University of Cincinnati

UNIVERSITY OF CINCINNATI

Date: ___ Feb 20th, 2008

I, Siyun Liao, hereby submit this work as part of the requirements for the degree of:

______Doctor of Philosophy

in: Molecular, Cellular and Biochemical Pharmacology

It is entitled:

____The Role of Fibroblast Grown Factor-2 Isoforms in ___Ischemia-Reperfusion Injury and Cardioprotection

This work and its defense approved by:

Chair: Jo El J. Schultz, Ph.D. Thomas Doetschman, Ph.D. W. Keith Jones, Ph.D. Evangelia G. Kranias, Ph.D. Mark Olah, Ph.D. Hong-Sheng Wang, Ph.D.

THE ROLE OF FIBROBLAST GROWTH FACTOR-2 ISOFORMS IN ISCHEMIA-

REPERFUSION INJURY AND CARDIOPROTECTION

A dissertation submitted to the

Division of Graduate Studies

of the University of Cincinnati

In partial fulfillment of the

requirements for the degree of

DOCTOR OF PHILOSOPHY

In the Department of Pharmacology and Cell Biophysics

2007

Siyun Liao

B.S. China Pharmaceutical University, 2000

Committee Chair: Dr. Jo El J. Schultz

Abstract

Cardiovascular disease (CVD) remains the leading cause of death in the United States and in the

developing world, with ischemic heart disease the second most common form of CVD.

Experimental and clinical studies have demonstrated that a number of interventions, including brief periods of ischemia or hypoxia and certain endogenous molecules such as growth factors, opioids, adenosine or pharmacological agents are capable of protecting the heart against post- ischemic cardiac dysfunction, arrhythmias and myocardial infarction. One of these growth factors, fibroblast growth factor-2 (FGF2), has been implicated to be a cardioprotective molecule. FGF2 consists of multiple protein isoforms (low molecular weight, LMW, and high molecular weight, HMW) produced by alternative translation from the Fgf2 gene and these protein isoforms are localized to different cellular compartments indicating unique biological activity. Currently, the roles of the FGF2 isoforms in ischemia-reperfusion injury and cardioprotection remain to be elucidated. Understanding the biological function(s) of the FGF2 isoforms in cardioprotection is of a great clinical importance and may lead to the development of novel pharmacological or gene therapy strategies for ischemic heart disease.

This dissertation research utilized mice with a targeted ablation of a specific FGF2 isoform (FGF2 LMWKO or FGF2 HMWKO) or mice in which all FGF2 isoforms (Fgf2 KO) were absent, and mice with a ubiquitous overexpression of the human FGF2 HMW 24 kD isoform (24 kD Tg) to evaluate the role(s) of the FGF2 protein isoforms in ischemia-reperfusion

(I/R) injury. Cardioprotection in mice subjected to an isolated work-performing heart model of global, low-flow ischemia-reperfusion injury was indicated as an improvement in post-ischemic recovery of cardiac function and/or a reduction in creatine kinase release into coronary effluent or a reduction in myocardial infarct size. FGF2 LMWKO hearts had a significant decrease in

iii

post-ischemic cardiac function compared to wildtype hearts (p<0.05). FGF2 HMWKO hearts,

however, had a significantly enhanced post-ischemic recovery of cardiac function (p<0.05).

Furthermore, in human FGF2 HMW 24 kD Tg hearts, the post-ischemic recovery of cardiac

function was significantly decreased compared to non-transgenic hearts (p<0.05). Myocardial cell injury was not different between either Wt, Fgf2 KO, FGF2 HMWKO and FGF2 LMWKO

or 24 kD Tg and NTg hearts after I/R injury indicating that all the isoforms were necessary to protect the heart from myocardial cell injury. The effect of FGF2 isoforms on I/R injury was independent of changes in coronary flow or blood vessel density. The cardioprotective effect

mediated by the FGF2 LMW isoform was abolished when the mixed lineage kinase

(MLK)/mitogen kinase kinase (MKK)/c-Jun N-terminal kinase (JNK) signaling pathway or FGF

receptor (FGFR) was inhibited. The LMW isoform significantly inhibited MKK7, JNK, and c-

Jun activation as well as apoptotic processes prior to and during ischemia–reperfusion injury

(p<0.05). The cardioprotective effect of FGF2 LMW isoform occurred through modulating

apoptosis via inhibition of c-Jun and JNK activation. The cardioprotective effect of the LMW

isoform also required the involvement of FGF receptor (FGFR), most likely the murine FGFR1.

Another potential mechanism involved in the LMW isoform-mediated cardioprotection may be

due to its actions on cardiac gene expression as preliminary results indicated that the LMW

isoform decreased cardiotoxic gene expression and increased cardioprotective gene expression.

The FGF2 HMW isoforms significantly decreased the activation of PKC α and increased the

activation of PI3-kinase and NFκB signaling pathways that are involved in cardioprotection

(p<0.05). In addition, the FGF2 HMW isoforms regulated expression of genes involved in

ischemia-reperfusion injury, gene transcription, and apoptosis. These genes could be potential

targets regulated by FGF2 HMW isoforms during I/R injury. Together, these data show that the

FGF2 LMW isoform had a beneficial role in protecting the heart from myocardial dysfunction while FGF2 HMW isoforms had a deleterious role in I/R injury. This dissertation provided a novel signaling mechanism of the LMW FGF2 isoform which could contribute to the cardioprotective effect. Though the mechanisms of the FGF2 HMW isoforms remain to be thoroughly characterized, this dissertation provides critical evidence for the role of the FGF2

HMW isoforms in ischemia-reperfusion injury including up-regulation of cardiotoxic gene expression and modulating transcription factor NF-κB. Together, these data show that the FGF2

LMW isoform has a beneficial effect, while FGF2 HMW isoforms have a detrimental effect in ischemia-reperfusion injury and the modulation of signals including FGFR, MAPK, NF-κB, c-

JUN, and calcium leads to the differential outcomes on post-ischemic recovery of cardiac function and myocardial infarction.

Acknowledgments

There are many people to whom I am deeply grateful and it may not be possible to individually

acknowledge here. But, even within that large list, it would be impossible not to mention those who have made an immense imprint.

I am indebted to my advisor, Dr. Jo El Schultz, who made this dissertation possible. I thank her

for the personal and scientific growth I’ve experienced in my years as a graduate student as well

as for the training, support, advice and patience I’ve received. I consider her not only a

professional role model but a valued friend.

I would like to thank my committee members, Dr. Thomas Doetschman, Dr. Keith Jones, Dr.

Evangelia Kranias, Dr. Mark Olah and Dr. Hong-sheng Wang, for the valuable time, comments and assistance that each has provided toward my graduate training and dissertation research.

Their guidance, scientific suggestions and careful review of my work aided and enhanced my

graduate research experience and this dissertation significantly.

I would also like to display my appreciation to the many past and present members of the Schultz

lab. Special thanks to Gilbert Newman who devotes countless time and his expertise on the

working-heart model of ischemia-reperfusion injury. I would also like to thank my past and

present lab mates, Dr. Stacey House, Craig Bolte, Darius Porter, Nicolae Vatamaniuc, Janet

Bodmer and Dan Pietras who have contributed greatly, their time, assistance, ideas, guidance and

amazing friendship throughout my graduate training.

I am also grateful to my collaborators, without whom I could not have accomplished the work

presented here. Dr. Xiaoping Ren constantly helped section the hearts and take picture for

measurement of infarct size even when he was also fighting for his own time. Special thanks to

Sharon Pawlowski, Maureen Bender and Angel Whitaker for their excellent animal husbandry work which has supported this project. Also, a very special thanks to Dr. Ming Zhao and Dr.

Azhar Mohamad, who both have been working on the creation of my mouse models for over ten years. Without these mouse models in place in the laboratory, my research project would not be significantly developed.

Over the six years of my graduate study in the Department of Pharmacology and Cell

Bbiophysics, I made friends with many students and staff. I especially want to thank Michael

Tabet and Ming Dong for their support and assistance. Also, the members of the Department have provided me great assistance and moral support as well.

Finally, I would also like to thank all the friends I made in Cincinnati, especially my boyfriend,

Zhimin Peng, for his constant emotional support.

最重要的一点，我想把这本论文献给我的爸爸妈妈。在我的人生中，是他们在最困难的

时候支持我，鼓励我，在我取得的成果的时候祝福我，无条件的爱我。他们为我提供了

物质上，生活上，精神上的支持和鼓励。没有他们，我就无法完成我的博士研究。

vii

TABLE OF CONTENTS Page

Abstract iii

Acknowledgments vi

Introduction 1

1. Ischemia-reperfusion injury 1

A. Ischemic injury 2

B. Reperfusion injury 3

C. Protecting the heart from ischemia-reperfusion injury 5

2. Fibroblast growth factor-2 6

A. Fibroblast growth factor family 6

B. Fibroblast growth factor-2 9

Fgf2 gene 9

FGF2 protein isoforms 10

FGF2 expression pattern 11

FGF2 isoform subcellular localization and release 12

C. FGF receptor 16

Heparan sulfate proteoglycans (HSPGs) 16

Fibroblast growth factor receptors (FGFRs) 17

Fibroblast growth factor receptor signaling 18

D. Biological activity of FGF2 isoforms 21

Blood vessels 21

Blood cells 22

Lung 23

viii

Nervous system 24

Heart 25

E. FGF2 isoforms and transcription factors 26

F. Characteristics of mice deficient and overexpressing the Fgf2 gene 29

G. FGF2 isoforms and ischemia-reperfusion injury 30

H. FGF2 and calcium homeostasis 33

3. Protein kinases and cardiac ischemia-reperfusion injury 34

A. Protein kinase C 34

B. Mitogen activated protein kinases (MAPK) 39

Mixed lineage kinase (MLK) 39

c-Jun terminal kinase (JNK) 40

p38 MAPK 44

Extracellular signal-regulated kinase (ERK1/2) 46

C. PI-3 kinase and Akt 50

4. Cell death and ischemia-reperfusion injury (I/R) 52

A. Apoptosis 52

B. Oncosis 53

C. Cell death in cardiac ischemia-reperfusion injury 54

D. FGF2 and apoptotic cell death 55

5. Dissertation focus and hypothesis 55

Hypothesis 1: The LMW and HMW isoforms have distinct roles in 57

ischemia-reperfusion injury

Hypothesis 2: The LMW and HMW isoforms do not share the same signaling 58

pathway(s) to elicit their actions in ischemia-reperfusion injury

Material and Methods 60

Animal exclusion criteria 60

Homologous recombination in ES cells 62

Generation of Fgf2 knockout mice 62

Generation of FGF2 LMW knockout mice 64

Generation of FGF2 HMW knockout mice 66

Generation of FGF2 EXON 3 knockout mice 68

Generation of transgenic mice overexpressing human FGF2 HMW 24 kD isoform 69

Isolated work-performing heart model 74

Model of global, low-flow ischemia 75

In vivo regional, ischemia model 77

Pharmacological studies 80

Myocardial infarction measurement via triphenyl tetrazolium chloride stain 81

Creatine kinase release in coronary effluent 82

Detection of FGF2 release in coronary effluent 83

Immunohistochemistry for blood vessel detection 84

Time course evaluation of protein kinase activation 85

Cardiac preparation for detection of FGF2 85

Nuclear and cytosolic preparation for detection of translocation of FGF2 isoform 86

Western immunoblotting for FGF2 protein isoforms detection 87

Cytosol and total membrane fractionation for PKC activation or cytochrome

C release 88

Western immunoblotting for PKC activation (translocation) 88

Western immunoblotting for cytochrome C release 89

Whole heart preparation for FGFR, PKC, MAPK, phospholamban, Akt

phosphorylation, caspase 3 activation and calsequestrin expression 90

Western immunoblotting for FGFR1 and FGFR4 expression and phosphorylation 90

Western immunoblotting procedure for PKC, MAPK, MKK4/7, c-Jun and Akt

activity (phosphorylation) 91

Western immunoblotting procedure for caspase 3 activity (caspase cleavage) 92

Western immunoblotting procedure for determination of expression and activation

of calcium handling protein 93

Quantification of immunoblotting 94

TUNEL assay 94

RNA isolation 95

Reverse transcription and real-time PCR 96

Gene microarray analysis 97

Nuclear preparation for electrophoretic mobility shift assay (EMSA) 100

Electrophoretic mobility shift assay (EMSA) procedure 100

Labeling 100

DNA Binding Reaction 101

Electrophoresis of DNA protein complexes 101

Statistical analysis 102

Results

Chapter 1. Role of FGF2 EXON 3 in ischemia-reperfusion injury 103

Results 103

Cardiac characterization of FGF2 EXON3 KO hearts 103

Discussion 107

Chapter 2. Role of FGF2 LMW isoform in ischemia reperfusion injury 109

Results 109

Cardiac characterization in mice with ablation of all FGF2 isoforms (Fgf2 KO)

or the FGF2 LMW (FGF2 LMWKO) isoform 110

Effect of ablation of all FGF2 isoforms (Fgf2 KO) or the FGF2 LMW

(FGF2 LMWKO) isoform on cardiac gene expression of other FGFS 112

Effect of FGF2 LMW isoform on post-ischemic myocardial dysfunction 115

Effect of FGF2 LMW isoform on myocardial cell injury 118

Alteration of PKC activation in non-ischemic Fgf2 KO and FGF2 LMWKO

mouse hearts 121

Alteration of MAPK and PI3 kinase/Akt activation in non-ischemic Fgf2 KO

and FGF2 LMWKO mouse hearts 130

Effect of FGF2 LMW isoform on apoptosis in non-ischemic Fgf2 KO and

FGF2 LMWKO mouse hearts 137

Calcium handling protein expression and activation in non-ischemic Fgf2 KO and

FGF2 LMWKO mouse hearts 140

Activation of c-Jun terminal kinase (JNK) pathway following ischemia-reperfusion

injury in Wt, Fgf2 KO and FGF2 LMWKO mouse hearts 143

xii

Role of JNK pathway necessary for FGF2 LMW isoform-induced cardioprotection on

post-ischemic recovery of cardiac function 148

Role of JNK signaling in FGF2 LMW isoform-induced cardioprotection against

myocardial cell injury 155

Effect of JNK pathway inhibition on JNK and MAPK pathway signaling 160

JNK pathway inhibition on apoptotic signaling 166

The localization of FGF2 LMW isoform and its effect on gene expression 173

Discussion 180

Chapter 3. Role of FGF2 HMW isoforms in ischemia-reperfusion injury and cardioprotection 202

Results 202

Cardiac characterization in mice deficient in or overexpression the FGF2 HMW

isoforms 202

Effect of ablation or overexpression of the FGF2 HMW isoforms on post-ischemic

myocardial function 206

Effect of FGF2 HMW isoforms on myocardial cell injury after

ischemia-reperfusion injury 212

Effect of alterating the protein level of FGF2 HMW isoforms on downstream

signaling pathways 215

Localization of FGF2 HMW isoforms in non-ischemic and ischemic-reperfused

hearts 228

The involvement of FGFR in ischemia-reperfusion injury and cardioprotection 231

Effect of FGFR inhibition on myocardial cell injury 235

xiii

Effect of FGFR inhibition on FGFR activation 238

Effect of FGF2 HMW isoforms in calcium homeostasis 241

Effect of FGF2 HMW isoforms on NF-κB regulation and on gene expression 244

Discussion 253

Summary 274

Clinical relevance and future directions 279

References 286

xiv

LIST OF FIGURES Page

1. FGF2 isoforms 13

2. FGF2 signaling 20

3. Structure of PKC family 37

4. MAPK signaling pathway 48

5. The involvement of apoptosis and oncosis in ischemia-reperfusion injury 56

6. Generation of Fgf2 KO, FGF2 LMWKO, FGF2 HMWKO, FGF2 EXON3

KO and human FGF2 HMW 24 kD isoform Tg mice 71

7. Schematic of isolated work-performing heart 76

8. Schematic of low-flow ischemia protocols 78

9. Schematic for DNA microarray analysis of gene expression 99

10. Cardiac characterization of FGF2 EXON 3 KO hearts 104

11. Irreversible ischemia-reperfusion injury – infarct size in FGF2 EXON 3 KO mice 105

12. MAPK phosphorylation in non-ischemic Wt and FGF2 EXON 3 KO hearts 106

13. Heart weight-to-body weight ratio in Wt, Fgf2 KO and FGF2 LMWKO mice 110

14. FGF2 protein expression in non-ischemic Wt and FGF2 LMWKO hearts 111

15. Percent recovery of cardiac function in Wt, Fgf2 KO and FGF2 LMWKO

hearts following 60 minutes ischemia and 120 minutes reperfusion 117

16. Myocardial cell injury in Wt, Fgf2 KO and FGF2 LMWKO hearts following

ex vivo 60 minutes ischemia and 120 minutes reperfusion 119

17. Myocardial infarct size Wt, Fgf2 KO and FGF2 LMWKO hearts following

in vivo 60 minutes regional ischemia and 24 hours reperfusion 120

18. PKC α activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 122

19. PKC δ activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 124

20. PKC ε activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 126

21. PKC ζ activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 128

22. ERK activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 132

23. p38 activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 133

24. JNK activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 134

25. Effect of recombinant murine LMW FGF2 on phosphorylation state of p38

and JNK in non-ischemic FGF2 LMWKO hearts 135

26. Akt activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 136

27. Apoptotic pathway in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 138

28. Calcium handling protein expression and activity in non-ischemic Wt, Fgf2 KO and

FGF2 LMWKO hearts 142

29. Time course of JNK activation in Wt, Fgf2 KO and FGF2 LMWKO hearts 145

30. Time course of MKK7 activation in Wt, Fgf2 KO and FGF2 LMWKO hearts 146

31. Time course of MKK4 activation in Wt, Fgf2 KO and FGF2 LMWKO hearts 147

32. Schematic of CEP11004 inhibition on the JNK pathway 150

33. JNK inhibition (CEP11004) – recovery of cardiac function 151

34. p38 inhibition (SB203580) and p38 activation (anisomycin)- recovery of cardiac

function 153

35. MEK-ERK inhibition (UO126) – recovery of cardiac function 154

36. JNK pathway inhibition (CEP11004) – infarct size 156

37. JNK pathway inhibition (CEP11004) – MKK7 activation 161

38. JNK pathway inhibition (CEP11004) – MKK4 activation 162

xvi

39. JNK pathway inhibition (CEP11004) – JNK activation 163

40. JNK pathway inhibition (CEP11004) – ERK activation 164

41. JNK pathway inhibition (CEP11004) – p38 activation 165

42. JNK pathway inhibition (CEP11004) – c-Jun activation 166

43. JNK pathway inhibition (CEP11004) – caspase 3 activation 167

44. JNK pathway inhibition (CEP11004) – TUNEL staining 168

45. JNK pathway inhibition (CEP11004) – cytochrome C release 172

46. FGF2 isoform localization in non-ischemic Wt and FGF2 LMWKO mouse hearts 175

47. Schematic for DNA microarray analysis of gene expression in non-ischemic and

ischemic-reperfused Wt, and FGF2 LMWKO hearts 176

48. Western immunoblot of FGF2 isoform expression in non-ischemicWt,

FGF2 HMWKO, NTg, FGF2 Tg and human 24 FGF2 HMW kD Tg hearts 204

49. Heart weight-to-body weight ratio in non-ischemic Wt , FGF2 HMWKO,

NTg and 24 kD FGF2 HMW FGF2 isoform Tg mice 205

50. Percent recovery of post-ischemic cardiac function in Wt and FGF2

HMWKO hearts following 60 minutes ischemia and 120 minutes 208

51. Percent recovery in NTg and 24 kD Tg hearts following 60 minutes

ischemia and 120 minutes reperfusion. 209

52. Post-ischemic contractile function in Wt and FGF2 HMWKO, NTg and 24 kD Tg

hearts during ex vivo 60 minutes global low-flow ischemia and 120 minutes

reperfusion 210

53. Myocardial infarct size Wt and FGF2 HMWKO, NTg and 24 kD Tg hearts following

ex vivo 60 minutes global low-flow ischemia and 120 minutes reperfusion 213

xvii

54. PKC translocation in non-ischemic NTg and 24 kD Tg hearts 217

55. ERK activation in non-ischemic NTg and 24 kD Tg hearts 219

56. p38 activation in non-ischemic NTg and 24 kD Tg hearts 221

57. JNK activation in non-ischemic NTg and 24 kD Tg hearts 223

58. Akt activation in non-ischemic NTg, FGF2 Tg and 24 kD Tg hearts 225

59. Cytochrome C release in non-ischemic NTg and 24 kD Tg hearts 227

60. FGF2 isoform localization in non-ischemic Wt and FGF2 HMWKO mouse hearts 229

61. FGFR inhibition (PD173074) – recovery of cardiac function 233

62. FGFR inhibition (PD173074) – infarct size 236

63. FGFR inhibition (PD173074) – FGFR1 activation 239

64. Calcium handling protein expression in non-ischemic NTg and human

FGF2 HMW 24 kD Tg hearts 242

65. NFκ-B activation in non-ischemic Wt, Fgf2 KO, FGF2 LMWKO,

NTg, FGF2 Tg and 24 kD Tg hearts 247

66. Schematic for DNA microarray analysis of gene expression in non-ischemic and

ischemic-reperfused FGF2 LMWKO and Fgf2 KO hearts 248

67. Schematic of fibroblast growth factor 2 isoforms in cardioprotection 278

xviii

LIST OF TABLES Page

1. List of molecules involved in the cardioprotective or cardiotoxic effect

ischemia-reperfusion injury 7

2. Fibroblast growth factor family: biological properties 8

3. Experiments and numbers of animals for dissertation research 61

4. Sense and antisense primers for genotyping 64

5. Mouse groups subjected to full ischemia-reperfusion injury study 77

6. Mouse groups subjected to in vivo regional (45 minutes ischemia and 24 hours

reperfusion) 79

7. Mouse groups for MAPK and FGFR inhibitor pharmacological studies 81

8. Mouse groups subjected to Western immunoblotting for protein kinase activation

or immunohistochemistry for blood vessel detection or immunofluurescence for

TUNEL assay 85

9. Mouse groups subjected to time course study 85

10. Fibroblast growth factor (FGF) primer sets used in real-time PCR 98

11. mRNA level of FGFs in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts 114

12. Cardiac function in Wt, Fgf2 KO and FGF2 LMWKO hearts subjected

to 60 minutes ischemia and 120 minutes reperfusion 116

13. JNK pathway inhibition (CEP11004) – cardiac function 152

14. JNK pathway inhibition (CEP11004), MEK-ERK inhibition (UO126), p38 inhibition

(SB203580), and p38 activation (anisomycin)–creatine kinase release 157

15. mRNA expression of representative genes involved in ischemia-reperfusion

injury 177

xix

16. mRNA expression of representative genes regulated by FGF2 LMW isoform 178

17. mRNA expression of representative genes regulated by the LMW isoforms

during ischemia-reperfusion injury 179

18. Cardiac function in Wt and FGF2 HMWKO hearts subjected to 60 minutes

ischemia and 120 minutes reperfusion 211

19. Cardiac function in NTg and 24 kD HMW Tg hearts subjected to 60 minutes

ischemia and 120 minutes reperfusion 211

20. Creatine kinase release from ischemic-reperfused Wt and FGF2 HMWKO hearts 214

21. Creatine kinase release from ischemic-reperfused NTg and 24 kD Tg hearts 214

22. FGF2 release in coronary effluent from wildtype, LMWKO and HMWKO hearts 230

23. FGFR pathway inhibition (PD173074) – cardiac function 233

24. FGFR inhibition (PD173074) – creatine kinase release 237

25. mRNA expression of representative genes regulated by FGF2 HMW isoform

in non-ischemic hearts 249

26. mRNA expression of representative genes involved in ischemia-reperfusion

injury in FGF2 LMWKO hearts 250

27. mRNA expression of representative genes by FGF2 HMW isoforms

after ischemia-reperfusion injury 251

28. Gene transcripts differentially expressed by the HMW isoforms of FGF2 in

hearts and ischemia-reperfusion injury 252

29. Summary of the activation of PKC and MAPK signaling pathway 277

30. Clinical trials using FGF2 for the treatment of coronary artery disease 281

LIST OF ABBREVIATIONS bp base pair

CK creatine kinase

CVD cardiovascular disease

DAG diacylglycerol

ECM extracellular matrix

ERK extracellular-regulated kinase

ES embryonic stem

FGF fibroblast growth factor

FGFR fibroblast growth factor receptor

FRS FGF receptor substrate

GPCR G-protein-coupled receptor

GSH glutathione

H & E hematoxylin and eosin

HBGF2 heparan binding growth factor 2

HMW high molecular weight

xxi

HPRT hypoxanthine phosphoribosyl transferase

HRP horseradish peroxidase

HSPG heparan sulfate proteoglycan

IgG immunoglobulin G

I/R ischemia-reperfusion

IRES internal ribosome entry sites

JNK c-Jun NH2-terminal kinase kb kilobase kD kilodalton

LMW low molecular weight

MAPK mitogen-activated protein kinase

MLK mixed lineage kinase

MKK mitogen-activated protein kinase kinase

MHC myosin heavy chain

MI myocardial infarction mM millimolar

xxii

µM micromolar

NLS nuclear localization sequence

NOS nitric oxide synthase

NO nitric oxide

PBS phosphate-buffered saline

PGK phosphoglycerate kinase

PCR polymerase chain reaction

PI3K phosphatidylinositol 3' kinase

PKA protein kinase A

PKC protein kinase C

PMSF phenylmethylsulfonylfluoride

RACK receptor for activated C-kinase

SAPK stress-activated protein kinase

TTC triphenyl tetrazolium chloride

VEGF vascular endothelial growth factor

xxiii

Introduction

Cardiovascular disease (CVD) is the class of diseases that involve the heart and/or blood vessels (arteries and veins)1. An estimated 79,400,000 American adults (one in three) have one or more type of CVD1. It is the leading cause of morbidity and mortality in the United States, with ischemic heart disease, the second most common form of CVD1. Ischemic heart disease is the end result of the accumulation of atheromatous plaques within the walls of the myocardial arteries2. As the disease progresses, the plaques cause an obstruction of the blood to the myocardium, leading to ischemia and an impairment in the relaxation and contraction of the myocardium3. Clearly, when the blood flow is restored (reperfusion) in a timely manner, it could limit the extent of tissue damage; however, the effect of reperfusion is contradictory and might result in its own deleterious effects, referred to reperfusion injury4. Understanding the pathology of ischemia-reperfusion (I/R) injury will lead to the identification of therapeutic targets and aid in the development of therapies to treat coronary artery disease.

1. Ischemia-reperfusion injury

Myocardial ischemia exists when there is a reduction of coronary blood flow severe enough that the supply of oxygen to the myocardium is inadequate for the oxygen demands of the tissue5. An extended period of myocardial ischemia leads to irreversible damage of the myocardial tissue (infarction)6. It is now believed that the heart can sustain several short-term ischemic episodes. During short-term ischemic episodes, the heart’s defense mechanisms seek to remedy this imbalance by downregulating myocardial contractile function and increasing the rate of glycolysis (anaerobic energy production)7. Consequently, sarcolemmal glucose transport increases and intracellular acidosis, resulting from a buildup of the glycolytic breakdown

products, causes further inhibition of the contractile apparatus8. This phenomenon known as myocardial stunning is characterized by post-ischemic impairment of myocardial function, and it is considered acute and completely reversible5. The traditional idea of ischemia, now termed

maimed myocardium, is the most severe syndrome and is characterized by irreversible

myocardial damage that follows ischemia-reperfusion9.

A. Ischemic injury

Ischemic injury is a very complex process involving the action and interaction of many factors4. Within ten seconds of blood flow interruption to the heart, mitochondrial oxidative

phosphorylation rapidly stops, resulting in depletion of high-energy phosphate compounds,

including ATP and creatine phosphate10. As a compensatory effect, anaerobic glycolysis

increases to produce more ATP. Poor washout results in the accumulation of lactate, protons and

NADH2 which conjointly inhibit anaerobic glycolysis. There are two general theories, which are not mutually exclusive, to explain the underlying mechanisms leading to ischemic injury. The formation of reactive oxygen species and alteration in intracellular calcium has been speculated

as the principal causes of ischemic injury11.

Intracellular acidosis during ischemia leads to intracellular calcium overload via

activation of the sarcolemmal Na+/H+ exchanger12. Activation of the Na+/H+ exchanger increases

intracellular proton levels, leading to an influx of sodium. With a substantial decline in ATP, the

Na+/K+-ATPase is inhibited, resulting in a further decline of intracellular K+ and an increase in

intracellular Na+. The increased intracellular Na+ concentration causes the Na+/Ca2+ exchanger to

work in a reverse mode, resulting in an excess level of intracellular calcium13. Normally, calcium

is present in the extracellular milieu at a concentration 10,000 times greater than the intracellular

concentration13. The excessive level of intracellular calcium in cardiomyocytes from the reverse

working mode of Na+/Ca2+ exchanger would result in improper relaxation of contractile

apparatus, leading to myocardial dysfunction.

Ischemia also causes the depletion of glutathione (GSH), which plays an important role in

maintaining cellular protein and lipid structure and functions by protecting these molecules from oxidation14. With the depletion of GSH, the toxic effects of oxidative stress are exacerbated15.

The oxidative stress caused by ischemia result in an increased production and/or decreased degradation of reactive oxygen species (ROS), consisting of superoxide anion, hydrogen peroxide and hydroxyl radical, which are harmful metabolic byproducts16. ROS tends to initiate a

chain reaction that results in irreversible chemical changes in proteins or lipids. In the heart, ROS

evokes many abnormalities, including cytotoxicity, cardiac stunning, arrhythmia, apoptosis,

DNA break, and reduction of contractility17. ROS impairs Na+-K+-ATPase activity resulting in

sodium overload, with consequent activation of the Na+- Ca2+ exchange activity, leading to

calcium overload in the sarcoplasmic reticulum (SR)18. ROS is released during ischemia from

mitochondria and a ROS-induced ROS release may amplify its signal19. The major burst of ROS

occurs during reperfusion and originates from a different cellular source19,20. The reperfusion released ROS is one major source of reperfusion injury11.

B. Reperfusion injury

Although immediate restoration of blood flow and oxygen to ischemic tissue is ultimately

beneficial, ischemic damage may be exaggerated upon reperfusion. The cellular events involved

in reperfusion damage could be, in part, explained by calcium overload, oxygen free radicals and

inflammatory processes21,22.

During early reperfusion, the myocardium is damaged by ischemic contracture

development, leading to myocardial stiffness and tissue necrosis23. In the ischemic myocardium,

contracture develops through a rigor-type mechanism, leading to cytoskeletal defects. These

defects result in a fragile and more susceptible myocardium to mechanical damage during

reperfusion24. During reoxygenation, ATP synthesis assists in cardiomyocyte recovery, but this

process also re-activates the contractile machinery, resulting in uncontrolled Ca2+-dependent

contraction25,26. The increased intracellular calcium at reperfusion may also lead to excess Ca2+ cycling, which in turn may cause delayed after-depolarization and ventricular automaticity27.

During reperfusion, oxygen is re-introduced to the myocardium, and undergoes a

reduction process, resulting in superoxide anion formation28. Forming superoxide anion is the

initial step in the generation of other oxygen-derived reactive products, including hydrogen

peroxide and hydroxyl radical22. Neutrophils accumulate in the myocardium and become

activated which further enhances oxygen free radical production29. In the perfused myocardium,

reoxygenated endothelial cells express adhesion proteins, release cytokines, and reduce

production of NO which promotes adherence, activation, and accumulation of neutrophils in the

ischemic-reperfused tissue30-32. These activated neutrophils will release reactive oxygen species

and proteolytic enzymes that can damage myocytes and vascular cells. Besides free radicals, the

newly returned blood also carries white blood cells including the neutrophils, releasing pro-

inflammatory lipid metabolites which are believed to promote expression and release of a pro-

inflammatory cytokine cascade involving interleukin 1 (IL-1) and TNFα (tumor necrosis factor

alpha)33; these cytokines then lead to the production of other pro-inflammatory molecules (such

as IL-6, IL-8), activation and infiltration of leukocytes, and production of anti-inflammatory factors (including IL-4 and IL-10, which might produce a negative feedback on the cascade)31.

C. Protecting the heart from ischemia-reperfusion injury

Experimental and clinical studies have shown that a number of interventions, including

brief periods of ischemia-reperfusion or hypoxia-reoxygenation and certain endogenous mediators or pharmacological agents are able to protect the heart against myocardial dysfunction, arrhythmias and infarction, three hallmarks of cardioprotection (Table 1)34-71.

Ischemic preconditioning, first described by Murry and colleagues in 198635, is the paradoxical phenomenon in which several brief cycles of ischemia prior to an extensive ischemic insult protects the heart from myocardial infarction. Another form of cardioprotection, postconditioning, in which initial reperfusion is interrupted by brief ischemic and reperfusion periods, is more clinically relevant since most cardiac patients will have ongoing ischemia when seeking medical assistance41. Besides ischemic pre-/post-conditioning, other factors and proteins

such as nitric oxide43,50-52, free radicals44,45,53,54, calcium46,55,56, adenosine receptors47,57-60, opioid receptor39,48,61,72, bradykinin receptor49,62,63, growth factors64-68,73, protein kinases (PKA, PKC

74-83 69- and mitogen activated protein kinase) and sarcolemmal and mitochondrial KATP channel

71,84 are known to protect the heart in experimental and clinical models of I/R injury. Clinically,

appropriate treatment for patients with ischemic heart disease should acutely protect against

myocardial infarction and cardiac dysfunction, but also protect the heart chronically from a long-

term ischemia. There is significant experimental evidence that growth factors, in particular

fibroblast growth factors (FGF), elicit a long-term cardioprotective effect through its angiogenic

properties85. Evidence also suggests that growth factors, including FGF, can acutely protect the heart from ischemia reperfusion injury independent of their vascular actions64-68,73. A clinically relevant therapy, not only would decrease myocardial damage and increase cardiac function during an acute ischemic event, but also prevent future, long-term damage. The acute

cardioprotective effects shown by our laboratory73 and others65,86 and the chronic actions of

FGF2 via its angiogenic activity87-89 indicate that growth factor as an excellent therapeutic candidate in the prevention and treatment of I/R injury. This dissertation will focus on the role of the FGF2 protein isoforms in acute ischemia-reperfusion injury and cardioprotection, and the functional complexity of the FGF2 protein isoforms in the heart.

2. Fibroblast growth factor-2

A. Fibroblast growth factor family

FGFs are a family of polypeptide growth regulators consisting of twenty-three Fgf genes90,91, with protein products varying in size from 17 to 34 kD92 and sharing 13-71% protein sequence identity. Most of FGFs share a similar internal core region, with twenty-eight highly conserved and six identical amino-acid residues. Among those highly conserved regions, ten are essential for FGF receptor interaction93. Another commonality among FGF family members is that they all have a high binding affinity to heparan and heparan sulfate proteoglycans93. It is thought that complexing with heparan protects FGF from enzymatic or thermal degradation and aids in receptor binding. Also heparan-associated proteoglycans can bind and store FGF within the extracellular matrix94. Most FGFs have signal peptides and are secreted from cells92. There are a few exceptions: FGF1 and FGF2 have no signal sequence, but are localized to the basement membrane of the extracellular matrix and can be detected in extracellular environment95. FGF11-

14 are not secreted and found only intracellularly(cytoplasm and nucleus)96-106. The biological activities, tissue distribution, and spatial expression of FGFs are listed in Table 2.

Table 1: List of molecules involved in cardioprotective or cardiotoxic effect ischemia- reperfusion injury

Factor or Protein Effect on ischemia-reperfusion injury Nitric oxide Conversial50-52,107 MAPK ERK Protective82,83 signaling p38 MAPK Controversial82,83,108 JNK Deleterious82,83 PKC PKC α Protective74-78,80,81 signaling PKC δ Controversial74-78,80,81 PKC ε Protective74-78,80,81 Free radicals Controversial19,53,54 Adenosine Protective57-60 Opioid Conversial39,48,61,72,109 Bradykinin Protective49,62,63 69-71 KATP channels Controversial Heat shock protein Controversial110-113 Sodium–proton exchanger Deleterious 114-118 Tyrosine kinase Protective119-121

Table 2: Fibroblast growth factor family biological properties

Nuclear Biological activities Tissue distribution localization signal FGF1122-125 + Angiogenesis, DNA Widely distributed throughout synthesis, wound healing, the body endothelial cell migration, cardioprotection FGF2122-125 + Mitogenic activity, Widely distributed throughout cardioprotection, wound the body healing, angiogenesis FGF3126,127 + Carcinogenesis, embryonic Embroynic development stages, development adult brain and testis FGF4128 - Cell differentiation, Embroynic development stages carcinogenesis FGF5129 - Hypertrophy, carcinogenesis, Most expressed in central nerve tissue regeneration, system and cardiovascular cardioprotection system FGF6130 - Muscle differentiation, Embryo, adult heart, testis, myogenesis, embryonic muscle, vascular endothelial development factor FGF7131-133 - Mitogenesis, cell migration Epithelial cell in liver, lung, gastrointestinal tract FGF8134 - Embryonic development Embryo, adult testis and ovaries FGF999 - Cell differentiation, Embryo, adult brain, kidney vascularization, Cell survival FGF10133,135 - Cell differentiation, Embryo, fetus, adult lung proliferation FGF11-12136 + Not identified Human fetus, adult brain FGF13136 + Not identified Human fetus, adult brain FGF14106,136 + Not identified Various adult tissue FGF15137 ? Embryogenesis Developing nervous system FGF16-19138-141 ? Development Embryonic development stages FGF20142 ? Development Embryonic limb FGF21-22143 ? Hematopoiesis, regulate Adult liver metabolism FGF23 90 ? Homeostasis, bone Brain mineralization, vitamin D metabolism

B. Fibroblast growth factor-2

Fibroblast growth factor-2 (FGF2) was first identified in pituitary and demonstrated to

stimulate the growth of a fibroblast cell line (3T3 cells)122. The protein has a basic isoelectric

point (pI>9.0), high affinity for heparan and is eluted from heparan binding with 1.5 M sodium

chloride (NaCl)144. Based on those biochemical properties, it was originally coined basic FGF145.

Fgf2 gene

The Fgf2 gene is mapped to band q26-q27 on human chromosome 4 and extends over 36

kb and is highly conserved among vertebrates. There are five GC boxes which might represent

SP-1 binding sites and one potential AP-1 binding site within the core promoter region146. The

Fgf2 gene has a unique feature of being bidirectionaly transcribed; it can be transcribed multiple polyadenylated sense and a unique 1.5 kb antisense transcript in a variety of species, including human, rat, chicken and Xenopus laevis147-150. The sense and antisense RNAs are complementary

at their 3’ ends and the antisense RNA has been implicated in the post-transcriptional regulation

of Fgf2 gene expression150,151. This antisense Fgf2 cDNA encodes a novel 35 kD nuclear protein

(GFG) with homology to the MutT family of antimutator NTPases which can spontaneously

form a mutagenic substrate of DNA replication152. Fgf2 gene consists of three exons interrupted

by two 16 kb introns and a large 5’ and 3’ non-coding regions148. Exon 1 contains the

translational start sites, leading to the expression of different FGF2 protein isoforms153-156. The overall species homology of FGF2 gene has not been identified. However, several pieces of evidence indicate that with exon 1, the human and chicken share a 97% homology157, while human and pig have a 93% homology158. Borja and colleagues151 identified two alternatively

spliced isoforms, canonical bFGF and alternative-bFGF (alt-bFGF), which had an alternative

exon 1 with its own promoter, in chicken embryo. Another alternative splicing of exon 1c to exon 2 creates a novel transcript in mouse embryo and could play a role in mouse embryogenesis159. Disruption of exon 1 or exon 2 results in mild vascular defect; otherwise the

mice are fertile, viable and phenotypically indistinguishable from wildtype160,161. Both exon1 and

exon2 knockout mice show a delayed wound healing, a decreased bone mass and a decreased

blood pressure160-164. The biological function of exon 3 is currently unknown.

FGF2 protein isoforms

FGF2 consists of multiple protein isoforms resulting from different translational start

sites from a single Fgf2 gene (Figure 1). One 18 kD FGF-2, termed low molecular weight

isoform (LMW), is translated from a conventional Kozak AUG start codon and consists of 155

amino acids, representing the core sequence common to all FGF-2 isoforms. Several high molecular weight (HMW) isoforms of FGF2 are identified in many species, including human, rat, bovine, guinea pig, and chicken153-156. These HMW isoforms are extensions, at the amino

terminal of the LMW isoform and use the upstream inframe CUG codons as alternative

translational start sites. In mouse, there are two HMW isoforms (21 and 22 kD), and in human,

there are four HMW isoforms (21, 22, 24 and 34 kD). The 34 kD FGF2 HMW isoform,

originally identified in Hela cells, is initiated at a fifth initiation (CUG) codon165. This 34 kD

FGF2 isoform, in contrast to the other FGF2 HMW isoforms, permits NIH 3T3 cell survival in

low-serum conditions165,166.

The three-dimensional structure of the LMW isoform of FGF2 has been determined by

several groups167,168. The backbone of FGF2 can be described as a trigonal pyramidal structure

with twelve anti-parallel β-sheets. A helix-like structure is identified at residues 131-136

(receptor-binding site) and residues 13-30 which is part of the heparan binding site169,170. The

human LMW FGF2 isoform contains two potential phosphorylation sites, serine 64, which is a

protein kinase A (PKA) site and threonine 112, a protein kinase C (PKC) site. The

phosphorylation of FGF2 modifies the affinity of FGF2 to its receptor and assists in the release

of FGF2 from the basement membrane171. Although FGF2 contains four cysteines, two which are conserved within the FGF family, there are no intramolecular disulfide bonds172, indicating

that the free cysteines will not form intermolecular disulfide bridges between two FGF2s. Two

inverse sequence arginine-glycine-aspartate (RGD) sequences, proline-aspartate-glycine-arginine

(PDGR) and glutamate-aspartate-glycine-arginine (EDGR) may be involved in the modulation of the mitogenic activity of the FGF2 LMW isoform, independent of FGF receptor activity173.

Currently, there is no evidence as to the protein structure of FGF2 HMW isoforms. It is hypothesized that all the isoforms have the same protein structure since they all share the same structural residues. Whether this hypothesis is true remains to be determined.

