G Model
TTBDIS-629; No. of Pages 5 ARTICLE IN PRESS
Ticks and Tick-borne Diseases xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases
j ournal homepage: www.elsevier.com/locate/ttbdis
Short communication
Diversity of spotted fever group Rickettsia infection in hard ticks from
Suifenhe, Chinese–Russian border
a,e a a a a a
Cheng Cheng , Weiming Fu , Wendong Ju , Liwei Yang , Ning Xu , Yan-mei Wang ,
b c c d d a e,∗
Hui Li , Yan-lu Wang , Man-xia Hu , Jing Wen , Dan Jiao , Cong Geng , Yi Sun
a
Heilongjiang International Travel Healthcare Center, No. 9, Ganshui Road, Nangang District, Harbin City 150001, Heilongjiang Province, China
b
Shanghai Huirui Biotechnology Co., Ltd., No. 720, Cailun Road, Pudongxin District, Shanghai City 200120, China
c
Suifenhe Entry-exit Inspection and Quarantine Bureau, No. 13, Changjiang Road, Suifenhe Town, Suifenhe City 157301, Heilongjiang Province, China
d
Heihe Entry-exit Inspection and Quarantine Bureau, No. 336, Wangsu Road, Heihe City 164399, Heilongjiang Province, China
e
State Key Laboratory of Pathogens and Biosecurity, Department of Vector Biology and Control, Beijing Institute of Microbiology and Epidemiology, No. 20,
Dong-dajie Street, Fengtai District, Beijing City 100071, China
a
r t i c l e i n f o a b s t r a c t
Article history: In order to investigate the diversity of spotted fever group (SFG) Rickettsia infection in hard ticks, ticks
Received 29 April 2015
were harvested from the forest areas in Suifenhe city, along the Chinese–Russian border and conventional
Received in revised form 26 February 2016
PCR was carried out using universal SFG Rickettsia primers targeting gltA and ompA genes to screen for
Accepted 29 February 2016
their infection with SFG Rickettsia organisms. Results showed that of the 215 ticks belonging to Ixodes
Available online xxx
persulcatus, Haemaphysalis concinna and Haemaphysalis japonica Warburton, 1908 species, 138 (64.2%)
were positive for SFG Rickettsia. Three species of SFG Rickettsia were detected, Rickettsia raoultii, Rickettsia
Keywords:
heilongjiangensis and Candidatus Rickettsia tarasevichiae. No co-infection with different species of SFG
Rickettsia raoultii
Rickettsia was found in any individual tick among the three tick species. We detected more than one
R. heilongjiangensis
SFG Rickettsia species in ticks from each of the three tick species with an overlapping distribution and
Candidatus Rickettsia tarasevichiae
Ixodes persulcatus potentially similar transmission cycles of SFG Rickettsia in the areas surveyed. Consequently, different
Suifenhe pathogenic rickettsial species may be involved in human cases of rickettsiosis after a bite of the three
above-mentioned tick species in that area Rickettsia
© 2016 Published by Elsevier GmbH.
Introduction Rickettsia heilongjiangensis in Northeastern China; Rickettsia sibi-
rica (mongolotimonae strain) in Asia and Rickettsia honei in Australia
Rickettsiae, a group of obligate intracellular Gram negative and Southeast Asia). In general, the clinical manifestations of most
bacteria, is subdivided into two major groups based on serological SFG rickettsiosis constitute a very broad spectrum; even when the
characteristics, namely, the typhus group (TG) and the spotted fever proportion of patients with an eschar is considered to be clinically
group (SFG) (Tay et al., 2014; Gillespie et al., 2007; Roux and Raoult, characteristic, the presentation varies for patients infected with the
2000; Tsui et al., 2007; Sarih et al., 2008). Among them, the SFG same strain in different geographic areas (Fournier et al., 2005).
Rickettsia organisms were known to be regionally distributed and In fact, most spotted fever rickettsiosis syndromes are similar,
maintained via tick vectors by transovarial and transstadial trans- including fever, headache, muscle pain, rash, and a characteristic
mission in nature, and occasionally infected victims through tick inoculation eschar (‘tache noire’) at the site of the bite (Santibánez˜
bite (Brouqui et al., 2004). During the past 3 decades, many novel et al., 2013). Consequently, it is not easy to carry out differential
SFG Rickettsia isolates have been characterized by newer meth- diagnosis of rickettsiosis by Rickettsia species based only on clini-
ods for genetic analysis (Socolovschi et al., 2009a). A large number cal features of human cases. Today, more precision laboratory tests,
of these Rickettsia species are agents of human diseases in areas for example, sequencing and genetic analysis, are being employed
of the world where rickettsioses had not previously been exten- to diagnose human rickettsiosis in more and more countries and
sively investigated. (e.g., Rickettsia japonica in Japan and Korea; regions (Jia et al., 2013).
