DOCSLIB.ORG

DNA Hypermethylation of Fgf16 and Tbx22 Associated with Cleft Palate During Palatal Fusion

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
DNA Hypermethylation of Fgf16 and Tbx22 Associated with Cleft Palate During Palatal Fusion Original Article http://dx.doi.org/10.1590/1678-7757-2018-0649 DNA hypermethylation of Fgf16 and Tbx22 associated with cleft palate during palatal fusion Abstract Xuan SHU1 Objective: Cleft palate (CP) is a congenital birth defect caused by the failure of palatal fusion. Little is known about the potential role of DNA methylation Zejun DONG1 in the pathogenesis of CP. This study aimed to explore the potential role of Liuhanghang CHENG1 DNA methylation in the mechanism of CP. Methodology: We established an Shenyou SHU1 all-trans retinoic acid (ATRA)-induced CP model in C57BL/6J mice and used methylation-dependent restriction enzymes (MethylRAD, FspEI) combined with high-throughput sequencing (HiSeq X Ten) to compare genome-wide DNA methylation profiles of embryonic mouse palatal tissues, between embryos from ATRA-treated vs. untreated mice, at embryonic gestation day 14.5 (E14.5) (n=3 per group). To confirm differentially methylated levels of susceptible genes, real-time quantitative PCR (qPCR) was used to correlate expression of differentially methylated genes related to CP. Results: We identified 196 differentially methylated genes, including 17,298 differentially methylated CCGG sites between ATRA-treated vs. untreated embryonic mouse palatal tissues (P<0.05, log2FC>1). The CP-related genes Fgf16 (P=0.008, log2FC=1.13) and Tbx22 (P=0.011, log2FC=1.64,) were hypermethylated. Analysis of Fgf16 and Tbx22, using Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG), identified 3 GO terms and 1 KEGG pathway functionally related to palatal fusion. The qPCR showed that changes in expression level negatively correlated with methylation levels. Conclusions: Taken together, these results suggest that hypermethylation of Fgf16 and Tbx22 is associated with decreased gene expression, which might be responsible for developmental failure of palatal fusion, eventually resulting in the formation of CP. Keywords: DNA methylation. Cleft palate. Gene expression. Submitted: November 1, 2018 Modification: February 17, 2019 Accepted: March 12, 2019 Corresponding address: 1Second Affiliated Hospital of Shantou University Medical College, Cleft Lip and Palate Treatment Shenyou Shu Center, Shantou, Guangdong, China. Cleft Lip and Palate Treatment Center, Second Affiliated Hospital of Shantou University Medical College 69 Dongxia North Road, Jinping District, Shantou 515041 - China. Phone: +86-18023235288 - Fax: +86-0754-83141156 e-mail: [email protected] J Appl Oral Sci. 1/8 2019;27:e20180649 DNA hypermethylation of Fgf16 and Tbx22 associated with cleft palate during palatal fusion Introduction and humans. We integrated DNA methylation analysis of Fgf16 and Tbx22, by MethylRAD-seq, with Cleft palate (CP) is a congenital birth defect their biological characteristics identified by GO and caused by both environmental and genetic factors.1 KEGG pathway enrichment analysis. The restriction It is universally acknowledged that palatal fusion is enzyme FspEI recognizes 5-methylcytosine and the most crucial process in the palate formation. In 5-hydroxymethylcytosine in CCGG and CCWGG (where 10 a mouse, palatal shelves appose at the midline and W=A or T), and cleaves DNA bilaterally to generate palatal fusion occurs at E 14.5, and an imbalance of 32 bp fragments at a methylated CCGG site and 31 embryonic palatal mesenchyme cell proliferation and bp fragments at a methylated CCWGG site, with either apoptosis might result in CP.2 Previous studies have FspE1 recognition site in the middle. The qPCR was demonstrated that Fgf16 and Tbx22 participate in used to correlate Fgf16 and Tbx22 expression levels murine