FGF2 expression pattern

FGF2 is widely expressed in various tissues and organs during embryogenesis and adult

stages. The Fgf2 gene can be detected in the developing embryo, with the highest expression

detected in the developing limbs, tail, heart and lung174. In the adult, expression of the FGF2 is

localized to the basement membranes of all blood vessels, but not in epidermal or epithelial

basement membranes175. High levels of FGF2 LMW isoform are also found in cardiac muscle fibers, smooth muscle cells of mid-size blood vessels, the digestive track and myometrium, in central nervous system neurons and cerebellar Purkinje cells, and on epithelial cells of the bronchi, colon, endometrium, and sweat gland ducts of the skin by immunohistochemistry175.

Since there is no specific FGF2 isoform antibody available, it is hard to differentiate the different

FGF2 isoforms by using immunohistochemistry.

A differential and unique expression pattern of FGF2 isoforms has begun to emerge based on several studies employing Western immunoblotting techniques176-178. In rat central

nervous system, the HMW isoforms are developmentally regulated such that the 22 kD FGF2

isoform appears after birth, reaching maximum level in adult; however, the 18 and 21 kD FGF2

isoforms are absent in the adult rat cerebellum176. In contrast, in the adult rat heart, the 18 kD

FGF2 isoform is the predominant isoform; whereas, in the neonatal rat heart, the 21 and 22 kD

FGF2 are the predominant isoforms expressed177. Additionally, the expression of the HMW

isoforms (21 and 22 kD isoforms), but not the 18 kD isoform, is selectively increased by

cytokines in rat hippocampal astrocytes178.

FGF2 isoform subcellular localization and release

The HMW isoforms, which possess N-terminal extensions upstream codon of AUG in the Fgf2 gene, contain several GR (Glu/Arg) repeats that act as nuclear localization sequences

(NLS) for FGF-2166,179-181. The 34 kD isoform contains an additional arginine-rich type of NLS

besides the common NLS for other FGF2 HMW isoforms182. This NLS is similar to that of the

HIV type1 Rev (Regulator of Virion) protein, suggesting that the 34 kD HMW isoform enters the

nucleus by binding to human nuclear import receptor, importin β182. In contrast, the 18 kD form

is mainly found in the cytoplasm and stored in the extracellular matrix 183.

Recent evidence indicates that the LMW and HMW isoforms are not always localized

only to the cytoplasm or nucleus, respectively. The 18 kD FGF2 does contain a C-terminal NLS,

FGF-2 mRNA (484) (951) (1)

CUG0 CUG1 (319) AUG (486) Stop (951) CUG2 (346)

5’ 3’ CUG3 (361)

34 kD (human)

nuclear HMW 24 kD (human)

22.5 kD (human)/22 kD (mice)

22 kD (human)/21 kD (mice)

cytoplasmic LMW 18 kD (mice/human)

Nuclear localization signal Gray bar

Modified from Okada-Ban M et al , Int J Biochem Cell Biol, 2000

Figure 1: Schematic of multiple FGF2 isoforms arising from different translational start sites. The 18 kD FGF2 LMW isoform is presented in both mice and human. In mice, two FGF2 HMW isoforms are identified (21 and 22 kD); in humans, four FGF2 HMW isoforms (22, 22.5, 24 and 34 kD). The nuclear localization signal in the HMW isoforms of FGF2 indicates that these isoforms are targeted to the nucleus, while the LMW isoform of FGF2 remains cytosolic.

consisting of Arg116 and Arg118, which is able to target it or a fusion protein to the

nucleus184,185. Like other polypeptides, such as insulin and interleukin-1, extracellular 18kD

FGF-2 can translocate into the nucleus after internalization186, possibly through heparin sulfate

proteoglycans (HSPGs) since this internalization can be abolished by treating with heparanase187.

The endogenous 18 kD FGF2 isoform can also directly translocate from ER to the nucleus188.

When 18 kD FGF2 remains in the nucleus, there is a slight stimulatory activity of cell proliferation and a down-regulation of its receptor, suggesting that the intracellular biological activity of 18 kD FGF2 is independent of its receptor signaling pathway. On the other hand, the

HMW FGF2 isoforms can also be released out of the cell through vesicle shedding189.

The activation of the FGF receptor (FGFR) requires the binding of the ligand (FGF2),

most likely the LMW isoform. However, one of the most perplexing pieces of FGF2 is that it

lacks a consensus signal peptide for secretion190,191. Typically, secreted proteins contain N-

terminal signal peptides which direct them to the endoplasmic reticulum192. Secretary vesicles

then carry the protein from the ER to the Golgi and finally to the cell surface where the secretory

vesicles fuse with the plasma membrane, releasing their contents into the extracellular

milieu193,194. Numerous studies have shown that LMW FGF2 gets ‘released’ from the cell,

associating with the basement membrane, HSPG and FGFR and eliciting biological activity in

vitro195-198. In fact, inhibitors of ER-Golgi-mediated secretion have no effect on FGF2 release194.

The mechanism of how the LMW FGF2 is released remains unclear. However, there are several mechanisms that have been postulated to indicate the possible unconventional pathway of secretion of LMW FGF2. In the late 1980s, studies demonstrated that the LMW FGF2 could be released by cell injury induced by high dose endotoxin and irradiation199,200. An initial study by

Ito and colleagues201 drew speculation that in situ occurrence of plasma membrane wounding

(transient, survivable disruption) followed by resealing might reflect a novel route for LMW

FGF2 trafficking in and out of the cytoplasm. Additionally, the export of LMW FGF2 may also

likely rely on plasma membrane-resident transport202 via Na+/K+-ATPase203 or HSPGs204.

Florkiewicz and colleagues203 suggested that the α/β heterodimers of Na+/K+-ATPase may form a higher-ordered complex that could catalyze LMW FGF2 export, while the Zehe group204 proposed that the cell surface receptor, HSPG, could form a molecular trap, driving net export of

LMW FGF2. Furthermore, Mignatti and colleagues100 have proposed that LMW FGF2 secretion

involved intracellular vesicles of endocytic membrane or internal vesicles fusion with the plasma

membrane, since lowering temperature or administration of methylamine, both of which would

be expected to inhibit secretory vesicle fusion, inhibited LMW FGF2 secretion and FGF2-

induced migration of 3T3 cells. However, many studies in terms of the localization or secretion

of FGF2 LMW and HMW isoforms, were in vitro166,179-181,189. In vivo, studies demonstrate that

FGF2 can be detected in the urine and pericardial fluid from patients with myocardial

ischemia205-207. Evidence suggests that FGF1 can form a complex with S100A13 which may

assist in the release of FGF1 out of cells. Since FGF1 and FGF2 shared 73% similarity92, this may also be a potential mechanism that facilitates the movement of FGF2208. However, to date,

there is little, if any, evidence demonstrating the localization or secretion of the individual FGF2 isoform in vivo. This dissertation would be the first study to determine the subcellular localization of FGF2 isoforms in cardiac tissue and their release upon I/R injury.

C. FGF receptor

There are two classes of FGF receptor identified on the cell surface. Heparan sulfate

proteoglycans (HSPGs), the low affinity-high capacity receptor, and FGF receptor (FGFR), the

high affinity-low capacity receptor209.

Heparan sulfate proteoglycans (HSPGs)

Heparan sulfate proteoglycans (HSPGs) are macromolecules that associate with the cell

surface and extracellular matrix (ECM) and are characterized by a protein core that couple to a unique glycosaminoglycan chain210,211. HSPGs are classified into several families based on their

core protein structure. Five classes of cell surface HSPGs are characterized including: four

syndecan isoforms, four glypican isoforms, perlecan, agrin, and type XVIII collagen212, and the heart contains all five classes213. Glypicans and syndecans are membrane proteoglycans, which

link to the plasma membrane by a glycosylphosphotidylinositol (GPI) linkage or a

transmembrane domain, respectively210. Many reports suggest that HSPGs are involved in

growth control214, cellular adhesion214, lipoprotein metabolism215, blood coagulation214, PKC signaling216, and growth factor signaling including EGF, the Wnts and FGFs. Unlike what was

previously thought (i.e., ligand binding was the interaction between heparan and heparan sulfate

and protein), each ligand actually interacts with its specific HSPG via a specific sequence and

domain167,217. Syndecan-1,-2 and -4 assist high-affinity binding of FGFs to their receptors216. It is

well established that the binding of FGF2 via HSPGs to FGFR increase the stability, affinity and

half life of the FGF/FGFR complex218. HSPGs can interact with a specific region (K18K) located

in the extracellular loop domain of FGFR, suggesting possible binding of HSPG with FGFR,

independent of ligand binding219. HSPGs also serve as storage sites for the FGF2 LMW isoform

and also protect FGF2 LMW isoform from proteolysis, prolonging the exposure of the

myocardium to FGF2220. Furthermore, the involvement of HSPGs in facilitating the

internalization of the FGF2 LMW isoforms or FGF-triggered angiogenesis212,221, suggests that

HSPGs are potential novel therapeutic targets that either may indirectly or directly facilitate

actions of FGF2 isoforms in I/R injury. However, the release of FGF2 HMW isoforms does not

occur by assistance of HSPGs, but is due to vesicle shedding189. The exact role of HSPGs in

cardioprotection and its interaction with FGF/FGFR complex is unknown and would be a great

future target to study, in order to further identify the functions of the FGF2 isoforms in I/R

injury.

Fibroblast growth factor receptors (FGFRs)

At least four distinct receptors for FGFs have been discovered (FGFR1, FGFR2, FGFR3

and FGFR 4), which consist of many additional structural variants resulting from alternative

splicing. The FGFRs contain a single membrane-spanning domain, an extracellular region, and a

cytosolic tyrosine kinase domain that is activated upon ligand binding. The extracellular region

of FGFRs is characterized by three consensus immunoglobulin (Ig)-like loops. Between Ig-like

loops 1 and 2 is a short segment referred to as the acidic box domain, which is unique to the

FGFRs. The tyrosine kinase region is the C-terminal tail domain that is divergent in sequence

between the four FGFRs. Although not all FGF-FGFR binding interactions have been studied, it

appears that most FGFs will bind to any FGFR. There is evidence that the first Ig-like domain is

not required for high affinity binding to FGF1 or FGF2222. Therefore, the three alternative sequences for the carboxyl-terminal half of the third Ig-like domain (named IIIa, IIIb, and IIIc) give rise to the functionally different FGF receptors. The FGFR1 IIIc form binds FGF1 and

FGF2 with equally high affinity209. The FGFR1 IIIb form shows higher affinity for FGF2223.

Also, the FGFR1 IIIa form binds preferentially to FGF2 over FGF1224.

In human hearts, FGFR1 and FGFR4 are the predominant FGF receptor225. In mouse hearts, FGFR1 is the predominant FGFR form, with no FGFR4 expression226. FGFR1

expression is essential in cardiac development227 and gradually declines, but still is expressed in

adult hearts228. FGFR1 signaling in the hearts leads to developmental cardiomyocyte growth227, acute cardioprotection after I/R injury229 (Chapter 3, Figure 60), angiogenesis-induced

cardioprotection230, tumorigenesis in myxoma231, and proliferation232,233. However, which

endogenous FGF2 isoform interacts with FGFR1 to modulate the outcome following cardiac I/R

injury remains to be elucidated. This dissertation has explored which FGF2 isoform(s) would

interact with FGFR1 and whether FGFR1 is involved in FGF2-induced cardioprotection.

Fibroblast growth factor receptor signaling

FGFR belongs to the receptor tyrosine kinase family234. Binding of FGFs to the

extracellular domain leads to activation of tyrosine kinase function. The FGFR undergoes homo-

and hetro-dimerization, resulting in auto-phosphorylation235,236. Five phosphotyrosine sites have

been identified, which provide binding sites for downstream signaling molecules (Src and Grb)

containing src homology domains (SH2) such as PLC237 and adaptor protein like Shc and

Crk238,239 (Figure 2). Individual phosphotyrosine residues present in the cytoplasmic domains of

FGFRs serves as highly selective binding sites that interact with specific cytoplasmic molecules.

The association between the tyrosine phosphorylated regions of FGF receptors and signaling

proteins was mediated by a conserved region of approximately 100 amino acids, termed src

homology domains (SH2)240 (Figure 2). Tyrosine phosphrylation of the binding site serves as the

receptor for SH2 association, while the C-terminal residues provide specific recognition of the

relevant SH2 domain-containing target protein. SH2 domain is usually accompanied by another

conserved domain of 50 amino acid residues, termed the SH3 domain, which may extend the

ability of signaling proteins to complex with one another241.

There are three major signal transduction pathways of FGF, including PLC/PKC, Ras-

Raf-MEK-MAP kinase and PI3K/Akt242,243 (Figure 2). One of SH2 domain-containing enzymes

that participate in FGF receptor signaling is phospholipase C (PLC)-γ. Phosphorylation of Y766

binds and subsequently phosphorylates PLC-γ, which hydrolyzes phosphatidylinositol 4,5

bisphosphate to inositol 1,4,5 trisphosphate (IP3) and diacylglycerol (DAG). The generation of

2+ IP3 leads in turn, to the release of the Ca from internal stores, whereas DAG accumulation

activates isoforms of the protein kinase C family244. FGFR stimulation leads to tyrosine

phosphorylation of the docking protein, FGF receptor substrate 2 (FRS)245. Growth factor

receptor-binding protein 2 (Grb2) binds to the phosphorylated FRS2, which recruits SOS to the

plasma-membrane, leading to activation of the Ras/MAPK pathway. Additionally, FGFR had

interacts with several adapter molecules including Shc, Crk and Shb238,239,246. Furthermore,

another protein kinase pathway activated by most tyrosine kinase receptors is

phosphatidylinositol 3' kinase (PI3 kinase)209. FGF-induced PI3 kinase activity has been difficult

to detect in vitro247. However, neurotrophin 3 inhibited FGF2-induced neural progenitor cell

proliferation via the PI3K/GSK3 pathway, suggesting the potential relationship between the : FGF2/FGFR complex and PI3K/GSK3 pathway248.

In ischemic cardiomyocytes, the protective effect of administration of human recombinant

FGF2 LMW isoform is dependent on its binding to FGFR1 and possible PKC ε activation229.

Furthermore, the Fgfr1 mRNA level was increased after cerebral ischemia which

Dimerization upon ligand LMW FGF2 FGFR binding and auto- cross-phosphorylation

Grb2 P Shp2 P P PLC DG PIP2 Internalization IP SOS 3 Multiple Nck P P PI3K docking PIP3 ? sites Grb2 P Shc P P Src SOS PKC ζ P Grb2 Tyrosine Sos phosphorylation Cytosolic PKCζ substrates RasGTP RasGDP GAP RGL Rho PI3K Cytosolic Rac1 PIP2 Substrates Raf MEKK ? Ral GDS PKCζ PIP3 SEK RKK Akt RalGTP RalGDP MEK ? ERK1JNK/SAPK p38 PLD ERK2 HMW FGF-2 Cytosolic substrates

HMW FGF-2 target gene

Figure 2: Schematic of FGF receptor signaling. The activation of FGF receptors can recruit target proteins that interact with the Src-homology 2 (SH2) domains and specific phosphotyrosine residues on the activated receptors. FGF2 signaling is through the phospholipase C/ protein kinase C (PKC) pathway, PI3 kinase/Akt cascade, and/or the mitogen activated protein kinase (MAPK) pathway. Grb: growth factor receptor-binding protein, Sos: Son of sevenless, Shp: protein tyrosine phosphatase, PLC: phospholipase C, DG: diacylglycerol, IP3: inositol 1,4,5 trisphosphate, PI3K: phosphatidylinositol 3' kinase,Src: v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog, MAPK: mitogen activated kinase, MEKK: MAPK kinase kinase,MEK: MAPK kinase, ERK: extracellular signal-regulated kinase, JNK: c-Jun terminal kinase, RGL: Ral guanine nucleotide exchange factor, Akt: thymoma viral proto-oncogene 1

may serve to self-protect neurons in the ischemic field of the cerebral cortex225. Currently, the

exact mechanism(s) that is triggered/activated via FGFR1 stimulation to protect against cardiac

I/R injury is not clearly defined, as FGFR may activate both beneficial and deleterious molecules modulating the outcome following I/R injury.

D. Biological activity of FGF2 isoforms

FGF2 is a multifunctional growth factor regulating cell proliferation, differentiation, survival and migration in various cell types including myoblasts, chondrocytes, osteocytes, nerve

cells and vascular endothelial cells249. The pleiotropic effects of FGF2 on multiple cell types

have led to postulate that it plays a critical role in many physiological processes, including

hematopoiesis, angiogenesis, nervous development and cardiac hypertrophy and ischemia-

reperfusion injury. Since FGF2 is composed of different molecular weight protein isoforms,

localized in different cellular compartment, it suggests unique biological functions of these FGF2

isoforms in development and disease.

Blood Vessels

Blood vessels arise via vasculogenesis and angiogenesis, which are two distinct

processes250. Vasculogenesis refers to the de novo formation of a vascular network. This process

begins with differentiation and segregation of precursor cells (angioblasts) into endothelial

cells251. Angiogenesis refers to the formation of new blood vessels from a preexisting vessel by

budding and branching252. The FGF2 isoforms have unique roles in cell proliferation and cell

migratory processes of angiogenesis249.

The first angiogenic regulator identified in tumor formation and maintenance is the FGF2

LMW isoform253. FGF2 LMW isoform induces angiogenesis by modulating interstitial

collagenase, urokinase type plasminogen activator (uPA), plasminogen activator inhibitor (PAI-

1), uPA receptor, and β1 integrins protein that are involved in regulating critical steps during angiogenesis254-256. In addition, FGF2 LMW isoform is detected in a variety of tumors, including

brain257, prostate258, breast259, and non-solid tumors such as leukemia and lymphomas260.

Angiogenesis is also involved in the wound healing process261. Wound healing is the

body's natural process of regenerating dermal and epidermal tissue, categorized into three

phases: inflammatory, proliferative, and maturation262. Tissue injury releases many growth

factors, including FGF2, which attract inflammatory, fibroblast, epithelial and vascular

endothelial cells to the injury site263. FGF2 LMW isoform also can stimulate cell migration,

proliferation, neovascularization, synthesis of the extracellular matrix and remodeling of the

scar264. Many studies showed that the FGF2 LMW isoform promotes re-epithelialization

formation of wound in vivo265,266.

There are few studies evaluating the FGF2 HMW isoforms in cell transformation,

proliferation and migration. Studies by Bikfalvi267 or Quarto180 showed that the FGF2 HMW

isoforms induce fibroblast transformation, but no cell migration, in a receptor-independent

manner. Although all FGF2 isoforms result in cell transformation, only the HMW isoforms could

induce cell growth in low serum267.

Blood cells

Hematopoiesis is the formation of blood cellular components. It is a complex process

involving the interplay between hematopoietic stem cells, their progenitors and bone marrow

stromal cells. The former leads to the formation of all mature lineages in peripheral blood, while the stromal cells provide cytokines and functional extracellular matrix to regulate the growth, differentiation and maturation of progenitor cells268.

Most data on the relationship of FGF2 and hematopoiesis are obtained from evaluating the FGF2 LMW isoform. FGF2 LMW isoform positively regulates hematopoiesis269-271. In vitro,

FGF2 LMW isoform plays a permissive action in stimulating the recovery of early hematopoietic progenitors from normal human adult peripheral blood269. Low concentrations of FGF2 LMW

isoform effectively augment myelopoiesis in human long-term BM cultures270, possibly by

abrogating the inhibitory effect of transforming growth factor-beta 1 (TGFβ-1)272. FGF2 LMW

isoform also synergizes with other hematopoietic cytokines (eg, IL-3, IL-6 and GM-CSF) to

stimulate proliferation of hematopoietic cell lineages272 and prevent progenitor cells from

undergoing apoptosis273. Clinically, patients that have myelofibrosis with myeloid metaplasia

(MMM) show an elevated level of TGF β1 and FGF2 LMW isoform274. Recent evidence by

Nakayama’s group suggests that the involvement of FGF2 LMW isoform in MMM was partially

due to a reduced expression of stroma cell-derived factor 1 (SDF-1)275. In human leukemic cells,

18, 22 and 24 kD FGF2 HMW isoforms are detected276. No other data has been provided to clarify the role of FGF2 HMW isoforms in hematopoiesis.

Lung

Fgf2 mRNA expression is very low in the fetal lung, but relatively high postnatally277. In rat fetal lung, FGF2 is found in the airway epithelial cells, basement membrane and extracellular matrix278. The receptor of FGF2, FGFR, localized to the airway epithelial cells and its expression increases the embryonic and pseudoglandular stages of lung development, followed by

fluctuations in reactivity during the canalicular stage278. FGFR level in the adult lung is in a low

expression level; therefore, the mechanism by which FGF2 regulates lung development remains

unclear279. Brettell and collegues280 showed that the FGF2 LMW isoform negatively regulates

the synthesis of elastin by interstitial fibroblasts and neutralized FGF2 antibody caused an

increase in elastin production .

In adult lung, FGF-2 LMW isoform is an efficient strain-dependent radioprotector in nonhematopoietic tissue and may prevent radiation-induced pneumonitis and fibrosis281,282. Fgf2 mRNA and FGF2 LMW isoform are detected in macrophages from patients with acute lung injury283. This expression of Fgf2 mRNA in lung fibroblast may be modulated by platelet- derived growth factor (PDGF) and TGF β284. Recently, FGF2 LMW isoform has been shown to inhibit mucus production and lung inflammation seen in airway hyperresponsiveness and therefore, could be a potential target for asthma treatment285.

Nervous system

During development, neuronal FGF2 LMW isoform expression is detected in stage

embryonic(E) day 12 in chicken spinal chord and ganglia286, and stage E16 and E17 in rat cortex, striatum and almost all neurons of the brain stem, and spinal chord287. In the newborn rat, Fgf2

mRNA is detected in the ventral spinal cord and spinal ganglia287. The 21 kD FGF2 HMW

isoform expression peaks at day 28 postnatal (P28) in rat adrenal medullae; while the 23 kD

FGF2 HMW isoform is not detectable at P1 and P10, but it has a weak expression at P28288. The

dramatic increase of the 21 kD FGF2 HMW isoform during postnatal development appears to

coincide with the plasma concentrations of corticosterone289. In human, FGF2 is detected in central nervous system neurons and in cerebellar Purkinje cells289.

Both FGF2 LMW and HMW isoforms play vital roles in nerve regeneration following

injury290. Peripheral nerve lesion upregulates the expression all three FGF2 isoforms with 23 kD

expression highest in the dorsal root ganglia and 21 kD expression highest in the sciatic nerve288.

Additionally, the FGF2 LMW isoform has been shown to maintain survival of cultured neurons291, promote transmitter storage and synthesis in chromaffin cells292, and prevent

neuronal death293. PC12 cells overexpressing 18 kD FGF2, differentiate into sympathetic-like

neurons and become electrically excitable294,295. Furthermore, FGF2 HMW isoforms promote

sensory recovery and the length and grades of myelinated axons; whereas motor recovery is

inhibited296. In contrast, the FGF2 LMW isoform mediates an inhibitory effect on the

myelination degree of axons296.

Heart

In cardiomyocytes, the FGF2 LMW isoform is localized within the external cell

membrane surface, with specialized intercellular junctions and with the myofibril Z lines in the cytoplasm297. In the heart, FGF1 and FGF2 are the predominant FGF family members

expressed298,299 and FGFR1 is the predominant receptor in murine hearts and FGFR1 and 4 are

markedly expressed in human heart tissue, with barely detectable FGFR2 and 3225,300. In vitro neonatal myocytes studies show that both LMW and HMW FGF2 isoforms increase cell proliferation, but only the HMW FGF2 isoforms cause binucleation independent of FGFR pathways, possibly by directly affecting chromatin structure301,302.

FGF2 isoforms have distinct roles in many pathological circumstances in the heart including cardiac hypertrophy303, ischemia-reperfusion injury65,73,304,305, and atherosclerosis306-

308. The expression of FGF2 LMW isoform is upregulated in the hearts subjected to

hemodynamic stress and undergoing hypertrophy309,310. Administration of the LMW FGF2

isoform to ventricular myocytes causes hypertrophy in the absence of mechanical stress311 and

reactivation of fetal forms of contractile proteins312. However, findings from Kardami and colleagues310 suggest that exogenous administration of the human recombinant FGF2 HMW

isoforms, but not the LMW isoform, leads to a 40% increase in culture neonatal myocyte size313.

Intracardiac administration of recombinant rat FGF2 HMW isoforms to the ischemic left ventricle results in cardiac hypertrophy 6-8 weeks after injury313. These studies suggest distinct

biological activities of FGF2 LMW and HMW isoforms both in vitro and in vivo. However, due

to the limitation of that only the recombinant FGF2 LMW isoform is available and the non-

specificity of the FGF2 antibody, much remains to be determined regarding the role(s) of the

FGF2 LMW and HMW isoforms in cellular behavior and in pathophysiological circumstances.

This dissertation will utilize unique genetically-manipulated mouse models to elucidate the specific biological role of each FGF2 isoform in I/R injury. This dissertation will provide valuable new information on the role of endogenous murine FGF2 LMW and HMW isoforms

and the human FGF2 HMW 24 kD isoform in I/R injury.

E. FGF2 isoforms and transcription factors

The LMW and HMW FGF2 isoforms, all to some extent, can localize to the nucleus,

suggesting the possibility that they might act as transcription factors or act as co-factors in

regulating gene expression186,314-326. For example, fibroblasts transfected with either LMW or

HMW FGF2 isoforms display a different pattern of gene expression326. A large number of genes

upregulated following HMW FGF2 transfection are implicated in growth arrest and include

nuclear factor I-X (NfI-X) and nuclear protein-1 (Nupr1) or are involved in tumor suppression

such as suppressor tumorigenicity 5(St 5)326. A large portion of the down-regulated genes (Egr-1 and Mapk-6) are important in promoting cell proliferation and tumor progression. In LMW

FGF2 overexpressing cells, the angiopoietin-like 4 gene (Angptl-4) and ribosomal protein 5

(Rps5) are also up-regulated326.

The FGF2 LMW isoform can act as an agonist of rDNA transcription by interacting with

protein kinase CK II186, and it can also bind to a specific sequence of rDNA to form a dimer, and

has high affinity to histone-1314. Furthermore, the FGF2 LMW isoform can regulate gene

transcription in a promoter specific manner such that, in the presence of FGF2, the transcription

of the phosphoglycerate kinase (pgk-1)-driven genes are inhibited; whereas the transcription of

pgk-2 driven genes are increased315. This evidence strongly suggests that the FGF2 LMW isoform directly or indirectly regulates the transcription of genes. Many apoptotic effects and angiogenic effects of FGF2 LMW isoform are mediated via several transcription factors, including NF-κB318, c-fos325, c-jun325, AP-1325, STAT1321, CREB322, NGFI-A-binding protein 2

(NAB2, regulating early growth response 1 gene)323, all which have also been implicated to be

activated and involved in the development of the late phase of ischemic preconditioning, a mode

of cardioprotection against I/R injury327-330. Therefore, understanding the transcriptional

contribution of HMW and LMW FGF2 signaling will be of great importance in elucidating their

mechanism in I/R injury.

The HMW isoforms have been observed to act as transcription factors315,316,331 or as part of a complex with transcription factors or other intracellular partners332 at the promoter level.

Delrieu and colleagues316 showed that overexpressing the 24 kD FGF2 isoform in 3T3 cells

causes an up-regulation of interleukin-6 (IL-6) transcription, independent of AP-1 binding sites; whereas exogenously added 18 kD FGF2 isoform produces a down-regulation of IL-6 involving

an AP-1 binding site. Interestingly, the same group later reported that FGF2 HMW isoforms lead

to a down-regulation of IL-6 promoter activity in Hela cells in a dose-dependant manner via a

FGF2 intracrine loop, since exogenously added FGF2 LMW isoform fails to regulate the IL-6 promoter activity317. This regulation involves a responsive region in 24 kD FGF2 containing a

retinoblastoma control element317.

Endogenous FGF2 isofoms are involved in different intracellular protein complexes332.

FGF2 LMW isoform induces degradation of IΚB and NF-κB activation in vascular smooth

muscle cell proliferation, possibly through activation of ERK pathway318. Furthermore,

Vandermoere and colleagues319 demonstrated that the FGF LMW isoform induces an anti-

apoptotic effect in a breast cancer cell line via an interaction between Akt and IκB kinase-β,

resulting in activation of NF-κB. FGF binding proteins such as ribosomal L6/TAX-responsive

element-binding 107 protein are able to associate with different FGF2 isoforms333. In nuclear

fractions from adult bovine aortic endothelial (ABAE) cells, FGF2 has high affinity for histone

H1 and complexes with CKII kinase to phosphorylate nucleolin and also regulates rDNA transcription and RNA polymerase activity314. Moreover, HMW FGF2 isoforms exclusively

associate with a nuclear factor, fibroblast growth factor-2 interacting factor (FIF), which is an

anti-apoptotic effect320.

These data suggest that in vitro, FGF2 isoforms could act on transcription differentially.

Further studies will be needed to elucidate the relationship between FGF2 isoforms and

transcription factors in in vivo gene expression. This dissertation will focus on understanding the

effects of HMW and LMW FGF2 signaling on transcriptional regulation and how this could

contribute to cardioprotection.

F. Characteristics of mice deficient and overexpressing the Fgf2 gene

To further probe the role of FGF2 in development and disease, mice were generated in

which the portion of exon 1, containing the known FGF2 isoforms, was ablated (Fgf2 KO).

Although the Fgf2 KO mice are viable, fertile and grossly indistinguishable from wildtype mice, a few subtle phenotypes have been observed162,334,335. First, FGF2 is reported to influence the

development of cerebral cortex162. Fgf2 KO mice display neurological defects consistent with the

idea that it has essential functions during development of the CNS162. A significant reduction in

the number of neurons in the brain neocortex, particularly in the motor area, is detected in Fgf2

KO mice162. The observed reduction in neuron density in the neocortex does not appear to be caused by increased neuronal cell death but may possibly be due to limiting the extent of proliferation, differentiation or migration of neuronal progenitor cells336. Second, FGF2 is

reported to be a potent mitogen for osteoblasts and osteoblast precursors334. Disruption of the

Fgf2 gene results in decreased in calvarial osteoblastic cells in the Fgf2 KO mice334. Also, bone marrow stromal cells from Fgf2 KO mice formed fewer alkaline phosphatase (ALP) mineralized colonies; this could be due to a decrease in obsteoblast precursor number, secondary to decreased replication334. Third, FGF2 plays an important role in the homeostatic process of vascular tone

control335. In FGF2-deficient mice, trabecular bone volume, mineral apposition, and bone formation rates are decreased334. FGF2-deficient mice show a decrease in vascular tone as

measured by the decreased contractility in portal vein, and this effect may contribute to the

reduced mean arterial blood pressure observed335. FGF2 has long been thought to play a role in

tissue regeneration and skin wound healing337. In FGF2-deficient mice, a small, but significant

defect in skin wound healing is observed336.

Mice overexpressing the human FGF2 gene (FGF2 Tg) were also generated using the

cardiac α-MHC promoter for enhanced expression specific to the heart73. The expression levels

of two FGF2 transgenic mice lines (MHC20 and MHC25) are 30-35-fold greater than non-

transgenic controls with a 2 fold increased FGF2 release in the coronary effluent during ischemia-reperfusion injury73 which is similar to the elevated levels of FGF2 detected in

pericardial fluid, serum or urine in patients suffering from myocardial ischemia207. The α-

MHC/FGF2 transgenic mice are viable and fertile and have normal postnatal heart development, no spontaneous cardiac hypertrophy, no alterations in vascular density with no apparent gross defects compared to non-transgenic mice160.

Using the PGK promoter, FGF2 transgenic mice were generated338, resulting in ubiquitous expression of the human FGF2 gene. Low transgene copy number mice show no overt phenotype; whereas high copy number mice appear smaller with skeletal abnormalities, and some fail to breed339. Chondrodysplasia is a phenotype in PGK/FGF2 overexpressing mice,

and these mice show an increase in replication and decrease in differentiation in bone339.

Overexpression of FGF2 significantly augments DNA synthesis in vascular smooth muscle cells338. With the exception of skeletal abnormalities and the vascular smooth muscle cell

phenotypes, pathology shows no lesions and no gross or microscopic morphological abnormalities339.

G. FGF2 isoforms and ischemia-reperfusion injury

Myocardial ischemia-reperfusion injury represents a clinical problem associated with

cardiac dysfunction, arrhythmias, and irreversible myocyte damage340. FGF2 had been shown to

protect the heart by improving cardiac function to ischemic insult, reducing reperfusion injury

and reduction of myocytes damage65,86,89,207,341-343.

FGF2 LMW isoform can induce cardioprotection in an angiogenic-dependent

manner65,86,89,207,341-343. Patients with ischemic heart disease, in particular minimal coronary

artery disease, have elevated levels of serum FGF2207. In a canine model of permanent coronary occlusion, administration of FGF2 LMW isoform reduces infarct size and this is associated with an increase in myocardial capillary density a week after infarction341. In the setting of chronic

ischemia, treatment with the FGF2 LMW isoform increases capillary density and blood flow in

ischemic myocardium via growth of new collateral vessels89.

However, exogenously administered FGF2 LMW isoform can protect the heart from

cardiac injury independent of its angiogenic effect65. Addition of the FGF2 LMW isoform

66,86,343 protects cultured neonatal cardiomyocytes from H2O2- induced cell injury and death . In the isolated adult rat or mouse heart model, recombinant rat FGF2 LMW isoform given by retrograde perfusion, protects the heart from subsequent ischemia-reperfusion induced contractile dysfunction and myocardial cell damage and preserved cardiac energy metabolites65.

Reperfusion of the ischemic myocardium adds risk since it is associated with

exacerbation of cell injury and death344. Factors that can reduce damage during development of

an MI and during reperfusion will attract much attention clinically345,346. An in vivo study

showed that FGF2 LMW isoform, injected into the left ventricle of rats after coronary occlusion,

exerts significant protection from tissue loss and contractile dysfunction229. Furthermore, an ex

vivo study also demonstrated that perfusion with the FGF2 LMW isoform during reperfusion

results in significantly improved contractile recovery and reduced apoptotic cell death347.

There are several speculated mechanisms that may lead to the protective effect of FGF2

LMW isoform in I/R injury. It is speculated that FGF2 LMW isoform mediated cardioprotection

requires activation of FGFR1229 and the activation of PLC/PKC signal cascade86,348.

Chelerythrine blocks the protective effect when exogenous FGF2 LMW isoform is administrated to isolated heart86or to myocytes229. Overexpression of FGF2 LMW isoform increases membrane-associated PKC α and cytosolic-associated PKC ε343, which would be expected to

elicit cardioprotection. This study also demonstrated that ERK pathway is involved in FGF2

LMW isoform-mediated cardioprotection by acting as an upstream target of PKC343. In addition,

exogenous administration of the FGF2 LMW isoform causes a hyper-phosphorylation of

connexin 43 in vitro349 and in the adult perfused heart350 via PKC pathway. FGF2 LMW isoform

causes a decrease in mitochondrial coupling by phosphorylation of connexin 43351.

Administration of recombinant rat or human FGF2 LMW isoform during reperfusion can also activate a number of intracellular signals (PKC, ERK, Akt), which are expected to mediate its beneficial effects88.

No direct evidence to suggest an involvement of FGF2 HMW isoforms in I/R injury was

available until recently, when Kardami and colleagues313 showed that intramyocardial injection

of the recombinant rat 23 kD FGF2 HMW isoform caused an improvement in cardiac function

and a decrease in myocardial infarct size 24 hours after MI; however, after 7-8 weeks post-MI, the improvement in cardiac function and decrease in myocardial infarct size disappeared, possibly due to the post-ischemic hypertrophic effect of FGF2 HMW isoforms. The endogenous role of the FGF2 HMW isoforms on I/R injury, however, has not been studied. This dissertation has utilized novel mouse models to elucidate the role of endogenous FGF2 LMW and FGF2

HMW isoforms and human FGF2 HMW 24 kD isoforms in cardiac I/R injury.

H. FGF2 and calcium homeostasis

Calcium homeostasis plays an important role in regulating cardiac function352. Cardiac contraction is triggered by an action potential.353 This action potential depolarizes

cardiomyocytes and causes a small amount of calcium influx353. This calcium triggers a

subsequent release of calcium that is stored in the sarcoplasmic reticulum (SR) through calcium-

release channels such as ryanodine receptors353. The free calcium binds to troponin-C (TN-C)

which is part of the regulatory complex attached to the thin filaments and cause contraction353.

On the other hand, activation of intracellular kinases can phosphorylate the inhibitory protein, phospholamban, and increase calcium transport into the SR354. Many pathophysiological diseases

of the heart, including heart failure and I/R injury, are associated with an imbalance in

intracellular calcium homeostasis355. FGFR activation can trigger several intracellular kinases

including PKC356, MAPK357 and Akt358, which have been shown to modulate calcium

homeostasis. Therefore, it is not unreasonable to speculate that FGF2 can also regulate calcium

homeostasis. Puro and colleagues359 were the first group to demonstrate that FGF2 augments calcium influx through L-type calcium channels in glial cells. Several other groups have

2+ subsequently reported that FGF2 can enhance intracellular calcium concentration ([Ca ]i) through NMDA receptors360, and L-type calcium channels361 in brain. In addition to the brain,

FGF2 also increases calcium influx in fibroblasts362, neonatal and adult rat cardiomyocytes363,364, osteoblastic cells365, and endothelial cells366. There is evidence demonstrating a negative

2+ 367 regulatory effect of FGF2 on [Ca ]i . In cardiac myocytes, the FGF2 LMW isoform decreases

intracellular calcium by 46% during systole367. Similar phenomenon was also observed in vivo

such that the FGF2 LMW decreases developed pressure by 15% in perfused rat hearts86. FGF2

can regulate gene expression of calcium binding protein S100A368 and S100B369. S100A1 protein

also is up-regulated in ischemic rat myocardium370. The S100A1 protein not only has a stimulatory action on RYR2 and SERCA2 to enhance the calcium transient amplitude371, but it can elicit a hypertrophic response, and increase the number of viable cardiomyocytes by inhibiting apoptosis370. In our Fgf2 KO mouse model, there is a decreased bone mass and bone

formation334. Chondrodysplasia is a phenotype observed in PGK/FGF2 overexpressing mice339.

These mouse models implicate a relationship between FGF2 and calcium signaling in bone mineral homeostasis. Overall, these findings demonstrate the important, but complicated role of

FGF2 regulation with calcium homeostasis and signaling.

3. Protein kinases and cardiac ischemia-reperfusion injury

A. Protein kinase C

Protein kinase C (PKC) belongs to a family of serine/threonine kinases which play a critical role in intracellular signal transduction and cell function372,373. PKC can be activated by

multiple stimuli, including calcium374, phorbol ester and phospholipids375 and stress 376-378.

To date, thirteen PKC isoforms have been identified and categorized into three distinctive families: 1) the classical PKC isoforms are calcium-dependent and consist of PKC

α, βI, βΙΙ, γ and µ that require Ca2+, diacylglycerol (DAG), and a phospholipid for activation; 2)

the novel PKC isoforms which are activated independent of calcium and consist of PKC

δ, ε, η, θ and ν which require DAG for activation; and 3) the atypical group PKC ζ , λ and ι379 which require neither calcium and DAG for activation (Figure 3). The protein structure of PKC can be divided into two domains: a regulatory domain at the N-terminus and a catalytic domain at the C-terminus. These domains are further divided into regions that are conserved (C1-C4) across isoenzymes and five regions (V1-V5) that were variable between isoenzymes, but

conserved within an isoenzyme across species380. The calcium-independent isoenzymes have

structures similar to the calcium-dependent isoenzymes, except that they lack the C2 region381.

The C1 region contains the pseudosubstrate site which is thought to inhibit the enzyme by binding to the catalytic site382. The C1 region also binds phorbol esters and DAG within tandemly repeated cysteine rich regions383,384. The C2 region is thought to contain the calcium

binding sites of classical PKC isozymes since the calcium-independent enzymes lacked this

region385.

Once a PKC isoform is activated, a specific adaptor anchors to the PKC isozyme, at a

particular site, in order to produce a precise and quick response386. The adaptors that anchor to

PKC isoforms are called RACKs (receptors for activated C-kinase) and a particular PKC isoform

will bind to its specific RACK and target next to a subset of protein substrates, away from other

substrates, thus displaying differential biological function387. Specific peptides designed to target

the RACK’s function can act as an agonist or antagonist to a specific PKC isoform381.

Several PKC isozymes are present in the heart in a temporal manner388. The PKC α, δ, ε,

η and β1 are detected in neonatal and adult ventricular myocytes33,388-393; whereas, PKC ζ and

βII are expressed in neonatal cardiomyocytes389,391. In the heart, PKC isozymes display various

functions, ranging from vasoconstriction394-396, cardiac hypertrophy397-402 and

cardioprotection355,403-410. PKC participates in ischemia-reperfusion injury in several organs,

including brain 411-413, liver414,415 and the heart403,416-422. PKC is involved during ischemic

preconditioning (IPC), a form of cardioprotection76,392,417,422-427. There is contradictory evidence

for the role of PKC in ischemic preconditioning. The ischemic preconditioning phenomenon is

abolished by several non-selective PKC inhibitors including staurosporin428, polymyxin B428, chelerythrine429, calphostin C430, H7430 and bisindolylmaleimide348,431. Other studies

demonstrated that these non-selective PKC inhibitors do not prevent ischemia preconditioning431-

433. These contradictory results may be a result of non-selective actions of the pharmacological

agents use or the different roles of specific PKC isoforms.

Information regarding the role of specific PKC isoforms in I/R injury may provide some

explanation into this controversy. Ischemic preconditioning induces translocation of PKC ε, δ, η,

and ν392,403,417. Under hypoxic conditions, PKC ε redistributes in rat cardiomyocytes from

cytoplasmic to membrane fractions432. Cardiac specific overexpression of PKC ε in mouse- or

delivery of ψε RACK, a PKC ε -activating peptide, to cardiomyocytes leads to cardioprotection after ischemia-reperfusion injury74 or simulated ischemia75. Also, ischemic preconditioning does

not reduce infarct size in PKC ε knockout mice76. The acute activation of PKC ε during ischemia

is similar to that which occurs in the heart constitutively overexpressing PKC ε. A specific

antagonist designed to target PKC ε RACK abolishes ischemic or pharmacological preconditioning in rat, mice, rabbit and pig75,77,78,80,81. These data suggested that PKC ε is

sufficient to induce cardioprotection.

