DOCSLIB.ORG

Diversity of Spotted Fever Group Rickettsia Infection in Hard Ticks From

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Diversity of Spotted Fever Group Rickettsia Infection in Hard Ticks From G Model TTBDIS-629; No. of Pages 5 ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2016) xxx–xxx Contents lists available at ScienceDirect Ticks and Tick-borne Diseases j ournal homepage: www.elsevier.com/locate/ttbdis Short communication Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe, Chinese–Russian border a,e a a a a a Cheng Cheng , Weiming Fu , Wendong Ju , Liwei Yang , Ning Xu , Yan-mei Wang , b c c d d a e,∗ Hui Li , Yan-lu Wang , Man-xia Hu , Jing Wen , Dan Jiao , Cong Geng , Yi Sun a Heilongjiang International Travel Healthcare Center, No. 9, Ganshui Road, Nangang District, Harbin City 150001, Heilongjiang Province, China b Shanghai Huirui Biotechnology Co., Ltd., No. 720, Cailun Road, Pudongxin District, Shanghai City 200120, China c Suifenhe Entry-exit Inspection and Quarantine Bureau, No. 13, Changjiang Road, Suifenhe Town, Suifenhe City 157301, Heilongjiang Province, China d Heihe Entry-exit Inspection and Quarantine Bureau, No. 336, Wangsu Road, Heihe City 164399, Heilongjiang Province, China e State Key Laboratory of Pathogens and Biosecurity, Department of Vector Biology and Control, Beijing Institute of Microbiology and Epidemiology, No. 20, Dong-dajie Street, Fengtai District, Beijing City 100071, China a r t i c l e i n f o a b s t r a c t Article history: In order to investigate the diversity of spotted fever group (SFG) Rickettsia infection in hard ticks, ticks Received 29 April 2015 were harvested from the forest areas in Suifenhe city, along the Chinese–Russian border and conventional Received in revised form 26 February 2016 PCR was carried out using universal SFG Rickettsia primers targeting gltA and ompA genes to screen for Accepted 29 February 2016 their infection with SFG Rickettsia organisms. Results showed that of the 215 ticks belonging to Ixodes Available online xxx persulcatus, Haemaphysalis concinna and Haemaphysalis japonica Warburton, 1908 species, 138 (64.2%) were positive for SFG Rickettsia. Three species of SFG Rickettsia were detected, Rickettsia raoultii, Rickettsia Keywords: heilongjiangensis and Candidatus Rickettsia tarasevichiae. No co-infection with different species of SFG Rickettsia raoultii Rickettsia was found in any individual tick among the three tick species. We detected more than one R. heilongjiangensis SFG Rickettsia species in ticks from each of the three tick species with an overlapping distribution and Candidatus Rickettsia tarasevichiae Ixodes persulcatus potentially similar transmission cycles of SFG Rickettsia in the areas surveyed. Consequently, different Suifenhe pathogenic rickettsial species may be involved in human cases of rickettsiosis after a bite of the three above-mentioned tick species in that area Rickettsia © 2016 Published by Elsevier GmbH. Introduction Rickettsia heilongjiangensis in Northeastern China; Rickettsia sibi- rica (mongolotimonae strain) in Asia and Rickettsia honei in Australia Rickettsiae, a group of obligate intracellular Gram negative and Southeast Asia). In general, the clinical manifestations of most bacteria, is subdivided into two major groups based on serological SFG rickettsiosis constitute a very broad spectrum; even when the characteristics, namely, the typhus group (TG) and the spotted fever proportion of patients with an eschar is considered to be clinically group (SFG) (Tay et al., 2014; Gillespie et al., 2007; Roux and Raoult, characteristic, the presentation varies for patients infected with the 2000; Tsui et al., 2007; Sarih et al., 2008). Among them, the SFG same strain in different geographic areas (Fournier et al., 2005). Rickettsia organisms were known to be regionally distributed and In fact, most spotted fever rickettsiosis syndromes are similar, maintained via tick vectors by transovarial and transstadial trans- including fever, headache, muscle pain, rash, and a characteristic mission in nature, and occasionally infected victims