Cross-Serotype Protection Against Group a Streptococcal Infections Induced by Immunization with Spy 2191

ARTICLE

https://doi.org/10.1038/s41467-020-17299-x OPEN Cross-serotype protection against group A Streptococcal infections induced by immunization with SPy_2191

Pooja Sanduja 1,6,8, Manish Gupta 2,8, Vikas Kumar Somani 2,7, Vikas Yadav 1, Meenakshi Dua3, ✉ Emanuel Hanski 4, Abhinay Sharma 4, Rakesh Bhatnagar 5,9 & Atul Kumar Johri 1,9

Streptococcus 1234567890():,; Group A (GAS) infection causes a range of diseases, but vaccine development is hampered by the high number of serotypes. Here, using reverse vaccinology the authors identify SPy_2191 as a cross-protective vaccine candidate. From 18 initially identified surface proteins, only SPy_2191 is conserved, surface-exposed and inhibits both GAS adhesion and invasion. SPy_2191 immunization in mice generates bactericidal antibodies resulting in opsonophagocytic killing of prevalent and invasive GAS serotypes of different geographical regions, including M1 and M49 (India), M3.1 (Israel), M1 (UK) and M1 (USA). Resident splenocytes show higher interferon-γ and tumor necrosis factor-α secretion upon antigen re- stimulation, suggesting activation of cell-mediated immunity. SPy_2191 immunization significantly reduces streptococcal load in the organs and confers ~76-92% protection upon challenge with invasive GAS serotypes. Further, it significantly suppresses GAS pharyngeal colonization in mice mucosal infection model. Our findings suggest that SPy_2191 can act as a universal vaccine candidate against GAS infections.

1 School of Life Sciences, Jawaharlal Nehru University, New Delhi 110067, India. 2 BSL-3 Unit, Molecular Biology and Genetic Engineering Laboratory, School of Biotechnology, Jawaharlal Nehru University, New Delhi 110067, India. 3 School of Environmental Sciences, Jawaharlal Nehru University, New Delhi 110067, India. 4 Department of Microbiology and Molecular Genetics, The Institute for Medical Research–Israel-Canada(IMRIC), Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem, Israel. 5 Banaras Hindu University, Varanasi, Uttar Pradesh, India. 6Present address: Division of Infectious Diseases, Department of Pediatrics, Boston Children’s Hospital, Harvard Medical School, Boston, MA, USA. 7Present address: Division of Oncology, Washington University School of Medicine, St. Louis, MO, USA. 8These authors contributed equally: Pooja Sanduja, Manish Gupta. 9These authors jointly supervised this ✉ work: Rakesh Bhatnagar, Atul Kumar Johri. email: [email protected]

NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x

treptococcus pyogenes or GAS is a human pathogenic promising universal vaccine candidate, in providing significant S bacterium. It causes a range of suppurative diseases protection against the globally prevalent and invasive GAS ser- (pharyngitis, impetigo), invasive diseases [necrotizing fas- otypes in different geographical areas. ciitis, streptococcal toxic shock syndrome (STSS)] and poststreptococcal sequel [Acute rheumatic fever (ARF), rheumatic Results heart disease (RHD), glomerulonephritis]. Annually, GAS causes Inhibition of adherence and invasion. For effective vaccination, 616 million cases of pharyngitis, 18.1 million severe cases and the potential vaccine candidate must be surface exposed, involved 517,000 deaths worldwide1. GAS is ninth leading infectious – in invasion and adherence23 26. Out of 52 previously predicted bacteria in the estimate of mortality and falls with measles, vaccine candidates, 45 sets of immune and preimmune mouse Haemophilus influenza type b and hepatitis B. Further, GAS antisera, generated against recombinant surface/secretory pro- causes high morbidity and mortality mostly in low and middle- teins of GAS (Supplementary Table 1)20,21 were used to investi- income countries. GAS pathogenicity is underestimated due to gate whether the corresponding surface/secretory proteins had lack of data from developing countries (South-Asian and Sub- any role in adherence or invasion. Initially, GAS serotype M49 Saharan African countries). that caused outbreaks in India and USA was used for this study as The M protein of GAS is a surface-exposed protein with a this serotype was found to be most invasive27,28. We found that highly variable N-terminal region that forms the basis of different 18 out of 45 antisera inhibited GAS adhesion by ≥75%; however, serotyping in GAS2. More than 220 serotypes of GAS are pre- only seven antisera abolished invasion by ≥80% (Table 1). We valent in different geographical regions3. Prevalence of a serotype found SPy_2191 antisera inhibited adherence and invasion by 89 also changes in few years with time in different regions4,5. The M and 93%, respectively (Table 1). Preimmunized mice antisera for protein is a major virulence factor of GAS that helps in adhesion each recombinant GAS protein were used as a control. and invasion of bacteria to epithelial cells and also in evading the host innate immune response due to its anti-phagocytic func- tion6–8. Few vaccine preparations like 26-valent, 30-valent and J8 Selection of surface-exposed antigen. One of the criteria for were made based on the M-protein, are currently in phase I or II effective vaccination against any pathogen involves surface clinical trials. Additionally, various other subunit vaccines like exposure of an antigen and its accessibility by specific host- C5a peptidase, GAS carbohydrate and serum opacity factor, have generated antibodies29. To narrow down our focus in subsequent also shown promising results, however no clinical trials were studies on the development of a broad-range GAS vaccine, we conducted related to these preparations9–14. The progress in employed all the 18 antisera (inhibiting adhesion) to confirm the development of an effective vaccine against GAS is further exposure of their respective target antigen on Indian GAS M49 impeded due to serotype diversity in different geographical areas, cell surface using flow cytometry analysis. Data were analyzed antigenic variation within serotype and cross-reacting antibodies using the mean fluorescence intensity (MFI) obtained in both causing auto-immune disorders like ARF and RHD2,3,15,16. immunized and preimmunized antisera. Candidates showing Currently, antibiotics like penicillin and cephalosporins among >2.4-fold increase in MFI as compared to preimmune controls others are in use to combat various GAS diseases. However, were considered significantly surface exposed (Fig. 1a). Out of 18 antibiotic resistance developed by some GAS clinical isolates protein candidates, 10 were found to be significantly exposed on against macrolides and tetracyclines in various geographical GAS cell surface (Fig. 1a, Table 1). regions, has led to a worldwide concern17. Till date, regardless of a high demand globally, no vaccine has been licensed against GAS In silico analysis and selection of SPy_2191. Out of the 10 infections. potential surface-exposed GAS vaccine candidates, nine did not Genome sequences of various pathogenic bacteria and viruses show significant inhibition of invasion and therefore were not are available for the past two decades and have been exploited considered for further experiments (Table 1). Only SPy_2191- immensely in vaccine development. One approach, which was showed significant inhibition of both adhesion and invasion. found to be highly successful to identify universally applicable Additionally, in overlay diagram, GAS M49 incubated with vaccine candidates, is reverse vaccinology. It was first tested on SPy_2191-immunized antisera had significantly higher MFI in serogroup B meningococcus18. Reverse vaccinology coupled with comparison to GAS alone and GAS M49 incubated with pre- comparative genomics, proteomics, and bioinformatics allow immune antisera (Fig. 1b), suggesting SPy_2191 is surface reducing the number of pre-clinical candidates to be analyzed for – exposed. Therefore SPy_2191 was selected for subsequent studies. immunogenicity19 21. It has been established that a successful Our BLAST analysis revealed that the SPy_2191 coding sequence vaccine candidate must be conserved, immunogenic, either sur- was highly conserved across various GAS serotypes of developed face exposed or secretory and should be well expressed22. and developing countries, with >98% similarity in all the GAS Importantly, universal vaccine candidates must protect against genome sequences available in the NCBI database. serotypes prevalent in different geographical areas. Based on reverse vaccinology approach, we predicted a total of 147 genes as universal GAS vaccine candidates. We further validated the in SPy_2191 elicit a humoral immune response. The SPy_2191 fi silico analysis by exploring the distribution pro le of these pre- antigen was expressed in E. coli BL21 (DE3) cells as His6-tagged dicted genes in non-sequenced Indian GAS strains. Among these, recombinant protein and purified to >95% purity by Ni-NTA 52 genes were present in all the prevalent GAS serotypes of affinity chromatography (Supplementary Figs. 1–4). Mice Indian origin21. In the current study, the available 45 recombi- immunization was performed as illustrated in Fig. 2a. The nant sera previously generated against these 52 and the other SPy_2191-specific serum IgG titres were measured at day 14 after reported genes20,21 are screened for their role in adherence and priming, followed by booster immunizations (day 28 and 42) by invasion. Among those that are found to be involved in adherence indirect ELISA (Fig. 2b). Compared to primary immunization, are subsequently checked for their exposure from the surface of the total serum IgG endpoint titers after the 1st and 2nd booster GAS serotypes of Indian origin. Only one candidate, SPy_2191 immunizations were found to be ~3.5 and ~5-fold higher, tests as a potential vaccine candidate in the mouse model against respectively (p < 0.0001) (Fig. 2b). Our data related to high IgG five prevalent and invasive GAS serotypes from India, Israel, UK titres (induced by SPy_2191 vaccination) suggested a resilient and USA. Importantly, this finding highlights SPy_2191 as a humoral immune response.

