The Proteasome Inhibitor Carfilzomib Functions Independently of P53 to Induce Cytotoxicity and an Atypical NF-Κb Response in Chronic Lymphocytic Leukemia Cells

Published OnlineFirst March 20, 2013; DOI: 10.1158/1078-0432.CCR-12-2754

Clinical Cancer Cancer Therapy: Preclinical Research

The Proteasome Inhibitor Carﬁlzomib Functions Independently of p53 to Induce Cytotoxicity and an Atypical NF-kB Response in Chronic Lymphocytic Leukemia Cells

Sneha V. Gupta1, Erin Hertlein2, Yanhui Lu4, Ellen J. Sass2, Rosa Lapalombella2, Timothy L. Chen2, Melanie E. Davis2, Jennifer A. Woyach2, Amy Lehman3, David Jarjoura4, John C. Byrd1,2, and David M. Lucas1,2

Abstract Purpose: The proteasome consists of chymotrypsin-like (CT-L), trypsin-like, and caspase-like subunits that cleave substrates preferentially by amino acid sequence. Proteasomes mediate degradation of regulatory proteins of the p53, Bcl-2, and nuclear factor-kB (NF-kB) families that are aberrantly active in chronic lymphocytic leukemia (CLL). CLL remains an incurable disease, and new treatments are especially needed in the relapsed/refractory setting. We therefore investigated the effects of the proteasome inhibitor carfilzomib (CFZ) in CLL cells. Experimental Design: Tumor cells from CLL patients were assayed in vitro using immunoblotting, real- time polymerase chain reaction, and electrophoretic mobility shift assays. In addition, a p53 dominant- negative construct was generated in a human B-cell line. Results: Unlike bortezomib, CFZ potently induces apoptosis in CLL patient cells in the presence of human serum. CLL cells have significantly lower basal CT-L activity compared to normal B and T cells, although activity is inhibited similarly in T cells versus CLL. Co-culture of CLL cells on stroma protected from CFZ-mediated cytotoxicity; however, PI3K inhibition significantly diminished this stromal protection. CFZ- mediated cytotoxicity in leukemic B cells is caspase-dependent and occurs irrespective of p53 status. In CLL cells, CFZ promotes atypical activation of NF-kB evidenced by loss of cytoplasmic IkBa, phosphorylation of IkBa, and increased p50/p65 DNA binding, without subsequent increases in canonical NF-kB target gene transcription. Conclusions: Together, these data provide new mechanistic insights into the activity of CFZ in CLL and support phase I investigation of CFZ in this disease. Clin Cancer Res; 19(9); 1–14. 2013 AACR.

Introduction Protein homeostasis is critical for the processes that Chronic lymphocytic leukemia (CLL) is characterized by govern cell survival, and the multicatalytic 26S protea- the growth and accumulation of malignant B-lymphocytes some regulates the turnover of key proteins in these in the blood, bone marrow, lymph nodes, and spleen. processes. Proteasomes consist of a catalytic 20S core Despite the introduction of new therapies, most CLL patients capped by regulatory 19S subunits (1). There are 2 forms eventually relapse and succumb to their disease. Identifica- of the 20S core: c20S and i20S. The former is ubiqui- tion of new strategies for relapsed and refractory CLL is tiously expressed in all cells, and the latter specifically in essential to make a positive impact on patient survival. hematopoietic cells and cells exposed to inflammatory cytokines (2). The active site in the c20S and i20S core has 6 N-terminal threonine proteases consisting of chymotrypsin-like (CT-L), trypsin-like (T-L), and caspase-like fi 1 2 Authors' Af liations: College of Pharmacy; Department of Internal (C-L) subunits (3, 4). Because selective inhibition of the Medicine; 3Center for Biostatistics, The Ohio State University, Columbus, Ohio; and 4Department of Pharmacology and Molecular Sciences, Johns CT-L site has a minor effect on total cellular protein Hopkins University School of Medicine, Baltimore, Maryland turnover, proteasome inhibitors that block only the Note: Supplementary data for this article are available at Clinical Cancer CT-L subunit are considered optimal (5). Proteasomes Research Online (http://clincancerres.aacrjournals.org/). mediate degradation of a variety of key regulatory factors

J.C. Byrd and D.M. Lucas contributed equally to this article. including cell-cycle control proteins (e.g., cyclins (6), p21 (7) and p27 (8), p53 (9), p53 target proteins Puma, Noxa, Corresponding Authors: John C. Byrd, 410 W. 12th Avenue, Room 455 OSUCCC Building, Columbus, OH 43210. Phone: 614-293-8330; Fax: 614- and Bax of the Bcl-2 family (10), and the inhibitor of 292-3312; E-mail: [email protected]; and David M. Lucas. Phone: nuclear factor-kB(NF-kB; IkB; ref. 11). Imbalanced 614-685-5667; Fax: 614-292-3312; E-mail: [email protected] expression of Bcl-2 family proteins, constitutive NF-kB doi: 10.1158/1078-0432.CCR-12-2754 activation, and variable p53 function are hallmarks of 2013 American Association for Cancer Research. CLL cells (12–14).

www.aacrjournals.org OF1

Gupta et al.