However, whether PKC δ activation is cardioprotective or cardiotoxic in I/R injury is

controversial. Translocation inhibitor peptides act as isozyme-selective competitors of PKC δ-

RACK binding and function434; on the other hand, peptide activators are derived from a

pseudoRACK (ψRACK) sequence in PKC δ that is similar to a sequence in its corresponding

RACK435. PKC δ inhibitor peptide treatment results in less cell damage in cardiomyocytes subjected to simulated ischemia77 or hearts subjected to coronary artery occlusion77; while administration of ψRACK δ increases cell damage both in vivo and in vitro77,79. PKC

δ overexpression in mice displays an increase in ischemia-reperfusion-induced cell damage79.

PKC δ activation also abolishes the cardioprotection, measured by ischemic cell damage,

Regulatory Domain Catalytic Domain PKC α PKC βI V1 V2 V3 V4 V5 Classical PKC βII C1 C2 C3 C4 PKC γ

PKC µ

PKC δ

Novel PKC η PKC θ C1 C3 C4 PKC ε PKC ζ Atypical PKC λ C1 C3 C4 PKC ι PKC υ

Pseudosubstrate Lipid Ca2+ Hinge ATP Substrate site Binding binding Region Binding Interaction

C1 C2 C3 C4

Figure 3: Schematic of the PKC family. Three distinct families, including the classical PKC isoforms, the novel PKC isoforms and the atypical isoforms, have been identified. The protein structure of PKC contains a regulatory domain, which includes the calcium binding site, lipid binding and pseudosubstrate site, and a catalytic domain, which includes ATP binding and substrate interaction sites.

mediated by ethanol after I/R injury77. There is evidence, however, that PKC δ inhibition has no

affect on IPC-induced reduction in rat heart436 or completely abolishes opioid-induced

cardioprotection422, demonstrating the controversy of PKC δ in cardioprotection. The role of

PKC δ in cardioprotection may be stimulus-dependent, as cardioprotective agents such as opioid422,437, adenosine A3 receptor agonist438, sildenafil439, sevoflurane440, chronic hypoxia441,442 and estrogen443 elicit protection via PKC δ activation. The complexity of PKC isozyme activation, due to a particular stimulus, adds to the difficulty of elucidating the role of PKC in

I/R injury. Questions remain as to which PKC isozymes may be activated by which FGF2 isoform(s) during I/R injury.

Many in vivo and in vitro studies demonstrate the regulation of PKC by FGF2 isoforms86,350,444-453. FGF2 LMW isoform treatment causes an increase in PKC α, ε, and ζ

expression in cultured hippocampal neurons445. FGF2 LMW isoform-induced proliferation of

endothelial cell, prostate cancer cell, müller cells is through PKC signaling446,447,454. Skaletz-

Rorowski and colleagues448 showed that PKC δ, in particular, is involved in FGF2 LMW

isoform-triggered proliferation. FGF2 LMW isoform protects epithelial cells from apoptosis via

the PKC pathway449, possibly involving PKC ε450 and PKC δ451. In hearts, the FGF2 LMW

isoform induces a negative inotropic effect, which is mediated by PKC δ and ε86,452. In addition,

FGF2 HMW isoforms are demonstrated to modulate PKC δ, ε, and ERK1/2 activation, independent of FGFR receptor stimulation444. Nonetheless, it remains to be determined which

FGF2 isoform links with which particular signaling pathway(s) in the heart to induce

cardioprotection.

B. Mitogen activated protein kinases (MAPK)

Upon FGF2 ligand binding, another large family of protein kinases, mitogen activated

protein kinases (MAPKs), are also stimulated242. MAPKs are serine/threonine kinases that are

modulated by various stimuli (e.g., growth factor and stress)455-457 and participate in numerous

biological functions and pathophysiological conditions, including cell proliferation458-460, apoptosis461,462, cancer463, Alzheimer disease464 and ischemic heart disease465. To date, three

distinct members of the MAPK family have been identified in mammals: 1) c-Jun terminal

kinase (JNK1/2/3), 2) p38 MAPK (α, β, γ and δ), and 3) extracellular signal-regulated kinases

(ERK1/2, ERKs 3 and 4, and ERK 5)466. MAPKs are activated by MAPK kinase (MAPKKs or

MKKs), also named MAPK/extracellular signal-regulated kinase (ERK) kinases (MEKs), which

is a central component in the cascade of activating MAPKs467. These kinases recognize and

phosphorylate the Thr-X-Tyr motif in the activation loop of their downstream targets, the

MAPKs. Upstream of MEKs are the kinases that activate and phosphorylate MEKs and

MEKKs/MAPKKKs467. The various biological functions of MAPKs occur via phosphorylation

of their potential substrates (i.e., phospholipases, transcription factors, and protein kinases

[MAPK-activated protein kinases, MKs])468. The specificity and efficiency of MAPK signaling

is mostly due to its specialized docking motifs, known as L-X-X-A-A469. Studies in yeast have

demonstrated that scaffold proteins, including kinase suppressor of Ras (KSR)470 and JIP1471 are crucial components of mitogen-activated protein kinase (MAPK) signaling82 (Figure 4).

Mixed lineage kinase (MLK)

Mixed lineage kinases belong to a family of serine/threonine protein kinase that controls

the activity of MAPKs by regulating their phosphorylation state. MLKs belong to MAPK-kinase

kinases (MKKKs) and are important in JNK and p38 MAPK signaling472. Seven MLKs have

been identified and are categorized into three subfamilies: 1) the MLKs (MLK1-4), 2) the dual- leucine-zipper-bearing kinases (DLKs), and 3) zipper sterile-α-motif kianase (ZAK)472. MLKs can phosphorylate and activate MAPK kinase such as MKK4 and/or MKK7, which in turn triggers JNK signaling473,474. MLKs also regulate p38 MAPK activation via their

phosphorylation of MAPK kinase 3/6475,476 (Figure 4).

c-Jun terminal kinase (JNK)

JNK first identified as a stress-activated protein kinase can phosphorylate c-Jun at

serine/threonine sites477. Alternative gene splicing results in ten different JNK isoforms from three different genes, JNK1, 2 and 3478. JNK1 and 2 are expressed ubiquitously; while JNK3 is

predominantly expressed in the central nervous system (CNS)478. Genetic ablation of JNK1,

JNK2, or JNK3 individually does not resulted in any abnormality in development; however,

JNK1 and 2 double knockout mice die prematurely, suggesting that JNK1 and 2 together are

essential for murine development478,479. JNK is activated by its upstream kinases (MKK4 and

MKK7). MKK4 preferentially phosphorylates at tyrosine sites and MKK7 phosphorylates JNK at its threonine site. A variety of receptor-associated signaling leads to the activation of MAPK kinase kinase (MAPKKKs), which is capable of stimulating either MKK4 or MKK7480.

Study in yeast showed that scaffold proteins are crucial components of mitogen-activated

protein kinase (MAPK) pathways82. Potential scaffold proteins that might coordinate JNK

signalling include: 1) JNK-interacting protein (JIP), 2) filamin, 3) β-arrestin, 4) JNK/stress-

activated protein kinase-associated protein 1 (JSAP1) and 5) p130Cas481,482. These scaffold

proteins bind discrete members of the JNK pathway and localize them to the nucleus482. These

scaffolds provide spatial and stimulus-specific regulation of JNK function482. JIP belongs to a

group of proteins that bind JNK and other components of that pathway, including mixed lineage

kinase (MLK) and MAPK kinase 7 (MAP2K7)483. Filamin is a large protein that interacts with

and organizes actin filaments, but also binds to MAPKK kinase (MAPKKK), MAP2K4 and

JNK484. The arrestin group of adapter proteins, including β-arrestin 2, binds to G-protein coupled

receptors (GPCRs) following ligand engagement and has important functions in the termination

of heterotrimeric G protein activation by GPCRs485. Recent studies demonstrate that β-arrestin 2 binds components like including MLKs and MKK7, which are part the JNK pathway486.

The well known function of JNK is its involvement in apoptosis83,487-489: It has both pro-

and anti-apoptotic actions depending on the cell type and stimuli490-492. Deng and colleagues487 demonstrated that JNK activation causes cleavage of Bid to jBid (cleaved Bid) which subsequently translocates to mitochondria causing release of Smac487. Smac, in turn, releases the

inhibition of caspase 8, resulting in apoptosis487. JNK also regulates apoptosis by triggering pro-

apoptotic molecules, Bcl-2 and Bcl-XL, leading to cytochrome C release, activation of caspase 3

and 9 and cell death83. Also, activated JNKs transcriptionally modulate several genes by

interacting with activator protein-1 (AP-1) and other transcription factors involved in

apoptosis492. There are, as mentioned, anti-apoptotic activity of JNK. For example, JNK1 and

JNK2 double knockout embryos exhibit increased apoptosis in the forebrain during

development478,493. In addition, T cells deficient of JNK1 and 2 are more susceptible to Fas-

induced apoptosis, suggesting that JNK may play a anti-apoptotic role in this cell type494. Also in certain tumor cells, inhibition of JNK suppresses growth by promoting apoptosis495,496.

On the other hand, the contradictory role of JNK in apoptosis may also be due to its various substrates. One of the major substrates of JNK is c-Jun which belongs to the AP-1 family

of transcription factors which are comprised of Jun (c-Jun, JunB, JunD), fos, maf and ATF497. c-

Jun activity is induced by a variety of physiological stimuli and cellular stresses such as growth

factors498, cytokines499, neurotransmitters500, hormones501, bacteria and viral infections502, short wavelength UV irradiation503, alkylating agents and several other physical and chemical

stresses497. c-Jun positively regulates cell proliferation since c-Jun deficient fibroblasts exhibit a

marked proliferation defect in vitro504,505. c-Jun can increase the expression of cyclin D1, a

positive regulator of cell cycle progression, or downregulate the f negative regulators, p53 and

cyclin dependent kinase inhibitor INK4A505,506. c-Jun has both pro- and anti-apoptotic

properties507-513 and the exact outcome is highly tissue dependent507-513. Several pieces of

evidence implicate a pro-apoptotic role of c-Jun507-511. The onset of apoptosis in cells exposed to

stress, such as alkylating agent or short wavelength UV radiation, is preceded by c-Jun

induction507-509. Transient overexpression of c-Jun induces apoptosis in various cell lines510,511. In

vivo studies demonstrated that inhibition of c-Jun activity through the expression of a dominant

negative c-Jun mutant or injection of neutralizing antibodies, can protect neuronal cells from apoptosis induced by nerve growth factor (NGF) or chronic depolarization511,514-516. The antiapoptotic properties of c-Jun is illustrated by hepatocytes derived from c-jun null embryos, which undergo massive apoptosis512,513. Increased spontaneous apoptosis is also exhibited by the

c-jun null fibroblasts that are resistant to UV-induced apoptosis517. Furthermore, re-introduction

of c-Jun reduces this spontaneous apoptosis, but simultaneously enhances UV-induced

apoptosis517. Other studies also suggest that c-Jun protects fibroblast505 and melanoma-derived cell lines518 against UV-induced cell death possible via co-operation with STAT3 to suppress

518 519-521 transcription of Fas . c-Jun regulates several proinflammatory genes . MIP-2 (macrophage

inflammatory protein-2)519 and the TNFα promoter activity520 is regulated by c-Jun upon LPS

stimulation. However, c-Jun also can regulate the anti-inflammatory cytokine, IL-10, in Th2 cells

in response to PMA/ionomycin521.

The controversial role of c-Jun in apoptosis may contribute to the differential actions of

JNK in cell death following I/R injury, and thus adding to the confusion of the role of JNK in I/R injury. JNK is activated in vitro in cardiomyocytes subjected to simulated ischemia522, in ex vivo

perfused ischemic rat and rabbit hearts328,523, and in animal models of ischemia-reperfusion

injury524,525. An increase in JNK activation is observed after reperfusion in human hearts that

underwent cardiopulmonary bypass sugery526 and also in patients that had heart failure secondary to ischemic heart disease527. Inhibition of JNK activation significantly decreases apoptosis in

simulated ischemic myocytes523,528 and decreases infarct size with no effect on hemodynamic

performance in ischemic rat heart529. Inhibition of JNK pathway by AS601245 also decreases apoptosis and infarct after I/R injury in rat cardiomyocytes529 and neurons530. The cardioprotective effect upon inhibition of JNK involves the inactivation of Bcl-2 529 and increase

in phosphorylation of Bax531. On the other hand, there is also evidence that inhibition of JNK

does not lead to cardioprotection, but instead, inhibiting JNK pathway results in a decrease in

activation of Akt signaling, an important survival pathway529. More evidence related to the

protective effect of JNK in cardiomyocytes, indicates that JNK is necessary for reactivation of

Akt after ischemic injury532 and inhibition of JNK aggravates I/R injury in cardiomyocytes532 and liver533. Therefore, care must be taken when investigating the therapeutic use of JNK inhibitors in I/R injury.

In mammalian genomes, three genes (Jnk1, Jnk2 and Jnk3) encode a JNK family of protein kinases534, further complicating the identification and interpretation of the biological

functions of the JNK pathway in I/R injury. Sequence alignment of these different products

shows homologies of >80%535. Such high similarity suggests that all JNK proteins perform

similar roles, with an equivalent ability to bind to various upstream activators and downstream

substrates. JNK1 and JNK2 proteins are widely expressed, whereas JNK3 expression is largely

535 restricted to the brain . Jnk1-/- or Jnk2-/- mice subjected to cardiac I/R injury show significant

cardioprotection judged by myocardial infarct size and apoptosis531, suggesting that JNK inhibition, irrespective of the JNK isoform, leads to cardioprotection following I/R injury. The

JNK inhibitor AS601245, inhibits JNK1, JNK2 and JNK3 in an ATP-competitive manner with

IC50 values of 150, 220 and 70 nM, respectively536. Our lab305 and other investigator537 indicated

that CEP11004 inhibits MLK activity, an upstream kinase in the JNK pathway, resulting in

inhibition of both JNK1 and 2 in the hearts. The following studies will utilize CEP11004 and study the role of both JNK1 and 2 in FGF2 LMW isoform-mediated cardioprotection.

p38 MAPK

To date, there are four subtypes of p38 MAPK identified: 1) α538, 2) β539, 3) γ540 and 4)

δ540. The p38 isoforms share more than 60% sequence identity amongst each other, but only 40-

45% to the other MAPK family members541. p38 α and β are ubiquitously expressed; p38 γ is

mainly expressed in skeletal muscle540 and p38 δ is predominantly expressed during

development and also is detected in adult lung, kidney, endocrine organs and small intestine539. p38 MAPK isoforms are phosphorylated by MKK3 and MKK6542, which in turn, are activated

by MKKK1-4, mixed lineage kinases (MLK), apoptosis signal-regulating kinase-1 (ASK1),

TPL2/Cot, TAK, and dual leucine zipper-bearing kinase (DLK)543 (Figure 4). Individual p38

MAPK isoforms are selectively activated by MKKs, such that MKK3 preferably phosphorylates

p38 MAPK α and β, while MKK6 phosphorylates all p38 MAPK isoforms to regulate unique

functions in vivo544. p38 MAPKs are present in both the nucleus and cytoplasm of the cell545 and

can translocate from cytoplasm to nucleus under stress conditions546. Additionally, different p38

MAPK isoforms are found in different subcellular compartments in mouse brain, suggesting the

possibility of unique biological functions of the different isoforms547.

Substrates of p38 MAPK vary from cytosolic proteins like Na+/H+ exchanger 1548 and phospholipase A2 (PLA2)549, to transcription factors such as myocyte enhancer factor 2C

(MEF2C)550, NF-κB551, ATF1/2552, heat shock transcription factor-1 (HSF-1)553 and p53554, as

well as protein kinases, including in MNK1555, MSK1556,557 and p38 regulated/activated kinase

(PRAK)558. Many of these factors are involved in cell death or survival funcitons559-561. Due to

the great diversity of substrates activated by p38 signaling, p38 can also function in cell cycle regulation, differentiation, inflammation and tumor development and pregression541,562.

Overwhelming evidence indicates that the p38 pathway is involved in apoptosis563-566.

The reported functions of p38 in apoptosis, similar to that of JNK, are diverse and complicated.

The p38 pathway can promote or inhibit the apoptotic process. p38 MAPK is activated by

563 various stimuli, including β-adrenergic receptors (β-AR) through Gβγ and Gαq/11 , growth

factors564, and stress565. p38-deficient cardiomyocytes are more resistant to serum deprivation and UV-induced apoptosis than the wild type cohorts566. Marber and colleagues567 showed that

the dominant-negative form of p38 MAPK, which has a inactive phosphorylation activity, has a decreased cell injury following simulated ischemia. All the above data suggest a pro-apoptotic role of p38, but the p38 pathway has also been shown to inhibit apoptosis562,568. For example, in

adult ventricular cardiomyocytes, p38 MAPK inhibits the β-AR stimulated apoptosis by

568 affecting Gi activity . The anti-apoptotic effect of p38 MAPK is also mediated via reducing

expression of proapoptotic protein Bax and apoptosis-inducing receptor 1(ASK1)569,570.

p38 MAPK can be activated by various extracellular stimuli including oxidative stress571,

UV irradiation572, hypoxia573, ischemia-reperfusion injury in heart328. p38 MAPK can activated

after 10 minutes of ischemia and rapidly return to basal level after 15 minutes328 to 45 minutes

of ischemia328,574,575. Inhibition of p38 MAPK by SB203580 prior to the sustained period of

ischemia blocks the protective effect of ischemic preconditioning (IPC), reflected by an

increased myocardial infarction after IPC576-578. These data indicate that inhibiting p38 MAPK

activation is detrimental during I/R injury. This controversy of whether p38 MAPK activation is cardioprotective or cardiotoxic may depend on the preconditioning protocol or whether p38

MAPK activation persists during ischemia567,579-581. Several groups report that preconditioned,

isolated, perfused hearts have less p38 activation during the sustained period of ischemia

compared to non-preconditioned myocardium and inhibition of p38 MAPK during sustained

ischemia is protective582,583. Another possible explanation is that since there are multiple p38

isoforms (α538, β539, γ540 and δ540) and in the heart p38 α and β has been detected541, these two isoforms may carry out different, possibly opposite, biological functions during I/R injury.

During I/R injury, p38 MAPK α is activated during early ischemia and early reperfusion581 and p38 MAPK β is inactivated in early ischemia567, indicating that p38 MAPK α may be an initiator

while p38 MAPK β may be an effector. Genetic disruption of p38 MAPK α leads to a tolerance

of the heart to an I/R insult suggesting that p38 MAPK α activation promotes cell apoptosis567.

Extracellular signal-regulated kinase (ERK1/2)

Extracellular signal-regulated kinase 1 and 2 (44 and 42 kD) are 83% identical to each

other and are ubiquitously expressed584. ERK has two domains: a kinase domain that has two

phosphorylation sites in the activation loop and a SH domain468. The primary extracellular

signals activating the ERK cascade are growth factors and other mitogens, which activate Ras-

ERK via receptor tyrosine kinases or G protein-coupled receptors on the cell membrane585,586.

The activated Ras relays the signal and activates the Raf family of proteins (Raf-1, A-Raf, B-

Raf), the MKKKs of this signaling cascade, that in turn phosphorylate and activate MEK1 and

MEK2, the specific MKKs of this pathway587,588 (Figure 4). The activated ERKs (phosphorylated

by MEK1/2) then translocate to the nucleus, where ERKs phosphorylate multiple substrates,

such as c-Myc, Elk-1, Ets-2, 90 kD ribosomal S6 protein kinase (p90RSK) and possibly, STAT proteins489,589,590.

Generally, the ERK pathway functions in cell proliferation, migration, survival,

differentiation, and actin cytoskeleton reorganization, depending on the cell types591-593. ERK1 and 2 are highly expressed in the heart and brain594. ERK1/2 is activated by various stimuli in the heart, including cardiac hypertophy595 and oxidative stress596, and is also involved in alterating

intracellular calcium levels597 or nitric oxide-induced apoptosis598. The major role of ERK1/2 in

I/R injury is its cell survival function591-593. ERK 1/2 is rapidly activated in simulated ischemic

cardio myocytes599, ex vivo perfused hearts600,601, in vivo models of I/R injury602-604, and in cardiopulmonary bypass patients526. ERK1/2 activation reaches a maximum level at 10 minutes

ischemia and then quickly returns to a basal level in cardiomyocytes subjected to simulated

ischemia599,605. During reoxygenation, ERK1/2 is reactivated at 10 minutes605. A similar pattern

is also observed in the ischemic-reperfused rat heart605. Some studies however, indicate no

ERK1/2 activation during I/R injury328,606, and this may be due to the particular I/R injury model

or the time point measured. Blockade of the upstream kinase MEK1 leads to an inhibition of

ERK activation, resulting in an increase in myocardial infarction607 or I/R-induced myocardial

apoptosis599, with no effect on cardiac function472. The mechanism of ERK1/2-mediated

Taken from Cell Signal Inc, http://www.cellsignal.com/pathways/map-kinase.jsp

Figure 4: Schematic of MAPK signaling pathway. MAPK signaling consists of three major subgroups, ERK, JNK, and p38 MAPKs, which are activated via phosphorylation of their specific MAPKKs. MAPKKs are also activated through phosphorylation of their specific MAPKKKs in response to stimulation by growth factors, cytokines and stresses. Activated MAPKs phosphorylate various substrates including transcription factors (Elk-1, Sap1, c-Jun, and MEF2C), protein kinases (p90 ribosomal S6 kinase [p90RSK]), MAPKAPK2/3, and serum- and glucocorticoid-inducible kinase (SGK), and cytoskeletal proteins (Tau and Stathmin), which are critical for proper cellular responses induced by extracellular stimuli.

cardioprotection includes activating hypoxia-induced factor 1 (HIF1)608, reducing gap junction

formation609, decreasing GSK-3β inactivation resulting in a decrease in mitochondrial

permeability transition pore opening610 and activating transcription factors such as NF-κB611 and

AP-1611. These observations indicate that the ERK pathway is protective against cell death

caused by I/R injury. ERK activation has also been implicated in mediating opioid-induced cardioprotection578 and the early and late phase of ischemic preconditioning607,612.

Much evidence links FGF2 LMW isoform treatment with the activation of MAPK

pathways in many tissue and cell types343,608,613-616. For example, ERK 1 and 2 are activated by

FGF2 LMW isoform in fibroblasts613, tumor614 and in lens cells615 to modulate cell proliferation

and apoptosis. Also p38 MAPK activation can be triggered by FGF2 LMW isoform in smooth muscle cell and cardiomyocytes343,617. Mice overexpressing or treated with FGF2 LMW isoform

have an increased activation in JNK, p38 MAPK and/or ERK343,616. In addition, FGF2 HMW isoforms can modulate ERK1/2 activation, independent of receptor stimulation444. The human

FGF2 HMW 24 kD isoform can regulate fibroblast proliferation through c-Jun, a important

downstream substrate of JNK618. Even though, FGF2 LMW and HMW isoforms can activate

MAPK under different circumstances, no direct evidence has been provide to link MAPK

activity as a mechanism of FGF2 isoform-mediated cardioprotection. Therefore, elucidating the

effect of FGF2 isoforms on MAPK activation will be of great importance in understanding the

role(s) of the FGF2 isoforms in I/R injury. This dissertation will focus on the regulation of FGF2

isoforms on MAPK signaling by utilizing specific FGF2 isoform ablated or overexpressed mouse

models and pharmacological agents to provide new evidence in the relationship between FGF2

isoforms and MAPK signaling pathway.

C. PI-3 kinase (PI3K) and Akt

The PI3K pathway regulates various cellular processes, such as promoting cell

proliferation, sustaining cell growth, and inhibiting cell apoptosis619. The function of PI3K is mainly mediated through PDK-1/Akt619.

Akt (also known as Protein kinase B) is a serine/threonine kinase with homology to both

protein kinase C (PKC) and cyclic-AMP-dependent protein kinase A (PKA)620,621. Akt is a core

component of the phosphoinositide 3-kinase (PI3K) signaling pathway619. Akt is composed of an

amino-terminal pleckstrin homology (PH) domain that binds phospholipids622, a kinase domain, and a proline-rich carboxyl-terminal regulatory domain.

In response to growth factors, such as FGF2, PI3K is recruited to the inner surface of the plasma membrane resulting in the generation of the membrane-bound lipid phosphatidylinositol

3,4,5-triphosphate (PIP3). Following binding of PIP3 to the PH domain, Akt is translocated from the cytoplasm to the inner surface of the plasma membrane623. This results in conformational

changes rendering Akt accessible to phosphorylation at two amino acid residues, threonine-308

(Thr-308), which lies within the Akt kinase domain, and serine-473 (Ser-473), which is located within the Akt regulatory domain624.

Akt acts primarily as a survival factor, resulting in protection of cells against

programmed cell death, apoptosis625-627. Akt may also promote cell survival by phosphorylating

and inactivating Caspase 9, the effector of apoptosis628. Akt not only elicits survival by

inactivating pro-apoptotic proteins, but also by inducing transcription of genes that promote

survival629. Activated Akt initiates degradation of the inhibitor of nuclear factor-kappa B beta

(IκB-β) by directly phosphorylating and activating IκB kinase (IKK)630. Degradation of Iκ B

frees NF-κB to translocate to the nucleus and initiate transcription of pro-survival genes,

including the Bcl-2 family member Bfl-1/A1631 and the caspase inhibitors c-IAP1 and c-IAP2632.

Akt also regulates p38 MAPK and JNK pathways by phosphorylation and inhibiting their upstream kinase, apoptosis signal regulating kinase 1 (ASK1)633.

Akt activation and phosphorylation are associated with I/R injury and ischemic

preconditioning634. Ischemic preconditioning can activate PI3K and Akt, and wortmannin and

LY294002, PI3K inhibitors, abolishes this cardioprotective effect of ischemic preconditioning577.

Furthermore, nuclear targeting of Akt can protect cardiomyocytes from apoptosis635. Mice

overexpressing Akt were protected from ischemia-reperfusion injury635. Akt phosphorylation can

be blocked by the Src inhibitor, indicating possible involvement of receptor tyrosine kinase636.

Activation of receptor tyrosine kinase by VEGF637, FGF2638,639, insulin640 can activate PI3K/Akt

pathway.

In vitro, FGF2 LMW isoform activates the PI3K/Akt pathway to modulate cell

proliferation638, differentiation639, and apoptosis638,641. The anti-apoptotic effect of FGF2 LMW

isoform may be due to the activation of Akt and in turn, the activated Akt stimulates the

phosphorylation of Bad, resulting in an inhibition of caspase 3 and decrease in cell death639. To

date, no in vivo evidence has been provided into the relationship between PI3K/Akt and the

FGF2 LMW isoform. Furthermore, the role of FGF2 HMW isoforms in activating the PI3K/Akt

is completely unknown. Due to the cardioprotective nature of Akt, it will be important to

understand whether FGF2 LMW and HMW isoforms modulates its activity in vivo, as this would

provide novel evidence to the role of FGF2 isoforms in I/R injury.

4. Cell death and ischemia-reperfusion injury (I/R)

Myocardial I/R injury is associated with cell death due to apoptosis and/or oncosis followed by necrosis5,41,642,643. Apoptosis is an ATP-dependent programmed cell death process,

in which an intricate signaling cascade is activated in response to a number of mediators,

including calcium and pro-oxidants644-647. This process is highly conserved from C. elegans to

humans648. Apoptosis is distinct from oncosis, which is characterized by the loss of membrane integrity and cell homeostasis, rather than a planned series of morphological and molecular events648. Majno and Joris649 suggested that “apoptosis leads to necrosis and cell shrinkage

“whereas “oncosis leads to necrosis with karyolysis”.

A. Apoptosis

Apoptosis is classified into two pathways: the extrinsic and intrinsic cascades, which are

distinguished by their differential modes of initiation650-654; both pathways necessitate the

processing of pro-caspases to their active tetramers for further activation of additional factors651,652,654. The intrinsic pathway begins when an injury occurs within the cell upon growth

factor withdrawal, DNA damage, unfolding stresses655. Once the stress signal is triggered, Bax

and Bid, the pro-apoptotic proteins in the cytoplasm, bind to the outer membrane of the

mitochondria to initiate the release of its internal content656. Bak, another pro-apoptotic protein

within the mitochondria, is also activated to promote the release of cytochrome C656. The

released cytochrome C forms an apoptosome complex with ATP, apoptosis protease activating

factor (Apaf-1), and activated caspase-9, an initiator protein656. This apoptosome activates

caspase 3, the effector protein that initiates degradation656. The extrinsic pathway, also known as

the death receptor mediated pathway, is the cascade in which transmembrane death receptors

such as Fas receptor (FasL)657 and TNF receptor658 are activated on the plasma membrane of the

target cell to induce apoptosis. The activation of a death receptor recruits an adaptor protein on

the cytoplasmic side of the receptor; in turn, recruiting caspase-8, an initiator protein, to form the death-inducing signal complex (DISC)656. Through the recruitment of caspase-8 to DISC,

caspase-8 becomes activated and is able to directly stimulate caspase 3, an effector protein, to initiate degradation of the cell655. Active caspase-8 can also cleave BID protein to tBID, which

acts as a signal on the membrane of mitochondria to facilitate the release of cytochrome C in the intrinsic pathway655.

An apoptotic cell is morphologically characterized by the condensation of the nucleus, a

decrease in cell size, and plasma membrane blebbing659,660. Molecularly, there are a number of

features often associated with apoptosis and include early phase markers, such as activation of a

family of cysteine proteases, known as caspase, exposure of phosphatidyl serine to the

extracellular space and cytochrome C release from the mitochondrial and late phase markers, like

mitochondrial dysfunction and inter-nucleosomal laddering of DNA in between nucleosomes661.

B. Oncosis

Oncosis refers to acute or accidental cell death associated with cell swelling648. It is characterized by death of a cluster cell. In this common reaction, the earliest changes involve cytoplasmic blebbing, loss of membrane integrity, increased membrane permeability, failure of the ionic pumps of the plasma membrane, dilatation of the endoplasmic reticulum (ER), swelling of the cytosol, normal or condensed mitochondria, and chromatin clumping in the nucleus662.

Ionic homeostasis is modified with a progressive change in membrane permeability to both mono- and divalent cations and a failure of regulation mechanisms663. The increase in Na+

concentration will lead to swelling of the cell without presenting degradation and fragmentation

of the chromatin663.

C. Cell death in cardiac ischemia-reperfusion injury

Apoptosis was first described in cardiac ischemia-reperfusion injury in 1994664. Since then, this form of cell death has been detected in other cardiac pathologies, including heart failure665, arrhythmogenic right ventricular dysplasia666 and cardiac hyptertrophy667. Apoptosis, as measured by DNA fragmentation and the appearance of TUNEL positive cells, also has been observed in vivo and ex vivo myocardial I/R642,643,664,668-670. Ischemia-reperfusion injury elicits

mitochondrial alterations in function and morphology, including the opening of mitochondrial

permeability transition pore, depolarization of the mitochondrial membrane, swelling of mitochondria, release of cytochrome C from mitochondria, all events which lead to activation of

caspase-dependent apoptosis671. Additionally, the production of neutrophils and reactive oxygen

species can also activate the pro-apoptotic cascade645,672-676. Kajstura and colleagues677 showed

that apoptosis and oncosis contribute independently to the development of myocardial infarction ,

where apoptosis was important and predominant in early (two hours) cell death and oncotic cell

death occurred in one and two days, leading to a more progressive cell death. In addition,

ischemia-reperfusion causes a dramatic ATP depletion which results in a switch from apoptotic

to oncotic cell death678. Severe ATP depletion will cause plasma membrane breakdown, resulting in oncosis679. Jaeschke and LeMasters680 proposed that I/R leads to caspase-dependent apoptosis

and ATP depletion-dependent oncosis.

D. FGF2 and apoptotic cell death

FGF2 has been reported to be involved in pro-apoptotic and anti-apoptotic effects614,679.

Evidence indicates that pretreatment with FGF2 LMW isoform inhibits TNF-α-mediated apoptosis614 through activation of MAPK pathways681. Caspase 3 has been implicated in FGF2

LMW isoform-mediated anti-apoptotic actions in rat embryonic cells682. However, there is

evidence that the FGF2 LMW isoform can also induce apoptosis679. FGF2 HMW isoforms are

reported to facilitate rat bladder carcinoma cell survival in vitro683. Therefore, elucidating the

role of FGF2 isoforms in apoptosis induced by I/R injury is of great importance in understanding

the mechanism of FGF2’s cardioprotective effect.

5. Dissertation focus and hypothesis

The underlying hypothesis of this dissertation is that the FGF2 LMW isoform and FGF2

HMW isoforms have distinct roles in the heart, influencing the functional and cellular outcomes

following I/R injury. The FGF2 LMW isoform, most likely, will be beneficial in cardioprotection,

while the FGF2 HMW isoforms will have a deleterious role in cardioprotection. Moreover, the

cardioprotective or cardiotoxic phenotypes of LMW and HMW isoforms will be due to the

activation of different signaling pathways involved in cell death or survival. To test the

hypothesis, this dissertation has utilized genetically modified mouse models that contain a

deficiency of a specific FGF2 isoform(s) or ubiquitous overexpression of the human FGF2

HMW 24 kD isoform to evaluate the role of the individual FGF2 isoforms in ischemia-

reperfusion injury. Signaling pathways that have been implicated to be involved in I/R injury or

FGF2 signaling, including MAPK, PKC and FGFR, will be analyzed to elucidate the

A. B.

Non-cardiomyocyte Myocardial ischemia-reperfusion injury ischemia-reperfusion injury (e.g, Hepatocyte)

Apoptosis Oncosis (Cell shrinkage) (Cell swelling)

? Cardiomyocyte Cardiomyocyte Apoptotic body Necrosis oncosis apoptosis formation: phagocytosis •Coagulation by macrophages & neighbor cells •Shrinkage or •Karyolysis “Secondary necrosis” •Phagocytosis •Apoptotic body •Inflammation breakdown •Aborted apoptosis and Cardiomyocyte necrosis inflammation

Figure 5: Schematic depicting apoptosis and oncosis in ischemia-reperfusion injury. A. 649 684 Concepts extracted from Majno and Joris , Jaeschke and LeMasters and others in hepatocytes. In hepatocytes, oncosis and apoptosis are two different pathways of early cell death leading to necrosis after I/R. Apoptosis may be aborted under certain conditions and result in the release of pro-inflammatory cytokines, thereby leading to secondary necrosis with inflammation. Oncosis progresses to full blown coagulation necrosis within 24 hours. B. In cardiomyocytes, cell death involves apoptosis and/or oncosis, eventually resulting in necrosis. There may also be some non-apoptotic cell death that may lead to eventual necrosis. Concept based on collective evidence in cardiomyocytes from Ohno and colleagues677 and Reimer and 660 Jennings . ? = not proven. Adapted from Jugdutt and Idikio Mol Cell Biochemistry 2005.

mechanism(s) involved in either LMW isoform or HMW isoforms induced cardioprotection or cardiotoxicity. The following hypotheses will be evaluated:

Hypothesis 1: The LMW and HMW isoforms have distinct roles in ischemia-reperfusion injury

FGF2 can protect the myocardium from ischemia-reperfusion injury65,86,89,207,341-343. To elucidate the role of endogenous murine FGF2 LMW and FGF2 HMW isoforms and the human

FGF2 HMW 24 kD isoform in ischemia-reperfusion injury, wildtype mice, mice with a targeted ablation of the Fgf2 gene (Fgf2 KO), mice with specific ablation of the LMW isoform (FGF2

LMWKO), mice with a deficiency of the HMW isoforms (FGF2 HMWKO), non-transgenic mice, and two independently-derived lines of mice with ubiquitous overexpression of the human

FGF2 HMW 24 kD isoform will be subjected to an isolated work-performing heart model of global, low-flow ischemia. An irreversible I/R model (60 minutes ischemia, 120 minutes reperfusion) which leads to functional deterioration and myocardial infarction will be used. The endpoints used to determine cardioprotection will be post-ischemic recovery of cardiac function and myocardial cell injury (myocardial infarct size and creatine kinase release). Vessel density will also be determined in these mice to determine whether differences observed in ischemia- reperfusion injury and cardioprotection are due to alterations in vasculogenesis and angiogenesis.

To evaluate the role of FGF LMW isoforms as direct or indirect transcription factors in regulating gene expression, gene microarray studies will be performed on non-ischemic Wt, Fgf2

KO and FGF LMWKO and on Wt, Fgf2 KO and FGF2 LMWKO hearts subjected to ischemia- reperfusion injury. Furthermore, studies will be initiated in non-ischemic Wt, Fgf2 KO, FGF2

LMWKO, to determine whether the FGF2 isoforms can act as co-factors to regulate

transcriptional factors such as NF-κB, to influence the ischemic-reperfusion injury outcome.

Hypothesis 2: The LMW and HMW isoforms do not share the same signaling pathway(s)

to elicit their actions in ischemia-reperfusion injury

Extracellular LMW and HMW FGF2 isoforms either externally or intracellularly interact

with its cell surface receptor (FGFR) and activate PKC, MAPK, PI3K and apoptosis pathway209.

Molecular analysis will be performed to determine whether ablation or overexpression of specific FGF2 isoform will alter the activity of known signaling pathways involved in ischemia- reperfusion. The expression levels and activation (phosphorylation and/or translocation) of ERK, p38 MAPK, JNK, MKK4, MKK7, PKC alpha, PKC delta, PKC epsilon, PKC zeta, Akt and calcium handling proteins (including phospholamban and calsequestrin) will be assessed in non- ischemic wildtype (Wt), Fgf2 KO, FGF2 LMWKO, FGF2 HMWKO and human FGF2 HMW 24 kD Tg hearts. In addition, the effect that ablation (or overexpression) or a specific FGF2 isoforms has on apoptotic signaling will be measured in non-ischemic Wt, Fgf2 KO and FGF2

LMWKO hearts. Also, during ischemia-reperfusion, the pattern of activation of MKK4, MKK7 and JNK will be also determined.

To elucidate the involvement of MAPKs and FGFR in FGF2 LMWKO and FGF2

HMWKO hearts after ischemia-reperfusion, selective pharmacological inhibitors for JNK, ERK, p38 MAPK and FGFR and an agonist for p38 MAPK will be administrated to the hearts subjected to global, low-flow ischemia. Recovery of post-ischemic cardiac function and myocardial cell injury, represented by myocardial infarct size and creatine kinase release, will be determined. Furthermore, MAPK activation as well as c-Jun and apoptotic endpoints (TUNEL,

cytochrome C release and caspase 3 activation) will be measured in hearts subjected to I/R injury

to identify the potential mechanism involved.

To evaluate the role of FGF HMW isoforms as direct or indirect transcription factors in

regulating gene expression, gene microarray studies will be performed on non-ischemic Wt, Fgf2

KO and FGF LMWKO and on Wt, Fgf2 KO and FGF2 LMWKO hearts subjected to ischemia- reperfusion injury. Furthermore, studies will be initiated in non-ischemic Wt, Fgf2 KO, FGF2

LMWKO, non-transgenic and human FGF2 HMW 24 kD Tg hearts to determine whether the

FGF2 isoforms can act as co-factors to regulate transcriptional factors such as NF-κB, to

influence the ischemic-reperfusion injury outcome.

This dissertation aims to provide novel evidence of the role of the specific FGF2 isoforms

in ischemia-reperfusion injury and cardioprotection and the potential signaling molecules

involved in the cardioprotective or cardiotoxic phenotype. These findings may lead to the

development of novel therapeutics for patients suffering from ischemic heart disease.

Material and Methods

Animal exclusion criteria

Mice were housed in a pathogen-free facility and handled in accordance with standard

use protocols, animal welfare regulations, and the NIH Guide for the Care and Use of

Laboratory Animals. All protocols were approved by the University of Cincinnati Institutional

Animal Care and Use Committee. Wildtype (Wt), Fgf2 knockout (all isoforms absent, KO),

FGF2 LMWKO (LMW isoform absent), FGF2 HMWKO (HMW isoforms absent), FGF2

EXON3 knockout (deficient of EXON3), non-transgenic (NTg) mice and two lines (24IP20 and

24IP28) of mice overexpressing the human HMW 24 kD isoform (24 kD HMW Tg) were randomly assigned to a series of studies (Table 3). Wildtype, Fgf2 KO, FGF2 LMWKO, FGF2

HMWKO and FGF2 EXON3 KO mice were bred on a Black Swiss (50%)/129 (50%) background. Non-transgenic and human FGF2 HMW 24 kD Tg mice were bred on a FVB/N background. Exclusion from the ischemia-reperfusion study was based on the signs of aortic or pulmonary vein leak in the working heart preparation. Aortic leak was represented as an aortic pressure <60 mmHg on Langendorff, retrograde perfusion mode. Pulmonary vein leak was demonstrated as an aortic flow <2.0 mL/min, low (<4 mmHg) atrial pressure, and a blood gas pO2 >380 mmHg or a visible leak (i.e., hole in ventricle or atrium) in the heart. A total of 27

mice were excluded from the approximately 180 ischemia-reperfusion injury studies.

Table 3. Experiments and numbers of animals for dissertation research Wt Fgf2 KO FGF2 FGF2 NTg 24IP20 24IP28 EXON3 LMWKO HMWKO KO I/R injury 19 6 14 7 7 5 6 5 (60’I/120’R) Regional in 4 4 4 - - - - - vivo I/R (45’I/24 h R) Vascular 4 4 4 4 4 4 4 - staining Western blot 6 6 6 4 4 4 4 3 TUNEL 4 4 4 - - - - - staining Microarray 4 4 4 - - - - - RT-PCR 6 6 6 - - - - - EMSA 3 3 3 - 3 3 3 - Time course 10 10 10 - - - - - JNK 54 43 48 - - - - - inhibitor MEK1 5 5 6 - - - - - inhibitor p38 MAPK 6 6 5 - - - - - inhibitor p38 MAPK 5 4 5 - - - - - activator FGFR 8 - - 8 - - - - inhibitor -: No mice were assigned to that particular study I/R injury: Mice subjected to global, low-flow 60 minutes ischemia and 120 minutes reperfusion Regional in vivo I/R: Mice subjected to 45 minutes left anterior descending occlusion and 24 h reperfusion Vascular staining: Mice subjected to immunohistochemical staining for detection of smooth muscle-containing blood vessels and capillaries Western blot: Mice subjected to Western immunoblotting TUNEL staining: Mice subjected to TUNEL staining Microarray: Mice subjected to gene microarray study RT-PCR: Mice subjected to real-time PCR study EMSA: Mice subjected to electrophoretic mobility shift assay Time course: Mice subjected to time course to evaluate protein kinase activity JNK inhibitor: Mice subjected to JNK pathway inhibitor, CEP11004 MEK1 inhibitor: Mice subjected to MEK1/ERK inhibitor, U0126 p38 MAPK inhibitor: Mice subjected to p38 MAPK inhibitor, SB203580 p38 MAPK activator: Mice subjected to p38 MAPK activator, anisomycin FGFR inhibitor: Mice subjected to FGFR inhibitor, PD173074

Homologous recombination in ES cells

ES cells were electroporated with the targeting vector at a final concentration of 5 nM685.

