PIN1 Maintains Redox Balance Via the C-Myc/NRF2 Axis to Counteract Kras-Induced Mitochondrial Respiratory Injury in Pancreatic C

Published OnlineFirst October 24, 2018; DOI: 10.1158/0008-5472.CAN-18-1968

Cancer Molecular Cell Biology Research

PIN1 Maintains Redox Balance via the c-Myc/NRF2 Axis to Counteract Kras-Induced Mitochondrial Respiratory Injury in Pancreatic Cancer Cells Chen Liang1,2,3,4, Si Shi1,2,3,4, Mingyang Liu5, Yi Qin1,2,3,4, Qingcai Meng1,2,3,4, Jie Hua1,2,3,4, Shunrong Ji1,2,3,4, Yuqing Zhang5, Jingxuan Yang5, Jin Xu1,2,3,4, Quanxing Ni1,2,3,4, Min Li5, and Xianjun Yu1,2,3,4

Abstract

Kras is a decisive oncogene in pancreatic ductal adeno- redox balance via synergistic activation of c-Myc and NRF2 carcinoma (PDAC). PIN1 is a key effector involved in the to upregulate expression of antioxidant response element Kras/ERK axis, synergistically mediating various cellular driven genes in PDAC cells. This study elucidates a new events. However, the underlying mechanism by which PIN1 mechanism by which Kras/ERK/NRF2 promotes tumor promotes the development of PDAC remains unclear. Here growth and identifies PIN1 as a decisive target in therapeutic we sought to elucidate the effect of PIN1 on redox homeo- strategies aimed at disturbing the redox balance in pancre- stasis in Kras-driven PDAC. PIN1 was prevalently upregu- atic cancer. lated in PDAC and predicted the prognosis of the disease, especially Kras-mutant PDAC. Downregulation of PIN1 Significance: This study suggests that antioxidation pro- inhibited PDAC cell growth and promoted apoptosis, par- tects Kras-mutant pancreatic cancer cells from oxidative tially due to mitochondrial dysfunction. Silencing of PIN1 injury, which may contribute to development of a targeted damaged basal mitochondrial function by significantly therapeutic strategy for Kras-driven PDAC by impairing increasing intracellular ROS. Furthermore, PIN1 maintained redox homeostasis.

Introduction oncogene, which would contribute to the development of an alternative therapy for refractory pancreatic cancer. Pancreatic cancer is one of the most lethal malignancies, Oncogenic Kras drives downstream activation of the ERK with an overall 5-year survival rate of less than 8% (1). signaling pathway, which promotes proliferation, metabolic Pancreatic ductal adenocarcinoma (PDAC) is the major reprogramming and metastasis, and prevents from apoptosis histologic type, accounting for >95% of human pancreatic (4–7). Accumulated evidence has demonstrated that neoplasms (2). Notably, oncogenic Kras mutations occur metabolic reprogramming is an emerging hallmark of can- early in PDAC carcinogenesis and are observed in more cer (8). Our previous findings indicated that ERK kinase than 90% of PDAC cases (3). Hence, there is an urgent modulates F-box and WD repeat domain-containing 7 need to explore the underlying mechanism and downstream (FBW7) ubiquitination in a T205 phosphorylation-dependent effectors of the constitutive activation of the Kras proto- manner, and FBW7 is a negative regulator of mitochondrial respiration in pancreatic cancer cells, thereby revealing an important function of Kras/ERK/FBW7 axis in promoting 1Department of Pancreatic Surgery, Fudan University Shanghai Cancer Center, PDAC progression (7, 9). However, the mechanism underly- Shanghai, China. 2Department of Oncology, Shanghai Medical College, Fudan ing the impact of ERK/FBW7 on mitochondrial metabolism University, Shanghai, China. 3Shanghai Pancreatic Cancer Institute, Shanghai, remains unclear. China. 4Pancreatic Cancer Institute, Fudan University, Shanghai, China. 5Depart- Protein interacting with never in mitosis A1 (PIN1) is a member ment of Medicine, Department of Surgery, the University of Oklahoma Health of the parvulin subfamily of peptidyl prolyl cis/trans isomerases Sciences Center, Oklahoma City, Oklahoma. (PPIases; ref. 10), which specifically isomerize the Ser/Thr-Pro Note: Supplementary data for this article are available at Cancer Research peptide bonds of proteins after phosphorylation to regulate their Online (http://cancerres.aacrjournals.org/). conformational changes with high efficiency (11, 12). The PIN1- C. Liang, S. Shi, M. Liu, and Y. Qin contributed equally to this article. mediated isomerization alters the structures and activities of these Corresponding Authors: Min Li, The University of Oklahoma Health Sciences proteins; PIN1 is thereby involved in diverse physiologic and Center, 975 NE 10th Street, BRC 1262A, Oklahoma City, OK 73104. Phone: 405- pathologic processes (13). Proline-directed phosphorylation is a 271-1796; Fax: 405-271-1476; E-mail: [email protected]; and Xianjun Yu, Pan- posttranslational modification that is instrumental in regulating creatic Cancer Institute, Fudan University, 270 DongAn Road, Shanghai 200032, signaling from the plasma membrane to the nucleus, the dysre- P.R. China. Phone: 86-021-64175590, ext. 1307; Fax: 86-021-64031446; E-mail: gulation of which contributes to cancer development (14). ERK [email protected] is a proline-directed protein kinase, and proline exhibits two doi: 10.1158/0008-5472.CAN-18-1968 conformations, cis and trans (12, 15). PIN1 catalyzes the isomer- 2018 American Association for Cancer Research. ization of ERK-phosphorylating substrates to activate them,

www.aacrjournals.org 133

Liang et al.

