G Model TTBDIS-629; No. of Pages 5 ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2016) xxx–xxx Contents lists available at ScienceDirect Ticks and Tick-borne Diseases j ournal homepage: www.elsevier.com/locate/ttbdis Short communication Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe, Chinese–Russian border a,e a a a a a Cheng Cheng , Weiming Fu , Wendong Ju , Liwei Yang , Ning Xu , Yan-mei Wang , b c c d d a e,∗ Hui Li , Yan-lu Wang , Man-xia Hu , Jing Wen , Dan Jiao , Cong Geng , Yi Sun a Heilongjiang International Travel Healthcare Center, No. 9, Ganshui Road, Nangang District, Harbin City 150001, Heilongjiang Province, China b Shanghai Huirui Biotechnology Co., Ltd., No. 720, Cailun Road, Pudongxin District, Shanghai City 200120, China c Suifenhe Entry-exit Inspection and Quarantine Bureau, No. 13, Changjiang Road, Suifenhe Town, Suifenhe City 157301, Heilongjiang Province, China d Heihe Entry-exit Inspection and Quarantine Bureau, No. 336, Wangsu Road, Heihe City 164399, Heilongjiang Province, China e State Key Laboratory of Pathogens and Biosecurity, Department of Vector Biology and Control, Beijing Institute of Microbiology and Epidemiology, No. 20, Dong-dajie Street, Fengtai District, Beijing City 100071, China a r t i c l e i n f o a b s t r a c t Article history: In order to investigate the diversity of spotted fever group (SFG) Rickettsia infection in hard ticks, ticks Received 29 April 2015 were harvested from the forest areas in Suifenhe city, along the Chinese–Russian border and conventional Received in revised form 26 February 2016 PCR was carried out using universal SFG Rickettsia primers targeting gltA and ompA genes to screen for Accepted 29 February 2016 their infection with SFG Rickettsia organisms. Results showed that of the 215 ticks belonging to Ixodes Available online xxx persulcatus, Haemaphysalis concinna and Haemaphysalis japonica Warburton, 1908 species, 138 (64.2%) were positive for SFG Rickettsia. Three species of SFG Rickettsia were detected, Rickettsia raoultii, Rickettsia Keywords: heilongjiangensis and Candidatus Rickettsia tarasevichiae. No co-infection with different species of SFG Rickettsia raoultii Rickettsia was found in any individual tick among the three tick species. We detected more than one R. heilongjiangensis SFG Rickettsia species in ticks from each of the three tick species with an overlapping distribution and Candidatus Rickettsia tarasevichiae Ixodes persulcatus potentially similar transmission cycles of SFG Rickettsia in the areas surveyed. Consequently, different Suifenhe pathogenic rickettsial species may be involved in human cases of rickettsiosis after a bite of the three above-mentioned tick species in that area Rickettsia © 2016 Published by Elsevier GmbH. Introduction Rickettsia heilongjiangensis in Northeastern China; Rickettsia sibi- rica (mongolotimonae strain) in Asia and Rickettsia honei in Australia Rickettsiae, a group of obligate intracellular Gram negative and Southeast Asia). In general, the clinical manifestations of most bacteria, is subdivided into two major groups based on serological SFG rickettsiosis constitute a very broad spectrum; even when the characteristics, namely, the typhus group (TG) and the spotted fever proportion of patients with an eschar is considered to be clinically group (SFG) (Tay et al., 2014; Gillespie et al., 2007; Roux and Raoult, characteristic, the presentation varies for patients infected with the 2000; Tsui et al., 2007; Sarih et al., 2008). Among them, the SFG same strain in different geographic areas (Fournier et al., 2005). Rickettsia organisms were known to be regionally distributed and In fact, most spotted fever rickettsiosis syndromes are similar, maintained via tick vectors by transovarial and transstadial trans- including fever, headache, muscle pain, rash, and a characteristic mission in nature, and occasionally infected victims through tick inoculation eschar (‘tache noire’) at the site of the bite (Santibánez˜ bite (Brouqui et al., 2004). During the past 3 decades, many novel et al., 2013). Consequently, it is not easy to carry out differential SFG Rickettsia isolates have been characterized by newer meth- diagnosis of rickettsiosis by Rickettsia species based only on clini- ods for genetic analysis (Socolovschi et al., 2009a). A large number cal features of human cases. Today, more precision laboratory tests, of these Rickettsia species are agents of human diseases in areas for example, sequencing and genetic analysis, are being employed of the world where rickettsioses had not previously been exten- to diagnose human rickettsiosis in more and more countries and sively investigated. (e.g., Rickettsia japonica in Japan and Korea; regions (Jia et al., 2013). In China, various species of SFG Rickettsia including R. hei- longjiangensis, Rickettsia slovaca, Rickettsia raoultii, Rickettsia felis, ∗ Rickettsia hulinii, Candidatus R. tarasevichiae and Rickettsia mona- Corresponding author. Tel.: +86 1066948579. E-mail addresses: [email protected], [email protected] (Y. Sun). censis have also been found in ticks, animal hosts and humans http://dx.doi.org/10.1016/j.ttbdis.2016.02.023 1877-959X/© 2016 Published by Elsevier GmbH. Please cite this article in press as: Cheng, C., et al., Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe, Chinese–Russian border. Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.02.023 G Model TTBDIS-629; No. of Pages 5 ARTICLE IN PRESS 2 C. Cheng et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx Table 1 Details of primers used in the study. ◦ Gene target Primer name Primer sequence (5 → 3 ) Amplicon size (bp) Annealing temperature ( C) Reference gltA RpCS.877p GGGGGCCTGCTCACGGCGG 381 49 Regnery et al. (1991) RpCS.1258n ATTGCAAAAAGTACAGTGAACA RpCS.896p GGCTAATGAAGCAGTGATAA 337 54 Roux et al. (1997) RpCS.1233n GCGACGGTATACCCATAGC ompA Rr190.70p ATGGCGAATATTTCTCCAAAA 631 46 Roux et al. (1997) Rr190.701n GTTCCGTTAATGGCAGCATCT Rr190.70p ATGGCGAATATTTCTCCAAAA 532 50 Regnery et al. (1991) Rr190.602n AGTGCAGCATTCGCTCCCCCT (Zhang et al., 2000, 2014; Tian et al., 2012; Jia et al., 2013; Sun Results et al., 2014). Diverse SFG Rickettsia in ticks and/or animal hosts may pose a potential health threat and may be suspected in tick-bite A total of 215 unfed adult ticks, representing 120 Ixodes per- victims presenting with fever from unclear rickettsial etiology. In sulcatus (54 males and 66 females), 55 Haemaphysalis concinna China, for the most part, current diagnostic technologies for SFG (20 males and 35 females) and 40 H. japonica (13 males and Rickettsia mainly depend on the clinical presentation and rarely 27 females), were collected from broad-leaved forest areas in genus-specific PCR determinations. It is therefore important and Suifenhe, Chinese–Russian border (Table 2). Samples positive for urgent to study the diversity of SFG Rickettsia in ticks, animal hosts corresponding fragments of both gltA and ompA genes of SFG Rick- and humans as this would improve their differential diagnosis ettsia were considered to be rickettsial species (Fournier et al., and strengthen prompt administration of the appropriate ther- 2003). Using this criterion, positive Rickettsia DNA was detected in apy. In this study, we investigated the tick-borne SFG rickettsiae in 138 ticks for both gltA and ompA by gene-specific PCR. Of them, Suifenhe forest areas along the Chinese–Russian border to reveal 97 I. persulcatus (46 males and 51 females), 30 H. concinna (10 the diversity of SFG Rickettsia in the natural foci using PCR and males and 20 females) and 11 H. japonica (5 males and 6 females) sequencing methods. were involved. The overall infection rate was shown to be 64.2% but ranged from 27.5% to 80.8% in the three species with the highest in I. persulcatus (Table 2). Moreover, three species of SFG Rickettsia (R. Material and methods raoultii, R. heilongjiangensis and Candidatus Rickettsia tarasevichiae) were identified from the tick specimens with available sequences Ticks encoding partial fragments of gltA and ompA genes (Table 3). Among I. persulcatus ticks, 87/97 (39 males and 48 females) were Blanket dragging on vegetation was utilized to obtain unfed ticks found to harbor Candidatus R. tarasevichiae, 9 ticks (7 males and 2 in Suifenhe counties, Heilongjiang province during April and July females) were infected with R. raoultii and only one female with 2014. Morphological identification of all ticks was performed using R. heilongjiangensis. Candidatus R. tarasevichiae appeared to be the taxonomic keys (Teng and Jiang, 1991). dominant Rickettsia species in I. persulcatus ticks. Seventeen H. concinna (11 males and 6 females) were found positive for R. hei- DNA extractions and PCR longjiangensis, 9 ticks (2 males and 7 females) for R. raoultii and only two ticks (a male and female) were found infected with Candidatus Upon identification, the ticks were ground in liquid nitrogen, R. tarasevichiae Although all the Hae. japonica tick specimens tested and 200 mg of the homogenate was transferred into a centrifu- negative for Candidatus R. tarasevichiae, 9 of them (4 males and 5 gal tube for DNA extraction with DNeasy Blood and Tissue Kit females) were positive for R. raoultii along with another male and (Qiagen, Hilden, Germany) according to the manufacturer’s instruc- female that had R. heilongjiangensis (Table 2). tions. DNA extracts were used as templates for PCR assays with As mentioned above, a total of 3 SFG Rickettsia species were primer sets targeting partial sequences of gltA and ompA genes. The found in the three tick species. R. heilongjiangensis was found in ␮ × 50 l PCR reaction mixture contained 5 Colorless GoTaq Reac- I. persulcatus, H. concinna and H. japonica ticks. The nucleotide ␮ tion buffer (Promega), 20 M of each primer, 2.5 mM of each dNTP, sequences coding ompA gene in R. heilongjiangensis harbored by ␮ 5 U/ l of recombinant GoTaq DNA Polymerase (Promega), ion-free- the infected tick specimens had similar Lys-deletion and Gln139His ␮ water and 5 l of DNA from each sample. DNA of Candidatus R.