Published OnlineFirst March 20, 2013; DOI: 10.1158/1078-0432.CCR-12-2754 Clinical Cancer Cancer Therapy: Preclinical Research The Proteasome Inhibitor Carfilzomib Functions Independently of p53 to Induce Cytotoxicity and an Atypical NF-kB Response in Chronic Lymphocytic Leukemia Cells Sneha V. Gupta1, Erin Hertlein2, Yanhui Lu4, Ellen J. Sass2, Rosa Lapalombella2, Timothy L. Chen2, Melanie E. Davis2, Jennifer A. Woyach2, Amy Lehman3, David Jarjoura4, John C. Byrd1,2, and David M. Lucas1,2 Abstract Purpose: The proteasome consists of chymotrypsin-like (CT-L), trypsin-like, and caspase-like subunits that cleave substrates preferentially by amino acid sequence. Proteasomes mediate degradation of regulatory proteins of the p53, Bcl-2, and nuclear factor-kB (NF-kB) families that are aberrantly active in chronic lymphocytic leukemia (CLL). CLL remains an incurable disease, and new treatments are especially needed in the relapsed/refractory setting. We therefore investigated the effects of the proteasome inhibitor carfilzomib (CFZ) in CLL cells. Experimental Design: Tumor cells from CLL patients were assayed in vitro using immunoblotting, real- time polymerase chain reaction, and electrophoretic mobility shift assays. In addition, a p53 dominant- negative construct was generated in a human B-cell line. Results: Unlike bortezomib, CFZ potently induces apoptosis in CLL patient cells in the presence of human serum. CLL cells have significantly lower basal CT-L activity compared to normal B and T cells, although activity is inhibited similarly in T cells versus CLL. Co-culture of CLL cells on stroma protected from CFZ-mediated cytotoxicity; however, PI3K inhibition significantly diminished this stromal protection. CFZ- mediated cytotoxicity in leukemic B cells is caspase-dependent and occurs irrespective of p53 status. In CLL cells, CFZ promotes atypical activation of NF-kB evidenced by loss of cytoplasmic IkBa, phosphorylation of IkBa, and increased p50/p65 DNA binding, without subsequent increases in canonical NF-kB target gene transcription. Conclusions: Together, these data provide new mechanistic insights into the activity of CFZ in CLL and support phase I investigation of CFZ in this disease. Clin Cancer Res; 19(9); 1–14. Ó2013 AACR. Introduction Protein homeostasis is critical for the processes that Chronic lymphocytic leukemia (CLL) is characterized by govern cell survival, and the multicatalytic 26S protea- the growth and accumulation of malignant B-lymphocytes some regulates the turnover of key proteins in these in the blood, bone marrow, lymph nodes, and spleen. processes. Proteasomes consist of a catalytic 20S core Despite the introduction of new therapies, most CLL patients capped by regulatory 19S subunits (1). There are 2 forms eventually relapse and succumb to their disease. Identifica- of the 20S core: c20S and i20S. The former is ubiqui- tion of new strategies for relapsed and refractory CLL is tiously expressed in all cells, and the latter specifically in essential to make a positive impact on patient survival. hematopoietic cells and cells exposed to inflammatory cytokines (2). The active site in the c20S and i20S core has 6 N-terminal threonine proteases consisting of chymo- trypsin-like (CT-L), trypsin-like (T-L), and caspase-like fi 1 2 Authors' Af liations: College of Pharmacy; Department of Internal (C-L) subunits (3, 4). Because selective inhibition of the Medicine; 3Center for Biostatistics, The Ohio State University, Columbus, Ohio; and 4Department of Pharmacology and Molecular Sciences, Johns CT-L site has a minor effect on total cellular protein Hopkins University School of Medicine, Baltimore, Maryland turnover, proteasome inhibitors that block only the Note: Supplementary data for this article are available at Clinical Cancer CT-L subunit are considered optimal (5). Proteasomes Research Online (http://clincancerres.aacrjournals.org/). mediate degradation of a variety of key regulatory factors J.C. Byrd and D.M. Lucas contributed equally to this article. including cell-cycle control proteins (e.g., cyclins (6), p21 (7) and p27 (8), p53 (9), p53 target proteins Puma, Noxa, Corresponding Authors: John C. Byrd, 410 W. 12th Avenue, Room 455 OSUCCC Building, Columbus, OH 43210. Phone: 614-293-8330; Fax: 614- and Bax of the Bcl-2 family (10), and the inhibitor of 292-3312; E-mail: [email protected]; and David M. Lucas. Phone: nuclear factor-kB(NF-kB; IkB; ref. 11). Imbalanced 614-685-5667; Fax: 614-292-3312; E-mail: [email protected] expression of Bcl-2 family proteins, constitutive NF-kB doi: 10.1158/1078-0432.CCR-12-2754 activation, and variable p53 function are hallmarks of Ó2013 American Association for Cancer Research. CLL cells (12–14). www.aacrjournals.org OF1 Downloaded from clincancerres.aacrjournals.org on September 27, 2021. © 2013 American Association for Cancer Research. Published OnlineFirst March 20, 2013; DOI: 10.1158/1078-0432.CCR-12-2754 Gupta et al. patients examined had immunophenotypically defined Translational Relevance CLL as outlined by IWCLL criteria (23) and