palate development.3 However, the role of with methylation levels to elucidate the molecular Fgf16 and Tbx22 during palatal fusion is still unknown. regulatory mechanisms underlying the development DNA methylation is an important epigenetic of CP. modification and plays a crucial role in many biological processes, such as embryogenesis, cellular differentiation, X-chromosome inactivation, genomic Methodology imprinting and transcriptional silencing.4 Methylation patterns of specific genes have been found to undergo Ethics, animals and treatment dynamic changes in embryonic development and This study was approved by the Laboratory Animal contribute to tissue-specific gene expression.5 The DNA Ethical Committee of the Medical College of Shantou methylation pattern of a mouse undergoes dynamic University (SUMC2015-106; Guangdong, China). and widespread alterations during palatogenesis, C57BL/6J mice of 20–28 g in body weight and 8 to and failing to establish correct methylation patterns 10 weeks of age were purchased from the Beijing can result in CP,6 which suggests that CP-susceptible Vital River Laboratory Animal Technology Co. Ltd. genes (e.g. Fgf16 and Tbx22) in embryonic mice (Beijing, China). In this study, female mice were mated provide new clues to epigenetic markers involved in with male mice of similar weight and age overnight. CP. Nevertheless, details on the methylation patterns Embryonic gestation day 0.5 (E0.5) was designated of CP-susceptible genes during palatal fusion are to be at 8 AM the next day when a vaginal plug was very limited, and the methylation pattern of Fgf16 observed. Pregnant mice at E10.5 were randomly and Tbx22 underlying palate development and its divided into an all-trans retinoic acid (ATRA, Sigma- contribution to CP is still unclear. Aldrich, St. Louis, MO, USA)-treated and control To explore the potential involvement of DNA (mock-treated) group. Mice in the ATRA-treated group methylation in regulating palatal fusion, we previously were treated, via oral gavage, with ATRA at 70 mg/ established a CP model in which pregnant C57BL/6J kg dissolved in corn oil as described previously.7 The mice are treated with all-trans retinoic acid (ATRA) untreated group was given an equivalent volume of to introduce CP in the embryos.7 ATRA is a vitamin A corn oil. At E14.5, mice were euthanized, and the metabolite and functions to support normal pattern embryonic palatal shelves (3 ATRA-treated samples formation during embryogenesis. Abnormally high vs. 3 untreated samples) were resected and stored concentrations of ATRA may affect palatogenesis at -80°C until use. by interfering in medial edge epithelia (MEE) cell differentiation and apoptosis, including inhibition of DNA preparation, library construction and mesenchymal proliferation and signaling growth factors MethylRAD-seq (transforming growth factor-β and platelet-derived Genomic DNA was extracted from palatal shelf growth factor).8 Cuervo, et al.9 (2002) reported that tissues using the conventional cetyltrimethyl high ATRA concentration blocked palatal shelf fusion ammonium bromide (CTAB) method following the and increased apoptosis within the MEE cell adhesion manufacturer’s instructions (AMRESCO Inc, Solon, process, and which may result in fetal malformations, OH, USA), and MethylRAD library construction and including cleft palate, in both experimental animals sequencing were the same as previously reported.10 J Appl Oral Sci. 2/8 2019;27:e20180649 SHU X, DONG Z, CHENG L, SHU S Paired-end sequencing was performed on a HiSeq X Protein-protein interaction (PPI) network Ten platform (100-150 bp) (Illumina Inc, San Diego, construction CA, USA), according to the manufacturer’s protocol, In this study, we used the online database, The by Shanghai Oebiotech Co. Ltd. (Shanghai, China). Search Tool for the Retrieval of Interacting Genes (STRING) (https://string-db.org/cgi/input.pl), to MethylRAD-seq analysis construct the PPI network of differentially methylated After quality-control and filtering of the original genes. Then the PPI network was constructed and reads, high-quality reads were mapped against these visualized using Cytoscape 3.5.1. reference sites (ftp://ftp.ensembl.org/pub/release-84/ fasta/mus_musculus/dna/Mus_musculus.GRCm38. Validation of susceptibility gene expression dna.toplevel.fa.gz) using the SOAP program.11 In by qPCR order to improve accuracy in the follow-up analysis, The same samples used for MethylRAD-seq were Pear software (v0.9.6)12was used to re-filter paired- used for reverse transcription. Briefly, total RNA end sequencing by removing: (i) low quality reads was isolated from mouse palatal shelf tissues and (Phred quality score lower than 30) and (ii) sequences reverse-transcribed into cDNA using TRIzol reagent containing too many N bases (sites containing more (Invitrogen Inc, Carlsbad, CA USA) and the Thermo than 8% of N bases). Signatures containing FspEI First cDNA Synthesis Kit (Thermo Scientific™, sites were extracted from the genome as the reference Waltham, MA, USA), respectively, according to the sequence. Sites covered by at least three reads were manufacturers’ protocols. In each qPCR tube, a 20 μl regarded as authentic methylated sites. The number of reaction mix was prepared using 2×SG Green qPCR Mix methylated sites and the depth of signature coverage (with ROX) (Sino Gene, Beijing, China). The thermal of each sample were then calculated. The untranslated profile was 40 cycles of 95°C for 10 seconds and region (UTR) was calculated using snpEff software 60°C for 30 seconds, followed by a dissociation curve (version: 4.3p),13 and was counted using bed tools check. The qPCR primer sequences for Fgf16 were software (v2.25.0)14 according to the annotation as follows: forward, 5′ACGTGAATGTGTTTTCCGGG3′, document and the distribution of methylation sites in reverse, 5′CCGTCTTTATTCAGGGCCAC3′. The qPCR the different gene elements
Load more

Recommended publications
  • ARTICLES Fibroblast Growth Factors 1, 2, 17, and 19 Are The
    0031-3998/07/6103-0267 PEDIATRIC RESEARCH Vol. 61, No. 3, 2007 Copyright © 2007 International Pediatric Research Foundation, Inc. Printed in U.S.A. ARTICLES Fibroblast Growth Factors 1, 2, 17, and 19 Are the Predominant FGF Ligands Expressed in Human Fetal Growth Plate Cartilage PAVEL KREJCI, DEBORAH KRAKOW, PERTCHOUI B. MEKIKIAN, AND WILLIAM R. WILCOX Medical Genetics Institute [P.K., D.K., P.B.M., W.R.W.], Cedars-Sinai Medical Center, Los Angeles, California 90048; Department of Obstetrics and Gynecology [D.K.] and Department of Pediatrics [W.R.W.], UCLA School of Medicine, Los Angeles, California 90095 ABSTRACT: Fibroblast growth factors (FGF) regulate bone growth, (G380R) or TD (K650E) mutations (4–6). When expressed at but their expression in human cartilage is unclear. Here, we deter- physiologic levels, FGFR3-G380R required, like its wild-type mined the expression of entire FGF family in human fetal growth counterpart, ligand for activation (7). Similarly, in vitro cul- plate cartilage. Using reverse transcriptase PCR, the transcripts for tivated human TD chondrocytes as well as chondrocytes FGF1, 2, 5, 8–14, 16–19, and 21 were found. However, only FGF1, isolated from Fgfr3-K644M mice had an identical time course 2, 17, and 19 were detectable at the protein level. By immunohisto- of Fgfr3 activation compared with wild-type chondrocytes and chemistry, FGF17 and 19 were uniformly expressed within the showed no receptor activation in the absence of ligand (8,9). growth plate. In contrast, FGF1 was found only in proliferating and hypertrophic chondrocytes whereas FGF2 localized predominantly to Despite the importance of the FGF ligand for activation of the resting and proliferating cartilage.
