (CT CPD), cytosine-cytosine (CC CPD) adducts; pyrimidine-pyrimidone (6-4) photoproducts of thymine-thymine (TT 6-4PP) and thymine-cytosine (TC 6-4PP); and the spore specific SP.

3. RESULTS 3.1 (V)UV Emission Diagnostics The measured (V)UV spectra emitted in LPP discharges in the DICP reactor setup are shown in comparison in (Fig. 2). The spectra deviate significantly from each other in absolute intensity as well as in wavelength position of emission depending on the process gas. In O2 plasma, the amount of VUV and UV-radiation is mainly emitted in the VUV around λ = 130 nm. The emission intensity increases at λ = 130 nm and in the UV-B wavelength range in the Ar:O2 mixture due to an additional excitation process in the plasma. Pure argon had nearly no emission in the measured VUV and UV range of λ = 130 – 400 nm. Peaks above λ = 200 nm were in most cases caused by noise from the Echelle detector due to its high sensitivity in the visible and infrared. Below λ = 200 nm, where measurements were performed with the monochromator, no noise was visible due to the

156 different detector material which is only sensitive from λ = 115 nm to λ = 320 nm. The presented spectra could only be determined down to λ = 130 nm due to N2(a-X) calibration of the monochromator. Below λ = 130 nm, the intense resonance lines were present which strongly increase the dose in the VUV range. The argon lines were calculated previously (Mertmann et al., 2009), where two of the first four excited energy levels emitt at λ = 104 nm and λ = 106 nm. This emission is very intense and strongly influences the dose in the VUV range as shown by calculations from (Mertmann et al., 2009) for the used plasma system.

Figure 2 Absolute measured (V)UV spectra intensity of LPP discharges in the DICP

setup. O2 (blue), Ar:O2 (red), and Ar (black). Overlaid inactivation rate constant indicates sporicidal effectiveness of particular wavelength spectra from λ = 50 – 300 nm (Munakata et al., 1999). (Raguse et al., 2016b submitted)

157 The spectral irradiance of the low-pressure mercury lamp is displayed in Figure 3. The major emission line is at 253.65 nm.

Figure 3 Spectral irradiance at semi-logarithmic (A) and linear (B) plotting, of the used mercury low-pressure lamp (NN 8/15, Heraeus, Berlin, Germany). The major emission line is at 253,65 nm. The spectral data were kindly provided by Dr. R. Facius (DLR, Cologne, Germany).

3.1 Spore survival B. subtilis spores lacking various DNA repair enzymes were subjected to low pressure plasma in a DICP setup and to UV-C radiation at 254 nm. The effects of the different plasma parameters on spore survivability were determined at different time points and inactivation kinetics were plotted. LD90 values were calculated and compared using Student’s t-test. All DNA-repair deficient strains were significantly more sensitive to the respective treatment than wildtype spores (Fig. 4). In Ar plasma spores impaired in DSB repair via RecA (ΔrecA) and NHEJ (Δku ΔligD) showed the highest sensitivity, followed by SP lyase (ΔsplB) activity and NER (ΔuvrAB). BER (ΔexoA Δnfo) seems to play a minor role in spore resistance towards Ar plasma discharges. In pure oxygen plasma discharges spores with defective DSB repair via RecA and NHEJ showed the highest sensitivity, whereas DNA repair by SP lyase, BER, and

NER seem to be of minor importance. The gas composition of Ar with admixtures of O2 showed the highest spore inactivation efficiency. Spore survival analyses indicate the importance of SP lase activity for spore survival, followed by DNA DSB repair, BER, and NER. Spores absent in SP lyase activity were most sensitive to UV-C treatment followed

158 by spores impaired in DSB repair by NHEJ. Spores impaired in RecA-mediated DSB repair and BER were moderately more sensitive to UV-V irradiation, whereas NER seems to play a min or role in resistance against UV-C radiation.

Figure 4 Survival of B. subtilis spores deficient in diverse DNA repair pathways after treatment with low pressure (A) Ar, (B) O2, (C) Ar:O2 plasma and (D) UV-C at 254 nm.

3.1 Photoproduct formation In order to monitor the generation of DNA photoproducts, dehydrated low-molecular weight plasmid DNA was subjected to plasma treatment and UV-C as control treatment and subsequently analyzed for the nature of formed photoproducts and their abundance in vitro. All tested DICP plasma treatments lead to the introduction of photoproducts in dehydrated plasmid DNA (Fig. 5). The highest average photoproduct formation in all

159 plasma treatments was observed for Ar:O2 discharges, followed by pure Ar discharges, and pure O2 discharges showing the lowest level of photoproduct induction in vitro. SP formation was the lesion with the highest abundance followed by TC 6-4PPs. Minor TT CPD and TC CPD formation was observed in all plasma treatments but no or very limited CT CPD CC CPD and TT 6-4PP formation. In UV-C treated plasmid DNA photoproduct formation was higher compared to all plasma treatments, although only little SP formation was observed. The major photoproducts found were TC 6-4PPs followed by TT CPDs and TC CPDs.

Figure 5 Distribution of DNA photoproducts in dehydrated pBR322 plasmid DNA in vitro after treatment with low pressure (A) Ar, (B) O2, (C) Ar:O2 plasma and (D) UV-C at 254 nm.

160 3.2 DNA strand breaks and transformation efficiency The treatment of dehydrated pBR322 plasmid DNA and subsequent analysis by agarose gel electrophoresis revealed the induction of SSB and DSB in vitro (Schnaith et al., 1994) after LPP treatment employing pure Ar and pure O2 discharges or Ar with admixtures of O2 (Fig. 6). Dehydration and subsequent low pressure treatment alone (10 Pa for 300 s) was found to induce SSBs but not DSBs. LPP treatment induced additional DSB breaks in all employed gas mixtures. With increasing treatment time continuous fragmentation was observed as well as the formation of multimeric structures running higher on the gel, possibly indicative of cross-links between plasmid molecules. After 300 s treatment time the plasmid DNA molecule was highly fragmented an no longer detectable by agarose electrophoresis. After UV-C treatment the induction of SSB (likely by the dehydration process) and at fluences > 100 J*m-2 DSB formation was observed. However, detectable plasmid fragmentation was not observed. The analysis of marker DNA indicates the homogeneous fragmentation of low and high molecular weight DNA molecules over treatment time (Fig. 7). Further, a significant reduction in the transformation efficiency of plasmid DNA into chemically competent E. coli DH5α cells was observed after exposure to Ar plasma with admixtures of O2 and after long exposure to pure Ar plasma discharges, indicating that the treated plasmid is at least in part structurally or functionally impaired due to plasma-mediated strand breaks, mutations in the tetR gene (conferring resistance to tetracycline), or damaged origin of replication (Fig. 8). No significant reduction in transformation efficiency was observed after treatment with pure

O2 discharges and UV-C at 254 nm.

161

Figure 6 Analysis of treated dehydrated pBR322 plasmid DNA by agarose gel electrophoresis

after treatment with Ar, O2, Ar:O2 plasma and UV-C at 254 nm. All samples ran on the same gel. The plasmid is shown in its supercoiled (INT), open circle (SSB), and linearized (DSB) form.

Figure 7 Analysis of dehydrated GeneRuler 1kb DNA ladder treated with Ar, O2, Ar:O2 plasma and UV-C at 254 nm by agarose gel electrophoresis.

162

Figure 8 Transformation efficiency of dehydrated pBR322 plasmid DNA in E. coli

DH5α and selection for tetracycline after after treatment with Ar, O2, Ar:O2 plasma and UV-C at 254 nm.

163 4. DISCUSSION LPP discharges have proven to be a promising alternative to conventional sterilization methods and are a very versatile agent for spore inactivation and decontamination (Raguseet al., 2016; Denis et al., 2012; Halfmann et al., 2007a; Stapelmann et al., 2013). However, the underlying mechanisms involved in spore inactivation by plasma have been only scarcely discussed (Roth et al., 2008; Halfmann et al., 2007b) and little is known about the interaction of plasma species with spore components, primary targets in the spore and which structural features and mechanisms are involved in spore resistance towards plasma-discharges. In previous studies we have shown that the protective structure surrounding the spore, the proteinaceous spore coat, plays a significant role in spore resistance to LPP discharges (Raguse et al., 2016 (submitted)). Yet, despite the potential photoionization and erosion of spore proteins, the major target of (V)UV photons is the well-protected DNA in the spore core. Therefore, the next step was the assessment of fundamental factors involved in spore resistance towards plasma-induced DNA lesions.

B. subtilis spores lacking the spore photoproduct lyase, specifically designated to the repair of SP lesions, were significantly more sensitive to the treatment compared to wildtype spores. Particularly in Ar:O2 plasma spores lacking SP layse were faster inactivated compared to pure O2 discharges which is likely associated with the higher UV spectrum emitted by Ar:O2. While O2 plasma mainly emits photons in the VUV spectrum at 130 nm, a combined discharge of Ar and O2 offers higher emission also at wavelength spectra > 200 nm, which are more likely to induce photoproducts. As expected, UV-C irradiated spores deficient in SP lyase showed the lowest survival rate of all tested mutants attributed to the previously reported predominant formation of SP (Donnellan and Setlow, 1965) and importance of SP lyase in the removal of SP lesions during spore revival (Moeller et al., 2007a). Furthermore, spores impaired in removal of bulky photoproducts by NER were more sensitive to plasma treatment. The increased sensitivity of spores devoid of pathways for photoproduct repair suggests the UV-based introduction of photoproducts into spore DNA that required extensive repair upon outgrowth. The analysis of the nature of photoproducts introduced by plasma treatment in dehydrated plasmid DNA, which switched into a A-like conformation similar but not identical to spore DNA in the spore core, revealed that all tested DICP plasma treatments lead to the introduction of photoproducts in vitro. The analyzed spectrum of bipyrimidine dimers revealed that the spore photoproduct was formed with the highest abundance by far in all plasma treatments, followed by T<>C 6-4 pyrimidone photoroducts and T<>T and T<>C cyclobutane

164 pyrimidine dimers between adjacent pyrimidines. The total amount of photoproducts was highest in UV-C radiation at 254 nm as expected from previous studies reporting spores deficient in spore photoproduct lyase were most sensitive to UV-C radiation (Moeller 2007b). However, only low quantities of spore photoproduct formation was observed, which is likely attributed to the condition of in vitro analysis in absence of α/β-type SASPs and Ca2+-DPA, both crucial factors favoring the generation of SP in spore DNA in vivo (reviewed in Setlow, 2001). In oxygen plasma discharges, spores lacking the SP lyase and NER as mechanisms for photoproduct repair are only slightly more sensitive than wildtype spores consistent with the observation of comparably lower photoproduct generation, suggesting that the introduction of photolesions in spore DNA plays only a minor role in spore inactivation by oxygen plasma. However, spores impaired in the repair of DNA strand breaks by Ku and LigD-mediated NHEJ and the RecA-mediated HR were found to be significantly more sensitive in all plasma treatments and also to some extent to UV-C radiation compared to wild-type spores. Indirect evidence for DSB induction derived from the observed UV sensitivity of NHEJ mutants confirmed the generation of strand breaks in spore DNA upon UV irradiation (Moeller et al., 2007b). Further, recA mutations have been reported to render B. subtilis spores about twofold more sensitive to UV-C radiation at 254 nm (Munakata and Rupert, 1975) and the induction of recA-lacZ fusion genes was observed in outgrowing spores after UV-C treatment, indicating the importance of this pathway in spore UV resistance (Setlow and Setlow, 1996). In vitro analysis revealed the induction of SSBs and DSBs in plasmid DNA over the course of all plasma treatments. The low pressure condition of 10 Pa functions as an extreme form of desiccation and introduces nicks into the DNA double helix producing single strand breaks that relax the supercoiled plasmid (Schnaith et al., 1994; Vlasic et al., 2013). Strand breaks and subsequent fragmentation of DNA by LPP discharges may be attributed to the high (V)UV fluence rates present in LPP discharges. The excitation of the sugar-phosphate group by VUV photons < 160 nm is thought to be the primary cause of DNA strand breaks (Ito et al., 1986; Ito and Ito (1986)). Highly energetic VUV photons emitted in LPP discharges, e.g. as emitted in Ar plasma at λ = 104.8 (11.8 eV) and λ = 106.7 nm (11.6 eV) (Mertmann et al, 2009), provide sufficient energy to ionize the DNA sugar backbone resulting in scission of N-glycosidic bonds and the formation of strand breaks in vitro (Ito and Ito, 1986). In UV-C irradiated plasmid DNA strand breaks but no fragmentation was observed (at least on the resolution limit of agarose gel electrophoresis).

165 Additionally, oxygen-containing plasmas produce a variety of oxidative species and the treated substrate can reach elevated temperatures in a continuous wave discharge of >100 °C after ~100 s of treatment. Dry heat is a well-known factor for the induction of DNA strand breaks (Setlow and Setlow, 1995) and may contribute to the plasma-mediated damage. Moreover, the activity of BER dedicated to the removal of apurinic or apyrimidinic sites during spore revival, plays a minor role in plasmas containing reactive oxygen species that may interact with the base moiety and lead to oxidative damage. However to provide a more definite statement the amount of oxidative lesions produced by LPP discharges need to be quantified. The significant reduction in the transformation efficiency of plasmid DNA after plasma treatment but not UV-C treatment was indicative of the plasma-induced damage that is evidently more complex. The results indicate that unfiltered LPP discharges significantly damage plasmid DNA in vitro by introducing photoproducts, predominately SP, along with DNA strand breaks. It was demonstrate that multiple DNA repair pathways, involved in the repair of photoproducts, DNA strand breaks, as well as in the removal of damaged base moieties, are required for spore resistance against plasma treatment, suggesting that various plasma- induced lesions are introduced into spore DNA that require repair upon spore revival.

5. ACKNOWLEDGEMENT The authors thank Andrea Schröder and Inga Hahn for their excellent technical assistance during parts of this work. This work was supported in parts by grants from the German Research Foundation (DFG) Paketantrag (PlasmaDecon PAK 728) to P.A. (AW 7/3-1) and R.M. (MO 2023/2-1), and the German Aerospace Center (DLR) grant DLR- FuE-Projekt ISS-Nutzung in der Biodiagnostik, Programm RF-FuW, Teilprogramm 475 (to R.M. and M.R.). The results of this study will be included in the Ph.D. thesis of Marina Raguse.

6. CONFLICT OF INTEREST No conflict of interest declared.

166 7. REFRENCES

Ayora S, Carrasco B, Cardenas PP, Cesar CE, Canas C, Yadav T, Marchisone C, Alonso JC. 2011. Double-strand break repair in bacteria: a view from Bacillus subtilis. FEMS Microbiol Rev 35:1055-1081. Barajas-Ornelas Rdel C, Ramírez-Guadiana FH, Juárez-Godínez R, Ayala-García VM, Robleto EA, Yasbin RE, Pedraza-Reyes M. 2014. Error-prone processing of apurinic/apyrimidinic (AP) sites by PolX underlies a novel mechanism that promotes adaptive mutagenesis in Bacillus subtilis. J Bacteriol 196:3012-3022.

Bibinov NK, Bolshukhin DO, Kokh DB, Pravilov AM, Vinogradov IP, Wiesemann K. 1997. Absolute calibration of the efficiency of a VUV-monochromator/detector system in the range 110-450 nm. Meas Sci Technol 8:773-781. Cox MM. 2007. Regulation of bacterial RecA protein function. Crit Rev Biochem Mol Biol 42:41-63. de Ory A, Nagler K, Carrasco B, Raguse M, Zafra O, Moeller R, de Vega M. 2016. Identification of a conserved 5’-dRP lyase activity in bacterial DNA repair ligase D and its Denis B, Steves S, Semmler E, Bibinov N, Novak W, Awakowicz P. 2012. Plasma sterilization of pharmaceutical products: from basics to production. Plasma Process Polym 9:619-629. Donnellan JE Jr, Setlow RB. 1965. Thymine photoproducts but not thymine dimers found in ultraviolet-irradiated bacterial spores. Science 149:308-310. Douki T, Setlow B, Setlow P. 2005a. Effects of the binding of α/β-type small acid-solube spore proteins on the photochemistry of DNA in spores of Bacillus subtilis in vitro. Photochem Photobiol 81:163-169. Douki T, Setlow B, Setlow P. 2005a. Effects of the binding of α/β-type small acid-solube spore proteins on the photochemistry of DNA in spores of Bacillus subtilis in vitro. Photochem Photobiol 81:163-169. Douki T, Setlow B, Setlow P. 2005b. Photosensitization of DNA by dipicolinic acid, a major component of spores of Bacillus species. Photochem Photobiol Sci 4:591-597. Fairhead H and Setlow P. 1992. Binding of DNA to alpha/beta-type small, acid-soluble proteins from spores of Bacillus or Clostridium species prevents formation of cytosine dimers, cytosine-thymine dimers, and bipyrimidine photoadducts after UV irradiation. J Bacteriol 174:2874-2880. Friedberg EC, et al. 2006. DNA repair and mutagenesis, 2nd ed. American Society for Microbiology, Washington, DC. Gunka K, Tholen S, Gerwig J, Herzberg C, Stülke J, Commichau FM. 2012. A high- frequency mutation in Bacillus subtilis: requirements for the decryptification of the gudB glutamate dehydrogenase gene. J Bacteriol 194:1036-1044. Halfmann H, Bibinov N, Wunderlich J, Awakowicz P. 2007a. A double inductively coupled plasma for sterilization of medical devices. J Phys D Appl Phys 40:4145 Halfmann H, Denis B, Bibinov N, Wunderlich J, Awakowicz P. 2007b. Identification of the most efficient VUV/UV radiation for plasma based inactivation of Bacillus atrophaeus spores. J Phys D Appl Phys 40:5907.

167 Humphreys PN. 2011. Testing standards for sporicides. J Hosp Infect 77:193–198. Ito A and Ito T. 1986. Absorption spectra of deoxyribose, ribosephosphate, ATP and DNA by direct transmission measurements in the vacuum-UV (150—190 nm) and far-UV (190—260 nm) regions using synchrotron radiation as a light source. Photochem Photobiol 44:355-358. Ito T and Taniguchi T. 1986. Enzymatic quantification of strand breaks of DNA induced by vacuum-UV radiation. FEBS 206:151-153. Keijser BJF, Ter Beek A, Rauwerda H, Schuren F, Montijn R, van der Spek H, Brul S. 2007. Analysis of Temporal Gene Expression during Bacillus subtilis Spore Germination and Outgrowth. J Bacteriol 189:3624-3634. Lenhart JS, Schroeder JW, Walsh BW, Simmons LA. 2012. DNA repair and genome maintenance in Bacillus subtilis. Microbiol Mol Biol Rev 76:530-564. Lindberg C and Horneck GJ. 1992. Thymine photoproduct formation and inactivation of intact spores of Bacillus subtilis irradiated with short wavelength UV (200 – 300nm) at atmospheric pressure and in vacuo. Adv Space Res 12:275-279. Mertmann P, Bibinov N, Halfmann H, Awakowciz P. 2009. Determination of argon resonance line emission in an ICP hitting a biological sample. Plasma Sources Sci Technol 7:665-675.