Briefly, ES cell were maintained for 2-3 days in medium containing 1X HAT (10-4 M

Hypoxanthine, 4x10-7 M Aminopterin, 1.6x10-5 M Thymidine). Twenty-four hours before

electroporation, medium was changed to the complete ES cell medium containing HT (1x10-4 M

Hypoxanthine, 1.6x10-5 M Thymidine). ES cells were electroporated, plated, and cultured in

complete ES cell medium, containing 1X HT medium followed by a change to ES cell medium

containing 1X 6-TG (6-Thioguanine, 3x10-5M). Targeted vector with Hprt minigene (Fgf2 KO

vector) survived under HAT solution selection and targeted vector without Hprt minigene (FGF2

LMWKO and FGF2 HMWKO vector) survived under 6-TG solution selection. Gancyclovir (2

µM) was added to the culture 48 hours after electroporation for 3-5 days to select for the loss of

the thymidine kinase (TK) gene. Double resistant colonies were double-genotyped by

polymerase chain reaction (PCR) and confirmed by Southern blot analysis.

Generation of Fgf2 knockout mice

Fgf2 null mice (Fgf2 KO, -/-) were generated by Ming Zhou in the laboratory of Dr.

Thomas Doetschman335 (see Figure 6A). The 0.5 kb Nar I/Xba I fragment in the Fgf2 genome

was replaced by a 3.2 kb hypoxanthine phosphoribosyl transferase (Hprt) minigene686 to eliminate a portion of the promoter region and the first exon of the Fgf2 gene. A thymidine kinase gene inserted at the 3’ end was used as a negative marker687. The construct was linearized

at a Not I site and then electroporated into ES cells (tagged ES cell)685. Targeted ES cells were

microinjected into C57BL/6 strain blastocytes and were transferred to pseudopregnant foster

mothers. The chimeric mice, designated by agouti coat color, were bred to Black Swiss mice for

germline transmission. The offspring of these crosses and later crosses between heterozygotes

were genotyped by PCR for Wt (+/+), heterozygotes (+/-) and homozygotes (-/-) pups.

Fresh or frozen tail clips (0.3 cm) from newborn pups were digested with 300 µL tail digestion buffer (100 mM NaCl, 10 mM Tris-Cl pH 8.0, 25 mM EDTA and 0.5% SDS) and 5 µL proteinase K solution (Roche, Indianapolis IN) at 56ºC overnight. To precipitate DNA, equal volume of isopropanol was added to the digested tail solution; tubes were inverted 50 times and then centrifuged at 13,000 rpm for 3 minutes. The DNA pellets were washed with 70% ethanol to remove excess salt in the buffer and then centrifuged at 130,000 rpm for 1 minute. The pellets were air dried for 15 minutes and dissolved in 50 µL 1X TE buffer (10 mM Tris-Cl, pH 7.5, 1 mM EDTA). Dissolved DNA was diluted 1:10 in DEPC-treated water. Two PCR reactions were performed to detect the Wt allele and the mutant allele. One microliter of diluted DNA along with 19 µL PCR master mixture [10.9 µL H2O, 4 µL 5X Cresol Red, 2 µL PCR buffer (1.5 mM

Mg, Roche, Indianapolis IN), 1 µL 2.5 mM dNTP (Roche, Indianapolis IN) and 0.5 µL each for

5’ and 3’ primer sets (10 mM) and 0.1 µL Taq DNA polymerase (5 units/µL, Roche, Indianapolis

IN)] were subjected to PCR reaction. The primers for wildtype allele and targeted allele are

shown in Table 4. The PCR protocol used for Wt and Fgf2 KO genotyping was: initial

denaturing step, 1 cycle (94°C for 5 minutes), 35 cycles of denaturing (95°C for 30 seconds),

annealing (58 °C for 50 seconds) and extension (72°C for 90 seconds), followed by 1 cycle of

denaturing (95°C for 30 seconds), annealing (58°C for 50 seconds) and extension (72°C for 10

minutes). The PCR products were loaded onto a 1% agarose gel containing 0.01% ethidium

bromide (Bio-Rad, Hercules CA) and run at 130 V for 40 minutes. The gel was visualized under

UV light with a Fluorchem 8800 gel imager (Alpha Innotech, San Leandro CA). The PCR

products were 185 bp for the wildtype allele and 1299 bp for the targeted allele (Figure 6 B)

Table 4: List of sense and antisense primer for genotyping Wt, Fgf2 KO, FGF2 LMWKO,

FGF2 HMWKO, FGF2 EXON3 KO, NTg and human FGF2 24 kD HMW overexpressing

(Tg) mice.

Primer sets

Sense primer 5’- CGA GAA GAG CGA CCC ACA C-3’ MFGFU10 Wt allele Antisense primer 5’- CCA GTT CGG GGA CCC TAT T-3’ Fgf2 KO MFGFD10 Sense primer 5’- AGG AGG CAA GTG GAA AAC GAA-3’ Targeted MFGF U1 allele Antisense primer 5’- CCC AGA AAG CGA AGG AAC AAA-3’ PGK D1 Sense primer 5’- CCC GCA CCC TAT CCT TAC ACA-3’ FGF2 MFGFU11 LMWKO Antisense primer 5’- GCC GCT TGG GGT CCT TG -3’ MFGFD11 Sense primer 5’-CCC AAG AGC TGC CAC AG -3’ FGF2 FGF2-F-2 HMWKO Antisense primer 5’-CGC CGT TCT TGC AGT AGA G -3’ FGF2-R-2 Sense primer 5’- TTGGTACCCTGGAATATTTTAGCCC - 3’ F2WTUP Wt allele 5’- AATAAGTAACCCAGAATATACTGG -3’ Anti-sense primer

F2DWNR EXON3 KO 5’- CTCGACGTTGTCACTGAAGCGGG -3’ Sense primer

NeoF1 Targeted allele 5’- GGTTCCGGATCAGCTTGATTCG -3’ Antisense BPAR

Sense primer 5’-CTT CAA AAG CGC ACG TCT GC-3’ Human FGF2 PGKU2 HMW 24 kD Antisense primer 5’-GCC TGC CAC ACC TCA AGC TT-3’ Tg PGK D1

Generation of FGF2 LMW knockout mice

FGF2 LMW mutant mice (FGF2 LMWKO) were generated by Ming Zhou in Dr.

Thomas Doetschman’s laboratory335. Briefly, 2.2 Kb BamHI/FapI fragment which contained the

5’ region of the mouse Fgf2 gene was subcloned into the pBluescript SK II plasmid. This

BamHI/FspI fragment was digested with Sma I and Nco I and then treated with mung bean

nuclease to remove a 20 bp fragment containing the ATG translational start site (bolded), 5’-GG

GGC CGC GGA AGG GCC ATG. A synthesized oligo DNA (5’-GG GGC CGC GGA AGG

GCT GCA) with the ATG changed to a GCA and an added diagnostic Pst I site, was ligated back

into BamHI/FspI restriction site [changed nucleotides are italicized and part of the Pst I site is underlined]. This manipulation resulted in a stop in the translation for the FGF2 LMW isoform.

The “Tag and Exchange” strategy (Figure 6A) was modified from the original protocol of

Askew and colleagues687. The wildtype Fgf2 gene was first tagged with an Hprt mini-gene. The

Hprt minigene was then replaced, using homologous recombination with the modified Fgf2 gene

in which only the HMW isoforms would be expressed (FGF2 LMWKO). ES cells carrying the

targeted allele were microinjected into C57BL/6 blastocytes, and were then transferred to the

pseudopregnant foster mothers. The chimeric mice, indicated by agouti coat color, were bred to

Black Swiss mice for germline transmission. The offspring of these crosses and later crosses

between heterozygotes were genotyped by PCR to identify for Wt (+/+), heterozygotes (+/-) and

homozygotes (-/-) pups.

Fresh or frozen tail clips (0.3 cm) from newborn pups were digested with 300 µL immediate tail buffer (50 mM KCl, 10 mM Tris-HCl, 0.45% NP-40, 0.45% Tween 20, and 1 mM

EDTA) and 5 µL proteinase K solution (Roche, Indianapolis, IN) at 56ºC overnight. One

microliter of diluted DNA along with 19 µL PCR master mixture [2 µL H2O, 6 µL 10X

Enhancer (Epicenter, Madison WI), 4 µL 5X Cresol Red, 4 µL 5X PCR buffer (1.5 mM Mg,

Epicenter，Madison WI), 1 µL 2.5 mM dNTP (Epicenter, Madison WI) and 0.75 µL each for 5’ and 3’ primer (10 mM) and 0.5 µL Tfl DNA polymerase (Epicenter, Madison WI)] were

subjected to PCR reaction. The primers for genotyping LMWKO mice are listed in Table 4. The

PCR protocol used for genotyping Wt and LMWKO mice was: 1 cycle for initial denaturing step

(97°C for 5 minutes and 80°C for 10 seconds), 35 cycles of denaturing (97°C for 60 seconds), annealing (58°C for 60 seconds) and extension (72°C for 2 minutes) followed by 1 cycle of denaturing (97°C for 60 seconds), annealing (58°C for 60 seconds) and extension (72°C for 10 minutes). Ten microliters of PCR product were digested with 0.5 µL Pst I restriction enzyme at

37°C for 1 hour. The digested PCR product was loaded onto a 1.5% agarose gel containing

0.01% ethidium bromide (Bio-Rad, Hercules CA) and run at 130 V for 50 minutes. The gel was visualized under UV light with a Fluorchem 8800 gel imager (Alpha Innotech, San Leandro CA).

The PCR products were 556 bp for the wildtype allele and 476+90 bp for the targeted allele

(Figure 6B).

Generation of FGF2 HMW knockout mice

The FGF2 HMW mutant (FGF2 HMWKO) mice were generated by Drs. Ming Zhou and

Azhar Mohamad in the laboratory of Dr. Thomas Doetschman335. Briefly, a 14-bp oligo DNA

(5’-CTA GTC TAG ACT AG-3’), which also contained stop codons (TAG) in all 3 reading frames, and designated to cause a frame-shift between the ATG and the two upstream CTG start sites, was ligated to the Sma I site. The insertion caused a frame-shift of the HMW isoforms reading frame and kept only the LMW isoform reading frame. This manipulation resulted in an

ablation of the FGF2 HMW isoforms.

The “Tag and Exchange” strategy (Figure 6A) was modified from the original protocol

of Askew and colleagues687. The wildtype Fgf2 gene was first tagged with an Hprt minigene.

The Hprt minigene was then replaced, using homologous recombination, with the modified Fgf2

gene in which only the LMW isoform will be expressed (HMWKO). ES cells carrying the targeted allele were microinjected into C57BL/6 blastocytsts, which were then transferred to the pseudopregnant foster mothers. The chimeric mice, indicated by agouti coat color, were bred to

Black Swiss mice for germline transmission. The offspring of these crosses and later crosses

between heterozygotes were genotyped by PCR to identify for Wt (+/+), heterozygotes (+/-) and

homozygotes (-/-) pups.

Mouse tail DNA was purified by Gentra Puregene Kit (Gentra, Valencia CA). Briefly,

fresh or frozen tail clips (0.3 cm) from newborn pups were digested with 250 µL cell lysis buffer and 5 µL proteinase K solution (Roche, Indianapolis IN) at 56ºC overnight. Samples were mixed with 0.5 µL RNase at 37ºC for 1 hour. Protein in the samples was removed by adding 100 µL

protein precipitation buffer, vortexing and centrifuging at 13,000 rpm for 3 minutes. Supernatant

was placed into a clean 1.5 mL centrifuge tube and the DNA pellet was precipitated with the

addition of 300 µL isopropanol and centrifuged at 13,000 rpm for 1 minute. The DNA pellets

were washed with 70% ethanol to remove excess salt in the buffer and then centrifuged at

130,000 rpm for 1 minute. The pellets were air dried for 15 minutes and dissolved in 200 µL hydration buffer.

One microliter of DNA along with 19 µL PCR master mixture [3 µL H2O, 6 µl 10X

Enhancer (Epicenter, Madison WI), 4 µL 5X Cresol Red, 1 µL 20X PCR buffer (Epicenter,

Madison, WI), 1 µL dNTP (10 mM), 1 µL 2.5 mM dNTP (Epicenter, Madison WI) and 0.75 µL each for 5’ and 3’ primers (10 mM) and 0.5 µL Tfl DNA polymerase (Epicenter, Madison WI)] were subjected to PCR reaction. The primers for genotyping HMWKO are shown in Table 4.

The PCR protocol used for genotyping Wt and FGF2 HMWKO mice was: 1 cycle for initial denaturing (97°C for 5 minutes) followed by 35 cycles of denaturing (97°C for 60 seconds),

annealing (58°C for 60 seconds) and extension (72°C for 2 minutes), 1 cycle of extension (72°C for 10 minutes). The PCR products were loaded onto a 2% agarose gel containing 0.01% ethidium bromide (Bio-Rad, Hercules CA) and run at 130 V for 120 minutes. The gel was

visualized under UV light with a Fluorchem 8800 gel imager (Alpha Innotech, San Leandro CA).

The PCR products were 152 bp for wildtype allele and 166 bp for the targeted allele (Figure 6B).

Generation of FGF2 EXON 3 knockout mice

The FGF2 EXON3 knockout mice were generated in Dr. Flora Vaccarino’s laboratory

(Yale University). Briefly, a strong Splice Acceptor (SA) followed by the strong bovine poly A site (bpA) was placed before exon 3 so that no transcript occurs, that included the 3rd exon which is common to all Fgf2 isoforms (Figure 6C). ES cells carrying the targeted allele were microinjected into C57BL/6 blastocytsts, which were then transferred to the pseudopregnant foster mothers. The chimeric mice, indicated by agouti coat color were bred to Black Swiss mice for germline transmission. The offspring of these crosses and later crosses between heterozygotes were genotyped by PCR analysis for Wt (+/+), heterozygotes (+/-) and homozygotes (-/-) pups.

Mouse tail DNA was purified by Gentra Puregene Kit (Gentra, Valencia CA). Briefly, fresh or frozen tail clips (0.3 cm) from newborn pups were digested with 250 µL cell lysis buffer and 5 µL proteinase K solution (Roche, Indianapolis IN) at 56ºC overnight. Samples were mixed with 0.5 µL RNase at 37ºC for 1 hour. Protein in the samples was removed by adding 100 µL

protein precipitation buffer, vortexing and centrifuging at 13,000 rpm for 3 minutes. Supernatant

was placed into a clean 1.5 mL centrifuge tube and the DNA pellet was precipitated with the

addition of 300 µL isopropanol and centrifuged at 13,000 rpm for 1 minute. The DNA pellets

were washed with 70% ethanol to remove excess salt in the buffer and then centrifuged at

130,000 rpm for 1 minute. The pellets were air dried for 15 minutes and dissolved in 200 µL hydration buffer.

One PCR reaction was performed to detect both the Wt allele and the mutant allele. One microliter of DNA along with 19 µL PCR master mixture [7.9 µL H2O, 2 µL 10X PCR buffer

(Qiagen, Valencia CA), 4 µL 5X Cresol Red, 1 µL 2.5 mM dNTP (Roche, Indianapolis IN) and

1 µL each for two primer sets (10 mM) and 0.1 µL Taq DNA polymerase (Qiagen, Valencia

CA)] were subjected to PCR reaction. The primer sets for genotyping FGF2 EXON3 KO are shown in Table 4. The PCR protocol used for genotyping Wt and FGF2 EXON3 KO mice was: 1 cycle for initial denaturing (95°C for 15 minutes) followed by 35 cycles of denaturing (94°C for

60 seconds), annealing (58°C for 60 seconds) and extension (72°C for 90 seconds), 1 cycle of extension (72°C for 10 minutes). The PCR products were loaded onto a 1% agarose gel containing 0.01% ethidium bromide (Bio-Rad, Hercules CA) and run at 130 V for 60 minutes.

The gel was visualized under UV light with a Fluorchem 8800 gel imager (Alpha Innotech, San

Leandro CA). The PCR products were 402 bp for wildtype allele and 886 bp for the targeted allele.

Generation of transgenic mice overexpressing human FGF2 HMW 24 kD isoform

The human FGF2 HMW 24 kD (24IP20 and 24IP28) transgenic mice were generated by

Dr. Ming Zhou in the laboratory of Dr. Thomas Doetschman339. Briefly, the AUG and first 2

CUG codons of the human Fgf2 cDNA (provided by Dr. R. Florkiewicz), were point-mutated,

leaving only the human FGF2 24 kD HMW isoform. The mutated vector was ligated to the 3’

end of the phosphoglycerate kinase (PGK) promoter with an SV 40-intron and poly A sequence

at the downstream of the cDNA (Figure 6D). The chimeric gene was injected into the pronuclei

of FVB/N strain fertilized mouse oocytes by the Transgenic Mouse Service Facility of the

University of Cincinnati. Founder mice harboring the transgene were identified by PCR.

7.5, 1 mM EDTA). One µL of DNA along with 19 µl PCR master mixture [10.9 µL H2O, 4 µL

5X Cresol Red, 2 µL PCR buffer (1.5 mM Mg, Roche, Indianapolis IN), 1 µL 2.5 mM dNTP

(Roche, Indianapolis IN) and 0.5 µL each for 5’ and 3’ primers (10 mM) and 0.1 µL Taq DNA polymerase (5 units/µL, Roche, Indianapolis IN)] were subjected to PCR reaction. The primer set for the human 24 kD HMW Tg genotyping is listed in Table 4. The PCR protocol used for genotyping non-transgenic and the human 24 kD HMW isoform was: 1 cycle for initial denaturing (94°C for 5 minutes), with another 36 cycles of denaturing (94°C for 30 seconds), annealing (59°C for 30 seconds) and extension (72 °C for 60 seconds), followed by 1 cycle denaturing step (94 °C for 30 seconds), annealing (59°C for 60 seconds) and extension (72°C for

10 minutes). The PCR products were loaded onto a 1% agarose gel containing 0.01% ethidium bromide (Bio-Rad, Hercules CA) and run at 130 V for 40 minutes. The gel was visualized under

UV light with a Fluorchem 8800 gel imager (Alpha Innotech, San Leandro CA). The PCR

products were 300 bp for the Tg allele and no product for NTg (Figure 6E).

A. Wildtype Fgf2 allele Hprt-neg- S BBX X/H N X S S H ES Cell line 1

X S S B Tagging construct Hprt Minigene Targeted HAT selection X construct S B X X/H S S B H Hprt Minigene

LMW & HMW KO S B X X/H N X S S B H construct *1

Sma I NcoI Wt CTG ……. CTG …….. CCCGGGGCCGCGGAAGGGCCATGCT

Sma I Pst I LMWKO CTG ……. CTG …….. CCCGGGGCCGCGGAAGGGCTGCACT

HMWKO CTG..CTG..CCC CTAGTCTAGACTAG GGGGCCGCGGAAGGGCCATGGCT

6-TG S B X X/H N X S S BH Exchange Alleles * 1

B. +/+ +/- -/-

Wt Target Wt Target Wt Target allele allele allele allele allele allele

Fgf2 KO 1299 bp 185 bp

556 bp FGF2 LMWKO 476 bp

166 bp FGF2 HMWKO 152 bp

4.7kb 2.1kb C. H K H 5’ arm 3’ arm

Fgf2 E2 E3 Genomic Locus 2.1kb EcoRV 4.7kb 1kb 5’ Probe 6.8 kb (HindIII)

3’ Probe 4.7 kb (EcoRV/HindIII) Fgf2 Exon3 KO 4.7k 2.1k K SA H EcoRv K H Locus H b b loxP lox E2 E3

5’ Probe 4.9 kb (HindIII) βGal PGKpNeo bpA 3’ Probe 5.8 kb (EcoRV/HindIII)

D. 24 kD HMW transgenic

24 kD HMW CUG CUG CUG AUG Fgf2 gene Stop isoform

300 bp

NTg 24 kD Tg line 20 NTg 24 kD Tg line 28

Figure 6: Schematic for the generation of Fgf2 gene-modified mice. (A) The Tag and Exchange procedure was used to generate Fgf2 KO, FGF2 LMWKO and FGF2 HMWKO mice. FGF2 LMWKO mice were generated by point mutating the AUG start site to eliminate the LMW isoform. The FGF2 HMWKO mice were generated by inserting a 14-base oligo DNA, designated to cause a frame-shift between the ATG and the 2 upstream CTG start sites, to eliminate the FGF2 HMW isoforms. (B) Representative PCR picture showing Wt, heterozygote and homozygote alleles from Fgf2 KO, FGF2 LMWKO and FGF2 HMWKO tail DNA (C) Schematic for the generation of FGF2 EXON3 KO mice. A strong splice acceptor (SA) followed by the strong bovine poly A site (bpA)was inserted before exon 3 so that no transcript occurs (D) cDNA construct engineered to overexpress the human FGF2 HMW 24 kD isoform when driven by the phosphoglycerate kinase promoter. Point mutations were designed to eliminate the translation codons for LMW isoform as well as the 21 and 22 HMW isoforms. (E) Representative PCR picture showing the Wt and 24 kD HMW Tg PCR products.

Isolated work-performing heart model

Age-(10-12 weeks) and sex-matched mice (see Tables 5 and 7) were anesthetized with

sodium pentobarbital (80 mg/kg, i.p.) and heparinized (5000U/kg, i.p.) to protect the heart

against microthrombi. The isolated work-performing heart preparation was performed as

previously described73,305,309,348,575 (Figure 7). Briefly, the chest was opened at the sternum and

the heart was quickly removed and placed in a separate tissue bath with warmed, heparinized and

oxygenated Krebs-Henseleit solution (118 mM NaCl, 25 mM NaHCO3, 0.5 mM Na-EDTA, 5

mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 2.5 mM CaCl2 and 11 mM glucose) which

contained physiological concentrations of ions for proper functioning of the heart. The aorta was

cannulated, preserving the aortic valve and coronary artery ostia. The aortic pressure transducer was connected to the side port of this cannula to record aortic pressure. A PE-50 catheter was inserted through the pulmonary vein and left atrium, past the mitral valve, and into the left ventricle to measure intraventricular systolic and diastolic pressures. After placement of the intraventricular catheter, the left atrial cannula was also placed into the left pulmonary vein through one of the two pulmonary vein roots, while preserving both the atrium and the atrial septum, thereby allowing the direction of perfusate to be switched from retrograde (Langendorff mode) to anterograde (working mode). Perfusion through the left atrial cannula was adjusted via a micrometer to a level that maintains pressure inside the atrium at 6-8 mmHg (venous return = 5 mL/min) and vascular resistance was adjusted to maintain aortic pressure at 50 mmHg, resulting in a basal cardiac minute work of 250 mL/min*mmHg. The atrial cannula had a side port to measure left atrial pressure. A small cut in the pulmonary artery proximal to the outflow tract allows the collection of venous perfusate gas for measurement of venous O2, CO2 and pH.

Arterial and venous perfusate samples were collected anaerobically, and the PO2 and PCO2

values of these samples were measured using an automated blood gas analyzer (model 248, Ciba

Corning Diagnostics Corp). Oxygen consumption (MVO2) by the perfused hearts was computed by multiplying the coronary flow by the arteriovenous difference in oxygen content and normalized per gram of tissue mass. Systolic and diastolic functional parameters, including left ventricular (LV) systolic (LVSP) and diastolic pressure (LVDP), LV end-diastolic pressure

(LVEDP), rates of contraction (+dp/dt) and relaxation (-dp/dt), as well as mean aortic pressure

(MAP), mean atrial pressure, were obtained from COBE pressure transducers. Functional data was recorded using a Grass polygraph and customized data acquisition system.

Model of global, low-flow ischemia

The hearts were equilibrated for 30 minutes at a basal workload of 250 mmHg*mL/min

[venous return/cardiac output (5.0 mL/min) *mean aortic pressure (50 mmHg)]. After 30 minutes of equilibration, the venous return was quickly reduced stepwise to a flow of 1 mL/min (a 90% of reduction in coronary flow similar to that of patients suffering from severe coronary artery disease) for 60 minutes to elicit a global, low-flow ischemia. Following 60 minutes of global, low-flow ischemia, venous return was increased to a flow of 5 mL/min and reperfusion occurred for 120 minutes. The heart was paced 10-20 beats/min (bpm) above its intrinsic heart rate during equilibration, ischemia and reperfusion to maintain the work demand during ischemia.

Physiological temperature (37ºC) of the heart was maintained throughout the length of experimental study. Cardiac function parameters represented as left ventricular systolic pressure

(LVSP), left ventricular end diastolic pressure (LVEDP), ±dP/dt as well as aortic flow and coronary flow measures, perfusate gases, and coronary effluent were collected at each stepwise decrease and increase in flow and during designated timepoints of baseline/equilibration, early

Figure 7: Schematic of isolated work-performing heart preparation. The heart was perfused with Krebs solution containing physiologic concentrations of ions and glucose. Cardiac out put and aortic flow were measured via flow meter. The aorta and left pulmonary vein were canulated and functional parameters such as MAP, LVSP, LVDP, LVEDP, ±dP/dt and atrial pressure were measured. Venous perfusate gas and coronary effluent were collected at the designated time points for measurement of venous O2, CO2, pH and the release of creatine kinase and FGF2.

ischemia, late ischemia, early reperfusion and late reperfusion (Figure 8). Percent of post-

ischemic functional recovery was calculated from the data of contractile or relaxation function

(±dP/dt) at 120 minutes of reperfusion (R120) versus the baseline (B) ±dP/dt. % Post-ischemic

recovery function = (±dP/dt R120/ ±dP/dt B) * 100. Hearts were either stained with tetrazolium

chloride for infarct determination or arrested and snap-frozen in liquid nitrogen for molecular

analysis.

Table 5: Mouse groups subjected to the full ischemia-reperfusion injury study

Group I: Wt, Fgf2 KO and FGF2 LMWKO: 60 minutes ischemia and 120 minutes reperfusion (60’I/120’R)

Group II: FGF2 HMWKO: 60’I/120’R Group III: NTg and human FGF2 HMW 24 kD Tg (2 lines): 60’I/120’R

In vivo regional, ischemia model

In vivo regional, ischemia studies were performed in collaborated with Dr. Ren in the

laboratory of Dr Keith Jones. Mice (See Table 6) were anesthetized with sodium pentobarbital

(90 mg/kg, i.p.), intubated with PE 90 tubing, and ventilated using a mouse miniventilator

(Harvard Apparatus, Holliston, MA). Blood pressure and ECG (Digi-Med Sinus Rhythm

Analyzer, Micro-Med, Inc., Louisville, KY) data were continuously recorded 10 minutes before

and during ischemia and for 10 minutes after reperfusion. The ventilation conditions used were as follows: Rate = 100±5 breaths/min, tidal volume = 2.2 mL. A lateral thoracotomy (1.5 cm incision between the second and third ribs) was performed to provide exposure of the left anterior descending coronary artery (LAD), while avoiding rib and sternal resection, retraction, and rotation of the heart. Vascular bundles in the vicinity were cauterized using a microacutery

(Medical Industries, Inc., St. Petersburg, FL). An 8-0 nylon suture was placed around the LAD,

30 minute 60 minute 120 minute Equilibration Low-Flow Ischemia Reperfusion

CE CE CE CE CE

B. 30 minute 60 minute 120 minute Equilibration Low-Flow Ischemia Reperfusion

Drug Drug C.

30 minute 60 minute 120 minute Equilibration Low-Flow Ischemia Reperfusion

D. 3.5 hour equilibration

30 minute 60 minute 120 minute Equilibration Low-Flow Ischemia Reperfusion

Figure 8: Schematic of low-flow ischemia protocols. (A) Protocol for 60 minutes ischemia and 120 minutes reperfusion. CE: coronary effluent collection. Arrow: Functional parameters and venous perfusate gas were taken at designated time points. (B) Drug infusion protocol for JNK, ERK, p38 MAPK, FGFR inhibitor studies. 30 minutes equilibration followed by 60 minutes global low-flow ischemia and 120 minutes reperfusion. Pharmacological agents were administered for 15 minutes before and during the initial 15 minutes ischemia and also 15 minutes before and after the beginning of reperfusion. (C) Protocol for time course study. Hearts were arrested and snap frozen at sham, 5 minutes ischemia, 60 minutes ischemia and 60 minutes ischemia followed by either 5 or 15 minutes of reperfusion (indicated by arrow). (D) Protocol for microarray study. Hearts were subjected to either 3.5 hours equilibration or 60 minutes ischemia and 120 minutes reperfusion.

2–3 mm from the tip of the left auricle, and a piece of silicon tubing (0.64 mm ID, 1.19 mm OD)

was placed over the artery. Coronary artery occlusion was achieved by tightening and tying the

suture around the silicon tubing. Due to the use of microsurgical techniques, blood loss is

minimal (<50 µL) and survival rate high (~95%).

On day 1, mice were subjected to an open-chest surgery involving a 45 minute left

anterior desending (LAD) coronary artery occlusion. At the end of the occlusion, the suture was

untied and left in place. Ischemia was confirmed by visual observation (i.e., by cyanosis) and by

continuous ECG monitoring (S-T segment changes), and reperfusion was confirmed by reversal of these effects. The chest was closed in layers using 7-0 polypropylene suture and the mice were allowed to regain consciousness in a warm chamber with 100% oxygen. Mice were euthanized after 24 hours of reperfusion, stained with Evans blue dye and 1% 2,3,5-triphenyl tetrazolium chloride (TTC), and cross-sectioned into 5-6 pieces for infarct size determination. Sections were photographed using a Nikon Coolpix 880 digital camera fitted with a UR-E2 macro lens and computerized digital planimetry was performed using NIH Image software, 1.61 version. Infarct size was determined and expressed as a percentage of the region at risk. Mice with unsuccessful

LAD coronary artery occlusion and/or reperfusion were excluded from the study. No mice were excluded from this study

Table 6: Mouse groups subjected to in vivo regional, 45 minutes ischemia (I) and 24

hours reperfusion (R) model Group I: Wt: 45 minutes I/24 hours R

Group II: Fgf2 KO: 45 minutes I/24 hours R Group III: LMWKO: 45 minutes I/24 hours R

Pharmacological studies

CEP11004, a JNK pathway inhibitor which inhibits mixed lineage kinase (MLK3)688, an upstream kinase involved in JNK activation, was generously donated as a gift from Cephalon

Inc., West Chester, PA. 1,4-Diamino-2,3-dicyano-1,4-bis(2-aminophenylthio) butadiene

(U0126), an inhibitor of MEK1/2 (upstream kinase of ERK activation)689, was purchased from

Promega, Madison, WI. 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)1H-

imidazole HCl (SB203580), an inhibitor of MAPKAP kinase 2 (upstream kinase of p38

MAPK)690, and 2-(p-Methoxybenzyl)-3,4-pyrrolidinediol-3-acetate (anisomycin), an agonist of

p38 MAPK691 were purchased from Calbiochem, San Diego, CA. 1-t-Butyl-3-(6-(3,5-

dimethoxyphenyl)-2-(4-diethylaminobutylamino)-pyrido[2,3-d]pyrimidin-7-yl)urea (PD173074),

a FGFR inhibitor, which inhibits the autophosphorylation of FGFR692, was generously donated

as a gift from Pfizer, New York, NY. CEP11004, U0126, anisomycin and PD173074 were

dissolved in DMSO, and SB203580 was dissolved in water; all were diluted in Kreb’s solution to

obtain final concentrations which had been shown to inhibit the targeted molecules without

causing any adverse effect. CEP11004 (50 nmol/L), U0126 (2.5 µmol/L), SB203580 (2 µmol/L), anisomycin (5 µmol/L), or PD173074 (25 nmol/L) was administrated 15 minutes prior to and for the first 15 minutes of ischemia and the last 15 minutes of ischemia and first 15 minutes of reperfusion. DMSO was administrated at the same length and time points to obtain vehicle treatment (Figure 8). Mouse groups that were subjected to pharmacological study are listed in

Table 7. Concentrations of 2.5 nM for CEP11004, 2 µM for SB203580, 2.5 µM for U0126, 5 µM for anisomycin and 25 nM for PD173074 were chosen according to previous studies in the

literature, IC50 value of each antagonist or EC50 for agonist, and preliminary studies from our

laboratoy demonstrating that these drug concentrations inhibited their targets without any

adverse effects (i.e., cardiac arrhythmias or increased left atrial pressure), which were observed at higher drug levels. Cell culture data indicates that the concentration of PD173073 to inhibit

FGFR1 (5 nM) is significantly lower than the concentration used to inhibit VEGFR (250 nM)692 or the concentration used to inhibit EGFR (5 µM)693. U0126 (MEK1/2 inhibitor) does not inhibit

protein kinases including c-Abl, Raf, MEKK, Erk, JNK, MKK3, MKK4/SEK1, MKK6, CDK2

or CDK4 at WHAT? given concentration (2.5 µM )694. SB 203580 inhibits LCK, GSK3β and

PKBα at a concentration 100- to 500-fold higher than the concentration to inhibit p38 MAPK (2

µM)695. Finally, the specificity of CEP11004 and evaluation of cross-inhibition of other MAPK

signaling molecules was determined by immunoblotting.

Table 7: Mouse groups for MAPK and FGFR inhibitor study Group I: Wt, Fgf2 KO and FGF2 LMWKO: Vehicle (DMSO): 60’I/120’R Group II: Wt, Fgf2 KO and FGF2 LMWKO: CEP11004, 50 nM: 60’I/120’R

Group III: Wt, Fgf2 KO and FGF2 LMWKO: U0126, 2.5 µM: 60’I/120’R

Group IV: Wt, Fgf2 KO and FGF2 LMWKO: SB203580, 2 µM: 60’I/120’R Group V: Wt, Fgf2 KO and FGF2 LMWKO: Anisomycin, 5 µM; 60’I/120’R

Group VI: Wt and FGF2 HMWKO: Vehicle (DMSO); 60’I/120’R Group VII: Wt and FGF2 HMWKO: PD173074, 25 nM; 60’I/120’R

Myocardial infarction

Infarct size was determined by the histochemical stain, 1% 2, 3, 5-triphenyltetrazolium

chloride [TTC (25 mg TTC, 4 mL KH2PO4 and 36 mL H2O) which delineates viable versus

necrotic tissue696, as previously described73,305. Following 60 minutes of global, low-flow

ischemia and 120 minutes of reperfusion injury, hearts from studies in Tables 5 and 7 were

perfused with a 1% TTC stain via the aortic cannula. The hearts were frozen and then cut into 5-

7 transverse slices, which were weighed, fixed in 4% formalin and photographed. The area of the

whole heart (area at risk) and infarct region were determined by computer morphomertry (NIH

imaging software, 1.61 version). Infarct size was depicted as a percent of area at risk (i.e., the

whole heart).

Creatine kinase release in coronary effluent

The coronary effluent was collected every 2 minutes during the last 10 minutes of the

equilibrium period, collected over the first 30 minutes and last 15 minutes of ischemia, during

the venous return increase (2 mL/min to 4 mL/min) period, and every 2 minutes for the first 14

minutes and last 10 minutes of reperfusion (Figure 8). EDTA-free protease inhibitor tablets (1

tablet/10 mL effluent, Roche, Indianapolis, IN) were immediately added to the collected

coronary effluent and samples were kept on ice during the study and then transferred to -80°C

freezer for future analysis.

The amount of creatine kinase (CK) released into coronary effluent was determined using

a CK Reagent Set (International Bio-Analytical, Boca Raton, FL). Creatine kinase catalyzes the

reversible phosphorylation of ADP, in the presence of creatine phosphate, to form ATP and

creatine. The auxiliary enzyme hexokinase (HK) catalyzes the phosphorylation of glucose by the

ATP formed, to produce ADP and glucose-6-phosphate (G6P). Glucose-6-phosphate is oxidized to 6-phosphogluconate with the concomitant production of NADH. The rate of NADH formation, measured at 340 nm, is directly proportional to CK activity. One milliliter of the

reaction mixture (30 mM creatine phosphate, 2 mM ADP, 5 mM AMP, 2 mM NAD, 20 mM

NAC, 2500 U/L hexokinase, 2000 U/L G6PDH, 20 mM D-glucose, 10 mM magnesium ions, 2

mM EDTA, 10 µM diadenosine pentaphosphate and 100 mM buffer, pH 6.7) was warmed in a

37.7°C water bath for 5 minutes. One milliliter of coronary effluent sample was added to the

warmed reaction mixture and heated for 4 minutes at 37.7°C. Absorbance readings at 340 nm

were obtained with a spectrophotometer (Beckman model DU-70) following this incubation and

every minute thereafter for a total of 7 readings. The change in absorbance between each reading

was then calculated and these differences were averaged. One international unit (U/L) is defined

as the amount of enzyme that catalyzes the transformation of one µmol of substrate per minute

under defined conditions. Creatine kinase release was normalized to coronary flow (mL/min) and

heart weight (g) and represented as U/min*g.

Detection of FGF2 release in coronary effluent

Quantitative determination of FGF2 release at various time points of

baseline/equilibration, ischemia, and reperfusion was performed by ELISA according to the

Quantikine human FGF2 immunoassay (R&D, Minneapolis, MN). One hundred microliters of

assay dilution buffer RD1-43 were added into microplate wells, precoated with FGF2 antibody.

One hundred microliters of standard (human FGF2 recombinant) or collected coronary effluent

were then added and incubated for 2 hours at room temperature, allowing the sample to fully

react with FGF2 antibody. After four washes with wash buffer, wells were incubated for 2 hours,

at room temperature, with mouse monoclonal antibody against FGF2 conjugated to horseradish peroxidase. Wells were again washed four times with 400 µL wash buffer at the end of the two hour incubation. Two hundred microliters of substrate solution (containing 100 µL of hydrogen

peroxide and 100 µL of chromogen mixture) was added to each well and incubated for 30 minutes at room temperature (protected from light). The reaction was terminated by adding 50

µL stop solution (2 N sulfuric acid), and the absorption, at 450 nm, of each well was measured

using a GENios microplate reader (Tecan, Durham, NC). FGF2 concentration (pg/mL) was

normalized to coronary flow (mL/min) and heart weight (g) and depicted as pg/min*g.

Immunohistochemistry for blood vessel detection

Hearts (see Table 8) were fixed in 4% formalin overnight and then transferred to 70%

ethanol the next day. Formalin-fixed hearts were embedded in paraffin and then cross-sectioned

(5 µm sections). The paraffin-embedded cardiac sections were de-paraffinized with xylene,

hydrated by decreasing ethanol concentrations (100%, 95%, 90%, 85% and 70%) and then

treated with pepsin (DAKO Corporation, Carpinteria, CA) for 10 minutes and 3% H2O2 for 5 minutes at 37°C to unmask the antigen. Primary antibodies against smooth muscle α−actin

(1:400, SIGMA, St Louis, MO) and von Willebrand’s factor (1:100, DAKO Corporation,

Carpinteria, CA) were utilized to stain vascular smooth muscle cells and endothelial cells, respectively. Biotinylated secondary antibodies to rabbit and mouse IgG (1:200) dilution, Vector

Laboratories, Burlingame, CA) were then applied to heart sections. Immunostaining was visualized utilizing the Vectastain ABC reagent kit (Vector Laboratories, Burlingame, CA) and

DAB reagent kit (Vector Laboratories, Burlingame, CA). Sections were counterstained with hematoxylin. To assess the level of smooth muscle-containing blood vessels, a total of 192 fields

(4 fields/section, 6 sections/heart) from each group (8 hearts/group) were counted at a magnification of 200X. Quantification of capillaries was performed by counting a total of 240 fields (5 fields/section, 6 sections/heart) from each group (8 hearts/groups) at a magnification of

1000X. Hematoxylin and eosin (H&E) staining, which stain the basophilic tissue component including nucleic acid, mitochondrial and collagen, as well as Mason’s trichrome staining, which

stain the nuclei and cytoplasm, were performed to detect any histological and pathophysiological

alteration of cardiac muscle prior to or following I/R injury.

Table 8: Mouse groups subjected to Western immunoblotting, immunohistochemistry or TUNEL staining

Group I: Wt, Fgf2 KO, FGF2 LMWKO and FGF2 HMWKO: non-ischemic Group II: NTg and human FGF2 24 kD HMW Tg (2 lines): non-ischemic

Time course evaluation of protein kinase activation

Mouse hearts (see Table 9) were arrested at different timepoints of ischemia and

reperfusion (Figure 8) to identify the timeframe of protein kinase activation. The timepoints

were: 30 minutes equilibrium (sham), 5 minutes ischemia, 60 minutes ischemia and 60 minutes

ischemia followed by either 5 or 15 minutes of reperfusion. Administration of pharmacological agents was similar to that of hearts subjected to the 60 minutes of ischemia and 120 minutes of reperfusion (Figure 8). Hearts were snap-frozen in liquid nitrogen and stored in -80°C until further analysis.

Table 9: Mouse groups subjected to time course study

Group I: Wt, Fgf2 KO and FGF2 LMWKO: 30’ equilibrium Group II: Wt, Fgf2 KO and FGF2 LMWKO: 5’ ischemia (I)

Group III: Wt, Fgf2 KO and FGF2 LMWKO: 60’I Group IV: Wt, Fgf2 KO and FGF2 LMWKO: 60’I/5’reperfusion (R)

Group V: Wt, Fgf2 KO and FGF2 LMWKO: 60’I/15’R

Cardiac preparation for detection of FGF2

Snap-frozen non-ischemic hearts (see Table 8) were powdered and homogenized in homogenization buffer [20 mM Tris, 2 mM EDTA, 2 M NaCl, 1% NP40, PMSF and EDTA-free

protease inhibitor tablet (1 tablet/10 mL)]. The homogenate was centrifuged at 13,000g for 20

minutes and the supernatant was collected to extract FGF2. Protein concentration was

determined via a Bio-Rad Lowry protein assay (Bio-Rad, Hercules, CA). Bovin serum albumin

was used as protein standard.