In China, various species of SFG Rickettsia including R. hei-
longjiangensis, Rickettsia slovaca, Rickettsia raoultii, Rickettsia felis,
∗ Rickettsia hulinii, Candidatus R. tarasevichiae and Rickettsia mona-
Corresponding author. Tel.: +86 1066948579.
E-mail addresses: [email protected], [email protected] (Y. Sun). censis have also been found in ticks, animal hosts and humans
http://dx.doi.org/10.1016/j.ttbdis.2016.02.023
1877-959X/© 2016 Published by Elsevier GmbH.
Please cite this article in press as: Cheng, C., et al., Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe,
Chinese–Russian border. Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.02.023
G Model
TTBDIS-629; No. of Pages 5 ARTICLE IN PRESS
2 C. Cheng et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx
Table 1
Details of primers used in the study.
◦
Gene target Primer name Primer sequence (5 → 3 ) Amplicon size (bp) Annealing temperature ( C) Reference
gltA RpCS.877p GGGGGCCTGCTCACGGCGG 381 49 Regnery et al. (1991)
RpCS.1258n ATTGCAAAAAGTACAGTGAACA
RpCS.896p GGCTAATGAAGCAGTGATAA 337 54 Roux et al. (1997)
RpCS.1233n GCGACGGTATACCCATAGC
ompA Rr190.70p ATGGCGAATATTTCTCCAAAA 631 46 Roux et al. (1997)
Rr190.701n GTTCCGTTAATGGCAGCATCT
Rr190.70p ATGGCGAATATTTCTCCAAAA 532 50 Regnery et al. (1991)
Rr190.602n AGTGCAGCATTCGCTCCCCCT
(Zhang et al., 2000, 2014; Tian et al., 2012; Jia et al., 2013; Sun Results
et al., 2014). Diverse SFG Rickettsia in ticks and/or animal hosts may
pose a potential health threat and may be suspected in tick-bite A total of 215 unfed adult ticks, representing 120 Ixodes per-
victims presenting with fever from unclear rickettsial etiology. In sulcatus (54 males and 66 females), 55 Haemaphysalis concinna
China, for the most part, current diagnostic technologies for SFG (20 males and 35 females) and 40 H. japonica (13 males and
Rickettsia mainly depend on the clinical presentation and rarely 27 females), were collected from broad-leaved forest areas in
genus-specific PCR determinations. It is therefore important and Suifenhe, Chinese–Russian border (Table 2). Samples positive for
urgent to study the diversity of SFG Rickettsia in ticks, animal hosts corresponding fragments of both gltA and ompA genes of SFG Rick-
and humans as this would improve their differential diagnosis ettsia were considered to be rickettsial species (Fournier et al.,
and strengthen prompt administration of the appropriate ther- 2003). Using this criterion, positive Rickettsia DNA was detected in
apy. In this study, we investigated the tick-borne SFG rickettsiae in 138 ticks for both gltA and ompA by gene-specific PCR. Of them,
Suifenhe forest areas along the Chinese–Russian border to reveal 97 I. persulcatus (46 males and 51 females), 30 H. concinna (10
the diversity of SFG Rickettsia in the natural foci using PCR and males and 20 females) and 11 H. japonica (5 males and 6 females)
sequencing methods. were involved. The overall infection rate was shown to be 64.2% but
ranged from 27.5% to 80.8% in the three species with the highest in
I. persulcatus (Table 2). Moreover, three species of SFG Rickettsia (R.
Material and methods
raoultii, R. heilongjiangensis and Candidatus Rickettsia tarasevichiae)
were identified from the tick specimens with available sequences
Ticks
encoding partial fragments of gltA and ompA genes (Table 3).
Among I. persulcatus ticks, 87/97 (39 males and 48 females) were
Blanket dragging on vegetation was utilized to obtain unfed ticks
found to harbor Candidatus R. tarasevichiae, 9 ticks (7 males and 2
in Suifenhe counties, Heilongjiang province during April and July
females) were infected with R. raoultii and only one female with
2014. Morphological identification of all ticks was performed using
R. heilongjiangensis. Candidatus R. tarasevichiae appeared to be the
taxonomic keys (Teng and Jiang, 1991).
dominant Rickettsia species in I. persulcatus ticks. Seventeen H.