were newly Standard therapies for chronic lymphocytic leukemia diagnosed or without treatment for a minimum of 30 days (CLL) are often ineffective in p53-mutated cases and at time of collection. The occurrence of del(17p13.1) was detrimental to existing T cells, leaving patients at risk of determined in CLL patient samples by fluorescence in situ opportunistic infections. A major focus of therapeutic hybridization as described (24), and in each positive case at development has been the investigation of agents that least 30% of cells showed this deletion. Normal cells were are cytotoxic to B cells independent of p53 but have obtained from partial leukocyte preparations from the minimal effects on T cells. Proteasome inhibitors have American Red Cross. B- or T-lymphocytes and CLL cells known activity in multiple myeloma, but to date have were negatively selected using RosetteSep reagents (Stem- not shown clinical efficacy in CLL. This manuscript Cell Technologies). The HS-5-GFP stromal cell line was shows B-cell selective efficacy of the proteasome inhib- provided by Dr. Beverly Torok-Storb (Fred Hutchinson itor carfilzomib (CFZ) that is independent of p53, and Cancer Research Center; ref. 25). 293 cells were obtained provides new mechanistic insights to its mode of action from American Type Culture Collection (Manassas, VA) and in CLL patient cells. This work supports an ongoing 697 lymphoblastic cells were obtained from DSMZ. Cells phase I clinical trial of CFZ in CLL. were incubated at 37 C and 5% CO2 in AIM-V medium (Invitrogen) or in RPMI 1640 with 10% FBS or 10% human serum (HS) supplemented with penicillin, streptomycin, and L-glutamine (Sigma). Bortezomib (BTZ, Velcade) is a proteasome inhibitor approved for the treatment of multiple myeloma and man- Viability assays tle cell lymphoma (15). Concentrations of BTZ that pro- Cell viability was monitored by flow cytometry using duce an antitumor response in vitro inhibit activities of the annexin V/propidium iodide (BD Biosciences) on a FC500 CT-L and C-L subunits of the proteasome (2). In spite of a instrument (Beckman Coulter). CellTiter 96 (MTS) assays high degree of cytotoxicity in vitro in CLL cells, BTZ failed to were conducted to monitor growth inhibition per manu- produce objective responses in CLL patients in a phase II facturer’s instructions (Promega). LIVE/DEAD (Invitrogen) clinical trial at the achieved doses (16). The lack of BTZ staining was done to monitor cytotoxicity with drug treat- efficacy in vivo has been attributed to the inactivation of its ments using the manufacturer’s instructions. boronate moiety by dietary flavonoids in human plasma (17). Carfilzomib (CFZ, PR-171) is a novel proteasome Immunoblot analyses inhibitor that specifically and irreversibly inhibits the CT- Nuclear and cytoplasmic lysates were prepared with NE- L activity of the proteasome (18). Unlike BTZ, CFZ has PER Nuclear and Cytoplasmic Extraction kit (Pierce). Anti- minimal activity against off-target enzymes including serine body to polyADP-ribose polymerase (PARP) was from EMD proteases, while at the same time inhibiting the CT-L Biosciences, p21 (OP64) and p53 (OP43) from Calbio- subunit of the proteasome more potently (19–21). Impor- chem, p27 (88264) from Abcam, and pIkBa from Cell tantly, CFZ lacks the boronate moiety of BTZ that is poten- Signaling Technologies. Remaining antibodies were from tially responsible for that agent’s inactivity in CLL patients. Santa Cruz Biotechnology. Bands were quantified on an Here, we investigate the effects of CFZ on CLL patient cells. AlphaImager system (Proteinsimple). This work shows that CFZ irreversibly inhibits the CT-L activity, has potent activity in CLL including cases with del Electrophoretic mobility shift assay A probe containing an NF-kB consensus binding site (17p13.1), and promotes an atypical activation of NF-kB 0 0 that may lack the classical prosurvival effect of this pathway. (5 AGTTGAGGGGACTTTCCCAGGC 3 ; Santa Cruz Bio- technology) was 32P-labeled using the Nick Translation Materials and Methods System (Invitrogen). Five micrograms of nuclear protein was incubated 30 minutes at room temperature in bind- Reagents ing buffer (10 mmol/L Tris-HCl, pH 7.5, 1.0 mmol/L CFZ was provided by Onyx Pharmaceuticals. Boc-D-FMK ethylenediaminetetraacetic acid (EDTA), 4% Ficoll, 1.0 (Enzyme Systems Products) was used at 100 mmol/L. BTZ mmol/L dithiothreitol, 75 mmol/L KCl) plus 250 ng poly was obtained from Millennium Pharmaceuticals Inc., and dI-dC (Sigma). Complexes were separated on polyacryl- TNF from R&D Systems. CD40L was purchased from Pepro- amide gels in Tris-borate EDTA buffer (89 mmol/L Tris- Tech. 2-Fluoro-ara-A (active metabolite of fludarabine), base, 89 mmol/L boric acid, 2.0 mmol/L EDTA), dried, G418, doxycycline, and puromycin were purchased from and autoradiographed. For supershift experiments, anti- Sigma. CpG DSP30 (22) was purchased from Eurofins/ bodies to p65, p50, or c-Rel (Santa Cruz Biotechnology) Operon. were incubated with nuclear extract for 10 minutes before addition of probe.