As the concentration of FGF2 protein level in the whole heart is low compared to other

cardiac proteins, heparan sepharose beads (Amersham, Buckinghamshire, UK) were used to

extract and concentrate FGF2 from the cardiac homogenate. Extraction of FGF2 via heparan

sepharose beads was performed on 2 mg of total protein from each heart. The homogenate was

diluted in 1X TE buffer to achieve a final salt concentration of 2 M, which would facilitate the

binding of the heparan sepharose beads to FGF2. One hundred microliters of the heparan

sepharose bead mixture (75% pre-washed heparan sepharose bead + 25% 1X TE buffer) were

incubated with the homogenate at 4ºC for 60 minutes, but no longer than 3 hours to prevent proteolysis. The heparan sepharose beads were washed three times with 1 mL wash buffer containing 0.6 M NaCl and 10 mM Tris-HCl pH 7.4. Thirty-five microliters of 10X sample buffer [312.5 mM Tris-HCl, pH 6.8, 5% SDS, 12.5% glycerol, 0.0075% bromophenol blue and

1% β-mercaptoethanol (add fresh)] were added to the washed heparan sepharose beads and boiled at 95ºC for 10 minutes. The bead sample was then ready to be used for Western immunoblot analysis for the detection of FGF2 protein isoforms.

Nuclear and cytosolic preparation for detection of translocation of FGF2 isoforms

Snap-frozen non-ischemic hearts (see Table 8) were powdered and homogenized in homogenization buffer A (0.3% β-mercaptoethanol, 50 mM Tris-HCl, 5 mM EDTA, 10 mM

EGTA, 50 µg/mL phenylmethylsulfonyl fluoride, 200 µΜ sodium orthovanadate, and 1 mL

Sigma Protease Inhibitor Cocktail/20 g tissue). The homogenate was loaded onto a sucrose

cushion, containing 2 mL of 1 M sucrose in homogenization buffer A, and was centrifuged at

1600g for 10 minutes to pellet the nuclear fraction. The pellet was washed with deionized-water

and resuspended in homogenization buffer B (buffer A + 0.5% NP40 + 0.1% Triton-X 100) for

60 minutes on ice and subsequently re-centrifuged at 7,850g for 5 minutes. This supernatant was the nuclear fraction. The supernatant from the first centrifugation was then centrifuged at

150,000 g for 60 min, resulting in the cytosolic fraction. Protein concentration was determined via a Bio-Rad Lowry protein assay (Bio-Rad, Hercules, CA). Bovin serum albumin was used as protein standard.

Western immunoblotting for FGF2 protein isoforms detection

The purity of cytosolic and nuclear fractions was determined by the enrichment of β-actin

(cytosolic fraction) and histone-1 (nuclear fraction). FGF2 was extracted from the nuclear and

cytosolic fractions as previously described in “Cardiac preparation for detection of FGF2”

section. Fifty micrograms of protein from cytosolic and nuclear fractions, for β-actin and

histone-1 detection, were loaded onto a 10% SDS-PAGE gel and extracted FGF2 from cytosolic

and nuclear fractions were loaded onto a 15% SDS-PAGE gel. Both the 10% and 15% SDS-

PAGE gels were run at 130 V for 90 minutes and transferred onto 0.2 µm nitrocellulouse membrane for 2 hours at constant 240 mA current. Transfer efficiency and loading equality were examined by staining the membrane with 0.1% Ponceau S in 5% acetic acid. The membrane was blocked in 5% dry milk in 0.1% PBS/Tween solution for one hour to prevent non-specific binding and then incubated with primary antibody against β-actin (1:1000, SIGMA, St Louis,

MO), histone-1 (1:1000, Santa Cruz, Santa Cruz, CA) or FGF2 (1:1000, Santa Cruz, Santa Cruz,

CA) followed by incubating with HRP-conjugated secondary mouse (1:10000, Bio-Rad,

Hercules, CA) or rabbit (1:5000, Santa Cruz, Santa Cruz, CA) antibody. The expression levels of

β-actin, histone-1 and FGF2 were visualized by enhanced chemiluminescence (ECL) reagent and densitometry of protein bands was quantitated using a Fluorchem 8800 gel imager. Location of histone -1 and β-actin on the Western blot was identified by size, based off the E-page See Blue prestain protein marker (Invitrogen, Carlsbad, CA).

Cytosolic and total membrane fractionation for PKC activation or cytochrome C release

Snap-frozen mouse hearts [see Table 5, Table 7 (group I and II) and Table 8] were powdered and homogenized in homogenization buffer A [5 mM TRIS, 4 mM EGTA, 2 mM

EDTA. 5 mM dithothreitol, 1 mM phenylmethyl sulfonylfluoride and EDTA-free protease inhibitor (1 table/10 mL)]. The homogenate was centrifuged at 100,000X g for 30 minutes at 4ºC, resulting in the supernatant as the cytosolic fraction. The pellet was re-homogenized with homogenization buffer A with 1% Triton. This homogenate was centrifuged at 100,000X g for

30 minutes at 4ºC, resulting in a supernatant which was only the nuclear fraction. Protein concentration was determined via a Bio-Rad Lowry protein assay (Bio-Rad, Hercules, CA).

Bovin serum albumin was used as protein standard.

Western immunoblotting for PKC activation (translocation)

Fifty micrograms of protein from cytosolic and membrane fractions were loaded onto

10% SDS-PAGE gel, and run at 130 V for 90 minutes, then transferred onto 0.2 µm nitrocellulouse membrane for 2 hours at constant current (240 mA). Transfer efficiency and loading equality were examined by staining the membrane with 0.1% Ponceau S in 5% acetic

acid697. The membrane was blocked in 5% dry milk in 0.1% PBS/Tween solution for 1 hour to

prevent non-specific binding and then incubated with primary antibody against PKC ε (1:1000,

Cell signaling, Boston, MA), δ (1:1000, Cell signaling, Boston, MA), α (1:1000, Cell Signaling,

Boston, MA), or ζ (1:1000, Santa Cruz, Santa Cruz, CA) followed by incubating with HRP- conjugated secondary mouse (1:10000, Bio-Rad, Hercules, CA) or rabbit (1:5000, Santa Cruz,

Santa Cruz, CA) antibody. The expression levels and translocation of PKC isoforms were visualized by ECL reagent, and densitometry of protein bands was quantitated using a Fluorchem

8800 gel imager.

Western immunoblotting for cytochrome C release

Fifty micrograms of cytosolic and membrane fraction (See Table 7, group I-II and Table

8) were loaded onto a 15% SDS PAGE gel, and run at 130 V for 90 minutes, then transferred onto 0.2 µm nitrocellulouse membrane for 2 hours at constant 240 mA current. Transfer efficiency and loading equality were examined by staining the membrane with 0.1% Ponceau S in 5% acetic acid. The membrane was blocked in 5% dry milk in 0.1% PBS/Tween solution for

1 hour to prevent non-specific binding and then incubated with primary antibody against cytochrome C (1:1000, Zymed, South San Francisco, CA) followed by incubation with HRP-

conjugated secondary mouse (1:10000, Bio-Rad, Hercules, CA) antibody. The expression of cytochrome C in cytosolic vs. membrane fraction was visualized by ECL and densitometry of protein bands was quantitated using a Fluorchem 8800 gel imager.

Whole heart preparation to detect phosphorylation of FGFR, PKC, MAPK,

phospholamban, Akt, and caspase 3 activation (cleavage) and calsequestrin expression

Snap-frozen hearts (see Tables 5, 7 group I-II, 8 and 9) were powdered and homogenized

in homogenization buffer [25 mM HEPES, pH 7.5, 1% glycerol, 150 mM NaCl, 1% Triton X-

100, 5 mM EDTA, 1 mM sodium orthovandate, 25 mM β-glycerolphosphate, 50 mM sodium

fluoride solid, 0.5 µM okadaic acid, disopropylfluorophosphate, 100 µM calpain inhibitor,

Pefabloc stock 1 and 2, Sigma phosphatase inhibitor (SIGMA, St Louis, MO)]. The homogenate

was centrifuged at 13,000g for 15 minutes and the supernatant collected. Protein concentration

was determined via Bio-Rad Lowry protein assay (Bio-Rad, Hercules, CA).

Western immunoblotting for FGFR1 and FGFR4 expression and phosphorylation

One hundred micrograms of whole cell homogenate (See Table 5, groups VI and VII)

were loaded onto an 8% SDS PAGE gel and run at 130 V for 120 minutes, then transferred onto

0.2 µm nitrocellulose membrane for 2 hours at constant 240 mA current. Transfer efficiency and

loading equality were examined by staining the membrane with 0.1% Ponceau S in 5% acetic

acid. The membrane was blocked in 5% dry milk in 0.1% PBS/Tween solution for 1 hour to

prevent non-specific binding and then incubated with primary antibody against phospho-FGFR

(1:500, Cell Signaling, Boston, MA) followed by incubation with HRP-conjugated secondary

mouse (1:10000, Bio-Rad, Hercules, CA) or rabbit (1:5000, Santa Cruz, Santa Cruz, CA)

antibody for overnight at 4ºC. The activation (i.e., phosphorylation) of FGFR1 and FGFR4

expression was visualized by ECL and densitometry of protein bands were quantitated using a

Fluorchem 8800 gel imager. The phospho-antibodies were stripped with stripping buffer (62.5

mM TRIS, pH 6.8, 2% SDS, and 100 mM β-mercaptoethanol) for 45 minutes in 65ºC oven. The

membrane was then blocked in 5% dry milk in 0.1% PBS/Tween solution for 1 hour to prevent

non-specific binding and then incubated with primary antibody against total FGFR1 (1:500, Cell

Signaling, Boston, MA) and FGFR4 (1:500, Santa Cruz, Santa Cruz, CA) followed by incubation

with HRP-conjugated secondary mouse (1:10000, Bio-Rad, Hercules, CA) or rabbit (1:5000,

Santa Cruz, Santa Cruz, CA) antibody. The expression of FGFR1 and FGFR4 expression was

visualized by ECL and densitometry of protein bands were quantitated using a Fluorchem 8800

gel imager.

Western immunoblotting procedure for PKC, MAPK, MKK4/7, c-Jun and Akt activity

(phosphorylation)

One hundred micrograms of whole cell homogenate (See Table 7 group I-II and Table 8)

were loaded onto 10% SDS PAGE gel and run at 130 V for 90 minutes, then transferred onto 0.2

µm nitrocellulose membranes for 2 hours at constant 240 mA current. Transfer efficiency and

loading equality were examined by staining the membrane with 0.1% Ponceau S in 5% acetic

acid. The membrane was blocked in 5% dry milk in 0.1% PBS/Tween solution for 1 hour to

prevent non-specific binding and then incubated with primary antibody against phospho-PKC

α (1:1000, Santa Cruz, Santa Cruz, CA), phospho-PKC δ (1:1000, Cell Signaling, Boston, MA),

phospho-PKC ε (1:1000, Santa Cruz, Santa Cruz, CA), phospho-PKC ζ (1:1000, Cell Signaling,

Boston, MA), phospho-ERK (1:1000, Cell Signaling, Boston, MA), phospho-p38

MAPK (1:1000, Cell Signaling, Boston, MA), phospho-JNK (1:1000, Promega, Madison, WI),

phospho-MKK4 (1:1000, Cell Signaling, Boston, MA), phospho-MKK7 (1:1000, Cell Signaling,

Boston, MA), phospho-Akt (1:1000, Cell Signaling, Boston, MA ), phospho-c-Jun (1:1000, Cell

Signaling, Boston, MA) for overnight at 4ºC. The activation of PKC, MAPK, MKK4/7, c-Jun

and Akt were visualized by ECL and densitometry of protein bands were quantitated using a

Fluorchem 8800 gel imager. The phospho-antibodies were stripped with stripping buffer (62.5

mM TRIS, pH 6.8, 2% SDS, and 100 mM β-mercaptoethanol) for 45 minutes in 65ºC oven with

shaking. The membrane was then blocked in 5% dry milk in 0.1% PBS/Tween solution for 1

hour to prevent non-specific binding and then incubated with primary antibody against total PKC

α (1:1000, Santa Cruz, Santa Cruz, CA), PKC δ (1:1000, Santa Cruz, Santa Cruz, CA), PKC

ε (1:1000, Santa Cruz, CA), PKC ζ (1:1000, Santa Cruz, Santa Cruz, CA), ERK (1:1000,

Transduction, Franklin Lakes, NJ), p38 MAPK (1:1000, Santa Cruz, Santa Cruz, CA) and JNK

(1:1000, Santa Cruz, Santa Cruz, CA), MKK4 (1:1000, Cell Signaling, Boston MA), MKK7

(1:1000, Cell Signaling, Boston, MA), Akt (1:1000, Cell Signaling, Boston, MA) and c-Jun

(1:1000, Cell signaling, Boston, MA) followed by incubation with HRP-conjugated secondary

mouse (1:10000, Bio-Rad, Hercules, CA) or rabbit (1:5000, Santa Cruz, Santa Cruz, CA)

antibody. The expression of PKC, MAPK and Akt molecules were visualized by enhanced

chemiluminescent (ECL) and densitometry of protein bands were quantitated using a Fluorchem

8800 gel imager.

Western immunoblotting procedure for caspase 3 activity (caspase cleavage)

One hundred micrograms of whole cell homogenate (See Table 7 group I-II and Table 8)

were loaded onto 10% SDS PAGE gel, and run at 130 V for 100 minutes, then transferred onto

0.2 µm nitrocellulose membrane for 2 hours at constant 240 mA current. Transfer efficiency and loading equality were examined by staining the membrane with 0.1% Ponceau S in 5% acetic

acid. The membrane was blocked in 5% dry milk in 0.1% PBS/Tween solution for 1 hour to

prevent non-specific binding and then incubated with cleaved caspase 3 (1:1000, Cell Signaling,

Boston, MA) and caspase 3 (1:1000, Cell Signaling, Boston, MA) antibody followed by

incubation with HRP-conjugated secondary rabbit (1:5000, Santa Cruz, Santa Cruz, CA)

antibody. The expression and activation of cleaved and total caspase 3 were visualized by

enhanced chemiluminescent (ECL), and densitometry of protein bands were quantitated using a

Fluorchem 8800 gel imager. The activation of caspase 3 was represented by the ratio of cleaved vs. total caspase 3.

Western immunoblotting procedure for determination of expression and activation of calcium handling protein

Fifty micrograms of whole cell homogenate (See Table 7 group I-II and Table 8) were loaded onto 15% SDS PAGE gel and run at 130 V for 100 minutes, then transferred onto 0.2 µm nitrocellulouse membrane for 2 hours at constant 240 mA current. Transfer efficiency and loading equality were examined by staining the membrane with 0.1% Ponceau S in 5% acetic acid. The membrane was blocked in 5% dry milk in 0.1% PBS/Tween solution for 1 hour to prevent non-specific binding and then incubated with phospho-phospholamban-Ser16 (1:1000,

Upstate, Lake Placid, NY), total phospholamban (1:1000, Affinity Bioreagents, Golden, CO), or calsequestrin (1:5000, Affinity Bioreagents, Golden, CO) antibody followed by incubation with

HRP-conjugated secondary rabbit (1:5000, Santa Cruz, Santa Cruz, CA) antibody. The activation

of phospholamban and expression of phospholamban or calsequestrin were visualized by

enhanced chemiluminescent (ECL) and densitometry of protein bands were quantitated using a

Fluorchem 8800 gel imager. The activation of phospholamban was represented by the ratio of

phospho- vs. total phospholamban.

Quantification of immunoblotting

Equal protein loading was assessed via Ponceau S (Sigma-Aldrich) staining of total

protein content. Films were developed under various condition including 10 seconds, 30 seconds,

1 minute, 5 minutes, 20 minutes and 1 hour (the signal of ECL solution decays 90% after 45

minutes). The optimized developed time was determinted by the lightest intensity where all the

bands were observed. For each immunoblotting, one specific exposure time was chosen. The

densitometry of protein bands were quantitated using a Fluorchem 8800 gel imager.

TUNEL assay

Terminal transferase dUTP nick end-labeling (TUNEL) assay is a common method used

for detecting DNA fragamentation that occurs during apoptosis698. The assay relies on the

presence of nicks in the DNA which are identified by terminal transferase, an enzyme that

catalyzes the addition of dUTPs that are secondarily labeled with a marker699. Paraffin-embedded

heart sections (See Table 7, group I and II and Table 8 group I) were de-paraffinized with xylene and rehydrated by decreasing ethanol washes (100%, 95%, 85%, 70% and 50%) for 3 minutes each at room temperature. The slides were washed by immersing in 0.85% NaCl and PBS for 5 minutes at room temperature and then fixed by immersing in 4% paraformaldehyde solution in

PBS for 15 minutes at room temperature. After three times wash with PBS, 20 µg/mL proteinase

K solution was applied for 10 minutes, covering the tissue sections, to help permeabilize tissues to the staining reagents in subsequent steps. The slides were washed again with PBS and fixed by 4% paraformaldehyde solution in PBS for 5 minutes at room temperature. To visualize apoptosis (nicked DNA), these sections were equilibrated with 100 µL of equilibration buffer at room temperature for 5-10 minutes and subsequently stained with incubation buffer (45 µL

equilibration buffer, 5 µL fluorescein labeled nucleotide mix and 1 µL terminal deoxynucleotidyl

transferase) in a humidified chamber. Plastic coverslips were placed over heart sections for 60

minutes, to ensure even distribution of the reagent. The reaction was stopped by immersing the

slides into 2X SSC solution (0.15 M Sodium Chloride and 0.015 M Sodium Citrate) for 15 minutes at room temperature, followed by three times wash with PBS. Slides were then mounted with Vectashield containing the nuclear stain, DAPI (Vector Labs, Burlingame, CA). Coverslip was sealed onto slide with nail polish and dried for one hour in the dark. The total nuclei and the number of apoptotic nuclei (TUNEL-positive) were determined by counting the same 96 fields from each group. The images were overlayed and the data were calculated as the percentage of apoptotic nuclei vs. total nuclei.

RNA isolation

Snap-frozen hearts (See Table 5, group I and Table 8, group I) were pulverized, put in

Trizol solution (50 mg tissue/1 mL, Invitrogen, Carlsbad, CA), and immediately homogenized with a mini-tissue homogenizer. Cardiac homogenate (750 µL) was transferred into a 1.5- microcentrifuge tube and centrifuged at 12,000X g for 10 minutes. Supernatant was incubated at room temperature for 5 minutes. RNA was extracted by phase separation with 100 µL bromochloropropane, vortexed at highest speed, and centrifuged at 12,000X g at 4ºC for 15 minutes. The aqueous phase was transferred into a new tube and RNA was precipitated by adding one-half volume of isopropanol. The RNA was pelleted via centrifugation at 4ºC for 10 minutes, and washed with 1 mL 75% ethanol to remove excess salt, and then centrifuged at

130,000 rpm for one minute. The pellets were air dried for 15 minutes and dissolved in 30 µL

RNase/DNase free water. To assess the integrity of the RNA, an RNA sample, which contained 1

µL of RNA, 13 µL water and 6 µl 6X bromophenol blue loading dye mixture, was loaded onto a

1% agarose gel containing 0.01% ethidium bromide (Bio-Rad, Hercules,CA), run at 130 V for 40

minutes and visualized for the appearance of two strong bands (28S and 18S) and a faint band

(5S). The purity and concentration of RNA was determined spectrophotometrically at an

ultraviolet (UV) absorbance of 260 nm and 280 nm. Calculation of the RNA concentration was based on the absorbance at 260 nm, and RNA purity was determined from the 260 nm/280 nm ratio; a low ratio indicates contamination by protein. RNA samples were frozen and stored at -

80°C until further use.

Reverse transcription and real-time PCR

Reverse transcription was performed with the SuperScript™ Double-Stranded cDNA

Synthesis Kit (Invitrogen, Carlsbad, CA). Briefly, 6 µg of DNase-treated RNA was incubated at

65ºC for 5 minutes with random hexamer and 2 µL of 10 mM dNTP. RNA samples were quickly

chilled on ice. To obtain a higher yield of full length cDNA, samples were incubated, at room

temperature, for 2 minutes, with 4 µL of 10X reverse transcription buffer, 8 µL of 25 mM

MgCl2, 4 µL of 0.1 M DTT and 2 µL of RNase H inhibitor. First strand cDNA synthesis was

performed by adding 2µL (50 units) Superscript II revese transcriptase in 25ºC for 10 minutes

and then 45ºC for 50 minutes. The reaction was terminated at 70ºC for 15 minutes. After being

chilled on ice, cDNA samples were treated with RNase H to eliminate the remaining RNA.

Direct detection of polymerase chain reaction (PCR) product was monitored by

measuring the increase in fluorescence caused by the binding of SYBR Green (Applied

Biosystem, Foster City, CA) to double-stranded (ds) DNA. One microliter of DNA plus 23 µL

PCR master mixture [12 µL SYBR mix, 9 µL water and 1 µL each of 5’ and 3’ primer (10

mM)(Table 10)] were subjected to RT-PCR reaction. The following PCR protocol was used:

initial denaturing step, 1 cycle (95°C for 10 minutes), followed by 40 cycles of denaturing (95°C

for 45 seconds), annealing (65°C for 45 seconds) and extension (72°C for 90 seconds). The

amount of fluorescence that was incorporated into PCR product was detected under the

GeneAmp® 5700 Sequence Detection System. Relative quantity of a target gene was represented by fold change against an 18S internal standard. Relative fold change were calculate by following equation (CT: cycle threshold): Fold change = [2^(∆CT1-∆CTavgwt)+ 2^(∆CT2-

∆CTavgwt)+…….+ 2^(∆CTn-∆CTavgwt)]/n, ∆CT=(CTn-CT18Sn). The genes that were evaluated and

the primer sets used are shown in Table 10.

Gene microarray analysis

Gene microarrays, evaluated by the University of Cincinnati core facility

(http://microarray.uc.edu) containing spots representing the Mouse Exonic Evidence-Based

Oligonucleotide (MEEBO) library (35,302 optimized mouse 70-mers targeting 25,000 genes),

were employed to identify the change of gene expression in designated RNA samples. Twenty micrograms of RNA (see Table 5, group I and Table 8, group I) was converted to cDNA and printed onto an aminosilane-coated slides. The printed slides were UV cross-linked and stored at room temperature under vacuum. The cross-linked oligonucleotides were subsequently labeled

with Cy3 or Cy5 fluorophores and hybridized to the arrays. Slides were imaged using a GenePix

Table 10: Fibroblast growth factor (FGFs) primer sets used in real-time PCR evaluation of gene expression level of FGFs in hearts

Primer sets Sense primer 5’-GCGGAGAAGAACTGGTTTGTG-3’ FGF1 Antisense primer 5’-CGAGGACCGCGCTTACAG-3’ Sense primer 5’-AGAGATTTCGGGTGTGAATTG-3’ FGF6 Antisense primer 5’-AGTAGAGTCTCCGCTGTCGCTTAA-3’ Sense primer 5’-TCATGCTTCCACCTCGTCTGT-3’ FGF7 Antisense primer 5’-CCGGACTCATGTCATTGCAA-3’ Sense primer 5’-CAAAGGCAAGGACTGCGTATT-3’ FGF8 Antisense primer 5’-TGCAGCGCCGTGTAGTTG-3’ Sense primer 5’-CAGCGGGACCAAGAATGAAG-3’ FGF10 Antisense primer 5’-TCCGATTTCCACTGATGTTATCTC-3’ Sense primer 5’-GGGACCAAGGACGAAAACAG-3’ FGF12 Antisense primer 5’-CCACCACACGCAGTCCTACA-3’ Sense primer 5’-GCCGACAAGGCTACCACTTG-3’ FGF13 Antisense primer 5’-CGTCTTTGGTGCCATCAATG-3’ Sense primer 5’-CACCAGAAATTCACTCACTTTTTACC-3’ FGF16 Antisense primer 5’-CTGGACATGGAGGGCAACTTA-3’ Sense primer 5’-TGCTGTGCTTCCAGGTTCAG-3’ FGF18 Antisense primer 5’-GCGGAAGTCCACATTC-3’ Sense primer 5’-TCCTGGAATTCATCAGTGTGGC-3’ FGF20 Antisense primer 5’-CAAAATACCTGCGACCCGTGTT-3’

4000A and 4000B and associated software from Axon Instruments, Inc, and differential gene expression levels were determined by the calculated ratio of Cy3 to Cy5 emittance. A low resolution preview scan and a high-resolution scan were used to determine the baseline and maximum level of photomultiplicator (PMT). Figure 9 shows the experimental design. First, alterations of gene expression in non-ischemic hearts were measured (Figure 9A). Wt, Fgf2 KO and FGF2 LMWKO were paired into three groups: 1) Wt vs. Fgf2 KO, 2) Wt vs. FGF2

LMWKO, and 3) Fgf2 KO vs. FGF2 LMWKO. Second, alteration of gene expression following

I/R injury were also measured (Figure 9B). Sham (hearts equilibrated for 3.5 hours) and ischemic-reperfused Wt, Fgf2 KO and FGF2 LMWKO hearts were paired into six groups: 1)

Sham vs. I/R Wt, 2) Sham vs. I/R Fgf2 KO, 3) Sham vs. I/R FGF2 LMWKO, 4) I/R treated Wt

vs.Fgf2 KO, 5) I/R treated Wt vs.FGF2 LMWKO, and 6) I/R treated Fgf2 KO vs. FGF2

LMWKO, to determine the role of specific FGF2 isoform in regulating gene expression during

I/R injury. Each group was repeated four times to achieve statistical significance.

Wt Fgf2 KO FGF2 LMWKO

Non-ischemic

B. Wt Fgf2 KO FGF2 LMWKO Sham

Ischemia-reperfusion injury

Figure 9: Schematic for DNA microarray analysis of gene expression. Non-ischemic (A)

wildtype (Wt, square), Fgf2 KO (triangle) and FGF2 LMWKO (diamond) hearts or hearts

that were subjected to sham (3.5 hour perfusion) or I/R injury (B) were competitively

hybridized to microarrays containing cDNA targets. RNA samples from four separate hearts were evaluated, in triplicate.

Nuclear preparation for electrophoretic mobility shift assay (EMSA)

Snap-frozen hearts (See Table 8) were powdered and homogenized in 10X volume (based

on heart weight) of homogenization buffer A (10 mM HEPES pH 7.9, 1.5 mM MgCl2, 10 mM

KCl, 0.5 mM DTT, 0.2 mM sodium orthovanadate, and 1 mL Sigma Protease Inhibitor

Cocktail/20 g tissue). Homogenates were incubated on ice, vortexed and centrifuged at 5000g for

10 minutes. The supernatant contained the cytosolic fraction. The pellets were washed with homogenization buffer C (20 mM HEPE, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM DTT,

0.2 mM sodium orthovanadate, and 25%(v/v) glycerol, 0.6 M KCl, 1.5 mM MgCl2, 0.2 mM

EDTA and 1 mL Sigma Protease Inhibitor Cocktail/20 g tissue)] and resuspended with 5X volume of homogenization buffer C. The re-suspended solution was incubated on ice for 40 minutes and subsequently centrifuged at 10,000g for 15 minutes. The supernatant was the nuclear extract. Bio-Rad Lowry protein assay was used to determine the protein concentration in the nuclear extract.

Electrophoretic mobility shift assay (EMSA) procedure

Labeling

NF-κB oligonucleotide labeling was performed by incubating 2 µL NF-κB Oligo

(Promega, Madison, WI) with T4 polynucleotide kinase and γ-32P ATP at 37ºC for 30 minutes.

The sequence of the NF-κB oligo was 5’-AGT TGA GGG GAC TTT CCC AGG C-3’. The

kinase reaction was stopped by adding 1 µL of 0.5 M EDTA and diluted by adding 89 µL of

Milli-Q water. The entire reaction was then transferred to a ProbeQuest G50 Spin column and spin at 3000 rpm for 2 minutes to remove the unincorporated nucleotides from the DNA probe.

One microliter of labeled oligonucleotide before or after passing through the G50 Spin column

100

was spotted onto filters. The filters were twice washed with 50 µL of 0.5 M Na2HPO4 and placed

into individual vials containing appropriate scintillation fluid and counted in a scintillation

counter. The percent incorporation was calculated by the ratio of cpm (count per minutes)

incorporated vs. total cpm.

DNA Binding Reaction

Twenty micrograms of nuclear extract (See Table 8) were incubated with 5X binding

buffer [20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris-

HCl and 0.25 mg/mL poly (dI-dC)·poly (dI-dC)] at room temperature for 10 minutes. One

microliter of 32γ-P-label oligonucleotide was added to the reaction at room temperature for 20 minutes and the reaction was stopped by adding 1 µL 10X loading buffer (250 mM Tris-HCl,

0.2% bromophenol blue, 40% glycerol).

Electrophoresis of DNA protein complexes

32γ-P labeled NF-κB oligo-nuclear extract complexes were loaded onto a pre-run 6%

acrylamide gel at 150 V for 2 hours until the gel dyeline was near the end of the gel. The gel was

subsequently transferred to Whatman filter paper and dried at 65ºC for 2 hours. Gel/filter paper

was exposed to the film or phosphoscreen and store at -20ºC for 1-5 days. The film was

developed and visualized. Semi-quantitation (lack of the loading control) of the densitometry of

protein-DNA complex was performed. The trend of transcriptional activity was determined.

101

Statistical analysis

All values in the text and figures were represented as mean±SEM of n independent

experiments. In Wt, Fgf2 KO and FGF2 LMWKO groups, and NTg vs. human FGF2 HMW 24

kD Tg groups, percent recovery of cardiac function, infarct size (ex vivo and in vivo), RT-PCR,

vascular density, immunoblotting, CK release and TUNEL assay were subjected to one-way

analysis of variance (ANOVA) followed by Students’ t-test. In Wt vs. FGF2 HMWKO groups,

percentage of contractile function, infarct size (ex vivo), vascular density and immunoblotting

were subjected to Students’ t-test. In Wt vs. FGF2 HMWKO groups, FGF2 release and CK

release were subjected to one-way ANOVA followed by Students’ t-test. Time course and

pharmacological treatment studies were using two-way ANOVA following by Students’t-test.

Probabilities of 0.05 or less (p<0.05) were considered statistically significant.

The statistical analysis for microarray was performed for each time point comparison and

for each gene separately by fitting the following Analysis of Variance (ANOVA) model: Yijk =

th µ + Ai + Sj + Ck+ εijk, where Yijk corresponds to the normalized log-intensity on the i array, with

the jth treatment condition, and labeled with the kth dye (k = 1 for Cy5, and 2 for Cy3). µ is the

th th overall mean log-intensity, Ai is the effect of the i array, Sj is the effect of the j treatment and

th Ck is the gene-specific effect of the k dye. Resulting T-statistics from each contrast were

modified using an empirical Bayesian moderated-T method700. False discovery rate (FDR)<0.10

and P<0.005 were the cutoff. This method uses variance estimates from all genes to improve the variance estimates of each individual gene. Statistical analyses were performed in R statistical software using the Bioconductor platform.

102

Chapter 1. Role of FGF2 EXON3 in ischemia reperfusion injury

Results

Cardiac characterization of FGF2 EXON3 knockout hearts

The Fgf2 gene contains three exons (Exon 1, 2 and 3) separated by two introns and

very large 5’- and 3’- non-coding regions. Borja and colleagues151 identified two alternatively

spliced isoforms termed canonical bFGF and alternative-bFGF (alt-bFGF) in chicken embryo. If

mouse had these two alternatively spliced isoforms, the Fgf2 KO mouse (generated by Ming

Zhou and Dr. Thomas Doetschman335) would have these two isoforms which would be still

functional. The common properties of these alternative spliced transcripts are that they both contain exon2 and exon3. Hence, if the expression of exon 3 was blocked, there could be no functional transcripts.

Immunoblotting showed that ablation of exon3 (EXON3 KO) resulted in no expression of any FGF2 protein isoform (Figure 10A) and no significant difference in heart weight (mg)-to- body weight (g) ratio between FGF2 EXON3 KO hearts (7.88±0.72 mg/g) and wildtype hearts

(8.47±0.5 mg/g). To elucidate the effect that exon 3 has on ischemic heart disease, FGF2

EXON3 KO mouse hearts were subjected to ischemia-reperfusion injury (60 minutes global, low-flow ischemia and 120 minutes reperfusion). There was a significant decrease in percent recovery of post-ischemic contractile and relaxation function (Figure 10B and C, p<0.05) and no difference in myocardial infarction in exon 3 knockout mice compared to wildtype hearts (Figure

11). These observations were similar to our observations with the EXON1 knockout (Fgf2 KO) mice73 (Figure 11). There was no difference in MAPK activation in non-ischemic hearts of exon

3 knockout mice compared to wildtype mice (Figure 12) and the total MAPK expression level

was not altered in FGF2 EXON3 KO hearts.

103

22 kD 21 kD

18 kD

Wt EXON3 knockout EXON1 knockout B. * p<0.05 vs. Wt Wt 70 FGF2 EXON3 KO 60 FGF2 EXON1 KO 50

40 (%) * * 30 20

Percent recovery of post- 10 ischemic systolic function 0

40 * *

30 (%) 20

10 Percent recovery of post- ischemic diastolic function 0

Figure 10: Cardiac characterization of FGF2 EXON3 KO hearts. (A) Representative Western blot of FGF2 isoform expression in non-ischemic Wt, FGF2 EXON3 KO and FGF2 EXON1 KO mouse hearts. There was no FGF2 protein expression in FGF2 EXON3 KO and FGF2 EXON1 KO hearts. (B) and (C) Percent recovery of post-ischemic systolic and diastolic function in Wt (black bar), FGF2 EXON3 KO (light gray bar) and FGF2 EXON1 KO (dark gray bar). Percent recovery of cardiac function was depicted as the ratio of +dP/dt (systolic) or –dP/dt (diastolic) at 120 minutes reperfusion to baseline measure. After ischemia- reperfusion injury, there was a significant decrease in recovery of post-ischemic systolic (B) and diastolic (C) function in FGF2 EXON3 KO and FGF2 EXON1 KO hearts compared to Wt hearts. n= 5 for Wt, n=5 for FGF2 EXON3 KO hearts, and n=6 for FGF2 EXON1 KO hearts. *p<0.05 vs. Wt hearts.

104

Wt 100 FGF2 EXON3 KO FGF2 EXON1 KO

40 Infarct Size

20 (% of area at risk [whole heart])

Figure 11: Myocardial infarction measured as a percent of area at risk in Wt (black bar), FGF2 EXON3 KO (light gray bar) and FGF2 EXON1 KO (dark gray bar) hearts following 60 minutes global low-flow ischemia and 120 minutes reperfusion. There was no difference in infarct size between the three groups. n= 3 for Wt and FGF2 EXON3 KO hearts. n=6 for FGF2 EXON1 hearts.

105

A. Wt 1.6 FGF2 EXON3 KO 1.4 1.2 1 0.8 0.6

Activation of ERK 1 0.4

(phospho- vs. total ERK1) 0.2 0 B. 0.9 0.8 0.7

) 0.6 0.5 0.4 MAPK 0.3 0.2

(phospho- vs. total p38 0.1 Activation of p38 MAPK 0 C. 1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 Activation of JNK 0.1 (phospho- vs. total JNK) 0

Figure12: MAPK activation, as measured by phosphorylation, in non-ischemic Wt (black) and FGF2 EXON3 KO (gray bar) hearts. There was no significant difference in (A) ERK1, (B) p38 MAPK and (C) JNK activation between Wt and FGF2 EXON3 KO hearts. n=3/group.

106

Discussion

Evidence suggests that FGF2 has two alternatively spliced isoforms including canonical

bFGF and alternative-FGF2 (alt-FGF2) in chicken embryo and mouse151,701. Mice with either of these two spliced isoforms have an alternative exon 1 with its own promoter701 besides its

original 3 exons (exon 1, 2 and 3)702. Transcripts derived from the original first exon contain

alternative CUG translation start sites upstream of a regular AUG start site702,703. Deletion of the

first exon results in the absence of all these isoforms335 referred as Fgf2 KO in this dissertation.

There is also a mouse model in which exon 2 is ablated161. Disruption of exon 1 or exon 2 results

in a mild vascular defect; otherwise, the mice are fertile, viable and phenotypically

indistinguishable from the wildtype161,335. Both mice show a delayed wound healing, a decreased bone mass and a decreased blood pressure161,335. Both exon 1 and exon 2 knockout mice may

still have the alternate exon 1, resulting in a pseudo Fgf2 KO mice. One of the commonalities of exon 1 and exon 2 knockout mice is the presence of exon3. Therefore, the idea is that with the

removal of exon 3, there will be no functional transcript. The absence of exon 3 resulted in a

disruption of FGF2 protein translation since no FGF2 proteins expressed in FGF2 EXON3 KO mice (Figure 10A). EXON3 knockout mice have no cardiac hypertrophy or significant cardiac

defects, displaying a similar cardiac phenotype as EXON1 KO (Fgf2 KO) and EXON2 KO

hearts161. This alternative exon 1 and original exon 1 seem to have a similar function in I/R

injury as both EXON1 KO and EXON3 KO mice do not recover from I/R injury (Figure 10B

and C), and their myocardial infarct size was similar (Figure 11). The effect observed in EXON1

KO (Fgf2 KO) is due to the absence of FGF2 protein but not due to the presence of this alternate

exon 1. Preliminary data indicated that the outcome following I/R injury due to exon 3 ablation

may not be mediated through MAPK signaling, since no alteration in MAPK activation was

107

observed in non-ischemic EXON3 KO hearts (Figure 12). However, the number of mice (n=3)

subjected to the Western immunoblotting study was small and more mice may need to be studied

to achieve statistical significance. Furthermore, other signaling pathways of interest need to be

evaluated to elucidate whether the underlying mechanism is the same in FGF2 EXON3 KO and

FGF2 EXON1 KO hearts after I/R injury.

Overall, this evidence shows that EXON3 KO (ablation of alternative EXON1) displayed

a similar phenotype in I/R injury as the Fgf2 KO (EXON1 KO) previously published by lab73 indicating that this alternative exon 1 does not have an unique function in I/R injury compared to original exon 1. Therefore, FGF2 EXON1 KO (Fgf2 KO) hearts will be used as a negative control to elucidate the role of the FGF2 LMW isoform or FGF2 HMW isoforms in I/R injury.

108

Chapter 2. Role of FGF2 LMW isoform in ischemia-reperfusion injury

Results

Cardiac characterization in mice with ablation of all FGF2 isoforms (Fgf2 KO) or the

FGF2 LMW (FGF2 LMWKO) isoform

Previous studies showed that Fgf2 KO mice had no significant cardiac defects162,334,335.

There was no significant difference in heart weight-to-body weight ratio (mg/g) between wildtype (5.0±0.1), Fgf2 KO (4.9±0.1 and FGF2 LMWKO (5.3±0.2) (Figure 13), indicating that ablation of either the LMW or all isoforms did not alter cardiac growth or induce spontaneous cardiac hypertrophy.

Cardiac levels of the FGF2 HMW isoforms in the FGF2 LMWKO mice were determined by immunoblotting. No difference in expression of the FGF2 HMW isoforms was observed in non-ischemic FGF2 LMWKO cardiac tissue (Figure 14A), suggesting that their expression was not FGF2 LMW isoform-dependent. No FGF2 LMW isoform was detected in FGF2 LMWKO mice (Figure 14B).

No significant alteration in vessel number or defects in vasculogenesis or angiogenesis was observed in Wt, Fgf2 KO and FGF2 LMWKO mouse hearts. There was no significant difference in the number of smooth muscle-containing blood vessels per square millimeter (mm2) in Wt (8.8±0.4), Fgf2 KO (9.7±0.7) and FGF2 LMWKO (8.6±0.4) hearts. Also, in FGF2

LMWKO (51.8 ±5.1) and Wt (55.1±4.0) groups, the cardiac capillary density was similar to Fgf2

KO groups as measured previously73.

109

5 Fgf2 KO FGF2 LMWKO

1 Heart weight (mg)-to-body weight (g) ratio Heart weight (mg)-to-body

Figure 13: Heart weight-to-body weight ratio (mg/g) in Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) mice. There was no significant difference in heart weight to body weight ratio between Wt, Fgf2 KO and FGF2 LMWKO groups, indicating that ablation of all FGF2 isoforms or only the FGF2 LMW isoform did not alter cardiac growth or cause spontaneous hypertrophy. n=60 for Wt, n=30 for Fgf2 KO and n=40 for FGF2 LMWKO groups.

110

22 kD 21 kD

18 kD

Wildtype Fgf2 KO FGF2 LMWKO

B. 250 Wt FGF2 LMWKO 200

150

100 Arbitrary Unit 500

0 21 kD 22 kD (21 and 22 kD FGF2 HMW isoform)

Figure 14: FGF2 protein expression in non-ischemic wildtype (Wt) and FGF2 LMWKO mice hearts. (A) Representative Western blot of FGF2 isoform expression in non-ischemic hearts. Wt mouse hearts expressed one FGF2 LMW isoform (18 kD) and two FGF2 HMW isoforms (21 and 22 kD). No FGF2 isoforms were present in Fgf2 KO mouse hearts and no FGF2 LMW isoform was expressed in FGF2 LMWKO mouse hearts. (B) Quantification of HMW isoforms expression in FGF2 LMWKO mouse hearts. There was no difference in either the murine 21 kD or 22 kD FGF2 HMW isoform expression in FGF2 LMWKO hearts compared to Wt hearts. n=6 for Wt, Fgf2 KO and FGF2 LMWKO groups.

111

Effect of ablation of all FGF2 isoforms (Fgf2 KO) or the FGF2 LMW (FGF2 LMWKO) isoform on cardiac gene expression of other FGFs

Twelve FGF isoforms (FGF 1, 2, 6, 7, 8, 10, 12, 13, 16, 18, 19 and 20) are found in the heart704, and among these twelve FGF isoforms, FGF1 has been studied extensively as a

cardioprotective molecule705,706. Since there was no cardiac defect in either Fgf2 KO or FGF2

LMWKO hearts, it is possible that there may be alterations in the expression of other FGFs that

are expressed in the heart and act as a compensatory mechanism during cardiac development and

possible during I/R injury. Therefore, mRNA from non-ischemic Wt, Fgf2 KO and FGF2

LMWKO hearts was subjected to real-time PCR to determine the gene expression level of those

other cardiac FGFs. Due to the difficulty in primer design, the mRNA level of FGF19 is not

elucidated. There was a significant decrease in FGF1 mRNA level in FGF2 LMWKO hearts, a

significant increase in FGF6 mRNA level in Fgf2 KO hearts and a significant decrease in FGF13

mRNA level in both Fgf2 KO and FGF2 LMWKO hearts (Table 11, p<0.05). FGF1 is a potent

angiogenesis factor707. In addition, FGF1 can prevent cardiomyocyte loss708 and improve cardiac

function after I/R injury709. FGF1 mRNA level was downregulated in FGF2 LMWKO hearts, but not in Fgf2 KO hearts, indicating that the FGF2 LMW isoform and HMW isoforms had opposite

outcomes in regulating FGF1 mRNA level. FGF6 mainly participates in muscle maintenance and

regeneration710 and this increase in FGF6 gene expression may be the result of a compensation

for FGF2 loss which could be the reason that there is no morphological changes in Fgf2 KO hearts. These data suggest that FGF2 HMW isoforms may have an direct or indirect influence on

FGF6 gene expression since just ablation of the LMW isoform (FGF2 LMWKO) did not affect the mRNA level of FGF6. FGF13 is essential for neural differentiation during embryogenesis711.