patients examined had immunophenotypically defined Translational Relevance CLL as outlined by IWCLL criteria (23) and were newly Standard therapies for chronic lymphocytic leukemia diagnosed or without treatment for a minimum of 30 days (CLL) are often ineffective in p53-mutated cases and at time of collection. The occurrence of del(17p13.1) was detrimental to existing T cells, leaving patients at risk of determined in CLL patient samples by fluorescence in situ opportunistic infections. A major focus of therapeutic hybridization as described (24), and in each positive case at development has been the investigation of agents that least 30% of cells showed this deletion. Normal cells were are cytotoxic to B cells independent of p53 but have obtained from partial leukocyte preparations from the minimal effects on T cells. Proteasome inhibitors have American Red Cross. B- or T-lymphocytes and CLL cells known activity in multiple myeloma, but to date have were negatively selected using RosetteSep reagents (Stem- not shown clinical efficacy in CLL. This manuscript Cell Technologies). The HS-5-GFP stromal cell line was shows B-cell selective efficacy of the proteasome inhib- provided by Dr. Beverly Torok-Storb (Fred Hutchinson itor carfilzomib (CFZ) that is independent of p53, and Cancer Research Center; ref. 25). 293 cells were obtained provides new mechanistic insights to its mode of action from American Type Culture Collection (Manassas, VA) and in CLL patient cells. This work supports an ongoing 697 lymphoblastic cells were obtained from DSMZ. Cells phase I clinical trial of CFZ in CLL. were incubated at 37 C and 5% CO2 in AIM-V medium (Invitrogen) or in RPMI 1640 with 10% FBS or 10% human serum (HS) supplemented with penicillin, streptomycin, and L-glutamine (Sigma). Bortezomib (BTZ, Velcade) is a proteasome inhibitor approved for the treatment of multiple myeloma and man- Viability assays tle cell lymphoma (15). Concentrations of BTZ that pro- Cell viability was monitored by flow cytometry using duce an antitumor response in vitro inhibit activities of the annexin V/propidium iodide (BD Biosciences) on a FC500 CT-L and C-L subunits of the proteasome (2). In spite of a instrument (Beckman Coulter). CellTiter 96 (MTS) assays high degree of cytotoxicity in vitro in CLL cells, BTZ failed to were conducted to monitor growth inhibition per manu- produce objective responses in CLL patients in a phase II facturer’s instructions (Promega). LIVE/DEAD (Invitrogen) clinical trial at the achieved doses (16). The lack of BTZ staining was done to monitor cytotoxicity with drug treat- efficacy in vivo has been attributed to the inactivation of its ments using the manufacturer’s instructions. boronate moiety by dietary flavonoids in human plasma (17). Carfilzomib (CFZ, PR-171) is a novel proteasome Immunoblot analyses inhibitor that specifically and irreversibly inhibits the CT- Nuclear and cytoplasmic lysates were prepared with NE- L activity of the proteasome (18). Unlike BTZ, CFZ has PER Nuclear and Cytoplasmic Extraction kit (Pierce). Anti- minimal activity against off-target enzymes including serine body to polyADP-ribose polymerase (PARP) was from EMD proteases, while at the same time inhibiting the CT-L Biosciences, p21 (OP64) and p53 (OP43) from Calbio- subunit of the proteasome more potently (19–21). Impor- chem, p27 (88264) from Abcam, and pIkBa from Cell tantly, CFZ lacks the boronate moiety of BTZ that is poten- Signaling Technologies. Remaining antibodies were from tially responsible for that agent’s inactivity in CLL patients. Santa Cruz Biotechnology. Bands were quantified on an Here, we investigate the effects of CFZ on CLL patient cells. AlphaImager system (Proteinsimple). This work shows that CFZ irreversibly inhibits the CT-L activity, has potent activity in CLL including cases with del Electrophoretic mobility shift assay A probe containing an NF-kB consensus binding site (17p13.1), and promotes an atypical activation of NF-kB 0 0 that may lack the classical prosurvival effect of this pathway. (5 AGTTGAGGGGACTTTCCCAGGC 3 ; Santa Cruz Bio- technology) was 32P-labeled using the Nick Translation Materials and Methods System (Invitrogen). Five micrograms of nuclear protein was incubated 30 minutes at room temperature in bind- Reagents ing buffer (10 mmol/L Tris-HCl, pH 7.5, 1.0 mmol/L CFZ was provided by Onyx Pharmaceuticals. Boc-D-FMK ethylenediaminetetraacetic acid (EDTA), 4% Ficoll, 1.0 (Enzyme Systems Products) was used at 100 mmol/L. BTZ mmol/L dithiothreitol, 75 mmol/L KCl) plus 250 ng poly was obtained from Millennium Pharmaceuticals Inc., and dI-dC (Sigma). Complexes were separated on polyacryl- TNF from R&D Systems. CD40L was purchased from Pepro- amide gels in Tris-borate EDTA buffer (89 mmol/L Tris- Tech. 2-Fluoro-ara-A (active metabolite of fludarabine), base, 89 mmol/L boric acid, 2.0 mmol/L EDTA), dried, G418, doxycycline, and puromycin were purchased from and autoradiographed. For supershift experiments, anti- Sigma. CpG DSP30 (22) was purchased from Eurofins/ bodies to p65, p50, or c-Rel (Santa Cruz Biotechnology) Operon. were incubated with nuclear extract for 10 minutes before addition of probe. Cells and cell lines Blood was obtained from patients following written, Real-time reverse transcription-PCR informed consent under a protocol approved by the Insti- RNA was extracted using TRIzol (Invitrogen). cDNA was tutional Review Board of The Ohio State University. All prepared with SuperScript First-Strand Synthesis System

OF2 Clin Cancer Res; 19(9) May 1, 2013 Clinical Cancer Research

Carﬁlzomib in Chronic Lymphocytic Leukemia

(Invitrogen). Real-time reverse transcription PCR (RT-PCR) p53DN system. Mutations in the p53 DNA-binding domain was done on an ABI 7900 (Applied Biosystems) using at codon 273 (Arg!His, p53DN818) and codon 281 TaqMan Universal Master Mix, primers, and labeled probes (Asp!Glu, p53DN843) were selected to generate 2 different (Applied Biosystems) and TBP as an endogenous control. p53DN constructs using the QuikChange mutagenesis kit Mean threshold cycle (Ct) values were calculated by PRISM (Stratagene). DNA was sequenced to confirm mutations. software (Applied Biosystems) to determine fold differences Using primer sequences provided by Clontech, the presence according to manufacturer’s instructions. and orientation of p53DN818 and p53DN843 sequences in the pRetro vector were similarly confirmed. Retrovirus par- CT-L activity assay ticles were produced by cotransfecting plasmid DNA and Whole cell extracts without protease inhibitors were ecotropic helper plasmids (pVSV and pGPZ) into the 293 cell analyzed using a CT-L–specific 20S proteasome assay kit line using calcium phosphate precipitation. The inducible (Chemicon) following the manufacturer’s instructions. The Tet activator 697 cell line (pRetrox-tet-on) was established assay is based on detection of the fluorophore 7-amino-4- according to the manufacturer’s protocol (Clontech). methylcoumarin (AMC) after cleavage from the labeled 697pTet-on cells were infected with retrovirus by culturing substrate. Free AMC was measured using a 380/460 nm for 10 hours in conditioned media with 8 mg/mL polybrene. fluorometer filter set. Relative activity was standardized by Cells were then washed and incubated 48 hours before protein concentration, determined by BCA assay. selection with 1 mg/mL puromycin and 100 mg/mL G418.

Gamma irradiation Statistics Cells were irradiated using 5 or 8 Gy as indicated. RNA For all experiments, linear mixed effects models were and lysates were collected from a subset of cells after 4 used to account for dependencies among the data. From hours, and viability was determined in remaining cells at the models, estimated differences between experimental 24 hours by annexin V/propidium iodide or LIVE/DEAD conditions were calculated along with 95% conﬁdence staining. intervals (CI). Log transformations of the data were applied when necessary to stabilize variances. Data from real-time Retroviral vectors and generation of cell line with RT-PCR experiments were ﬁrst normalized to internal con- inducible dominant-negative (DN) p53 activity trols, and then linear mixed models were applied to the log- The retroviral construct pRetroX-Tight-Puro (pRetro; transformed fold changes. All analyses were done using Clontech) was used to stably transfect 697 cells with the SAS/STAT software, v9.2 (SAS Institute).

A * B

* ** 150

6 2.5 10 100 6 2.0 10

6 1.5 10 50

6 1.0 10

5 vehicle) to (normalized % Mitochondrial activity Mitochondrial % 0 5.0 10 CFZ 0 (nmol/L) T cells B cells CLL cells Relative fluorescence units units (RFU) fluorescence Relative

Figure 1. T cells express more chymotrypsin-like (CT-L) proteasome activity than B cells. A, basal CT-L activity in T cells (n ¼ 10) is higher than B cells (n ¼ 11) from healthy donors and in primary CLL cells (n ¼ 10; , P < 0.0001 for both). CT-L activity in B cells was also higher than in CLL cells (, P ¼ 0.0003). Results are displayed in relative ﬂuorescence units (RFU). B, B and T cells from healthy donors (n ¼ 8 each) and CLL patient samples (n ¼ 10) were incubated in serum-free AIM-V media with various concentrations of CFZ for 1 hour. Mitochondrial activity as a surrogate for cell viability was determined by MTS assay at 48 hours, and is shown relative to time-matched untreated controls. Horizontal lines represent the mean. CFZ across all doses is more cytotoxic to CLL cells than T cells (, P < 0.0001). CFZ is also more cytotoxic to CLL cells than to B cells at 33 and 100 nmol/L (P < 0.0001 for both) but is not different at 300 nmol/L.

www.aacrjournals.org Clin Cancer Res; 19(9) May 1, 2013 OF3

Gupta et al.