    [Show full text]
  • Pathophysiological Roles of FGF Signaling in the Heart
    MINI REVIEW ARTICLE published: 06 September 2013 doi: 10.3389/fphys.2013.00247 Pathophysiological roles of FGF signaling in the heart Nobuyuki Itoh* and Hiroya Ohta Department of Genetic Biochemistry, Kyoto University Graduate School of Pharmaceutical Sciences, Kyoto, Japan Edited by: Cardiac remodeling progresses to heart failure, which represents a major cause of Marcel van der Heyden, University morbidity and mortality. Cardiomyokines, cardiac secreted proteins, may play roles Medical Center, Netherlands in cardiac remodeling. Fibroblast growth factors (FGFs) are secreted proteins with Reviewed by: diverse functions, mainly in development and metabolism. However, some FGFs play Marcel van der Heyden, University Medical Center, Netherlands pathophysiological roles in cardiac remodeling as cardiomyokines. FGF2 promotes cardiac Christian Faul, University of Miami hypertrophy and fibrosis by activating MAPK signaling through the activation of FGF Miller School of Medicine, USA receptor (FGFR) 1c. In contrast, FGF16 may prevent these by competing with FGF2 for the *Correspondence: binding site of FGFR1c. FGF21 prevents cardiac hypertrophy by activating MAPK signaling Nobuyuki Itoh, Department of through the activation of FGFR1c with β-Klotho as a co-receptor. In contrast, FGF23 Genetic Biochemistry, Kyoto α University Graduate School of induces cardiac hypertrophy by activating calcineurin/NFAT signaling without Klotho. Pharmaceutical Sciences, These FGFs play crucial roles in cardiac remodeling via distinct action mechanisms. These Yoshida-Shimoadachi, Sakyo, findings provide new insights into the pathophysiological roles of FGFs in the heart and Kyoto 606-8501, Japan may provide potential therapeutic strategies for heart failure. e-mail: itohnobu@ pharm.kyoto-u.ac.jp Keywords: FGF, heart, hypertrophy, fibrosis, heart failure, cardiomyokine INTRODUCTION mice and humans, respectively.
    [Show full text]
  • Instability Restricts Signaling of Multiple Fibroblast Growth Factors
    Cell. Mol. Life Sci. DOI 10.1007/s00018-015-1856-8 Cellular and Molecular Life Sciences RESEARCH ARTICLE Instability restricts signaling of multiple fibroblast growth factors Marcela Buchtova • Radka Chaloupkova • Malgorzata Zakrzewska • Iva Vesela • Petra Cela • Jana Barathova • Iva Gudernova • Renata Zajickova • Lukas Trantirek • Jorge Martin • Michal Kostas • Jacek Otlewski • Jiri Damborsky • Alois Kozubik • Antoni Wiedlocha • Pavel Krejci Received: 18 June 2014 / Revised: 7 February 2015 / Accepted: 9 February 2015 Ó Springer Basel 2015 Abstract Fibroblast growth factors (FGFs) deliver ex- failure to activate FGF receptor signal transduction over tracellular signals that govern many developmental and long periods of time, and influence specific cell behavior regenerative processes, but the mechanisms regulating FGF in vitro and in vivo. Stabilization via exogenous heparin signaling remain incompletely understood. Here, we ex- binding, introduction of stabilizing mutations or lowering plored the relationship between intrinsic stability of FGF the cell cultivation temperature rescues signaling of un- proteins and their biological activity for all 18 members of stable FGFs. Thus, the intrinsic ligand instability is an the FGF family. We report that FGF1, FGF3, FGF4, FGF6, important elementary level of regulation in the FGF sig- FGF8, FGF9, FGF10, FGF16, FGF17, FGF18, FGF20, and naling system. FGF22 exist as unstable proteins, which are rapidly de- graded in cell cultivation media. Biological activity of Keywords Fibroblast growth factor Á FGF Á Unstable Á FGF1, FGF3, FGF4, FGF6, FGF8, FGF10, FGF16, FGF17, Proteoglycan Á Regulation and FGF20 is limited by their instability, manifesting as Electronic supplementary material The online version of this article (doi:10.1007/s00018-015-1856-8) contains supplementary material, which is available to authorized users.