through tick inoculation eschar (‘tache noire’) at the site of the bite (Santibánez˜ bite (Brouqui et al., 2004). During the past 3 decades, many novel et al., 2013). Consequently, it is not easy to carry out differential SFG Rickettsia isolates have been characterized by newer meth- diagnosis of rickettsiosis by Rickettsia species based only on clini- ods for genetic analysis (Socolovschi et al., 2009a). A large number cal features of human cases. Today, more precision laboratory tests, of these Rickettsia species are agents of human diseases in areas for example, sequencing and genetic analysis, are being employed of the world where rickettsioses had not previously been exten- to diagnose human rickettsiosis in more and more countries and sively investigated. (e.g., Rickettsia japonica in Japan and Korea; regions (Jia et al., 2013). In China, various species of SFG Rickettsia including R. hei- longjiangensis, Rickettsia slovaca, Rickettsia raoultii, Rickettsia felis, ∗ Rickettsia hulinii, Candidatus R. tarasevichiae and Rickettsia mona- Corresponding author. Tel.: +86 1066948579. E-mail addresses: [email protected], [email protected] (Y. Sun). censis have also been found in ticks, animal hosts and humans http://dx.doi.org/10.1016/j.ttbdis.2016.02.023 1877-959X/© 2016 Published by Elsevier GmbH. Please cite this article in press as: Cheng, C., et al., Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe, Chinese–Russian border. Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.02.023 G Model TTBDIS-629; No. of Pages 5 ARTICLE IN PRESS 2 C. Cheng et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx Table 1 Details of primers used in the study. ◦ Gene target Primer name Primer sequence (5 → 3 ) Amplicon size (bp) Annealing temperature ( C) Reference gltA RpCS.877p GGGGGCCTGCTCACGGCGG 381 49 Regnery et al. (1991) RpCS.1258n ATTGCAAAAAGTACAGTGAACA RpCS.896p GGCTAATGAAGCAGTGATAA 337 54 Roux et al. (1997) RpCS.1233n GCGACGGTATACCCATAGC ompA Rr190.70p ATGGCGAATATTTCTCCAAAA 631 46 Roux et al. (1997) Rr190.701n GTTCCGTTAATGGCAGCATCT Rr190.70p ATGGCGAATATTTCTCCAAAA 532 50 Regnery et al. (1991) Rr190.602n AGTGCAGCATTCGCTCCCCCT (Zhang et al., 2000, 2014; Tian et al., 2012; Jia et al., 2013; Sun Results et al., 2014). Diverse SFG Rickettsia in ticks and/or animal hosts may pose a potential health threat and may be suspected in tick-bite A total of 215 unfed adult ticks, representing 120 Ixodes per- victims presenting with fever from unclear rickettsial etiology. In sulcatus (54 males and 66 females), 55 Haemaphysalis concinna China, for the most part, current diagnostic technologies for SFG (20 males and 35 females) and 40 H. japonica (13 males and Rickettsia mainly depend on the clinical presentation and rarely 27 females), were collected from broad-leaved forest areas in genus-specific PCR determinations. It is therefore important and Suifenhe, Chinese–Russian border (Table 2). Samples positive for urgent to study the diversity of SFG Rickettsia in ticks, animal hosts corresponding fragments of both gltA and ompA genes of SFG Rick- and humans as this would improve their differential diagnosis ettsia were considered to be rickettsial species (Fournier et al., and strengthen prompt administration of the appropriate ther- 2003). Using this criterion, positive Rickettsia DNA was detected in apy. In this study, we investigated the tick-borne SFG rickettsiae in 138 ticks for both gltA and ompA by gene-specific PCR. Of them, Suifenhe forest areas along the Chinese–Russian border to reveal 97 I. persulcatus (46 males and 51 females), 30 H. concinna (10 the diversity of SFG Rickettsia in the natural foci using PCR and males and 20 females) and 11 H. japonica (5 males and 6 females) sequencing methods. were involved. The overall infection rate was shown to be 64.2% but ranged from 27.5% to 80.8% in the three species with the highest in I. persulcatus (Table 2). Moreover, three species of SFG Rickettsia (R. Material and methods raoultii, R. heilongjiangensis and Candidatus Rickettsia tarasevichiae) were identified from the tick specimens with available sequences Ticks encoding