Results centrations used were based on pharmacokinetics data from T cells express increased CT-L proteasome activity and a phase I clinical trial in CLL now underway at OSU. In this decreased sensitivity to CFZ compared to B cells trial, the maximum concentration achieved was 0.876 A common disadvantage of current therapies for CLL is 0.099 mg/mL (1.22 0.138 mmol/L) for the 45 mg/m (2) the negative impact on normal lymphocytes, especially T dose (unpublished results). This is similar to concentrations cells, which leaves patients at increased risk of opportunistic previously reported to be clinically achievable in patients infection. To address the impact of CT-L inhibition on CLL with hematologic malignancies (27). As shown in Fig. 1B, and normal cell types, we first measured the basal levels of normal B cells were significantly more sensitive to CFZ than CT-L activity in CLL cells compared to B and T cells from normal T cells at 48 hours using 100 and 300 nmol/L P healthy volunteers. Interestingly, normal T cells showed concentrations ( < 0.0001 for both). This finding is con- significantly higher CT-L activity compared to normal B sistent with the elevated CT-L activity observed in T cells cells and CLL cells (P < 0.0001 for both). CT-L activity in relative to B cells. normal B cells was also significantly higher than in CLL cells (P ¼ 0.0003; Fig. 1A). We next tested the relative cytotoxicity CFZ irreversibly inhibits the CT-L subunit and of CFZ in these cell types. Because CFZ exhibits a short in vivo promotes apoptosis in CLL cells half-life (approximately 30 minutes; refs. 26 and 27), cells Because of the lower CT-L activity in CLL cells, we in all experiments were incubated with CFZ for 1 hour, hypothesized that the CT-L–specific inhibitor CFZ would washed, and further cultured in fresh media for the indi- show particular efficacy in these cells. We therefore tested cated times to more closely mimic in vivo exposure. Con- the cytotoxicity of CFZ in CLL patient samples. As BTZ was

A AIM-V media RPMI with 10% HS RPMI with 10% FBS -

100 100 100

50 50 50 /propidium iodide /propidium -

0 0 0 (normalized to vehicle) % AnnexinV %

CFZ (nmol/L) BTZ (nmol/L) CFZ (nmol/L) BTZ (nmol/L) CFZ (nmol/L) BTZ (nmol/L) B C CLL cells T cells CLL cells T cells 200 Veh Veh 150 Veh Veh CFZ 100 CFZ 100 CFZ 100 CFZ 100 CFZ 300 CFZ 300 CFZ 300 150 100 100

50 50 % CT-L activity inhibition (normalized to vehicle at at to 1 hour) vehicle (normalized 0 hour) 1 at vehicle to (normalized CFZ 0 100 300 0 100 300 0 100 300 0 (nmol/L) negative andpropidium iodide Annexin % CFZ - 100 300 - 100 300 - 100 300 - 100 300 1 hour 4 hours 12 hours (nmol/L) 1 hour 4 hours 12 hours24 hours

Figure 2. Carfilzomib irreversibly inhibits the CT-L subunit and promotes selective apoptosis in CLL cells cultured in human serum. A, CLL cells (n ¼ 8) were treated with various concentrations of CFZ or BTZ for 1 hour in media as indicated. Viability was determined by annexin V/propidium iodide flow cytometry at 24 hours. Horizontal lines represent the mean. B, CLL cells or normal T cells (n ¼ 6 each) were incubated with CFZ in RPMI with 10% HS for 1 hour and cells were harvested at several time points to determine CT-L activity. C, viability of cells from B was determined by annexin/propidium iodide flow cytometry. Because of cell number limitations, T cells (striped bars) were investigated for viability at 24 hours only.

OF4 Clin Cancer Res; 19(9) May 1, 2013 Clinical Cancer Research

Carﬁlzomib in Chronic Lymphocytic Leukemia

previously shown to be inactivated by human plasma of the lack of external signals from the microenvironment components (17), we also included this agent and tested provided by soluble factors and contact with a variety of in the presence of 3 different media: serum-free AIM-V cells in the bone marrow and lymph nodes (28). We medium, RPMI 1640 with 10% HS, and RPMI 1640 with therefore sought to determine the impact of microenvi- 10% FBS. In serum-free or FBS-containing media, CFZ was ronment factors on CFZ-mediated cytotoxicity using a more cytotoxic to CLL cells than BTZ (approximate LC50 in previously established stromal cell line, HS-5-GFP (29). AIM-V and FBS: CFZ ¼ 40 and 80 nmol/L; BTZ ¼ 200 and CFZ did not substantially affect viability of HS-5-GFP 170 nmol/L, respectively). In media containing HS, how- stromal cells at 48 hours at concentrations up to 300 ever, CFZ maintained efficacy but BTZ was largely inactive nmol/L (data not shown). To test the protective effects of (approximate LC50 of CFZ in HS ¼ 80 nmol/L; Fig. 2A). To stroma, CLL cells were incubated with CFZ or vehicle for 1 more closely approximate in vivo conditions, media with HS hour and transferred to plates with or without HS-5-GFP was used for the remaining work. Next, CT-L activity was cells. Using flow cytometry, GFP-negative CLL cells were assessed in CLL patient cells and in normal T cells after total distinguished from GFP-positive HS-5 cells and cytotox- incubations of 1, 4, or 12 hours (Fig. 2B). Viability was also icity was assessed by propidium iodide uptake. CFZ determined by propidium iodide flow cytometry (Fig. 2C). caused significantly more cytotoxicity in CLL cells alone CFZ rapidly (within 1 hour) suppressed the CT-L protea- as compared to CLL cells on stroma, although CLL cells some activity both in CLL samples and in T cells. This was on stroma remained sensitive to CFZ at the tested con- followed by a time-dependent increase in apoptosis (as centrations (P < 0.0001; Fig. 3A). The importance of the determined by annexin positivity) and cytotoxicity (as PI3K signaling pathway to the survival of mature B cells, determined by propidium iodide uptake) that was greater and specifically co-culture of CLL on stromal cells, has in CLL versus T cells. Despite drug washout, CT-L inhibition been established (29). Therefore, we sought to determine was not reversible within the 12-hour period following CFZ if the stromal cell protection of CLL cells was mediated by treatment. Proteasome activity was not determined at later PI3K signaling. As shown in Fig. 3B, the addition of the time points because of the high degree of CFZ-induced cell pan-PI3K inhibitor LY294002 significantly diminished death. the stromal cell–mediated protection of CFZ-treated CLL cells (P ¼ 0.0083). These data indicate that CFZ can Stromal protection of CFZ-treated CLL cells is mediate cytotoxicity in CLL cells despite the protective diminished by a pan-PI3K inhibitor effect of stromal cells, and that stromal cell protection CLL cells have dysregulated apoptosis in vivo,butin from CFZ-mediated cytotoxicity can be diminished by vitro they rapidly undergo spontaneous apoptosis because PI3K inhibition.

AB*

NS * 120 120

100 100 80 80 60 60 40 40 20 20 0 % Propidium iodide negative % Propidium iodide negative

0 LY LY CFZ CFZ (normalized to vehicle in suspension) CFZ 0 33 100 300 + 0 33 100 300 + (normalized to vehicle in suspension)

(nmol/L) Vehicle Vehicle CFZ + + LY CFZ + LY CFZ CLL suspension CLL cells on stroma CLL suspension CLL cells on stroma

Figure 3. Stromal protection of CLL cells treated with CFZ is reversed by pan-PI3K inhibitor. A, CLL cells (n ¼ 5) were incubated with various concentrations of CFZ for 1 hour, washed, and transferred to plates with or without HS-5-GFP stromal cells. Dinaciclib (indicated by þ) was included as a positive control (52). Viability of GFP negative (CLL) cells was determined by propidium iodide uptake at 48 hours and the differences were signiﬁcant (P < 0.0001). B, addition of 25 mmol/L pan propidium iodide-3K inhibitor LY294002 to 100 nmol/L CFZ treated CLL cells (n ¼ 5) decreased stromal protection as determined by propidium iodide uptake at 48 hours (, P ¼ 0.0083). Horizontal lines represent the mean.

www.aacrjournals.org Clin Cancer Res; 19(9) May 1, 2013 OF5

Gupta et al.