synergistically mediating various cellular consequences (16–18). assessed for quality and quantity using absorption measurements. Because we previously demonstrated that ERK kinase modulates The expression of candidate genes and b-actin was determined by FBW7 phosphorylation in a PIN1-dependent manner (7), we quantitative real-time PCR, according to the standard procedures examined the effect of PIN1 on cancer metabolism. described previously (9). RNA was used for analysis of Human Nuclear factor E2-related factor 2 (NRF2) is a leucine zipper Oxidative Stress using pathway-focused RT-PCR array systems transcription factor and plays an important role in the mainte- (The Human Oxidative Stress RT2 Profiler PCR Array; PAHS- nance of redox homeostasis. When subjected to oxidative stress, 065ZA; Qiagen). Comparative data analysis was performed via NRF2 is stabilized, accumulated, and translocates to the nucleus, the DDCt method using the PCR Array Data analysis web portal where it binds to a specific DNA sequence, referred to as the (http://gncpro.sabiosciences.com/gncpro/gncpro.php) to deter- antioxidant response element (ARE), and induces the expression mine relative expression differences between the comparison of a cohort of cytoprotective enzyme genes (19, 20). NRF2 and the groups. All reactions were run in triplicate, and primer sequences ARE-driven genes it controls are frequently upregulated in PDAC are listed in Supplementary Table S2. and correlate with poor survival. Upregulation of NRF2 is, at least in part, Kras-driven and contributes to proliferation and chemore- Oxygen consumption rate analysis sistance in PDAC (21, 22). Cellular mitochondrial function was determined using the Here, we show that PIN1 is prevalently upregulated in pancre- Seahorse XF Cell Mito stress test kit per the manufacturer's atic cancer and predicts prognosis. Given the oncogenic effect of instructions, as described previously (9). Briefly, cells were seeded PIN1 on pancreatic tumorigenesis, we demonstrate that PIN1 into 96-well plates and incubated overnight. After washing the protects the basal mitochondrial function from Kras/ERK- cells with Seahorse buffer, 175 mL of Seahorse buffer plus 25 mL induced oxidative injury and maintains the redox balance in each of 1 mmol/L oligomycin, 1 mmol/L FCCP [carbonyl cyanide- PDAC by increasing the expression of ARE-driven genes. Our 4-(trifluoromethoxy)phenylhydrazone], and 1 mmol/L rotenone fi study identi es PIN1 as a decisive regulator of redox homeostasis was automatically injected to measure the OCR. The OCR values for cell survival via cooperation with the c-Myc/NRF2/ARE axis, were calculated after normalization to the cell number and are thereby highlighting PIN1 as an important target for the treatment plotted as the mean SD. of Kras-driven pancreatic cancer. Reactive oxygen species evaluation Materials and Methods One hour before the end of the experimental time, cells were Human tissues and cell culture incubated with 50 mmol/L 20,70-dichlorodihydrofluorescein The clinical tissue samples used in this study were obtained diacetate (H2DCF-DA) within a Reactive Oxygen Species Assay from patients who were diagnosed at Fudan University Shanghai Kit (Beyotime) at 37C. Cells were then washed, resuspended in Cancer Center in the year of 2012. Written informed consent was ice-cold PBS, and collected. The fluorescence intensities of DCF, obtained from the patients and the studies were approved by the formed by the reaction of DCF with ROS, were monitored with Institutional Research Ethics Committee of Fudan University an excitation wavelength at 488 nm and emission wavelength Shanghai Cancer Center. The clinical information for the samples at 530 nm. is presented in Supplementary Table S1. The pathologic grading was performed by two independent pathologists at our center. Analysis of the intracellular reduced glutathione/oxidized þ The PANC-1, MiaPaCa-2, CFPAC-1, Capan-1, and SW1990 glutathione ratio and NADP /NADPH ratio human pancreatic cancer cell lines were purchased from ATCC The intracellular glutathione/oxidized glutathione (GSH/ fi in 2012 and were cultured at 37 C in a humidi ed incubator with GSSG) ratio was determined using Abcam's GSH/GSSG Ratio þ 5% CO2. The cell lines were authenticated by short tandem repeat Detection Assay Kit. The NADP /NADPH ratio was determined fi Mycoplasma þ pro ling in 2016 and were tested for contamination using Abcam NADP /NADPH Assay Kit. The assays were per- with PCR-based method every 3 months. Cells used for the formed to examine the oxidative status of the pancreatic cancer experimental study were passaged within 10 to 15 passages after cells, according to the manufacturer's instructions. reviving from the frozen vials.

Plasmids Chromatin immunoprecipitation assay pLKO.1 TRC cloning vector (Addgene plasmid 10878) was used Chromatin immunoprecipitation (ChIP) was performed to generate shRNA constructs against PIN1 and c-Myc. 21 bp targets according to the instructions of the Magna ChIP A/G Chro- against PIN1 were GCCATTTGAAGACGCCTCGTT and AGGA- matin Immunoprecipitation Kit (Merck Millipore Corporation; GAAGATCACCCGGACCA, respectively. 21-bp targets against ref. 23). The nuclear DNA extracts were ampliﬁed using a pair c-Myc were CCTGAGACAGATCAGCAACAA and CAGTTGAAACA- of primers (Supplementary Table S3) that spanned the NRF2 or CAAACTTGAA, respectively. pCMV-C-FLAG vector obtained from HMOX1 promoter region. As a negative control, the primary the manufacturer was used to generate the PIN1(W34/K63A) antibody was omitted or replaced with normal rabbit or mouse dominant negative mutant, designated as PIN1MUT, to examine serum. To verify whether PIN1 and c-Myc or NRF2 simulta- the interaction with c-Myc. To generate PIN1WT and PIN1MUT neously occupy the same region on the NRF2 or HMOX1 stably overexpressing cells, HA-tagged PIN1WT and PIN1MUT were promoter, the re-ChIP assay was performed. In brief, after the cloned into a pCDH-CMV-MCS-EF1 vector (System Biosciences). standard ChIP process, the beads were incubated with equal volumes of 10 mmol/L DTT for 30 minutes at 37Ctoelutethe qPCR analysis chromatin from the beads. The eluent was then diluted with Total RNA was extracted with TRIzol reagent (Invitrogen), sonication buffer, followed by a second round of the ChIP puriﬁed using the PureLink RNA Minikit (Life Technologies), and reaction.