Moeller R, Douki T, Cadet J, Stackebrandt E, Nicholson WL, Rettberg P, Reitz G, Horneck G. 2007a. UV-radiation-induced formation of DNA bipyrimidine photoproducts in Bacillus subtilis endospores and their repair during germination. Int Microbiol 10:39-46. Moeller R, Raguse M, Reitz G, Okayasu R, Li Z, Klein S, Setlow P, Nicholson WL. 2014. Resistance of Bacillus subtilis Spore DNA to Lethal Ionizing Radiation Damage Relies Primarily on Spore Core Components and DNA Repair, with Minor Effects of Oxygen Radical Detoxification. Appl Environ Microbiol 80:104-109. Moeller R, Setlow P, Reitz G, Nicholson WL. 2009. Roles of small, acid-soluble spore proteins and core water content in survival of Bacillus subtilis spores exposed to environmental solar UV radiation. Appl Environ Microbiol 75:5202-5208. Moeller R, Setlow P, Reitz G, Nicholson WL. 2009. Roles of small, acid-soluble spore proteins and core water content in survival of Bacillus subtilis spores exposed to environmental solar UV radiation. Appl Environ Microbiol 75:5202-5208. Moeller R, Stackebrandt E, Reitz G, Berger T, Rettberg P, Doherty AJ, Horneck G, Nicholson WL. 2007b. Role of DNA repair by nonhomologous-end joining in Bacillus subtilis spore resistance to extreme dryness, mono- and polychromatic UV, and ionizing radiation. J Bacteriol 189:3306-3311.

Munakata N and Rupert CS. 1972. Genetically controlled removal of “spore photoproduct” from deoxyribonucleic acid of ultraviolet-irradiated Bacillus subtilis spores. J Bacteriol 111:192–198. Munakata N and Rupert CS. 1974. Dark repair of DNA containing „spore photoproduct” in Bacillus subtilis. Mol Gen Genet 130:239-250. Munakata N and Rupert CS. 1975. Effects of DNA-polymerase-defective and recombination-deficient mutations on the ultraviolet sensitivity of Bacillus subtilis spores. Mutat Res 27:157-69.

168 potential role in base excision repair. Nucleic Acids Res 44:1833-1844. Raguse M, Fiebrandt M, Stapelmann K, Madela K, Laue M, Lackmann JW, Thwaite JE, Setlow P, Awakowicz P, Moeller R. 2016. Improvement of biological indicators by uniformly distributing of Bacillus subtilis monolayers to evaluate enhanced spore decontamination technologies. Appl Environ Microbiol 82:2031-2038. Roth S, Feichtinger J, Hertel C. 2010. Characterization of Bacillus subtilis spore inactivation in low-pressure, low-temperature gas plasma sterilization processes. J Appl Microbiol 108:521-31 Schaeffer P, Millet J, Aubert JP. 1965. Catabolic repression of bacterial sporulation. Proc Natl Acad Sci USA 45:704-711. Schnaith LMT, Hanson RS, Que L Jr. 1994. Double-stranded cleavage of pBR322 by a diiron complex via a “hydrolytic” mechanism. Proc Natl Acad Sci USA 91:569-573. Setlow B and Setlow P. 1995. Small, acid-soluble proteins bound to DNA protect Bacillus subtilis spores from killing by dry heat. Appl Environ Microbiol 61:2787-2790 Setlow B and Setlow P. 1996. Role of DNA repair in Bacillus subtilis spore resistance. J Bacteriol 178:3486-3495. Setlow P and Kornberg A. 1970. Biochemical studies of bacterial sporulation and germination. 23. Nucleotide metabolism during spore germination. J Biol Chem 245:3645- 3652. Setlow P and Lei L. 2015. Photochemistry and photobiology of the spore photoproduct: A 50-year journey. Photochem Photobiol 91:1263-1290. Setlow P. 2001. Resistance of spores of Bacillus species to ultraviolet light. Environ Mol Mutagen 38:97-104. Setlow P. 2014b. Spore resistance properties. Microbiol Spec 2:TBS-0003-2012. (doi:10.1128/microbiolspec.TBS-0003-2012). Tyrrell RM. 1978. Solar dosimetry with repair deficient bacterial spores: action spectra, photoproduct measurements and comparison with other biological systems. Photochem Photobiol 27:571-579. Weller GR, Kysela B, Roy R, Tonkin LM, Scanlan E, Della M, Devine SK, Day JP, Wilkinson A, d'Adda di Fagagna F, Devine KM, Bowater RP, Jeggo PA, Jackson SP, Doherty AJ. 2002. Identification of a DNA nonhomologous end-joining complex in bacteria. Science 297:1686-1689. Wilson TE, Topper LM, Palmbos PL. 2003. Non-homologous end-joining: bacteria join the chromosome breakdance. Trends Biochem Sci 28:62-66.

169 I. Discussion

Limitations of traditional sterilization procedures for processing innovative heat- sensitive materials, equipment prone to corrosion, and complex electronic instruments have motivated the search for alternative sterilization methods. Non-thermal plasma discharges have proven to be a promising alternative and a very versatile agent for the decontamination and sterilization of medical equipment, innovative plastics often used for the fabrication of medical tools, and food packages (Stapelmann et al., 2008; Moisan et al., 2001; Pankaj et al., 2014). Plasma sterilization operates with moderate temperature, often as low as room temperature, which makes it suitable for the sterilization of a wide variety of heat-sensitive materials. Especially LPP discharges offer extremely short treatment times and have been recognized as universal method for the inactivation of a broad range of biological systems, including exceptionally resistant bacterial endospores (Halfmann et al., 2007a/ 2007b; Moisan et al., 2001; Lerouge et al., 2000a). Considering the multitude of advantages of plasma sterilization, it is surprising that the process has not yet been widely implemented in industrial settings. The main reason for this circumstance is the lack of information regarding the underlying mechanism leading to bacterial inactivation, which strongly limits validation and process optimization (Rauscher et al., 2010). The complexity of the plasma discharge complicates the identification of mechanisms as an array of different reactive components ((V)UV radiation, excited and neutral atoms and molecules, charged particles, heat, and electrons) affect the biological system making it difficult to understand the principal action that leads to plasma-based modification and inactivation. In this work the applicability of LPP sterilization in the challenging setting of hardware decontamination in space flight industry was demonstrated. Further, a procedure was developed for the uniform and reproducible preparation of spore monolayers, which significantly improved the assessment of the plasma-mediated inactivation efficiency. Further key morphological attributes were identified that aid in the protection of spores from plasma-induced damage as well as crucial spore-specific and universal DNA repair pathways active during spore revival.

1. Industrial Implementation The implication of an alternative method of sterilization is of considerable importance in a variety of industrial fields that impose strict regulations of sterilization. Besides healthcare settings and food packaging, where sterilization is a crucial factor, also the space industry is utterly concerned with the risk of microbial contamination. The national space agencies impose strict regulations on the cleaning and sterilization procedure of spacecraft hardware

170 and components to limit the environmental contamination of extraterrestrial bodies with terrestrial microorganisms and organic molecules in the course of space flight missions (The Outer Space Treaty, 1967; COSPAR, 2011). To achieve the desired sterilization standards several cleaning methods are employed individually to each component, however with common methods in practice, problems are concerning the insufficient removal of microorganisms or thermomechanical incompatibilities of sensitive materials that can lead to failure of electronic equipment in a space craft during a mission. The control and removal of highly resistant bacterial endospores are still one of the most difficult problems in space craft sterilization and insufficient sterilization and disinfection performance has led to the development of strains with elevated resistance properties towards different stressors, e.g. UV radiation and hydrogen peroxide (Link et al., 2004; LaLuc et al., 2004). To test the efficiency and applicability of a LPP sterilization process for the inactivation of spore contaminations in a realistic setting for space craft assembly, spores of the highly resistant spacecraft assembly facility (SAF) isolate B. pumilus SAFR-032 were analyzed and compared to the response of spores of the standard dosimetric laboratory B. subtilis wildtype strain 168 for their inactivation by LPP hydrogen or oxygen discharges with and without the addition of vaporized hydrogen peroxide. The inactivation was carried out in a VHF-CCP setup, which was specifically designed for industrial applications (reactor setup, see section 2.1; Stapelmann et al., 2013 (Chapter B)). Spores were exposed to the plasma discharge in a multilayered fashion deposited on a representative stainless steel, complex-shaped three- dimensional object, challenging the sterilization process with limited accessibility of critical areas in a material. Shielding of microorganisms by overlapping structures or by deposition in pits and fissures is a major problem for surface based sterilization, especially for nonpenetrating agents (Coohill and Sagripanti, 2008). Pure hydrogen discharges are characterized by a high amount of sporicidal UV and VUV radiation emitted over a broad wavelength spectrum (Stapelmann, 2013). The reduction efficiency of both Bacillus species was highly dependent on the experimental parameters, particularly the power coupled into the discharge. Increased power coupling (comparing 100 W to 400 W) resulted in higher inactivation rates, which is in good agreement with reports describing the relationship of increasing power with the dissociation degree, generating higher active particle densities (Fiebrandt, 2012). While pure hydrogen plasma was moderately effective for the microbial reduction by 1 - 2 orders of magnitude (60 s treatment time), a two- step decontamination process was employed to investigate the influence of additional hydrogen peroxide as a supportive agent for enhanced spore inactivation. The vaporization of

171 30 % hydrogen peroxide in the low-pressure chamber with subsequent exposure to hydrogen plasma (400 W, 5 Pa, 20 standard cubic centimeters per minute (sccm)) resulted in a significantly higher reduction of the spore load after 60 seconds, reducing B. subtilis spores by 6 orders of magnitude and spores of the highly resistant B. pumilus SAFR-032 by 4.5 orders of magnitude (Stapelmann et al., 2013, (Chapter B)). The increase in efficiency can be explained by fast saturation of the volume in the low pressure environment that causes vaporized hydrogen peroxide solution to promptly condensate on the reactor walls and the spore samples. Venugopalan and Shih (1981) have reported that with the ignition of microwave plasma, hydrogen peroxide vapor is dissociated into atomic and molecular hydrogen, oxygen, and reactive species, including OH• and O1. This suggests that a similar mechanism occurs when hydrogen peroxide is vaporized by the VHF-CCP leading to the production of species which are possibly directly affecting the spore in addition to the hydrogen discharge plasma particles leading to enhanced inactivation rates. However, possible synergistic mechanisms of generated reactive species and plasma particles leading to spore inactivation remain to be investigated. In all treatments full spore inactivation was obtained after 5 min treatment time, independent of the genotype or process gas. The combined use of hydrogen peroxide evaporation in a low-pressure chamber with a plasma sterilization process of LPP has proven to be an effective and suitable method for the potential reduction and control of spore bioburden, even of a significantly more resistant clean room isolate, on space craft hardware components. Here, in this work it is important to note, that in contrast to the Sterrad® system employed by Johnson & Johnson, a “plasma-assisted” sterilization system often mistaken for the first plasma sterilizer implemented in industry (Shintani, 2015; Denis et al., 2012), the treated spore samples are in direct contact with the plasma discharge, which results in the delivery of an array of sporicidal plasma particles directly to the surface enhancing the spore inactivation.

2. Biological Indicators for Plasma Sterilization When considering a new sporicidal agent several desirable performance criteria and international industry standards must be met by the designated process. Generally, a procedure is required that is (i) fast-acting, (ii) able to deal with high levels of contamination and (iii) realistic levels of organic matter, while at the same time (iv) being compatible with most construction materials and (v) safe to use (Humphreys, 2011). At first glance, LPP

172 sterilization is a method that meets most desirable performance criteria required for a sporicidal agent (Stapelmann et al., 2013, (Chapter B)). However, in order for a process to be implemented in industrial processes, the performance must be assessed by testing biological standards to ensure the efficiency and to validate the continuous functionality of a disinfection or sterilization procedure. One of the critical points includes the selection of a reference microorganism that exhibits high resistance behavior towards the considered sterilizing agent (Humphreys, 2011; Yardimci and Setlow, 2000). Bacterial spores are frequently used as a BI of sterility, primarily because bacterial spores exhibit a remarkable resistance to chemical and physical methods of sterilization, exceeding the resistance of their vegetative counterpart by far (Penna et al., 2002; Humphreys, 2011; Setlow, 2014). Hence, a process that achieves full spore inactivation ensures complete elimination of other contaminating microorganisms. Effective standard tests are required to be accurate and highly reproducible (Humphreys, 2011). However, in many practical cases the performance of a BI is compromised by inhomogeneous distribution of the respective test strain (especially at the required high concentrations of >106 spores/sample for sufficient monitoring of inactivation efficiency (Shintani, 2014)) resulting in multilayered stacks of spores thereby shielding the embedded spores from incident plasma processes (Shintani, 2015; Raballand et al., 2008). To approach this common problem, an electrically operated device for the reproducible spray deposition of B. subtilis spores was developed during this work that ensures a reproducible and homogeneous sample preparation process of highly concentrated spore monolayers (Raguse et al., 2016a (Chapter D)). Briefly, the setup consists of a high-precision two- substance nozzle comprising two inlets, one for pressurized carrier gas (N2) and one for liquid sample feed. The gas supply is regulated by a power-driven magnetic valve that is electrically coupled to a quartz timer that allows simultaneous opening of nozzle and gas inlet allowing dispersion of the injected liquid sample through the nozzle outlet onto a carrier material. The electrical operation of the spraying process allows for highly controlled and extremely short spraying times of <0.1 s, enhancing the accuracy and technical refinement of the process. Analysis of the resulting spatial distribution of spores on glass surfaces as obtained by the spraying process revealed a uniform distribution of spores exclusively in monolayers with no apparent overlapping structures or spore aggregates even at high spore concentrations (>5x107 spores/sample). It was clearly demonstrated that monolayered spores are significantly faster inactivated by low pressure argon plasma treatment in a DICP setup (for reactor setup see section 2.2) as compared to multilayered spores prepared by a common sample preparation

173 method. Evidently, accumulation of spore multilayers shield the spores in lower layers against low pressure argon plasma treatment. As UV and VUV are major factors in spore inactivation mediated by low-pressure argon plasma, the impact on spore viability of mono- and multilayered spore populations is highly dependent on the penetration capability of generated UV photons. For UV-C radiation at 254 nm a limited penetration depth was reported that is significantly reduced by spore clumping and multilayered spore aggregates (Coohill and Sagripanti, 2008). Studies have demonstrated that a bacterial spore of 1 µm in diameter shielding an underlying spore only allows the transmission of 61% of the incident beam. Assuming two spores shield a third, only 37% of the incident beam would reach the underlying spore (Coohill, 1986). Argon plasma primarily emits photons in the VUV range at wavelengths of λ = 104.8 and λ = 106.7 nm (Mertmann et al., 2009) along with additional weak emission at λ = 355 nm and λ = 360 nm. Additionally, impurities in the chamber (N2,

O2, and H2O from samples and residual gas after ventilation of the chamber) radiate in the bactericidal range from λ = 120 nm to λ = 380 nm (Raguse et al., 2016b (under revision) (Chapter E)); unpublished data). Hence, even small accumulations of multilayered spores can reduce photon transmission and significantly affect the sterilization efficiency. Thus, tailing phenomenon in survival curves are inevitable, making industrially required SAL of 10- 6 difficult to achieve. However, in realistic scenarios, microbial contamination will likely occur in multilayered forms. Therefore the plasma process must be carefully tuned to obtain an effective combination of sporicidal UV radiation as well as reactive particles, molecules, and atoms that erode the biological material by etching, sputtering, and photodesorption processes to uncover the deeper layers and expose previously embedded spores to the sporicidal UV radiation. In the field of LPP sterilization, work is still needed to standardize the performance and develop a suitable BI for sterilization assurance (Shintani, 2015). Relative changes within the concentrations of the active particles present in a plasma discharge greatly depend on the gas composition, the device setup, and operational settings. Hence, a highly reproducible and quality-controlled BI for the evaluation of plasma sterilization efficiency is crucial for this process to be widely implemented in industrial settings.

3. B. subtilis Spore Inactivation by Low Pressure Plasma Treatment Spores of the gram-positive bacterium B. subtilis, which are much more resistant to a variety of environmental stresses than their vegetative counterpart, were used as BI and

174 genetic model system to identify key factors involved in spore protection against plasma treatment. Besides the essential influence of reactor type, frequency, power, and pressure, the plasma composition is highly dependent on the gas composition as it determines the type of active species in a discharge. While plasma discharges are comprised of a variety of active species, in the low pressure environment UV and VUV photons in particular have been shown to play a major role in spore inactivation (Halfmann et al., 2007b; Lerouge et al., 2000a). Experiments using magnesium fluoride windows (cutoff 115 nm) to isolate emitted (V)UV radiation from the remaining plasma components revealed that B. subtilis wildtype spores are largely inactivated by (V)UV radiation as only a slight increase of the inactivation efficiency was observed when spores were treated with the complete discharge, indicating the significance in spore inactivation in a low pressure VHF-CCP setup (Neumann, 2014). Wild type spores were found to be generally more sensitive to hydrogen plasma and hydrogen with admixture of oxygen than pure argon or oxygen plasma, indicating that spores were faster inactivated by LPP discharges emitting high intensity (V)UV radiation in the sporicidal spectrum ((Raguse et al., 2016b (under revision), (Chapter E)). Hydrogen discharges offer a high amount of (V)UV radiation due to H2(a-b, C-X, B-X) and atomic Lyman emission offering a nearly continuous emission from λ = 100 nm to λ = 400 nm. Halfmann et al. (2007b) have studied survival of B. atrophaeus spores in the DICP setup using cutoff filters between the sample and discharge and identified wavelength regions from λ = 235 to λ = 300 nm as dominant factor in in spore reduction. In contrast, in oxygen plasma, the amount of VUV and UV-radiation is significantly lower compared to hydrogen plasma and mainly emits in the VUV around λ = 1γ0 nm, leading to less pronounced spore inactivation. Interestingly, argon emits extremely high UV doses at λ = 104.8 nm and λ = 106.7 nm compared to other plasma discharges (Mertmann et al., 2009), however spore survival was less pronounced despite the enormous fluence intensities (Raguse et al., 2016b (under revision) (Chapter E)). This insensitivity of B. subtilis spores towards certain wavelengths around λ = 100 nm and λ = 190 nm has been previously observed by Munakata et al. (1999), who argued that radiation at these wavelengths are strongly absorbed by the outer spore layers and do not efficiently damage the genetic material (see following section). Besides the substantial amount of lethal UV and VUV radiation in LPP discharges, there are other factors potentially contributing to plasma-mediated spore inactivation. The plasma gas temperature varies with the employed gas type and parameter settings. Gas temperatures in argon and hydrogen plasmas can be maintained at lower temperatures whereas pure oxygen

175 discharges reach elevated temperatures > 100 °C after 120 s treatment time in a continuous wave DICP (unpublished data). Bacillus spores are significantly more resistant to dry heat compared to growing cells (reviewed in Setlow, 2014b) by protecting their genome from damage through saturation with α/-type SASPs and repair heat-inflicted DNA damage by efficient repair mechanisms. Depending on the employed gas, radicals and active species are produced, e.g., atomic oxygen, OH radicals, atomic hydrogen, argon metastables, which can lead to direct killing of the spore by introducing damage of crucial components, e.g. spore coat, inner membrane, or essential germination receptors (Setlow, 2006; Setlow, 2003), or indirect killing by etching of outer spore layers and removal of shielding material enhancing the penetration of sporicidal UV radiation (Rossi et al., 2008; Setlow, 2006). Spores possess a variety of efficient protection and repair mechanisms to endure and counteract plasma-induced damage in the dormant state and upon spore revival. In the following section, specific spore structures and components are analyzed for their significance in spore survival against LPP discharges, from outside (spore coat) to inside (α/-type SASPs, core water, Ca2+-DPA and DNA repair).