partial fragments of gltA and ompA genes (Table 3). Among I. persulcatus ticks, 87/97 (39 males and 48 females) were Blanket dragging on vegetation was utilized to obtain unfed ticks found to harbor Candidatus R. tarasevichiae, 9 ticks (7 males and 2 in Suifenhe counties, Heilongjiang province during April and July females) were infected with R. raoultii and only one female with 2014. Morphological identification of all ticks was performed using R. heilongjiangensis. Candidatus R. tarasevichiae appeared to be the taxonomic keys (Teng and Jiang, 1991). dominant Rickettsia species in I. persulcatus ticks. Seventeen H. concinna (11 males and 6 females) were found positive for R. hei- DNA extractions and PCR longjiangensis, 9 ticks (2 males and 7 females) for R. raoultii and only two ticks (a male and female) were found infected with Candidatus Upon identification, the ticks were ground in liquid nitrogen, R. tarasevichiae Although all the Hae. japonica tick specimens tested and 200 mg of the homogenate was transferred into a centrifu- negative for Candidatus R. tarasevichiae, 9 of them (4 males and 5 gal tube for DNA extraction with DNeasy Blood and Tissue Kit females) were positive for R. raoultii along with another male and (Qiagen, Hilden, Germany) according to the manufacturer’s instruc- female that had R. heilongjiangensis (Table 2). tions. DNA extracts were used as templates for PCR assays with As mentioned above, a total of 3 SFG Rickettsia species were primer sets targeting partial sequences of gltA and ompA genes. The found in the three tick species. R. heilongjiangensis was found in ␮ × 50 l PCR reaction mixture contained 5 Colorless GoTaq Reac- I. persulcatus, H. concinna and H. japonica ticks. The nucleotide ␮ tion buffer (Promega), 20 M of each primer, 2.5 mM of each dNTP, sequences coding ompA gene in R. heilongjiangensis harbored by ␮ 5 U/ l of recombinant GoTaq DNA Polymerase (Promega), ion-free- the infected tick specimens had similar Lys-deletion and Gln139His ␮ water and 5 l of DNA from each sample. DNA of Candidatus R.
Load more

Recommended publications
  • Changchun–Harbin Expressway Project
    Performance Evaluation Report Project Number: PPE : PRC 30389 Loan Numbers: 1641/1642 December 2006 People’s Republic of China: Changchun–Harbin Expressway Project Operations Evaluation Department CURRENCY EQUIVALENTS Currency Unit – yuan (CNY) At Appraisal At Project Completion At Operations Evaluation (July 1998) (August 2004) (December 2006) CNY1.00 = $0.1208 $0.1232 $0.1277 $1.00 = CNY8.28 CNY8.12 CNY7.83 ABBREVIATIONS AADT – annual average daily traffic ADB – Asian Development Bank CDB – China Development Bank DMF – design and monitoring framework EIA – environmental impact assessment EIRR – economic internal rate of return FIRR – financial internal rate of return GDP – gross domestic product ha – hectare HHEC – Heilongjiang Hashuang Expressway Corporation HPCD – Heilongjiang Provincial Communications Department ICB – international competitive bidding JPCD – Jilin Provincial Communications Department JPEC – Jilin Provincial Expressway Corporation MOC – Ministry of Communications NTHS – national trunk highway system O&M – operations and maintenance OEM – Operations Evaluation Mission PCD – provincial communication department PCR – project completion report PPTA – project preparatory technical assistance PRC – People’s Republic of China RRP – report and recommendation of the President TA – technical assistance VOC – vehicle operating cost NOTE In this report, “$” refers to US dollars. Keywords asian development bank, development effectiveness, expressways, people’s republic of china, performance evaluation, heilongjiang province, jilin province, transport Director Ramesh Adhikari, Operations Evaluation Division 2, OED Team leader Marco Gatti, Senior Evaluation Specialist, OED Team members Vivien Buhat-Ramos, Evaluation Officer, OED Anna Silverio, Operations Evaluation Assistant, OED Irene Garganta, Operations Evaluation Assistant, OED Operations Evaluation Department, PE-696 CONTENTS Page BASIC DATA v EXECUTIVE SUMMARY vii MAPS xi I. INTRODUCTION 1 A.