2 NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x ARTICLE

Table 1 Neutralization assay showing inhibition of GAS M49 adherence and invasion to HEp-2 cells.

NCBI reference no Protein annotation % adhesion inhibition % invasion inhibition aNP_268656 cABC transporter substrate-binding protein 77.6 19.1 aNP_268747 cABC transporter metal binding protein (lipoprotein) 81.4 29.0 aNP_269961 cSurface lipoprotein 75.3 40.8 aNP_269968 cLaminin adhesion 99.8 36.1 aNP_269203 cExtracellular hyaluronate lyase 79.8 0.95 NP_269743 cEsterase 78 24.0 aNP_269944 cStreptokinase A/ Streptokinase A precursor 75.8 65.7 NP_269981 bATP-binding cassette transporter-like protein 77.8 89.9 aNP_269984 bFoldase PrsA 91.7 95 aNP_270099 (This study) Hypothetical protein SPy_2191/Transglycosylase SLT domain family 89 93 protein NP_269045 bHypothetical protein SPy_0836 96 96.9 NP_269051 cHypothetical protein SPy_0843 99.6 73.3 aNP_270005 bDipeptidase 88.3 99.7 aNP_270119 cSerine protease 89.2 23.1 aNP_269570 bHypothetical protein SPy_1492 86 84.6 aNP_269402 bcAMP factor 97 36.9 aNP_268542 bABC transporter lipoprotein 78.9 15.7 aNP_269268 bAcid phosphatase/ phosphotransferase 99.7 86.4

For this purpose 18 antisera generated against surface proteins were selected. aRepresent protein candidates showing high relative expression in M49/IND as compared to M1/IND GAS. bOut of these 18, eight candidates were rejected as they were not found to be surface exposed (Fig. 1). cFrom the remaining 10 candidates, nine candidates, though found to be involved in adherence as well as surface exposed but not showed signiﬁcant inhibition in invasion therefore were not selected. Only one candidate i.e., NP_270099 showed inhibition in adherence and invasion as well as found to be surface exposed (Fig. 1), therefore was selected for further study. Bold numbers: More than 75% inhibition in adherence and invasion.

a b NP_269268 NP_268542 NP_269402 NP_269570

NP_270119 Cell number NP_269051 NP_269045 NP_270099 Fluorescence intensity NP_269984 NP_269981 NP_269743 GAS antigens NP_269203 NP_269968 NP_269961 NP_268747 NP_268656 NP_270005 NP_269944

012345 Fold difference in mean fluorescence intensity

Fig. 1 Surface localization of potential vaccine candidates on GAS M49 surface. a Surface exposure analysis of 18 selected candidates. GAS M49 cells were incubated with protein-specific polyclonal antibodies and surface localization was analyzed by flow cytometry using FITC-conjugated secondary goat anti-mouse IgG. Mean fluorescence intensity (MFI) obtained for each immunized serum (I) was normalized with the MFI of preimmunized sera (PI) to measure the fold difference. Serum candidates showing >2.4-fold difference in MFI (represented by red dotted line) were considered significant. b Histogram depicting SPy_2191 surface exposure. In the overlay diagram, purple line represents control M49 GAS cells without antisera, blue line represents cells with preimmunized antisera and red line represents cells incubated with SPy_2191 antisera. Experiment was repeated two times and data shown here are a representative experiment.

SPy_2191 -speciﬁc serum antibodies mediate GAS opsono- manner. Hence, to ascertain the biological activity of the phagocytic killing. Conservation of SPy_2191 sequences across SPy_2191 -speciﬁc IgG antibodies, sera was tested for comple- different GAS serotypes led us to hypothesize that SPy_2191 ment mediated opsonophagocytic killing of different GAS could trigger protective immunity in a serotype-independent serotypes by whole blood bactericidal assay. For this purpose,

NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications 3 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x

a Recall response to SPy_2191 antigen (cytokine profiling)

Enumeration of Serum anti-SPy_2191 Ab titres bacterial load in lungs, 14,28 and 42 day post priming liver, spleen and skin

C57BL/6 mice Immune profiling Day 5 Protection studies (female, 6 weeks old)

–8 –6 –4 –2 0 1 2 (weeks)

Immunization Challenge Subcutaneous route Different GAS serotypes (SPy_2191 or PBS alone) through intraperitoneal route

b 5.0×105 c p = 0.0274 100

4.0×105 90

3.0×105 80

2.0×105

Antibody titre 70

5 % reduction in CFU 1.0×10 60

0 50 14 28 42

Days after first immunization M3.1/IL M1/UK M1/IND M49/IND M1/USA

Fig. 2 SPy_2191 induces humoral immune response. a Immunization schedule in C57BL/6 mice. b SPy_2191 specific total IgG endpoint titres in sera samples (n = 6 mice) collected 2 weeks after priming (day 14) and booster immunizations (day 28 and 42), was measured by Indirect ELISA. One-way ANOVA followed by Tukey’s multiple-comparison test was employed for calculating the significant difference. Data are presented as mean values ± SEM c Opsonophagocytic activity of SPy_2191 specific antibodies containing sera (n = 4), was evaluated for bactericidal assay, against various GAS serotypes, viz. M1/IND, M49/IND, M3.1/IL, M1/USA, and M1/UK. Percent reduction of CFU by SPy_2191-immunized sera was estimated in comparison to PBS- immunized mice sera, used as control. Data are presented as mean values ± SEM. ****P < 0.0001.