A B - 100 Patient 3 80 Hours 1.5 4 8 18 Patient 1 60 Patient 2 CFZ –+–+–+–+ UV Jurkat Patient 3

PARP iodide /propidium 40 -

20 Actin 0 % AnnexinV %

4 hours 8 hours 18 hours

C D - 200 * Patient 6 Patient 4 Patient 5 150 Patient 6

100 /propidium iodide -

Untreated CFZ + BoCD CFZ BocD F-ara A F-ara BocD + 50

PARP (normalized tovehicle) AnnexinV 0 % Actin

Figure 4. CFZ-mediated cytotoxicity in CLL cells is caspase-dependent. A, CLL samples (n ¼ 3) were treated with CFZ 350 nmol/L for 1 hour. Lysates were collected at 1.5, 4, 8, and 18 hours, and cleavage of PARP was assessed by immunoblot. UV Jurkat was included as positive control to assess PARP cleavage products. A representative immunoblot is shown. B, viability of cells from A was determined by annexin V/propidium iodide at 4, 8 and 18 hours. C, CLL cells (n ¼ 3) were incubated with or without CFZ and pan-caspase inhibitor 100 mmol/L Boc-D-fmk (BocD) for 18 hours. PARP cleavage was assessed by immunoblot. A representative immunoblot is shown. D, viability of cells from C was determined by annexin/propidium iodide at 24 hours. Differences in cytotoxicity of CFZ with the addition of BocD were signiﬁcant (P ¼ 0.0003). F-ara A (active metabolite of ﬂudarabine) was included as a positive control for PARP cleavage and caspase-dependent cytotoxicity.

Cytotoxicity induced by CFZ in CLL cells is caspase overall significantly poorer outcome (32). The proteasome dependent regulates the turnover of p53 as well as several key p53 CFZ has been reported to mediate caspase-dependent targets. We therefore sought to determine the effects of apoptosis in mature B-cell malignancies such as Walden- proteasome inhibition on p53 and its targets. CLL cells strom’s macroglobulinemia (30) and multiple myeloma incubated with CFZ were analyzed by immunoblot or real- (31). We sought to determine if similar death pathways time RT-PCR. Gamma irradiation was included as a positive were used in less-differentiated malignant B cells. CFZ control representing a classical p53-inducing treatment. As caused a time-dependent cleavage (Fig. 4A) of the caspase shown in Fig. 5A, CFZ treatment caused only modest accu- substrate PARP and cytotoxicity (Fig. 4B) that was rescued mulation of p53 and p21 proteins compared to irradiated by the pan-caspase inhibitor Boc-D-fmk (Fig. 4C). The cells, and p27 was unchanged. Puma and Bax proteins were cytotoxic effect of CFZ on CLL cells was also diminished similarly unchanged (data not shown). Significant increases with the addition of Boc-D-fmk (Fig. 4D; P ¼ 0.0003). These in p21 transcription were noted in all patient samples data indicate that the primary mechanism of the cytotox- following CFZ treatment (average fold change of 5.78; icity by CFZ in primary CLL cells is caspase dependent. P < 0.0001), and Puma transcription was slightly increased (average fold change of 1.97; P ¼ 0.0323; Fig. 5B). However, CFZ is cytotoxic to cells independent of p53 p53 was found to be downregulated by an average of 0.75 Mutations or deletions of p53 are far more common in fold (P ¼ 0.0193), and no significant changes were observed advanced cases of CLL and are associated with resistance to in the transcription of Noxa (P ¼ 0.2232) or Bax (P ¼ alkylating agents, disease progression in 1 or 2 years, and 0.1531). These findings show that CFZ does not induce a

OF6 Clin Cancer Res; 19(9) May 1, 2013 Clinical Cancer Research

A Pt 1 Pt 2 B Veh CFZ γ Veh CFZ γ

p53 100 p21 *** * ** p27 10 Actin

Pt 3 Pt 4 1 UV UV Jurkat 300 nmol/L CFZ: –+ – + Jurkat

Noxa 0.1

Actin untreated) changeto (relative Fold

C - del(17p) - Non-del(17p) 100 100 * ** 80 80

60 60 /propidium iodide /propidium iodide /propidium - 40 - 40

20 20

0 0 % AnnexinV % AnnexinV %

mol/L mol/L mol/L mol/L mol/L mol/L

Figure 5. Carfilzomib is cytotoxic to CLL cells independent of p53. CLL cells were treated with CFZ (300 nmol/L) for 1 hour and whole cell lysates were collected at 8 hours. g-Irradiation (5 Gy) was included as a positive control for p53-dependent treatment. Untreated and UV-irradiated Jurkat cells were included as negative and positive controls for expression of Noxa protein. Changes in p53 and its targets were assessed by (A) immunoblot (n ¼ 6) and (B) real-time RT- PCR (n ¼ 6-14). CFZ treatment induced p21 (, P < 0.0001) and PUMA (, P ¼ 0.0323) and significantly downregulated p53 by 0.75-fold (, P ¼ 0.0193) compared to vehicle. Horizontal lines represent the geometric mean. C, CLL samples from patients with or without del(17p13.1) (n ¼ 9) were incubated with 100 and 300 nmol/L of CFZ for 1 hour. No significant differences were observed (P ¼ 0.3924). A total of 5 Gy g-irradiation and fludarabine (Fara A) were included as controls for p53-dependent treatments and were more cytotoxic in non-del(17p13.1) patients than del(17p13.1) patients (, P < 0.0001; , P ¼ 0.0002). Viability was determined by annexin V/propidium iodide flow cytometry at 24 hours. Horizontal lines represent the mean. typical p53 response in CLL cells, and suggests that CFZ- toxicity of CFZ in cells with wild-type versus defective p53 mediated p21 induction may be because of an indirect activity. In CLL, a transition mutation in the p53 DNA mechanism rather than direct p53 activity. As was shown binding domain at codon 273 that converts Arg to His has previously with BTZ (33), we observed an increase in Noxa been described as a gain-of-function dominant negative protein (Fig. 5A), but not mRNA, with CFZ treatment. mutation (34). In addition, mutations at codons 281 Next, we analyzed CLL samples from patients with or (Asp!Glu) and 273 (Arg!His) are found in certain leu- without del(17p13.1), the chromosomal site of the p53 kemias (35). Doxycycline-inducible p53DN constructs gene (Fig. 5C). CFZ was similarly cytotoxic to patient cells representing these mutations were transfected into 697 irrespective of del(17p13.1) status (P ¼ 0.3924). In con- cells, an acute B-lymphoblastic leukemia cell line that has trast, significant differences in cytotoxicity were observed wild-type p53 and responds to CFZ treatment similarly to between patient samples with and without this deletion for CLL cells (Supplementary Fig. S1B). As shown in Fig. 6A, both g-irradiation and fludarabine treatments (P < 0.0001 p53 protein was induced in cell lines carrying the p53DN and P ¼ 0.0002, respectively). As p53 is only one of the genes constructs, but not the empty vector, as early as 18 hours deleted on del(17p13.1), we next sought to test the cyto- after doxycycline addition. Induction of p53DN activity

www.aacrjournals.org Clin Cancer Res; 19(9) May 1, 2013 OF7 Gupta et al.