    [Show full text]
  • Optimization Path of the Freight Channel of Heilongjiang Province
    2017 3rd International Conference on Education and Social Development (ICESD 2017) ISBN: 978-1-60595-444-8 Optimization Path of the Freight Channel of Heilongjiang Province to Russia 1,a,* 2,b Jin-Ping ZHANG , Jia-Yi YUAN 1Harbin University of Commerce, Harbin, Heilongjiang, China 2International Department of Harbin No.9 High School, Harbin, Heilongjiang, China [email protected], [email protected] * Corresponding author Keywords: Heilongjiang Province, Russia, Freight Channel, Optimization Path. Abstract. Heilongjiang Province becomes the most important province for China's import and export trade to Russia due to its unique geographical advantages and strong complementary between industry and product structure. However, the existing problems in the trade freight channel layout and traffic capacity restrict the bilateral trade scale expansion and trade efficiency improvement. Therefore, the government should engage in rational distribution of cross-border trade channel, strengthen infrastructure construction in the border port cities and node cities, and improve the software support and the quality of service on the basis of full communication and coordination with the relevant Russian government, which may contribute to upgrade bilateral economic and trade cooperation. Introduction Heilongjiang Province is irreplaceable in China's trade with Russia because of its geographical advantages, a long history of economic and trade cooperation, and complementary in industry and product structures. Its total value of import and export trade to Russia account for more than 2/3 of the whole provinces and nearly 1/4 of that of China. After years of efforts, there exist both improvement in channel infrastructure, layout and docking and problems in channel size, functional positioning and layout, as well as important node construction which do not match with cross-border freight development.
    [Show full text]
  • Estimations of Undisturbed Ground Temperatures Using Numerical and Analytical Modeling
    ESTIMATIONS OF UNDISTURBED GROUND TEMPERATURES USING NUMERICAL AND ANALYTICAL MODELING By LU XING Bachelor of Arts/Science in Mechanical Engineering Huazhong University of Science & Technology Wuhan, China 2008 Master of Arts/Science in Mechanical Engineering Oklahoma State University Stillwater, OK, US 2010 Submitted to the Faculty of the Graduate College of the Oklahoma State University in partial fulfillment of the requirements for the Degree of DOCTOR OF PHILOSOPHY December, 2014 ESTIMATIONS OF UNDISTURBED GROUND TEMPERATURES USING NUMERICAL AND ANALYTICAL MODELING Dissertation Approved: Dr. Jeffrey D. Spitler Dissertation Adviser Dr. Daniel E. Fisher Dr. Afshin J. Ghajar Dr. Richard A. Beier ii ACKNOWLEDGEMENTS I would like to thank my advisor, Dr. Jeffrey D. Spitler, who patiently guided me through the hard times and encouraged me to continue in every stage of this study until it was completed. I greatly appreciate all his efforts in making me a more qualified PhD, an independent researcher, a stronger and better person. Also, I would like to devote my sincere thanks to my parents, Hongda Xing and Chune Mei, who have been with me all the time. Their endless support, unconditional love and patience are the biggest reason for all the successes in my life. To all my good friends, colleagues in the US and in China, who talked to me and were with me during the difficult times. I would like to give many thanks to my committee members, Dr. Daniel E. Fisher, Dr. Afshin J. Ghajar and Dr. Richard A. Beier for their suggestions which helped me to improve my research and dissertation.