PBS-immunized mice sera were used as control. Importantly, all mice (Fig. 3a, b). In case of IL-2 no significant difference was the tested GAS serotypes (used in this study) were found to be observed between both the groups (Fig. 3c). In contrast to the prevalent, caused invasive diseases in various geographical strong Th1 response, Th2-specific IL-6 levels were found to be areas like USA, Australia, New Zealand, and UK in the past ~7.5-fold significantly higher in the culture supernatant of decade27,30–33. Remarkably, in the presence of SPy_2191 -specific SPy_2191-vaccinated mice as compared to PBS-treated mice antibodies the mean reduction in CFUs of different GAS ser- (Fig. 3d). However, the levels of IL-4 and IL-10 cytokine levels otypes was observed between 70 and 90 %, with highest reduction were found to be statistically insignificant under similar condition was found in case of M49/IND (~90 %) followed by M1/IND (Fig. 3e, f). Additionally, stimulation with SPy_2191 antigen (~84 %) and M1/USA (~77 %) (Fig. 2c). Likewise, in case of triggered a robust secretion of Th17-specific proinflammatory M3.1/IL and M1/UK GAS serotypes, ~75 and 71 % reduction in cytokine like IL-17A (P < 0.001; Fig. 3g). CFUs were observed (Fig. 2c). In situ protection and expanded serotype coverage by SPy_2191 evoked Th1-baised immune response. To monitor the SPy_2191 vaccination. We further assessed protective efficacy of efficacy of SPy_2191 vaccination on the development of helper T SPy_2191 upon challenge with GAS serotypes from different cell, the memory-recall response of ex vivo cultured splenocytes geographical areas. Two weeks after the final booster, SPy_2191 was assessed by measuring the level of different cytokines released and PBS vaccinated mice were challenged intraperitoneally with in the culture supernatant after antigen stimulation. Two weeks the LD50 dose of different GAS serotypes (Supplementary after the final booster (day 42), mice were euthanized; splenocytes Table 2). Four days post-challenge, mice were sacrificed asepti- were isolated and stimulated with SPy_2191 antigen for 72 h. cally and the total bacillary load in the liver, lungs, spleen, and Overall, a superior cytokine response was observed in SPy_2191- skin was enumerated. Remarkably, in case of all the serotypes, a fi – vaccinated mice as compared to PBS-immunized mice, which signi cant decrease i.e., ~3 5 Log10 GAS CFU load was observed produced low amount of cytokines upon antigen-stimulation in all the organs of SPy_2191-immunized mice as compared to (Fig. 3). Among all the analysed cytokines, Th1-specific IFN-γ the PBS-treated mice (p < 0.01). This decrease in total bacillary and TNF-α level were found to be ~27- and ~15-fold higher in load in case of each organ was found to be >99% (Fig. 4a–e). case of SPy_2191-vaccinated mice as compared to PBS-treated Direct protection to streptococcal infection and extended GAS

4 NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x ARTICLE

abc 4000 3000 8 2500 3000 2000 6 2000 1500 1000

1000 (pg/mL) 4 (pg/mL) α γ 500 IL-2 (pg/mL) IFN- 200 TNF- 250 2 100 125 0 0 0 g p = 0.0006

PBS PBS PBS 1500

SPy_2191 SPy_2191 SPy_2191 1200 900 d ef 3000 200 10 600 300 2400 8 150

IL-17A (pg/mL) 40 1800 6 20 100 1200 4 0 IL-6 (pg/mL) IL-4 (pg/mL) IL-10 (pg/mL) 50 600 2 PBS SPy_2191 0 0 0

PBS PBS PBS

SPy_2191 SPy_2191 SPy_2191

Fig. 3 Th1-baised antigen recall response by SPy_2191-immunized mice splenocytes. Two weeks after the final immunization, splenocytes were extracted (n = 5), cultured under ex vivo conditions and stimulated with SPy_2191 antigen for 72 h. a–g Release of Th1-specific IFN-γ, TNF-α, and IL-2; Th2-specific IL-4, IL-6, and IL-10, and Th17-specific IL-17A cytokines, was measured in the extracellular culture supernatant. Two-tailed unpaired t-test was employed for calculating the significant difference in all the cases. Data are presented as mean values ± SEM. ****P < 0.0001. serotype coverage in parallel to the findings of opsonophagocytic Discussion killing assays; reaffirm the potential of SPy_2191 as a vaccine GAS causes high mortality and morbidity in developing countries candidate against GAS infection. as compared to developed countries34. In addition to their het- GAS being the most common cause of bacterial pharyngitis, we erogenic serotype distribution worldwide, GAS has an array of further monitored the efficacy of SPy_2191 vaccination in virulence factors, which can evade or inhibit human immune preventing a mucosal infection. For pharyngeal colonization, system making it difficult to design a universal vaccine against all GAS M9 serotype (UK) was used. For this purpose, viable counts serotypes. Surface/secretory proteins were suggested as compel- were enumerated on day 5 post nasal infection. Interestingly, the ling vaccine candidates19,29. The surface-exposed M-protein of SPy_2191-vaccinated mice showed (~19 folds) significantly lower GAS has been identified as a prominent virulence factor7 pri- CFUs in nasopharynx as compared to PBS-treated mice (Fig. 4f; marily due to its crucial role in adhesion to the host cell surface35. p < 0.01). Therefore, M-protein-based vaccine preparation has been well established. The 30-valent vaccine was shown to evoke bactericidal antibodies against 30 vaccine serotypes and also against 24 SPy_2191 provides cross-serotype protection against GAS of 40 tested non-vaccine serotypes of GAS, suggesting that its infection. Further, we have tested if SPy_2191 vaccination could protective efficacy would be better than predicted10. Further, it increase the survival efficacy of mice challenged with GAS ser- has been reported that 26-valent M protein-based vaccine would otypes of different geographical regions. We observed that all the cover more serotype diversity in developed countries but its PBS-treated mice succumbed to death within 8 days post-chal- coverage would be very less in severely affected areas and tech- lenge, regardless of the GAS serotype (Fig. 5). Most importantly, nologically less advance countries like Sub-Saharan African SPy_2191 was found to be significantly protective with ~92, ~86, countries and Pacific region36. However, due to the emergence of ~86, ~81, and ~76 % mice survival after challenge with M3.1/IL, new emm types, it has been suggested that M-protein-based M1/IND, M1/USA, M49/IND, and M1/UK GAS serotypes, multivalent vaccine should also be tested against serotypes of respectively (p < 0.001) (Fig. 5). As SPy_2191 triggered a cross- high-income as well as low- and moderate-income countries. serotype immunity, it could be employed as a universal GAS Therefore, this preparation may not be effective against many vaccine candidate, protecting against prevalent and invasive ser- unknown GAS serotypes37. Henceforth, there is an urgent need to otypes from different geographical areas. identify a universal vaccine candidate against GAS infections.

NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications 5 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x

a M49/IND b M1/IND 10 10

8 8 CFU) CFU) 10 6 10 6

4 4

2 2 Organ load (Log Organ load (Log

0 0

PBS PBS PBS PBS PBS PBS PBS PBS

SPy_2191 SPy_2191 SPy_2191 SPy_2191 SPy_2191 SPy_2191 SPy_2191 SPy_2191

Lungs Liver Spleen Skin Lungs Liver Spleen Skin

cdM3.1/IL M1/USA 10 10

8 8 CFU) CFU) 10 10 6 6

4 4

2 2 Organ load (Log Organ load (Log

0 0

PBS PBS PBS PBS PBS PBS PBS PBS

SPy_2191 SPy_2191 SPy_2191 SPy_2191 SPy_2191 SPy_2191 SPy_2191 SPy_2191

Lungs Liver Spleen Skin Lungs Liver Spleen Skin

efM1/UK p = 0.0012 10 5

8 CFU) 4 10 CFU) 10 6 3

4 2

2 1 Organ load (Log Nasopharynx load (Log 0 0

PBS PBS PBS PBS PBS

SPy_2191 SPy_2191 SPy_2191 SPy_2191 SPy_2191

Lungs Liver Spleen Skin

Fig. 4 SPy_2191 immunization reduced organ load post-challenge with different GAS serotypes. Two weeks after the final booster immunization with SPy_2191, C57BL/6 mice were challenged intraperitoneally with different GAS serotypes. Four days post-challenge, three mice from both SPy_2191- immunized and placebo groups were sacrificed, and the bacterial load (represented as Log10 CFU) was enumerated in the liver, lungs, spleen and skin. a–d and e represents data of different organ load after challenge with M49/IND, M1/IND, M3.1/IL, M1/USA, and M1/UK serotypes, respectively. Red bar represents CFUs obtained from PBS control mice and blue bar represents CFUs obtained from SPy_2191-immunized mice. In case of all the organs, across all the infected serotypes, SPy_2191 effectively reduced the bacterial load compared to the placebo group (minimum significance p < 0.01). f The nasopharyngeal streptococcal load in SPy_2191 and PBS-immunized mice (n = 6), 5 days post-intranasal challenge with GAS M9/UK (**P < 0.01). Data are presented as mean values ± SEM. The level of significance was checked by using two-tailed unpaired t-test.

6 NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x ARTICLE

100 90 PBS/M1/IND 80 SPy_2191/M1/IND 70 PBS/M49/IND 60 SPy_2191/M49/IND 50 PBS/M1/USA

% Survival 40 SPy_2191/M1/USA 30 PBS/M1/UK 20 SPy_2191/M1/UK PBS/M3.1/IL 10 SPy_2191/M3.1/IL 0 0 2 4 6 8 10 Days post-infection

Fig. 5 SPy_2191 immunization provided cross-serotype protection against GAS. Survival of mice (n = 12) from each group infected with different GAS serotypes, was monitored for death until 10 days. The results are presented as percent survival. To calculate the signiﬁcance of difference in survival studies, the log-rank test (Mantel-Cox) was applied. ***P < 0.001; ****P < 0.0001. Survival curves were generated from two independent experiments.

Identification and characterization of GAS vaccine candidates inducing humoral adaptive immune responses as we observed have been reported earlier also. In the past, high throughput significantly high IgG antibody endpoint titer after second and strategies have been used to identify antigens that are immuno- third immunization in comparison to first immunization genic during GAS infection. Similarly, proteomic analyses of (Fig. 2b). Five prevalent and invasive GAS serotypes of Israel, UK, surface-associated proteins have been employed to map for sui- USA, and India were tested for bactericidal assay to validate the table GAS vaccine candidates20. In the latter studies, interpreta- functionality of the SPy_2191-induced humoral immunity. The tions have been drawn either based on antigen’s immunogenicity average killing was observed against all tested serotypes, which index or on its cell surface-exposure. In order to identify a uni- range between 71–90% (Fig. 2c). Our data suggest that antibodies versal vaccine candidate, we have undertaken a very robust three present in sera were able to opsonize and kill all the GAS ser- point criteria for selection, viz. (1) candidate should be surface otypes successfully. exposed and conserved across prevalent and disease causing GAS It is known that cytokines are the effector molecules that serotypes of developed as well as developing countries (2) control and determine the type of adaptive immune response involved in both GAS adhesion as well as invasion (3) should be generated within a host, upon encountering any pathogen39. Re- immunogenic in nature to induce adaptive immune response in stimulation of SPy_2191-vaccinated mice splenocytes with the host. Based on these criteria and stringent screening, we found antigen showed higher secretion of Th1-type IFN-γ and TNF-α that SPy_2191 was the only surface-exposed required for both cytokines, signifying the activation of cell-mediated adaptive GAS adhesion as well as invasion (Table 1 and Fig. 1). Further, immunity (Fig. 3a). TNF-α is known to instigate the NF-κB the presence and conservativeness of SPy_2191 was checked in all pathway which involved induction in the synthesis of other innate the available sequenced genomes of GAS. We found that it was cytokines like IL-10 and IL-640. In our study also, a significant 98% conserved in all available GAS genomes. On the basis of its increase in Th2-type IL-6 cytokine was observed upon SPy_2191 conserved nature, we speculate that SPy_2191 might be essential vaccination. Similarly, upon antigen recall, the subsequent for viability or persistence of most of the GAS serotypes circu- increase in the secretion of proinflammatory cytokine-IL-17A, lation in human population. Additionally, we found that it could be another salient arsenal of SPy_2191 immune response in induces good immunity and provides good protection in mice. increasing the protective efficacy against GAS serotypes (Fig. 5). Therefore present study conclusively defines a robust and The pivotal role of IFN-γ and IL-17A cytokines in protection and improved approach to identify and validate one of the best pos- clearance of invasive GAS infections is well documented10,41–44. sible universal vaccine candidates. Indeed, IFN-γ at the infection site is thought to be critical SPy_2191 was first reported in a genome-wide study and found for protection and it further triggers the activation and func- to be expressed more during phagocytosis38. The 204 amino acid tioning of myeloid cells including polymorphonuclear leukocytes residue protein harboured a 41-mer signal peptide and was pre- (PMNs), which play a key role in survival from GAS infections41. dicted to be transported by the Sec translocon and cleaved by Altogether, we suggest that higher production of Th1-specific signal peptidase I (SignalP-5.0). Further, the conserved domain IFN-γ and TNF-α, and Th17-specific IL-17A cytokines by prediction tool of NCBI suggests SPy_2191 to be an apparent splenocytes in case of SPy_2191-vaccinated mice after antigen member of the Lyz-like superfamily with a lytic transglycosylase re-stimulation mimics its potentiality for a memory-recall domain and two membrane-spanning segments, similar to that of responses against GAS infections and validates immunomodula- soluble lytic transglycosylases (SLT), which catalyze the cleavage tory competency. Whether it is mediated by CD8+ cytotoxic T of the β-1,4-glycosidic bond between N-acetylmuramic acid lymphocytes and CD4+ Th1 lymphocytes is not studied in (MurNAc) and N-acetyl-D-glucosamine (GlcNAc). Although, at the present study45, therefore, needs warrant investigation. this stage the above stated functionality of SPy_2191 is only Importantly, SPy_2191 was found to evoke both humoral as speculative and requires further biochemical characterization. well as cell-mediated adaptive immune responses in mice To test whether the SPy_2191 could induce an immune (Figs. 2b, c, 3a, b). response in mice, after the second and third immunization, Multi-organ failure during GAS infections (STSS and sepsis) antisera were analyzed to check whether antibodies were gener- can be correlated with the bacterial burden of peripheral organs. ated against SPy_2191. We found that SPy_2191 is capable of Therefore, we have also investigated whether vaccination with

NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications 7 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x

abInfection inside host When host is immunized against pathogen with the SPy_2191 GAS GAS

Antibody

GAS Opsonophagocytosis GAS Host cell of pathogen

Adherence of pathogen on host cell surface Host cell

GAS adherence is inhibited by adaptive IFN γ GAS GAS GAS GAS GAS immune response generated by protein T cell-mediated immunity

Host GAS GAS GAS cell

GAS

Colonization of pathogen on host cell surface GAS Host

GAS GAS GAS Further, colonization and invasion of pathogen was inhibited GAS

GAS

Host

Invasion of pathogen in Dissemination of host cell pathogen to various sites inside host Mice survived

Fig. 6 Adhesion and invasion of GAS in placebo and SPy_2191-vaccinated mice. a Graphical representation of how GAS infects a host by ﬁrst adhering then colonizing on the host cell surface, later invades and disseminates inside the cell. b In SPy_2191-vaccinated mice, GAS infection was bypassed plausibly due to the presence of bactericidal antibodies that caused opsonophagocytosis, thus blocking adhesion of bacteria on the host cell surface and subsequently hindered colonization and invasion of GAS within the host. Further a Th1-biased immune response and immuno-stimulation triggered by SPy_2191 helps the mice to survive against GAS challenge’.