concinna (11 males and 6 females) were found positive for R. hei-
DNA extractions and PCR longjiangensis, 9 ticks (2 males and 7 females) for R. raoultii and only
two ticks (a male and female) were found infected with Candidatus
Upon identification, the ticks were ground in liquid nitrogen, R. tarasevichiae Although all the Hae. japonica tick specimens tested
and 200 mg of the homogenate was transferred into a centrifu- negative for Candidatus R. tarasevichiae, 9 of them (4 males and 5
gal tube for DNA extraction with DNeasy Blood and Tissue Kit females) were positive for R. raoultii along with another male and
(Qiagen, Hilden, Germany) according to the manufacturer’s instruc- female that had R. heilongjiangensis (Table 2).
tions. DNA extracts were used as templates for PCR assays with As mentioned above, a total of 3 SFG Rickettsia species were
primer sets targeting partial sequences of gltA and ompA genes. The found in the three tick species. R. heilongjiangensis was found in
×
50 l PCR reaction mixture contained 5 Colorless GoTaq Reac- I. persulcatus, H. concinna and H. japonica ticks. The nucleotide
tion buffer (Promega), 20 M of each primer, 2.5 mM of each dNTP, sequences coding ompA gene in R. heilongjiangensis harbored by
5 U/ l of recombinant GoTaq DNA Polymerase (Promega), ion-free- the infected tick specimens had similar Lys-deletion and Gln139His
water and 5 l of DNA from each sample. DNA of Candidatus R. substitution mutations found in referenced R. heilongjiangensis 054
tarasevichiae obtained from one patient in Mudanjiang city was strain. Besides, another mutation Gly67Trp was detected in ompA
used as positive control. Details about PCR primer pairs, size of the gene sequences of R. heilongjiangensis from H. concinna. No muta-
amplicons (bp), annealing temperatures and type of the assays are tion was detected in gltA-coding R. heilongjiangensis genes from
shown in Table 1. To avoid possible contamination, DNA extraction, any of the three tick species. Both I. persulcatus and H. concinna
the reagent setup, amplification, and agarose gel electrophoresis harbored Candidatus R. tarasevichiae. The gltA-coding genes of Can-
were performed in separate rooms. Negative control samples (ster- didatus R. tarasevichiae harbored by the two tick species had two
ile double distilled water) were included in each PCR reaction. silent mutations with a similar nucleotide change that results in
The PCR products were analyzed after electrophoresis in a 1% the Thr-deletion in ompA of Candidatus R. tarasevichiae when com-
agarose gel stained with ethidium bromide. After DNA sequenc- pared with human-derived Candidatus R. tarasevichiae. The ompA
ing, the nucleotide sequences were compared with those available gene of R. raoultii had one nucleotide deletion and 3 nucleotide
in GenBank using the National Center for Biotechnology Informa- changes resulting in two deduced amino acids mutations in H.
tion (NCBI; Bethesda, MD) Basic Local Alignment Sequence Tool japonica-derived strains while another two nucleotide changes
(BLAST) search engine (http://blast.ncbi.nlm.nih.gov/blast.cgi). The gave rise to two amino acid mutations in H. concinna-derived
DNA and the deduced amino acid sequences were analysed with strains. The Thr11Ala substitution occurred in the ompA gene of R.
CLC Genomic Workbench 3.6.1 (http://www.clcbio.com). raoultii harbored by the two Haemphysalis tick species. No mutation
Please cite this article in press as: Cheng, C., et al., Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe,
Chinese–Russian border. Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.02.023
G Model
TTBDIS-629; No. of Pages 5 ARTICLE IN PRESS
C. Cheng et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx 3
Table 2
Diversity of SFG Rickettsia in ticks.
Species Sex No No. infected Prevalence (%) Identified SFG Rickettsiae Percentage (%) Species
infection (%)
I. persulcatus F 66 51 77.27 R. raoultii 2 3.92 3.03
R. heilongjiangensis 1 1.96 1.52
Candidatus R. tarasevichiae 48 94.12 72.73
M 54 46 85.71 R. raoultii 7 15.22 12.96
Candidatus R. tarasevichiae 39 84.78 72.22
H. concinna F 35 20 57.14 R. raoultii 7 35 20
R. heilongjiangensis 11 55 31.43
Candidatus R. tarasevichiae 2 10 5.71
M 20 10 50 R. raoultii 2 20 10
R. heilongjiangensis 6 60 30
Candidatus R. tarasevichiae 2 20 10
H. japonica F 27 6 22.22 R. raoultii 5 83.33 18.51
R. heilongjiangensis 1 16.67 3.7
M 13 5 38.46 R. raoultii 4 80 30.76
R. heilongjiangensis 1 20 7.69
Total F 128 77 60.16 R. raoultii 14 18.18 10.94
R. heilongjiangensis 13 16.88 10.16
Candidatus R. tarasevichiae 50 64.94 39.06
M 87 61 70.11 R. raoultii 13 21.31 14.94
R. heilongjiangensis 7 11.48 8.05
Candidatus R. tarasevichiae 41 67.21 47.13
F + M 215 138 64.19 R. raoultii 27 19.57 12.56
R. heilongjiangensis 20 14.49 9.30
Candidatus R. tarasevichiae 91 65.94 42.32
Table 3
Mutations observed in the SFG Rickettsia infecting the three species of ticks.