FGF13 mRNA was downregulated in both Fgf2 KO and FGF2 LMWKO hearts and there was no

112

difference between Fgf2 KO and FGF2 LMWKO hearts indicating that FGF2 LMW isoform is

regulating FGF13 mRNA expression. Overall, there was no alteration in cardiac phenotype in

Fgf2 KO and FGF2 LMWKO hearts. This can suggest that the LMW isoform or the HMW isoforms did not alter cardiac phenotype; however, this can also indicate that either the LMW

isoform and/or the HMW isoforms may influence the cardiac phenotype, but this effect may be compensated by the alteration of other FGFs.

113

Table 11. mRNA level of various FGFs in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts.

Relative fold change Wt Fgf2 KO FGF2 LMWKO

FGF 1 1.27±0.48 0.95±0.08 0.52±0.15*

FGF 6 1.15±0.30 4.43±1.63* 1.07±0.28

FGF 7 1.11±0.28 0.96±0.23 0.80±0.3

FGF 8 1.24±0.48 1.83±0.64 2.13±0.78

FGF 10 1.17±0.34 0.67±0.24 0.97±0.62

FGF 12 1.11±0.38 0.62±0.15 0.94±0.34

FGF 13 1.09±0.28 0.68±0.02* 0.64±0.14*

FGF 16 1.00±0.02 0.83±0.11 1.02±0.53

FGF 18 1.07±0.28 0.74±0.29 0.69±0.14

FGF 20 1.17±0.46 0.96±0.22 1.06±0.49

The relative levels of FGFs expressed in non-ischemic Fgf2 KO and FGF2 LMWKO hearts were compared to those in Wt hearts. All values were presented as mean ± SEM of n independent experiments. n=6/group for Wt, Fgf2 KO and FGF2 LMWKO. *p<0.05 vs. Wt.

114

Effect of the FGF2 LMW isoform on post-ischemic myocardial dysfunction

To elucidate the role of the FGF2 LMW isoform in ischemia-reperfusion injury, Wt, Fgf2

KO and FGF2 LMWKO hearts were subjected to 60 minutes of global, low-flow ischemia and

120 minutes of reperfusion. Following ischemia-reperfusion injury, there was significant systolic

and diastolic dysfunction as measured by left ventricular systolic pressure (LVSP), +dP/dt

(derivative of change in contractile pressure over time), left ventricular end-diastolic pressure

(LVEDP), -dP/dt (derivative of change in relaxation pressure over time), and oxygen

consumption in Fgf2 KO and FGF2 LMWKO hearts compared to Wt hearts (p<0.05, Table 12).

There was increased cardiac contractile function and oxygen consumption in FGF2 LMWKO

hearts at baseline, indicating that the FGF2 LMWKO heart needs a higher energy demand under

normal conditions. After I/R injury, the systolic and diastolic dysfunction led to a significant

decrease in post-ischemic recovery of contractile and relaxation function in Fgf2 KO hearts

(39±4% and 33±4%, respectively) and FGF2 LMWKO hearts (47±5% and 42±4%, respectively)

compared to Wt hearts (60±7% and 56±4%, respectively) (p<0.05, Figure 15A). There was no

difference in systolic and diastolic parameters between Fgf2 KO and FGF2 LMWKO hearts

following I/R injury (Table 12), suggesting that the FGF2 LMW isoform is most likely the

isoform required for protecting the heart from myocardial dysfunction and plays a beneficial role

in ischemia-reperfusion injury.

115

Table 12. Cardiac function in Wt, Fgf2 KO and FGF2 LMWKO hearts subjected to 60’I/120’R.

Baseline 60’ischemia/120’reperfusion

Wt Fgf2 KO FGF2 LMWKO Wt Fgf2 KO FGF2 LMWKO

LVSP 95±2 96±3 100±22* 70±5 45±16* 58±7* (mmHg)

LVEDP 7±1 6±4 6±1 19±3 17±8 22±4* (mmHg)

+dP/dt 4076±119 3781±86* 4458±124* 2723±211 1460±453* 2054±329* (mmHg/sec)

-dP/dt -3222±115 -2945±66* -3566±115* -1808±113 -949±203* -1510±187* (mmHg/sec)

O2 consumption 129±13 109±19.5 170±19* 131±24 119±44 161±18 (∆L min-1g-1)

All values presented as mean ± SEM of n independent experiments. LVSP: left ventricle systolic pressure. LVEDP: left ventricle end diastolic pressure. ±dP/dt: derivative of change in contractile (+) and relaxation (-) pressure over time. n=10 for Wt, n=5 for Fgf2 KO and n=14 for FGF2 LMWKO. *p<0.05 vs. Wt cohort.

116

A. Wt Fgf2 KO 100 FGF2 LMWKO *p<0.05 vs. Wildtype 90 80 70 60 * 50 40 * 30 contractile function (%) 20 66±4% 31±6% 44±8%

Percent recovery of post-ischemic 10 0 B.

100 Wt Fgf2 KO 90 *p<0.05 vs.Wildtype FGF2 LMWKO 80 70 60 50 * * 40 30 relaxation function (%) 20 56±4% 42±4% Percent recovery of post-ischemic 10 33±6% 0 Figure 15: Percent recovery of post-ischemic systolic (A) and diastolic function (B) in Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) hearts following 60 minutes global, low-flow ischemia and 120 minutes reperfusion. Percent recovery of cardiac function is depicted as the ratio of +dP/dt (contractile) or –dP/dt (relaxation) at 120 minutes reperfusion to baseline measure. There was a poorer recovery of post-ischemic contractile and relaxation function in Fgf2 KO and FGF2 LMWKO compared to Wt. n= 18 for Wt, n=12 for Fgf2 KO and FGF2 LMWKO hearts. *p<0.05 vs. Wt hearts.

117

Effect of the FGF2 LMW on myocardial cell injury

Myocardial infarct size was measured both in an ex vivo global, low-flow ischemia model

(isolated work-performing heart) and in an in vivo regional ischemia model (60 minutes left anterior descending artery occlusion and 24 hours reperfusion). There was no difference between

the three ex vivo groups: Wt (22±3%), Fgf2 KO (25±3%), and FGF2 LMWKO (27±4%) (Figure

16A) or the in vivo groups: Wt (49±2%), Fgf2 KO (54±6%), and FGF2 LMWKO (56±4%)

(Figure 17).

Myocardial cell injury, represented as CK release, was measured at designated time

points of baseline equilibration, ischemia and reperfusion (Figure 16B). There was no difference

between the groups at any time points evaluated. Our previous data showed a decrease in

myocardial infarction in mice overexpressing all of the FGF isoforms (LMW and HMW) compared to wildtype hearts73; therefore, these data suggest that all FGF2 isoforms are necessary

to protect the heart from myocardial infarction and cell injury.

118

A. 100 90 Wt Fgf2KO 80 70 FGF2 LMWKO

50 40 Infarct Size [whole heart]) study, % of area at risk 30

ex vivo ( 10 0 B. 0.06 Wt Fgf2 KO 0.05 FGF2 LMWKO

0.04

0.03

0.02

0.01

Creatine Kinase release (U/min*g)

12 14 2-4 2-4 - 0-2 0-2 - 4-6 4-6

6-8 0-30 0-30 8-10 8-10 24-26 24-26 28-30 28-30 26-28 26-28 45-60 45-60 10 12 116-118 114-116 118-120 Equilibration Ischemia Reperfusion (min) (min) (min)

Figure 16: Myocardial cell injury, measured as myocardial infarct size (A) and creatine kinase release (B), in Wt, Fgf2 KO and FGF2 LMWKO hearts following ex vivo 60 minutes global low- flow ischemia and 120 minutes reperfusion. (A) There was no difference in infarct size, depicted as a percent of area at risk, in Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar). (B) There was no difference in creatine kinase release in Wt (diamond), Fgf2 KO (square) and FGF2 LMWKO (triangle) hearts. Infarct size study: n= 9 for Wt, n=10 for Fgf2 KO and FGF2 LMWKO hearts. Creatine kinase study: n= 18 for Wt, n=20 for Fgf2 KO and FGF2 LMWKO hearts.

119

Wt Fgf2KO

100 FGF2 LMWKO

90 80 70

60 50 40 Infarct Size

study, % of area at risk) 30

in vivo 10 ( 0

Figure 17: Myocardial infarct size depicted as a percent of area at risk in Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) hearts following in vivo 45 minutes regional ischemia and 24 hours reperfusion. There was no difference in infarct size between the three groups. n=4 for Wt, Fgf2 KO and FGF2 LMWKO hearts.

120

Alteration of PKC activation in non-ischemic Fgf2 KO and FGF2 LMWKO mouse

hearts

To understand how the FGF2 LMW isoform protects against myocardial dysfunction

following I/R injury, it is necessary to determine the potential signaling cascades in the heart that

are modulated by FGF2. The protein kinase C (PKC) signaling cascade is cardioprotective against a variety of stressful stimuli403,416,712. Since our laboratory and others showed that FGF2

can activate the PKC cascade in cardiac tissue187,348, it is possible that PKC signaling may

mediate the cardioprotection elicited by FGF2 LMW isoform. To understand whether

manipulation of FGF2 LMW isoform expression would “prime” the cardiac PKC signaling

pathway, the activation of PKC isoforms (α, δ, ε, and ζ) was assessed in non-ischemic Wt, Fgf2

KO and FGF2 LMWKO hearts. PKC activation was evaluated by both its translocation and phosphorylation status.

There was no significant difference in PKC α, ε, and ζ translocation between non- ischemic Wt, Fgf2 KO, and FGF2 LMWKO mice hearts (Figures 18A, 20A and 21A). However, the translocation of PKC δ was significantly decreased in non-ischemic Fgf2 KO and FGF2

LMWKO hearts compared to non-ischemic Wt hearts (Figure 19A). Activation of PKC α, δ, ε, and ζ, indicated as the ratio of phospho-isozyme vs. total PKC isozyme, was not different between non-ischemic Wt, Fgf2 KO and FGF2 LMWKO groups (Figures 18B, 19B, 20B and

21B). There was no difference in total PKC α, δ, ε and ζ protein level between the three groups.

The phosphorylation state and translocation of PKC is not always correlated as shown by our labortary348. Our data showed that the LMW isoform can modulate PKC δ translocation in hearts

but not its phorphorylation state.

121

A. Wt 0.9 PKC α Fgf2 KO

FGF2 LMWKO ) 0.8 α

0.7 0.6 tosol ratio y 0.5 0.4 0.3 0.2 Translocation of PKC membrane vs. c (

0.1 0

B. PKC α 2.5 ) α α

1.5

0.5 Phosphorylation of PKC (phospho- vs. total PKC

122

C. Cy M Cy M Cy M

Wt Fgf2 KO FGF2 LMWKO

PKC α

FGF2 FGF2 Wt Fgf2 KO LMWKO Wt Fgf2 KO LMWKO

PKC α

Phosphorylation Total

Figure 18: PKC α kinase activation, as measured by translocation (A) and phosphorylation (B) in non-ischemic Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) hearts. There was no significant difference in PKC α translocation or phosphorylation in non- ischemic Fgf2 KO and FGF2 LMWKO hearts compared to Wt hearts. (C) Representative Western blot depicting activation of PKC α in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. Cy: cytosolic fraction; M: Membrane fraction. n=8 Wt, Fgf2 KO and FGF2 LMWKO groups.

123

A. Wt PKC δ Fgf2KO

4 FGF2 LMWKO

δ 3.5 3 *p<0.05 vs.Wildtype 2.5 2 * 1.5 * 1 0.5 Translocation of PKC

(membrane vs. cytosol ratio) 0 B.

1.6 PKC δ

1.4 ) δ δ 1.2

0.8

0.6

0.4 (phospho- vs. total PKC Phosphorylation of PKC 0.2

124

Cy M Cy M Cy M C. Wt Fgf2 KO FGF2 LMWKO

PKC δ

FGF2 FGF2 Wt Fgf2 KO LMWKO Wt Fgf2 KO LMWKO

PKC δ

Phosphorylation Total

Figure 19: PKC δ activation, as measured by translocation (A) and phosphorylation (B) in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. There was a significant decrease in PKC δ translocation in FGF2 LMWKO compared to Wt hearts. There was no significant difference in PKC δ phosphorylation between the non-ischemic hearts. (C) Representative

Western blot depicting activation of PKC δ in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. n=6 Wt, Fgf2 KO and FGF2 LMWKO groups. Cy: cytosolic fraction; M: membrane fraction. *p<0.05 vs. Wt hearts.

125

PKC ε A. 5 Wt Fgf2 KO 4.5 FGF2 LMWKO

ε 4 3.5 3 2.5 2 1.5

Translocation of PKC 1 (membrane vs. cytosol ratio) 0.5 0 B.

2.5 PKC ε

ε ε) 2

1.5

0.5 Phosphorylation of PKC (phospho- vs. total PKC 0

126

C. Cy M Cy M Cy M

Wt Fgf2 KO FGF2 LMWKO

PKC ε

FGF2 FGF2 Wt Fgf2 KO LMWKO Wt Fgf2 KO LMWKO

PKC ε

Phosphorylation Total

Figure 20: PKC ε activation, as measured by translocation (A) and phosphorylation (B) in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. There was no significant difference in PKC ε translocation or PKC ε phosphorylation in non-ischemic Fgf2 KO and FGF2 LMWKO hearts compared to Wt hearts. (C) Representative Western blot depicting activation of PKC ε in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. Cy: cytosolic fraction; M: membrane fraction. n=8 Wt, Fgf2 KO and FGF2 LMWKO groups.

127

PKC ζ Wt A. Fgf2KO 1.2 FGF2 LMWKO

ζ 1

0.8

0.6

0.4

0.2 Translocation of PKC

(membrane vs. cytosol ratio) 0

B. PKC ζ 4

ζ 3.5 ζ) 3

2.5

1.5

1 Phosphorylation of PKC (phospho- vs. total PKC 0.5

128

C. Cy M Cy M Cy M Wt Fgf2 KO FGF2 LMWKO PKC ζ

FGF2 FGF2 Wt Fgf2 KO LMWKO Wt Fgf2 KO LMWKO

PKC ζ

Phosphorylation Total

Figure 21: PKC ζ activation, as measured by translocation (A) and phosphorylation (B) in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. There was no significant difference in PKC ζ translocation or phosphorylation in non-ischemic Fgf2 KO and FGF2 LMWKO hearts compared to Wt hearts. (C) Representative Western blot depicting activation of PKC ζ in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. Cy: cytosolic fraction; M: membrane fraction. n=8 Wt, Fgf2 KO and FGF2 LMWKO groups.

129

Alteration of MAPK and PI3 kinase/Akt activation in non-ischemic Fgf2 KO and FGF2

LMWKO mouse hearts

Besides PKC signaling, FGF2 elicits its biological function through other cellular pathways, including mitogen activated protein kinase (MAPK) and phosphatidylinositol 3' kinase

(PI3 kinase)638,639,641, making it possible that these factors may elicit FGF2 LMW isoform- induced cardioprotection. Both pathways also mediate cardioprotection in response to many different stimuli, including ischemic preconditioning522,539,634, again supporting the hypothesis

that MAPK and/or PI3 kinase signaling may be important in the cardioprotective action of the

FGF2 LMW isoform. To elucidate whether ablation of either all FGF2 isoforms or only the

LMW isoform alters the activity of MAPK and PI3-kinase, the activation (i.e. phosphorylation)

state of JNK, p38 MAPK and ERK, arms of MAPK signaling, and Akt was examined in non-

ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts.

There was a significant increase in phosphorylation of JNK (p<0.05, Figure 24A), a

decrease in phosphorylation of p38 MAPK (p<0.05, Figure 23A), but no difference in

phosphorylation of ERK (Figure 22A) in Fgf2 KO and FGF2 LMWKO hearts compared to Wt

hearts. Protein expression of the MAPKs was not different among groups. There was also a

significant decrease in Akt activation (i.e. phosphorylation) in Fgf2 KO and FGF2 LMWKO

hearts compared to Wt hearts (p<0.05, Figure 26A). Protein expression of the Akt was not

different among groups (Figure 26B). To verify that the observed alterations in JNK and p38

MAPK phosphorylation (activation) were caused by the LMW isoform of FGF2, FGF2

LMWKO hearts were exogenously treated with recombinant mouse LMW FGF2 (rmLMW

FGF2, 10µg/heart) and arrested five minutes after administration. A significant decrease (53%)

in JNK phosphorylation (p<0.05) and a marked increase (50%) in p38 MAPK phosphorylation

130

(p<0.05) was observed in rmLMW FGF2-treated vs. saline-treated FGF2 LMWKO hearts

(Figure 25). Overall, these data indicate that manipulation of the LMW FGF2 protein isoform

expression modulates the level of MAPK phosphorylation, in particular p38 MAPK and JNK, and also, for the first time, indicate that manipulation of the FGF2 LMW protein isoform expression altered the activation of Akt.

131

A. ERK Wt 2 Fgf2 KO 1.8 FGF2 LMWKO 1.6 1.4 1.2

1 0.8

Activation of ERK 0.6 (phospho- vs. total ERK) 0.4 0.2 0

B. Wt Fgf2 KO FGF2 LMWKO

Phospho–ERK

Total ERK

Figure 22: ERK activation in non-ischemic Wt (black bar), Fgf2 KO (gray bar), and FGF2 LMWKO (white bar) hearts. One hundred microgram of non-ischemic Wt, Fgf2 KO and FGF2 LMWKO cardiac homogenate was analyzed by SDS-PAGE gel and Western immunoblotting with phospho-ERK and total ERK antibodies. (A) There was no significant difference in ERK activation. (B) Representative Western blot depicting the phosphorylation of ERK and total ERK protein level in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. There was no significant difference in ERK total protein level between the three groups. n=8 Wt, Fgf2 KO and FGF2 LMWKO groups.

132

A. 1.6 p38-MAPK Wt Fgf2 KO 1.4 FGF2 LMWKO 1.2 *p<0.05 vs. Wt 1

0.8

0.6 * * 0.4 Activation of p38-MAPK Activation of p38-MAPK

(phospho- vs. total p38 MAPK) 0.2

0 B.

Wt Fgf2 KO FGF2 LMWKO

Phospho–p38 MAPK

Total p38 MAPK

Figure 23: p38 MAPK activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. One hundred microgram of non-ischemic Wt, Fgf2 KO and FGF2 LMWKO cardiac homogenate was analyzed by SDS-PAGE gel and Western immunoblotting with phospho-p38 MAPK and total p38 MAPK antibodies. (A) There was a significant decrease in p38 MAPK activation in non-ischemic Fgf2 KO and FGF2 LMWKO compared to Wt heart. (B) Representative Western blot depicting the phosphorylation of p38 MAPK and total p38 MAPK protein levels in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. There was no significant difference in total p38 MAPK protein level between the three groups. n=8 Wt, Fgf2 KO and FGF2 LMWKO groups. *p<0.05 vs. Wt.

133

A. JNK Wt *p<0.05 vs. Wt Fgf2 KO FGF2 LMWKO 3.5 * 3 * 2.5

1.5

Activation of JNK 1 (phospho- vs. total JNK) 0.5

0 B.

Wt Fgf2 KO FGF2 LMWKO

Phospho–JNK

Total JNK

Figure 24: JNK activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. One hundred micrograms of non-ischemic Wt, Fgf2 KO and FGF2 LMWKO cardiac homogenate was analyzed by SDS-PAGE gel and Western immublotting with phospho-JNK and total JNK antibodies. (A) There was a significant increase in JNK activation in non-ischemic Fgf2 KO and FGF2 LMWKO compared to Wt hearts. (B) Representative Western blot showing the phosphorylation and total protein level of JNK in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. There was no significant difference in total JNK protein level between the three groups. n=8 Wt, Fgf2 KO and FGF2 LMWKO groups. *p<0.05 vs. Wt hearts

134

A. *p<0.05 vs saline-treated FGF2 LMWKO Saline-treated FGF2 LMWKO rmFGF2-treated FGF2 LMWKO 7000 *

) 6000 5000 Unit y 4000 3000

Arbitrar 2000 (

phospho-p38 MAPK 1000 0 B. 7000 6000 5000 4000 * 3000

phospho-JNK 2000 (Arbitrary Unit) 1000 0 C. Wt FGF2 LMWKO

Phospho-p38 MAPK

Phospho-JNK

Figure 25: Treatment with recombinant murine LMW FGF2 (rmLMW) “reverses” the phosphorylation state of p38 MAPK (A) and JNK (B) in non-ischemic FGF2 LMWKO hearts. There was a marked increase (50%) in p38 MAPK phosphorylation and a significant decrease (53%) in JNK phosphorylation and in rmLMW FGF2-treated vs. saline-treated FGF2 LMWKO hearts. (C) Representative Western blot showing the phosphorylation of p38 MAPK and JNK in rmLMW-treated FGF2 LMWKO hearts. n=4 for saline-or rmLMW FGF2-treated groups. *p<0.05 vs. saline-treated FGF2 LMWKO hearts.

135

A. *p<0.05 vs. Wt Wt Fgf2KO

3 FGF2 LMWKO 2.5 2 * 1.5 * 1 Activation of Akt

(phospho- vs. total Akt) 0.5 0 B. 14000

12000 10000

8000

6000 Total Akt

(Arbitary Unit) 4000 2000

0 C. FGF2 FGF2 Wt Fgf2 KO LMWKO Wt Fgf2 KO LMWKO

Akt

Phosphorylation Total

Figure 26: Akt activation in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. (A) There was a significant decrease in Akt activation in non-ischemic Fgf2 KO and FGF2 LMWKO compared to Wt hearts. (B) There was no significant difference in total Akt protein level between the three groups. (C) Representative Western blot showing the phosphorylation and total protein level of Akt in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. n=4 Wt, Fgf2 KO and FGF2 LMWKO groups. *p<0.05 vs. Wt hearts.

136

Effect of FGF2 LMW isoform on apoptosis in non-ischemic Fgf2 KO and FGF2 LMWKO mouse hearts

Ischemia-reperfusion injury can activate pathways involved in apoptosis and oncosis in the myocardium677. Previous data from our laboratory suggested that ablation of all isoforms of

FGF2 had a similar degree of myocardial infarction as wildtype hearts73. Whether an individual

FGF2 isoform affects apoptotic or oncotic death is unknown. Many studies demonstrate that the

FGF2 LMW isoform has both pro-apoptotic and anti-apoptotic properties in either JK-GMS

tumor cells or fibroblasts679,682. To elucidate whether ablation of all FGF2 isoforms or only the

FGF2 LMW isoform modulates the apoptotic pathway in the heart, the activation of caspase 3,

the level of TUNEL-positive nuclei, and cytochrome C release was evaluated in non-ischemic

Wt, Fgf2 KO and FGF2 LMWKO hearts.

No differences were observed in non-ischemic hearts at the early stage of apoptosis, as

measured by caspase 3 cleavage (Figure 27A); however, a slight increase in TUNEL-positive

cells, an indication of the late stage of apoptosis, was seen in non-ischemic Fgf2 KO (4.2 ±0.6%)

and FGF2 LMWKO (3.5 ±0.5%) vs. Wt hearts (2.4 ±0.4%) (p<0.05, Figure 27B). There was

also a significant increase in cytochrome C release, an indication of the early stage of apoptosis,

in FGF2 LMWKO hearts (p<0.05, Figure 27C). These pieces of evidence suggest that FGF2

LMW isoform might regulate the mitochondrial and nuclear apoptotic pathways; however, the

difference in the degree of TUNEL-positive cell between Fgf2 KO and FGF2 LMWKO hearts

compared to Wt was only ~ 1%, and this difference, most likely, would not lead to the

physiological difference in cardiac function in non-ischemic hearts (basal cardiac function in

Fgf2 KO and wildtype hearts less than that of FGF2 LMWKO hearts).

137

3 Wt Fgf2 KO 2.5 FGF2 LMWKO 2

1.5

1 (cleaved vs. total)

Activation of caspase 3 0.5

B. 40 35 * p<0.05 vs. Wt 30 25 20 15 10

% TUNEL-positive nuclei 5 * * 0

138

Wt Fgf2KO C. 3.5 FGF2 LMWKO

) 3 * * p<0.05 vs. Wt 2.5

1.5 tosol vs. membrane

y 1 c Cytochrome C release (

0.5

Figure 27: Apoptotic outcomes resulting from the manipulation of the FGF2 LMW isoform in non-ischemic Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) hearts. (A) There was no significant difference in caspase 3 activation, measured by the ratio of cleaved caspase 3 vs. total caspase 3, in non-ischemic Fgf2 KO and FGF2 LMWKO vs. Wt hearts. (B) Quantification of TUNEL-positive nuclei in non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts. There was a significant increase in TUNEL-positive nuclei in non-ischemic Fgf2 KO and FGF2 LMWKO heart compared to non-ischemic Wt hearts. (C) There was a significant increase in cytochrome C release in FGF2 LMWKO hearts compared to Wt hearts. Caspase 3 activation: n=6/group. TUNEL staining: n=4/groups and 96 fields/groups. Cytochrome C release: n=4/group. *p<0.05 vs. Wt groups.

139

Calcium handling protein expression and activation in non-ischemic Fgf2 KO and FGF2

LMWKO mouse hearts

There is evidence that administration of human FGF2 LMW isoform results in a negative

inotropic effect on rat cardiomyocytes367, while others have shown that the FGF2 LMW isoform

increased free calcium content364 and calcium influx through L-type calcium channel364, possibly

resulting in an increase in cardiac contraction. In our mouse models, there was an increase in

cardiac function in FGF2 LMWKO hearts and a decrease in cardiac function in Fgf2 KO hearts

compared to Wt hearts (Table 12). Thus, it is important to elucidate whether manipulation of the

LMW isoform affects expression or activity of calcium handling proteins such as

phospholamban, calsequestrin, which may dictate the functional outcome following I/R injury.

Western immunoblotting analysis was performed on non-ischemic Wt, Fgf2 KO and FGF2

LMWKO hearts to determine the expression and activation of calcium handling proteins,

phospholamban and calsequestrin.

There was no significant difference in calsequestrin between Wt, Fgf2 KO and FGF2

LMWKO mice hearts (Figure 28B). Inhibition of phospholamban activity, indicated by the level

of its phosphorylation state, was significantly attenuated in FGF2 LMWKO hearts compared to

Wt hearts (Figure 28A). The ser-16 on phospholamban is a phosphorylation site for PKA which

activated by G-protein couple receptor (GPCR)713. This evidence indicates that there might be

possible direct or indirect cross-talk between PKA signaling and receptor tyrosine kinases. Also, this finding shows that ablation of the FGF2 LMW isoform modulates phospholamban function, which may contribute to the cardiac function outcome in I/R injury. However, the direct expression levels of the proteins do not always correlate with their function. Although no difference in calsequestrin expression level and a decreased phosphorylation in phospholamban

140

were observed, further studies, such as their binding activity as well as their ability of interacting with calcium, need to be employed to determine the function of these proteins in the context of

FGF2’s actions in basal cardiac function and in cardiac function upon ischemic stress.

141

A. Phospholamban 2 Wt 1.8 Fgf2KO 1.6 FGF2 LMWKO 1.4 1.2 1 *p<0.05 vs. Wildtype 0.8 * 0.6

phospholamban) phospholamban) 0.4 0.2 0 (phospho- phospholamban vs. total (phospho- phospholamban Phosphorylation of Phospholamban Phosphorylation of Phospholamban

B. 25000 Calsequestrin

20000

15000

10000 Arbitrary Unit

5000 (Expression of calsequestrin)

Figure 28: Calcium handling protein expression in non-ischemic Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) hearts. (A) There was a significant decrease in inhibition of phospholamban activity, as measured by phosphorylation at Ser16 site, in non-ischemic FGF2 LMWKO hearts compared to Wt hearts. (B) There was no significant alteration in calsequestrin protein expression level between the three groups. n=6 Wt, Fgf2 KO and FGF2 LMWKO groups. *p<0.05 vs. Wt hearts.

142

Activation of c-Jun terminal kinase (JNK) pathway following ischemia-reperfusion injury

in Wt, Fgf2 KO and FGF2 LMWKO mouse hearts

Our data revealed that ablation of the FGF2 LMW isoform increased JNK

activation in non-ischemic hearts (Figure 24), but whether, under a stress condition like

ischemia, this effect would still be observed is unknown. To elucidate whether

manipulation of the LMW FGF2 protein isoform would influence JNK phosphorylation, indicative of activation, during ischemia-reperfusion injury, Wt, Fgf2 KO and FGF2

LMWKO hearts were subjected to 5 or 60 minutes global, low-flow ischemia or 60 minutes global, low-flow ischemia followed by 5 or 15 minutes of reperfusion. Phosphorylation of

JNK was significantly increased in sham-treated Fgf2 KO (2.2±0.3 fold) and FGF2

LMWKO (1.8±0.2 fold) vs. sham-treated Wt hearts (p<0.05, Figure 29), and this finding was consistent with that observed in non-ischemic hearts (Figure 24). In addition, JNK phosphorylation was significantly elevated in Fgf2 KO and FGF2 LMWKO vs. Wt hearts

at 5 minutes of ischemia (Fgf2 KO: 2.6±0.9 fold and FGF2 LMWKO: 2.2±0.1 fold), 60

minutes of ischemia and 15 minutes of reperfusion (Fgf2 KO: 5.0±0.9 fold and FGF2

LMWKO: 4.8±1.2 fold), or 120 minutes of reperfusion (Fgf2 KO: 6.6±1.3 fold and FGF2

LMWKO: 5.8±1.5 fold) (p<0.05, Figure 29). At 5 minutes and 15 minutes of reperfusion,

there was a significant increase (3.3±0.9 and 2.1±0.5 fold, respectively) in JNK

phosphorylation in Wt hearts vs. sham-treated cohort (p<0.05, Figure 29) which is

consistent with results from others328. Since phosphorylation and activation of JNK require

the upstream kinases, MKK4 and MKK7714, their activation, as measured by

phosphorylation level, during ischemia-reperfusion injury was assessed. The

phosphorylation level of MKK7 was significantly increased in sham-treated Fgf2 KO

143

(1.7±0.6 fold) and FGF2 LMWKO (1.7±0.3 fold) vs. sham-treated Wt hearts (p<0.05,

Figure 30). MKK7 phosphorylation was also significantly increased in Fgf2 KO and FGF2

LMWKO vs. Wt hearts at 60 minutes ischemia and 5 minutes of reperfusion (Fgf2 KO:

3.7±0.4 fold and FGF2 LMWKO: 5.9±0.3 fold), 15 minutes of reperfusion (Fgf2 KO:

2.6±0.9 fold and FGF2 LMWKO: 2.2±0.1 fold) or 120 minutes of reperfusion (Fgf2 KO:

2.8±0.4 fold and FGF2 LMWKO: 2.9±0.9 fold) (p<0.05, Figure 30). MKK4

phosphorylation was significantly elevated in Fgf2 KO (1.7±0.1 fold) and FGF2 LMWKO

(1.8±0.4 fold) vs. Wt hearts at 60 minutes ischemia and 15 minutes of reperfusion (Figure

31). Manipulation of FGF2 LMW isoform expression had no effect on total protein level of

JNK, MKK7 and MKK4 (Figure 29B, 30B and 31B).

144

A. Wt Fgf2 KO 7 FGF2 LMWKO

6 *p<0.05 vs. sham cohort #p<0.05 vs. Wt # 5 * # 4 # # 3 * # # Activation of JNK 2 #

(phospho-JNK vs. total JNK) 1

0 sham 5'I 60'I 60'I/5'R 60'I/15'R 60'I/120'R B.

Sham 5’I 60’I 60’I/5’R 60’I/15’R 60’I/120’R

Wt Fgf2 FGF2 Wt Fgf2 FGF2 Wt Fgf2 FGF2 Wt Fgf2 FGF2 Wt Fgf2 FGF2 Wt Fgf2 FGF2 KO LMWKO KO LMWKO KO LMWKO KO LMWKO KO LMWKO KO LMWKO Phospho- JNK

Total JNK

Figure 29: Activation of JNK as measured by phosphorylation at different time-points during ischemia-reperfusion injury in Wt (diamond), Fgf2 KO (square) and FGF2 LMWKO (triangle) hearts. (A) There was a significant increase in JNK activation prior to ischemia, early ischemia and early reperfusion in Fgf2 KO and FGF2 LMWKO hearts compared to Wt hearts. (B) Representative Western blot depicting activation of JNK at different time-points of ischemia-reperfusion injury in Wt, Fgf2 KO and FGF2 LMWKO hearts. n=6/group. *p<0.05 vs. sham cohort. #p<0.05 vs. Wt.

145

A. Wt 6 *p<0.05 vs. sham cohort Fgf2 KO #p<0.05 vs. Wt FGF2 LMWKO 5

# 4 * # * *# 3 * # # 2 #

Activation of MKK7 * 1 (phospho-MKK7 vs. total MKK7) 0 sham 5'I 60'I 60'I/5'R 60'I/15'R 60'I/120'R B.

Sham 5’I 60’I 60’I/5’R 60’I/15’R 60’I/120’R

Wt Fgf2 FGF2 Wt Fgf2 FGF2 Wt Fgf2 FGF2 Wt Fgf2 FGF2 Wt Fgf2 FGF2 Wt Fgf2 FGF2 KO LMWKO KO LMWKO KO LMWKO KO LMWKO KO LMWKO KO LMWKO

Phospho- MKK7

Total MKK7

Figure 30: Activation of MKK7, as indicated by phosphorylation, at different time-points during ischemia-reperfusion injury in Wt (diamond), Fgf2 KO (square) and FGF2 LMWKO (triangle) hearts. (A) There was a significant increase in MKK7 activation in early reperfusion in Fgf2 KO and FGF2 LMWKO hearts compared to Wt hearts. (B) Representative Western blot showing activation of MKK7 at different time-points of ischemia-reperfusion injury in Wt, Fgf2 KO and FGF2 LMWKO hearts. n=6/group. *p<0.05 vs. sham cohort. #p<0.05 vs. Wt.

146

A. Wt Fgf2 KO 3 FGF2 LMWKO 2.5

2 * # # 1.5 *

Activation of MKK4 0.5

(phospho-MKK4 vs. total MKK4) sham 5'I 60'I 60'I/5'R 60'I/15'R 60'I/120'R

Sham 5’I 60’I 60’I/5’R 60’I/15’R 60’I/120’R

Wt Fgf2 Wt Fgf2 FGF2 Wt FGF2 Wt Fgf2 FGF2 Fgf2 FGF2 Wt Fgf2 FGF2 Wt Fgf2 FGF2 KO LMWKO KO LMWKO KO LMWKO KO LMWKO KO LMWKO KO LMWKO Phospho- MKK4

Total MKK4

Figure 31: Activation, as indicated by phosphorylation, of MKK4 at different time points during ischemia-reperfusion injury in Wt (diamond), Fgf2 KO (square) and FGF2 LMWKO (triangle) hearts. (A) There was a significant increase in MKK4 activation in early reperfusion in Fgf2 KO and FGF2 LMWKO hearts compared to Wt hearts. (B) Representative Western blot depicting activation of MKK4 at different time points of ischemia-reperfusion injury in Wt, Fgf2 KO and FGF2 LMWKO hearts. n=6/groups. *p<0.05 vs. sham cohort. #p<0.05 vs. Wt.

147

Role of the JNK pathway in FGF2 LMW isoform-induced cardioprotection on post- ischemic recovery of cardiac function

To determine whether JNK signaling mediates FGF2 LMW isoform-induced cardioprotection, Wt, Fgf2 KO and FGF2 LMWKO hearts were subjected to 60 minutes of global, low-flow ischemia and 120 minutes of reperfusion, and treated with vehicle (DMSO) or

CEP-11004 (50 nM), a JNK pathway inhibitor that inhibits the upstream mixed lineage kinase

(MLKs) MKK4/7 (Figure 32). There were no differences in basal cardiac function in DMSO- and CEP11004-treated Wt and Fgf2 KO, while basal cardiac function was significantly increased in FGF2 LMWKO hearts compared to Wt hearts (Table 13). Following ischemia-reperfusion injury, there was significant systolic and diastolic dysfunction as measured by left ventricular systolic pressure (LVSP), +dP/dt (derivative of change in contractile pressure over time), left ventricular end-diastolic pressure (LVEDP), and -dP/dt (derivative of change in relaxation pressure over time) in ischemic-reperfused, DMSO-treated Fgf2 KO and FGF2 LMWKO vs.

DMSO-treated Wt hearts (p<0.05, Table 13). This systolic dysfunction resulted in a significant decrease in post-ischemic recovery of contractile function in DMSO-treated Fgf2 KO (39±4%) hearts and FGF2 LMWKO (47±5%) hearts vs. Wt (60±7%) hearts (p<0.05, Figure 33).

Furthermore, there was no difference in the systolic and diastolic parameters between Fgf2 KO and FGF2 LMWKO hearts (Table 13), suggesting that the FGF2 LMW isoform is most likely the isoform required for protection against myocardial dysfunction. After CEP11004 (50 nM) treatment, post-ischemic contractile function was significantly restored in all groups: Wt

(81±4%), Fgf2 KO (83±5%) and FGF2 LMWKO (67±5%) (p<0.05, Figure 33), indicating that inhibition of JNK signaling had a cardioprotective role against I/R injury. Furthermore, the percent increase in post-ischemic contractile function in Fgf2 KO (~50%) and FGF2 LMWKO

148

(~35%) hearts was significantly higher than in Wt hearts (~17%), indicating that the cardioprotective effect of FGF2 LMW isoform involved the JNK signaling pathway. Finally, there were significant increases in systolic (LVSP and +dP/dt) and diastolic (LVEDP and –dP/dt) parameters in CEP11004-treated groups compared to DMSO-treated groups (p<0.05, Table 13), demonstrating that CEP11004 improved both contractile and relaxation function. Collectively, these results revealed that the cardioprotective effect of the FGF2 LMW isoform against myocardial dysfunction occurred, in part, through modulating JNK activation.

To determine whether p38 or ERK signaling was also important in FGF2 LMW isoform- mediated cardioprotection, SB203580 (p38 MAPK inhibitor, 2 µM), anisomycin (p38 MAPK agonist, 5 µM), or U0126 (MEK1/ERK inhibitor, 2.5 µM), was administered. No improvement in post-ischemic cardiac dysfunction following SB203580 treatment (Wt: 38±11%, Fgf2 KO:

28±10% and FGF2 LMWKO 19±7%, Figure 34A) or anisomycin treatment (Wt: 62±13%, Fgf2

KO: 38±1% and FGF2 LMWKO: 31 ±2% Figure 34B), compared to vehicle groups was observed. Furthermore, inhibition of MEK1/ERK did not improve post-ischemic contractile dysfunction (Wt: 50±4%, Fgf2 KO: 33± 7% and FGF2 LMWKO 34± 9% Figure 35). Hence,

JNK is the predominant MAPK involved in modulating the cardioprotective actions of the FGF2

LMW isoform.

149

MLKs

CEP11004 (50 nM)

MKK4/7 P

P JNKs P Bim P Bad P c-Jun

BAX/BAK AP-1 Cell death

Cytochrome C and Smac

Caspase

Cell death

Figure 32: Schematic of CEP11004 inhibition JNK pathway. CEP11004 inhibits the phosphorylation of MKK4/7 (upstream kinases of JNK) by upstream kinase mixed lineage kinase (MLKs), subsequently causing JNK inhibition.

150

#p<0.05 vs. DMSO Wt Wt *p<0.05 vs. DMSO cohort †p<0.05 vs. CEP11004 Wt Fgf2 KO FGF2 LMW KO 100 90 * * 80 *† 70 60 # 50 # 40

Contractile Function (%) 20 10 Percent Recovery of Post-ischemic 0 DMSO CEP11004 (50 nM)

Figure 33: Percent recovery of post-ischemic contractile function in Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) hearts following DMSO or CEP11004 (50 nM) treatment. There was a poorer recovery of post-ischemic contractile function in DMSO-treated Fgf2 KO and FGF2 LMWKO groups compared to the DMSO-treated Wt group. Inhibition of the JNK pathway significantly restored the post-ischemic recovery of contractile function in all three groups. Percent recovery of contractile function is depicted as the ratio of +dP/dt at 120 minutes reperfusion to baseline measure. n=6 for DMSO- and CEP11004- treated Wt, Fgf2 KO and FGF2 LMWKO hearts. *p<0.05 vs. DMSO-treated cohort. #p<0.05 vs. DMSO-treated Wt hearts. †p<0.05 vs. CEP11004-treated Wt hearts.

151

Table 13. Cardiac function in DMSO- and CEP11004-treated Wt, Fgf2 KO and FGF2 LMWKO hearts.