4. Role of Spore Coat in Protection The outermost layer, the B. subtilis spore coat, is a multilayered proteinaceous structure that constitutes the first barrier to environmental stresses. The complex cross-linked protein meshwork acts as a protective armor for incoming stressors in form of a permeability barrier for large molecules and detoxifies, e.g. oxidizing agents. It was of fundamental interest to identify the role of major coat layers in spore resistance towards LPP treatment. Therefore, wild-type spores, spores lacking the major protective coat layers (inner, outer, and crust), pigmentation-deficient spores and spores impaired in encasement (a late step in coat assembly) were systematically tested for their resistance to low-pressure argon, hydrogen, and oxygen plasmas with and without admixtures (Raguse et al., 2016b (Chapter E)). Indeed, spores lacking the inner and outer coat layers as well as spores impaired in spore encasement were found to be significantly more susceptible to LPP discharges, independent of the employed gas mixture (Raguse et al., 2016b (under revision)). Although most proteins do not have a well-defined role, spores lacking the melanin-like pigment produced by CotA, present in the outer coat layer, were significantly more sensitive to plasma discharges emitting UV radiation at more environmentally relevant wavelength spectrum (Raguse et al., 2016b (under revision)), which is in good agreement with Hullo et al. (2001), who reported an increased

176 sensitivity of CotA-deficient B. subtilis spores to UV-A radiation of λ = 320 – 400 nm. The recently identified outermost layer, the crust (McKenney et al., 2010), exhibits only a minor role in protection against plasma treatment. Several studies have demonstrated that the appearance of Bacillus spores is significantly altered when subjected to plasma treatment (Opretzka et al., 2007; Lerouge et al., 2000b). When subjected to low pressure argon and oxygen plasma treatment in a DICP setup, we observed significant alterations in the spore surface structure in B. subtilis wildtype spores analyzed by high resolution imaging with atomic force microscopy (AFM) (Raguse et al., 2016b, (Chapter E)). Spores displayed significantly increased surface roughness and distinct visible morphological changes ranging from global irregularities to complete fractures in the surface structures after surprisingly short treatment times of 15 – 60 sec. Morphological changes and surface erosions can be induced by different effects. Lerouge et al. (2000b) observed spore surface modification and correlated elevated spore mortality with increased ROS etching rates. Similarly, Rossi et al. (2008) found significant etching of a bovine serum albumin film after oxygen plasma treatment. Opretzka et al. (2007) attributed surface modifications to the synergistic effect of simulated beams of argon ions and hydrogen atoms in chemical sputtering processes. However, argon ions alone only accounted for minor modifications in the spore outer structures as physical sputtering processes only become significant at ion energies above 150 – 200 eV, which are not observed in DICP discharges (unpublished data). A major factor in surface modifications of LPP-treated spores is likely the high intensity of emitted UV radiation in a DICP discharge and associated photodesorption and photoionization processes. Significant morphological changes were rapidly observed already after very short treatment times of 15 s, where etching and sputtering processes are unlikely to have such a tremendous effect as these processes usually become relevant at later stages in plasma treatment, although an additive effect cannot be excluded (Fozza et al., 1998; Opretzka et al., 2007; Halfmann et al., 2007 a, 2007b; Raguse et al., 2016b (Chapter E) Table 2). Being the outermost layer consisting of more than 70 different protein, the spore coat is the initial target of incoming (V)UV radiation and reactive species produced by the plasma. Macromolecules such as proteins with carbohydrate-structures are susceptible to photochemical modification by sensitized photo-oxidation of endogenous chromophores, e.g. alterations of amino acids side-chain residues and bound prosthetic groups (Silva, 1996; Davies et al., 2001; Benasson et al, 1983). Significantly higher surface damage was induced by argon plasma compared to pure oxygen plasma at similar inactivation rates, indicating that

177 the high emission of energetic argon resonance radiation in the VUV spectrum likely has a prominent effect on the outer spore layers. The ionization potential of polypeptides is ~7.3 eV (Iwanami and Oda, 1983), suggesting that especially photons in the VUV range below λ = 200 nm (6 eV) evoke dissociative reactions. Indeed, Wertheimer et al. (1999) reported that synthetic polymers with simple CH2 backbones exhibit absorption maxima at λ = 80 – 120 nm, when dissociative excitation of C-C and C-H bond electrons leads to bond breakage and formation of radicals. Further absorption maxima of aromatic rings and multiple bonds where observed at λ = 170 – 190 nm. The photo-oxidation of chromophores or amino acid side chains by VUV and UV radiation can severely affect the physio-chemical properties of polypeptides (Correira et al. 2012), which can lead to breakage of disulphide bonds or the introduction of conformational changes. As the spore coat is mainly composed of tyrosine- and cysteine-rich proteins (Driks, 1999) insights into the modification of these specific amino acids by LPP discharges would be of great interest. For atmospheric pressure discharges Lackmann et al. (2013b) have demonstrated that tyrosine residues and sulfur-containing amino acids are modified by CAP-emitted photons as well as particles, however, the emission spectrum of the employed plasma jet differs considerably from the LPP discharges used in this study. In LPP, significant modifications in amino acids and protein structures were observed after LPP (H2/O2, VHF-CCP, 10 Pa, 400 W), including radiation-based modification (deamidation) of asparagine, oxidation of the two sulfur-containing amino acid residues methionine and cysteine, and the unfolding of α-helices and β-sheets in the fluorescent protein mCherry due to peptide backbone breakage resulting in structural loss (Stapelmann, 2013). Calculations of the penetration depth of VUV radiation into synthetic polymers with simple carbohydrate structures revealed a very small penetration depth of tens of nm by radiation in the VUV range, with increasing penetration of up to 1µm at wavelength above λ = 200 nm (Wertheimer et al., 1999). This suggests that the spore coat, as a proteinaceous structure of approximately 200 nm in width, largely absorbs photons in the VUV range and protects the spore inner structures from VUV-induced damage, whereas UV radiation above λ = 200 nm penetrates the outer spore layers and reaches the spore core components, i.e. nucleic acids, with minimal attenuation (Lerouge, 2000). Similar findings were reported by Hieda et al. (1984), who found that UV radiation at wavelength ranging from λ = 155 – 250 nm efficiently killed dried yeast cells, however by different mechanisms depending on the wavelength spectrum. UV radiation of λ = 220 and λ = 250 nm lead to yeast killing by gene conversion whereas shorter wavelength at λ = 155 and λ = 170 nm induced protein and

178 membrane damage rather than genetic damage, consistent with the absorbance maxima of proteins and the resulting attenuation (Inagaki et al., 1975; Munakata et al., 1999). Although, we cannot state that the plasma-induced damage of the coat structure has a direct detrimental effect on spore survivability, the compromised structure of the proteinaceous network may indirectly enhance permeability of reactive plasma components to deeper spore layer, e.g. cortex, IM harboring the GRs required for germination, and nucleic acids. However, possible plasma-mediated damage to these components has yet to be elucidated. The lack of protective coat layers which hamper the penetration of (V)UV radiation and provide detoxifying properties to reactive species produced by the plasma discharge itself (e.g. oxygen containing plasmas) or as a result of photoexcitation of spore coat proteins significantly reduces spore survival to LPP treated. Riesenmann and Nicholson (2000) have reported that B. subtilis spores lacking the major coat layers were significantly more sensitive to the common oxidant hydrogen peroxide, indicating the detoxifying property of the protein meshwork. Also, Cot-A dependent pigmentation may assist in neutralizing radical oxygen species (Commoner et al., 1954). The putative detoxifying role of the coat-associated Mn2+- dependent superoxide dismutase (SodA) and pseudocatalases remains to be investigated (Henriques and Moran, 2007). With current knowledge it is not possible to pinpoint specific target or functional proteins present in the spore coat as the detailed molecular and spatial arrangement of the coat proteins and their role in spore protection remain largely unclear. It is assumed that protection is provided by the coat protein network or the vast amount of coat proteins acting in concert to nonspecifically react with and detoxify reactive species before they can reach deeper layers and more delicate spore components (Setlow, 2006; Henriques and Moran, 2007; Nicholson, 1999). The outer and inner spore coat structures have been shown to play a major role in spore resistance against plasma sterilization indicating the protective role of the complex protein network against plasma-emitted species. The outermost and comparably thinner layer in B. subtilis, the crust, seemed to be of minor importance in conferring resistance.

5. DNA Protection and Repair

5.1 DNA Protection LPP discharges emit an array of active species capable of damaging the genetic material. Despite the multiple protective and attenuating layers encasing the spore core, under specific discharge conditions active plasma species have the potential to introduce various types of

179 lesions into the DNA in the spore core. B. subtilis spores are much more resistant to DNA damage than their vegetative counterpart, attributed to crucial spore-specific protection factors (Setlow, 2006). One major factor is the saturation of the spore’s genome with α/-type SASPs leading to a conformational change from B- to A-DNA helix (Nicholson et al., 2000; Setlow, β001). The absence of α/-type SASPs was found to significantly sensitize B. subtilis spores to plasma treatment (Neumann, 2013). This is in good agreement with results obtained previously demonstrating that α/-type SASPs play a major role in spore resistance to UV-C at 254 nm, heat, (Mason and Setlow, 1987; reviewed in Setlow, 2006; Moeller et al., 2009) and in preventing DNA damage due to reactive oxygen species (Moeller et al., 2014 (Chapter C)), all stressors found in LPP discharges. Additional protection is provided by reduced core water content and accumulation of Ca2+-DPA, which was shown to confer resistance to spores exposed to DNA damaging and reactive oxygen inducing agents (Moeller et al., 2014 (Chapter C).

5.2 Induction of DNA Photoproducts The change in the secondary structure of the DNA double helix, induced by bound SASPs, low hydration levels as well as accumulation of dipicolinic acid chelated with Ca2+ in the spore core alter the UV photochemistry of DNA in dormant spores by favoring the production of a spore-specific unique DNA photoproduct, the spore photoproduct (SP), which is easier to repair by the spore upon revival. Indeed, in LPP discharges with argon or argon with admixtures of oxygen as process gases providing high fluency of (V)UV radiation, B. subtilis spores lacking the spore photoproduct lyase, a repair enzyme unique to outgrowing spores and specifically designated to the repair of SP lesions, were significantly more sensitive to the treatment compared to wildtype spores. Furthermore, spores impaired in removal of bulky photoproducts by NER were more sensitive to plasma treatment (Raguse et al., 2016c (in preparation) (Chapter H)). The increased sensitivity of spores devoid of pathways for photoproduct repair suggests generated DNA damage by the UV-based introduction of photoproducts. Therefore, dried plasmid DNA (pBR322) spotted on glass slides, which switches to the more compact A-conformation, similar but not identical to dehydrated DNA in the spore core, a condition found to favour the generation of SP over other photoproducts (Douki and Cadet, 2003), was used to analyze the nature of photoproducts in dehydrated DNA after LPP treatment in vitro by HPLC MS/MS and compared to defined monochromatic UV-C radiation at 254 nm as a reference treatment (Raguse et al., 2016c (in preparation) (Chapter H)). All tested DICP plasma treatments lead to the introduction of photoproducts in dehydrated plasmid DNA. The spectrum of

180 bipyrimidine dimers was analyzed, revealing that the spore photoproducts was formed with the highest abundance in all plasma treatments, followed by T<>C 6-4 pyrimidone photoroducts and T<>T and T<>C cyclobutane pyrimidine dimers between adjacent pyrimidines. The total amount of photoproducts was highest in UV-C radiation at 254 nm as expected from previous studies reporting DNA spores deficient in spore photoproduct lyase were most sensitive to UV-C radiation (Moeller et al., 2007a). However, only small quantities of spore photoproduct formation were observed, which was likely attributed to the condition of in vitro analysis in absence of α/-type SASPs and Ca2+-DPA, both crucial factors in sensitizing spore DNA towards the generation of SP.

5.3 Induction of DNA Strand Breaks and Base Modification In oxygen plasma discharges, spores lacking the spore photoproduct lyase and NER as mechanisms for photoproduct repair are only slightly more sensitive than wildtype spores, suggesting that the introduction of photolesions in spore DNA plays only a minor role in spore inactivation by oxygen plasma. Indeed, the amount of photoproducts introduced in plasmid DNA in vitro by oxygen plasma was comparably lower than in other gas compositions, consistent with the low quantity of measured fluence densities of emitted (V)UV radiation (primarily molecular oxygen at 130 nm) (Raguse et al., 2016b (under revision) Table 2). However, spores impaired in the repair of DNA strand breaks by Ku and LigD-mediated NHEJ, and the RecA-mediated HR were significantly more sensitive, especially in oxygen plasma treatment, compared to wild-type spores. Oxygen-containing plasmas produce a variety of oxidative species and the treated substrate can reach elevated temperatures in a continuous wave discharge of >100 °C after ~100 s of treatment (Raguse et al., 2016b (under revision) Table 2), both factors well-known for the contribution to spore inactivation (Setlow, 2014b). With current techniques it is not possible to isolate these factors directly from the plasma discharge. Therefore, in order to analyze the impact on spore survival, the substrate heating occurring in an oxygen gas mixture was simulated as a single component of the plasma discharge by exposing B. subtilis spores to dry heat at 120 °C for 90 min (LD90 value when 90 % of the spore population is inactivated, i.e. spore survival is reduced by one order of magnitude). Dry heat predominantly induces DNA strand breaks in spore DNA (Setlow and Setlow, 1995, Setlow and Setlow, 1996) and B. subtilis spores have been reported to be significantly more resistant to dry heat than growing cells (Nicholson, 2000; Setlow, 2006). Efficient DNA repair during spore outgrowth is crucial for the survival. Time-course microscopy of key DNA repair enzymes fused with fluorescent proteins was used to study the fate of Ku and RecA by means of monitoring their accumulation during

181 spore revival after exposure to dry heat in the dormant state (Appendix Fig. S1). Time-course microscopy revealed that dry heat, as a single component, readily induced the activity of Ku as part of the template-independent NHEJ repair pathway, indicating the active repair of DNA double strand breaks in the presence of a single chromosome after exposure to dry heat in the dormant state. RecA-YFP foci formation was also observed after dry heat-inflicted damage, consistent with Setlow and Setlow (1996) who monitored the induction of RecA-lacZ fusion proteins in outgrowing spores after dry heat treatment. However, RecA-YFP activity occurred at a later stage during spore outgrowth, supporting the indication that RecA-mediated stabilization of stalled replication fork progression plays an important role in spore recovery (Setlow and Setlow, 1996; Vlasic et al., 2013). The production of ROS in plasma discharges was simulated by challenging B. subtilis spores with hydrogen peroxide in solution (LD90 = 10 min). Generated hydroxyl radicals are highly reactive and can cause significant damage to macromolecules and cellular components (Cadet and Wagner, 2013; Cadet et al., 2010). However, time-course microscopy revealed that the exposure to hydrogen peroxide did not result in the induction of Ku-GFP or RecA- YFP activity during spore outgrowth, suggesting that B. subtilis spores are not killed through the induction of DNA strand breaks. Indeed, spore DNA is very well protected against oxidative damage by the saturation with α/-type SASPs and spores deficient in major SASPs, but have been reported to be significantly more sensitive to hydrogen peroxide than wildtype spores and exhibited higher quantities of DNA strand breaks and increased mutation rates (Setlow and Setlow, 1993; Setlow, 2000). Further, it was found that major SASPs, but not -SASPs, protect DNA from damage by reactive oxygen species generated by ionizing radiation (Moeller et al., 2013 (Chapter C)). Also BER, dedicated to the removal of apurinic or apyrimidinic sites, plays a minor role in plasmas containing reactive oxygen species. Hence, in the presence of major SASPs, oxidizing agents presumably kill wildtype spores by interacting with other essential spore components but not DNA (Melly et al., 2002; Setlow and Setlow, 1993). Microarray analysis of B. subtilis spores exposed to hydrogen peroxide in the dormant state showed upregulation of a number of genes active in the oxidative stress response during outgrowth (M Raguse, unpublished data). Particularly ATP-dependent Clp proteases were found to be upregulated indicating the unspecific proteolysis of misfolded proteins (Krüger et al., 2000), however this requires further investigations. In all tested plasma discharges B. subtilis strains defective in DSB repair were more sensitive compared to wildtype spores, suggesting that plasma discharges introduce strand breaks that require repair upon spore revival. The treatment of dehydrated pBR322 plasmid

182 DNA and subsequent analysis by agarose gel electrophoresis revealed the induction of SSB and DSB in vitro after LPP treatment employing argon, oxygen, and argon with admixtures of oxygen with formation of multimeric structures with increasing plasma treatment time (Raguse et al., 2016c (in preparation) Chapter H). Low pressure treatments (here, 10 Pa) function as an extreme form of desiccation introducing nicks into the DNA double helix producing single strand breaks that relax the supercoiled plasmid (Schnaith et al., 1994; Vlasic et al., 2013). LPP discharges induce additional single and/or double strand breaks in vitro and uniformly fragments DNA molecules of different lengths. Strand breaks and subsequent fragmentation of DNA may be attributed to the high (V)UV fluence rates present in LPP discharges. Ito and Ito (1986) reported the photon absorption maxima of DNA at λ = β60 nm, ββ0 nm, and 180 nm as well as < λ =160 nm, whereas the absorption in far-UV radiation between λ = 180 – 280 nm prevails at the base and the absorption of VUV photons < 160 nm is mainly attributed to the ribose and phosphate backbone. The excitation of the sugar-phosphate group is thought to be the primary cause of DNA strand breaks (Ito et al., 1986). Synchrotron irradiation of a model substance of DNA (dApdA and other desoxyoligonucletides) with photon energies from 7.3 eV to 22.5 eV was reported to induce strand breaks and fragmentation by absorbance of excitation energy and dissipation through the molecular bonds (Dodonova, 1993). Therefore, fragmentation of plasmid DNA was primarily observed in discharges containing a high degree of (V)UV radiation (argon and argon with oxygen admixtures over pure oxygen discharges and UV-C at λ = β54 nm). Highly energetic VUV photons at λ = 104.8 (11.8 eV) and λ = 106.7 nm (11.6 eV), as emitted in argon plasmas, provide sufficient energy to ionize the DNA sugar backbone resulting in scission of N-glycosidic bonds and the formation of strand breaks in vitro (Ito and Ito, 1986). Moreover, reactive species and heat produced in oxygen plasma discharges may possibly interact with the base moiety and lead to oxidative damage, however to provide definite statement the amount of oxidative lesions produced in LPP discharges need to be quantified. Further, a significant reduction in the transformation efficiency of plasmid DNA into competent E. coli DH5α cells and subsequent selection for ampicillin resistance was observed after exposure to argon plasma with admixtures of oxygen, indicating that the treated plasmid is at least in part structurally or functionally impaired due to strand breaks, mutations in the β-lactamase gene (leading to sensitivity to ampicillin), or damaged origin of replication. Lackmann et al. (2013) observed an increased mutation rate in dehydrated plasmid DNA that was transformed into E. coli DH5α cells after treatment with an

183 atmospheric pressure plasma jet emitting only UV-photons, which is indicative of a mutagenic effect of plasma treatment at least in vitro.