Rickettsia species Tick species ompA gltA
Nucleotides Amino acids GenBank accession no. Nucleotides Amino acids GenBank accession no.
R. heilongjiangensis I. persulcatus A13-, A418T Q139H KP729603 N N KR131751
H. japonica A13-, A418T Q139H KP729609 N N KR131752
H. concinna A13-, A298C, A418T G67W, Q139H KP729606 N N KR131753
Candidatus R. I. persulcatus A13- T- KP729604 T273C, C276T N KR131754
tarasevichiae H. concinna A13- T- KP729607 T273C, C276T N KR131755
R. raoultii I. persulcatus N N KP729602 N N KR131756
H. japonica A23T, A26-, A32G, G38A T9-, T11A KP729608 N N KR131757
H. concinna A32G, A44- T11A. M15- KP729605 N N KR131758
was detected in the gltA-coding gene in either of the tick species SFG Rickettsia. In fact, various SFG Rickettsia organisms have pre-
(Table 3). viously been reported to infect and transmit infections via these
tick species (Socolovschi et al., 2009b). In the present study, R. hei-
Discussion longjiangensis, Candidatus R. tarasevichiae and R. raoultii have been
shown as the emerging predominant SFG Rickettsia in hard ticks in
Since it was discovered in Luobei and Suifenhe counties of Hei- Suifenhe County. Together with R. sibirica and R. hulinii found in
longjiang province in 1983, R. heilongjiangensis has been recognized the area, the broad spectrum of SFG Rickettsia organisms in hard
as a human pathogen of Far-eastern spotted fever (FESF) for a ticks should require attention from public health authorities and
long time (Wu et al., 1986). The patients naturally infected with researchers.
R. heilongjiangensis experience fever, chills, headache, dizziness, According to available literature, R. raoultii has recently been
myalgia, arthralgia and anorexia, after which most of the patients detected in at least 13 different tick species belonging to 6 gen-
show signs of a macular or maculopapular rash, as well as lym- era (Wen et al., 2014), including Dermacentor (Vitorino et al.,
phadenopathy near the inoculation eschar itself (Wu, 2013). In the 2007; Spitalská et al., 2012; Raoult et al., 2005; Stanczak,´ 2006;
recent past, the potential health risk to humans posed by the rick- Nijhof et al., 2007; Dautel et al., 2006; Rumer et al., 2011; Tian
ettsial organisms has been worsened by some emerging Rickettsia et al., 2012), Ixodes (Jiang et al., 2005; Boldis et al., 2008; Speck
organisms. Of these, Candidatus R. tarasevichiae, and R. raoultii were et al., 2012), Rhipicephalus (Merino et al., 2005), Haemaphysalis
confirmed to cause human fever and tick-borne lymphadenopathy (Márquez, 2008), Amblyomma (Paddock et al., 2010) and Hyalomma
(TIBOLA), respectively (Jia et al., 2013, 2014; Parola et al., 2009). (Shpynov et al., 2004). Of them, D. silvarum, Dermacentor niveus,
Notably, while Candidatus R. tarasevichiae-infected patients do not Dermacentor marginatus, Dermacentor everstanii and Dermacentor
present with any skin spots, they may have eschar and swollen reticulatus were the most frequent species infected by R. raoultii.
lymph nodes and other common clinical manifestations of tick The presence of Candidatus R. tarasevichiae has also been docu-
bites, with serious cases progressing to central nervous system mented in I. persulcatus (Eremeeva et al., 2006; Igolkina et al., 2006),
symptoms and meningeal irritation with fatality due to renal fail- H. japonica Warburton, 1908 (Socolovschi et al., 2009b), Ixodes
ure and respiratory acidosis (Jia et al., 2013). Due to the similar pavlovskyi, Ixodes angustus, D. reticulatus (Socolovschi et al., 2009b;
ecologic habitats and seasonal patterns, I. persulcatus, H. concinna, Mediannikov et al., 2006; Wójcik-Fatla et al., 2013) and other Ixodes
H. japonica and Dermacentor silvarum may share the most common spp. in Japan (Hiraoka et al., 2005). With H. concinna confirmed in
animal hosts resulting in the transmission of pathogens, especially the present study, at least six tick species are now known to be
Please cite this article in press as: Cheng, C., et al., Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe,
Chinese–Russian border. Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.02.023
G Model
TTBDIS-629; No. of Pages 5 ARTICLE IN PRESS
4 C. Cheng et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx
infected with the emerging Rickettsia Candidatus R. tarasevichiae. In References
addition, I. persulcatus and several members of the genus Haema-
Boldis, V., Kocianová, E., Strus, J., Tusek-Znidaric, M., Sparagano, O.A.,
physalis including Hae. flava, Hae. longicornis Hae. concinna and Hae.