Baseline (Equilibration) 60’ischemia/120’reperfusion

Wt Fgf2 KO FGF2 Wt Fgf2 KO FGF2 Wt Fgf2 KO FGF2 Wt Fgf2 KO FGF2 (DMSO) (DMSO) LMWKO (CEP11004 (CEP11004 LMWKO (DMSO) (DMSO) LMWKO (CEP11004 (CEP11004 LMWKO (DMSO) 50nM) 50nM) (CEP11004 (DMSO) 50nM) 50nM) (CEP11004 50nM) 50nM) LVSP 100±2 100±1 101±2 101±2 96±2 105±2& 67±7† 51±4#† 54±5#† 84±3*† 79±4*† 78±3*† (mmHg)

LVEDP 7±1 9±1 7±1 7±1 7±1 7±1 21±4† 25±3† 18±2† 18±2*† 15±3*† 23±4† (mmHg)

+dP/dt 4062±114 3985±66& 4359±98& 4268±69 3994±85 4463±77& 2519±319† 1548±186†# 2102±261† 3409±173*† 3357±241* 2948±254*† (mmHg/s)

-dP/dt -3618±121 -3322±67 -3508±145 -3560±101 -3240±100 -3739±106 -1817±189† -1158±98†# -1568±165†# -2259±127†* -2122±139*† -1999±146†* (mmHg/s)

All values were presented as mean ± SEM of n independent experiments. LVSP: left ventricle systolic pressure. LVEDP: left ventricle end diastolic pressure. ±dP/dt: derivative of change in contractile and relaxation pressure over time. n=12/group. *p<0.05 vs DMSO-treated cohort. #p<0.05 vs. DMSO-treated Wt. †p<0.05 vs. Baseline cohort. &p<0.05 vs. Wt cohort. 152

152

A. Wt 100 *p<0.05 vs.Wt Fgf2 KO 90 FGF2 LMWKO 80 70 60 * 50 40 * *

30 * 20 Contractile Function (%) 10

Percent Recovery of Post-ischemic 0 Vehicle SB203580 B. (2 µM) 100 90

70 60 50 * * 40 * * 30

Contractile Function (%) 20 10 Percent Recovery of Post-ischemic 0

Vehicle Anisomycin (5 µM) Figure 34: Percent recovery of post-ischemic contractile function in Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) hearts following vehicle, p38 MAPK antagonist (SB203580, 2 µM) (A), or p38 MAPK agonist (anisomycin, 5 µM) (B). There was no improvement in recovery of post-ischemic contractile function in Fgf2 KO and FGF2 LMWKO upon p38 MAPK inhibition (A) or activation (B) compared to vehicle- treated groups. Percent recovery of contractile function is depicted as the ratio of +dP/dt at 120 minutes reperfusion to baseline measure. n=4 for SB 203580- and anisomycin- treated Wt, Fgf2 KO and FGF2 LMWKO hearts. *p<0.05 vs. Wt cohort.

153

*p<0.05 vs.Wt Wt Fgf2KO 100 FGF2 LMWKO 90 80 70 60 50 * * * 40 * 30

Contractile Function (%) 20 10 Percent Recovery of Post-ischemic 0 DMSO U0126 (2.5 µM)

Figure 35: Percent recovery of post-ischemic contractile function in Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) hearts following treatment with vehicle or the ERK pathway antagonist (U0126, MEK1 inhibitor, 2.5 µM) treatment. There was no improvement in recovery of post-ischemic contractile function in Fgf2 KO and FGF2 LMWKO hearts upon MEK/ERK inhibition compared to vehicle-treated groups. Percent recovery of contractile function is depicted as the ratio of +dP/dt at 120 minutes reperfusion to baseline measure. n=4 for U0126-treated Wt, Fgf2 KO and FGF2 LMWKO hearts. *p<0.05 vs. Wt cohort.

154

Role of JNK signaling in FGF2 LMW isoform-induced cardioprotection against myocardial cell injury

Myocardial infarct size was measured after 60 minutes global, low-flow ischemia and

120 minutes reperfusion. There was no difference in DMSO-treated groups: Wt (25±3%), Fgf2

KO (25±3%) and FGF2 LMWKO (30±3%) (Figure 36). Following CEP11004 treatment, there was a significant decrease in myocardial infarct size in all three groups: Wt (18±3%), Fgf2 KO

(17±3%) and FGF2 LMWKO (16±2%) (p<0.05, Figure 36) compared to DMSO-treated cohorts.

CK release, a marker of myocardial cell injury, was measured from coronary effluent at designated time-points of baseline equilibration, ischemia and reperfusion (Figure 8). There was a significant increase in CK release at early reperfusion compared to baseline (equilibration) values in all vehicle-treated groups (p<0.05, Table 14A). Following CEP11004 treatment, there was a significant decrease in CK release in all groups during ischemia and early reperfusion compared to DMSO-treated hearts (p<0.05, Table 14A).

Following SB203580 (p38 MAPK inhibitor, 2 µM) and U0126 (MEK1/ERK inhibitor,

2.5 µΜ) treatment, there was no significant change in creatine kinase release in all three groups during equilibration, ischemia and early reperfusion (Table 14B and C). p38 activation (via anisomycin treatment, 5 µM) resulted in a reduction in CK release during reperfusion; however, there was no difference in CK release in anisomycin-treated Wt, Fgf2 KO and FGF2 LMWKO hearts, suggesting that the reduction of CK release was not FGF2 isoform-dependent (Table

14D). This result indicates that inhibition of the JNK signaling pathway is important in protecting the heart from myocardial cell injury.

155

35 *p<0.05 vs. DMSO cohort Wt Fgf2 KO 30 FGF2 LMW KO 25 * * 20 * 15

5 Infarct size (% of whole heart)

0 DMSO CEP11004 (50 nM)

Figure 36: Myocardial infarct size depicted as a percent of area at risk in Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) hearts following DMSO or CEP11004 (50 nM) treatment. There was no difference in infarct size in the DMSO- treated groups; however, CEP11004 treatment attenuated myocardial infarct size in all three groups. n=6 for DMSO- and CEP11004-treated Wt, Fgf2 KO and FGF2 LMWKO hearts. *p<0.05 vs. DMSO-treated cohort.

156

Table 14. Creatine kinase release from from vehicle-, CEP11004-, U0126-, SB203580-, and anisomycin- treated Wt, Fgf2 KO and FGF2 LMWKO hearts. A. Baseline (Equilibration) Ischemia Early Reperfusion Late Reperfusion Vehicle 0.041±0.020 0.025±0.019† 0.100±0.031† 0.057±0.036 Wt CEP-11004 0.015±0.004* 0.007±0.002†* 0.046±0.013†* 0.015±0.006* (50 nM) Vehicle 0.043±0.015 0.015±0.007† 0.114±0.056† 0.019±0.005† Fgf2 KO CEP-11004 0.031±0.023#* 0.001±0.001 †* 0.060 ±0.028 0.021±0.010# (50 nM) Vehicle FGF2 0.034±0012 0.011±0.002† 0.129±0.034† 0.017±0.005 LMWKO CEP-11004 0.027±0.012# 0.005±0.005†* 0.070 ±0.024#*† 0.029±0.010# (50 nM) B. Baseline (Equilibration) Ischemia Early Reperfusion Late Reperfusion Vehicle 0.011±0.003 0.002±0.000† 0.019±0.006 0.010±0.003 Wt U0126 0.009±0.00 0.003±0.001† 0.023±0.003† 0.003±0.002† (2.5 µΜ) Vehicle 0.007±0.002 0.002±0.001† 0.016±0.006 0.008±0.003 Fgf2 KO U0126 0.015±0.006 0.004±0.002† 0.021 ±0.003 0.004±0.002† (2.5 µΜ) Vehicle FGF2 0.012±0.004 0.003±0.001† 0.023±0.003† 0.014±0.003 LMWKO U0126 0.014±0.006 0.004±0.001† 0.023 ±0.011 0.010±0.004 (2.5 µΜ) 157 157

Baseline (Equilibration) Ischemia Early Reperfusion Late Reperfusion Vehicle 0.041±0.020 0.024±0.019† 0.100±0.041† 0.057±0.029 Wt SB 203580 (2 µΜ) 0.069±0.050 0.011±0.006† 0.153±0.048 0.066±0.028

Vehicle 0.043±0.015 0.015±0.007† 0.114±0.056† 0.029±0.005 Fgf2 KO SB 203580 (2 µΜ) 0.027±0.003 0.01±0.0041† 0.106 ±0.025† 0.057±0.025† Vehicle FGF2 0.034±0012 0.005±0.001† 0.129±0.034† 0.020±0.005 LMWKO SB 203580 (2 µΜ) 0.041±0.011 0.019±0.01† 0.140 ±0.052† 0.108±0.027† 158

158

Baseline (Equilibration) Ischemia Early Reperfusion Late Reperfusion Vehicle 0.041±0.020 0.024±0.019† 0.100±0.041† 0.057±0.029 Wt Anisomycin 0.013±0.001* 0.002±0.001*† 0.03±0.005*† 0.010±0.003* (5 µΜ) Vehicle 0.043±0.015 0.015±0.007† 0.114±0.056† 0.029±0.005 Fgf2 KO Anisomycin 0.012±0.002* 0.004±0.001*† 0.020 ±0.003*† 0.003±0.001*† (5 µΜ) Vehicle FGF2 0.034±0012 0.005±0.001† 0.129±0.034† 0.020±0.005 LMWKO Anisomycin 0.009±0.002* 0.002±0.000*† 0.017 ±0.003*† 0.004±0.001*† (5 µΜ)

All values depicted as mean ± SEM of n independent experiments. The release of creatine kinase in units of U/min*g. Baseline/Equilibration: last 10 minutes of baseline, Ischemia: 0-30 and 45-60 minutes of ischemia. Early reperfusion: 0-14 minutes of reperfusion. Late reperfusion: 114-120 minutes of reperfusion. n=10/group. *p<0.05 vs. vehicle treated-cohort. #p<0.05 vs. Wt cohort. † p<0.05 vs. baseline. 159 159

Effect of JNK pathway inhibition on JNK and MAPK pathway signaling:

CEP11004 (50 nM) inhibits its upstream kinase MLK, subsequently blocking MKK4/6

activation and JNK phosphorylation688 (Figure 32). To determine whether CEP11004 inhibited

the JNK pathway, Western immunoblot analysis was performed and activation (phosphorylation)

of MKK7, MKK4 and JNK was evaluated. Following 60 minutes low-flow ischemia and 120

minutes reperfusion, JNK and MKK7 activation were significantly increased in DMSO-treated

Fgf2 KO hearts compared to DMSO-treated Wt hearts (p<0.05, Figure 37 and 39). This finding

suggests that the FGF2 LMW isoform may have a partial role in modulating JNK signaling.

Immunoblotting indicated that activation of MKK4, MKK7 and JNK was inhibited in

CEP11004-treated Fgf2 KO groups compared to vehicle-treated cohorts (p<0.05, Figures 37, 38

and 39), demonstrating that CEP11004 sufficiently inhibited MKK4/7 activation. No significant

difference in MKK4 activation was observed in DMSO-treated Wt, Fgf2 KO, and FGF2

LMWKO hearts (Figure 38). Total protein level of JNK, MKK7, and MKK4 was not altered

after DMSO or CEP11004 treatment.

There is evidence which suggests that MKK4 may also activate p38 MAPK715. Western immunoblotting was performed to determine whether CEP11004 inhibited the other MAPK pathway signals, ERK and p38 MAPK. Following 60 minutes low-flow ischemia and 120 minutes reperfusion, activation of ERK and p38 MAPK was not changed in CEP11004-treated

Wt, Fgf2 KO and FGF2 LMWKO compared to DMSO treated Wt, Fgf2 KO and FGF2

LMWKO groups (Figure 40 and 41). The total protein level of ERK and p38 MAPK was not

altered after DMSO or CEP11004 treatment.

160

A. *p<0.05 vs. DMSO cohort #p<0.05 vs. DMSO Wt 3 Wt # Fgf2 KO # 2.5 FGF2 LMWKO

1.5 * * * 1 Activation of MKK7 0.5 (phospho-MKK7 vs. total MKK7) 0 DMSO CEP11004 (50 nM) B. DMSO CEP11004 (50 nM) Wt Fgf2 KO FGF2 Wt Fgf2 KO FGF2 LMWKO LMWKO Phospho-MKK7

Total MKK7

Figure 37: MKK7 activation, as measured by the level of phosphorylation, in DMSO- and CEP11004 (50 nM)-treated Wt, Fgf2 KO and FGF2 LMWKO hearts. MKK7 activation was significantly increased in DMSO-treated Fgf2 KO and FGF2 LMWKO hearts compared to DMSO-treated Wt hearts. (A) CEP11004 treatment significantly decreased MKK7 activation in all groups. (B) Representative Western blot showing the phosphorylation and total protein level of MKK7 in DMSO- and CEP11004-treated Wt, Fgf2 KO and FGF2 LMWKO hearts following 60 minutes ischemia and 120 minutes reperfusion. n=6/group. *p<0.05 vs. DMSO-treated cohort. #p<0.05 vs. DMSO-treated Wt group.

161

A. *p<0.05 vs. DMSO cohort Wt 2 Fgf2 KO 1.8 FGF2 LMWKO 1.6 1.4 1.2 * 1 * * 0.8 0.6 Activation of MKK4 0.4 0.2 (phospho-MKK4 vs. total MKK4) 0 DMSO CEP11004 (50 nM) B. DMSO CEP11004 (50 nM) Wt Fgf2 KO FGF2 Wt Fgf2 KO FGF2 LMWKO LMWKO

Phospho-MKK4

Total MKK4

Figure 38: MKK4 activation, as indicated by phosphorylation, in DMSO- and CEP11004 (50 nM) treated Wt, Fgf2 KO and FGF2 LMWKO hearts. (A) There was a significant decrease in MKK4 phosphorylation in CEP11004-treated groups compared to DMSO- treated groups. (B) Representative Western blot showing the phosphorylation and total protein level of MKK4 in DMSO- and CEP11004-treated Wt, Fgf2 KO and FGF2 LMWKO hearts following 60 minutes ischemia and 120 minutes reperfusion. n=6/group. *p<0.05 vs. DMSO-treated cohort.

162

A. *p<0.05 vs. DMSO cohort 10 # #p<0.05 vs.DMSO Wt 9 # Wt 8 Fgf2KO 7 FGF2 LMWKO 6 5 4 * 3 *

Activation of JNK 2 1 (phospho-JNK vs. total JNK) 0 DMSO CEP11004 (50 nM) B. DMSO CEP11004 (50 nM) Wt Fgf2 KO FGF2 Wt Fgf2 KO FGF2 LMWKO LMWKO

Phospho-JNK

Total JNK

Figure 39: JNK activation, as measured by phosphorylation state, in DMSO- and CEP11004 (50 nM)-treated Wt, Fgf2 KO and FGF2 LMWKO hearts. (A) JNK phosphorylation was significantly increased in DMSO-treated Fgf2 KO and FGF2 LMWKO hearts compared to DMSO-treated Wt hearts. Upon CEP11004 treatment, there was a significant decrease in JNK phosphorylation compared to DMSO-treated groups. (B) Representative Western blot showing the phosphorylation and total protein level of JNK in DMSO- and CEP11004-treated Wt, Fgf2 KO and FGF2 LMWKO hearts following 60 minutes ischemia and 120 minutes reperfusion. n=6/group. *p<0.05 vs. DMSO-treated cohort. #p<0.05 vs. DMSO-treated Wt group.

163

A. Wt

Fgf2 KO #p<0.05 vs. Wt cohort 6 FGF2 LMWKO

5 # # 4

Activation of ERK 2

(phospho-ERK vs. total ERK) 1

0 DMSO CEP11004 B. (50 nM)

DMSO CEP11004 (50 nM) Wt Fgf2 KO FGF2 Wt Fgf2 KO FGF2 LMWKO LMWKO Phospho-ERK2

Total ERK2

Figure 40: ERK activation, as measured by its phosphorylation state, in DMSO- and CEP11004 (50 nM)-treated Wt, Fgf2 KO and FGF2 LMWKO hearts. (A) There was no significant difference in ERK activation in CEP11004-treated groups compared to DMSO-treated groups. (B) Representative Western blot showing the phosphorylation and total protein level of ERK1 in DMSO- and CEP11004-treated Wt, Fgf2 KO and FGF2 LMWKO hearts following 60 minutes ischemia and 120 minutes reperfusion. n=6/group. #p<0.05 vs. DMSO-treated Wt group.

164

A. Wt 2 #p<0.05 vs. Wt Fgf2KO 1.8 # FGF2 LMWKO 1.6 # 1.4 # 1.2 # 1 0.8 0.6 0.4 Activation of p38 MAPK 0.2 (phospho-p38 MAPK vs. total p38)

DMSO CEP11004 (50 nM) B. DMSO CEP11004 (50 nM) Wt Fgf2 KO FGF2 Wt Fgf2 KO FGF2 LMWKO LMWKO

Phospho-p38 MAPK

Total p38 MAPK

Figure 41: p38 MAPK activation, as measured by phosphorylation state, in DMSO- and CEP11004 (50 nM)-treated Wt, Fgf2 KO and FGF2 LMWKO hearts. (A) Activation of p38 MAPK was significantly higher in DMSO- and CEP11004-treated Fgf2 KO and FGF2 LMWKO compared to DMSO- or CEP11004 treated Wt hearts. (B) Representative Western blot showing the phosphorylation and total protein level of p38 MAPK in DMSO- and CEP11004-treated Wt, Fgf2 KO and FGF2 LMWKO hearts following 60 minutes ischemia and 120 minutes reperfusion. n=6/group. #p<0.05 vs. DMSO-treated Wt group.

165

Effect of JNK pathway inhibition on apoptotic signaling

The present studies have shown that inhibition of the JNK pathway mediates the cardioprotection elicited by FGF2 LMW isoform. Also, there was a slight increase in TUNEL- positive nuclei in non-ischemic Fgf2 KO and FGF2 LMWKO hearts (Figure 27). Nonetheless, the underlying mechanisms of how inhibition of JNK signaling results in LMW FGF2-induced cardioprotection remains to be elucidated. The main biological function mediated by JNK signaling is apoptosis83,487,509. To study the degree of apoptosis during I/R injury and following

JNK inhibition, the activation of apoptosis regulatory factors such as caspase 3, key downstream targets such as c-Jun, and indicators of the early phase of apoptosis such as cytochrome C release, were evaluated. Activation of c-Jun and cleavage of caspase 3 were increased in DMSO-treated

Fgf2 KO and FGF2 LMWKO vs. DMSO-treated Wt hearts (p<0.05, Figure 42, 43 and 45). In

DMSO-treated groups, there was also a significant increase in TUNEL-positive cells in Fgf2 KO

(26±1%) and FGF2 LMWKO (31±5%) vs. Wt (16±4%) hearts (p<0.05, Figure 44). These results are similar as those observed in the non-ischemic cohorts and suggest that the FGF2 LMW isoform may modulate apoptotic signaling during ischemia-reperfusion injury.

After CEP11004 treatment, there was a significant decrease in the activation of c-Jun and caspase 3 cleavage in Wt, Fgf2 KO and FGF2 LMWKO hearts compared to DMSO-treated hearts (p<0.05, Figure 42 and 43). Furthermore, the number of TUNEL-positive cells was significantly decreased in CEP11004-treated Wt (8±1%), Fgf2 KO (5±1%) and FGF2 LMWKO

(8±2%) hearts compared to DMSO-treated hearts (p<0.05, Figure 44). Thus, inhibition of the

JNK pathway resulted in decreased ischemia-reperfusion-induced apoptosis, measured by

TUNEL assay and caspase 3 cleavage. There was, however, no significant difference in cytochrome C release, an early sign of apoptosis, in CEP11004-treated Wt, Fgf2 KO and FGF2

166

LMWKO hearts compared to DMSO-treated groups (Figure 45). Furthermore, in DMSO-treated groups, there was also no significant difference between Wt, Fgf2 KO and FGF2 LMWKO groups. This could be due to the time-point used to measure apoptosis or due to the difference in activation of intrinsic vs. extrinsic pathways.

167

A. *p<0.05 vs. DMSO cohort #p<0.05 vs. Wt Wt # 2 # Fgf2KO 1.8

FGF2 LMWKO ) 1.6 1.4 * 1.2 * * 1 0.8 0.6 0.4 ho-c-Jun vs. total c -Jun Activation of c-Jun p 0.2

hos 0 (p DMSO CEP11004 B. (50 nM)

DMSO CEP11004 (50 nM) Wt Fgf2 KO FGF2 Wt Fgf2 KO FGF2 LMWKO LMWKO Phospho-c-Jun

Total c-Jun

Figure 42: c-Jun activation, as measured by its phosphorylation state, in DMSO- and CEP11004 (50 nM)-treated Wt, Fgf2 KO and FGF2 LMWKO hearts. (A) c-Jun activation was significantly increased in DMSO-treated Fgf2 KO and FGF2 LMWKO hearts compared to DMSO-treated Wt hearts. Moreover, there was a significant decrease in c-Jun activation in CEP11004-treated groups compared to DMSO-treated groups. (B) Representative Western blot showing the phosphorylation and total protein level of p38 MAPK in DMSO- and CEP11004-treated Wt, Fgf2 KO and FGF2 LMWKO hearts following 60 minutes ischemia and 120 minutes reperfusion. n=6/group. *p<0.05 vs. DMSO-treated groups. #p<0.05 vs. DMSO-treated Wt group.

168

*p<0.05 vs. DMSO cohort Wt #p<0.05 vs. DMSO Wt Fgf2KO FGF2 LMWKO

) 3 #

ase 3 # p 2.5

1.5 * * * 1

Activation of caspase 3 0.5 cleaved vs. total cas ( 0 DMSO CEP11004 (50 nM)

Figure 43: Effect of JNK pathway inhibition on caspase 3 activation, depicted as cleaved caspase 3, following 60 minutes ischemia and 120 minutes reperfusion in DMSO- and CEP11004 (50 nM)-treated Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) groups. Caspase 3 cleavage (activation) was significantly increased in DMSO-treated Fgf2 KO and FGF2 LMWKO hearts compared to DMSO-treated Wt hearts. Furthermore, there was a significant decrease in caspase 3 cleavage in CEP11004-treated groups compared to DMSO-treated groups. n=6/group. *p<0.05 vs. DMSO-treated groups. #p<0.05 vs. DMSO-treated Wt group.

169

Wt DMSO

Wt CEP11004

Fgf2 KO CEP11004

Fgf2 KO DMSO

FGF2 LMWKO DMSO

FGF2 LMWKO CEP11004

170

Wt 40 B. # Fgf2 KO 35 FGF2 LMWKO

30 # *p<0.05 vs. DMSO cohort 25 #p<0.05 vs. DMSO Wt 20 15 10 * * * % TUNEL-positive nuclei 5 0 DMSO CEP11004 (50 nM)

Figure 44: Effect of JNK pathway inhibition on apoptosis, measured by TUNEL-positive nuclei, following 60 minutes ischemia and 120 minutes reperfusion in DMSO- and CEP11004 (50 nM)- treated Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) groups. (A) Representative heart sections depicting TUNEL-positive nuclei from DMSO- and CEP11004- treated Wt, Fgf2 KO and FGF2 LMWKO following 60 minutes ischemia and 120 minutes reperfusion. Red: DAPI-stained nuclei; Green: TUNEL positive-nuclei; Yellow: Overlay; Arrow: nuclei. (B) Quantification of TUNEL-positive nuclei following 60 minutes ischemia and 120 minutes reperfusion. TUNEL-positive nuclei were significantly increased in DMSO-treated Fgf2 KO and FGF2 LMWKO hearts compared to DMSO-treated Wt hearts. There was a significant decrease in TUNEL-positive nuclei in CEP11004-treated groups compared to DMSO-treated groups. n=4/groups and 96 fields/groups.*p<0.05 vs. DMSO-treated groups. #p<0.05 vs. DMSO-treated Wt group.

171

Wt Fgf2 KO FGF2 LMWKO

4.5

3.5

2.5

1.5 Cytochrome C release

(cytosol vs. membrane) 1

0.5

0 DMSO CEP11004 (50 nM)

Figure 45: Effect of JNK pathway inhibition on apoptosis, measured by cytochrome C release, following 60 minutes ischemia and 120 minutes reperfusion in DMSO- and CEP11004 (50 nM)-treated Wt (black bar), Fgf2 KO (gray bar) and FGF2 LMWKO (white bar) groups. There was no significant difference in cytochrome C release between DMSO-treated Wt, Fgf2 KO and FGF2 LMWKO groups. There was also no significant difference in cytochrome C release after CEP11004 treatment. n=6/group. *p<0.05 vs. DMSO-treated groups. #p<0.05 vs. DMSO-treated Wt group.

172

The localization of FGF2 LMW isoform and its effect on gene expression

The localization of FGF2 LMW isoform is controversial in that most studies demonstrate

a cytosolic location; however more recent studies also show a nuclear location155,179,187,188,716-720.

There is evidence that FGF2 LMW isoform can translocate into the nucleus after internalization186. This internalized FGF2 LMW isoform can stimulate cell proliferation and

down-regulation of FGFR179. Based on this, understanding the localization of the FGF2 LMW isoform in non-ischemic Wt and FGF2 LMWKO hearts will aim to understand the subcellular

targets of LMW isoform signaling. The localization of the LMW and HMW isoforms of FGF2

in non-ischemic Wt and FGF2 LMWKO (presence of only HMW isoforms) hearts has been

identified in this dissertation. Western immunoblot data showed that the HMW isoforms were

localized predominantly to the nucleus in Wt and LMWKO hearts with little to no detection in

the cytoplasm; whereas, the LMW isoform was found in the cytoplasm as well as in the nucleus

in wildtype hearts (Figure 46A). To determine whether alteration of the LMW isoform affected

the the protein levels of the HMW isoforms of FGF2 in the heart, quantitation of the Western

blot was performed. There was no difference in the protein expression of the 21 kD HMW

isoform between Wt and FGF2 LMWKO hearts in either fraction (Figure 46B). The expression

level of the 22 kD HMW isoform was also evaluated, and similar to the 21 kD isoform, there was

no difference in the 22 kD protein expression in Wt and FGF2 LMWKO cytoplasmic and

nuclear fractions. These results are consistent with those of other investigators who demonstrated

that the LMW isoform was identified in both cytoplasm and nucleus and HMW isoforms were

localized to the nucleus187,188,716. The nuclear localization of the FGF2 LMW isoform may

indicate that the FGF2 LMW isoform can elicit its biological activity not only through FGFR,

173

but it may also act as a transcription factor or a co-factor in the nucleus to affect gene expression under normal or stress conditions.

To determine any change in gene expression, mRNA from non-ischemic Wt, Fgf2 KO and FGF2 LMWKO hearts or those hearts subjected to I/R injury were evaluated in DNA under microarray studies. There was no gene expression differences identified in non-ischemic FGF2

LMWKO hearts compared to non-ischemic Wt hearts. However, after I/R injury, there were 630 genes which included those involved in immune response, cellular metabolism, calcium signaling, transcriptional regulation, oxidation, and apoptosis that were either up-regulated or down-regulated in sham-treated Wt hearts compared to ischemic-reperfused Wt hearts (Figure

47B, circle A, Table 15). These gene changes were influenced by I/R injury. Furthermore, there were 77 genes that were either up-regulated or down-regulated in ischemic-reperfused FGF2

LMWKO hearts compared to ischemic-reperfused Wt hearts (Table 16). These genes were affected by FGF2 LMW isoform regardless of I/R injury. Among these 77 genes, twelve were also altered in their mRNA expression level during I/R injury (Table 17). These twelve genes

(involved in cardiac function, ischemia-reperfusion injury, post-translational modification, membrane structure or cell death pathway) were regulated by FGF2 LMW isoform during I/R injury721-725 (Table17). This suggests that under stress, FGF2 LMW isoform may transcriptionally regulate the expression of genes involved in I/R injury.

174

A. Cyt NNNCyt Cyt Cyt N

β−actin

Histone-1

HMW: m22kD HMW: m21kD LMW: m18kD

FGF2 LMWKO Wt B. 14000 * 12000 Wt * FGF2 LMWKO 10000 *p<0.05 vs. Cytoplasmic cohort

8000

6000

Arbitary Unit 4000

2000

0 Cytoplasm Nucleus

Expression level of 21 kDa FGF2 isoform in non-ischemic Wt and FGF2 LMWKO hearts

Figure 46: (A) Representative Western immoblotting of FGF2 isoform localization in non- ischemic Wt and FGF2 LMWKO mouse hearts. (B) Quantification of the 21 kD HMW isoform in cytoplasmic and nucleus fractions from Wt and FGF2 LMWKO hearts. In Wt hearts, the LMW, 18 kD isoform, was localized to the cytosolic (Cyt) and nuclear (N) fractions of the heart; whereas, the HMW, 21 and 22 kD, isoforms were localized predominately to the nucleus. In the absence of the LMW isoform (FGF2 LMWKO), the HMW isoforms were predominantly expressed in the nucleus. β-actin is a cytosolic protein and used as a marker of cytosolic fraction enrichment. Histone-1 is a nuclear protein and used as a marker of nuclear fraction enrichment. n=6/group. *p<0.05 vs. cytoplasmic cohort.

175

Wt FGF2 LMW KO Non-ischemic

B. Wt FGF2 LMW KO Sham A

Ischemic-reperfused I/R B

A 630 12 77 B

Genes regulated by FGF2 LMW isoform during ischemia reperfusion injury

Figure 47. Schematic for DNA microarray analysis of gene expression. (A) Non-ischemic Wt and FGF2 LMWKO hearts were subjected to microarray study and the genes whose expression altered were those regulated by FGF2 LMW isoforms. (B) Wildtype (Wt, square) hearts, and hearts deficient of LMW isoforms (LMW KO, triangle) were subjected to sham (3.5 hour perfusion) or I/R injury. The Venn diagram demonstrates how intersections between sets of genes will allow the identification of those most likely to be involved in ischemia-reperfusion injury [A] and those regulated by the LMW FGF2 protein isoforms [B]. Yellow overlay shows the genes changed both in A and B thus indicating those genes regulated by FGF2 LMW isoforms during ischemia- reperfusion injury.

176

Table 15: mRNA expression of representative genes involved in ischemia-reperfusion injury (Circle A).

Functional Gene name Fold-increase (+) or group Fold-decrease (-) (FDR<0.10) Immune T-cell receptor beta +33.94 response interleukin 1 family, member 6 +3.83 lymphotoxin b +4.69 Metabolism histone 1, h1b +4.20 deoxynucleotidyltransferase, terminal +23.04 ribonucleotide reductase m2 +3.92 phospholipase b1 -1.05 cathepsin f +1.05 tumor necrosis factor receptor superfamily, member 7 +3.27 cadherin -2.54 Calcium calcium/calmodulin-dependent protein kinase IV +5.12 signaling calcium/calmodulin-dependent protein kinase IIalpha +4.20 calcium/calmodulin-dependent protein kinase II, beta +3.10 ATPase, Ca2+ transporting, cardiac muscle, fast +6.61 twitch 1 Protein Kinase protein kinase c, β 1 +3.99 inhibitor of κB kinase epsilon +3.02 Mitochondrial creatine kinase +2.61 deoxycytidine kinase +3.08 mitogen-activated protein kinase 11 +2.73 lymphocyte protein tyrosine kinase +11.08 Receptor type 1 protein tyrosine phosphatase +1.84 activity β 1 colony stimulating factor 2 receptor +5.51 Apoptosis angiopoietin-like 4 +4.04 b-cell leukemia/lymphoma 2 related protein a1b +6.50 b-cell leukemia/lymphoma 2 related protein a1d +6.06 angiotensin II receptor 1a -2.68 Transcription lymphoid enhancer binding factor 1 +8.03 factor growth factor independent 1 +3.89 Oxidation family 1, cytochrome p450 +3.75 fatty acid synthase +9.43 ribonucleotide reductase m2 +3.92 hydroxysteroid dehydrogenase-2 +4.55 Membrane sarcospan -19.14 protein FDR: False discovery rate

177

Table 16: mRNA expression of representative genes regulated by FGF2 LMW isoform (Circle B). Functional group Gene name Fold-increase (+) or Fold-decrease (-) (FDR<0.10) Immune response major histocompatibility complex class I -2.15 sffv proviral integration 1 +2.31 Ion transport solute carrier organic anion transporter family +2.71 potassium voltage-gated channel, isk-related -2.14 subfamily Metabolism u2 small nuclear ribonucleoprotein auxiliary +2.94 factor (u2af) 2 mitochondrial ribosomal protein l27 -2.09 phospholipase b1 -2.39 cathepsin f -2.07 Calcium signaling calcium/calmodulin-dependent protein kinase +2.08 ii, beta calcium/calmodulin-dependent protein kinase +1.88 II alpha cadherin +1.84 Receptor activity colony stimulating factor 2 receptor +2.50 type 1 protein tyrosine phosphatase -1.35 Apoptosis b-cell leukemia/lymphoma 2 related protein +6.50 a1b b-cell leukemia/lymphoma 2 related protein +6.06 a1d Membrane sarcospan -9.97 Transcription LPS-induced factor +3.25 factor/DNA binding taf6-like rna polymerase ii, p300/cbp- +2.96 associated factor (pcaf)-associated factor UDP-Gal:betaGlcNAc beta 1,4- +6.17 galactosyltransferase, polypeptide 5

Protein Type 1 protein tyrosine phosphatase receptor, -1.90 phosphorylation interacting protein, alpha 1

FDR: False discovery rate

178

Table 17. Gene transcripts differentially expressed by the LMW isoforms of FGF2 in hearts during ischemia-reperfusion injury (overlap)

Functional group Gene name Fold-increase (+) or Fold-decrease (-) (FDR<0.10) Metabolism phospholipase b1 -2.39

cathepsin f -2.07 Calcium signaling calcium/calmodulin-dependent protein kinase +2.08 ii, beta calcium/calmodulin-dependent protein kinase +1.88 II alpha cadherin +2.53

Receptor activity colony stimulating factor 2 receptor +2.50 type 1 protein tyrosine phosphatase -1.35 Apoptosis b-cell leukemia/lymphoma 2 related protein +6.50 a1b b-cell leukemia/lymphoma 2 related protein +6.06 a1d Membrane sarcospan -9.97 Transcription UDP-Gal:betaGlcNAc beta 1,4- +6.17 factor/DNA binding galactosyltransferase, polypeptide 5

Protein Type 1 protein tyrosine phosphatase receptor, -1.90 phosphorylation interacting protein, alpha 1

FDR: False discovery rate

179

Discussion

This dissertation demonstrated, unequivocally for the first time, that the endogenous

murine FGF2 LMW isoform has an important role in protecting the heart against post-ischemic

cardiac dysfunction (systolic and diastolic) and both LMW and HMW isoforms are most likely

necessary for protecting the heart from myocardial infarction. Upon inhibition of the JNK

pathway, post-ischemic cardiac dysfunction is restored in Fgf2 KO and FGF2 LMWKO hearts

compared to Wt, and the degree of myocardial infarction was reduced in Wt, Fgf2 KO and FGF2

LMWKO hearts, suggesting that the FGF2 LMW isoform-mediated cardioprotection involved

modulation of c-Jun terminal kinase (JNK) signaling leading to an inactivation of c-Jun and a

decrease in apoptosis.

FGF2 is a potent angiogenic and vasculogenic factor726,727. Amman and colleagues728 showed that the Fgf2 KO had a 25% decrease in myocardial capillary density compared to Wt, while Sheikh343 showed that overexpressing FGF2 protein had a 20% increase in capillary

density compared to non-transgenic mice. However, previous work from our laboratory showed

no difference between Wt, Fgf2 KO and FGF2 Tg hearts with regard to cardiac vessel density73.

The present study did not find any alterations in vasculogenesis, reflected by no change vessel density of cardiac smooth muscle-containing blood vessels and capillaries in non-ischemic Wt,

Fgf2 KO and FGF2 LMWKO hearts. These data are consistent with that of Sullivan and group285 who demonstrated that vascular adaptation, both angiogenesis and arteriogenesis, was not affected in Fgf2 knockout mice. These findings indicate that other angiogenic factors may mediate angiogenesis and vasculogenesis and act as a compensatory effect in Fgf2 KO and FGF2

LMWKO hearts. On the other hand, the angiogenic or mitogenic pathway may not be triggered until an organ/tissue is under stress.

180

FGF2 HMW isoforms are involved in cell growth301 and cause myocyte

binucleation301,729, an early marker of cardiomyocyte hypertrophic growth730, independent of

their cell surface receptors. No alteration in cardiac growth or induction of spontaneous cardiac

hypertrophy was observed in Fgf2 KO and FGF2 LMWKO hearts compared to Wt hearts (Figure

13), indicating that the presence of only the FGF2 HMW isoforms in FGF2 LMWKO hearts did

not influence the cardiac phenotype. The findings in this dissertation are opposite to the study by

Jiang and colleagues313 in which exogenous 23 kD FGF HMW isoforms administered to rat

heart contributed to a post-MI hypertrophy. This observed difference may be due to the time

frame when the measurements are taken, or the difference between exogenous treatment and

endogenous activity. In this dissertation, non-ischemic hearts were used, while Jiang and colleagues were evaluating the role of FGF2 HMW isoforms on hypertrophy after I/R injury.

These findings may also indicate that other factors (such as TGFβ731 and Angiotensin II732) may

mediate the hypertropic response or that hypertrophy is not triggered in the myocardium until an

ischemic or hypoxic event occurs, which then activates growth factor release and hypertrophic

signaling733. Furthermore, although evidence suggests that the LMW FGF2 isoform can increase

its own promoter activity326, the expression levels of the two murine FGF2 HMW isoforms (21

and 22 kD) were not changed, demonstrating that their expression was not FGF2 LMW isoform- dependent. The LMW promoter activity study by Quarto and colleagues326 was performed in

cell culture, where there are no neuronal and hormonal influences. In the in vivo study,

compensatory effects of other intracellular molecules and signals most likely will occur in the

absence of the FGF2 LMW isoform or all FGF2 isoforms. For example, this dissertation research

demonstrated a 2-fold decrease in FGF1 mRNA level in non-ischemic FGF2 LMWKO hearts, a

significant increase in FGF6 mRNA level in non-ischemic Fgf2 KO hearts, and a significant

181

decrease in FGF13 mRNA level in non-ischemic Fgf2 KO and FGF2 LMWKO hearts (Table 11).

Studies indicate that FGF6 and FGF13 are involved in embryonic cardiac development and

cardiac muscle regeneration in the adult heart711,734. In our mouse models, the changes in FGF6

and FGF13 mRNA levels may be a compensatory mechanism for the absence of only the FGF2

LMW isoform or all of the FGF2 isoforms and that could be the reason that there is no gross

anatomical or morphological cardiac defects in Fgf2 KO and FGF2 LMWKO hearts (Figure 13).

Overall, these findings indicated that the FGF2 protein isoforms are not the only growth factors responsible for angiogenesis and cardiac growth.

Many studies demonstrate FGF2 as a cardioprotective molecule65,86,89,207,341-343.

Exogenous administration of the human recombinant FGF2 LMW isoform can protect the heart from contractile dysfunction and/or myocardial infarction65. In vitro data from other

investigators65,86 and data from our laboratory309 show that ubiquitous or cardiac-specific

overexpression of FGF2 is very important in protecting the heart from myocardial dysfunction

and/or myocardial infarction following ischemia-reperfusion (I/R) injury. FGF2 consists of

multiple isoforms (LMW and HMW isoforms) which target to different cellular locations. In

several in vitro studies, LMW and HMW FGF2 isoforms have been implicated to elicit different

biological functions; however, the question remains as to the in vivo role of a specific FGF2 isoform(s) in I/R injury and cardioprotection. Kardami and colleagues65 demonstrated that

exogenous treatment with the recombinant human LMW FGF2 isoform improved cell survival

and functional recovery in the ischemic rat heart and also that overexpression of the human

FGF2 LMW isoform in mice reduced cardiomyocyte damage with no improvement in contractile function following I/R343. However, the role of endogenous FGF2 LMW and HMW isoforms in ischemia-reperfusion injury has yet to be studied. This dissertation demonstrated that deficiency

182

of the FGF2 LMW isoform (FGF2 LMWKO) displayed a significant decrease in percent

recovery of post-ischemic cardiac function compared to wildtype hearts (Figure 15, Table12),

suggesting that the LMW isoform is important for protection against myocardial dysfunction.

Interestingly, FGF2 LMWKO mouse hearts, in which only the FGF2 HMW isoforms are present,

had a percent recovery of post-ischemic contractile function similar to mice deficient in all LMW

and HMW isoforms (Figure 15). In addition, other FGFs like FGF1, when administered or

overexpressed, can elicit a cardioprotective action in an angiogenic-dependent or angiogenic-

independent manner705,706,735-740. In FGF2 LMWKO hearts, the poor post-ischemic cardiac

function following I/R injury may not be due to the decrease in mRNA level of FGF1, especially,

since Fgf2 KO hearts, where the percent recovery of contractile function was also decreased after

I/R injury, had no alteration of FGF1 mRNA level (Table 11). This observation clearly indicates

that the LMW isoform is responsible for protecting the heart from myocardial dysfunction, and is similar to exogenous treatment with the human recombinant FGF2 LMW isoform65,343. This is the first study to identify a potential biological function of the FGF2 LMW isoform in vivo in cardiac ischemia-reperfusion injury by using novel genetically-modified mouse models. There was no significant difference in myocardial infarction and creatine kinase release between Wt,

Fgf2 KO and FGF2 LMWKO hearts. This indicates that both LMW and HMW isoforms may be needed to protect the heart from myocardial infarction as our previous data showed that overexpression of all human FGF2 isoforms protected the heart from myocardial infarction309.

Several investigators observed that exogenous treatment or endogenous manipulation of the

FGF2 LMW isoform expression led to either a better recovery in cardiac function and/or a decrease in cell injury65,89,341-343. Not all studies, however, observed an improvement in both

endpoints (function and infarct size) of cardioprotection343, and the inconsistency could be due to

183

the difference between ischemic or animal models or endogenous FGF2 manipulation vs.

exogenous treatment with FGF2. Our ischemic model is the work-performing murine heart

preparation, a load-dependent model compared to the Langendorff model, which is extensively

used in the ex vivo I/R injury field. It is suggested that the induction of low-flow global and

regional ischemia is better controlled in isolated perfused hearts741. Global or regional ischemia can be controlled through various degrees of flow reduction with a level of control as good as or if not better than that with large mammalian hearts. In addition, in the working model, a supply-

demand imbalance of oxygen and accumulation of cardiotoxic metabolites occurs in the ischemic

heart while the Langendorff isolated heart is a quiescent system with no significant oxygen

imbalance during ischemia. The work-performing preparation has the advantage of measuring work-related indices of whole heart function during normal and ischemic episodes742. The differences in ex vivo models may be the reason why there is an inconsistency in the effect of

FGF2 LMW isoform in I/R injury. Even with this “inconsistency”, FGF2 LMW has good therapeutic potential for patients with ischemic heart disease. One of the major desired outcomes of clinical treatment of ischemic heart disease is to increase cardiac function. FGF2 LMW isoform’s acute action can protect the heart against myocardial dysfunction after I/R injury. Even though this dissertation showed that both isoforms are required for optimal protection against myocardial infarction, in many models, the recombinant LMW isoform alone can still protect the heart from cell damage343. Furthermore, the angiogenic effect of the FGF2 LMW isoform can further protect the heart from I/R injury.