134 Cancer Res; 79(1) January 1, 2019 Cancer Research

Antioxidative Role of PIN1 in PDAC

Animal models PIN1 supports the growth of pancreatic cancer in vitro and BALB/c-nu mice (4–6 weeks of age, 18–20 g, Shanghai SLAC in vivo Laboratory Animal Co., Ltd.) were housed in sterile, filter-capped Considering the vital clinical significance of PIN1 in PDAC, we cages. The right flanks of mice were injected subcutaneously with investigated whether PIN1 affected the tumor growth in vitro. First, 2 106 SW1990 cells with stably expressing sh-PIN1 and scram- we determined the expression level of PIN1 in various human ble shRNA in 100 mL PBS. The size of xenograft was determined PDAC cell lines with Kras mutations and in normal human twice a week by measuring tumor length and width with calipers. pancreatic ductal epithelial (HPDE) cells. The PIN1 levels were Tumor volumes were determined using the formula volume ¼ prevalently upregulated in five human pancreatic cancer cell lines length width2/2. At the indicated time, the tumors were surgi- especially the Kras-mutant cell lines (Fig. 1F; Supplementary Table cally dissected. Samples were then processed for histopathologic S6), compared with HPDE cells (Fig. 1F). Next, specific shRNAs examination. All animal experiments were performed according against PIN1 were constructed for stable transfection into Capan-1 to the guidelines for the care and use of laboratory animals and and SW1990 cells. As shown in Supplementary Fig. S1A, both sh- were approved by the Institutional Animal Care and Use Com- PIN1-A and sh-PIN1-B effectively knocked down PIN1 expression. mittee of Fudan University. The cell viability and clone formation capacity were significantly reduced in Capan-1 and SW1990 cells with stable expression of Statistical analysis PIN1 shRNA (Fig. 1G; Supplementary Fig. S1B). A subsequent All data are presented as the mean SD. Experiments were cell-cycle analysis indicated that knockdown of PIN1 arrested the repeated at least three times. Two-tailed unpaired Student t tests or cell cycle at the S-phase (Supplementary Fig. S1C and S1D). one-way ANOVA were used to evaluate the data. Spearman corre- Moreover, knockdown of PIN1 decreased the survivin expression lation analysis was used to determine the correlation between the (Supplementary Fig. S1E). Given that high cancer cell prolifera- NRF2 and PIN1 expression levels. Fisher exact test was used to tion requires sufficient energy, we also demonstrated that PIN1 determine the correlation between PIN1 and the clinicopathologic significantly increased ATP production to support the growth of characteristics. SPSS software (version 17.0, IBM Corp.) was used cancer cells (Supplementary Fig. S1F). Moreover, to determine for the data analysis. Statistical differences were considered signif- whether PIN1 promoted tumor growth in vivo, we subcutaneously icant at , P < 0.05; , P < 0.01, and , P < 0.001. injected SW1990 cells into nude mice. As expected, the downregulation of PIN1 inhibited tumor growth in a xenograft mouse model (Fig. 1H and I; Supplementary Fig. S1G), which exhibited Results fewer Ki-67-positive and survivin-positive cells (Fig. 1J and K). PIN1 is prevalently upregulated and predicts poor prognosis in PDAC Downregulation of PIN1 negatively regulated mitochondrial To investigate the role of PIN1 in PDAC progression, we first respiration in pancreatic cancer cells used hematoxylin-eosin and IHC staining to examine PIN1 Because energy metabolism reprogramming is associated with expression in 10 paired PDAC and adjacent normal tissues (Fig. mitochondrial function, we first examined the OCR, an indicator 1A). PIN1 was highly upregulated in primary PDAC compared of the mitochondrial respiration capacity, and showed that the with the corresponding adjacent benign tissues (Fig. 1A). The OCRs were decreased in Capan-1 and SW1990 cells with PIN1 prevalent upregulation of PIN1 expression was revealed by IHC knockdown (Fig. 2A). Interestingly, the addition of FCCP, a staining of a tissue microarray of the PDAC samples (Fig. 1B and mitochondrial uncoupler, did not stimulate maximal respiration. C). Seventy-one (64.54%) of the 110 PDAC samples showed Instead, FCCP caused respiration to fall below basal levels, abundant PIN1, while the remaining 39 samples (35.46%) had indicating that the uncoupled maximal respiratory capacity for low PIN1 expression (Fig. 1C). ATP synthesis was depressed (Fig. 2A). Measurement of the Next, the analysis of the clinical characteristics and pathology of mitochondrial potential further demonstrated that downregula- the PDAC revealed that higher expression of PIN1 in PDAC was tion of PIN1 damaged mitochondrial function, with decreased significantly associated with tumor size (P ¼ 0.0249; Supplemen- mitochondrial potential in Capan-1 and SW1990 cells (Fig. 2B). tary Table S1). To determine whether the predictive effect of PIN1 Because the mitochondrial potential was also an indicator of early on survival depended on the Kras mutation, we examined 70 apoptosis, we examined the role of PIN1 in apoptosis control. patients with PDAC to perform Kras mutation testing. We found Flow cytometric analysis for apoptosis showed that PIN1 was an that 80% of the patients harbored the mutant Kras (Supplemen- antiapoptosis molecule; inhibition of PIN1 expression increased tary Table S4), and we further stratified the cohort into Kras cell apoptosis, especially the percentage of early apoptotic cells wild-type (KrasWT) and Kras-mutant (KrasMUT) groups. Kaplan– (Fig. 2C). Moreover, we also found that knockdown of PIN1 Meier analysis revealed that PIN1 was a prognostic marker in Kras- decreased the expression of COX IV and SIRT3, two mitochondrial mutant PDAC, but not in KrasWT PDAC (Fig. 1D). However, there proteins (Supplementary Fig. S2). was no significant correlation between Kras-mutant status and To further confirm the importance of PIN1 in mitochondrial PIN1 level (Supplementary Table S4). Next, we performed IHC for function, we constructed a dominant negative mutant, PIN1MUT, ERK phosphorylation (p-ERK), and found that the effect of PIN1 without affecting FBW7 expression (Fig. 2D). Staining of PIN1MUT level on survival depended on ERK activation (Fig. 1E). Likewise, and PIN1 wild-type (PIN1WT) cells with MitoTracker Green, a IHC analysis revealed a significant correlation of ERK phosphor- membrane potential–based mitochondrial dye, revealed that the ylation levels with PIN1 expression in PDAC tissue (Supplemen- mitochondrial network in the PIN1WT cells clustered in the peri- tary Table S5). Moreover, as the univariate and multivariate Cox nuclear region, compared with the control cells. However, inacti- regression analysis showed, PIN1 was an independent prognostic vation of PIN1 could induce the appearance of aberrant dot-shaped factor in PDAC, where increased PIN1 expression was predictive mitochondria, a more interconnected mitochondrial network, and of a short overall survival rate for patients with PDAC (Table 1). a decreased perinuclear clustering (Fig. 2E). As the mitochondria

www.aacrjournals.org Cancer Res; 79(1) January 1, 2019 135

Liang et al.

Figure 1. PIN1 is upregulated in pancreatic cancer and predicts poor overall survival. A, Representative hematoxylin and eosin (H&E) and IHC images of PIN1 expression in PDAC or adjacent normal tissues (left; magnification scale bar, 100 mm). PIN1 expression was higher in PDAC tissues than in adjacent normal tissues, as determined by the IHC score (right). B, IHC scoring of PIN1 expression in PDAC patient tissue samples (magnification scale bar, 40 mm). C, The percentage of patients with PDAC with different levels of PIN1 examined by IHC. D, Stratification of the cohort according to Kras status showed no predictive effect of PIN1 on prognosis in patients with PDAC with Kras wild-type (KrasWT), but high PIN1 expression predicted the poor survival of patients with Kras mutant (KrasMUT). E, There was no predictive effect for PIN1 on prognosis of patients with PDAC with low levels of phosphorylated ERK (p-ERK), but high PIN1 expression predicted the poor survival of patients with high-level p-ERK. F, Immunoblot analysis of PIN1 expression in the indicated human pancreatic cancer cell lines and an HPDE cell line. G, Knockdown of PIN1 inhibited cell proliferation of Capan-1 and SW1990 cells, according to results from the CCK-8 proliferation kit. H, An image of the SW1990 xenografts that were dissected from nude mice. I, At the indicated times, the sizes ofthescrambleandsh-PIN1xenograftsweremeasured(mean SEM; n ¼ 6). J, IHC staining of survivin and Ki-67 in xenograft tissues to determine the cellular proliferative capacity. K, IHC staining of survivin and Ki-67 in xenograft tissues was quantified as mean SD. , P < 0.01 versus scramble for xenografts or xenografts treated with vehicle.