    [Show full text]
  • FGF Signaling Network in the Gastrointestinal Tract (Review)
    163-168 1/6/06 16:12 Page 163 INTERNATIONAL JOURNAL OF ONCOLOGY 29: 163-168, 2006 163 FGF signaling network in the gastrointestinal tract (Review) MASUKO KATOH1 and MASARU KATOH2 1M&M Medical BioInformatics, Hongo 113-0033; 2Genetics and Cell Biology Section, National Cancer Center Research Institute, Tokyo 104-0045, Japan Received March 29, 2006; Accepted May 2, 2006 Abstract. Fibroblast growth factor (FGF) signals are trans- Contents duced through FGF receptors (FGFRs) and FRS2/FRS3- SHP2 (PTPN11)-GRB2 docking protein complex to SOS- 1. Introduction RAS-RAF-MAPKK-MAPK signaling cascade and GAB1/ 2. FGF family GAB2-PI3K-PDK-AKT/aPKC signaling cascade. The RAS~ 3. Regulation of FGF signaling by WNT MAPK signaling cascade is implicated in cell growth and 4. FGF signaling network in the stomach differentiation, the PI3K~AKT signaling cascade in cell 5. FGF signaling network in the colon survival and cell fate determination, and the PI3K~aPKC 6. Clinical application of FGF signaling cascade in cell polarity control. FGF18, FGF20 and 7. Clinical application of FGF signaling inhibitors SPRY4 are potent targets of the canonical WNT signaling 8. Perspectives pathway in the gastrointestinal tract. SPRY4 is the FGF signaling inhibitor functioning as negative feedback apparatus for the WNT/FGF-dependent epithelial proliferation. 1. Introduction Recombinant FGF7 and FGF20 proteins are applicable for treatment of chemotherapy/radiation-induced mucosal injury, Fibroblast growth factor (FGF) family proteins play key roles while recombinant FGF2 protein and FGF4 expression vector in growth and survival of stem cells during embryogenesis, are applicable for therapeutic angiogenesis. Helicobacter tissues regeneration, and carcinogenesis (1-4).
    [Show full text]
  • Supplementary Information
    Supplementary information Supplemental Figure 1. No tissue contamination is confirmed by immunostaining of anti-MHC antibodies in the human-mouse heterogeneous recombination. A: The mesenchymally exclusive expression of human MHC in recombinant of mouse dental epithelium and human dental mesenchyme after subrenal culture for 4 weeks. B: The mesenchymally exclusive expression of mouse MHC in the recombinant of human dental epithelium and mouse dental mesenchyme after subrenal culture for 7 days. C: The epithelially exclusive expression of human MHC in the recombinant of human dental epithelium and mouse dental mesenchyme after subrenal culture for 7 days. hdm, human bell-stage dental mesenchyme; mam, mouse ameloblasts; mdm, E13.5 mouse dental mesenchyme; hde, human bell-stage dental epithelium. Scale bar = 50 μm. Supplemental Figure 2. Expression pattern of FGF1, FGF2, FGF15/19, and FGF18 in human tooth germs at the cap and bell stages. In situ hybridization shows the expression of FGF1 (A, B), FGF2 (C, D), FGF15/19 (E, F), and FGF18 (G, H) in human molar germs at the cap (A, C, E, G) and bell (B, D, F, H) stages. de, dental epithelium; dm, dental mesenchyme; ek, enamel knot; sr, stellate reticulum; iee, inner enamel epithelium. Scale bar = 50 μm. Supplemental Figure 3. Fgf8 is ectopically expressed in E13.5 molar germs of Wnt1-Cre;R26RFgf8 mice. Immunostaining of FGF8 in E13.5 wild-type (A) and mutant (B) molar germs. de, dental epithelium; dm, dental mesenchyme. Scale bar: 50 μm. Supplemental Table 1. Comparison of the expression pattern of FGF ligands between human and mouse tooth germ at the cap and bell stages.