    [Show full text]
  • A Brief Introduction to the Dairy Industry in Heilongjiang NBSO Dalian
    A brief introduction to the Dairy Industry in Heilongjiang NBSO Dalian RVO.nl | Brief Introduction Dairy industry Heilongjiang, NBSO Dalian Colofon This is a publication of: Netherlands Enterprise Agency Prinses Beatrixlaan 2 PO Box 93144, 2509 AC, The Hague Phone: 088 042 42 42 Email: via contact form on the website Website: www.rvo.nl This survey has been conducted by the Netherlands Business Support Office in Dalian If you have any questions regarding this business sector in Heilongjiang Province or need any form of business support, please contact NBSO Dalian: Chief Representative: Renée Derks Deputy Representative: Yin Hang Phone: +86 (0)411 3986 9998 Email: [email protected] For further information on the Netherlands Business Support Offices, see www.nbso.nl © Netherlands Enterprise Agency, August 2015 NL Enterprise Agency is a department of the Dutch ministry of Economic Affairs that implements government policy for agricultural, sustainability, innovation, and international business and cooperation. NL Enterprise Agency is the contact point for businesses, educational institutions and government bodies for information and advice, financing, networking and regulatory matters. Although a great degree of care has been taken in the preparation of this document, no rights may be derived from this brochure, or from any of the examples contained herein, nor may NL Enterprise Agency be held liable for the consequences arising from the use thereof. This publication may not be reproduced, in whole, or in part, in any form, without the prior written consent of the publisher. Page 2 of 10 RVO.nl | Brief Introduction Dairy industry Heilongjiang, NBSO Dalian Contents Colofon .....................................................................................................
    [Show full text]
  • Vision for the Northeast Asia Transportation Corridors
    Northeast Asia Economic Conference Organizing Committee Transportation Subcommittee Chairman KAYAHARA, Hideo Japan: Director General, the Japan Port and Harbor Association/ Counselor, ERINA Committee Members DAI, Xiyao PRC: Director, Tumen River Area Development Administration, the People’ s Government of Jilin Province WANG, Shengjin PRC: Dean, Northeast Asia Studies College of Jilin University TSENGEL, Tsegmidyn Mongolia: State Secretary, Ministry of Infrastructure SEMENIKHIN, Yaroslav RF: President, Far Eastern Marine Research, Design and Technology Institute (FEMRI) Byung-Min AHN ROK: Head, Northeast Asia Research Team, Korea Transportation Institute(KOTI) GOMBO, Tsogtsaikhan UN: Deputy Director, Tumen Secretariat, UNDP Secretariat ERINA (Ikuo MITSUHASHI, Senior Fellow, Kazumi KAWAMURA, Researcher, Research Division, Dmiriy L. Sergachev, Researcher, Research Division) Vision for the Northeast Asia Transportation Corridors Contents Chapter 1 Introduction ................................................................................................. 1 Chapter 2 Nine Transportation Corridors in Northeast Asia.................................... 2 Chapter 3 Current Situation and Problems of the Nine Transportation Corridors in Northeast Asia ....................................................................................... 5 3.1 Taishet~Vanino Transportation Corridor 3.2 Siberian Land Bridge (SLB) Transportation Corridor 3.3 Suifenhe Transportation Corridor 3.4 Tumen River Transportation Corridor 3.5 Dalian Transportation Corridor
    [Show full text]
  • The Impact of Continuous Driving Time and Rest Time on Commercial Drivers' Driving Performance and Recovery
    Journal of Safety Research 50 (2014) 11–15 Contents lists available at ScienceDirect Journal of Safety Research journal homepage: www.elsevier.com/locate/jsr The impact of continuous driving time and rest time on commercial drivers' driving performance and recovery Lianzhen Wang a,⁎,YulongPeib a School of Transportation Science and Engineering, Harbin Institute of Technology, Harbin 150090, China b Traffic College, Northeast Forestry University, Harbin 150040, China article info abstract Article history: Problem: This real road driving study was conducted to investigate the effects of driving time and rest time on the Received 16 March 2013 driving performance and recovery of commercial coach drivers. Methods: Thirty-three commercial coach drivers Received in revised form 11 January 2014 participated in the study, and were divided into three groups according to driving time: (a) 2 h, (b) 3 h, and (c) 4 Accepted 15 January 2014 h. The Stanford Sleepiness Scale (SSS) was used to assess the subjective fatigue level of the drivers. One-way Available online 28 January 2014 ANOVA was employed to analyze the variation in driving performance. Results: The statistical analysis revealed that driving time had a significant effect on the subjective fatigue and driving performance measures among Keywords: the three groups. After 2 h of driving, both the subjective fatigue and driving performance measures began to de- Fatigue driving fi Driving performance teriorate. After 4 h of driving, all of the driving performance indicators changed signi cantly except for depth per- Commercial coach drivers ception. A certain amount of rest time eliminated the negative effects of fatigue. A 15-minute rest allowed drivers Driving time to recover from a two-hour driving task.