136 Cancer Res; 79(1) January 1, 2019 Cancer Research

Antioxidative Role of PIN1 in PDAC

Table 1. Univariate and multivariate Cox regression of overall survival for patients with PDAC Univariate Multivariate Characteristics HR 95% CI P HR 95% CI P Age, y <60 1 0.7070–1.616 0.09967 60 1.069 Gender Female 1 0.5807 –1.344 0.5649 Male 0.886 Tumor size (cm) <4.0 1 1.496 to 3.875 0.0004a 1 1.339–3.208 0.001b 4.0 2.081 2.073 Tumor differentiation Well/Moderate 1 0.9094–2.177 0.127 Poor 1.381 Lymph node status Negative 1 1.418–3.408 0.0005a 1 1.429–3.354 0.000a Positive 2.028 2.189 Vessel infiltration Negative 1 0.6387–2.026 0.6622 Positive 1.131 Nerve infiltration Negative 1 0.4284–1.261 0.2644 Positive 0.7553 PIN1 expression Low 1 1.382–3.13 0.0005a 1 1.325–3.294 0.002b High 2.125 2.089 NOTE: Univariate P values were derived with log-rank test. Multivariate P values were derived with Cox regression analysis. aP < 0.001. bP < 0.01. became depolarized, they lost their membrane potential and results indicated that ARE-driven genes were significantly down- incorporated less dye into their membranes. High intensity staining regulated in PIN1-silenced cells (Fig. 4A and B). AREs are in the was observed in PIN1WT cells, while the intensity of MitoTracker regulatory regions of several genes that encode for enzymes that Green was restored in the PIN1MUT cells, indicating repolarization contribute to the regulation of antioxidants (21). We cloned the of mitochondria (Fig. 2E). Furthermore, we used transmission ARE sequences into a luciferase vector and cotransfected it with a electron microscopy (TEM) to observe the ultrastructure of the PIN1 expression vector, showing that ARE activity was increased mitochondria in the PIN1WT and PIN1MUT cells. Consistent with in a dose-dependent manner (Fig. 4C). This finding was also the above results, the PIN1WT cells demonstrated interconnected confirmed in the Capan-1 and SW1990 cells. PIN1 increased the mitochondria, although the PIN1MUT cells contained rounded and activity of ARE (Fig. 4D) and further increased the mRNA and swollen mitochondria (Fig. 2F and G). To further quantify the protein levels of ARE-driven genes (GCLC, GCLM, TXNRD, ME1, mitochondrial number, we found that PIN1 was an important and NQO1; Fig. 4E; Supplementary Fig. S3A). positive regulator of mitochondrial biogenesis (Fig. 2H). Because NRF1 and NRF2 are the important transcription factors that are responsible for the expression of ARE-driven genes (24), PIN1 regulates redox balance to affect mitochondrial function we examined the influence of PIN1 on NRF1 and NRF2 expres- Because cellular redox homeostasis is important for mainte- sion. As shown in Fig. 4F, downregulation of NRF2 was observed nance of mitochondrial respiratory function (24), we further upon silencing PIN1 expression in pancreatic cancer cells, but no validated whether PIN1 was an antioxidative molecule that pro- change in the expression of NRF1 was observed (Supplementary tected basal mitochondrial respiration in Capan-1 and SW1990 Fig. S3B). Recently, the NRF2/ARE axis was identified as the pancreatic cancer cells. As expected, inhibition of PIN1 expression oxidative stress response pathway that contributes to pancreatic significantly increased ROS production (Fig. 3A). Moreover, carcinogenesis (25). We further confirmed NRF2 mRNA down- silencing of PIN1 expression decreased the GSH/GSSG ratio and regulation in cells with PIN1 knockdown by quantitative PCR þ increased the NADP /NADPH ratio (Fig. 3B and C). To investi- (Fig. 4G). An immunofluorescence analysis indicated that the gate whether this redox imbalance impaired mitochondrial func- NRF2 decrease was accompanied by PIN1 downregulation in tion, we treated the PIN1 knockdown cells with an antioxidant, Capan-1 and SW1990 cells (Fig. 4H). IHC staining of serial tissue NAC, to recover the redox status (Fig. 3D). The results indicated microarray for NRF2 and PIN1 indicated a positive correlation that the antioxidant treatment could counteract the unfavorable between PIN1 and NRF2 in 110 patient samples (Fig. 4I). More- effect of the PIN1 knockdown on mitochondrial function, as over, we demonstrated that PIN1 increased the promoter activity analyzed by OCR and JC-1 (Fig. 3E and F). Indeed, the increased of NRF2 to upregulate its transcription (Fig. 4J). apoptosis induced by PIN1 knockdown could also be counteracted by treatment with NAC (Fig. 3G). PIN1 interacts with c-Myc to bind to the promoter of NRF2 To uncover the regulatory mechanism, we predicted the proteins PIN1 transcriptionally activates NRF2 expression in PDAC that interacted with PIN1 using bioinformatics. Several transcrip- Next, we performed a PCR array to examine the influence of the tion factors are shown in Fig. 5A (http://mentha.uniroma2.it). PIN1 knockdown on the expression of antioxidative genes. The Notably, there was one conservative c-Myc–binding site (E-box)

www.aacrjournals.org Cancer Res; 79(1) January 1, 2019 137

Liang et al.

Figure 2. PIN1 maintains cell survival by protecting mitochondrial function. A, Knockdown of PIN1 decreased the OCR in Capan-1 and SW1990 cells. B, Mitochondrial potential was analyzed by detecting the JC-1 decrease in Capan-1 and SW1990 cells with the knockdown of PIN1. The decrease in mitochondrial potential was quantified as mean SD. , P < 0.01. C, Knockdown of PIN1 resulted in apoptosis of Capan-1 and SW1990 cells, which was quantified as the means the SD. , P < 0.01. D, Immunoblot analysis of FBW7 expression in Capan-1 and SW1990 cells infected with the dominant-negative mutant vector of PIN1 (PIN1MUT)to indicate the inactivation of PIN1. The wild-type PIN1 (PIN1WT) was used as a positive control. E, Fluorescence microscopic analysis of a PIN1MUT-induced deformed mitochondrion stained with MitoTracker Green. F, Transmission electron microscopy analysis of mitochondrial morphology affected by PIN1 in PANC-1 cells. G, Quantification of transmission electron microscopy data as the percentages of swollen mitochondria and interconnected mitochondria. H, Quantification of transmission electron microscopy data as the number of mitochondria per 20 mm2 (, P < 0.01 vs. control PANC-1 cells).

138 Cancer Res; 79(1) January 1, 2019 Cancer Research

Antioxidative Role of PIN1 in PDAC

Figure 3. PIN1 regulates redox balance to affect mitochondrial function in pancreatic cancer. A, Left, analysis of ROS production by flow cytometry in Capan-1 and SW1990 cells with knockdown of PIN1. Right, quantification of ROS production is shown as mean SD. , P < 0.01. B, Determination of the GSH/GSSG ratio in Capan-1 and SW1990 cells with knockdown of PIN1. , P < 0.05; , P < 0.01. C, Determination of the NADPþ/NADPH ratio in Capan-1 and SW1990 cells with knockdown of PIN1. , P < 0.05; , P < 0.01. D, Analysis of ROS production in Capan-1 and SW1990 cells with knockdown of PIN1 after treatment with antioxidant, NAC (10 mmol/L). E, Analysis of the OCR in Capan-1 and SW1990 cells with the knockdown of PIN1 after treatment with 10 mmol/L NAC. F, Detection of the mitochondrial potential in Capan-1 and SW1990 cells with the knockdown of PIN1 after treatment with NAC. G, Quantification of the mitochondrial potential in Capan-1 and SW1990 cells with the knockdown of PIN1 after treatment with 10 mmol/L NAC. in the NRF2 promoter (Fig. 5B). c-Myc could bind to the NRF2 precipitation assay (Fig. 5D). An immunofluorescence analysis promoter (Fig. 5C), and silencing of Myc inhibited NRF2 expres- showed that PIN1 and c-Myc were predominantly colocalized in sion (Supplementary Fig. S4A–S4C). Thus, we hypothesized that Capan-1 and SW1990 cells (Fig. 5E). Furthermore, PIN1 was c-Myc could carry PIN1 to bind to the NRF2 promoter. As demonstrated to be enriched at the NRF2 promoter region expected, c-Myc was a PIN1 interaction partner in a coimmuno- (Fig. 5F). To confirm whether PIN1 and c-Myc interacted at the

www.aacrjournals.org Cancer Res; 79(1) January 1, 2019 139

Liang et al.