5.4 DNA Double Strand Break Repair in Reviving Spores In the dormant state, B. subtilis spores are metabolically inactive and, thus, acquired lesions to macromolecules by environmental factors accumulate and cannot be repaired. Upon spore revival and resuming of metabolic activity, the active repair of lesions is initiated. The efficient repair of DNA damage is essential for spore survival as damaged DNA sites can result in blockage of genome replication, ultimately leading to cell death, or in incorporation of incorrect bases. Bacteria have evolved several pathways to deal with DNA lesions (see section A.3.4.5). DSB constitute the most lethal form of DNA damage because they disrupt the integrity of the DNA molecule (Lenhart et al., 2012). As seen in section I.5.3. LPP treatment causes substantial damage to DNA in vitro in form of SSB and DSB and B. subtilis spores defective in major DSB repair pathways, NHEJ and HR, are significantly more sensitive to the treatment. To study the induction of DSB repair in germinating and outgrowing B. subtilis spores, spores were irradiated with IR (X-rays, 200 keV, 15 mA) for the defined introduction of DSBs in spore DNA in the dormant state. Spores exhibit increased resistance properties towards ionizing radiation, which was found to be attributed to genome protection by α/-type SASPs, the presence of Ca2+-DPA, as well as DNA repair by AP endonucleases (BER), NHEJ, and HR (Moeller et al., 2014 (Chapter C); Moeller et al., 2007b; Vlasic et al., 2014). The induction of DSB repair in reviving bacterial spores is subject of ongoing research. HR is the leading repair pathway of DSB in the presence of a homologous genome copy, however, if recombination function is impaired or a homologous DNA template is not available, two-ended DSB are rejoined by NHEJ through the action of the DNA-binding protein Ku and subsequent recruitment of LigD (Rothkamm et al., 2003; Weller et al., 2002; Moeller et al., 2007b). Controversially, the dormant spores lacking key players of HR, RecA and its accessory factors RecO, RecR, and RecF, are significantly sensitized to DSB-inducingsparsely ionizing radiation, indicating a role of RecA-mediated DNA repair in spore resistance although no homologous template is available for DNA repair via strand exchange (Vlasic et al., 2014). However, recognition, processing and commitment to DNA double-strand break repair during the revival of B. subtilis haploid non-replicating spores are poorly understood. Time-course microscopy of fluorescent fusion proteins was used to study the activity of key enzymes of each DSB DNA repair pathway, Ku-GFP and Rec-YFP, by means of monitoring their accumulation in germinating, ripening and outgrowing B. subtilis spores after

184 exposure to IR (Fig. 11; Raguse et al., 2016c (in preparation) Chapter F). Untreated spores germinated normally and exhibited low activity of Ku during spore outgrowth, whereas RecA activity was found to increase with progressing outgrowth to exponential growth indicating its role in cell division. Treatment with IR readily induced RecA-YFP and Ku-GFP foci formation in the process of spore revival compared to non-irradiated controls and increased dose-dependently, indicating the accumulation of strand breaks in the dormant spore that require repair upon revival. Ku-GFP formation was predominantly observed in up to 90 % of spores in the early stage of outgrowth stressing the role of NHEJ as a major DNA repair pathway during initial stages of spore revival. NHEJ was therefore identified as the primary pathway for the repair of DSBs in the early stage of spore revival when DNA replication is absent and no chromosome template is available. RecA-YFP foci induction occurred at a later stage during spore outgrowth. Therefore, we propose that low levels of Ku and initiated DNA replication dictate the DSB repair pathway choice towards homologous recombination, supporting the indication that RecA-mediated stabilization of stalled replication fork progression plays an important role in spore recovery (Vlasic et al., 2014).

Figure 11. Representative images of DNA repair by Ku-GFP (NHEJ) and RecA-YFP (HR) induction during spore revival after exposure to DSB-inducing ionizing radiation. Ku-GFP is primarily active in the early stages of spore revival, indicating its importance in DSB repair in the absence of a homologous template. RecA-YFP shows increased activity at later stages in spore revival, supporting the theory that RecA stabilizes a stalled replication fork.

185 Figure 12. DSB repair pathway choices and their regulation in B. subtilis. The two major DSB repair pathways (NHEJ and HR) are depicted schematically. During exponential growth DNA damage recognition, basal and long-range resections process ssDNA ends that are preferentially utilized by HR, thereby indirectly inhibiting NHEJ. Competition between RecN and Ku might take place directly on DNA ends. Ku, perhaps in concert with PNPase, can process DSB breaks under conditions when HR is not operating due to the absence of a homologous template.

The first step in DSB repair is the damage recognition by RecN that assembles at the damage site, tethers damaged ssDNA ends in a single repair center (Kindane et al, 2004) and, in concert with the a γ’-ssDNA exonuclease/polymerase (PNPase), promotes basal end processing of broken DNA ends by removing γ’ overhangs, followed by 5’ long range end processing via AddAB or RecJ/Q/S complex. The initiation of end resection is a critical turning point in DSB repair pathway choice because processed γ’-DNA ends are a poor substrate for Ku binding, and cells will be committed to HR. Here, we report that basal processing by PNPase exonuclease/polymerase, rather than end recognition by RecN, contributes to spore survival by aiding in the pathway choice (Raguse et al., 2016c (in preparation)). We propose that i) an unknown factor might down-regulate long range end resection, as has been previously proposed for eukaryotic cells (Ira et al., 2004); ii) an unknown signal probably linked to DNA replication, rather than to DNA damage recognition or long-range end resection, might down-regulate Ku and up-regulates RecA expression; iii) translesion synthesis and alternative end joining seem to play a minor role in DNA DSB repair in germinating B. subtilis spores and iv) Ku contributes to DSB repair and RecA plays a

186 role in delaying DNA replication to cope with replication stress (Fig. 12; Raguse et al., 2016c (in preparation) Chapter F).

5.5 Multifunctional Role of LigD in DNA Repair LPP discharges contain a variety of species that have the potential to introduce lesions into spore DNA (Laroussi and Leipold, 2004). Highly reactive species, ROS, hydroxyl radicals, atomic oxygen etc., as well as dry heat carry the potential to introduce oxidative damage to the DNA, often affecting the base moiety and require repair upon outgrowth (Cadet and Wagner, 2013; Cadet et al., 2010; Salas Pacheco et al, 2005). Base excision repair is the most frequently used DNA repair system in vivo and accounts for the repair of non-bulky lesions resulting from oxidation, alkylation, depurination/depyrimidation, and deamination that do not compromise the secondary structure of the DNA molecule directly but can ultimately lead to stalling of DNA replication and transcription machineries, leading to frequent mutations (Friedberg et al., 2006). In B. subtilis cells, the BER pathway is initiated by removal of the damaged base, resulting in an AP site that is recognized and excised by AP endonucleases (Nfo, ExoA). This excision process leaves ends that require further processing by exonucleases at the γ’- end and by a dRPase at the 5’-dRP end giving rise to ligatable ends that can be closed by a DNA polymerase and finally sealed by a DNA ligase (Almeida and Sobol, β007). Recent studies have revealed an increasing numbers of proteins exhibiting 5’- dRP lyase activity that could potentially participate in the repair or AP sites indicating the importance of this particular pathway (Khodyreva and Lavrik, 2011). B. subtilis spores deficient in AP endonucleases (Nfo and/or ExoA) have been reported to be significantly more sensitive to densely and sparsely ionizing radiation, germicidal UV-C as well as environmentally relevant UV radiation (Moeller et al., 2011). In addition to its polymerization and ligase activities in DSB repair BsuLigD of the NHEJ DSB repair pathway, has been recently identified to possess a 5’-dRP lyase activity which has been located at the N-terminal ligase domain and could potentially play a role in the BER pathway (de Ory et al., 2016 (Chapter G)). In coordination with its polymerization and ligase activities, LigD allowed for the efficient repair of β’deoxyuridine-contaning DNA in vitro by removing the 5’-dRP group giving rise to a ligatable γ’-OH and 5’-P ends in a reconstituted BER reaction pathway. In order to investigate the role and impact of LigD in the BER pathway after plasma treatment, B. subtilis spores lacking BsuLigD, the BsuLigD ligase activity only (impaired LIG-domain), the spore specific endonuclease IV Nfo, and Ku were subjected to vacuum at

187 10 Pa only and low pressure argon and oxygen plasma (Raguse et al., 2016d (in preparation) (Chapter H)). Generally, all tested spore mutant strains exhibited a moderate sensitivity towards vacuum at 10 Pa and were significantly more sensitive to plasma treatment than wildtype spores and sole vacuum treatment, indicating a involvement of both enzymes, LigD and Nfo, in survival of vacuum conditions, as reported in de Ory et al., 2016 (Chapter G), and LPP treatment. Spores deficient in IV endonuclease Nfo showed moderately increased sensitivity to LPP discharges compared to wildtype spores, suggesting the induction of base damage, possibly by photolysis via the high-intensity of emitted (V)UV radiation in combination with reactive oxygen species produced either by the plasma directly or indirectly within the spore by VUV- radiolysis of water (Cadet et al., 2010; Cadet et al., 2005; Daniels and Grimison, 1967). A higher rate of non-specific DNA damage, including strand breaks and AP site induction, in spores has also been attributed to irradiation with environmentally relevant UV-(A+B) radiation in the dry state due to the increased likelihood of ROS production (Moeller et al., 2011; Slieman and Nicholson, 2000). Singlet oxygen has been shown to selectively react with guanine nucleobases leading to base oxidation and formation of 8-oxoguanine nucleobases, which is known as the major biomarker of oxidative stress in a cell (Cadet and Wagner, 2013). Spores deficient in BsuLigD as well as spores lacking the BsuLigD ligase activity showed increased but comparable sensitivity to LPP discharges, indicating the vital role of LigD activity in spore survival, which can be attributing it to the ligase domain (Appendix Fig. S2). The additive effect of inactivation of double mutants lacking both LigD and Ku of the NHEJ pathway further indicates the generation of DSB during plasma treatment in addition to base damage and generated AP sites, perhaps closely located in clusters. These and previous results i) lead to the assumption that LPP discharges generate AP sites in spore DNA, ii) indicate that BsuLigD plays a vital role in spore resistance to LPP discharges, iii) could show that the active site for AP lyase activity is located in the N- terminal ligase domain of BsuLigD, and iii) support the hypothesis that BsuLigD (together with a spore specific AP endonuclease) could constitute a new branch of the BER pathway to repair AP sites during spore revival after plasma treatment.

188 J. Conclusion

Low pressure plasma discharges in DICP and VHF-CCP reactor setups have been demonstrated as a fast and efficient method for enhanced inactivation of Bacillus sp. spores even under challenging circumstances. For a reliable assessment of the inactivation efficiency of LPP discharges and fundamental insights into the underlying mechanism of inactivation, the performance must be assessed employing quality-controlled spore samples of highly reproducible spore monolayers, particularly with regard to future industrial implementation. The current model of plasma inactivation of B. subtilis spores and the proposed role of spore specific components providing protection against active plasma species, based on this work, is illustrated in Fig. 13. Several factors were found to contribute to spore resistance against LPP. The multilayered proteinaceous spore coat constitutes the first barrier to incoming active plasma species and was found to play a significant role in spore resistance against plasma treatment likely by attenuating the traversing radical species and (V)UV photons before they reach more delicate spore structures underneath the coat. Particularly the inner and outer spore coat layers were found to confer resistance, whereas the outermost layer, the crust, did not significantly influence spore survival. Spore specific protection factors, including a low core water content, Ca2+-DPA, and α/-types SASPs, were found to confer resistance to LPP or simulated plasma components. A variety of universal and spore-specific photoproducts (SP), as well as SSBs and DSBs were found to be introduced into plasmid DNA by plasma- emitted species in vitro. Despite the sophisticated genomic protection a multitude of damages are introduced into spore DNA that require extensive repair upon spore revival. Essential DNA repair pathways include SP repair by spore photoproduct lyase, DSB repair by HR and NHEJ, as well as NER and BER systems. The results indicate a complex interaction between LPP components with various spore constituents that lead to inactivation by damaging various spore structures in synergy, however, elucidating the exact mechanisms of interaction calls for future investigations.

189

Figure 13. Current model of low pressure plasma inactivation of B. subtilis spores and the proposed role of spore specific components providing protection against active plasma species † in vivo; * in vitro. The spore coat acts as a protective barrier towards incoming plasma species by non-specifically detoxifying reactive particles and attenuating the passage of (V)UV photons. Predominantly the inner and outer spore coat layers, but not the outermost crust layer, play a role in spore resistance towards LPP. CotA-mediated pigmentation in the outer coat layer provides protection against UV photons in the UV-A and UV-B wavelength spectrum. The spore is significantly eroded by plasma-emitted species inducing chemical degradation and volatilizing proteinaceous components on spore surfaces. Inside the spore core the DNA is protected by a low core water content, saturation with α/-type SASPs, and accumulation of Ca2+-DPA. Multiple DNA repair pathways are involved in spore recovery indicating a multitude of different lesions introduced into spore DNA by LPP. Oxidative damage (AP sites), DNA strand breaks (SSBs, DSBs) as well as universal and spore-specific photoproducts (SP formation) are introduced into spore DNA by plasma-emitted active species and/or elevated temperatures. Damage is indicated by yellow bursts. Dashed arrows represent attenuated stress retained by spore structural features.

190 K. Summary

Plasma sterilization is seen as promising alternative to conventional sterilization methods as it offers low temperature operations that are suitable for a wide variety of heat-labile plastic and materials prone to corrosion. Plasma, often considered the 4th state of matter, is an ionized gas comprising several active components, i.e. free electrons, ions, neutral / excited atoms or molecules (e.g. ROS), heat, alongside VUV and UV photons, that possess sporicidal characteristics. LPP offers a homogeneous discharge as it is operated under vacuum conditions and potentially extremely short processing times. The underlying mechanism that leads to biological inactivation by LPP has not been sufficiently clarified for broad industrial implementation. Due to their extreme resistance against heat, chemicals, desiccation and radiation, spores of the genus Bacillus are often used as BI for the reliable assessment of sterilization efficiency. In this work the applicability of LPP as a fast and efficient method for enhanced spore inactivation was demonstrated (Chapter B). Spores of the highly resistant spacecraft assembly facility (SAF) isolate B. pumilus SAFR-032 were successfully inactivated by LPP hydrogen or oxygen discharges with and without the addition of vaporized hydrogen peroxide in a VHF-CCP setup, demonstrating the potential application of LPP for enhanced spore inactivation also on complex structures challenging the sterilization process with limited accessibility of critical areas in a material. A highly reproducible and quality-controlled BI for the evaluation of plasma sterilization efficiency is essential. Therefore an electrically operated device for the reproducible spray deposition of B. subtilis spores was developed that ensures a reproducible and homogeneous sample preparation process of highly concentrated spore monolayers and provides a more reliable and realistic assessment of the plasma-mediated inactivation efficiency (Chapter D). Fundamental aspects contributing to spore resistance to plasma sterilization were elucidated in this work. Plasma discharges evoke significant surface alterations of the spore surface, compromising the structure of the outer spore layers. The multilayered proteinaceous spore coat constitutes the first barrier to environmental influences and was found to play a significant role in spore resistance against plasma treatment. Particularly the inner and outer spore coat layers were found to confer resistance, whereas the outermost layer, the crust, did not significantly influence spore survival (Chapter E). The spore is very well protected against oxidative and radiation-induced damage. This work shows that spores protect their genome from damage by low core water content, Ca2+- DPA, and α/-types SASPs, which bind to and alter the structure of spore DNA sensitizing the spore to UV-radiation (Chapter C, Neumann, 2014.). All tested LPP treatments lead to

191 the introduction of photoproducts in dehydrated plasmid DNA in vitro. The spore specific lesion, SP, was formed with the highest abundance and the SP-specific repair enzyme, spore photoproduct lyase, played a major role in survival of B. subtilis spores after plasma treatment with high (V)UV fluencies, suggesting SP formation also in vivo. Spore survival further depended to some extent on NER and BER repair pathways, accountable for the removal of bulky adducts (photoproducts, cross-links) and non-bulky adducts (depurination / depyrimidation or deamination caused by plasma-induced oxidative and/or heat stress), respectively. Spores impaired in the major DSB repair systems, HR and NHEJ, were significantly more sensitive to plasma treatment, suggesting the induction of strand breaks in spore DNA that require repair upon revival. Indeed, it was found that DSBs and SSBs are induced in plasmid DNA by argon and oxygen plasma discharges in vitro (Chapter H). Simulated ROS stress was not found to induce DSB repair in reviving spores, whereas heat as a single component evoked DSB repair by NHEJ and HR. The induction of DNA DSB repair pathways in germinating and outgrowing B. subtilis spores was studied in more detail after treatment with a defined DSB-inducing agent, with regard to recognition and processing of DSB and subsequent commitment to NHEJ or HR. This work demonstrated that end processing of the damaged γ’-ssDNA ends by the exonuclease PNPase is a crucial turning point in pathway choice and aids in the commitment of DNA DSB repair to either NHEJ (non-processed ends) or HR (processed ends). Therefore, it is proposed that unknown factors possibly down-regulate long range end resection, committing the outgrowing spore to DSB repair by NHEJ in the presence of one chromosome copy. Another unknown signal that is likely associated with the process of DNA replication, rather than to DNA damage recognition or long-range end resection, might down-regulate Ku (NHEJ) and up-regulate RecA (HR) expression later in outgrowth as Ku likely contributes to DSB repair during the early stages of spore revival and RecA plays a role in delaying DNA replication to cope with replication stress (Chapter F). Further, this work indicates that a key enzyme previously thought to function primarily in the NHEJ repair pathway in B. subtilis, the ligase BsuLigD, does not only possess a polymerization and ligase function but also exhibits a 5’-dRP lyase activity which has been located at the N-terminal ligase domain and could potentially play a role in the BER pathway after plasma-induced oxidative lesions (Chapter G). These results indicate that the inactivation of B. subtilis spores by LPP is most likely an interaction of various components based on the synergy of various plasma-induced lesions in

192 spore DNA, the destruction of protective structures (spore coat), and possibly damage to more delicate spore components (cortex, inner membrane, germination receptors).