    [Show full text]
  • Expression of Placenta Growth Factor Is Associated with Unfavorable Prognosis of Advanced-Stage Serous Ovarian Cancer
    Tohoku J. Exp. Med., 2018, 244PGF, is291-296 a Prognostic Biomarker in Advanced-Stage Serous Ovarian Cancer 291 Expression of Placenta Growth Factor Is Associated with Unfavorable Prognosis of Advanced-Stage Serous Ovarian Cancer Qin Meng,1 Pengjing Duan,2 Lin Li3 and Yongmei Miao3 1Department of Gynecology and Obstetrics, Shandong Medical College Linyi, Shandong, China 2Department of Gynecology and Obstetrics, Affiliated Hospital of Shandong Medical College Linyi, Shandong, China 3Department of Gynecology and Obstetrics, Linyi People’s Hospital, Linyi, Shandong, China Ovarian cancer is the fourth leading cause of cancer death in women and the most fatal gynecologic malignancy. Placenta growth factor (PGF), a member of the vascular endothelial growth factor, plays an important role in angiogenesis. The overexpression of PGF was observed in several types of cancers, but the clinical significance of PGF in epithelial ovarian cancer (EOC) is still unknown. To explore the prognostic value of PGF among patients with serous EOC, we analyzed the expression of PGF in 89 EOC specimens by immunohistochemistry. The scoring system of immunohistochemistry was based on the staining intensity and the percentage of PGF-positive cells in each EOC tissue. According to the immunohistochemical score, 34 patients with score ≥ 6 were defined as high PGF expression, and other 55 patients were the group with low PGF expression. The prognostic significance of PGF expression was analyzed. EOC patients with higher IHC scores of PGF expression are significantly associated with positive lymphatic invasion and poorer response to chemotherapy. Patients with higher IHC scores of PGF expression had poorer response to chemotherapy and lower overall survival rate.
    [Show full text]
  • Expression of Fgfs During Early Mouse Tongue Development
    Gene Expression Patterns 20 (2016) 81e87 Contents lists available at ScienceDirect Gene Expression Patterns journal homepage: http://www.elsevier.com/locate/gep Expression of FGFs during early mouse tongue development * Wen Du a, b, Jan Prochazka b, c, Michaela Prochazkova b, c, Ophir D. Klein b, d, a State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, Sichuan, 610041, China b Department of Orofacial Sciences and Program in Craniofacial Biology, University of California San Francisco, San Francisco, CA 94143, USA c Laboratory of Transgenic Models of Diseases, Institute of Molecular Genetics of the ASCR, v.v.i., Prague, Czech Republic d Department of Pediatrics and Institute for Human Genetics, University of California San Francisco, San Francisco, CA 94143, USA article info abstract Article history: The fibroblast growth factors (FGFs) constitute one of the largest growth factor families, and several Received 29 September 2015 ligands and receptors in this family are known to play critical roles during tongue development. In order Received in revised form to provide a comprehensive foundation for research into the role of FGFs during the process of tongue 13 December 2015 formation, we measured the transcript levels by quantitative PCR and mapped the expression patterns by Accepted 29 December 2015 in situ hybridization of all 22 Fgfs during mouse tongue development between embryonic days (E) 11.5 Available online 31 December 2015 and E14.5. During this period, Fgf5, Fgf6, Fgf7, Fgf9, Fgf10, Fgf13, Fgf15, Fgf16 and Fgf18 could all be detected with various intensities in the mesenchyme, whereas Fgf1 and Fgf2 were expressed in both the Keywords: Tongue epithelium and the mesenchyme.
    [Show full text]
  • FGF/FGFR Signaling in Health and Disease
    Signal Transduction and Targeted Therapy www.nature.com/sigtrans REVIEW ARTICLE OPEN FGF/FGFR signaling in health and disease Yangli Xie1, Nan Su1, Jing Yang1, Qiaoyan Tan1, Shuo Huang 1, Min Jin1, Zhenhong Ni1, Bin Zhang1, Dali Zhang1, Fengtao Luo1, Hangang Chen1, Xianding Sun1, Jian Q. Feng2, Huabing Qi1 and Lin Chen 1 Growing evidences suggest that the fibroblast growth factor/FGF receptor (FGF/FGFR) signaling has crucial roles in a multitude of processes during embryonic development and adult homeostasis by regulating cellular lineage commitment, differentiation, proliferation, and apoptosis of various types of cells. In this review, we provide a comprehensive overview of the current understanding of FGF signaling and its roles in organ development, injury repair, and the pathophysiology of spectrum of diseases, which is a consequence of FGF signaling dysregulation, including cancers and chronic kidney disease (CKD). In this context, the agonists and antagonists for FGF-FGFRs might have therapeutic benefits in multiple systems. Signal Transduction and Targeted Therapy (2020) 5:181; https://doi.org/10.1038/s41392-020-00222-7 INTRODUCTION OF THE FGF/FGFR SIGNALING The binding of FGFs to the inactive monomeric FGFRs will Fibroblast growth factors (FGFs) are broad-spectrum mitogens and trigger the conformational changes of FGFRs, resulting in 1234567890();,: regulate a wide range of cellular functions, including migration, dimerization and activation of the cytosolic tyrosine kinases by proliferation, differentiation, and survival. It is well documented phosphorylating the tyrosine residues within the cytosolic tail of that FGF signaling plays essential roles in development, metabo- FGFRs.4 Then, the phosphorylated tyrosine residues serve as the lism, and tissue homeostasis.