Figure 4. PIN1 transcriptionally activates the NRF2 axis in pancreatic cancer cells. A, PCR array analysis of the effect of PIN1 downregulation on antioxidative gene expression. B, The volcano plot identified significant gene expression changes from the PCR array data, displaying statistical significance versus fold change on the y-andx-axes, respectively. C, PIN1 increased ARE luciferase activity in a dose-dependent manner in HEK-293T cells. , P < 0.001 versus cells cotransfected with Repo-NC and pCDH-PIN1. D, PIN1 increased ARE luciferase activity in Capan-1 and SW1990 cells. , P < 0.01. E, PIN1 affected the transcription of ARE-driven genes in Capan-1 and SW1990 cells. F, Immunoblot analysis of NRF1 and NRF2 expression in Capan-1 and SW1990 cells with silencing of PIN1 expression. G, Quantitative PCR was performed to confirm that NRF2 mRNA expression was downregulated by knockdown of PIN1. , P < 0.01. H, Immunofluorescence analysis of NRF2 in Capan-1 and SW1990 cells with silencing of PIN1 expression. I, Left, representative images of IHC analysis of NRF2 and PIN1 expression in PDAC patient samples (magnification scale bar, 40 mm).Right,SpearmananalysisofIHCdatashowedthatPIN1was positively associated with NRF2 (r ¼ 0.4259). J, PIN1 increased the promoter activity of NRF2. , P < 0.01.

140 Cancer Res; 79(1) January 1, 2019 Cancer Research

Antioxidative Role of PIN1 in PDAC

Figure 5. PIN1 interacts with c-Myc to bind the promoter of NRF2. A, Bioinformatics predicted the protein interacted with PIN1 protein. B, Schematic representation of the NRF2 promoter regions that contain one E-box, the conservative c-Myc–binding site. C, c-Myc enrichment at the NRF2 promoter was measured using a c-Myc antibody to perform the ChIP assay. D, Coimmunoprecipitation analysis of the interaction between PIN1 and c-Myc in pancreatic cancer cells. E, Double immunoﬂuorescent staining revealed colocalization of the c-Myc and PIN1 proteins in Capan-1 and SW19990 cells. F, PIN1 enrichment at the NRF2 promoter was measured using a PIN1 antibody to perform the ChIP assay. G, The ChIP and re-ChIP experiments indicated that PIN1 and c-Myc synergistically occupied the same promoter region on the NRF2 promoter. H, Downregulation of PIN1 decreased the abundance of c-Myc that occupied the NRF2 promoter. I, PIN1MUT-FLAG was transfected into HEK-293T cells, where it failed to interact with c-Myc. J, PIN1 was involved in the c-Myc-mediated upregulation of the promoter activity of NRF2. , P < 0.05; , P < 0.01 versus cells cotransfected with pGL3-NRF2 and c-Myc.

NRF2 promoter chromatin region, we performed a sequential re- Myc could decrease the PIN1-induced upregulation of NRF2 ChIP assay and observed that PIN1 and c-Myc occupied the same (Supplementary Fig. S4E and S4F). Furthermore, silenced Myc region at the NRF2 promoter (Fig. 5G). PIN1 knockdown also counteracted the PIN1-induced enhancement of prolifera- decreased the occupation of c-Myc on the NRF2 promoter (Fig. tion and survival in BxPC-3 cells (Supplementary Fig. S4G and 5H). However, the interaction between PIN1 and c-Myc disap- S4H). Moreover, silenced Myc recovered the mitochondrial peared when inactivation of PIN1 resulted from the dominant potential, OCR, and ROS production in BxPC-3 with PIN1 over- negative mutation (Fig. 5I). Luciferase reporter assays indicated expression (Supplementary Fig. S4I–S4K). that PIN1 not only increased the NRF2 promoter activity, but also enhanced the positive effect of c-Myc on the NRF2 promoter PIN1 promotes nuclear translocation of NRF2 to increase ARE activity (Fig. 5J). Moreover, IHC analysis of xenograft samples also activity demonstrated that PIN1 expression was positively correlated As the immunoﬂuorescence results show (Fig. 5H), silencing of with c-Myc and NRF2 expression (Supplementary Fig. S4D). PIN1 not only decreased the abundance of NRF2, but also likely Next, to investigate the effect of c-Myc on the PIN1-induced decreased NRF2 nuclear translocation in Capan-1 and SW1990 malignant potential, we silenced Myc in BxPC-3 cells, one wild- cells. Thus, we extracted both cytosolic and nuclear protein frac- type K-ras cell, with overexpressing PIN1, and found that silenced tions to examine the effect of PIN1 on the translocation of NRF2.

www.aacrjournals.org Cancer Res; 79(1) January 1, 2019 141

Liang et al.