Stefanidesová, K., Spitalská, E., 2008. Rickettsial agents in Slovakian ticks
japonica etc, were found to be infected with R. heilongjiangensis. This
(Acarina Ixodidae) and their ability to grow in Vero and L929 cell lines. Ann.
wide host range for the rickettsial species revealed their appropri- N.Y. Acad. Sci. 1149, 281–285.
Brouqui, P., Bacellar, F., Baranton, G., Birtles, R.J., Bjoërsdorff, A., Blanco, J.R., Caruso,
ate adaptation to the transmission cycles between ticks and animals
G., Cinco, M., Fournier, P.E., Francavilla, E., Jensenius, M., Kazar, J., Laferl, H.,
instead of the hypothesis that peculiar SFG Rickettsia species only
Lakos, A., Lotric Furlan, S., Maurin, M., Oteo, J.A., Parola, P., Perez-Eid, C., Peter,
specifically infect certain tick species. O., Postic, D., Raoult, D., Tellez, A., Tselentis, Y., Wilske, B., 2004. Guidelines for
the diagnosis of tick-borne bacterial diseases in Europe. Clin. Microbiol. Infect.
In this study, the sequences coding for ompA in R. heilongjian-
10, 1108–1132.
gensis infecting H. longicornis and H. flava have shown similar amino
Burgdorfer, W., Hayes, S.F., Mavros, A.J., 1981. Nonpathogenic rickettsiae in
acid mutations which might distinguish them from those infecting Dermacentor andersoni: a limiting factor for the distribution of Rickettsia
rickettsii. In: Burgdorfer, W., Anacker, R.L. (Eds.), Rickettsiae and Rickettsial
I. persulcatus, H. japonica and H. concinna. Moreover, a similar phe-
Diseases. Academic Press, New York, NY, pp. 585–594.
nomenon was also observed in R. raoultii, ompA sequences from D.
Dautel, H., Dippel, C., Oehme, R., Hartelt, K., Schettler, E., 2006. Evidence for an
reticulatus and D. marginatus distinguishing them from those infect- increased geographical distribution of Dermacentor reticulatus in Germany and
detection of Rickettsia sp. RpA4. Int. J. Med. Microbiol. 296, 149–156.
ing other tick species. However, no mutation was observed in the
Eremeeva, M.E., Oliveira, A., Robinson, J.B., Ribakova, N., Tokarevich, N.K., Dasch,
gltA sequences (Supplemental Figs. 1 and 2). One possible reason
G.A., 2006. Prevalence of bacterial agents in Ixodes persulcatus ticks from the
might be the function of ompA. As one antigen epitope interacts Vologda Province of Russia. Ann. N.Y. Acad. Sci. 1078, 291–298.
directly between the Rickettsia and host cells, outer membrane pro- Fournier, P.E., Dumler, J.S., Greub, G., Zhang, J., Wu, Y., Raoult, D., 2003. Gene
sequence-based criteria for identification of new Rickettsia isolates and
tein A, coded by ompA gene, might play an important role to endure
description of Rickettsia heilongjiangensis sp.nov. J. Clin. Microbiol. 41,
the selection pressure from vector ticks while the citric acid dehy- 5456–5465.
drogenase encoded by gltA is only involved in the carbohydrate Fournier, P.E., Gouriet, F., Brouqui, P., Lucht, F., Raoult, D., 2005. Lymphangitis
associated rickettsiosis (LAR), a new rickettsiosis caused by Rickettsia sibirica
metabolism. Furthermore, mutations of ompA genes occurred in
mongolotimonae: seven new cases and review of the literature. Clin. Infect.
some tick species with overlapping or neighboring distribution pat-
Dis. 40, 1435–1444.
terns. H. longicornis and H. flava occur in Central and Southern China Gillespie, J.J., Beier, M.S., Rahman, M.S., Ammerman, N.C., Shallom, J.M.,
Purkayastha, A., Sobral, B.S., Azad, A.F., 2007. Plasmids and rickettsial
while I. persulcatus and H. japonica and H. concinna are distributed
evolution: insight from Rickettsia felis. PLoS ONE 2 (3), e266.