SPy_2191 can reduce bacterial load in different organs of mice. report on the vaccine potential of SPy_2191 in modulating host We found that application of SPy_2191 led to enhanced bacterial immune responses. clearance in lungs, liver, spleen and skin of mice upon challenge For the advancement of diseases in the host, bacteria must with different GAS serotypes (Fig. 4a–e). It is important to note adhere, colonize on host surface and invade inside host by sub- that GAS causes ~600 million new cases of pharyngitis each year1. verting host immune system with a range of virulence factors. It has been reported that pharyngeal infection not only causes Gram-positive bacteria such as Streptococci have evolved with acute illness but also can trigger the postinfectious syndromes of diverse pathogenic factors works as adhesins to cause diseases. poststreptococcal glomerulonephritis and acute rheumatic Therefore, we hypothesize that if we can inhibit adhesion of fever46. Although rheumatic fever was found to be uncommon in bacteria to host cells, then we may be able to bypass bacterial most developed countries, however, it is a leading cause of infection inside host (Fig. 6). Our study reports, SPy_2191 is a acquired heart disease in the school going children in case of highly conserved, extracellular protein, involved in adhesion and many economically less developed countries like sub-Saharan invasion; protective, elicit bactericidal antibodies, hence, we Africa, India, etc1. Therefore, we have also used nasopharyngeal conclude that SPy_2191 can act as a universal potential vaccine infection model to test SPy-2191 as a vaccine candidate. Inter- candidate against global important human pathogen GAS. This estingly, SPy_2191 vaccination significantly reduced GAS naso- approach can be used for identification of new vaccine candidates pharyngeal load upon intranasal challenge (Fig. 4f). We suggest against pathogenic bacteria especially those infect host severely that SPy_2191 can also be used as a vaccine candidate in case of after invasion like Listeria, Salmonella, and Shigella47. pharyngeal infection. However, further investigations are required to determine the immunomodulatory mechanism of SPy_2191 induced protection against pharyngitis. The efficacy of Methods a vaccine candidate is judged mainly by the degree of protection it Bacterial strains and culture conditions. GAS serotypes M1 and M49 from India (IND); M3.1 from Israel (IL); M1 from USA; and M1 and M9 (pharyngitis causing provides to the recipient. Ability of SPy_2191 to modulate pro- strain) from UK, were used in the present study. Escherichia coli DH5α and BL21 tective efficacy can be observed at different levels, starting from (DE3) strains were used for cloning and expression of recombinant proteins. GAS activation of Th1 and Th17-specific cytokines, generation of a and E. coli cultures were grown in Todd Hewitt Broth (THB) and Luria-Bertani repertoire of antibodies and reduction of bacterial burden in (LB) medium respectively at 37 °C at 220 rpm shaking. For plating and CFU different organs of mice. Further, SPy_2191 was tested for in vivo enumeration of GAS serotypes, 5% sheep blood agar plates were used. protection and was found to be immunogenic and protective in fi mice against ve prevalent and invasive GAS serotypes belongs to Human cell line and culture conditions. Human epithelial type 2 (HEp-2) cell line four different countries (Fig. 5). Ours is the first comprehensive was procured from the National Centre for Cell Science, Pune, India and used for