    [Show full text]
  • Global Map of Irrigation Areas CHINA
    Global Map of Irrigation Areas CHINA Area equipped for irrigation (ha) Area actually irrigated Province total with groundwater with surface water (ha) Anhui 3 369 860 337 346 3 032 514 2 309 259 Beijing 367 870 204 428 163 442 352 387 Chongqing 618 090 30 618 060 432 520 Fujian 1 005 000 16 021 988 979 938 174 Gansu 1 355 480 180 090 1 175 390 1 153 139 Guangdong 2 230 740 28 106 2 202 634 2 042 344 Guangxi 1 532 220 13 156 1 519 064 1 208 323 Guizhou 711 920 2 009 709 911 515 049 Hainan 250 600 2 349 248 251 189 232 Hebei 4 885 720 4 143 367 742 353 4 475 046 Heilongjiang 2 400 060 1 599 131 800 929 2 003 129 Henan 4 941 210 3 422 622 1 518 588 3 862 567 Hong Kong 2 000 0 2 000 800 Hubei 2 457 630 51 049 2 406 581 2 082 525 Hunan 2 761 660 0 2 761 660 2 598 439 Inner Mongolia 3 332 520 2 150 064 1 182 456 2 842 223 Jiangsu 4 020 100 119 982 3 900 118 3 487 628 Jiangxi 1 883 720 14 688 1 869 032 1 818 684 Jilin 1 636 370 751 990 884 380 1 066 337 Liaoning 1 715 390 783 750 931 640 1 385 872 Ningxia 497 220 33 538 463 682 497 220 Qinghai 371 170 5 212 365 958 301 560 Shaanxi 1 443 620 488 895 954 725 1 211 648 Shandong 5 360 090 2 581 448 2 778 642 4 485 538 Shanghai 308 340 0 308 340 308 340 Shanxi 1 283 460 611 084 672 376 1 017 422 Sichuan 2 607 420 13 291 2 594 129 2 140 680 Tianjin 393 010 134 743 258 267 321 932 Tibet 306 980 7 055 299 925 289 908 Xinjiang 4 776 980 924 366 3 852 614 4 629 141 Yunnan 1 561 190 11 635 1 549 555 1 328 186 Zhejiang 1 512 300 27 297 1 485 003 1 463 653 China total 61 899 940 18 658 742 43 241 198 52
    [Show full text]
  • Heilongjiang Road Development II Project (Yichun-Nenjiang)
    Technical Assistance Consultant’s Report Project Number: TA 7117 – PRC October 2009 People’s Republic of China: Heilongjiang Road Development II Project (Yichun-Nenjiang) FINAL REPORT (Volume II of IV) Submitted by: H & J, INC. Beijing International Center, Tower 3, Suite 1707, Beijing 100026 US Headquarters: 6265 Sheridan Drive, Suite 212, Buffalo, NY 14221 In association with WINLOT No 11 An Wai Avenue, Huafu Garden B-503, Beijing 100011 This consultant’s report does not necessarily reflect the views of ADB or the Government concerned, ADB and the Government cannot be held liable for its contents. All views expressed herein may not be incorporated into the proposed project’s design. Asian Development Bank Heilongjiang Road Development II (TA 7117 – PRC) Final Report Supplementary Appendix A Financial Analysis and Projections_SF1 S App A - 1 Heilongjiang Road Development II (TA 7117 – PRC) Final Report SUPPLEMENTARY APPENDIX SF1 FINANCIAL ANALYSIS AND PROJECTIONS A. Introduction 1. Financial projections and analysis have been prepared in accordance with the 2005 edition of the Guidelines for the Financial Governance and Management of Investment Projects Financed by the Asian Development Bank. The Guidelines cover both revenue earning and non revenue earning projects. Project roads include expressways, Class I and Class II roads. All will be built by the Heilongjiang Provincial Communications Department (HPCD). When the project started it was assumed that all project roads would be revenue earning. It was then discovered that national guidance was that Class 2 roads should be toll free. The ADB agreed that the DFR should concentrate on the revenue earning Expressway and Class I roads, 2.