193 L. Zusammenfassung

Plasmasterilisation wird als vielversprechende Alternative zu konventionellen Sterilisationsmethoden gehandelt. Da der Prozess eine Anwendung bei Niedrigtemperaturen erlaubt ist er somit äußerst geeignet ist für die Behandlung von hitzeempfindlichen Plastiken und korrosionsanfälligen Materialen. Plasma als vierter und energiereichster Aggregatzustand ist ein ionisiertes Gas, das aus mehreren reaktiven Komponenten besteht. Neben freien Elektronen, Ionen, neutralen sowie angeregten Atomen und Molekülen (z.B. Reaktive Sauerstoff Spezies), werden hochenergetische VUV und UV Strahlen bei der Plasmaentladung freigesetzt, die eine biozide Wirkung entfalten. Niederdruckplasmen werden unter Vakuumkonditionen erzeugt und ermöglichen eine homogene Entladung mit extrem kurzen Behandlungszeiten. Der grundlegende Mechanismus der zu Inaktivierung eines biologischen Systems durch Niederdruckplasma führt, ist nicht ausreichende geklärt um den Prozess in die breitgefächerte industrielle Anwendung zu bringen. Durch ihre hohe Widerstandfähigkeit gegenüber Hitze, Chemikalien, Trocknung, und verschiedenen Arten von Strahlung, werden Bakteriensporen der Gattung Bacillus oft als Bioindikator eingesetzt um die Sterilisationseffizienz zu ermitteln. In dieser Arbeit wurde zuerst die Anwendbarkeit von Niederdruckplasma als schnelle und effiziente Methode zur verbesserten Inaktivierung von Sporen dargestellt (Kapitel B). Sporen des besonders resistenten Stammes B. pumilus SAFR-032, isoliert aus einem Montagewerk für Raumfahrzeuge (Spacecraft Assembly Facility), wurden durch Sauerstoff- und Wasserstoffplasma im Niederdruck, mit und ohne zusätzliche Anwendung von Wasserstoffperoxid, erfolgreich abgetötet. Die Behandlung wurde in einem VHF-CCP Reaktor durchgeführt und demonstriert die erfolgreiche Anwendung von Niederdruckplasma auch bei komplexen Strukturen, die durch kleine Hohlräume mit verminderter Zugänglichkeit generell eine besondere Herausforderung für Sterilisationsprozesse darstellen. Für die Evaluation der plasma-basierten Sterilisationseffizienz sind qualitätsgeprüfte und im hohen Maße reproduzierbare biologische Indikatoren essentiell. In dieser Arbeit wurde eine elektrisch betriebe Sprüheinheit entwickelt, die die reproduzierbare Herstellung von einheitlichen experimentellen Proben, in Form von hochkonzentrierten monolagigen Sporen, ermöglicht und somit eine verlässlichere und realistischere Beurteilung der plasmabasierten Inaktivierung gestattet (Kapitel D). Weiterhin wurden in dieser Arbeit grundlegende Aspekte, die zur Sporenresistenz gegenüber der Sterilisation mit Niederdruckplasma beitragen, untersucht. Plasmaentladungen induzierten signifikante Oberflächenmodifikationen und beeinträchtigten die Struktur der

194 äußeren Sporenlagen. Der multilagige Sporenmantel stellt die erste Barriere gegenüber einfallenden Umwelteinflüssen darf und spielte eine signifikante Rolle in der Sporenresistenz von B. subtilis gegenüber Niederdruckplasma. Besonders der innere und äußere Sporenmantel schützten die Spore vor aktiven Plasmakomponenten, wobei die äußerste Schicht, die Kruste, eine untergeordnete Rolle spielte (Kapitel E). Die Spore ist hervorragend gegen oxidative und strahlungsinduzierte Schäden geschützt. In der Arbeit wird deutlich, dass der Schutz vor DNA Schädigung in B. subtilis Sporen auf dem sehr geringen Wassergehalt im Sporenkern, der Einlagerung von Mineralien und DPA, sowie den DNA-gebundenen und strukturverändernden α/-type SASPs beruht (Kapitel C, Neumann, 2014). Die UV-basierende Entstehung sporenspezifischer DNA Photoprodukte wird somit begünstigt. Alle getesteten Niederdruckplasmen induzierten Photoprodukte in dehydrierter Plasmid-DNA in vitro, wobei das Sporenphotoprodukt, SP, am häufigsten gebildet wurde. Tatsächlich spielte das SP-spezifische Reparaturenzym, SP-Lyase, eine zentrale Rolle im Überleben von B. subtilis Sporen nach Plasmabehandlungen, die besonders hohe (V)UV Fluenzen aufweisen. Dies deutet darauf hin, dass die Entstehung von SP auch in vivo stattfindet und im Zuge der Keimung repariert werden muss. Als weitere relevante DNA Reparaturmechanismen wurden NER zur Entfernung von strukturverändernden Läsionen, wie Photoprodukten und DNA Vernetzungen, sowie BER, zur Entfernung von geschädigten Basen (Depurinierung und Depyrimidierung durch plasmainduzierten oxidativen Stress und/oder Hitzeeinwirkung) identifiziert. Es wurde gezeigt, dass eine Behandlung mit Argon- oder Sauerstoffplasma SSB und DSB in Plasmid DNA in vitro induziert und weiterführend, dass Sporen mit Defekten in den wesentlichen Mechanismen zur Reparatur von Doppelstrangbrüchen, HR und NHEJ, signifikant sensitiver gegenüber Plasmabehandlung waren, was darauf schließen lässt, dass DNA Strangbrüche ebenfalls in vivo generiert werden (Kapitel H). Simulierte im Plasma einwirkende Hitze, aber nicht simulierter oxidativer Stress, führten zur Induktion von DSB Reparatur durch NHEJ und HR in keimenden Sporen. Die Induktion von DNA DSB Reparatur in keimenden B. subtilis Sporen wurde genauer untersucht im Hinblick auf Erkennung und Verarbeitung des DSB, sowie die Entscheidung zur Wahl des Reparaturweges. Es wurde dargestellt, dass die Verarbeitung der geschädigten γ’-ssDNA Enden durch die Exonuklease PNPase einen wesentlichen Wendepunkt in der Wahl des DSB Reparaturweges durch NHEJ (keine Endverarbeitung) oder HR (Endverarbeitung) darstellt. Daher wird angenommen, dass unbekannte Faktoren die DNA Endresektion runterregulieren und somit die keimende Spore zur DNA DSB Reparatur mittels

195 NHEJ verpflichten, wenn nur eine Kopie des Genoms vorliegt. Ein weiteres - wahrscheinlich mit der DNA Replikation assoziiertes - Signal wird angenommen Ku (NHEJ) runter- und RecA (HR) hochzuregulieren, da Ku-vermittelte DNA Reparatur vornehmlich in der frühen Auswuchsphase aktiv zu sein scheint, während RecA die DNA Replikation verzögert und eine stabilisierende Funktion einnimmt, um Replikationsstress zu bewältigen (Kapitel F). Weiterhin wurde festgestellt, dass die Ligase des NHEJ Reparaturweges in B. subtilis (BsuLigD) nicht nur eine Polymerisations- und Ligasefunktion aufweist, sondern zusätzlich eine 5’-dRP Lyase Funktion besitzt, die an der N-terminalen Ligase-Domäne lokalisiert wurde und eine potentielle Rolle in der Verarbeitung von plasmainduzierten oxidativen Schäden mittels BER spielen könnte (Kapitel G). Die generierten Resultate weisen darauf hin, dass die Inaktivierung von B. subtilis Sporen auf komplexen Interaktionen zwischen der vielschichtigen Spore und den verschiedenartigen Plasmaspezies basiert, die eine Vielzahl von Schäden hervorrufen können, wie plasmainduzierte DNA Schäden, die Zerstörung von schützenden äußeren Sporenlagen (Sporenmantel), sowie eine mögliche Schädigung von empfindlichen sporenspezifischen Strukturen (Cortex, innere Membran, Keimungsrezeptoren).

196 M. Outlook

In this work fundamental aspects of B. subtilis spore resistance towards low pressure plasma discharges have been evaluated. However, many questions remain open and require further studies to fully understand the interaction of low pressure plasma components with spore structures and how the various spore components aid in spore resistance towards plasma-mediated macromolecular damage. As (V)UV radiation is highly relevant in spore inactivation, the identification of DNA lesions, particularly photoproducts, in vivo is of major interest. Studies on plasmid DNA have provided valuable insight into the nature of plasma-induced lesions, however, as spore DNA is protected by SASPs, a low core water content, mineralization, and DPA accumulation, which significantly alter DNA photochemistry, the induction pattern in vivo is of considerable interest. Also, plasma-induced oxidative DNA lesions should be investigated in order to quantify the nature of damage and enhance the understanding of the significance of oxidative stress induced by plasma discharges. The spore coat is substantially damaged by emitted plasma species. While it was demonstrated that the spore coat plays a significant role in spore protection against plasma, it is unclear to what extent the surface modification directly influence spore survival. As numerous proteins of different compositions and structures constitute the coat and cortex layer, the exact function and interaction of the single spore components with plasma particles regarding protection against plasma-mediated damage remain to be elucidated. Advanced techniques like live cell imaging analysis would allow the time-resolved assessment of the germination and outgrowth characteristics of plasma-treated spores, providing answers to questions i) regarding the functionality of the germination apparatus in the presence of various germinants triggering specific germination initiation events, ii) whether treated spores are still able to germinate and grow out in combination with lysozyme- assisted cortex hydrolysis (sporistatic vs. sporicidal plasma treatment), and iii) track the activity of fluorescently-labelled DNA repair proteins (e.g. RecA, Ku, SP lyase) during spore revival after plasma treatment to study the induced effect on a single-spore-level. As several different gas mixtures were employed in this study emitting different wavelength spectra it was possible to make assumptions regarding the inactivation influence of UV radiation, however, to verify the results cut-off and band pass filters should be used to separate the sporicidal UV/VUV portion of the plasma discharge and enhance the understanding of role of photons alone and in combination with other reactive species in whole LPP discharges on spores and spore components.

197 A major topic that should be addressed is the characterization of gene regulation on a transcriptomic level in reviving plasma-treated spores at various outgrowth time points when cellular adaptation response is activated. The development of the electrical deposition device in this work enables the homogeneous plasma treatment of high numbers of monolayered spores which allows for the feasibility of experimental setups requiring great spore quantities such as RNA sequencing studies. Data on the transcriptional response of spores treated with isolated/simulated plasma components and full LPP discharges, in combination with obtained fluence rates and densities of single plasma components, would enable us to correlate spore inactivation with LPP components and allow for a systematic evaluation of major repair pathways involved and the combined interaction of (V)UV, ROS and heat stress. In attempts to further adapt LPP sterilization to industrial applications for the treatment of heat sensitive materials, the gas temperature and thus the heat transfer to the material can be reduced by applying pulsed plasma. Therefore the duty cycle (i.e. time of applied power) is adjusted, reducing the heat flux but maintaining high photon and particle densities for sufficient sterilization efficiency. Plasma sterilization offers unique features for the innovative sterilization and decontamination procedures, yet, the complex interaction of plasma components with spore structures raise many questions that require comprehensive future investigations.

198 N. References

Abreu AC, Tavares RR, Borges A, Mergulhão F, Simões M. 2013. Current and emergent strategies for disinfection of hospital environments. J Antimicrob Chemother 68:2718 –2732.

Adler S, Scherrer M, Daschner FD. 1998. Costs of low-temperature plasma sterilization compared with other sterilization methods. J Hosp Infect 49:125-134.

Alekhova TA, Zakharchuk LM, Tatarinova NY, Kadnikov VV, Maradano AV, Ravin NV, Skryabin KG. 2015. Diversity of bacteria of the genus Bacillus on board the International Space Station. Dokl Biochem Biophys 465:347-350. Almeida KH and Sobol RW. 2007. A unified view of base excision repair: lesion-dependent protein complexes regulated by post-translational modification. DNA Repair (Amst.) 6:695– 711.

Atrih A, Zollner P, Allmaier G, Foster SJ. 1996. Structural analysis of Bacillus subtilis 168 endospore peptidoglycan and its role during differentiation. J Bacteriol 178:6173–6183. Atrih A, Zollner P, Allmaier G, Williamson MP, Foster SJ. 1998. Peptidoglycan structural dynamics during germination of Bacillus subtilis 168 endospores. J Bacteriol 180:4603–4612. Ayora S, Carrasco B, Cardenas PP, Cesar CE, Canas C, Yadav T, Marchisone C, Alonso JC. 2011. Double-strand break repair in bacteria: a view from Bacillus subtilis. FEMS Microbiol Rev 35:1055-1081.

Bagyan I, Casillas-Martinez L, Setlow P. 1998. The katX gene, which codes for the catalase in spores of Bacillus subtilis, is a forespore-specific gene controlled by ςF, and KatX is essential for hydrogen peroxide resistance of the germinating spore. J Bacteriol 180:2057- 2062.

Barajas-Ornelas Rdel C, Ramírez-Guadiana FH, Juárez-Godínez R, Ayala-García VM, Robleto EA, Yasbin RE, Pedraza-Reyes M. 2014. Error-prone processing of apurinic/apyrimidinic (AP) sites by PolX underlies a novel mechanism that promotes adaptive mutagenesis in Bacillus subtilis. J Bacteriol 196:3012-3022

Baxter RL, Baxter HC, Campbell GA, Grant K, Jones A, Richardson P, Whittaker G. 2006. Quantitative analysis of residual protein contamination on reprocessed surgical instruments. J hosp infect 63:1329.

Beall B, Driks A, Losick R, Moran CP Jr. 1993. Cloning and chacaterization of a gene required for assembly of Bacillus subtilis spore coat. J Bacteriol 175:1705-1716. Beaman TC and Gerhardt P. 1986. Heat resistance of bacterial spores correlated with protoplast dehydration, mineralization, and thermal adaptation. Appl Environ Microbol 52:1242-1246. Bejerano-Sagie M, Oppenheimer-Shaanan Y, Berlatzky I, Rouvinski A, Meyerovich M, Ben-Yehuda S. 2006. A checkpoint protein that scans the chromosome for damage at the start of sporulation in Bacillus subtilis. 125:679-90.

199 Bekeschus S, Schmidt A, Weltmann KD, von Woedtke T. 2016. The plasma jet kINPen – A powerful tool for wound healing. Clin Plasma Med doi:10.1016/j.cpme.2016.01.001.

Benasson RV, Land EJ, Truscott TG. 1983. Pulse radiolysis and flash photolysis: Contribution to the chemistry of biology and medicine Pergamon press, Oxdord.

Benedikt J, Flötgen C, Kussel G, Raballand V, von Keudell A. 2008. Etching of Bacillus atrophaeus by oxygen atoms, molecules and argon ions. J Phys: Conf Ser 133: doi:10.1088/1742-6596/133/1/012012.

Blatchley ER, Meeusen A, Aronson AI, Brewster L. 2005. Inactivation of Bacillus spores by ultraviolet or gamma radiation. J Environ Eng 131:1245–1252. Bruckner JC, Osman S, Conley C, Venkateswaran K. 2009. Space microbiology: planetary protection, burden, diversity and significance of spacecraft associated microbes. In Encyclopedia of Microbiology, edited by M. Schaechter, Elsevier, Oxford, 52–65.

Burbulys D, Trach KA, Hoch JA. 1991. Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64:545-552. Cadet J and Wagner JR. 2013. DNA base damage by reactive oxygen species, oxidizing agents, and UV radiation. Cold Spring Harb Perspect Biol 5:a012559.

Cadet J, Douki T, Ravanat JL. 2010. Oxidatively generated base damage to cellular DNA. Free Radic Biol Med 49:9–21.

Cadet J, Sage E, Douki T. 2005. Ultraviolet radiation-mediated damage to cellular DNA. Mutat Res 571:3–17.

Campos SS, Ibarra-Rodriguez JR, Barajas-Ornelas RC, Ramírez-Guadiana FH, Obregón-Herrera A, Setlow P, Pedraza-Reyes M. 2014. Interaction of apurinic/apyrimidinic endonucleases Nfo and ExoA with the DNA integrity scanning protein DisA in the processing of DNA damage during Bacillus subtilis spore outgrowth. J Bacteriol 196:568-578.

Cano RJ, Borucki MK. 1995. Revival and identification of bacterial spores in 25- to 40- million-year-old Dominican amber. Science 268:1060-1064. Carstensen EL, Marquis RE, Bender GR, et al. 1979. Dielectric properties of native and decoated spores of Bacillus megaterium. J Bacteriol 140: 917–928. Casillas-Martinez L and Setlow P. 1997. Alkyl hydroperoxide reductase, catalase, MrgA, and superoxide dismutase are not involved in resistance of Bacillus subtilis spores to heat or oxidizing agents. J Bacteriol 179:7420–7425 Claus D and Berkeley RCW. 1986. Genus Bacillus Cohn 1872 in Bergey's manual of systematic bacteriology Vol.2, P. A. Sneath, Ed., Williams and Wilkins, Baltimore, MD, 1105-1141. Commoner B, Townsens J, Pake GE. 1954. Free radicals in biological materials. Nature 174:689-691.

200 Coohill TP and Sagripanti JL. 2008. Overview of the inactivation by 254 nm ultraviolet radiation of bacteria with particular relevance to biodefense. Photochem Photobiol 84:1084- 1090. Coohill TP and Sagripanti JL. 2009. Bacterial inactivation by solar ultraviolet radiation compared with sensitivity to 255 nm radiation. Photochem Photobiol 85:1043-1052. Coohill TP. 1986. Virus-cell interactions as probes for vacuum ultraviolet radiation damage and repair. Photochem Photobiol 44:359–363.

Correia M, Neves-Petersen T, Parracino A, di Gennaro AK, Petersen S B. 2012. Photophysics, photochemistry and energetics of UV light induced disulphide bridge disruption in apo-alpha-lactalbumin. J Flouresc 22:323-37.

Cortezzo DE, Setlow P. 2005. Analysis of factors that influence the sensitivity of spores of Bacillus subtilis to DNA damaging chemicals. J Appl Microbiol 98:606–617. COSPAR. 2011. COSPAR Planetary Protection Policy (20 October 2002, as amended to 24 March 2011), COSPAR, Paris. https://cosparhq.cnes.fr/sites/default/files/pppolicy.pdf.

Cowan AE, Koppel DE, Setlow P, et al. 2003. A soluble protein is immobile in dormant spores of Bacillus subtilis but is mobile in germinated spores: implications for spore dormancy. Proc Natl Acad Sci USA 100:4209–4214. Cowan AE, Olivastro EM, Koppel DE, Loshon CA, Setlow B, Setlow P. 2004. Lipids in the inner membrane of dormant spores of Bacillus species are immobile. Proc Natl Acad Sci USA 101:7733–7738. Cox MM. 2007. Regulation of bacterial RecA protein function. Crit Rev Biochem Mol Biol 42:41-63. Crafts-Lighty A and Ellar DJ. 1980. Structure and function of the spore outer membrane in dormant and germinating spores of Bacillus megaterium. J Appl Bacteriol 48:135–145. Daniels M and Grimison A. 1967. Photolysis of the aqueous thymine system. 1. Excitation at 1849 Å. Biochim Biophys Acta 142:292-303.

Davies MJ and Truscott RJW. 2001. Photo-oxidation of proteins and its role in cataractogenesis. J Photochem Photobiol 63:114-25.

De Geyter N and Morent R. 2012. Nonthermal plasma sterilization of living and nonliving surfaces. Annu Rev Biomed Eng 14:255-74.

Della M, Palmbos PL, Tseng HM, Tonkin LM, Daley JM, Topper LM, Pitcher RS, Tomkinson AE, Wilson TE, Doherty AJ. 2004. Mycobacterial Ku and ligase proteins constitute a two-component NHEJ repair machine. Science 306:683-685.