As indicated, knockdown of PIN1 decreased the nuclear fraction As one of isomerases, PIN1 also catalyzes a conformational of NRF2 in the pancreatic cancer cells (Fig. 6A), while PIN1MUT modification of integrase to restrict HIV-1 genome integration had a slight effect on NRF2 translocation compared with PIN1WT (40). Moreover, PIN1 regulated the ATF1 expression at the (Fig. 6B). A similar result was obtained with immunofluorescence transcriptional and posttranscriptional level (41). Previous and IHC for NRF2 (Fig. 6C; Supplementary Fig. S5). Thus, we studies have shown that PIN1 catalyzes the isomerization of hypothesized that PIN1 might cooperate with NRF2 to enter the ERK-phosphorylating substrates to activate them and ERK kinase nucleus. To confirm this hypothesis, we performed coimmuno- modulates FBW7 phosphorylation in a PIN1-dependent manner precipitation assays to demonstrate the interaction between PIN1 (7). Because c-Myc was one of substrates for ubiquitination and and NRF2 (Fig. 6D) and an immunofluorescence analysis to show degradation of FBW7, the catalytic activity of PIN1 is so important that PIN1 was colocalized with NRF2 in Capan-1 and SW1990 for the accumulation of cytoplasmic c-Myc in pancreatic cancer cells (Fig. 6E). ChIP assays indicated that PIN1 was also enriched cells. Moreover, PIN1 was demonstrated to interact with c-Myc to in the ARE region (Fig. 6F). To investigate whether PIN1 interacted increase the NRF2 transcription and play a role in antioxidative with NRF2 to bind to the ARE chromatin region, we performed a stress. Because c-Myc is extremely important for determining the sequential re-ChIP assay and demonstrated that PIN1 and NRF2 redox balance in the Kras-driven PDAC (42), Kras-mutant cells occupied the same location on the ARE region of the HMOX1 not only induce oxidative stress, but also harbor a mechanism to promoter (Fig. 6G). Indeed, downregulation of PIN1 significantly prevent excessive ROS production. PIN1/c-Myc are involved in decreased the occupation of NRF2 on the HMOX1 promoter (Fig. this mechanism to maintain the basal level of intracellular ROS to 6H). The combination of a high level of PIN1 with a high level of support the growth and survival of cancer cells. NRF2 might be a good predictor of unfavorable prognosis in Accumulated evidence has demonstrated that PIN1 functions human patients with PDAC (Fig. 6I). as an oncogene by regulating numerous protein kinases and phosphatases, which are involved in cell metabolism, cell-cycle progression, cell proliferation, and apoptosis (14). Moreover, Discussion PIN1 overexpression is prevalent in many human cancers and Oncogenic Kras mutations are highly prevalent in PDAC associated with a poor prognosis (43–45). Previously, it was carcinogenesis (3). Constitutive activation of Kras drives reported that PIN1-mediated polyubiquitination of FBW7 when uncontrolled proliferation and enhances the survival of cancer T205 was phosphorylated by activation of the Ras/ERK signaling cells, primarily through the Ras–Raf–MEK–ERK and PI3K–Akt– pathway (7, 46). FBW7 has been demonstrated to bind NRF1 and mTOR pathways (26–33). In the past few decades, extensive promote proteasome degradation of NRF1 (47). Furthermore, efforts have been focused on identifying effective molecular our previous study indicated that the FBW7/c-Myc/TXNIP axis targets for this oncogene (34). However, these efforts have negatively regulated mitochondrial respiration in PDAC, espe- failed, and Kras is still considered to be an undruggable target. cially maximal respiration (9). Moreover, TXNIP plays an impor- Herein, we identify PIN1 as a decisive gene and a prognostic tant role in redox homeostasis that increases the production of factor for Kras-mutant PDAC. Downregulation of PIN1 inhibits ROS, resulting in cellular apoptosis (48). Thus, we hypothesized cell growth and promotes apoptosis of pancreatic cancer cells, that PIN1 could be involved in oxidative injury and mitochon- partially due to mitochondrial dysfunction. To decipher the drial bioenergetics. Indeed, our results indicated that knockdown regulatory mechanism underlying the effect of PIN1 on mito- of PIN1 could increase the ROS level and inhibit mitochondrial chondrial function, we demonstrated that PIN1 maintained the respiration in pancreatic cancer cells. It is well known that most redox balance via synergistic activation of the c-Myc/NRF2/ARE oncogenes suppress mitochondrial metabolism to support gly- axis to counteract Kras-induced oxidative injury in Kras-mutant colysis. In our results, however, PIN1 was an exception. It bal- PDAC (Fig. 6J). anced redox potential and counteracted Kras-induced oxidative It is evident that cancer cells require a sufficient energy supply to stress, which played a key role in mitochondrial protection from fuel Kras-induced proliferation. Thus, Kras-induced metabolic oxidative injury. Thus, we assumed that PIN1 was decisive for the reprogramming is a requirement for uncontrolled proliferation basal mitochondrial respiration and cell survival of Kras-mutant and malignant property maintenance (5, 30, 35). In addition to pancreatic cancer cells. ATP, Oronsky and colleagues noted the requirement of NADPH Under homeostatic conditions, NRF2 affects the mitochondrial for the survival of cancer cells, which made it possible to develop membrane potential, fatty acid oxidation, and availability of strategies for targeting cancer that involved disrupting the redox substrates for respiration. Under conditions of stress stimulation, balance (36). Notably, Kras does not affect the activity of the activation of NRF2 predominantly regulates the antioxidant pro- oxidative arm of the pentose phosphate pathway, which provides gram that tightly controls the levels of ROS (24, 49, 50). Moreover, NADPH for ROS detoxification (33). Thus, detoxification is enhanced ROS detoxification and additional NRF2 functions heavily dependent on Kras-driven glutamine metabolism (32, might be protumorigenic (51). Emerging evidence has demon- 37). In the context of PDAC, Kras expression directs the metab- strated that Kras, B-Raf, and c-Myc each increase the transcription olism of glutamine through a unique pathway to maintain the of NRF2 to elevate the antioxidant program and thereby lower redox state (32, 38). The normal functions of mitochondria are intracellular ROS and confer a further reduced intracellular envi- required for glutamine-driven detoxification (39). A previous ronment (25, 51). However, it is unclear how NRF2 is activated by report indicated that Kras leads to mitochondrial dysfunction, the Ras/ERK axis. We also demonstrated that the c-Myc axis which is accompanied by an increase in ROS production (30). increased NRF2 transcription. Importantly, PIN1 interacted with Paradoxically, despite Kras-induced changes in mitochondrial c-Myc/NRF2, leading to upregulation of the expression of ARE- function, no significant cell death was detected (30). Thus, we driven genes. Moreover, a report indicated that NRF2 influenced hypothesized Kras-driven PDAC cells had a protective mechanism mitochondrial biogenesis (24). Thus, PIN1 protected mitochon- from "respiratory injury" to regulate the redox balance. drial function partially by affecting NRF2 expression to maintain

142 Cancer Res; 79(1) January 1, 2019 Cancer Research

Antioxidative Role of PIN1 in PDAC

Figure 6. PIN1 promotes the nuclear translocation of NRF2 to increase the ARE activity. A and B, The nuclear and cytoplasmic fraction was extracted to examine the effect of PIN1 on the translocation of NRF2. C, Immunofluorescence analysis indicated that nuclear translocation of NRF2 was decreased in Capan-1 and SW1990 cells transfected with the PIN1MUT vector. D, Coimmunoprecipitation analysis of the interaction between PIN1 and NRF2 in pancreatic cancer cells. E, Double immunofluorescent staining revealed colocalization of the NRF2 and PIN1 proteins in Capan-1 and SW19990 cells. F and G, ChIP and re-ChIP experiments indicated that PIN1 and NRF2 synergistically occupied the same region on the promoter of HMOX1. H, Downregulation of PIN1 decreased the occupation by NRF2 on the promoter of HMOX1. I, Kaplan–Meier survival curve of patients with PDAC tissues with PIN1HighNRF2High (n ¼ 64) and PIN1LowNRF2Low (n ¼ 16) expression profiles. J, A working model illustrates the role of PIN1 in redox homeostasis in Kras-mutant pancreatic cancer cells.

www.aacrjournals.org Cancer Res; 79(1) January 1, 2019 143

Liang et al.