    [Show full text]
  • Strategic Priorities of Cooperation Between Heilongjiang Province and Russia L
    R-ECONOMY, 2019, 5(1), 13–18 doi: 10.15826/recon.2019.5.1.002 Original Paper doi 10.15826/recon.2019.5.1.002 Strategic priorities of cooperation between Heilongjiang province and Russia L. Song Institute of Northeast Asian Studies, Heilongjiang Provincial Academy of Social Sciences, Harbin, China; e-mail: [email protected] ABSTRACT KEYWORDS During the five-year period of implementation of the Belt and Road Initia- Belt and Road Initiative; tive, Heilongjiang Province, which is one of the nine Chinese border provinc- Heilongjiang Province; Eastern es, has actively responded to the national development policy and achieved Silk Road Belt; Longjiang Silk some impressive results in its strategic cooperation with the Russian Far Road Belt; strategic planning; East. The article characterizes the current state of Heilongjiang Province’s re- cooperation lationship with Russia and describes its strategic plans for findings new paths of cooperation as a result of the province’s integration into the Belt and Road ACKNOWLEDGEMENTS Initiative and participation in China-Mongolia-Russia Economic Corridor Heilongjiang Province, the special construction. The key projects crucial for the province’s development are the subject of the 12th Fourth Plenary Eastern Land-Sea Silk Road Economic Belt (hereinafter referred to as the Session of “Research on the Eastern Silk Road Belt) and the Heilongjiang Land-Sea Silk Road Economic Construction of New Pattern Belt (hereinafter referred to as Longjiang Silk Road Belt). Both projects are of All-dimensional Opening up aimed at increasing the interconnectedness between regions and countries, in Heilongjiang Province”, promoting international trade and fostering understanding and tolerance.
    [Show full text]
  • Trans-Border Exchange Between Russia and China: the Case of Blagoveshchensk and Heihe
    Ryzhova.fm Page 348 Thursday, May 14, 2009 11:48 AM Trans-border Exchange between Russia and China: The Case of Blagoveshchensk and Heihe Nataliya Ryzhova and Grigory Ioffe1 Abstract: Two Russian-trained geographers investigate the multiple and largely informal and illicit forms of exchange between two provincial cities of roughly similar size located on opposite banks of the Amur River, namely Blagoveshchensk, in Russia’s Far East, and Heihe, in neighboring northeast China. The study is based on interviews and field observations from 2002 to 2009 in Blagoveshchensk, as well as official statistics from the relevant Russian and Chinese provincial governments. Particular attention is focused on the activities and treat- ment of Chinese guest workers comprising a material component of the labor force in Amur Oblast (e.g., in construction and agriculture), unregistered Chinese entrepreneurs in retailing and catering, and trans-border logging operations of Chinese timber/wood products compa- nies. Also covered are the activities of visiting Russian nationals in Heihe and the extralegal activities of Russian entrepreneurs and bureaucrats. Journal of Economic Literature, Classifi- cation Numbers: F20, J61, O17, O18. 5 figures, 1 table, 50 references. Key words: Russia, China, cross-border trade, Blagoveshchensk, Heihe, Heilongjiang Province, Amur River, free economic zones, suitcase trade, illegal logging, grey imports, contraband, illegal entrepre- neurs, migrant labor. orders separating countries with different socio-economic systems tend to impede the B free flow of goods and people, to greater or lesser degree in proportion to the extent to which those systems diverge.2 Certainly the Soviet–Chinese border in the Russian Federa- tion’s Far East region was tightly controlled for a good part of the last century, reflecting (despite outward signs of Communist solidarity) a protracted territorial dispute between the USSR and China involving islands located in the Amur River, which formed an extended portion of that border.