    [Show full text]
  • Halotag Is an Effective Expression and Solubilisation Fusion Partner for a Range of Fibroblast Growth Factors
    HaloTag is an eVective expression and solubilisation fusion partner for a range of fibroblast growth factors Changye Sun1,3 , Yong Li1,3 , Sarah E. Taylor1, Xianqing Mao2, Mark C. Wilkinson1 and David G. Fernig1 1 Department of Biochemistry, Institute of Integrative Biology, University of Liverpool, Liverpool, UK 2 Department of Oncology, Laboratory of Cellular and Molecular Oncology, Luxembourg Institute of Health, Luxembourg 3 These authors contributed equally to this work. ABSTRACT The production of recombinant proteins such as the fibroblast growth factors (FGFs) is the key to establishing their function in cell communication. The production of recombinant FGFs in E. coli is limited, however, due to expression and solubility problems. HaloTag has been used as a fusion protein to introduce a genetically- encoded means for chemical conjugation of probes. We have expressed 11 FGF proteins with an N-terminal HaloTag, followed by a tobacco etch virus (TEV) protease cleavage site to allow release of the FGF protein. These were purified by heparin-aYnity chromatography, and in some instances by further ion-exchange chromatography. It was found that HaloTag did not adversely aVect the expression of FGF1 and FGF10, both of which expressed well as soluble proteins. The N-terminal HaloTag fusion was found to enhance the expression and yield of FGF2, FGF3 and FGF7. Moreover, whereas FGF6, FGF8, FGF16, FGF17, FGF20 and FGF22 were only expressed as insoluble proteins, their N-terminal HaloTag fusion counterparts (Halo-FGFs) were soluble, and could be successfully purified. However, cleavage of Halo-FGF6, -FGF8 and -FGF22 with TEV resulted in aggregation of the FGF protein.
    [Show full text]
  • Dissertation LFS Corrected 08-22-16
    EXPRESSION AND ROLE OF FIBROBLAST GROWTH FACTOR 9 (FGF9) IN BOVINE FOLLICULOGENESIS By LUÍS FERNANDO SCHÜTZ Doctor of Veterinary Medicine Federal University of Rio Grande do Sul Porto Alegre, Brazil 2007 Master of Science in Animal Science Santa Catarina State University Lages, Brazil Submitted to the Faculty of the Graduate College of the Oklahoma State University in partial fulfillment of the requirements for the Degree of DOCTOR OF PHILOSOPHY July, 2016 EXPRESSION AND ROLE OF FIBROBLAST GROWTH FACTOR 9 (FGF9) IN BOVINE FOLLICULOGENESIS Dissertation Approved: Dr. Leon J. Spicer Dissertation Adviser Dr. Robert Wettemann Dr. Glenn Zhang Dr. Peter Hoyt ii ACKNOWLEDGEMENTS To my beloved wife, for her love, support, encouragement, and understanding. She made all the steps of the arduous pathway to achieve this degree much easier. With her by my side, I feel much stronger. To my family in Brazil: my beloved parents, my brother, Lipe, and my sister, Ane, for their love, faith, and support. And to my beautiful niece, Sofia, my sister-in-law, Manuela, and my brother-in-law, Joni. To my advisor and mentor, Dr. Leon Spicer, for accepting me as a student, for giving me priceless lessons and advice whenever I needed, for stimulating me to develop a critical thinking, and for teaching me how to perform sound science in the field of ovarian folliculogenesis. And to his family, Michael, Melissa, Anna, and Richie, for their friendship and support. To the Franceschi family: my mother-in-law, Pierina, and my father-in-law, Adi, for their support and encouragement; to my brother-in-law, Junior, his wife, Janine, and his great boys, Bernardo and Bruno; and to my sister-in-law, Sheila, and her fiancé, Fábio.