8 NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x ARTICLE neutralization assay. HEp-2 cell line was maintained in RPMI 1640 with 10% fetal immunized subcutaneously (n = 18) with optimal concentration i.e. 10 μgof fi bovine serum (FBS), at 37 °C with 5% CO2. recombinant SPy_2191 (Supplementary Fig. 5) in PBS emulsi ed with complete Freund’s adjuvant (CFA) in the ratio of 1:1. Additionally, mice were administered two subcutaneous booster doses of SPy_2191 with incomplete Freund’s adjuvant In vitro neutralization assay. This assay was performed to find the role of selected 24 (1:1) on day 14 and 28. In the placebo group, mice were immunized with CFA/IFA surface proteins in adherence/invasion of GAS . Mice were immunized with 45 in emulsification with PBS alone. Blood was collected by retro-orbital bleeding on different surface-exposed/secretory recombinant proteins followed by collection of fi − 20 speci c time intervals (described below), sera was isolated and stored at 80 °C. antisera . Polyclonal antibodies present in immunized antisera (gift from GSK Two weeks after the final booster, five mice from each group were euthanized vaccine, Siena, Italy) were incubated with GAS and then introduced on HEp-2 cell under anaesthesia by cervical dislocation for splenocyte culturing and cytokine line. Preimmune sera was used as the negative control. Briefly, Indian GAS M49 fi 7 pro ling. was grown till OD600 reaches ~0.5. Cells (4 × 10 ) were collected and diluted in RPMI 1640 in the ratio of 1:10. Forty microliters of GAS dilution was mixed with 10 µl of mice sera (1:250 dilution in PBS) raised against each recombinant protein Measurement of SPy_2191-specific antibody titre. To evaluate SPy_2191 anti- in 2.5 ml RPMI 1640 medium. The mixture was incubated for 1 h at 4 °C and 500 µl gen’s vaccine potential, total serum IgG levels were measured on day 0 (pre- fl of it was added to con uent HEp-2 cells (80 %) at a multiplicity of infection (GAS/ immune), 14, 28, and 42, by indirect enzyme-linked immunosorbent assay mammalian cells) of 0.1:1 in a 24 well plate and kept at 37 °C in a 5% CO2 (ELISA). Briefly, 96-well high-binding, polystyrene microtiter plates (NuncMax- incubator (Shellab, Cornelius, OH, USA) for 2 h. These infected monolayers were iSorp™) were coated with SPy_2191 at a concentration of 500 ng per well, in coating washed thrice with PBS to remove non-adherent GAS. To study invasion, adherent buffer containing 50 mM sodium bicarbonate (pH 9.6). The plate was incubated μ −1 GAS cells were killed by treating the monolayers with 100 gml gentamycin and overnight at 4 °C, followed by blocking with 150 μl of 2% bovine serum albumin μ −1 5 gml penicillin containing complete RPMI 1640 media. The monolayer was (BSA) for 2 h at 37 °C. Serial dilution of the sera was prepared in PBS (102–106) fi then washed ve times with PBS followed by addition of 0.2 ml of 0.25% trypsin- and 0.1 ml of each dilution was added to the SPy_2191 precoated wells in triplicates – EDTA (Himedia, Mumbai, India) for 5 7 min at 37 °C in a 5% CO2 incubator. To and further incubated for 1 h at 37 °C. The plate was then washed four times with obtain the internalized GAS load, monolayer was disrupted using 0.8 ml of ice-cold 1×PBST (1×PBS containing 0.05% tween-20) and incubated with horseradish 0.025% Triton X-100 followed by repeated pipetting. Further, this mixture was peroxidase (HRP) conjugated goat anti-mouse IgG at a dilution of 1:5000, in PBS diluted accordingly and plated on 5% sheep blood agar plates. The plates were containing 2% BSA. After washing four times with 1×PBST, the microtiter plate incubated overnight at 37 °C and GAS CFUs were counted. was incubated in dark with BD OptEIA TMB substrate (BD Bioscience) for 20–30 To study adherence, all the conditions were kept the same as mentioned above, min. The reaction was stopped by adding 1 N HCl before measuring the absor- fi except in this case, no antibiotic treatment was given after the rst 2 h of bance at 450 nm using 570 nm as the reference wavelength, in a TECAN SunriseTM incubation. The number of attached GAS was calculated as total CFUs (attached microplate reader. The endpoint titre was defined as the highest sera dilution that and invaded) minus invaded CFUs. Each test was done in quadruplicate and the gave an absorbance > mean+3 SD absorbance obtained at 1:100 dilution of the number of CFUs recovered per plate was determined. Percent inhibition of only PBS-immunized mice group. adherence was calculated using the formula = [1-mean CFUs in the presence of immunized serum/mean CFUs in presence of preimmunized mice serum] × 100. Bactericidal assay. This in vitro assay was used to validate the functionality of SPy_2191-specific antibodies in GAS killing. For this purpose, GAS serotypes were Flow cytometry analysis of surface proteins. Surface exposed proteins were −5 mapped on the GAS membrane using protein-specific polyclonal antibodies. In grown at 37 °C to OD600~0.6 in 5 ml THB broth and diluted to 10 in sterile 1xPBS. In each case, 50 µl of heat-inactivated serum (1:16 in dilution) was mixed brief, the GAS M49 serotype was grown in THB to an OD600 ~0.4, centrifuged at μ with diluted GAS and incubated for 20 min at 25 °C. As a source of blood cells and 7000 rpm and the resulting pellet was washed with PBS. Five hundred l of bac- μ terial cells were taken and suspended in 50 μl new-born calf serum. This mixture complement, 400 l of non-opsonic heparinized donor blood was added to the was incubated for 20 min at RT. From this, 100 μl of bacterial suspension was mixture and further incubated at 37 °C for 3 h with an end to end rotation. Each dispensed in fresh microcentrifuge tubes and mixed with 100 μl of preimmune/ tube was serially diluted and the mixture was plated in duplicate on 5% sheep blood immune sera (1:100 dilution in PBS containing 0.1% BSA) and further incubated agar plate. Further, plates were incubated overnight at 37 °C and the resulting colonies were counted. Percent reduction in CFUs was counted by the formula— for 30 min. Further, cells were washed with washing buffer (0.1% BSA in PBS) and = incubated with goat anti-mouse IgG conjugated with FITC (in PBS containing Opsonic activity of serum sample [1-mean CFUs in the presence of SPy_2191- 0.1% BSA and 20% new-born calf serum) to a final dilution of 1:100 for 30 minutes. immunized serum/mean CFUs in presence of PBS-immunized mice serum] × 100. Cells were finally washed, re-suspended in PBS and analyzed with BD FACSCa- ™ fl ™ libur ow cytometer using BD CellQuest Pro software (Becton Dickinson). Splenocyte culturing and stimulation. Two weeks after the final booster immunization, five mice from each group were sacrificed and their spleen was Molecular cloning, expression and purification. SPy_2191 was PCR amplified aseptically isolated. The spleen was washed with sterile PBS and crushed between using the genomic DNA of M49 GAS as template and gene specific primers (FP- frosted slides in RPMI 1640 medium containing 10% FBS. To obtain a tissue-free 5’CGCGGATCCATGTTTAAGAAAGAAAATTTAAAACAACG3′ and RP-5′ homogenous cell-suspension, the splenic contents were filtered through a 70 µm CCGCTCGAGGTAACCCCAAGCTGATAAACCTTG3′), at an annealing tem- cell strainer. The contaminating red blood cells (RBCs) were lysed using 0.9% perature of 54.7 °C. Amplified PCR product was eluted using gel extraction kit NH4Cl, for 10 min at room temperature. The resulting cell pellet was washed three (Agilent Technologies, USA) and cloned in protein expression vector pET-21a times with complete RPMI 1640 medium and cell viability was measured by the (Novagen) at the BamHI and XhoI sites, followed by transformation into E. coli trypan blue (0.4%) staining using a haemocytometer. Subsequently, splenocytes DH5α. Positive clones were screened by colony PCR using gene specific primers were seeded at 106 cells per well in a 96-well tissue culture plate in complete RPMI (described above) and confirmed by sequencing (Supplementary Fig. 2). 1640 medium and stimulated with either 10 µg of SPy_2191 antigen in PBS or PBS Plasmid (containing the cloned fragment) was isolated from the positive clones alone (0.2 µm filter-sterilized). Cells were stimulated with concanavalin A as a and transformed into chemically competent E. coli BL21(DE3) cells for SPy_2191 positive control. Plates were incubated at 37 °C with 5% CO2 and 95% humidity. fi fi − expression. The His6-tagged SPy_2191 was puri ed by the Ni-NTA af nity After 72 h of incubation, culture supernatants were collected and stored at 80 °C chromatography. To do this, 500 ml of LB media containing 100 µg ml−1 until further use. ampicillin was inoculated with 0.1% of overnight grown culture and grown to OD ~0.6 at 37 °C with 180 rpm shaking. For protein expression, the culture was 600 ™ induced with 1 mM IPTG and further incubated for 4 h at 37 °C. Cells were Cytokine measurements. The BD Cytometric Bead Array (CBA) mouse Th1/ harvested by centrifugation and suspended in extraction buffer A [50 mM Tris- Th2/Th17 cytokine kit (BD Biosciences) was used to determine the levels of Th1- fi γ α fi fi HCl, pH 8.0, 300 mM NaCl, 1 mM PMSF (serine protease inhibitor), 1 mg ml−1 speci c (IFN- , TNF- , IL-2), Th2-speci c (IL-4, IL-6, IL-10) and Th17-speci c lysozyme, 0.05% Triton X-100] and incubated for 30 min at room temperature. (IL-17A) cytokines in the splenocyte culture supernatant. All the samples were ’ Cells were lysed by sonication (30% amplitude, at 4 °C) on a Sonics VibraCellTM processed according to the manufacturer s instructions. The data was acquired on a TM fl digital sonicator. The lysate was centrifuged for 20 min at 11,000 × g and subjected BD FACSCanto II ow cytometer (Becton Dickinson) installed at the BD-JH fi FACS Academy, Jamia Hamdard, India and analysed using the FCAP ArrayTM to Ni-NTA af nity chromatography (Qiagen). The His6-tagged SPy_2191 bound to the column, was washed first with buffer B [50 mM Tris-Cl (pH 8.0), 300 mM NaCl software, V3.0 (Becton Dickinson). and 5% glycerol] and then by buffer C (buffer B containing 30 mM imidazole). Further, protein was eluted in Buffer B containing 300 mM imidazole. The eluted fi – −1 GAS infection and protective ef cacy. All the GAS challenge experiments were fractions were analysed on SDS PAGE and concentrated to 5 mg ml by using fl Macrosep® Advance Centrifugal Devices (3 kDa cut-off), dialyzed against 1xPBS carried out within laminar ow safety enclosures in the BSL-3 facility and infected pH 7.4 and stored at 4 °C. animals were housed in micro-isolator cages. Mice were challenged intraperitoneally with LD50 of the desired GAS serotypes (1 × 108 CFU per mice in case of M49/IND, M3.1/IL and M1/USA; and 5 × 107 CFU per mice in case of M1/IND Mice immunization. Six weeks old, specific-pathogen-free, inbred, female C57BL/6 and M1/UK) in PBS, 2 weeks after the final booster. For the next 10 days, mice mice were purchased from Hylasco Biotechnology India Pvt. Ltd., housed in a were monitored for behavioural changes and survival or death due to GAS ventilated animal caging system, fed pelleted diet and water ad libitum. Mice were infection. After 10 days, all the remaining mice were euthanized.

NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications 9 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x

Measurement of bacterial load. For enumeration of GAS load in different organs, 11. Batzloff, M. R. et al. Protection against group A streptococcus by viz. lungs, spleen, liver and skin, three mice from both SPy_2191-immunized and immunization with J8-diphtheria toxoid: contribution of J8- and diphtheria placebo groups were euthanized under anaesthesia by cervical dislocation. All the toxoid-specific antibodies to protection. J. Infect. Dis. 187, 1598–1608 (2003). organs were collected aseptically, weighed, washed, and homogenized in 2 ml of 12. Cleary, P. P., Matsuka, Y. V., Huynh, T., Lam, H. & Olmsted, S. B. − sterile PBS. The resulting homogenate was serially diluted to 10 6 in PBS and the Immunization with C5a peptidase from either group A or B streptococci dilutions were plated in duplicate on 5% sheep blood agar plates. The plates were enhances clearance of group a streptococci from intranasally infected mice. incubated overnight at 37 °C and colonies were counted next day. Vaccine 22, 4332–4341 (2004). 13. Sabharwal, H. et al. Group A streptococcus (GAS) carbohydrate as an Intranasal infection. For pharyngeal colonization, SPy_2191-immunized mice immunogen for protection against GAS infection. J. Infect. Dis. 193, 129–135 (n = 6) were intranasally infected with pharyngitis causing M9 (H728) strain48. (2006). Briefly, mice were restrained by physical means and 20 µl of droplet containing 14. Courtney, H. S., Hasty, D. L. & Dale, J. B. Serum opacity factor (SOF) of ~1.2 × 109 CFUs was placed on the nares for inhalation. After 5 days, the naso- Streptococcus pyogenes evokes antibodies that opsonize homologous and pharynx was aseptically dissected, weighed and homogenized in sterile PBS. Bac- heterologous sof-positive serotypes of group A streptococci. Infect. Immun. terial burden was monitored by plating the serial dilutions of homogenized nasal 71, 5097–5103 (2003). tissue onto 5% sheep blood agar plates. 15. Lannergård, J. et al. The hypervariable region of Streptococcus pyogenes M protein escapes antibody attack by antigenic variation and weak – Ethical statement. Mice infection studies were carried out in strict accordance immunogenicity. Cell Host Microbe 10, 147 157 (2011). 16. Massell, B. F., Honikman, L. H. & Amezcua, J. Rheumatic fever following with the recommendations given by the Institutional Animal Ethics Committee – (IAEC), Jawaharlal Nehru University and Council for the Purpose of Control and streptococcal vaccination. JAMA 207, 1115 1119 (1969). Supervision of Experiments on Animals (CPCSEA, Ministry of Social Justice and 17. Cattoir, V. in Streptococcus Pyogenes: Basic biology to clinical manifestations (eds – Empowerment, Government of India), New Delhi. Protocols were approved by Ferretti, J. J., Stevens, D. L. & Fischetti, V.A.) (Oklahoma City, 2016) pp. 1 24. IERB board and all efforts were made to minimize the suffering of mice employed 18. Rappuoli, R. Reverse vaccinology, a genome-based approach to vaccine – in the study with IAEC code 10/2017. development. Vaccine 19, 2688 2691 (2001). 19. Rodríguez-Ortega, M. J. et al. Characterization and identification of vaccine candidate proteins through analysis of the group A streptococcus surface Statistics and reproducibility . GraphPad Prision 6 software (La Jolla, CA) was proteome. Nat. Biotechnol. 24, 191–197 (2006). used for statistical analysis. The GAS challenge experiments were evaluated using 20. Bensi, G. et al. Multi high-throughput approach for highly selective Kaplan–Meier survival estimates and statistically analysed by using Log-rank identification of vaccine candidates: the group A streptococcus case. Mol. Cell (Mantel-Cox) test. For comparisons between multiple groups, one-way analysis of Proteom. 11,1–12 (2012). variance (ANOVA) followed by Tukey’s multiple-comparison test was used. The 21. Sharma, A. et al. Identification of potential universal vaccine candidates level of significance in cytokine production and CFU enumeration studies, was checked by using two-tailed unpaired t-test. All attempts at replication of the data against group A streptococcus by using high throughput in silico and proteomics approach. J. Proteome Res. 12, 336–346 (2013). were successful. All the experiments were replicated and performed independently – at least twice. 22. Grandi, G. Bacterial surface proteins and vaccines. F1000 Biol. Rep. 3,1 3(2010). 23. Maione, D. et al. Identification of a universal group B streptococcus vaccine by multiple genome screen. Science 309, 148–150 (2005). Reporting summary. Further information on research design is available in 24. Johri, A. K. et al. Transcriptional and proteomic profiles of group B the Nature Research Reporting Summary linked to this article. streptococcus type V reveal potential adherence proteins associated with high- level invasion. Infect. Immun. 75, 1473–1483 (2007). Data availability 25. Chiang-Ni, C. & Wu, J. J. Effects of streptococcal pyrogenic exotoxin B on – The data that support the findings of this study are available within the article and its pathogenesis of Streptococcus pyogenes. J. Formos. Med. Assoc. 107, 677 685 Supplementary Information files, or are available from the corresponding author upon (2008). request. Source data are provided with this paper. 26. Wahid, R. M. et al. Immune response to a laminin-binding protein (Lmb) in group A streptococcal infection. Pediatr. Int. 47, 196–202 (2005). 27. Gherardi, G., Vitali, L. A. & Creti, R. Prevalent emm types among invasive Received: 22 December 2018; Accepted: 23 June 2020; GAS in Europe and north America since year 2000. Front Public Heal 6,1–11 (2018). 28. Arya, D. K., Sharma, A., Mehta, G., Dua, M. & Johri, A. K. Molecular epidemiology and virulence characteristics of prevalent group A streptococci recovered from patients in northern India. J. Infect. Dev. Ctries 8, 271–281 References (2014). 1. Carapetis, J. R., Steer, A. C., Mulholland, E. K. & Weber, M. The global burden 29. Pizza, M. et al. Identification of vaccine candidates against serogroup B of group A streptococcal diseases. Lancet Infect. Dis. 5, 685–694 (2005). meningococcus by whole-genome sequencing. Science 287, 1816–1820 (2000). 2. Fischetti, V. A. Streptococcal M protein: molecular design and biological 30. Rudolph, K. et al. Epidemiology of invasive group A streptococcal disease in behavior. Clin. Microbiol Rev. 2, 285–314 (1989). Alaska, 2001 to 2013. J. Clin. Microbiol. 54, 134–141 (2016). 3. Sanderson-Smith, M. et al. A systematic and functional classification of 31. Nelson, G. E. et al. Epidemiology of invasive group A streptococcal infections Streptococcus pyogenes that serves as a new tool for molecular typing and in the United States, 2005–2012. Clin. Infect. Dis. 63, 478–486 (2016). vaccine development. J. Infect. Dis. 210, 1325–1338 (2014). 32. Williamson, D. A. et al. Molecular epidemiology of group A streptococcus 4. Chiou, C. S. et al. Association of the shuffling of Streptococcus pyogenes clones from pharyngeal isolates in Auckland, New Zealand, 2013. N. Z. Med. J. 127, and the fluctuation of scarlet fever cases between 2000 and 2006 in central 55–60 (2014). Taiwan. BMC Microbiol. 9,1–9 (2009). 33. Fritzer, A. et al. Novel conserved group A streptococcal proteins identified by 5. Shulman, S. T. et al. Seven-year surveillance of North American pediatric the antigenome technology as vaccine candidates for a non-M protein-based group A streptococcal pharyngitis isolates. Clin. Infect. Dis. 49,78–84 (2009). vaccine. Infect. Immun. 78, 4051–4067 (2010). 6. Cue, D., Dombek, P. E., Lam, H. & Cleary, P. P. Streptococcus pyogenes 34. Walker, M. J. et al. Disease manifestations and pathogenic mechanisms of serotype M1 encodes multiple pathways for entry into human epithelial cells. group A streptococcus. Clin. Microbiol. Rev. 27, 264–301 (2014). Infect. Immun. 66, 4593–4601 (1998). 35. Okada, N., Liszewski, M. K., Atkinson, J. P. & Caparon, M. Membrane 7. Metzgar, D. & Zampolli, A. The M protein of group A streptococcus is a key cofactor protein (CD46) is a keratinocyte receptor for the M protein of the virulence factor and a clinically relevant strain identification marker. Virulence group A streptococcus. Proc. Natl Acad. Sci. USA 92, 2489–2493 (1995). 2, 402–412 (2011). 36. Steer, A. C. et al. Status of research and development of vaccines for 8. Siemens, N., Patenge, N., Otto, J., Fiedler, T. & Kreikemeyer, B. Streptococcus Streptococcus pyogenes. Vaccine 34, 2953–2958 (2016). pyogenes M49 plasminogen/plasmin binding facilitates keratinocyte invasion 37. Dale, J. B. et al. Potential coverage of a multivalent M protein-based group A via integrin-integrin-linked kinase (ILK) pathways and protects from streptococcal vaccine. Vaccine 31, 1576–1581 (2013). macrophage killing. J. Biol. Chem. 286, 21612–21622 (2011). 38. Voyich, J. M. et al. Genome-wide protective response used by group A 9. McNeil, S. A. et al. Safety and immunogenicity of 26-valent group A Streptococcus to evade destruction by human polymorphonuclear leukocytes. streptococcus vaccine in healthy adult volunteers. Clin. Infect. Dis. 41, Proc. Natl Acad. Sci. USA 100, 1996–2001 (2003). 1114–1122 (2005). 39. Banyer, J. L., Hamilton, N. H., Ramshaw, I. A. & Ramsay, A. J. Cytokines in 10. Dale, J. B., Penfound, T. A., Chiang, E. Y. & Walton, W. J. New 30-valent M innate and adaptive immunity. Rev. Immunogenet. 2, 359–373 (2000). protein-based vaccine evokes cross-opsonic antibodies against non-vaccine 40. Hayden, M. S. & Ghosh, S. Regulation of NF-κB by TNF family cytokines. serotypes of group A streptococci. Vaccine 29, 8175–8178 (2011). Semin Immunol. 26, 253–266 (2014).