increased p53 transcription by more than 5-fold in both CD40L. The constitutive NF-kB (p50/p65) DNA binding p53DN818 and p53DN843 cells but not in empty-vector activity in CLL cells was increased with CFZ treatment in transfected cells (P < 0.0001; Fig. 6B). Addition of doxycy- approximately 50% of the samples, whereas there was no cline also caused a significant reduction in cytotoxicity (Fig. change in the remainder (Fig. 7E and F, respectively). 6C) with g-irradiation, but not with CFZ treatment, in the Importantly, CFZ was similarly cytotoxic to all CLL samples cells with p53DN activity (P ¼ 0.0378 and 0.0243 for tested (Fig. 7G). These results indicate that the impact of p53DN818 and p53DN843, respectively). Furthermore, in CFZ on NF-kB is not relevant to its cytotoxic activity in CLL. g-irradiated cells, although doxycyline caused a 1.5-fold Finally, to determine whether the increased NF-kB activity upregulation of p21 transcription in empty-vector control observed by EMSA resulted in changes in gene expression, cells, p21 was reduced (0.7-fold) in doxycycline-treated we analyzed several known NF-kB targets by real-time RT- p53DN cells (Fig. 6B). Although these changes did not reach PCR (Fig. 7H). CFZ induced a subset of these targets, statistical significance, they further support the functional including IkBa, IL-6, c-FLIP, and CXCL13, but with sub- activity of the p53DN constructs in the 697 cells. Cumula- stantial interpatient variability (average fold changes for tively, these experiments indicate that cytotoxicity of CFZ is target genes are indicated in Supplementary Table S1). not dependent on functional p53 activity in leukemic cells. Notably, CFZ did not induce the transcription of several classical NF-kB targets such as Bcl2A1, XIAP, Mcl-1, and CFZ induces an atypical NF-kB response in CLL cells p53. Thus, our results show that CFZ induces rather than CLL cells are characterized by constitutive activation of inhibits NF-kB in CLL patient cells, but that this response is NF-kB as indicated by high levels of nuclear NF-kB, p50, atypical and does not contribute to the CFZ induced cyto- and p65 (RelA) proteins. In cutaneous T-cell lymphoma, toxicity or resistance to this therapy. BTZ was reported to inhibit the NF-kB pathway by preventing the degradation of the phosphorylated form of IkBa, Discussion thus preventing the nuclear translocation of p50 and p65 CFZ represents a new class of irreversible proteasome and further activation of NF-kB targets (36). More recently it inhibitors that specifically target the CT-L subunit. It is was shown in multiple myeloma cell lines that IkBa can be currently in clinical trials for B-cell malignancies, but its degraded by proteasome-independent mechanisms follow- mechanism of cell death is poorly understood. Here, we ing BTZ treatment to allow for translocation and activation show that CLL cells have a low level of CT-L proteasome of NF-kB subunits (37). Thus, NF-kB response to protea- activity relative to normal B- and T-lymphocytes. We some inhibition may vary by cell type or other factors not yet hypothesized that an irreversible inhibitor of the CT-L identified. To determine the effects of CFZ on NF-kB activity subunit would be most effective in cells having the least in CLL, CLL cells were incubated with CFZ for 1 hour and baseline activity, and used this to justify the examination of examined by immunoblot. As shown in Fig. 7A–C, IkBa CFZ in CLL. In fact, we show that a short (1 hour) exposure protein decreases in both whole cell extracts as well as of 100 nmol/L CFZ is more cytotoxic to CLL cells compared nuclear and cytoplasmic fractions. However, phosphoryla- to normal lymphocytes, even though this concentration tion of IkBa (p-IkBa) increased in all fractions. To deter- similarly inhibits the CT-L subunit in CLL and normal T mine if this decrease in IkBa was because of caspase activity cells. This finding indicates that the differential sensitivity of as was previously reported (38), CLL cells were incubated CLL versus T cells to CFZ is not directly related to the extent with CFZ in the presence or absence of Boc-D-fmk (Fig. 7B). of CT-L inhibition. Unlike BTZ, the cytotoxicity of CFZ is Although Boc-D-fmk rescued cells from CFZ-mediated not diminished in media with HS. Importantly, our studies PARP cleavage and apoptosis, it did not prevent degradation indicate that CFZ induces cytotoxicity irrespective of del of IkBa. Antibodies recognizing epitopes in both the N- and (17p13.1) status or p53 function. Stromal cells partially C-terminal region of IkBa produced identical results (data protected CLL cells from CFZ-mediated cytotoxicity, not shown). It also was reported that IkBa is a substrate of although this protective effect was decreased by the addition calpains (37) but similar to caspase inhibitors, calpain of a pan-PI3K inhibitor. Finally, we show that CFZ mediates inhibitors did not prevent degradation of IkBa (data not an atypical NF-kB activation that does not associate with shown). As proteasome inhibitors were previously shown transcriptional induction of classical NF-kB targets or with to induce or inhibit both the canonical and noncanonical CLL cell death. As previously reported with other protea- NF-kB pathways (36, 37), nuclear and cytoplasmic fractions some inhibitors (33), Noxa induction is observed with CFZ of CFZ-treated CLL cells were probed for canonical (Fig. 7C) treatment concurrent with the onset of apoptosis, suggest- and noncanonical (Fig. 7D) proteins. No significant ing that Noxa-mediated caspase induction is the mecha- changes were observed in the nuclear or cytoplasmic levels nism of action of CFZ in CLL. of NF-kB subunits p50, p65, p52, or p100 in the CFZ treated To our knowledge, this is the first study showing the samples. As controls, CpG and CD40L increased expression reduced CT-L activity in primary CLL cells versus normal of both canonical and noncanonical proteins in the nuclear B and T cells. Although activity of proteasome inhibitors fraction. is well documented, the mechanism by which these To determine whether nuclear translocation of pIkBa agents preferentially target malignant cells is yet to be affects NF-kB activity, NF-kB DNA binding was measured in elucidated. We speculate that differences in CT-L activity nuclear extracts prepared from CLL cells treated with CFZ or explain the observed therapeutic window between CLL

OF8 Clin Cancer Res; 19(9) May 1, 2013 Clinical Cancer Research www.aacrjournals.org C Gy 8 Gamma A Doxycycline Doxycycline Fold change (relative to untreated) 10 15 20 GAPDH 0 5 % Live p53 (normalized to Veh without Dox) 100 120 20 40 60 80 0 –+ –+ – – + + + – – –+ –+ + – Vector Mcl1 p21 p53 N1 DN843 DN818 mol/L p53DN818

mol/L p53DN818

mol/L % Live

mol/L * (normalized to Veh without Dox) 100 120 20 40 60 80 0

+ Adr

mol/L GammaGy 8 Doxycycline B Vector mol/L % Live (normalized to Veh without Dox) mol/L

100 120 Fold change (relative to untreated) Fold change (relative to untreated) 10 15 20 20 40 60 80 10 15 20 0 5 0 mol/L 0 5 – – + + + – – + + – – – – + + + + – – + – –

mol/L

mol/L p53DN843 Car p53 Mcl1 p21 p53 Mcl1 p21

mol/L ﬁ p53DN843 zmbi hoi ypoyi Leukemia Lymphocytic Chronic in lzomib Vector mol/L * lnCne e;1()My1 2013 1, May 19(9) Res; Cancer Clin OF9 Gupta et al.