redox homeostasis. That PIN1 maintained a low level of Kras- Analysis and interpretation of data (e.g., statistical analysis, biostatistics, induced ROS by ERK/c-Myc/NRF2 axis to avoid apoptosis and computational analysis): C. Liang, M. Liu, Q. Meng, S. Ji, Y. Zhang, M. Li support basal mitochondrial respiration is to decipher the para- Writing, review, and/or revision of the manuscript: C. Liang, S. Shi, M. Liu, fl Y. Zhang, J. Yang, J. Xu, M. Li, X. Yu dox of Kras-in uencing ROS and mitochondrial function. Administrative, technical, or material support (i.e., reporting or organizing Taken together, our findings elucidated a novel regulatory data, constructing databases): S. Shi, M. Liu, Y. Qin, J. Hua, S. Ji, M. Li function for PIN1 through activation of the NRF2-mediated Study supervision: M. Liu, Q. Ni, M. Li, X. Yu antioxidant program and the importance of PIN1 for the survival of Kras-mutant pancreatic cancer cells. Moreover, genetic targeting of PIN1 impairs Kras-directed proliferation and tumorigenesis. Acknowledgments Thus, the PIN1 antioxidant and cellular detoxification program This study was jointly funded by the National Science Fund for Distinguished represents a previously unappreciated mediator of oncogenesis, Young Scholars of China (grant no. 81625016 to X. Yu), the National Natural and the development of its inhibitor is expected to provide a Science Foundation of China (grant nos. 81502031 to Y Qin; 81602085 to S. Ji; fi and 81772555 to J. Xu), and Shanghai Sailing Program (grant no. 16YF1401800 therapeutic bene t for pancreatic cancer. to S. Ji; 17YF1402500 to S. Shi). Moreover, we are grateful to Prof. Qunying Lei (Fudan University) for valuable discussions. Disclosure of Potential Conflicts of Interest No potential conflicts of interest were disclosed. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked Authors' Contributions advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate Conception and design: C. Liang, S. Shi, M. Liu, Y. Qin, Y. Zhang, M. Li, X. Yu this fact. Development of methodology: Y. Qin, Q. Meng, J. Xu, M. Li Acquisition of data (provided animals, acquired and managed patients, Received August 1, 2018; revised September 21, 2018; accepted October 19, provided facilities, etc.): C. Liang, J. Hua 2018; published first October 24, 2018.

References 1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin 17. Dougherty MK, Muller J, Ritt DA, Zhou M, Zhou XZ, Copeland TD, et al. 2018;68:7–30. Regulation of Raf-1 by direct feedback phosphorylation. Mol Cell 2005;17: 2. Wolfgang CL, Herman JM, Laheru DA, Klein AP, Erdek MA, Fishman EK, 215–24. et al. Recent progress in pancreatic cancer. CA Cancer J Clin 2013;63: 18. Shen ZJ, Esnault S, Schinzel A, Borner C, Malter JS. The peptidyl-prolyl 318–48. isomerase Pin1 facilitates cytokine-induced survival of eosinophils by 3. Hruban RH, Adsay NV, Albores-Saavedra J, Anver MR, Biankin AV, Boivin suppressing Bax activation. Nat Immunol 2009;10:257–65. GP, et al. Pathology of genetically engineered mouse models of pancreatic 19. Shukla K, Sonowal H, Saxena A, Ramana KV, Srivastava SK. Aldose exocrine cancer: consensus report and recommendations. Cancer Res reductase inhibitor, ﬁdarestat regulates mitochondrial biogenesis via 2006;66:95–106. Nrf2/HO-1/AMPK pathway in colon cancer cells. Cancer Lett 2017;411: 4. Liu M, Yang J, Zhang Y, Zhou Z, Cui X, Zhang L, et al. ZIP4 promotes 57–63. pancreatic cancer progression by repressing ZO-1 and Claudin-1 through a 20. Cha HY, Lee BS, Chang JW, Park JK, Han JH, Kim YS, et al. Downregulation ZEB1-dependent transcriptional mechanism. Clin Cancer Res 2018;24: of Nrf2 by the combination of TRAIL and Valproic acid induces apoptotic 3186–96. cell death of TRAIL-resistant papillary thyroid cancer cells via suppression 5. Bryant KL, Mancias JD, Kimmelman AC, Der CJ. KRAS: feeding pancreatic of Bcl-xL. Cancer Lett 2016;372:65–74. cancer proliferation. Trends Biochem Sci 2014;39:91–100. 21. Hayes AJ, Skouras C, Haugk B, Charnley RM. Keap1-Nrf2 signalling in 6. Liang C, Qin Y, Zhang B, Ji S, Shi S, Xu W, et al. ARF6, induced by mutant pancreatic cancer. Int J Biochem Cell Biol 2015;65:288–99. Kras, promotes proliferation and Warburg effect in pancreatic cancer. 22. Ji S, Zhang B, Liu J, Qin Y, Liang C, Shi S, et al. ALDOA functions as an Cancer Lett 2016;388:303–11. oncogene in the highly metastatic pancreatic cancer. Cancer Lett 2016;374: 7. Ji S, Qin Y, Shi S, Liu X, Hu H, Zhou H, et al. ERK kinase phosphorylates and 127–35. destabilizes the tumor suppressor FBW7 in pancreatic cancer. Cell Res 23. Hussong M, Borno ST, Kerick M, Wunderlich A, Franz A, Sultmann H, et al. 2015;25:561–73. The bromodomain protein BRD4 regulates the KEAP1/NRF2-dependent 8. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell oxidative stress response. Cell Death Dis 2014;5:e1195. 2011;144:646–74. 24. Dinkova-Kostova AT, Abramov AY. The emerging role of Nrf2 in mito- 9. Ji S, Qin Y, Liang C, Huang R, Shi S, Liu J, et al. FBW7 (F-box and WD repeat chondrial function. Free Radic Biol Med 2015;88:179–88. domain-containing 7) negatively regulates glucose metabolism by target- 25. DeNicola GM, Karreth FA, Humpton TJ, Gopinathan A, Wei C, Frese K, et al. ing the c-Myc/TXNIP (thioredoxin-binding protein) axis in pancreatic Oncogene-induced Nrf2 transcription promotes ROS detoxiﬁcation and cancer. Clin Cancer Res 2016;22:3950–60. tumorigenesis. Nature 2011;475:106–9. 10. Lu KP, Hanes SD, Hunter T. A human peptidyl-prolyl isomerase essential 26. Eser S, Schnieke A, Schneider G, Saur D. Oncogenic KRAS signalling in for regulation of mitosis. Nature 1996;380:544–7. pancreatic cancer. Br J Cancer 2014;111:817–22. 11. Lu KP, Finn G, Lee TH, Nicholson LK. Prolyl cis-trans isomerization as a 27. Collins MA, Bednar F, Zhang Y, Brisset JC, Galban S, Galban CJ, et al. molecular timer. Nat Chem Biol 2007;3:619–29. Oncogenic Kras is required for both the initiation and maintenance of 12. Lu KP, Zhou XZ. The prolyl isomerase PIN1: a pivotal new twist in pancreatic cancer in mice. J Clin Invest 2012;122:639–53. phosphorylation signalling and disease. Nat Rev Mol Cell Biol 2007;8: 28. Collins MA, Brisset JC, Zhang Y, Bednar F, Pierre J, Heist KA, et al. 904–16. Metastatic pancreatic cancer is dependent on oncogenic Kras in mice. PLoS 13. Xu GG, Etzkorn FA. Pin1 as an anticancer drug target. Drug News Perspect One 2012;7:e49707. 2009;22:399–407. 29. Corcoran RB, Cheng KA, Hata AN, Faber AC, Ebi H, Coffee EM, et al. 14. Lu Z, Hunter T. Prolyl isomerase Pin1 in cancer. Cell Res 2014;24:1033–49. Synthetic lethal interaction of combined BCL-XL and MEK inhibition 15. Gothel SF, Marahiel MA. Peptidyl-prolyl cis-trans isomerases, a superfam- promotes tumor regressions in KRAS mutant cancer models. Cancer Cell ily of ubiquitous folding catalysts. Cell Mol Life Sci 1999;55:423–36. 2013;23:121–8. 16. Yang W, Zheng Y, Xia Y, Ji H, Chen X, Guo F, et al. ERK1/2-dependent 30. Hu Y, Lu W, Chen G, Wang P, Chen Z, Zhou Y, et al. K-ras(G12V) phosphorylation and nuclear translocation of PKM2 promotes the transformation leads to mitochondrial dysfunction and a metabolic switch Warburg effect. Nat Cell Biol 2012;14:1295–304. from oxidative phosphorylation to glycolysis. Cell Res 2012;22:399–412.