in North China. Similarly, the distribution pattern of Haemaphysalis
Hiraoka, H., Shimada, Y., Sakata, Y., Watanabe, M., Itamoto, K., Okuda, M., Inokuma,
species, D. reticulatus and D. marginatus is restricted to the arid H., 2005. Detection of rickettsial DNA in ixodid ticks recovered from dogs and
cats in Japan. J. Vet. Med. Sci. 67, 1217–1222.
forests with high elevation, while D. niveus and D. silvarum occur in
Igolkina, Y.P., Fomenko, N.V., Livanova, N.N., Astanin, V.B., Gosteeva, L.A.,
humid forests with low elevation. The geographical habitats differ-
Chernousova, N.Y., Rar, V.A., 2006. Detection of different Rickettsia species
ence, not the species difference, might lead to the diverse patterns from ixodid ticks, human blood and blood of small mammals in the
South-Western Siberia and Ural. Bull. Siberian Med. 5, 121–125.
of SFG Rickettsia infection via ompA gene mutations.
Jia, N., Zheng, Y.C., Jiang, J.F., Ma, L., Cao, W.C., 2013. Human infection with
It has long been recognized that competitive interactions may
Candidatus Rickettsia tarasevichiae. N. Engl. J. Med. 369, 1178–1180.
be very important in the evolution of virulence and transmission Jia, N., Zheng, Y.C., Ma, L., Huo, Q.B., Ni, X.B., Jiang, B.G., Chu, Y.L., Jiang, R.R., Jiang,
pathways in Rickettsia. One Rickettsia species can affect the distri- J.F., Cao, W.C., 2014. Human Infections with Rickettsia raoultii, China. Emerg.
Infect. Dis. 20, 866–868.
bution and dynamics of the other Rickettsia species with significant
Jiang, J., Blair, P.J., Felices, V., Cespedes, M., Anaya, E., Schoeler, G.B., Sumner, J.W.,
public health implications. The competitive interactions between
Olson, J.G., Richards, A.L., 2005. Phylogenetic analysis of a novel molecular
R. rhipicephali and R. montana in D. variabilis were shaped by mutual isolate of spotted fever group rickettsiae from northern Peru: Candidatus
Rickettsia andeanae. Ann. N.Y. Acad. Sci. 1063, 337–342.
inhibition of vertical transmission (Macaluso et al., 2002) and the
Macaluso, K.R., Sonenshine, D.E., Ceraul, S.M., Azad, A.F., 2002. Rickettsial infection
presence of the non-pathogenic R. peacockii has been implicated in
in Dermacentor variabilis (Acari: Ixodidae) inhibits transovarial transmission of
a decrease in R. rickettsii Rocky Mountain spotted fever outbreaks a second Rickettsia. J. Med. Entomol. 39, 809–813.
Márquez, F.J., 2008. Spotted fever group Rickettsia in ticks from southeastern Spain
since this symbiont outcompetes via highly efficient vertical trans-
natural parks. Exp. Appl. Acarol. 45, 185–194.
mission in the tick host D. andersoni (Burgdorfer et al., 1981). In
Mediannikov, O., Sidelnikov, Y., Ivanov, L., Fournier, P.E., Tarasevich, I., Raoult, D.,
the present study, we report the detection of R. heilongjiangensis, R. 2006. Far eastern tick borne rickettsiosis: identification of two new cases and
tick vector. Ann. N.Y. Acad. Sci. 1078, 80–88.
raoultii and Candidatus R. tarasevichiae in hard ticks from Suifenhe
Merino, F.J., Nebreda, T., Serrano, J.L., Fernaındez-Soto,´ P., Encinas, A.,
with no co-infection. The competitive interactions among the SFG
Peırez-Sa´ ınchez,´ R., 2005. Tick species and tick-borne infections identified in
Rickettsia species should not be ruled out due to the limited samples population from a rural area of Spain. Epidemiol. Infect. 133, 943–949.
Nijhof, A.M., Bodaan, C., Postigo, M., Nieuwenhuijs, H., Opsteegh, M., Franssen, L.,
and more comprehensive investigations are recommended.
Jebbink, F., Jongejan, F., 2007. Ticks and associated pathogens collected from
domestic animals in the Netherlands. Vector Borne Zoonotic Dis. 7, 585–595.