tumor cells and normal lymphocytes. This hypothesis ylated IkBa in nuclear and cytoplasmic fractions, and could be further tested by comparing the levels of inhi- enhanced binding of NF-kB subunits to NF-kB consensus bition of the CT-L activities in the constitutive (c20S) and sites. However, NF-kB activation does not correlate with immunoproteasome (i20S). We observed that levels of CLL cell death. This result is similar to what was reported in CT-L activity inhibition did not necessarily correlate with multiple myeloma cell lines using BTZ (37), although our CFZ cytotoxicity. One potential explanation is differing studies in CLL primary cells extend these observations to levels of inhibition of the CT-L activity in c20S and i20S show that a classical NF-kB gene induction pattern is not by CFZ, although this remains to be tested. observed. Therefore, although the inhibition of proteasome The tumor suppressor protein p53 induces apoptosis activity is not inhibitory to the NF-kB pathway per se,it under conditions of cellular stress or DNA damage. induces an atypical response that does not result in the Although p53 is functional in most CLL patients at the time ultimate transcription of canonical NF-kB targets and thus is of diagnosis, the gene becomes mutated or deleted in at least unlikely to provide a prosurvival effect. one allele in approximately 40% of patients with advanced To characterize the mechanism of CFZ-mediated cell CLL (24, 39), corresponding with significantly poorer out- death, we assessed the effects of CFZ on the Bcl-2 family come (32). Thus, agents that work independently of p53 are of proteins and subsequent caspase activation. We found of significant interest in the development of therapies for that inhibition of caspase activity caused a significant reduc- drug-resistant CLL. Proteasome inhibitors have been shown tion in cytotoxicity of CFZ. In addition, of the Bcl-2 family of to induce apoptosis in both p53-independent (40) and p53- proteins, only Noxa was consistently upregulated in all CFZ- dependent manners (41). Here, we show that CFZ induces treated samples. This effect was recently shown to induce cytotoxicity irrespective of del(17p13.1) status or the caspase activity in CLL cells, further supporting a caspase- expression of a dominant negative p53 protein. Given the dependent pattern of cytotoxicity (33). Proteasome inhibi- poor outcome and lack of effective therapies for del tors can also cause cytotoxicity because of endoplasmic (17p13.1) CLL patients, these findings suggest CFZ therapy reticulum stress by blocking the degradation of regulatory may be effective in this disease subtype. and misfolded proteins (33, 45). However in our studies Recent advances in CLL biology show the importance of CFZ did not cause changes in conventional endoplasmic both internal and external (microenvironment) factors in reticulum stress markers, including splicing of XBP1 or the survival and drug resistance of CLL tumor cells. The PI3K mRNA or protein levels of CHOP, GRP78, or pEIF2a (data and NF-kB pathways are key regulators of differentiation not shown). Thus, we concluded that in primary CLL cells, and survival in B cells and are induced by microenviron- CFZ-mediated cytotoxicity was caused by a caspase-depen- mental factors (42, 43). CLL cells cultured with stromal cells dent pathway and not via endoplasmic reticulum stress. were less sensitive to CFZ compared to CLL cells in suspen- To date, BTZ is the only proteasome inhibitor approved sion. This protective effect has been linked to the PI3K for treatment of malignant blood disorders and is now pathway (29, 44), and our data show that PI3K inhibition being used in front-line therapy for multiple myeloma indeed reverses this protection. Further work is necessary to (46). In spite of a high degree of cytotoxicity in vitro,BTZ determine the specific PI3K isoform responsible for this failed to produce any objective responses in CLL patients effect, but our data suggest that combination therapy of CFZ in a phase II clinical trial (16). Its failure in vivo was with PI3K inhibitors may provide added benefit. hypothesized to be because of the inactivation of the Although the mechanism of proteasome inhibitor–medi- boronate moiety in BTZ by flavonoids in HS (17), which ated cell death is unclear, these agents have commonly been is consistent with our observation that BTZ lacks activity reported to be inhibitors of the NF-kB pathway (36, 37). against CLL cells in media containing HS. Despite the This notion is attributed to the observation that the NF-kB initial clinical success of BTZinhematologicaldisorders, inhibitory molecule IkBa is a proteasome substrate, and significant populations of patients remain refractory to that proteasome inhibitors should prevent its degradation. treatment. Furthermore, toxicities with BTZ treatment More recent studies indicate that proteasome inhibitors can such as peripheral neuropathy and thrombocytopenia either inhibit or induce NF-kB, again through interaction have increased the intervals between dosing, allowing with IkBa (36, 37). However, these reports are conflicting recovery of the proteasome function (47, 48). This has and effects may vary by cell type. Our data in CLL show that spurred development of a new class of proteasome inhi- the NF-kB pathway is in fact activated by CFZ as evidenced bitors that lack these toxicities. CFZ is being investigated by degradation of total IkBa, accumulation of phosphor- throughclinicaltrialsinnewly diagnosed, relapsed, or

Figure 6. Carﬁlzomib is similarly cytotoxic in cells expressing dominant negative p53 mutants. The 697 acute B-lymphoblast leukemia cell line was transfected with an empty vector or with either of 2 different inducible p53 dominant negative constructs. After 18 hours induction with doxycycline (n ¼ 3): A, cells were harvested for lysates to determine expression of p53 protein. Adriamycin (Adr) treated 697 cells were included as a positive control for p53 protein expression. B, cells were g-irradiated (8 Gy) and RNA was collected at 4 hours. Changes in p53 and p21 were detected by real-time RT-PCR. Mcl-1 is not a p53- target and was included as a negative control. Doxycycline induced p53 (P < 0.0001) in p53DN cells. C, cells were g-irradiated (8 Gy) or treated with CFZ for 1 hour. At 24 hours, viability was determined by LIVE/DEAD staining. In p53DN cells the difference in cytotoxicity in doxycycline-induced and uninduced cells following g treatment was signiﬁcantly different than with CFZ treatment (, P ¼ 0.0378 and , P ¼ 0.0243 for p53DN818 and p53DN843, respectively). Horizontal lines represent the mean.

OF10 Clin Cancer Res; 19(9) May 1, 2013 Clinical Cancer Research Carﬁlzomib in Chronic Lymphocytic Leukemia

A B Pt 4 Pt 5 Pt 1 Pt 2 Pt 3 300 nmol/L CFZ − + − + − + − + − − + + − − + + −+ −+ −+ HeLa 300 nmol/L CFZ: HeLa TNF 100 µmol/L BocD

pIκBα PARP

IκBα IκBα

Actin GAPDH

C NE CE D NE CE Veh CFZ CD40L CpG Veh CFZ CD40L CpG Veh CFZ CD40L CpG Veh CFZ CD40L CpG p50 p100 p65 p52 pIκBα

RelB IκBα

Brg1 Brg1

Tubulin Tubulin

EF 4 350 4 350 4 hourshours nmol/L +– 4 hours hours nmol/L –+ 0 70 350 p65 p50 c-Rel CD40L BMS 0 70 350 p65 p50 c-Rel BMS CD40L

p50/p65 p50/p65 p50/p50 p50/p50

NF-κB induced NF-κB unchanged

G 150

100

50 (normalized to vehicle) to (normalized % Mitochondrial activity 0 CFZ 0 300 0 300 (nmol/L) NF-κB induced NF-κB unchanged

Figure 7. CFZ induces a defective NF-kB response. A, CLL cells (n ¼ 6) were incubated 1 hour without or with 300 nmol/L CFZ, and lysates were collected at 8 hours. IkBa and phosphorylated IkBa (pIkBa) were assessed by immunoblot. Untreated and TNF-treated HeLa cells were included as negative and positive controls for pIkBa protein expression, respectively. B, CLL cells (n ¼ 6) were treated as in A, with or without 100 mmol/L Boc-D-fmk. Lysates were isolated at 18 hours and analyzed by immunoblot. CLL cells (n ¼ 6) were incubated with 0, 70, and 350 nmol/L CFZ for 1 hour or 500 ng/mL CD40L for 4 hours. Nuclear (NE) and cytosolic (CE) extracts were collected at 4 hours and analyzed by immunoblot for NF-kB (C) canonical pathway and (D) noncanonical pathway proteins. EMSAs were run using NE from cells treated with 350 nmol/L CFZ (1 hour treatment, 4 hours incubation) or 500 ng/mL CD40L (4 hours; n ¼ 14), using a probe containing a consensus NF-kB binding site. Representative EMSAs from CFZ-treated NE that displayed (E) increased NF-kB binding and (F) no changes are shown. CD40L and BMS-345541 (IKK inhibitor) treated NE were included as positive and negative controls for p50/p65 binding, respectively. G, viability of all samples analyzed by EMSA was determined by MTS at 48 hours. www.aacrjournals.org Clin Cancer Res; 19(9) May 1, 2013 OF11 Gupta et al.