144 Cancer Res; 79(1) January 1, 2019 Cancer Research

Antioxidative Role of PIN1 in PDAC

31. Weinberg F, Hamanaka R, Wheaton WW, Weinberg S, Joseph J, Lopez M, 42. Benassi B, Fanciulli M, Fiorentino F, Porrello A, Chiorino G, Loda M, et al. et al. Mitochondrial metabolism and ROS generation are essential for Kras- c-Myc phosphorylation is required for cellular response to oxidative stress. mediated tumorigenicity. Proc Natl Acad Sci U S A 2010;107:8788–93. Mol Cell 2006;21:509–19. 32. Son J, Lyssiotis CA, Ying H, Wang X, Hua S, Ligorio M, et al. Glutamine 43. Wulf GM, Ryo A, Wulf GG, Lee SW, Niu T, Petkova V, et al. Pin1 is supports pancreatic cancer growth through a KRAS-regulated metabolic overexpressed in breast cancer and cooperates with Ras signaling in pathway. Nature 2013;496:101–5. increasing the transcriptional activity of c-Jun towards cyclin D1. EMBO 33. Ying H, Kimmelman AC, Lyssiotis CA, Hua S, Chu GC, Fletcher- J 2001;20:3459–72. Sananikone E, et al. Oncogenic Kras maintains pancreatic tumors through 44. Bao L, Kimzey A, Sauter G, Sowadski JM, Lu KP, Wang DG. Prevalent regulation of anabolic glucose metabolism. Cell 2012;149:656–70. overexpression of prolyl isomerase Pin1 in human cancers. Am J Pathol 34. Yoshikawa Y, Takano O, Kato I, Takahashi Y, Shima F, Kataoka T. Ras 2004;164:1727–37. inhibitors display an anti-metastatic effect by downregulation of lysyl 45. Tan X, Zhou F, Wan J, Hang J, Chen Z, Li B, et al. Pin1 expression contributes oxidase through inhibition of the Ras-PI3K-Akt-HIF-1alpha pathway. to lung cancer: prognosis and carcinogenesis. Cancer Biol Ther 2010;9: Cancer Lett 2017;410:82–91. 111–9. 35. Cairns RA, Harris IS, Mak TW. Regulation of cancer cell metabolism. 46. Min SH, Lau AW, Lee TH, Inuzuka H, Wei S, Huang P, et al. Negative Nat Rev Cancer 2011;11:85–95. regulation of the stability and tumor suppressor function of Fbw7 by the 36. Oronsky BT, Oronsky N, Fanger GR, Parker CW, Caroen SZ, Lybeck M, et al. Pin1 prolyl isomerase. Mol Cell 2012;46:771–83. Follow the ATP: tumor energy production: a perspective. Anticancer Agents 47. Biswas M, Phan D, Watanabe M, Chan JY. The Fbw7 tumor suppressor Med Chem 2014;14:1187–98. regulates nuclear factor E2-related factor 1 transcription factor turnover 37. Liang C, Qin Y, Zhang B, Ji S, Shi S, Xu W, et al. Metabolic plasticity in through proteasome-mediated proteolysis. J Biol Chem 2011;286: heterogeneous pancreatic ductal adenocarcinoma. Biochim Biophys Acta 39282–9. 2016;1866:177–88. 48. Zhou J, Chng WJ. Roles of thioredoxin binding protein (TXNIP) in 38. Trachootham D, Zhou Y, Zhang H, Demizu Y, Chen Z, Pelicano H, et al. oxidative stress, apoptosis and cancer. Mitochondrion 2013;13: Selective killing of oncogenically transformed cells through a ROS-mediated 163–9. mechanism by beta-phenylethyl isothiocyanate. Cancer Cell 2006;10:241–52. 49. Itoh K, Wakabayashi N, Katoh Y, Ishii T, Igarashi K, Engel JD, et al. Keap1 39. Wise DR, Thompson CB. Glutamine addiction: a new therapeutic target in represses nuclear activation of antioxidant responsive elements by Nrf2 cancer. Trends Biochem Sci 2010;35:427–33. through binding to the amino-terminal Neh2 domain. Genes Dev 1999; 40. Manganaro L, Lusic M, Gutierrez MI, Cereseto A, Del Sal G, Giacca M. 13:76–86. Concerted action of cellular JNK and Pin1 restricts HIV-1 genome inte- 50. Nguyen T, Nioi P, Pickett CB. The Nrf2-antioxidant response element gration to activated CD4þ T lymphocytes. Nat Med 2010;16:329–33. signaling pathway and its activation by oxidative stress. J Biol Chem 2009; 41. Huang GL, Liao D, Chen H, Lu Y, Chen L, Li H, et al. The protein level and 284:13291–5. transcription activity of activating transcription factor 1 is regulated by 51. Chio II, Jafarnejad SM, Ponz-Sarvise M, Park Y, Rivera K, Palm W, et al. prolyl isomerase Pin1 in nasopharyngeal carcinoma progression. Cell NRF2 promotes tumor maintenance by modulating mRNA translation in Death Dis 2016;7:e2571. pancreatic cancer. Cell 2016;166:963–76.

www.aacrjournals.org Cancer Res; 79(1) January 1, 2019 145

PIN1 Maintains Redox Balance via the c-Myc/NRF2 Axis to Counteract Kras-Induced Mitochondrial Respiratory Injury in Pancreatic Cancer Cells

Chen Liang, Si Shi, Mingyang Liu, et al.

Cancer Res 2019;79:133-145. Published OnlineFirst October 24, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-18-1968

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2018/10/24/0008-5472.CAN-18-1968.DC1

Cited articles This article cites 51 articles, 8 of which you can access for free at: http://cancerres.aacrjournals.org/content/79/1/133.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/79/1/133. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.