Paddock, C.D., Fournier, P.E., Sumner, J.W., Goddard, J., Elshenawy, Y., Metcalfe,
Acknowledgments
M.G., Loftis, A.D., Varela-Stokes, A., 2010. Isolation of Rickettsia parkeri and
identification of a novel spotted fever group Rickettsia sp. from Gulf Coast ticks
(Amblyomma maculatum) in the United States. Appl. Environ. Microbiol. 76,
We thank Prof. Rongman Xu and Wuchun Cao for their help-
2689–2696.
ful comments and for revising the manuscript. This study was
Parola, P., Rovery, C., Rolain, J.M., Brouqui, P., Davoust, B., Raoult, D., 2009.
supported by grants from the General Administration of Quality Rickettsia slovaca and R. raoultii in tick-borne Rickettsioses. Emerg. Infect. Dis.
15, 1105–1108.
Supervision, Inspection and Quarantine of the People’s Republic of
Raoult, D., Fournier, P.E., Eremeeva, M., Graves, S., Kelly, P.J., Oteo, J.A., Sekeyova, Z.,
China (AQSIQ) scientific research subject (Grant no. 2014IK047),
Tamura, A., Tarasevich, I., Zhang, L., 2005. Naming of rickettsiae and rickettsial
Heilongjiang Import and Export Inspection and Quarantine Bureau diseases. Ann. N.Y. Acad. Sci. 1063, 1–12.
autonomous scientific research subject (Grant no. 2013HK006) and Regnery, R.L., Spruill, C.L., Plikaytis, B.D., 1991. Genotypic identification of
rickettsiae and estimation of intraspecies sequence divergence for portions of
National Critical Project for Science and Technology on Infectious
two rickettsial genes. J. Bacteriol. 173, 1576–1589.
Disease of P.R. China (Grant no. 2012ZX10004219).
Roux, V., Raoult, D., 2000. Phylogenetic analysis of members of the genus Rickettsia
using the gene encoding the outer-membrane protein rOmpB (ompB). Int. J.
Syst. Evol. Microbiol. 50 (4), 1449–1455.
Roux, V., Rydkina, E., Eremeeva, M., Raoult, D., 1997. Citrate synthase gene
Appendix A. Supplementary data
comparison, a new tool for phylogenetic analysis, and its application for the
rickettsiae. Int. J. Syst. Bacteriol. 47, 252–261.
Supplementary data associated with this article can be found, in Rumer, L., Graser, E., Hillebrand, T., Talaska, T., Dautel, H., Mediannikov, O.,
Roy-Chowdhury, P., Sheshukova, O., Mantke, O.D., Niedrig, M., 2011. Rickettsia
the online version, at doi:10.1016/j.ttbdis.2016.02.023.
Please cite this article in press as: Cheng, C., et al., Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe,
Chinese–Russian border. Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.02.023
G Model
TTBDIS-629; No. of Pages 5 ARTICLE IN PRESS
C. Cheng et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx 5
aeschlimannii in Hyalomma marginatum ticks, Germany. Emerg. Infect. Dis. 17, Teng, K.F., Jiang, Z.J., 1991. Ixodidae. In: Teng, K.F., Jiang, Z.J. (Eds.), Economic Insect
325–326. Fauna of China, Acari: Ixodidae. Science Press, Beijing, pp. 81–234.
Santibánez,˜ S., Portillo, A., Santibánez,˜ P., Palomar, A.M., Oteo, J.A., 2013. Usefulness Tian, Z.C., Liu, G.Y., Shen, H., Xie, J.R., Luo, J., Tian, M.Y., 2012. First report on the
of rickettsial PCR assays for the molecular diagnosis of human rickettsioses. occurrence of Rickettsia slovaca and Rickettsia raoultii in Dermacentor silvarum
Enferm. Infect. Microbiol. Clin. 31, 283–288. in China. Parasit Vectors 5, 19–22.
Sarih, M., Socolovschi, C., Boudebouch, N., Hassar, M., Raoult, D., Parola, P., 2008. Tsui, P.Y., Tsai, K.H., Weng, M.H., Hung, Y.W., Liu, Y.T., Hu, K.Y., Lien, J.C., Lin, P.R.,
Spotted fever group rickettsiae in ticks, Morocco. Emerg. Infect. Dis. 14, Shaio, M.F., Wang, H.C., Ji, D.D., 2007. Molecular detection and characterization
1067–1073. of spotted fever group rickettsiae in Taiwan. Am. J. Trop. Med. Hyg. 77,
Shpynov, S., Fournier, P.E., Rudakov, N., Tankibaev, M., Tarasevich, I., Raoult, D., 883–890.