H 12 CFZ 9

6 * ** ** **

3 over vehicle over Ct)= log fold change Δ

( 0 Δ –

–3 α B Iκ

12 CD40L 12 CpG

9 9

6 6

3 3 over vehicle over vehicle over Ct)= log fold change Ct)= log fold change Δ Δ ( ( 0 0 Δ Δ – –

–3 –3 α α κB B I Iκ

Figure 7. (Continued ) H, CLL cells (n ¼ 12) were treated with 300 nmol/L CFZ (1 hour), 1.7 mmol/L CpG (4 hours), and 500 ng/mL CD40L (4 hours), and RNA was collected at 8 hours from CFZ-treated samples. mRNA expression was analyzed using real-time RT-PCR. CFZ treatment signiﬁcantly induced expression of IkBa () by 1.5-fold, and IL-6, c-FLIP, and CXCL-13 ( all 3) by greater than 2-fold. Horizontal lines represent the mean.

refractory multiple myeloma, and has seen promising Administrative, technical, or material support (i.e., reporting or orga- nizing data, constructing databases): S.V. Gupta, Y. Lu, E.J. Sass, J.C. Byrd, activity both as a single agent and in combination with D.M. Lucas immunomodulators (49–51). Study supervision: D.M. Lucas In summary, our study indicates that CFZ represents a promising, p53-independent therapeutic for CLL and pro- Acknowledgments vides the rationale for development of CFZ in this disease. CFZ was provided for these studies by Onyx Pharmaceuticals, South San Based on these data, we have initiated a phase I dose Francisco, CA. The HS-5-GFP stromal cell line was kindly provided by Dr. Beverly Torok-Storb, Fred Hutchinson Cancer Research Center, Seattle, WA. escalation study of this agent in relapsed and refractory CLL. The authors thank the members of our laboratory for helpful comments and the many patients who donated blood for our studies. Disclosure of Potential Conﬂicts of Interest No potential conﬂicts of interest were disclosed. Grant Support Authors' Contributions This work was supported by The Leukemia & Lymphoma Society and the Conception and design: S.V. Gupta, Y. Lu, D. Jarjoura, J.C. Byrd, D.M. Lucas National Cancer Institute (P50 CA140158, 1K12 CA133250). Mr. and Mrs. Development of methodology: S.V. Gupta, Y. Lu, R. Lapalombella, J.C. Michael Thomas, The Harry Mangurian Foundation, and The D. Warren Byrd, D.M. Lucas Brown Foundation also provided support. Acquisition of data (provided animals, acquired and managed patients, The costs of publication of this article were defrayed in part by the provided facilities, etc.): S.V. Gupta, Y. Lu, E.J. Sass, T.L. Chen, M. Davis, J. payment of page charges. This article must therefore be hereby marked A. Woyach, J.C. Byrd advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate Analysis and interpretation of data (e.g., statistical analysis, biosta- this fact. tistics, computational analysis): S.V. Gupta, Y. Lu, A. Lehman, D. Jarjoura, J.C. Byrd, D.M. Lucas Writing, review, and/or revision of the manuscript: S.V. Gupta, Y. Lu, R. Received August 22, 2012; revised February 26, 2013; accepted March 5, Lapalombella, M. Davis, J.A. Woyach, A. Lehman, J.C. Byrd, D.M. Lucas 2013; published OnlineFirst March 20, 2013.

OF12 Clin Cancer Res; 19(9) May 1, 2013 Clinical Cancer Research Carﬁlzomib in Chronic Lymphocytic Leukemia

References 1. Peters JM, Franke WW, Kleinschmidt JA. Distinct 19-S and 20-S Chronic Lymphocytic Leukemia updating the National Cancer Insti- subcomplexes of the 26-S proteasome and their distribution in the tute-Working Group 1996 guidelines. Blood 2008;111:5446–56. nucleus and the cytoplasm. J Biol Chem 1994;269:7709–18. 24. Lozanski G, Heerema NA, Flinn IW, Smith L, Harbison J, Webb J, et al. 2. Parlati F, Lee SJ, Aujay M, Suzuki E, Levitsky K, Lorens JB, et al. Alemtuzumab is an effective therapy for chronic lymphocytic leukemia Carfilzomib can induce tumor cell death through selective inhibition of with p53 mutations and deletions. Blood 2004;103:3278–81. the chymotrypsin-like activity of the proteasome. Blood 2009;114: 25. Graf L, Iwata M, Torok-Storb B. Gene expression profiling of the 3439–47. functionally distinct human bone marrow stromal cell lines HS-5 and 3. Glickman MH, Ciechanover A. The ubiquitin-proteasome proteolytic HS-27a. Blood 2002;100:1509–11. pathway: destruction for the sake of construction. Physiol Rev 26. Demo SD, Kirk CJ, Aujay MA, Buchholz TJ, Dajee M, Ho MN, et al. 2002;82:373–428. Antitumor activity of PR-171, a novel irreversible inhibitor of the 4. Myung J, Kim KB, Crews CM. The ubiquitin-proteasome pathway and proteasome. Cancer Res 2007;67:6383–91. proteasome inhibitors. Med Res Rev 2001;21:245–73. 27. O'Connor OA, Stewart AK, Vallone M, Molineaux CJ, Kunkel LA, 5. Kisselev AF, Callard A, Goldberg AL. Importance of the different Gerecitano JF, et al. A phase 1 dose escalation study of the safety proteolytic sites of the proteasome and the efficacy of inhibitors varies and pharmacokinetics of the novel proteasome inhibitor carfilzomib with the protein substrate. J Biol Chem 2006;281:8582–90. (PR-171) in patients with hematologic malignancies. Clin Cancer Res 6. Yew PR. Ubiquitin-mediated proteolysis of vertebrate G1- and 2009;15:7085–91. S-phase regulators. J Cell Physiol 2001;187:1–10. 28. Meads MB, Hazlehurst LA, Dalton WS. The bone marrow microenvi- 7. Blagosklonny MV, Wu GS, Omura S, El-Deiry WS. Proteasome-depen- ronment as a tumor sanctuary and contributor to drug resistance. Clin dent regulation of p21WAF1/CIP1Expression. Biochem Biophys Res Cancer Res 2008;14:2519–26. Commun 1996;227:564–69. 29. Herman SE, Gordon AL, Wagner AJ, Heerema NA, Zhao W, Flynn JM, 8. Pagano M, Tam SW, Theodoras AM, Beer-Romero P, Del Sal G, Chau et al. Phosphatidylinositol 3-kinase-delta inhibitor CAL-101 shows V, et al. Role of the ubiquitin-proteasome pathway in regulating promising preclinical activity in chronic lymphocytic leukemia by abundance of the cyclin-dependent kinase inhibitor p27. Science antagonizing intrinsic and extrinsic cellular survival signals. Blood 1995;269:682–85. 2010;116:2078–88. 9. Batchelor E, Loewer A, Lahav G. The ups and downs of p53: under- 30. Sacco A, Aujay M, Morgan B, Azab AK, Maiso P, Liu Y, et al. Carfilzo- standing protein dynamics in single cells. Nat Rev Cancer. 2009;9: mib-dependent selective inhibition of the chymotrypsin-like activity of 371–77. the proteasome leads to antitumor activity in Waldenstrom's Macro- 10. Rozan LM, El-Deiry WS. p53 downstream target genes and tumor globulinemia. Clin Cancer Res 2011;17:1753–64. suppression: a classical view in evolution. Cell Death Differ 2007; 31. Kuhn DJ, Chen Q, Voorhees PM, Strader JS, Shenk KD, Sun CM, et al. 14:3–9. Potent activity of carfilzomib, a novel, irreversible inhibitor of the 11. Chen ZJ. Ubiquitin signalling in the NF-[kappa]B pathway. Nat Cell Biol ubiquitin-proteasome pathway, against preclinical models of multiple 2005;7:758–65. myeloma. Blood 2007;110:3281–3290. 12. Chipuk JE, Moldoveanu T, Llambi F, Parsons MJ, Green DR. The BCL- 32. Zenz T, Krober A, Scherer K, Habe S, Buhler A, Benner A, et al. 2 family reunion. Mol Cell 2010;37:299–10. Monoallelic TP53 inactivation is associated with poor prognosis in 13. Hertlein E, Byrd JC. Signalling to drug resistance in CLL. Best Pract chronic lymphocytic leukemia: results from a detailed genetic char- Res Clin Haematol 2010;23:121–31. acterization with long-term follow-up. Blood 2008;112:3322–29. 14. Packham G, Stevenson FK. Bodyguards and assassins: Bcl-2 family 33. Baou M, Kohlhaas SL, Butterworth M, Vogler M, Dinsdale D, Walewska proteins and apoptosis control in chronic lymphocytic leukaemia. R, et al. Role of NOXA and its ubiquitination in proteasome inhibitor- Immunology 2005;114:441–49. induced apoptosis in chronic lymphocytic leukemia cells. Haemato- 15. Bross PF, Kane R, Farrell AT, Abraham S, Benson K, Brower ME, et al. logia 2010;95:1510–18. Approval summary for bortezomib for injection in the treatment of 34. Trbusek M, Smardova J, Malcikova J, Sebejova L, Dobes P, Svitakova multiple myeloma. Clin Cancer Res 2004;10:3954–64. M, et al. Missense mutations located in structural p53 DNA-binding 16. Faderl S, Rai K, Gribben J, Byrd JC, Flinn IW, O'Brien S, et al. Phase II motifs are associated with extremely poor survival in chronic lympho- study of single-agent bortezomib for the treatment of patients with cytic leukemia. J Clin Oncol 2011;29:2703–08. fludarabine-refractory B-cell chronic lymphocytic leukemia. Cancer 35. Sugawara W, Arai Y, Kasai F, Fujiwara Y, Haruta M, Hosaka R, et al. 2006;107:916–24. Association of germline or somatic TP53 missense mutation with 17. Liu FT, Agrawal SG, Movasaghi Z, Wyatt PB, Rehman IU, Gribben JG, oncogene amplification in tumors developed in patients with Li-frau- et al. Dietary flavonoids inhibit the anticancer effects of the proteasome meni or Li-fraumeni-like syndrome. Genes Chromosomes Cancer inhibitor bortezomib. Blood 2008;112:3835–46. 2011;50:535–45. 18. Groll M, Kim KB, Kairies N, Huber R, Crews CM. Crystal structure of 36. Juvekar A, Manna S, Ramaswami S, Chang TP, Vu HY, Ghosh CC, epoxomicin: 20S proteasome reveals a molecular basis for selectivity et al. Bortezomib induces nuclear translocation of IkBa resulting in of alpha-, beta-epoxyketone proteasome inhibitors. J Am Chem Soc gene-specific suppression of NF-kB–dependent transcription and 2000;122:1237–38. induction of apoptosis in CTCL. Mol Cancer Res 2011;9:183–94. 19. Adams J, Behnke M, Chen SW, Cruickshank AA, Dick LR, Grenier L, 37. Hideshima T, Ikeda H, Chauhan D, Okawa Y, Raje N, Podar K, et al. et al. Potent and selective inhibitors of the proteasome: dipeptidyl Bortezomib induces canonical nuclear factor-kB activation in multiple boronic acids. Bioorganic Med Chem Lett 1998;8:333–38. myeloma cells. Blood 2009;114:1046–52. 20. Demo SD, Buchholz TJ, Laidig GJ, Parlati F, Shenk KD, Smyth MS, 38. Ravi R, Bedi A, Fuchs EJ. CD95 (Fas)-induced caspase-mediated et al. Biochemical and cellular characterization of the novel protea- proteolysis of NF-kB. Cancer Res 1998;58:882–86. some inhibitor PR-171. Blood 2005;106:455a–55a. 39. Zenz T, Vollmer D, Trbusek M, Smardova J, Benner A, Soussi T, et al. 21. Dorsey BD, Iqbal M, Chatterjee S, Menta E, Bernardini R, Bernareggi A, TP53 mutation profile in chronic lymphocytic leukemia: evidence for a et al. Discovery of a potent, selective, and orally active proteasome disease specificprofile from a comprehensive analysis of 268 muta- inhibitor for the treatment of cancer. J Med Chem 2008;51:1068–72. tions. Leukemia 2010;24:2072–79. 22. Liang H, Nishioka Y, Reich CF, Pisetsky DS, Lipsky PE. Activation of 40. Perez-Galan P, Roue G, Villamor N, Montserrat E, Campo E, Colomer human B cells by phosphorothioate oligodeoxynucleotides. J Clin D. The proteasome inhibitor bortezomib induces apoptosis in mantle- Invest 1996;98:1119–29. cell lymphoma through generation of ROS and Noxa activation inde- 23. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, pendent of p53 status. Blood 2006;107:257–64. Dohner H, et al. Guidelines for the diagnosis and treatment of chronic 41. Lopes UG, Erhardt P, Yao R, Cooper GM. p53-dependent induction of lymphocytic leukemia: a report from the International Workshop on apoptosis by proteasome inhibitors. J Biol Chem 1997;272:12893–96.