Demidov VV, Goncharov AA, Osipov VB, Trofimov VI. 1995. Modern aspects of planetary protection and requirements to sterilization of space hardware. Adv Space Res 15:251–255.

201 Dodonova NY. 1993. Vacuum UV – photophysics and photochemistry of biomolecules. J Photochem Photobiol B: Biol 18:111-121.

Donnellan JE Jr and Stafford RS. 1968. Photochemical evidence for conformation changes in DNA during germination of bacterial spores. Proc Natl Acad Sci USA 59:822– 829.

Donnellan JE Jr, Setlow RB. 1965. Thymine photoproducts but not thymine dimers found in ultraviolet-irradiated bacterial spores. Science 149:308-310. Douki T, Setlow B, Setlow P. β005a. Effects of the binding of α/-type small acid-solube spore proteins on the photochemistry of DNA in spores of Bacillus subtilis in vitro. Photochem Photobiol 81:163-169. Douki T, Setlow B, Setlow P. 2005b. Photosensitization of DNA by dipicolinic acid, a major component of spores of Bacillus species. Photochem Photobiol Sci 4:591-597. Douki T, Setlow B, Setlow P. 2005b. Photosensitization of DNA by dipicolinic acid, a major component of spores of Bacillus species. Photochem Photobiol Sci 4:591-597. Driks A, Roels S, Beall B, Moran CP Jr, Losick R. 1994. Subcellular localization of proteins involved in the assembly of the spore coat of Bacillus subtilis. Genes Dev 8:234–44. Driks A. 1999. Bacillus subtilis spore coat. Microbiol Mol Biol Rev 63:1-20. Ehlbeck J, Schnabel U, Polak M, Winter J, von Woedtke Th, Brandeburg R, von dem Hagen T, Weltmann KD. 2011. Low temperature atmospheric pressure plasma sources for microbial decontamination. J Phys D: Appl Phys 44:doi:10.1088/0022-3727/44/1/013002.

Eichenberger P, Fujita M, Jensen ST, Conlon EM, Rudner DZ, Wang ST, Ferguson C,Haga K, Sato T, Liu JS, Losick R. 2004. The program of gene transcription for a single differentiating cell type during sporulation in Bacillus subtilis. PloS Biol 2:1664-1683. Errington J. 2003. Regulation of endospore formation in Bacillus subtilis. Nat Rev Microbiol 1:117-126. Fairhead H and Setlow P. 1992. Binding of DNA to alpha/beta-type small, acid-soluble proteins from spores of Bacillus or Clostridium species prevents formation of cytosine dimers, cytosine-thymine dimers, and bipyrimidine photoadducts after UV irradiation. J Bacteriol 174:2874-2880. Fairhead H, Setlow B, Setlow P. 1993. Prevention of DNA damage in spores and in vitro by small, acid-soluble proteins from Bacillus species. J Bacteriol 175:1367–1374.

Fiebrandt M. 2012. Teilchenflussbestimmung und Plasmaparametercharakterisierung eines VHF-CCP mittels optischer Emissionsspektroskopie, Master’s thesis, Ruhr-Universität Bochum.

Fozza AC, Kruse A, Holländer A, Ricard A, Wertheimer MR. 1998. Vacuum ultraviolet to visible emission of some pure gases and their mixtures used for plasma processing. J Vac Sci Technol A 16:72-77.

202 Friedberg EC, et al. 2006. DNA repair and mutagenesis, 2nd ed. American Society for Microbiology, Washington, DC

Friedline AW, Zachariah MM, Middlaugh AN, Garimella R, Vaishampayan PA, Rice CV. 2015. Sterilization resistance of bacterial spores explained by water chemistry. J Phys Chem 119:14033-14044.

Garrick-Silversmith L, and Torriani A. 1973. Macromolecular syntheses during germination and outgrowth of Bacillus subtilis spores. J Bacteriol 114:507-516. Ghosh S, Setlow B, Wahome PG, Cowan AE, Plomp M, Malkin AJ, Setlow P. 2008. Characterization of spores of Bacillus subtilis that lack most coat layers. J Bacteriol 190:6741-6748. Gong CL, Bongiorno P, Martins A, Stephanou NC, Zhu H, Shuman S, Glickman MS. 2005. Mechanism of nonhomologous end-joining in mycobacteria: a low-fidelity repair system driven by Ku, ligase D and ligase C. Nature Structural & Molecular Biology 12:304- 312.

Goodhead DT. 1994. Initial events in the cellular effects of ionizing radiations; clustered damage in DNA. Int J Radiat Biol 65:7-17. Granger AC, Gaidamakova EV, Matrosova VY, Daly MJ, Setlow P. 2011. Effects of Mn and Fe levels on Bacillus subtilis spore resistance and effects of Mn2+, other divalent cations, orthophosphate, and dipicolinic acid on protein resistance to ionizing radiation. Appl Environ Microbiol 77:32-40. Griffith KK, Jingqiao Zhang, Cowan AE, Yu J, Setlow P. 2011. Germination proteins in the inner membrane of dormant Bacillus subtilis spores colocalize in a discrete cluster. Mol Microbiol 81:1061-1077. Griffiths KK and Setlow P. 2010. Effects of modification of membrane lipid composition on Bacillus subtilis sporulation and spore properties. J Appl Microbiol 106:2064–2078. Große-Kreul S, Corbella C, von Keudell A. 2012. Chemical and physical sputtering of polyethylene terephthalate (PET). Plasma Process Polym 10:225-234.

Grzegorzewski F, et al. 2010. Surface morphology and chemical composition of lamb's lettuce (Valerianella locusta) after exposure to a low-pressure oxygen plasma. Food Chemistry 122:1145-1152.

Haberer K and van Doorne H. 2011. Biological indicators, tools to verify the effect of sterilization processes–position paper prepared on behalf of group 1 (biological methods and statistical analysis). Pharmeur Bio Sci Notes 2:25–39.

Haertel B, von Woedtke T, Weltmann KD, Lindequist U. 2014. Non-thermal atmospheric- pressure plasma possible application in wound healing. Biomol Ther 22:477-490.

Halfmann H, Bibinov N, Wunderlich J, Awakowicz P. 2007a. A double inductively coupled plasma for sterilization of medical devices. J Phys D: ApplPhys 40:4145-4254.

203 Halfmann H, Denis B, Bibinov N, Wunderlich J, Awakowicz P. 2007b. Identification of the most efficient VUV/UV radiation for plasma based inactivation of Bacillus atrophaeus spores. J Phys D Appl Phys 40:5907.

Henriques AO and Moran CP Jr. 2007. Structure, assembly, and function of the spore surface layers. Annu Rev Microbiol 61:555-588. Hertwig C, Steins V, Reineke K, Rademacher A, Klocke M, Rauh C, Schlüter O. 2015. Impact of surface structure and feed gas composition on Bacillus subtilis endospore inactivation during direct plasma treatment. Front Microbiol 6:774.

Hieda K, Kobayashi K, Ito A, Ito T. 1984. Comparison of the effects of vacuum-UV and far-UV synchrotron radiation on dry heat cells of different UV sensitivities. Radiat Res 98:74- 81.

Horneck G, Klaus DM, Mancinelli RL. 2010. Space Microbiology. Microbiol Mol Biol Rev 74:121-56. Horneck G. 1994. HZE particle effects in space. Acta Astronaut 11:749–755. Huang SS, ChenD, Pelczar PL, Vepachedu VR, Setlow P, Li YQ. 2007. Levels of Ca2+- dipicolinic acid in individual Bacillus spores determined using microfluidic Raman tweezers. J Bacteriol 189:4681–4687. Hullo MF, Moszer I, Danchin A, Martin-Verstraete I. 2001. CotA of Bacillus subtilis is a copper-dependent laccase. J Bacteriol 183:5426–30. Humphreys PN. 2011. Testing standards for sporicides. J Hosp Infect 77:193–198.

Hutchinson F. 1985. Chemical changes induced by DNA by ionizing radiation. Prog Nucleic Acid Res Mol Biol 32:115-154. Inagaki T, Hamm RN, Arakawa ET, Birkhoff RD. 1975. Optical property of bovine plasma albumin between 2 and 82 eV. Biopol 14:839-847.

Ira G, Pellicioli A, Balijja A, Wang X, Fiorani S, Carotenuto W, Liberi G, Bressan F, Wan L, Hollingsworth NM, Haber JE, Foiani M. 2004. DNA end resection, homologous recombination and DNA damage checkpoint activation require CDK1. Nature 431:1011- 1017.

Ito A and Ito T. 1986. Absorption spectra of deoxyribose, ribosephosphate, ATP and DNA by direct transmission measurements in the vacuum-UV (150—190 nm) and far-UV (190— 260 nm) regions using synchrotron radiation as a light source. Photochem Photobiol 44:355- 358.

Ito T and Taniguchi T. 1986. Enzymatic quantification of strand breaks of DNA induced by vacuum-UV radiation. FEBS 206:151-153.

Iwanami S and Oda N. 1983. Photoabsorption and photoelectron-yield spectra of polypeptides in the vacuum-UV region. Rad Res. 95:24-31.

204 Janzen G. 1992. Plasmatechnik. Grundlagen, Anwendungen, Diagnostik. Hüthig, Heidelberg. Jedrzejas MJ and Setlow P. 2001. Comparison of the binuclear metalloenzymes diphosphoglycerate-independent phosphoglycerate mutase and alkaline phosphatase: their mechanism of catalysis by a phosphoserine intermediate. Chem Rev 101:607-618. Kaieda S, Setlow B, Setlow P, Halle B. 2013. Mobility of core water in Bacillus subtilis spores by 2H NMR. Cell 105:2016-2023. Keijser BJF, Ter Beek A, Rauwerda H, Schuren F, Montijn R, van der Spek H, Brul S. 2007. Analysis of Temporal Gene Expression during Bacillus subtilis Spore Germination and Outgrowth. J Bacteriol 189:3624-3634. Keynan A and Evenchik Z. 1969. Activation, in The Bacterial Spore, G.W. Gould and A. Hurst, eds. Academic, 359–396. Khan HA, Ahmad A, Riffat M. 2015. Nosocomial infections and their control strategies. 5:509-514.

Khodyreva S and Lavrik OI. 2011. New players in recognition of intact and cleaved AP sites: implication in DNA repair in mammalian cells. Chen,CC (ed). In Selected Topics in DNA Repair. In Techd.o.o., Rijeka, 305–330.

Kidane D, Sanchez H, Alonso JC, Graumann PL. 2004. Visualization of DNA double- strand break repair in live bacteria reveals dynamic recruitment of Bacillus subtilis RecF, RecO and RecN proteins to distinct sites on the nucleoids. Mol Microbiol 52:1627-1639.

Kim H, Hahn M, Grabowski P, McPherson DC, Otte MM, et al. 2006. The Bacillus subtilis spore coat protein interaction network. Mol Microbiol 59:487–502. Kim H, Hahn M, Grabowski P, McPherson DC, Otte MM, et al. 2006. The Bacillus subtilis spore coat protein interaction network. Mol Microbiol 59:487–502. Kong L, Zhang P, Wang G, Yu J, Setlow P and Li Y-Q. 2011. Phase contrast microscopy, fluorescence microscopy, Raman spectroscopy and optical tweezers to characterize the germination of individual bacterial spores. Nat Protoc 6:625–639. Koshikawa T, Yamazaki M, Yoshimi M, Ogawa S, Yamada A, Watabe K, Torii M. 1989. Surface hydrophobicity of spores in Bacillus spp. J Gen Microbiol 135:2717-2722. Krüger E, Witt E, Ohlmeier S, Hanschke R, Hecker M. 2000. The Clp proteases of Bacillus subtilis are directly involved in degradation of misfolded proteins. J Bacteriol 182:3259-3265.

Kunst et al. 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390:249-56. Kvam E, Davis B, Mondello F, Gamer AL. 2012. Nonthermal atmospheric plasma rapidly disinfects multidrug resistant microbes by inducing cell surface damage. Antimicrob Agents Chemo 56:2028-2036.

205 La Duc MT, Kern R, Venkateswaran K. 2004 Microbial monitoring of spacecraft and associated environments. MicrobEcol 47:150–158.

Lackmann JW and Bandow JE. 2014. Inactivation of microbes and macromolecules by atmospheric-pressure plasma jets. Appl Microbiol Biotechnol 98:6205-6213.

Lackmann JW, Baldus S, Steinborn E, Edengeise E, Kogelheide F, Schäkermann S, Schneider S, Leichert LIO, Benedikt J, Awakocwiz P, Bandow JE. 2015. A dielectric barrier discharge terminally inactivates RNase A by oxidizing sulfur-containing amino acids and breaking structural disulfide bonds. J Phys D: Appl Phys 48:494003.

Lackmann JW, Edengeiser E, Schneider S, Benedikt J, Havenith M, Bandow J E. 2013a.

Effects of the effluent of a microscale atmospheric pressure plasma-jet operate with He/O2 gas on bovine serum albumin. Plasma Medicine 3:115-124 Lackmann JW, Schneider S, Edengeiser E, Jarzina F, Brinckmann S, Steinborn E, Havenith M, Benedikt J, Bandow JE. 2013b. Photons and particles emitted from cold atmospheric-pressure plasma inactivate bacteria and biomolecules independently and synergistically. J R Soc Interface 10:20130591.

Langmuir I. 1928. Oscillations in ionized gases. Proc Natl Acad Sci USA 14:627–37.

Laroussi M and Leipold F. 2004. Evaluation of the roles of reactive species, heat, and UV radiation in the inactivation of bacterial cells by air plasmas at atmospheric pressure. In. J Mass Spectrom 233:81–6.

Lee KS, Bumbaca D, Kosman J, Setlow P, Jedrzejas MJ. 2008. Structure of a protein- DNA complex essential for DNA protection in spores of Bacillus species. Proc Natl Acad Sci USA 105:2806-2811. Lendlein A and Langer R. 2002. Biodegradable, elastic shape-memory polymers for potential biomedical applications. Science 296:1673-1676.

Lenhart JS, Schroeder JW, Walsh BW, Simmons LA. 2012. DNA repair and genome maintenance in Bacillus subtilis. Microbiol Mol Biol Rev 76:530-564.

Lerouge S, Fozza A C, Wertheimer M R, Marchand R, Yahia L. 2000a. Sterilization by low-pressure plasma: the role of vacuum-ultraviolet radiation. Plasmas Polym 5:31-46.

Lerouge S, Wertheimer MR, Marchand R, Tabrizian M, Yahia L. 2000b. Effect of gas composition on spore mortality and etching during low-pressure plasma sterilization. J Biomed Mater Res 51:128-135.

Lerouge S. 2001. Non-traditional sterilization techniques for biomaterials and medical devices. In Lerouge S, Simmons A (ed), Sterilisation of Biomaterials and Medical Devices. Woodhead Publishing, Witney, Oxford, UK.

Leuschner RGK and Lillford PJ. 2000. Effects of hydration on molecular mobility in phase-bright Bacillus subtilis spores. Microbiol 146:49–55.

206 Lindberg C and Horneck GJ. 1992. Thymine photoproduct formation and inactivation of intact spores of Bacillus subtilis irradiated with short wavelength UV (200 – 300nm) at atmospheric pressure and in vacuo. Adv Space Res 12:275-279. Link L, Sawyer J, Venkateswaran K, Nicholson W. 2004. Extreme spore UV resistance of Bacillus pumilus isolates obtained from an ultraclean spacecraft assembly facility. Microb Ecol 47: 159-163.

Loisan P, Hosny NA, Gervais P, Champion D, Kuimova MK, Perrier-Cornet JM. 2013. Direct investigation of viscosity of an atypical inner membrane of Bacillus spores: a molecular rotor/FLIM study. Biochim Biophys Acta 1828:2436–2443. Loshon CA, Genest PC, Setlow B, Setlow P. 1999. Formaldehyde kills spores of Bacillus subtilis by DNA damage and small, acid-soluble spore proteins of the a/b-type protect against this DNA damage. J Appl Microbiol 87:8–14. Luu S and Setlow P. 2014. Analysis of the loss in heat and acid resistance during germination of spores of Bacillus species. J Bacteriol 196:1733-1740. Luu S, Cruz-Mora J, Setlow B, Feeherry FE, Doona CJ, Setlow P. 2015. The effects of heat activation on Bacillus spore germination, with nutrients or under high pressure, with or without various germination proteins. Appl Environ Microbiol 81:2927-2938. Mandic-Mulec I, Stefanic P, van Elsas JD. 2015. Ecology of Bacillaceae. Microbiol Spectr 3: doi:10.1128/microbiolspec.TBS-0017-2013. Mason JM and Setlow P. 1987. Different small, acid-soluble proteins of the α/-type have interchangeable roles in the heat and UV radiation resistance of Bacillus subtilis. J Bacteriol 169:3633-3637.

Matz LL, Beaman TC, Gerhardt P. 1970. Chemical composition of exosporium from spores of Bacillus cereus. J Bacteriol 101:196–201. McKenney PT and Eichenberger P. 2012. Dynamics of spore coat morphogenesis in Bacillus subtilis. Mol Microbiol 83:245-260. McKenney PT, Driks A, Eichenberger P. 2013. The Bacillus subtilis endospore: assembly and functions of the multilayered coat. Nat Rev Microbiol 11:33-44. McKenney PT, Driks A, Eskandarian HA, Grabowski P, Guberman J, Wang KH, Gitai Z, Eichenberger O. 2010. A distance-weighted interaction map reveals a previously uncharacterized layer of the Bacillus subtilis spore coat. Curr Biol 20:934–938. Mehl RA and Begley TP. 1999. Mechanistic studies on the repair of a novel DNA photolesion: the spore photoproduct. Org Lett 1:1065-1066.

Melly E, Genest PC, Gilmore ME, Little S, Popham DL, Driks A, Setlow P. 2002b. Analysis of the properties of spores of Bacillus subtilis prepared at different temperatures. J Appl Microbiol 92:1105–1115. Mertmann P, Bibinov N, Halfmann H, Awakowciz P. 2009. Determination of argon resonance line emission in an ICP hitting a biological sample. Plasma Sources Sci Technol 7:665–675.

207 Moeller R, Douki T, Cadet J, Stackebrandt E, Nicholson WL, Rettberg P, Reitz G, Horneck G. 2007a. UV-radiation-induced formation of DNA bipyrimidine photoproducts in Bacillus subtilis endospores and their repair during germination. Int Microbiol 10:39-46. Moeller R, Raguse M, Reitz G, Okayasu R, Li Z, Klein S, Setlow P, Nicholson WL. 2014. Resistance of Bacillus subtilis Spore DNA to Lethal Ionizing Radiation Damage Relies Primarily on Spore Core Components and DNA Repair, with Minor Effects of Oxygen Radical Detoxification. Appl Environ Microbiol 80:104-109. Moeller R, Setlow P, Horneck G, Berger T, Reitz G, Rettberg P, Doherty AJ, Okayasu R, Nicholson WL. 2008. Roles of the major, small, acid-soluble spore proteins and spore- specific and universal DNA repair mechanisms in resistance of Bacillus subtilis spores to ionizing radiation from X rays and high-energy charged-particle bombardment. J Bacteriol 190:1134-1140.