    [Show full text]
  • Preparing the Heilongjiang Road Development II Project (Yichun–Nenjiang)
    Technical Assistance Report Project Number: 42017 August 2008 People’s Republic of China: Preparing the Heilongjiang Road Development II Project (Yichun–Nenjiang) The views expressed herein are those of the consultant and do not necessarily represent those of ADB’s members, Board of Directors, Management, or staff, and may be preliminary in nature. CURRENCY EQUIVALENTS (as of 1 July 2008) Currency Unit – yuan (CNY) CNY1.00 = $0.1459 $1.00 = CNY6.8543 ABBREVIATIONS ADB – Asian Development Bank C&P – consultation and participatory EIA – environmental impact assessment GDP – gross domestic product HPCD – Heilongjiang Provincial Communications Department IPSA – initial poverty and social analysis PRC – People’s Republic of China TA – technical assistance TECHNICAL ASSISTANCE CLASSIFICATION Targeting Classification – General intervention Sector – Transport and communications Subsector – Roads and highways Themes – Sustainable economic growth, capacity development Subthemes – Fostering physical infrastructure development, institutional development NOTE In this report, "$" refers to US dollars. Vice-President C. Lawrence Greenwood, Jr., Operations 2 Director General K. Gerhaeusser, East Asia Department (EARD) Director C.S. Chin, Officer-in-Charge, Transport Division, EARD Team leader E. Oyunchimeg, Transport Specialist (Roads), EARD Team members S. Ferguson, Senior Social Development Specialist (Resettlement), EARD T. Yokota, Transport Specialist, EARD 121o 00'E 132o 00'E HEILONGJIANG ROAD DEVELOPMENT II PROJECT (YICHUN--NENJIANG) IN THE PEOPLE'S REPUBLIC OF CHINA RUSSIAN FEDERATION Provincial Capital City/Town Mohe County Highway Port National Key Tourism Scenic Spot H eilong River Proposed Project Road Tahe ADB--Financed Road Loop Line Radial Line Huma Vertical Line Horizontal Line River Provincial Boundary 52 o 00'N 52 o 00'N International Boundary Woduhe Jiagdaqi Boundaries are not necessarily authoritative.
    [Show full text]
  • Toward Expanding Japan–Russia–China Multimodal Transportation
    Toward Expanding Japan–Russia–China Multimodal Transportation Toward Expanding Japan–Russia–China Multimodal Transportation ARAI, Hirofumi Director and Senior Research Fellow, Research Division, ERINA ZHU, Yonghao Associate Professor, Faculty of Economics and Business Administration, Fukushima University / ERINA Collaborative Researcher LI, Jinbo Director, Strategy Research Center, People’s Government of Suifenhe City Introduction decline. As shown in Table 1, while there was an increasing It would be no exaggeration to say that the economic trend for the trade volumes with Japan of China’s Northeast relationship between Japan and China is the closest bilateral from 2000 on, its share of Japan–China trade went from relationship in the world. However, within China’s 12.4% in 2000 to 7.3% in 2012 for exports, and from 7.6% Northeast, which is geographically close to Japan, the in 2000 to 4.4% in 2012 for imports. This is due to Japan– relationship between Japan and the inland provinces of Jilin China trade being concentrated in coastal areas, such as the and Heilongjiang is comparatively weak. At present for Pearl River Delta, the Yangtze River Delta, and the Bohai Japan’s trade with these areas, there is no alternative but to Sea Rim. use a circuitous route via Dalian, Yingkou and other ports on Second, taking a look at the trade volumes with Japan of the Bohai Sea. However, if the ports of Russia’s Primorsky each of the Northeast provinces, it can be seen that Liaoning Krai are used, it will be possible to greatly shorten the Province has a runaway lead.
    [Show full text]