10 NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17299-x ARTICLE

41. Raeder, R. H., Barker-Merrill, L., Lester, T., Boyle, M. D. & Metzgera, D. W. A written by P.S., M.G., A.K.J., R.B., and E.H. A.K.J., P.S., M.G., and A.S. analyzed the pivotal role for interferon-γ in protection against group a streptococcal skin data. Chemicals were provided by A.K.J., R.B., M.D., and V.Y. Project was supervised by infection. J. Infect. Dis. 181, 639–645 (2000). A.K.J. and R.B. 42. Matsumura, T. et al. Interferon-γ-producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections. Nat Competing interests Commun. 3,1–11 (2012). 43. Gratz, N. et al. Type I interferon production induced by Streptococcus The authors declares no competing interests. pyogenes-derived nucleic acids is required for host protection. PLoS Pathog. 7, e1001345 (2011). Additional information 44. Carey, A. J. et al. Interleukin-17A contributes to the control of Streptococcus Supplementary information is available for this paper at https://doi.org/10.1038/s41467- pyogenes colonization and inflammation of the female genital tract. Sci. Rep. 6, 020-17299-x. 26836 (2016). 45. Schoenborn, J. R. & Wilson, C. B. Regulation of interferon-γ during innate Correspondence and requests for materials should be addressed to A.K.J. and adaptive immune responses. Adv. Immunol. 96,41–101 (2007). 46. Wessels, M. R. Clinical practice. Streptococcal pharyngitis. N. Engl. J. Med. 17, Peer review information Nature Communications thanks Mehfuz Zaman and the other, 648–655 (2011). anonymous, reviewer(s) for their contribution to the peer review of this work. Peer 47. Pizarro-Cerdá, J. & Cossart, P. Bacterial adhesion and entry into host cells. reviewer reports are available. Cell 124, 715–727 (2006). 48. Puchta, A., Verschoor, C. P., Thurn, T. & Bowdish, D. M. Characterization of Reprints and permission information is available at http://www.nature.com/reprints inflammatory responses during intranasal colonization with Streptococcus pneumoniae. J. Vis. Exp. 17, e50490 (2016). Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Acknowledgements P.S. is thankful to Council of Scientific and Industrial Research (CSIR), Govt. of India for Open Access This article is licensed under a Creative Commons providing research fellowship. M.G. is thankful to the University Grants Commission Attribution 4.0 International License, which permits use, sharing, (UGC), Govt. of India, for providing Dr. D. S. Kothari Postdoctoral fellowship [No. F.4- 2/2006(BSR)/17-18/0044]. A.K.J. and E.H. are thankful to the Indo-Israel project F.No:6- adaptation, distribution and reproduction in any medium or format, as long as you give 5/2016 (1 C) funded by UGC, Govt. of India and Israel Science Foundation. We are also appropriate credit to the original author(s) and the source, provide a link to the Creative very thankful to Prof. Michael Wessels, Boston children’s hospital, Boston and Prof. Commons license, and indicate if changes were made. The images or other third party ’ Shiranee Sriskandan, Imperial college, London for providing GAS M1 and M9 serotypes material in this article are included in the article s Creative Commons license, unless respectively. We are very grateful to Dr. Rino Rappuoli and Dr. Immaculada, GSK indicated otherwise in a credit line to the material. If material is not included in the ’ vaccine, Siena, Italy for providing the recombinant sera, critical reading of the MS that article s Creative Commons license and your intended use is not permitted by statutory helped in improving the MS. regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/ licenses/by/4.0/. Author contributions Project initiated by A.K.J., E.H., and R.B. P.S., M.G., and V.K.S. have performed the experiments. P.S., M.G., A.K.J., M.D., and V.Y. have designed the experiments. MS is © The Author(s) 2020

NATURE COMMUNICATIONS | (2020) 11:3545 | https://doi.org/10.1038/s41467-020-17299-x | www.nature.com/naturecommunications 11