Moeller R, Setlow P, Pedraza-Reyes M, Okayasu R, Reitz G, Nicholson W. 2011. Role of the Nfo and ExoA apurinic/apyrimidinic endonucleases in radiation resistance and radiation- induced mutagenesis of Bacillus subtilis spores. J Bacteriol 193:2875-2879.

Moeller R, Setlow P, Reitz G, Nicholson WL. 2009. Roles of small, acid-soluble spore proteins and core water content in survival of Bacillus subtilis spores exposed to environmental solar UV radiation. Appl Environ Microbiol 75:5202-5208. Moeller R, Stackebrandt E, Reitz G, Berger T, Rettberg P, Doherty AJ, Horneck G, Nicholson WL. 2007b. Role of DNA repair by nonhomologous-end joining in Bacillus subtilis spore resistance to extreme dryness, mono- and polychromatic UV, and ionizing radiation. J Bacteriol 189:3306-3311.

Moisan M, Barbeau J, Moreau S, Pelletier J, Tabrizian M, Yahia L’H. 2001. Low- temperature sterilization using gas plasmas: a review of the experiments and an analysis of the inactivation mechanisms. Int J Pharma 226:1-21.

Molle V, Fujita M, Jensen ST, Eichenberger P, González-Pastor JE, Liu JS, Losick R. 2003. The Spo0A regulon of Bacillus subtilis. Mol Microbiol 50:1683-701.

Munakata N and Ruperst CS. 1974. Dark repair of DNA containing „spore photoproduct” in Bacillus subtilis. Mol Gen Genet 130:239-250.

Munakata N and Rupert CS. 1972. Genetically controlled removal of “spore photoproduct” from deoxyribonucleic acid of ultraviolet-irradiated Bacillus subtilis spores. J Bacteriol 111:192–198.

Munakata N and Rupert CS. 1975. Effects of DNA-polymerase-defective and recombination-deficient mutations on the ultraviolet sensitivity of Bacillus subtilis spores. Mutat Res 27:157-69.

Nemchinsky VA and Severance WS. 2006. What we know and what we do not know about plasma arc cutting. J Phys D: Appl Phys 39:R423.

208 Neumann V. 2014. Characterisation of DNA damage and repair in Bacillus subtilis spores after treatment with cold technical plasmas. Bachelor thesis,University of Applied Sciences Bonn-Rhein-Sieg.

Nguyen TMH, Durand A, Loison P, Perrier-Cornet JM. 2011. Effect of sporulation conditions on the resistance of Bacillus subtilis spores to heat and high pressure. Appl Microbiol Biotechnol 90:1409–1417.

Nicholson WL, Munakata N, Horneck G, Melosh HJ, Setlow P. 2000. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol Mol Biol Rev 64:548–572. Nicholson WL, Schrueger AC, Race MS. 2009. Migrating microbes and planetary protection. Trends Microbiol 17:389-392.

Oppenheimer-Shaanan Y, Wexselblatt E, Katzendler J, Yavin E, Ben-Yehuda S. 2011. C-di-AMP reports DNA integrity during sporulation in Bacillus subtilis. EMBO Rep 12:594- 601.

Ozin AJ, Henriques AO, Yi H, Moran CP Jr. 2000. Morphogenetic proteins SpoVID and SafA form a complex during assembly of the Bacillus subtilis spore coat. J Bacteriol 182:1828–33. Paidhungat M and Setlow P. 2002. Spore germination and outgrowth. In Bacillus subtilis and its Relatives: From Genes to Cells. Edited by Hoch JA, Losick R, Sonenshein AL. Washington, DC: American Society for Microbiology, 537-548. Paidhungat M and Setlow P. 2000. Role of Ger proteins in nutrient and nonnutrient triggering of spore germination in Bacillus subtilis J. Bacteriol. 182:2513-2519. Paidhungat M, and Setlow P. 2001. Localization of a germinant receptor protein (GerBA) to the inner membrane of Bacillus subtilis spores. J Bacteriol 183:3982-3990. Pankai SK, Bueno-Ferrer C, Misra NN, Milosavljevic V, O’Donnell CP, Bourke P, Keener KM, Cullen PJ. 2014. Applications of cold plasma technology in food packaging. 35:5-17.

Pedraza-Reyes M, Gutierrez-Corona F, Nicholson WL. 1994. Temporal regulation and forespore-specific expression of the spore photoproduct lyase gene by sigma-G RNA polymerase during Bacillus subtilis sporulation. J Bacteriol 176:3983-3991.

Penna TCV, Ishii M, Machoshvili IA, Marques M. 2002. The effect of bioindicator preparation and storage on thermal resistance of Bacillus stearothermophilus spores. Appl Biochem Biotechnol 98:525–538.

Philip N, Saoudi B, Crevier MC, Moisan M, Barbeau J, Pelletier J. 2002. The respective roles of UV photons and oxygen atoms in plasma sterilization at reduced gas pressure: the case of N2 – O2 mixtures. IEEE Trans Plasma Sci 30:1429-1463.

Piggot PJ and Coote JG. 1976. Genetic aspects of bacterial endospore formation. Bacteriol Rev 40:908-962.

209 Piggot PJ and Hilbert DW. 2004. Sporulation of Bacillus subtilis. Curr Opin Microbiol 7:579–586. Plomp M, Carroll AM, Setlow P, Makin AJ. 2014. Architecture and assembly of the Bacillus subtilis spore coat. PLoS One 9:e108560. doi: 10.1371/journal.pone.0108560. Plomp M, Leighton TJ, Wheeler KE, Hill HD, Malkin AJ. 2006. In vitro high-resolution structural dynamics of single germinating bacterial spores. PNAS 104:9644-9649 Popham DL and Setlow P. 1993. The cortical peptidoglycan from spores of Bacillus megaterium and Bacillus subtilis is not highly cross-linked. J Bacteriol 175:2767–2769 Popham DL, Sengupta S, Setlow P. 1995. Heat, hydrogen peroxide, and UV resistance of Bacillus subtilis spores with increased core water content and with or without major DNA- binding proteins. Appl Environ Microbiol. 10:3633-3638.

Popham DL, Sengupta S, Setlow P. 1995. Heat, hydrogen peroxide, and UV resistance of Bacillus subtilis spores with increased core water content and with or without major DNA- binding proteins. Appl Environ Microbiol 61:3633-8. Popham DL. 2002. Specialized peptidoglycan of the bacterial endospore: the inner wall of the lockbox. Cell Mol Life Sci 59:426-433. Raballand V, Benedikt J, Wunderlich J, von Keudell A. 2008. Inactivation of Bacillus atrophaeus and of Aspergillus niger using beams of argon ions, of oxygen molecules and of oxygen atoms. J Phys D: Appl Phys 41:115207.

Ragkousi K, Cowan AE, Ross MA, and Setlow P. 2000. Analysis of nucleoid morphology during germination and outgrowth of spores of Bacillus species. J Bacteriol 182:5556-5562. Raguse M, Fiebrandt M, Stapelmann K, Madela K, Laue M, Lackmann JW, Thwaite JE, Setlow P, Awakowicz P, Moeller R. 2016. Improvement of biological indicators by uniformly distributing of Bacillus subtilis monolayers to evaluate enhanced spore decontamination technologies. Appl Environ Microbiol 82:2031-2038.

Rauscher H, Kylián O, Benedikt J, von Keudell A, Rossi F. 2010. Elimination of Biological Contaminations from Surfaces by Plasma Discharges: Chemical Sputtering. Chemphyschem 11:1382-1389.

Redmond C, Baillie LW, Hibbs S, Moir AJ, Moir A. 2004. Identification of proteins in the exosporium of Bacillus anthracis. Microbiol 120:355-363. Reibel R, Sun Y, Chooback L, Pedraza-Reyes M, Kinsland C, Begley TP, Nicholson WL. 1998. Spore photoproduct lyase from Bacillus subtilis spores in a novel iron-sulfur DNA repair enzyme which shares features with proteins such as class III anaerobic ribonucleotide reductases and pyruvate lyases. J Bacteriol 180:4879-4885.

Reinke K, Mathys A, Heinz V, Knorr D. 2013. Mechanisms of endospore inactivation under high pressure. Trends Microbiol 21:296-304.

210 Riesenman PJ and Nicholson W. 2000. Role of the spore coat layers in Bacillus subtilis spore resistance to hydrogen peroxide, artificial UV-C, UV-B, and solar UV radiation. Appl Environ Microbio 66:620-626. Rossi F, Kylián O, Rauscher H, Gilliland D, Sirghi L. 2008. Use of a low-pressure plasma discharge for the decontamination and sterilization of medical devices. 80:1939-1951.

Rothkamm K, Kruger I, Thompson LH, Lobrich M. 2003. Pathways of DNA double- strand break repair during the mammalian cell cycle. Mol Cell Biol 23:5706-5715.

Rummel JD. 2001. Planetary protection in the time of astrobiology: protecting against biological contamination. Proc Natl Acad Sci USA 98:2128–2131.

Rutala WA and Weber DJ. 2013. Disinfection and sterilization: an overview. Am J Infect Control 41:S2–S5.

Salas-Pacheco JM, Setlow B, Setlow P, Pedraza-Reyes M. 2005. Role of the Nfo (YqfS) and ExoA apurinic/apyrimidinic endonucleases in protecting Bacillus subtilis spores from DNA damage. 187:7374-7381. Sanchez-Salas JL, Santiago-Lara ML, Setlow B, Sussman MD, Setlow P. 1992. Properties of mutants of Bacillus megaterium and Bacillus subtilis which lack the protease that degrades small, acid-soluble proteins during spore germination. J Bacteriol 174:807–814. Santo LY and Doi RH. 1974. Ultrastructural analysis during germination and outgrowth of Bacillus subtilis spores. J Bacteriol 120:475–481. Schlüter O, Ehlbeck J, Hertel C, Habermeyer M, Roth A, Engel KH, et al. 2013. Opinion on the use of plasma processes for treatment of foods. Mol Nutr Food Res 57:920–927.

Schnaith LMT, Hanson RS, Que L Jr. 1994. Double-stranded cleavage of pBR322 by a diiron complex via a “hydrolytic” mechanism. Proc Natl Acad Sci USA 91:569-573.

Schneider J, Baumgärtner K M, Feichtinger J, Krüger J, Muranyi P, Schulz A, et al. 2005. Investigation of the practicability of low-pressure microwave plasmas in the sterilisation of food packaging materials at industrial level. Surf Coat Tech 200:962e966.

Schneider S, Lackmann JW, Narberhaus F, Bandow JE, Denis B, Benedikt J. 2011.

Separation of VUV/UV Photons and Reactive Particles in the Effluent of a He/O2 Atmospheric Pressure Plasma Jet. J Phys D 44:295201.

Segev E, Rosenberg A, Mamou G, Sinau L, Ben-Yehuda S. 2013. Molecular kinetics of reviving bacterial spores. J Bacteriol 195:1875-1882. Selcuk M, Oksuz L, Basaran P. 2008. Decontamination of grains and legumes infected with Aspergillus spp. and Penicillum spp. by cold plasma treatment. Bioresour Technol 99:5104- 5109.

Semmler E, Novak W, Allinson WW, Wallis DP, Wood NI, Awakowicz P, Wunderlich J. 2016. Plasma decontamination: A case study on kill efficacy of Geobacillus

211 stearothermophilus spores on different carrier materials. PDA J Pharm Sci Technol doi:10.5731/pdajpst.2015.

Setlow B and Setlow P. 1987. Thymine containing dimers as well as spore photoproducts are found in ultraviolet-irradiated Bacillus subtilis spores that lack small acid-soluble proteins. Proc Natl Acad Sci USA 84:421–423. Setlow B and Setlow P. 1993. Binding of small, acid-soluble spore proteins to DNA plays a significant role in the resistance of Bacillus subtilis spores to hydrogen peroxide. Appl Environ Microbiol 59:3418-3423.

Setlow B and Setlow P. 1995. Small, acid-soluble proteins bound to DNA protect Bacillus subtilis spores from killing by dry heat. Appl Environ Microbiol 61:2787-2790 Setlow B and Setlow P. 1996. Role of DNA repair in Bacillus subtilis spore resistance. J Bacteriol 178:3486-3495. Setlow B, Loshon CA, Genest PC, Cowan AE, Setlow C, Setlow P. 2002. Mechanisms of killing spores of Bacillus subtilis by acid, alkali and ethanol. J Appl Microbiol 92:362-375.

Setlow B, Yu J, Li YQ, Setlow P. 2013. Analysis of the germination kinetics of individual Bacillus subtilis spores treated with hydrogen peroxide or sodium hypochlorite. Lett Appl Microbiol 57:259-265.

Setlow B, McGinnis KA, Ragkousi K, Setlow P. 2000. Effects of major spore-specific DNA binding proteins on Bacillus subtilis sporulation and spore properties. J Bacteriol 182:6906– 6912. Setlow P and Kornberg A. 1970. Biochemical studies of bacterial sporulation and germination. 23. Nucleotide metabolism during spore germination. J Biol Chem 245:3645- 3652. Setlow P and Lei L. 2015. Photochemistry and photobiology of the spore photoproduct: A 50-year journey. Photochem Photobiol 91:1263-1290.

Setlow P and Primus G. 1975. Protein metabolism during germination of Bacillus megaterium spores. I. Protein synthesis and amino acid metabolism. J Biol Chem 250:623- 630. Setlow P. 2001. Resistance of spores of Bacillus species to ultraviolet light. Environ Mol Mutagen 38:97-104. Setlow P. 2003. Spore germination. Curr Opin Microbiol 6:550-556. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. J Appl Microbio 101:514-525. Setlow P. 2012. Dynamics of the assembly of a complex macromolecular structure - the coat of spores of the bacterium Bacillus subtilis. Mol Microbiol 83:241-244. Setlow P. 2013. Summer meeting 2013 – when the sleepers wake: the germination of spores of Bacillus species. J Appl Biol 116:1251-1268.

212 Setlow P. 2014a. Germination of Spores of Bacillus species: what we know and do not know. J Bacteriol 196:1297-1305. Setlow P. 2014b. Spore resistance properties. Microbiol Spec 2:TBS-0003-2012. (doi:10.1128/microbiolspec.TBS-0003-2012). Shimizu S, Barczyk S, Rettberg P, Shimizu T, Klaempfl T, Zimmermann JL, Hoeschen T, Linsmeier C, Weber P, Morfill GE, Thomas HM. 2014. Cold atmosphericplasma – A new technology for spacecraft component decontamination. Plan Space Sci 90:60-71.

Shintani H and Akers JE. 2000. On the cause of performance variation of biological indicators used for sterility assurance. PDAJ Pharm Sci Technol 54:332–342.

Shintani H. 2014. Important points to attain reproducible sterility assurance. Biochem Physiol 3:135.

Shintani H. 2015. Current mistaken interpretation of microbiological data on gas plasma sterilization. Pharamecut Reg Affairs 4:2.

Sigwarth V and Stärk A. 2003. Effect of carrier materials on the resistance of spores of Bacillus stearothermophilus to gaseous hydrogen peroxide. PDA J Pharm Sci Technol 57:3– 11.

Silva E. 1996. Sensitized photo-oxidation of amino acids in proteins: Some important biological implications Biol Res 29:57-67.

Singh RP, B Setlow, and Setlow P. 1977. Levels of small molecules and enzymes in the mother cell compartment and the forespore of sporulating Bacillus megaterium. J. Bacteriol. 130:1130–1138. Stapelmann K, Fiebrandt M, Raguse M, Awakowicz, Reitz G, Moeller R. 2013. Utilization of low-pressure plasma to inactivate bacterial spores on stainless steel screws. Astrobiology 13:597-606.

Stapelmann K, Kylián O, Denis B, Rossi F. 2008. On the application of inductively coupled plasma discharges sustained in Ar/O2/N2 ternary mixture for sterilization and decontamination of medical instruments. J Phys D: Appl Phys 41:192005.

Stapelmann K, Lackmann JW, Buerger I, Bandow JE, Awakowicz P. 2014. A H2 very high frequency capacitively coupled plasma inactivates glyceraldehyde 3-phosphate dehydrogenase (GapDH) more efficiently than UV photons and heat combined. J Phys D: Appl Phys 47:085402. Stapelmann K. 2013. Plasma technical and microbiological characterization of newly developed VHF plasmas. Dissertation. Department of Electrical Engineering and Plasma Technology, Ruhr University Bochum, Bochum, Germany.

Stevens CM, Daniel R, Illing N, Errington J. 1992. Characterization of a sporulation gene, spoIVA, involved in spore coat morphogenesis in Bacillus subtilis. J Bacteriol 174:586–94.

213 Sunde EP, Setlow P, Hederstedt L, Halle B. 2009. The physical state of water in bacterial spores. Proc Natl Acad Sci USA 106:19334–19339. Sutherland BM, Bennett PV, Sidorkina O, Laval J. 2000. Clustered damages and total lesions induced in DNA by ionizing radiation: oxidized bases and strand breaks. Biochemistry 39:8026–8031. Tennen R, Setlow B, Davis KL, Loshon CA, and Setlow P. 2000. Mechanisms of killing of spores of Bacillus subtilis by iodine, glutaraldehyde and nitrous acid. J Appl Microbiol 89:330–338. The Outer Space Treaty. 1967. Treaty on Principles Governing the Activities of States in the Exploration and Use of Outer Space, Including the Moon and Other Celestial Bodies. US department of State, Bureau of arms control, verification and compliance. http://www.state.gov/t/isn/5181.htm

Traba C and Liang JF. 2011. Susceptibility of Staphylococcus aureus biofilms to reactive discharge gases. Biofouling. 27:763-772.

Tyrrell RM. 1978. Solar dosimetry with repair deficient bacterial spores: action spectra, photoproduct measurements and comparison with other biological systems. Photochem Photobiol 27:571-579. Ulbin-Figlewicz N, Jarmoluk A, Marycz K. 2015. Antimicrobial activity of low-pressure plasma treatment against selected foodborne bacteria and meat microbiota. Ann Microbiol 65:1537-1546.

University Bochum, Vaishampayan P, Probst A, Krishnamurthi S, Ghosh S, Osman S, McDowall A, Ruckmani A, Mayilraj S, Venkateswaran K. 2010. Bacillus horneckiae sp. nov., isolated from a spacecraft-assembly clean room. Int J Syst Evol Microbiol 60:1031–1037. Venugopalan M and Shih AL. 1981. Reactions of hydrogen peroxide vapor dissociated in a microwave plasma. Plasma Chem Plasma Process 1:191-200.

Vlasic I, Mertens R, Seco EM, Carrasco B, Ayora S, Reitz G, Commichau FM, Alonso JC, Moeller R. 2014. Bacillus subtilis RecA and its accessory factors, RecF, RecO, RecR and RecX, are required for spore resistance to DNA double-strand break. Nucleic Acids Res 42:2295-2307. von Keudell A, Awakowicz P, Benedikt J, Raballand V, Yanguas-Gil A, Opretzka J, Flötgen C, Reuter R, Byelykh L, Halfmann H, Stapelmann K, Denis B, Wunderlich J, Muranyi P, Rossi F, Kylián O, Hasiwa N, Ruiz A, Rauscher H, Sirghi L, Comoy E, Dehen C, Challier L, Deslys JP. 2010. Inactivation of bacteria and biomolecules by low- pressure plasma discharges. Plasma Process Polym 7:327-52.

Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, Sato T, Setlow P, Losick R, Eichenberger P. 2006. The forespore line of gene expression in Bacillus subtilis. 358:16-37.

214 Wang TC and Rupert CS. 1977. Evidence for the monomerization of spore photoproduct to two thymines by the light-independent “spore repair” process in Bacillus subtilis. Photochem. Photobiol. 25:123–127.

Warth AD and Strominger JL. 1972. Structure of peptidoglycan from spores of Bacillus subtilis. Biochemistry 11:1389–1396. Warth AD, Ohye DF, Murrell WG. 1963. The composition and structure of bacterial spores. J Cell Biol 16:579-592. Weller GR, Kysela B, Roy R, Tonkin LM, Scanlan E, Della M, Devine SK, Day JP, Wilkinson A, d'Adda di Fagagna F, Devine KM, Bowater RP, Jeggo PA, Jackson SP, Doherty AJ. 2002. Identification of a DNA nonhomologous end-joining complex in bacteria. Science 297:1686-1689.

Wertheimer MR, Fozza AC, Holländer A. 1999. Industrial processing of polymers by low- pressure plasmas: the role of VUV radiation. Nucl Instrum Meth in Phys Res B 151:65-75

Williams GJ, Denyer SP, Hosein IK, Hill DW, Maillard JY. 2009. Limitations of the efficacy of surface disinfection in the healthcare setting. Infect Control Hosp Epidemiol 30:570–573.

Wilson TE, Topper LM, Palmbos PL. 2003. Non-homologous end-joining: bacteria join the chromosome breakdance. Trends Biochem Sci 28:62-66.

Xue Y and Nicholson WL. 1996. The two major spore DNA repair pathways, nucleotide excision repair and spore photoproduct lyase, are sufficient for the resistance of Bacillus subtilis spores to artificial UV-C and UV-B but not to solar radiation. Appl Environ Microbiol 62:2221-2227.

Yang L and Li L. 2015. Spore photoproduct lyase: the known, the controversial, and the unknown. J Biol Chem 290:4003-4009.

Yang L, Lin G, Liu D, Dria KJ, Telser J, Li L. 2011. Probing the reaction mechanism of spore photoproduct lyase (SPL) via diastereoselectively labeled dinucleotide SP TpT substrates. J Am Chem Soc 133:10434-10447.

Yardimci O and Setlow P. 2010 Plasma sterilization: opportunities and microbial assessment strategies in medical device manufacturing. IEEE Trans Plasma Sci 38:973—981.

Yi X and Setlow P. 2010. Studies of the commitment step in the germination of spores in the bacillus species. J Bacteriol 192:3424-3433. Zhang P, Setlow P, Li Y. 2009. Characterization of single heat-activated Bacillus spores using laser tweezers Raman spectroscopy. Opt Express 17:16480-16491.

215 O. Appendix

1. Unpublished Data

Figure S1 Visualization of the repair of DNA double-strand breaks by NHEJ (Ku-GFP) and HR (RecA-YFP) during B. subtilis PY79 wildtype spore revival after treatment with simulated active plasma agents. The DNA-binding protein Ku required for non-homologous end joining (NHEJ) is active during spore germination after treatment with dry heat (120°C, LD90) indicating heat- inflicted DNA double-strand breaks but not after treatment with radical species (10% H2O2, LD90). The RecA protein, mediator of homologous recombination (HR), is likewise not active in germinating spores after treatment with radical species, but after dry heat treatment, although at a later stage, indicating its importance in DNA replication.

Figure S2 B. subtilis spores with with mutations in AP endnuclease IV Nfo, DSB-binding protein Ku, the ligase LigD (-), impaired LigD ligase domain (/), and wildtype versions of the respective mutation (+) were treated with (A) low pressure (10 Pa), (B) LP argon plasma (100 sccm), and (C) LP oxygen plasma (20 sccm) for 60 seconds.

216 2. Publications Raguse M, Fiebrandt M, Stapelmann K, Madela K, Laue M, Lackmann JW, Thwaite JE, Setlow P, Awakowicz P, Moeller R. 2016a. Improvement of biological indicators by uniformly distributing of Bacillus subtilis monolayers to evaluate enhanced spore decontamination technologies. Appl Environ Microbiol 82:2031-2038. de Ory A, Nagler K, Carrasco B, Raguse M, Zafra O, Moeller R, de Vega M. 2016. Identification of a conserved 5’-dRP lyase activity in bacterial DNA repair ligase D and its potential role in base excision repair. Nucleic Acids Res 44:1833-1844.

Halstead F, Thwaite J, Burt R, Laws T, Raguse M, Moeller R, Webber M, Oppenheim B. 2016. The antibacterial activity of blue light against nosocomial wound pathogens growing planktonically and as mature biofilms. (accepted in Applied and Environmental Microbiology)

Raguse M, Fiebrandt M, Denis B, Stapelmann K, Eichenberger P, Driks A, Eaton P, Awakowicz, Moeller R. 2016b. Understanding of the importance of the spore coat structure and pigmentation in the Bacillus subtilis spore resistance to low pressure plasma sterilization. (under revision)

Raguse M, Eichenberger P, Alonso J, Moeller R. 2016c. DNA double-strand breaks commit outgrown Bacillus subtilis haploid spore to non-homologous end joining. (in preparation)

Raguse M, Fiebrandt M, Douki T, Commichau F, Setlow P, Moeller R. 2016d. Role of DNA repair in Bacillus subtilis spore resistance towards low pressure plasma sterilization. (in preparation)

Raguse M, Berger T, Hellweg CE, Fujimori A, Okayasu R, STARLIFE Team, Moeller R. 2016. STARLIFE I: Studying the effects of galactic cosmic radiation on astrobiological model systems: introducing the STARLIFE intercomparison initiative. (submitted)

Verseux C, Baqué M, Cifariello R, Fagliarone C, Raguse M, Moeller R, Billi D. 2016. STARLIFE IV: Resistance of Chroococcidiopsis sp. to sparsely and densely ionizing radiation. (under revision)

Pacelli C, Selbmann L, Zucconi L, Raguse M, Moeller R, Onofri. 2016. STARLIFE V: DNA persistence in cryptoendolithic microorganisms treated with ionizing radiations. (under revision)

217 Brandt A, Meeßen J, Jänicke RU, Raguse M, Ott S. 2016. STARLIFE VI: Simulated space radiation: Impact of four different types of high-dose ionizing radiation on the lichen Xanthoria elegans. (under revision)

De la Torre R, Miller AZ, Cubero B, Martin –Cerezo ML, Raguse M, Meeßen J. 2016. STARLIFE VII: The effect of high dose ionizing radiation on the astrobiological model lichen Circinaria gyrosa.

Meeßen J, Backhaus T, Brandt A, Raguse M, Böttger U, Raguse M, de Vera JP, de la Torre R. 2016. STARLIFE VIII: The effect of high dose ionizing radiation on the isolated photobiont of the astrobiological model lichen Circinaria gyros. (under revision)

Cockell C, Samuels T, Sirks E, Mayer M, Friswell I, Nicholson N, Moeller R, Nagler K, Raguse M, Schroeder A, Berger T, Rettberg P. 2015. A 500-year experiment. Astron. Geophys. 56:1.28-1.29.

Moeller R, Raguse M, Reitz G, Okayasu R, Li Z, Klein S, Setlow P, Nicholson WL. 2014. Resistance of Bacillus subtilis spore DNA to lethal ionizing radiation damage relies primarily on spore core components and DNA repair, with minor effects of oxygen radical detoxification. Appl Environ Microbiol 80:104-109.

Stapelmann K, Fiebrandt M, Raguse M, Awakowicz, Reitz G, Moeller R. 2013. Utilization of low-pressure plasma to inactivate bacterial spores on stainless steel screws. Astrobiology 13:597-606.

Hallström T, Mörgelin M, Barthel D, Raguse M, Kunert A, Hoffmann R, Skerka C, Zipfel PF. 2012. Dihydrolipoamide dehydrogenase of Pseudomonas aeruginosa is a surface-exposed immune evasion protein that binds three members of the factor H family and plasminogen. J. Immunology 189:4939-50.

218 3. Conference Proceedings

3.1. Conference Talks Raguse M, Fiebrandt M, Awakowicz P, Narberhaus F, Moeller R (2015) Plasma sterilization as an innovative tool to inactive Bacillus subtilis endospores, BaCell Conference, 14-15 April 2015, Amsterdam, Netherlands.

Raguse M, Fiebrandt M, Awakowicz P, Moeller R (β01γ) “Utilization of Very High Frequency Capacitively-Coupled Plasma for the inactivation of Bacillus subtilis spores”, ZIK Plasmatis 2nd Young Professionals Workshop on Plasma Medicine, 15-18 September 2013, Usedom, Germany

Raguse M, Fiebrandt M, Denis B, Stapelmann K, Awakowicz P, Reitz G, Moeller R. “The devil is in the detail” - understanding bacterial spore resistance towards plasma sterilization. 14th Conference of the European Astrobiology Network Association (EANA), 13-16 October 2014 Moeller R, Raguse M, Fujimori A, Okayasu R, Reitz G. Bacterial spore resistance to galactic cosmic radiation: what do we really know and what needs to be done? 15th Conference of the European Astrobiology Network Association (EANA), 6-9 October 2015, Maastricht, NL.

Meeßen J, Brandt A, Backhaus T, Ott S, Jänicke R, de la Torre R, de Vera JP, Raguse M, Okayasu R, Moeller R. The effect of ionizing radiation on two astrobiological models: the lichen Xanthoria elegans and the isolated photobiont of Circinaria gyrosa. 15th Conference of the European Astrobiology Network Association (EANA), 6-9 October 2015, Maastricht, NL.

Stapelmann K, Fiebrandt M, Raguse M, Denis B, Lackmann JW, Moeller R, Awakowicz P. Low-pressure plasma sterilization: from basic research to production, Gaseous Electronics Meeting 14-17 February 2016, Geelong, Victoria, Australia.

Fiebrandt M, Raguse M, Lackmann JW, Moeller R, Awakowicz P, Stapelmann K. Low- pressure plasma sterilization: inactivation mechanisms on a macromolecular level, 43rd Conference on Plasma Physics, 4-7 Juli 2016, Leuven, Belgium.

3.2. Conference Posters Raguse M, Fiebrandt M, Denis B, Stapelmann K, Awakocwicz P, Eichenberger P, Eaton P, Reitz G, Moeller R (2015) Plasma sterilization as an innovative tool for the next generation of

219 planetary protection, 15th Conference of the European Astrobiology Network Association (EANA), 6-9 October 2015, Maastricht, NL. (Poster prize for best poster of the category)

Raguse M, Fiebrandt M, Denis B, Stapelmann K, Awakocwicz P, Eaton P, Reitz G, Moeller R (2015) Plasma sterilization as an innovative tool to inactivate bacterial endospores for improved surface decontamination, 67. Jahrestagung der Deutschen Gesellschaft für Hygiene und Mikrobiologie e.V., 27.-30. September 2015, Münster, D

Raguse M, Fiebrandt M, Denis B, Stapelmann K, Awakocwicz P, Eaton P, Reitz G, Moeller R (2015) Understanding bacterial spore resistance towards plasma sterilization, 6th Congress of European Microbiologists (FEMS), 7-11 Juni 2015, Maastricht, NL.

Raguse M, Fiebrandt M, Narberhaus F, Awakowicz P, Eichenberger P, Reitz G, and Moeller R. Introducing low pressure plasma sterilization for Bacillus subtilis spore inactivation. 6th European Spores Conference, 9-12 April 2014, Royal Holloway, London, UK.

Cerezo M, de la Torre Noetzel R, Raguse M, Moeller R. The Starlife project: Circinaria gyrosa, an astrobiological model exposed to heavy ion radiation. 40th COSPAR Scientific Assembly, 2-10 August 2014 Moscow, Russia.

Denis B, Bibinov N, Raguse M, Moeller R, Awakocwiz P. Etching of bacterial endospores of Bacillus subtilis in an Inductively Coupled Low Pressure Plasma. IEEE International Conference on Plasma Science (ICOPS), 16-21 June 2013, San Francisco, CA, USA.

3.3. Awards

Posterprize at the „15th European Workshop on Astrobioloy“ within the frame work of the EANA 2015 Konferenz, 6 – 9. Oktober2015, Noordwijk, NL

4. Miscellaneous Organizer of the Astrobiology Graduate Conference (AbGradCon) 2014, 27-31 July 2014, Troy, NY, USA. (Dept. of financial support)

Acquisition of DAAD-grant 570505γ1, Project “AFM imaging of spore surface structures” in cooperation with the University of Porto, Porto, Portugal (2 years funding for travelling).

Research stay at REQUIMTE (Liasion: Dr. Peter Eaton), University of Porto, Porto, Portugal (Visiting Scientist) (2014/2015)

220 Research stay at the International Space Radiation Laboratory (Liasion: Dr. Ryuichi Okayasu), National Institute of Radiological Sciences (NIRS), Chiba, Japan (Visiting Scientist) (2013 – ongoing)

Research stay at the Center for Genomics and Systems Biology (Head of Laboratory: Prof. Dr. Patrick Eichenberger), New York University, New York City, USA (Visiting Scientist) (July -August 2014)

Supervision of Bachelor Thesis of Ms. Vanessa Neumann, University of Applied Sciences Bonn-Rhein-Sieg, Bonn, Germany, Titel: “Characterisation of DNA Damage and Repair in Bacillus subtilis Spores after Treatment with Cold Technical Plasmas”, conducted at the German Aerospace Center, Dept. Radiation Biology, Cologne, Germany (01.03.-31.05.2014)

221 5. Curriculum vitae

Personal information

Name Marina Claudia Raguse Birthdate 18.04.1988 Birthplace KönigsWusterhausen Nationality German

Education

Since 2012 PhD candidate at the Chair for Microbial Biology, Ruhr University Bochum, Bochum; performed at the German Aerospace Center, Institute for Aerospace Medicine, Dept. Radiation Biology, RS Astrobiology/Space Microbiology, Cologne, Germany.

2010 – 2012 Studies in Microbiological Sciences at the Friedrich-Schiller University of Jena, Germany Degree: Master of Science Thesis: „Identification of complement regulator binding sites and functional domains of Lipoamide dehydrogenase (Lpd) of Pseudomonas aeruginosa”

2009 – 2010 Studies in Biomedical Sciences at the Robert Gordon University, Aberdeen, Scotland, UK (exchange year) Degree: Bachelor of Honours in Biological and Biomedical Science (Double-Degree) Thesis: “The antimicrobial properties of Chinese green tea”

2007 – 2010 Studies of Applied Biology at the University of Applied Sciences Bonn- Rhein-Sieg, Rheinbach, Germany Degree: Bachelor of Science (Double Degree)

2000 – 2007 Pädadogium Godesberg Otto-Kühne Schule, Bonn, Germany

1998 – 2000 Gymnasium Bonn-Tannenbusch, Bonn, Germany

1994 – 1998 Carl-Schurz-Grundschule, Bonn, Germany

222 Professional experience

2013 – now International Space Radiation Laboratory (Liasion: Dr. Ryuichi Okayasu), National Institute of Radiological Sciences (NIRS), Chiba, Japan (Visiting Scientist)

2014/2015 Research stay at REQUIMTE (Liasion: Dr. Peter Eaton), University of Porto, Porto, Portugal (Visiting Scientist)

2014 2 month research stay at the Center for Genomics and Systems Biology (Head of Laboratory: Prof. Dr. Patrick Eichenberger), New York University, New York City, USA (Visiting Scientist)

2013 REQUIMTE Atomic Force Microscopy Workshop 2013, University of Porto, Portugal

2011-2012 Leibniz Institute for Natural Product Research and Infection Biology e.V. Hans-Knöll-Institute, Department of Infection Biology, Jena, Germany (Master student)

2007/2010 Internships at the Center of Advanced European Studies and Research (CAESAR), Department of Molecular Sensory Systems, Bonn, Germany (student assistant)

223 6. Contribution of the Integrated Publications and Manuscripts

P = Planning/Design, E = Experimental procedure, M = Writing of manuscript

Chapter B Stapelmann K, Fiebrandt M, Raguse M, Awakowicz, Reitz G, Moeller R. 2013. Utilization of low-pressure plasma to inactivate bacterial spores on stainless steel screws. Astrobiology 13:597-606. P: 10 %, E: 10 %, M: 20 %

Chapter C Moeller R, Raguse M, Reitz G, Okayasu R, Li Z, Klein S, Setlow P, Nicholson WL. 2014. Resistance of Bacillus subtilis spore DNA to lethal ionizing radiation damage relies primarily on spore core components and DNA repair, with minor effects of oxygen radical detoxification. Appl Environ Microbiol 80:104-109. P: 20 %, E: 50 %, M: 10 %

Chapter D Raguse M, Fiebrandt M, Stapelmann K, Madela K, Laue M, Lackmann JW, Thwaite JE, Setlow P, Awakowicz P, Moeller R. 2016a. Improvement of biological indicators by uniformly distributing of Bacillus subtilis monolayers to evaluate enhanced spore decontamination technologies. Appl Environ Microbiol 82:2031-2038. P: 75 %, E: 75 %, M: 75 %

Chapter E Raguse M, Fiebrandt M, Denis B, Stapelmann K, Eichenberger P, Driks A, Eaton P, Awakowicz, Moeller R. 2016b. Understanding of the importance of the spore coat structure and pigmentation in the Bacillus subtilis spore resistance to low pressure plasma sterilization. (under revision) P: 50 %, E: 75 %, M: 50 %

224 Chapter F Raguse M, Eichenberger P, Alonso J, Moeller R. 2016c. DNA double-strand breaks commit outgrown Bacillus subtilis haploid spore to non-homologous end joining. (in preparation) P: 50 %, E: 75 %, M: 50 %

Chapter G de Ory A, Nagler K, Carrasco B, Raguse M, Zafra O, Moeller R, de Vega M. 2016. Identification of a conserved 5’-dRP lyase activity in bacterial DNA repair ligase D and its potential role in base excision repair. Nucleic Acids Res 44:1833-1844. P: 20 %, E: 20 %, M: 20 %

Chapter H Raguse M, Fiebrandt M, Douki T, Commichau F, Setlow P, Moeller R. 2016d. Role of DNA repair in Bacillus subtilis spore resistance towards low pressure plasma sterilization. (in preparation) P: 50 %, E: 75 %, M: 75 %

225 7. Selbstständigkeitserklärung

Hiermit erkläre ich, dass ich die Arbeit selbstständig verfasst und bei keiner anderen Fakultät eingereicht und dass ich keine anderen als die angegebenen Hilfsmittel verwendet habe. Es handelt sich bei der heute von mir eingereichten Dissertation um sechs in Wort und Bild völlig übereinstimmende Exemplare. Weiterhin erkläre ich, dass digitale Abbildungen nur die originalen Daten enthalten und in keinem Fall inhaltsverändernde Bildbearbeitung vorgenommen wurde.

Bochum, den 15.04.2016

(Unterschrift)

226