2004. Detection of a Rickettsia closely related to Rickettsia aeschlimannii, Vitorino, L., De Sousa, R., Bacellar, F., Zeı-Ze´ ı,´ L., 2007. Rickettsia sp. strain RpA4
Rickettsia heilongjiangensis. Rickettsia sp. strain RpA4, and Ehrlichia muris in detected in Portuguese Dermacentor marginatus ticks. Vector Borne Zoonotic
ticks collected in Russia and Kazakhstan. J. Clin. Microbiol. 42, 2221–2223. Dis. 7, 217–220.
Socolovschi, C., Mediannikov, O., Raoult, D., Parola, P., 2009a. Update on tick-borne Wen, J., Jiao, D., Wang, J.H., Yao, D.H., Liu, Z.X., Zhao, G., Ju, W.D., Cheng, C., Li, Y.J.,
bacterial diseases in Europe. Parasite 16, 259–273. Sun, Y., 2014. Rickettsia raoultii, the predominant Rickettsia found in
Socolovschi, C., Mediannikov, O., Raoult, D., Parola, P., 2009b. The relationship Dermacentor silvarum ticks in China–Russia border areas. Exp. Appl. Acarol. 63,
between spotted fever group rickettsiae and Ixodid ticks. Vet. Res. 40, 34. 579–585.
Speck, S., Derschum, H., Damdindorj, T., Dashdavaa, O., Jiang, J., Kaysser, P., Jigjav, Wójcik-Fatla, A., Cisak, E., Zajac,˛ V., Sroka, J., Sawczyn, A., Dutkiewicz, J., 2013.
B., Nyamdorj, E., Baatar, U., Munkhbat, E., Choijilsuren, O., Gerelchuluun, O., Study on tick-borne rickettsiae in eastern Poland. I. Prevalence in Dermacentor
Romer,¨ A., Richards, A.L., Kiefer, D., Scholz, H., Wolfel,¨ R., Zoller,¨ L., Dobler, G., reticulatus (Acari: Amblyommidae). Ann. Agric. Environ. Med. 20, 276–279.
Essbauer, S., 2012. Rickettsia raoultii, the predominant Rickettsia found in Wu, Y.M., 2013. Research progress of Rickettsia heilongjiangensis and Far-eastern
Mongolian Dermacentor nuttallii. Ticks Tick Borne Dis. 3, 227–231. tick borne spotted fever. Chin. J. Shenyang Mil. Med. 26, 109–111.
Spitalská, E., Stefanidesová, K., Kocianová, E., Boldis,ˇ V., 2012. Rickettsia slovaca and Wu, Y.M., Wang, B., Xu, L.P., 1986. Antibody investigation of tick borne spotted
Rickettsia raoultii in Dermacentor marginatus and Dermacentor reticulatus ticks fever (Rickettsia heilongjiangensis). Chin. J. Zoonoses 2, 63.
from Slovak Republic. Exp. Appl. Acarol. 57, 189–197. Zhang, J., Lu, G., Kelly, P., Zhang, Z., Wei, L., Yu, D., Gu-Li, S., Wang, C., 2014. First
Stanczak,´ J., 2006. Detection of spotted fever group (SFG) rickettsiae in Dermacentor report of Rickettsia felis in China. BMC Infect. Dis. 14, 682–687.
reticulatus (Acari:Ixodidae) in Poland. Int. J. Med. Microbiol. 296, 144–148. Zhang, J.Z., Fan, M.Y., Wu, Y.M., Fournier, P.E., Roux, V., Raoult, D., 2000. Genetic
Sun, Y., Jiang, H.R., Cao, W.C., Fu, W.M., Ju, W.D., Wang, X., 2014. Prevalence of classification of “Rickettsia heilongjiangii” and “Rickettsia hulinii,” two Chinese
Candidatus Rickettsia tarasevichiae-like bacteria in Ixodid ticks at 13 sites on spotted fever group rickettsiae. J. Clin. Microbiol. 38, 3498–3501.
the Chinese–Russian border. J. Med. Entomol. 51, 1304–1307.
Yi Sun, Ph. D., works at the State Key Laboratory of Biosecurity and Microbiology,
Tay, S.T., Mokhtar, A.S., Low, K.C., Mohdzain, S.N., Jeffery, J., Abdulaziz, N., Kho, K.L.,
Beijing Institute of Microbiology & Epidemiology, Beijing, People’s Republic of China.
2014. Identification of rickettsiae from wild rats and cat fleas in Malaysia. Med.
His primary research interest is ticks and tick borne diseases.
Vet. Entomol. 28, 104–108.
Please cite this article in press as: Cheng, C., et al., Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe,
Chinese–Russian border. Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.02.023 本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。
学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，
提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。 图书馆致力于便利、促进学习与科研，提供最强文献下载服务。
图书馆导航：
图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具