    [Show full text]
  • University of Cincinnati
    UNIVERSITY OF CINCINNATI Date: ___ Feb 20th, 2008 I, Siyun Liao, hereby submit this work as part of the requirements for the degree of: ________________Doctor of Philosophy in: Molecular, Cellular and Biochemical Pharmacology It is entitled: ____The Role of Fibroblast Grown Factor-2 Isoforms in ___Ischemia-Reperfusion Injury and Cardioprotection This work and its defense approved by: Chair: Jo El J. Schultz, Ph.D. Thomas Doetschman, Ph.D. W. Keith Jones, Ph.D. Evangelia G. Kranias, Ph.D. Mark Olah, Ph.D. Hong-Sheng Wang, Ph.D. THE ROLE OF FIBROBLAST GROWTH FACTOR-2 ISOFORMS IN ISCHEMIA- REPERFUSION INJURY AND CARDIOPROTECTION A dissertation submitted to the Division of Graduate Studies of the University of Cincinnati In partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY In the Department of Pharmacology and Cell Biophysics 2007 by Siyun Liao B.S. China Pharmaceutical University, 2000 Committee Chair: Dr. Jo El J. Schultz ii Abstract Cardiovascular disease (CVD) remains the leading cause of death in the United States and in the developing world, with ischemic heart disease the second most common form of CVD. Experimental and clinical studies have demonstrated that a number of interventions, including brief periods of ischemia or hypoxia and certain endogenous molecules such as growth factors, opioids, adenosine or pharmacological agents are capable of protecting the heart against post- ischemic cardiac dysfunction, arrhythmias and myocardial infarction. One of these growth factors, fibroblast growth factor-2 (FGF2), has been implicated to be a cardioprotective molecule. FGF2 consists of multiple protein isoforms (low molecular weight, LMW, and high molecular weight, HMW) produced by alternative translation from the Fgf2 gene and these protein isoforms are localized to different cellular compartments indicating unique biological activity.
    [Show full text]
  • Termination of Receptor Tyrosine Kinase Signal
    International Journal of Molecular Sciences Review All Good Things Must End: Termination of Receptor Tyrosine Kinase Signal Azzurra Margiotta 1,2 1 Department of Biology, Faculty of Medicine, Masaryk University, 62500 Brno, Czech Republic; [email protected] 2 International Clinical Research Center, St. Anne’s University Hospital, 65691 Brno, Czech Republic Abstract: Receptor tyrosine kinases (RTKs) are membrane receptors that regulate many fundamental cellular processes. A tight regulation of RTK signaling is fundamental for development and survival, and an altered signaling by RTKs can cause cancer. RTKs are localized at the plasma membrane (PM) and the major regulatory mechanism of signaling of RTKs is their endocytosis and degradation. In fact, RTKs at the cell surface bind ligands with their extracellular domain, become active, and are rapidly internalized where the temporal extent of signaling, attenuation, and downregulation are modulated. However, other mechanisms of signal attenuation and termination are known. Indeed, inhibition of RTKs’ activity may occur through the modulation of the phosphorylation state of RTKs and the interaction with specific proteins, whereas antagonist ligands can inhibit the biological responses mediated by the receptor. Another mechanism concerns the expression of endogenous inactive receptor variants that are deficient in RTK activity and take part to inactive heterodimers or hetero-oligomers. The downregulation of RTK signals is fundamental for several cellular functions and the homeostasis of the cell. Here, we will review the mechanisms of signal attenuation and termination of RTKs, focusing on FGFRs. Keywords: RTKs; FGFRs; termination of signaling; degradation; ubiquitination; PTPs; kinases Citation: Margiotta, A. All Good Things Must End: Termination of Receptor Tyrosine Kinase Signal.
    [Show full text]