www.aacrjournals.org Clin Cancer Res; 19(9) May 1, 2013 OF13 Gupta et al.

42. Cantrell DA. Phosphoinositide 3-kinase signalling pathways. J Cell Sci 48. Richardson PG, Sonneveld P, Schuster MW, Irwin D, Stadtmauer EA, 2001;114:1439–45. Facon T, et al. Bortezomib or high-dose dexamethasone for relapsed 43. Baldwin AS Jr. The NF-kB and IkB proteins: new discoveries and multiple myeloma. N Engl J Med 2005;352:2487–98. insights. Annu Rev Immunol 1996;14:649–83. 49. Jakubowiak AJ, Dytfeld D, Griffith KA, Lebovic D, Vesole DH, Jagan- 44. Niedermeier M, Hennessy BT, Knight ZA, Henneberg M, Hu J, Kurtova nath S, et al. A phase 1/2 study of carfilzomib in combination with AV, et al. Isoform-selective phosphoinositide 30-kinase inhibitors inhib- lenalidomide and low-dose dexamethasone as a frontline treatment for it CXCR4 signaling and overcome stromal cell-mediated drug resis- multiple myeloma. Blood 2012;120:1801–09. tance in chronic lymphocytic leukemia: a novel therapeutic approach. 50. SiegelDS, Martin T, WangM, VijR, Jakubowiak AJ,Lonial S,et al.A phase Blood 2009;113:5549–57. 2 study of single-agent carfilzomib (PX-171-003-A1) in patients with 45. Obeng EA, Carlson LM, Gutman DM, Harrington WJ Jr., Lee KP, Boise relapsed and refractory multiple myeloma. Blood 2012;120:2817–25. LH. Proteasome inhibitors induce a terminal unfolded protein response 51. Vij R, Siegel DS, Jagannath S, Jakubowiak AJ, Stewart AK, McDonagh in multiple myeloma cells. Blood 2006;107:4907–16. K, et al. An open-label, single-arm, phase 2 study of single-agent 46. Ruschak AM, Slassi M, Kay LE, Schimmer AD. Novel proteasome carfilzomib in patients with relapsed and/or refractory multiple mye- inhibitors to overcome bortezomib resistance. J Natl Cancer Inst loma who have been previously treated with bortezomib. Br J Hae- 2011;103:1007–17. matol 2012;158:739–48. 47. Orlowski RZ, Stinchcombe TE, Mitchell BS, Shea TC, Baldwin AS, 52. JohnsonAJ, YehY-Y,Smith LL, WagnerAJ, Hessler J,Gupta S, etal. The Stahl S, et al. Phase I trial of the proteasome inhibitor PS-341 in novel cyclin-dependent kinase inhibitor dinaciclib (SCH727965) pro- patients with refractory hematologic malignancies. J Clin Oncol motes apoptosis and abrogates microenvironmental cytokine protection 2002;20:4420–27. in chronic lymphocytic leukemia cells. Leukemia 2012;26:2554–7.

OF14 Clin Cancer Res; 19(9) May 1, 2013 Clinical Cancer Research Published OnlineFirst March 20, 2013; DOI: 10.1158/1078-0432.CCR-12-2754

The Proteasome Inhibitor Carfilzomib Functions Independently of p53 to Induce Cytotoxicity and an Atypical NF-κB Response in Chronic Lymphocytic Leukemia Cells

Sneha V. Gupta, Erin Hertlein, Yanhui Lu, et al.

Clin Cancer Res Published OnlineFirst March 20, 2013.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-12-2754

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2013/03/20/1078-0432.CCR-12-2754.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2013/04/17/1078-0432.CCR-12-2754. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.