Evidence demonstrates that exogenous treatment of rat cardiomyocytes with the

recombinant human FGF2 LMW isoform has a negative inotropic effect, but no effect on

lusitropy367. This dissertation also showed that FGF2 LMWKO hearts had a significant increase

184

in basal contractile and relaxation function compared to wildtype and Fgf2 KO hearts (Table 12);

however, FGF2 LMWKO hearts, similar to Fgf2 KO hearts, had a significantly poorer recovery

of cardiac function than wildtype hearts. This indicates that the enhanced basal cardiac function

in FGF2 LMWKO hearts does not yield a better outcome of cardiac function following I/R.

Interestingly, in FGF2 LMWKO hearts, the oxygen consumption was higher than in Wt hearts at

basal level. This may give a clue as to the potential outcome of LMWKO hearts during ischemia

as the LMWKO heats were working harder basally, and when stressed, the supply of oxygen

could not keep up with the demand required to function during I/R injury. Since cardiac

contractile and relaxation functions are regulated by intracellular calcium homeostasis, whether

the absence of the FGF2 LMW isoform alters the proteins involved in regulating intracellular

calcium load, resulting in the observed basal increase in cardiac function or affect calcium

handling/cycling during I/R injury needs to be further elucidated. Preliminary data in this

dissertation showed, for the first time, that ablation of the FGF2 LMW isoform had no effect on

calsequestrin, a Ca2+ binding protein which forms a functional complex at the cardiac functional

sarcoplasmic reticulum and coordinates Ca2+ release743, but caused a decrease in phospholamban

phosphorylation (Figure 28). The decreased phosphorylation of phospholamban will lead to an

enhanced inhibitory effect of phospholamban on SERCA (sarcoplasmic reticulum Ca2+-ATPase),

subsequently resulting in a decrease in intracellular calcium reuptake and a decrease in

relaxation, which was the opposite effect that was observed in non-ischemic LMWKO hearts

(Table 12). A possible explanation is that there are many other calcium handling proteins of the

sarcoplasmic reticulum (such as SERCA, junctin, triadin, histidine-rich calcium binding protein)744,745, or within the sarcolemma [sodium calcium exchanger (NCX), L-type calcium channel]746, or as part of the contractile apparatus (troponin T and I)747 which play an important

185

role in intracellular calcium homeostasis and cardiac function. The role of any of these proteins

in normal or ischemic-reperfused FGF2 LMWKO heart is unknown. In order to compensate for

this observed decrease in phosphorylation of phospholamban, the expression of SERCA, junctin and triadin might increase to stimulate the process of calcium transport back to the SR, or the

NCX may increase its activity to transport calcium out of the cell. Another possible explanation is that the antibody presently used to detect the phosphorylation of phospholamban recognizes the protein kinase A (PKA) phosphorylation sites. PKA is not known to be regulated by FGF2

LMW isoform/FGFR activation, but PKA can be activated by G-protein coupled receptors

(GPCRs)748. There is evidence indicating that receptor tyrosine kinases (RTKs) can crosstalk with GPCRs749,750. The insulin growth factor receptor and epithelial growth factor receptor, both

751,752 RTKs, can phosphorylate Gi and Gq which may lead to alterations of PKA activity . There

currently is no direct evidence to suggest that FGFR can couple to or crosstalk with GPCRs,

thereby regulating protein kinase A activity. Our preliminary data suggest that there may be a

potential crosstalk between FGFR and GPCR, but more investigation needs to be performed.

Overall, understanding the action of FGF2 LMW isoform in the regulation of cardiac calcium

homeostasis will be a future goal toward elucidating the function of the FGF2 LMW isoform in

I/R injury.

This dissertation has demonstrated that FGF2 LMW isoform is important for post-

ischemic recovery of cardiac function, independent of any angiogenic effects of FGF2. This

cardioprotective action, in part, is mediated through modulation of the MKK/JNK/c-Jun

pathway. Many actions of FGF2 are mediated through interaction with its low affinity receptor

(heparan sulfate proteoglycan, HSPG) and its high affinity FGF receptor (FGFR), a receptor

tyrosine kinase209. The HSPG receptors regulate FGF bioavailability and improve FGF2’s

186

affinity to the FGFRs753. Ligand binding results in the dimerization and autophosphorylation of

the receptor and stimulation of the PKC, PI3 kinase and MAPK pathways209.

PKC is implicated in cardioprotection and in the regulation of cardiac function76,392,417,422-

427. Four PKC isoforms (PKC α, δ, ε and ζ) were studied because of their known relationship to

FGF2 signaling or protection from ischemia-reperfusion injury. PKC isoform activation, as measured by translocation and phosphorylation, was examined in non-ischemic wildtype, Fgf2

KO and FGF2 LMWKO hearts to determine whether ablation of all FGF2 isoforms or only the

LMW isoform would “prime” protective PKC signaling. The activation of PKCs may occur in several ways including translocation to their cellular compartment(s) to phosphorylate

downstream targets754 or via phosphorylation by their upstream kinases such as (PDK-1)755-757 or

autophosphorylation757. Phosphorylation and translocation of PKC do not always correlate with

each other and there is evidence that these events may occur at different time points758-760. In this dissertation, both translocation and phosphorylation were used as indices of PKC activation.

There were no differences in PKC α, ε, and ζ activation (translocation and phosphorylation) in non-ischemic wildtype, Fgf2 KO and FGF2 LMWKO hearts. Non-ischemic Fgf2 KO and FGF2

LMWKO hearts had a decreased translocation of PKC δ compared to wildtype hearts (Figure

19). There was no difference in PKC δ translocation between Fgf2 KO and FGF2 LMWKO hearts, suggesting that the FGF2 LMW isoform may modulate the translocation of PKC δ in hearts. Many studies have shown that PKC δ translocation is deleterious to the cardiac muscle77 and inhibition of PKC δ translocation leads to a protective effect against I/R injury77. Other studies have, however, shown a protective422 or no effect436 of PKC δ activation in I/R injury. In

our study, the decrease in PKC δ translocation did not “prime” the heart and protect it from a

future I/R injury.

187

This dissertation also revealed, for the first time, the influence of the FGF2 LMW

isoform on the PI3 kinase pathway in cardiac tissue. There was a significant decrease in Akt

activation (phosphorylation) in non-ischemic Fgf2 KO and FGF2 LMWKO hearts compared to

wildtype hearts (Figure 26). Akt is the main functional component activated by PI3 kinase621, and the activation of Akt can serve as a survival factor, resulting in protection against apoptosis628. Ischemic preconditioning can activate PI3 kinase and Akt, and this protective effect can be abolished by the PI3 kinase inhibitors, wortmannin and LY294002634. Therefore, attenuation of Akt activation may act in an adverse manner and could potentially contribute to the poorer recovery of post-ischemic contractile function observed in Fgf2 KO and FGF2

LMWKO hearts.

Studies reveal differential roles of LMW and HMW FGF2 isoforms in MAPK activation343,444,761. Evidence shows that administration of the FGF2 LMW isoform to a tumor

cell line activates p38 MAPK and ERK, leading to cell death761. Overexpressing the FGF2 HMW

isoform in pancreatic cells causes an increase in ERK activation444. Sheikh and group343 demonstrated that overexpression of the FGF2 LMW isoform results in a significant increase in the phosphorylated form of JNK and p38 MAPK in the non-ischemic heart. However, in this dissertation, JNK activation was significantly increased and p38 activation was significantly decreased in non-ischemic Fgf2 KO and FGF2 LMWKO hearts compared to Wt hearts (Figure

24). Importantly, there was no difference in JNK and p38 MAPK activation between Fgf2 KO and FGF2 LMWKO hearts, suggesting that the LMW isoform was responsible for regulating the activation of JNK and p38 MAPK in non-ischemic murine hearts. In support of this finding, recombinant mouse FGF2 LMW isoform given to non-ischemic LMWKO hearts resulted in a decrease in JNK phosphorylation (i.e., decreased activation) (Figure 25). This action of the

188

LMW isoform may be a potential mechanism by which it elicits a cardioprotective effect. The

overexpression model of the Sheikh group343 had a 34-fold increase in the FGF2 LMW isoform

and this high fold increase exceeds the physiological level of FGF2, potentially resulting in non- specific activation of MAPK signaling pathway. On the other hand, in our model, exogenous administration of FGF2 LMW isoform is within the physiological range (10-500 ng/mL)762. This may be a reason of the opposing observation in JNK activation between our findings and those of

Sheikh and colleagues.

JNK, a branch of the MAPK pathway, is activated upon various stimuli, including

inflammatory cytokines, UV irradiation, heat shock, and ischemia, and promotes cell death in a number of cell types763,764. Ischemia-reperfusion injury induces JNK activation, most notably

during reperfusion765. In our study, not only was JNK activated, but MKK4 and MKK7,

upstream signals in the JNK pathway, were also significantly activated in Fgf2 KO and FGF2

LMWKO hearts at early reperfusion (Figures 30 and 31). Moreover, JNK and MKK7 activation were significantly increased in sham-treated Fgf2 KO and FGF2 LMWKO hearts consistent with the observation in non-ischemic cohorts (Figures 29 and 30). These data are not only similar with previous reports showing alteration in JNK activation throughout both ischemia and reperfusion763-765, but also provide novel evidence that it is the FGF2 LMW isoform which

regulates JNK signaling as JNK, MKK4 and MKK7 were activated to a similar level in Fgf2 KO

and FGF2 LMWKO hearts compared to Wt hearts (Figures 29, 30 and 31). A JNK pathway

inhibitor, CEP11004 which inhibits the activation of mixed lineage kinases (MLKs) and

therefore inhibits the activation of MKK4/7, the upstream kinases of JNK, was employed to

demonstrate the importance of the JNK pathway in FGF2 LMW isoform-mediated

cardioprotection. After CEP11004 treatment, there was a significant increase in the percent

189

recovery of cardiac function (Figure 33) and a significant reduction in creatine kinase release and apoptosis (Table 14) compared to DMSO-treated group. These data demonstrate that inhibition of upstream kinases of JNK, MLKs, could restore cardiac function and reduce cell death following ischemia-reperfusion injury. Similar studies using different JNK inhibitors also demonstrated the importance of modulating JNK activation during I/R injury for cytoprotection to occur529. Administration of the JNK inhibitors, AS601245 or SP600125, which compete for

ATP binding, decreased infarct size as well as apoptosis in a rat model of myocardial I/R

injury764,765, and increased neuronal survival after transient brain ischemia-reperfusion injury by suppressing the activation of c-Jun and Bcl-2766. Most importantly, our data reveal a relationship

between the FGF2 LMW isoform and JNK signaling in I/R injury.

Immunoblotting was performed to confirm the inhibition of JNK pathway via CEP11004

as well as the selectivity of CEP11004 (i.e., whether it affected the activation of other MAPK

signaling molecules, ERK and p38 MAPK). Western immunoblot analysis showed that JNK,

MKK7 and MKK4 were inhibited after CEP11004 treatment with no alteration in ERK and p38

MAPK activation (Figures 37, 38, 39, 40 and 41). Both MKK7 and JNK activation but not

MKK4 activation were significantly increased, in DMSO-treated Fgf2 KO and FGF2 LMWKO

hearts. These data indicate that the FGF2 LMW isoform elicited its cardioprotective effect via modulating the MKK7/JNK pathway and not the MKK4/JNK pathway, providing novel evidence on the regulation MKK4/7. MKK4/7 are regulated by different MAPK kinase kinase kinase (MEKK) such that MEKK1, 2, 3 and 4, all have the potential to activate MKK4, while only MEKK1, 2, 3 can regulate MKK7767. The employed concentration (50 nM) of CEP11004

did not inhibit the other MAPKs (ERK and p38 MAPK, Figures 34 and 35). It is well

characterized that ERK acts as a cell survival molecule , while p38 MAPK has dual effects (cell

190

survival or cell death) during myocardial I/R injury768. p38 MAPK is protective when activated

prior to ischemia576-578 and it is detrimental when activated during ischemia582,583. Interestingly,

regardless of the activation of strong survival proteins, ERK and p38 MAPK, during ischemia-

reperfusion injury (Figures 34 and 35), only inhibition of JNK signaling by CEP treatment

caused almost full recovery of contractile function compared to DMSO-treated cohorts (Figure

33). In fact, the present study provides evidence that inhibition of the MEK1/ERK or p38

pathway did not improve the contractile function nor reduce creatine kinase release during

ischemia-reperfusion injury (Table 14). Furthermore, activation of p38 by anisomycin also did

not improve the cardiac dysfunction observed in Fgf2 KO and FGF2 LMWKO hearts following

ischemia-reperfusion injury (Table 14), suggesting that the deleterious actions of JNK are a

predominant event in I/R injury in our mouse models and that the FGF2 LMW isoform has a role

in modulating the JNK pathway to elicit its cardioprotective effect.

It has been well established that cardiomyocyte cell death during I/R injury includes

apoptosis and oncosis769. FGF2 and JNK are both involved in regulating intrinsic and extrinsic

pathways of apoptosis343,480,770. FGF2 can inhibit endothelial cell apoptosis by a Bcl-2-dependent

or -independent mechanism771, and antisense blockade of FGF2 induces apoptosis in vascular

smooth muscle cells346,772. Furthermore, FGF2 can alter the level of Bcl-2 and Bax family proteins involved in apoptosis773. JNK is a key factor in apoptosis, moving to the nucleus to phosphorylate and activate transcription factors such as c-Jun, or translocating to mitochondria to phosphorylate the apoptotic-related proteins, Bcl-2 associated protein X (Bax), Bcl-2-antagonist

of cell death (Bad), and Bcl-2774. Several hallmarks of apoptosis, including caspase 3 cleavage

(early phase), cytochrome C release (early phase), Poly (ADP-ribose) polymerase (PARP) and

DNA strand breaks (late phase), are used for detection of apoptosis. The dissertation work first

191

demonstrated that in non-ischemic hearts, there was no difference in caspase 3 cleavage; but

there was a significant increase in TUNEL-positive nuclei, indication of apoptosis, in Fgf2 KO and FGF2 LMWKO hearts. However, the difference in the degree of TUNEL-positive cells between non-ischemic Fgf2 KO and FGF2 LMWKO hearts compared to non-ischemic wildtype was only ~1%, and it is questionable whether this difference would lead to a pathophysiological influence in cardiac function. Interestingly, an increase in cytochrome C release was noted in non-ischemic FGF2 LMWKO hearts compared to wildtype and Fgf2 KO hearts, suggesting the possible regulation on mitochondrial function by FGF2 LMW isoform. In DMSO-treated Fgf2

KO and FGF2 LMWKO hearts, there was a significant increase in TUNEL-positive nuclei and caspase 3 cleavage, suggesting that in addition to ischemia-reperfusion injury’s influence on apoptosis, the FGF2 LMW isoform also modulates apoptotic events. Upon JNK pathway inhibition (CEP11004), apoptosis, measured by TUNEL-positive nuclei and caspase 3 cleavage, in Fgf2 KO and FGF2 LMWKO mouse hearts was also inhibited (Figures 43 and 44). However, unlike the non-ischemic hearts, there was no difference in cytochrome C release between the

DMSO-treated groups following I/R injury. It had been suggested that extrusion of cytochrome

C from the mitochondrial appears to be fundamental for the progression of apoptosis during I/R injury11. In our models, I/R injury lead to an increase in cytochrome C release in wildtype and

Fgf2 KO hearts, while in FGF2 LMWKO hearts, the cytochrome C release had already reached a

maximum level basally. Therefore, after I/R injury, there was no further cytochrome C release

observed, resulting in no difference among groups. Furthermore, after JNK pathway inhibition,

there was no difference in cytochrome C release in CEP11004-treated groups. Evidence

demonstrates that after being phosphorylated, JNK can translocate to mitochondria and associate

with Bcl-2 and protein phosphatase 1 (PP1) to regulate mitochondria pore formation and

192

function, resulting in cytochrome C release775,776. This step requires the mitochondrial

localization of JNK. This dissertation, however, did not provide any evidence that cytochrome C

release was altered upon inhibition of the JNK pathway. In our model, it is unknown where JNK

localizes after I/R injury in FGF2 LMWKO hearts. Based on this evidence, it appears that JNK

may not have translocated to mitochondria to regulate cytochrome C release and other factors

might regulate this process such as FGF2 HMW isoform777 and PKC778. For example, HEK293

cells transfected with FGF2 HMW isoforms had an increased cytosolic cytochrome C content

indicating the possibly involvement of FGF2 HMW isoforms777. As c-Jun is a major substrate of

JNK497 and an important molecule involved in cell death507-510, its activation was evaluated to identify a potential molecular mechanism of JNK in FGF2 LMW isoform-mediated cardioprotection. A significant increase in c-Jun activation was observed in DMSO-treated Fgf2

KO and FGF2 LMWKO hearts compared to DMSO-treated Wt hearts (Figure 42). This finding suggests that the FGF2 LMW isoform negatively regulates c-Jun by modulating JNK pathway activation during ischemia-reperfusion injury. Upon JNK pathway inhibition, the activation of c-

Jun in Wt, Fgf2 KO and FGF2 LMWKO hearts was significantly decreased (Figure 42). c-Jun activation and apoptosis were also inhibited in wildtype hearts following CEP11004 treatment, indicating that not only absence of the FGF2 LMW isoform (or presence of FGF2 HMW isoforms), but I/R injury can activate c-Jun and induce cell death. Since numerous studies have revealed that phosphorylation of c-Jun by JNK is necessary for the apoptotic response in certain cell types515,767,768 as well as in several models of ischemia-reperfusion injury515,765-767,779, the

FGF2 LMW isoform may modulate apoptosis through inhibition of c-Jun activation, leading to the cardioprotective effect. Overall, these findings suggest a role of FGF2 LMW isoform in regulation of the late stage of apoptosis occurring through MKK7/JNK/c-Jun pathway.

193

The mechanism by which inhibiting the JNK pathway protects against post-ischemic

cardiac dysfunction is unknown. It is speculated that the effect of JNK pathway on cardiac

function could be indirect or direct mechanism. The indirect mechanism may be due to the

deleterious influence of JNK on cell apoptosis during I/R injury. JNK induces apoptosis343,480,770 which will lead to fewer cells that can function normally and eventually lead to poor post- ischemic cardiac function. By inhibiting the JNK pathway, our data indicated that less cells undergo apoptosis which may help the heart function better during ischemic stress. The final phenotype (outcome) from these apoptotic events occurs over days; yet, our observed effect (i.e., cardiac dysfunction) occurs within minutes, which indicates that JNK is initiating a predominantly direct mechanism on cardiac function. Evidence demonstrates that JNK can phosphorylate the contractile protein, caldesmon, in a calcium-independent manner in aortic smooth muscle which leads to an increased contraction of the muscle780. In our non-ischemic

Fgf2 KO and FGF2 LMWKO hearts, JNK had an increased phosphorylation (activation)

compared to Wt hearts (Figure 24). Also, the FGF2 LMWKO hearts had a significant increase in

cardiac function and myocardial oxygen consumption compared to Wt hearts (Table 12). It is

speculated that this increase in JNK phosphorylation may result in an enhanced cardiac

contractile function. During I/R injury, increasing the stress on “overworked” FGF2 LMWKO

hearts then results in poorer cardiac function. JNK pathway inhibition during I/R resulted in

improved post-ischemic recovery of cardiac function. One explanation is that myocardial oxygen

consumption may be reduced in LMWKO hearts during I/R injury, reducing the imbalance

between oxygen supply/demand, leading to the observed restoration of cardiac function. Besides

caldesmon, activation of JNK can result in a down-regulation of connexin 43 (Cx 43) in

cardiomyocytes781. The altered localization of Cx 43 from gap junctions to mitochondria and

194

overall reductions in Cx 43 level are common features of ischemic heart disease782,783. Connexin

43 also is significantly involved in electrophysiological properties of the heart784. Decreased

connexin 43 levels leads to a poor conduction of the heart, resulting cardiac arrhythmias784. In our mouse models, increased JNK activation may affect connexin 43 function, ultimately influencing the ion conduction of the heart and cardiac function during I/R injury; evaluation of this hypothesis needs to occur. These substrates of JNK could be the potential targets by which the LMW isoform-JNK link modulates cardiac function during I/R injury. Studies need to be performed to elucidate this relationship between the FGF2 LMW isoform, JNK signaling and post-ischemic recovery of cardiac function.

No difference in myocardial infarction between the Wt, Fgf2 KO and FGF2 LMWKO groups was observed. This observation could be related to the methods that were employed to determine myocardial infarction which included apoptotic and oncotic death648. Myocardial

infarction refers to irreversible cell damage (necrosis)3. Clinically, the release of cardiac enzymes

such as creatine kinase, lactate dehydrogenase, troponin I and myoglobin levels is used as an index of the onset of heart attack785,786. This dissertation utilized triphenyl tetrazolium chloride

(TTC) staining to measure necrotic cell death and creatine kinase release to indicate cell injury.

Both methods are based on the presence of cardiac enzymes787. TTC staining detects viable

tissue by its reaction with NADPH to form a red formazan color in normal myocardium788, while creatine kinase release analysis utilizes the permeability of the membrane and result in a release of the cardiac enzyme, creatine kinase, to detect cardiac cell injury. Both myocardial apoptosis and oncosis can progress to necrosis (cell membrane rupture) and apoptosis, and each cell death pathway has its own morphological abnormalities including cell shrinkage (apoptosis) and cell swelling (oncosis)648. All of these abnormalities will result in an increase in cell membrane

195

permeablility and eventual release of cardiac enzymes648. Therefore, these methods cannot

differentiate between cells that undergo apoptosis or necrosis. Furthermore, other methods such

as a combination of propidium iodide and annexin V staining should be performed to delineate

necrotic cell death from apoptotic cell death in these mouse models in order to support that

overall cell death (necrosis) and apoptotic cell death are differentially altered by the FGF2 LMW isoform. Mitochondria can mediate necrotic cell death through membrane swelling, loss of the electrochemical gradient across the inner membrane, production of ROS and declining ATP production789. Evidence indicated that FGF2 LMW isoform can preserve mitochondrial

intergrity347 and upregulate Bcl-2 expression790, which could be the potential target to regulate

necrosis. Apoptotic signaling also occurs in the nucleus791. Therefore, it is also important to

understand whether the LMW isoform can also mediate nuclear apoptotic signaling.

The FGF2 LMW isoform can remain in the cytosol or translocate into the nucleus after

internalization155,179,187,188,716-720. Whether the LMW FGF2 isoform can be found in the nucleus in

cardiac tissue is unknown. This dissertation demonstrated that the FGF2 LMW isoform was

located in both the cytoplasm and nucleus (Figure 46), while the FGF2 HMW isoform was

localized in nucleus (Figure 46). This evidence is consistent with other groups184,185,186,187,188. The nuclear localization of FGF2 LMW isoform leads to its binding to the nuclear matrix187 and potential involvement in regulation of gene transcription and/or DNA replication188. This dissertation also speculates that the nuclear-targeted FGF2 LMW isoform can regulate gene transcription (see microarray study results). However, many studies demonstrate that the FGF2

LMW isoform fails to act as a transcriptional factor317. Similarly, this dissertation provided evidence that the LMW isoform may not be important for basal regulation of gene as no significant alteration in gene expression was observed in non-ischemic FGF2 LMWKO hearts

196

compared to wildtype hearts. As mentioned, this outcome was observed during normal organ

homeostasis, and LMW isoform may not be important or necessary for gene transcription in the

nucleus until stress stimulations occur. Under an ischemic insult, there were a number of genes

regulated by the FGF2 LMW isoform (Table 17). After I/R injury, there were 630 genes

upregulated or down-regulated in sham-treated Wt hearts compared to ischemic-reperfused Wt

hearts (Figure 47, circle A, Table 15, p<0.05). These genes, regulated by I/R injury, included those involved in the immune response, cellular metabolism, calcium signaling, transcriptional regulation, oxidation and apoptosis. Seventy-seven genes were either up-regulated or down- regulated (Table 16) in ischemic-reperfused FGF2 LMWKO compared to ischemic-reperfused

Wt hearts, and these gene expression changes were due to the ablation of FGF2 LMW isoform.

Among these 77 genes, twelve genes were also regulated by I/R injury (Table 17). These twelve,

including genes involved in metabolism, calcium signaling, transcription factor function, and

apoptosis were determined as those genes regulated by the FGF2 LMW isoform during I/R

injury. Among these twelve genes, four are implicated to be involved in I/R injury, cell death or

cardiac function, and below is listed their potential biological activity relating to I/R injury:

Cathepsin f: Cathepsin f is a protease, found in many types of cells792. Cathepsin f plays a

central role in the enhancement of survival including tumor-induced angiogenesis, cell migration

and proliferation793. During renal I/R injury, inhibition of cathepsin results in an increased renal

function794, suggesting the possible dual role of cathepsin in regulating cell survival. In our

model, ablation of FGF2 LMW isoform resulted in a decreased mRNA expression in cathespsin,

leading to the idea that this gene may influence the apoptotic process and the outcome of FGF2

LMW isoform activity during I/R injury.

197

Calcium/calmodulin-dependent protein kinase II (CaMKII): CaMKII is a serine/threonine kinase

regulated by calcium/calmodulin complex795. CaMKII can phosphorylate phospholamban,

SERCA and ryanodine receptor to regulate intracellular calcium796. In the FGF2 LMWKO

hearts, there is an increase in CaMKII mRNA level, indicating potential increase CaMKII

activity which may lead to an increased cardiac function. This may be a reason why the basal cardiac function in FGF2 LMWKO heart is higher compared to Wt hearts. Although CaMKII

mRNA levels are increased, our data showed that the phospholamban activation is decreased in

FGF2 LMWKO hearts, indicating that other factors are modulating the phosphorylation level of phospholamban.

Cadherin: Cadherins are a class of transmembrane proteins regulated by calcium797. The expression of cadherins is significantly reduced after ischemia798. The adheren junction, formed

by cadherin, is involved in maintaining attachments between adjacent cardiomyocytes799 , and the decreased expression of N-cadherin has implications on altering cell-to-cell attachments and, subsequently, altering mechanical coupling between cardiomyocytes800. Overexpression of

cadherin can lead to dilated cardiomyopathy801. In ischemic-reperfused hearts, tissue injury is

associated with vascular leakage, myofibrillar dysfunction and endothelial junction dysfunction

caused by the “no-flow”phenomon800,802. These dysfunctions are associated with a degradation of

cadherin, leading to vascular permeability and cardiomyocyte dysfunction. Cadherins can also

promote cell proliferation through FGFR803 and FGF2 can inhibit this proliferation possibly by

competitivly binding with FGFR. FGF2 can also increase phosphorylation of cadherin, leading to

a loss of cell to cell adhesion804. In our FGF2 LMWKO hearts, there is an increase in cadherin

198

mRNA level which may result from a compensatory effect of tissue damage and loss of vascular

integrity during I/R injury.

Sarcospan: Sarcospan belongs to the dystrophin-glycoprotein complex805. The whole body

ablation of sarcospan leads to myocardial ischemic-like lesions followed by fibrotic calcification and scarring of the cardiac muscle805, indicating that sarcospan could possibly be the trigger

during I/R injury. In the LMWKO hearts, the expression of sarcospan is significantly decreased which could partially be responsible for the I/R injury observed in the LMWKO hearts.

Overall, ablation of FGF2 LMW isoform results in alteration of gene expression which could contribute to I/R injury; yet, due to the time needed for gene-to-protein expression to occur

(>3 hours), the length of I/R injury most likely is not enough for transcription (gene)-to-

translation (protein) to occur. Therefore, most of these cardioprotective actions of the LMW

isoform during acute I/R injury are due to the activation of rapid signaling mechanisms identified

in the dissertation. In the mice, the genetic manipulation of the FGF2 isoforms is chronic (in

utero and over its lifespan) and with that, leads to expression (or lack) of sets of genes, and

ultimately proteins, that are influenced by the presence or absence of the LMW isoform, to affect

cardiac function and cell survival/death in the heart. There is a possibility that these genes

expressed (or not expressed) because of the genetic manipulation of the FGF2 isoforms may modify cellular, subcellular or molecular cardiac structure (no gross anatomical or morphological structural changes were identified in these hearts) and function of the heart and subsequently the response of the heart to I/R injury. For example, cadherin is important in maintaining cell-to-cell connections and the mechanical coupling between cardiomyocytes800. Sarcospan belongs to the

dystrophin-glycoprotein complex805 which is important for membrane integrity806. The gene

199

expression of these two proteins is regulated by the LMW isoform in the absence of I/R injury

(see Table 16). This altered gene expression of proteins involved in cardiac structure/function

may cause the LMWKO hearts to be more susceptible to myocardial dysfunction during I/R

injury. These genes could be future candidates to further identify and understand the role of the

FGF2 LMW isoform in I/R injury. To elucidate the importance of genes whose expression are modulated by the LMW isoform during I/R injury, a longer in vivo I/R injury protocol need to be performed to provide enough time and allow the gene under transcriptional alteration. It is also necessary to verify the microarray data by using RT-PCR and immunoblotting to correlate the mRNA expression level to protein level. To test the necessity of these gene candidates in FGF2

LMW isoform’s action during I/R injury and cardioprotection, several methods can be utilized including the use of pharmacological agents (agonists or antagonists) on FGF2 LMWKO hearts or crossing specific knockout or overexpression candidate mice with the FGF2 LMWKO mouse.

In summary, this dissertation provides important and new evidence for the FGF2 LMW isoform as a cardioprotective molecule against post-ischemic cardiac dysfunction. Furthermore, the LMW isoform modulates MKK7, JNK, and c-Jun activation as well as apoptotic processes prior to and during ischemia-reperfusion injury. A novel JNK pathway inhibitor, CEP11004, administrated during ischemia-reperfusion restored the recovery of post-ischemic cardiac function and reduced myocardial cell death. In addition, several genes, including cathepsin, caMKII, cadherin and sarcospan that are involved in cardiac function, vascular structure and cell damage, are regulated by FGF2 LMW isoform and may be possible candidates/downstream targets which dictate the cardioprotective outcome of FGF2 LMW. Overall, our findings unequivocally demonstrate the importance of the FGF2 LMW isoform in cardioprotection and

200

for the first time, demonstrate the relationship between the FGF2 LMW isoform and the JNK signaling pathway in cardioprotection.

201

Chapter 3. Role of FGF2 HMW isoforms in ischemia-reperfusion injury and

cardioprotection

Results

Cardiac characterization of mice deficient in or overexpressing the FGF2 HMW isoforms

Our previous data indicated that neither ablation of all FGF2 isoforms (Fgf2 KO) nor only the FGF2 LMW isoform (FGF2 LMWKO) led to abnormal cardiac growth73,160,305 (see

Chapter 2, Figure 13). The question remains, however, whether ablation of only the FGF2 HMW

isoforms (FGF2 HMWKO) or overexpression of the human FGF2 24 kD HMW isoform (FGF2

HMW 24 kD Tg) would influence cardiac developmental growth. There was no significant

difference in heart weight-to-body weight ratio (mg/g) between Wt (6.1±0.4) and HMWKO

(6.0±0.4) mice (Figure 49A) or between NTg (5.0±0.1) and 24 kD Tg (line 20: 5.2±0.1 and line

28: 4.9±0.1) animals (Figure 49B), indicating that neither ablation of the HMW nor

overexpression of the human FGF2 24 kD HMW isoform altered cardiac growth or induced

spontaneous cardiac hypertrophy.

No difference in FGF2 LMW isoform expression was observed in FGF2 HMWKO hearts

(Figure 48A). In hearts overexpressing the human 24 kD isoform, the endogenous murine 18, 21

and 22 kD FGF2 isoforms were not different compared to NTg hearts, suggesting that alterating

the protein level of the FGF2 HMW isoforms did not affect the expression of endogenous FGF2

isoforms (Figure 48B). No FGF2 HMW isoforms were detected in FGF2 HMWKO mice (Figure

48A).

No significant alteration in vessel number or defects in vasculogenesis or angiogenesis

was detected in any of the groups. There was no significant difference in the number of smooth

muscle-containing blood vessels per square millimeter (mm2) between Wt (8.6±0.2 and FGF2

202

HMWKO (8.8±0.4) hearts or between NTg (10.3±0.7) and 24 kD Tg hearts (line 20: 9.6±0.4 and line 28: 9.2±0.6). Also, in FGF2 HMWKO (54.0 ±10.6) and Wt (57.3±8.6) groups as well as in

NTg (49.8±13.7) and 24 kD Tg (line 20: 53.7 ±8.79 and line 28: 51.5±11.0) hearts, the cardiac

capillary density was similar. Furthermore, there was no correlation between percent recovery of

post-ischemic cardiac function or myocardial infarction to coronary flow.

203

HMW m22 kD m21 kD LMW m18 kD

Wt Fgf2 KO FGF2 HMW KO

h34 kD h24 kD HMW m22&h22.5 kD m&h21 kD LMW m&h18 kD

NTg hFGF2 Tg hFGF2 HMW Tg (24 kD)

Figure 48: Representative Western immunoblot of FGF2 isoform expression. (A) Wildtype (Wt) hearts expressed one FGF2 LMW isoform (18 kD) and 2 FGF2 HMW isoforms (21 and 22 kD). No FGF2 isoforms were present in Fgf2 KO mouse hearts and no FGF2 HMW isoforms were expressed in FGF2 HMWKO mouse hearts. (B) Non- transgenic (NTg) hearts also expressed one FGF2 LMW isoform (18 kD) and two FGF2 HMW isoforms (21 and 22 kD). The FGF2 Tg hearts expressed the murine (m) LMW and HMW isoforms (18, 21, and 22 kD) and overexpressed the human (h) FGF2 LMW (18 kD) and HMW (21, 22.5, 24, and 34 kD) isoforms. The FGF2 HMW Tg hearts overexpressed the human 24 kD HMW isoform.

204

A. Wt 7 FGF2 HMWKO

weight (g) ratio 2

Heart weight (mg)-to-body Heart weight (mg)-to-body 1

NTg B. 6 24 kD Tg line 20 5 24 kD Tg line 28

weight (g) ratio 2

Heart weight (mg)-to-body Heart weight (mg)-to-body 1

Figure 49: Heart weight-to-body weight ratio (mg/g) in Wt (black bar), FGF2 HMWKO (striped bar), NTg (black bar) and hearts overexprssing FGF2 24 kD HMW isoform (24 kD Tg) (line 20: crossed bar; line 28: dotted bar). There was no significant difference in heart weight-to-body weight ratio between Wt and HMW KO groups (A) and between NTg, 24 kD Tg line 20, and 24 kD Tg line 28 groups (B), indicating that alterating the protein expression level of FGF2 HMW isoforms did not affect cardiac growth or cause spontaneous hypertrophy. n=3 for Wt and FGF2 HMWKO; n=12 for Tg, n=19 for 24 kD Tg line 20 and n=10 for 24 kD Tg line 28 groups.

205

Effect of ablation or overexpression of the FGF2 HMW isoforms on post-ischemic

myocardial function

Wt, FGF2 HMWKO, NTg, and two lines of human FGF2 HMW 24 kD Tg mouse hearts

were subjected to 60 minutes global low-flow ischemia and 120 minutes reperfusion. The cardiac

function in FGF2 HMWKO gradually increased during I/R injury and by 60 minutes of

reperfusion, cardiac function significantly improved in HMWKO hearts (Figure 52A) compared to wildtype hearts (p<0.05). At the end of 60’I/120’R, there was a significant increase in post- ischemic recovery of contractile function in FGF2 HMWKO hearts (70±6%) compared to Wt hearts (31±6%) and in post-ischemic recovery of relaxation function in FGF2 HMWKO hearts

(55±4%) compared to Wt hearts (31±2%) (p<0.05, Figure 50). Following ischemia-reperfusion injury, there was a significant improvement in systolic and diastolic function as measured by left ventricular systolic pressure (LVSP), +dP/dt (derivative of change in contractile pressure over time), left ventricular end-diastolic pressure (LVEDP), and -dP/dt (derivative of change in relaxation pressure over time) in FGF2 HMWKO hearts compared to Wt hearts (p<0.05, Table

18). Other cardiac function parameters were also significantly increased in FGF2 HMWKO hearts compared to Wt hearts (Table 18). On the other hand, the cardiac function in 24 kD FGF2

HMW Tg mice hearts gradually decreased and by 30 minutes reperfusion, cardiac function was significantly poorer in HMW Tg hearts compared to non-transgenic hearts (Figure 52B, p<0.05).

At the end of 60’I/120’R, there was a significant decrease in post-ischemic recovery of contractile function in 24 kD Tg (line 20: 41±6% and line 28: 33±4%) compared to NTg hearts

(64±9%) and in post-ischemic recovery of relaxation function in 24 kD Tg (line 20: 36±1% and line 28: 36±2%) compared to NTg hearts (52±6%) (p<0.05, Figure 51). Other cardiac function parameters were also significantly decreased in 24 kD Tg hearts compared to NTg hearts (Table

206

19). These data suggest that the FGF2 HMW isoforms, most likely, play a deleterious role in myocardial dysfunction during ischemia-reperfusion injury.

207

A. Wt 100 *p<0.05 vs. Wt

90 FGF2 HMWKO 80 * 70 60 50 40 30

contractile function (%) 20 10 Percent recovery of post-ischemic 0 B. 100 90

80 70 60 * 50 40 30

relaxation function (%) 20 10 Percent recovery of post-ischemic 0

Figure 50: Percent recovery of post-ischemic systolic and diastolic function in Wt (black bar) and FGF2 HMWKO (striped bar) hearts following 60 minutes global low-flow ischemia and 120 minutes reperfusion. Percent recovery of cardiac function is depicted as the ratio of +dP/dt (contraction) or –dP/dt (relaxation) at 120 minutes reperfusion to baseline measure. There was an increase in recovery of post-ischemic contractile (A) and relaxation (B) function in FGF2 HMWKO compared to Wt. n= 5 for Wt and FGF2 HMWKO hearts. *p<0.05 vs. Wt hearts.

208

A. 100 *p<0.05 vs. NTg NTg 90 24 kD Tg line 20 80 24 kD Tg line 28 70 60 50 * 40 * 30

contractile function (%) 20 10 Percent recovery of post-ischemic 0 B. 100

90 *p<0.05 vs. NTg 80 70 60 50 40 * * 30

relaxation function (%) 20 10 Percent recovery of post-ischemic 0

Figure 51: Percent recovery of post-ischemic systolic and diastolic function in NTg (black bar), 24 kD Tg (line 20: crossed bar, line 28: dotted bar) hearts following 60 minutes low- flow ischemia and 120 minutes reperfusion. Post-ischemic recovery of contractile or relaxation function was calculated, respectively, as the percent of +dP/dt or –dP/dt at 120 minutes reperfusion to baseline measure. There was a significant decrease in recovery of post-ischemic contractile (A) and relaxation (B) function in 24 kD Tg (line 20 and line 28) hearts compared to NTg hearts. n= 7 for NTg, n=5 for 24 kD Tg line 20 and n=6 for 24 kD Tg line 28. *p<0.05 vs. NTg hearts.

209

4500 Wt 4000 * p<0.05 vs. Wt FGF2 HMWKO 3500 3000 2500 * ** 2000 1500 * 1000

+dP/dt (mmHg/s) 500 0 0 5 0 5 15 30 45 60 15 30 60 90 120

Control Ischemia (minutes) Reperfusion (minutes)

5000 NTg 4500 * p<0.05 vs. NTg 24 kD Tg line20 4000 24 kD Tg line28 3500 3000 * 2500 * 2000 * * 1500 +dP/dt (mmHg/s) * * 1000 * * 500 0 0 5 0 5 15 30 45 60 15 30 60 90 120

Control Ischemia (minutes) Reperfusion (minutes)

Figure 52: Recovery of contractile function as measured by +dP/dt in (A) wildtype (diamond) and FGF2 HMWKO (open circle) hearts and (B) non-transgenic (diamond) and 24 kD Tg line 20 (square) and line 28 (triangle) hearts subjected to 60 minutes ischemia and 120 minutes reperfusion. FGF2 HMWKO hearts had a significant increase in the recovery of post-ischemic contractile function compared to wildtype hearts. Hearts overexpressing the human FGF2 24 kD HMW isoform had a poorer recovery of post- ischemic contractile function compared to non-transgenic hearts. n=6/group. *p<0.05 vs. wildtype or non-transgenic control for the same time point.

210

Table 18. Cardiac function in wildtype (Wt) and FGF2 HMWKO hearts subjected to 60 minutes ischemia and 120 minutes reperfusion.

Baseline (Equilibration) 60’ischemia/120’reperfusion

LVSP LVEDP +dP/dt -dP/dt LVSP LVEDP +dP/dt -dP/dt (mmHg) (mmHg) (mmHg/sec) (mmHg/sec) (mmHg) (mmHg) (mmHg/sec) (mmHg/sec) Wt 100±1 7±1 4175±39 -3508±70 43±7 25±5 2119±112 -1557±32

FGF2 93±3* 7±1 3910±150* -3216±189* 68±5* 17±2* 2740±237* -1775±169* HMWKO All values were presented as mean ± SEM of n independent experiments. LVSP: left ventricle systolic pressure. LVEDP: left ventricle end diastolic pressure. ±dP/dt: derivative of change in contractile (+) and relaxation (-) pressure over time. *p<0.05 vs. Wt.

Table 19. Cardiac function in NTg and 24 kD HMW Tg (line 20 and line 28) hearts subjected to 60 minutes ischemia and 120 minutes reperfusion. Baseline 60’ischemia/120’reperfusion

LVSP LVEDP +dP/dt -dP/dt LVSP LVEDP +dP/dt -dP/dt (mmHg) (mmHg) (mmHg/sec) (mmHg/sec) (mmHg) (mmHg) (mmHg/sec) (mmHg/sec) NTg 100±1 5±1 4079±24 -3319±137 76±5* 22±6 2773±358 -1734±199

24 kD Tg 97±2 4±1 4265±107* -3180±162 56±5* 27±10 1625±170* -1148±49* line 20 24 kD Tg 99±1 6±1 4331±88* -3271±142 55±6* 31±7 1452±165* -1180±70* line 28 All values were presented as mean ± SEM of n independent experiments. LVSP: left ventricle systolic pressure. LVEDP: left ventricle end-diastolic pressure. ±dP/dt: derivative of change in contractile (+) and relaxation (-) pressure over time. *p<0.05 vs. NTg. 211

211

Effect of FGF2 HMW isoforms on myocardial cell injury after ischemia-reperfusion injury

Myocardial infarct size was measured in an ex vivo global low-flow ischemia model

(isolated work-performing heart). There was no difference between the groups: Wt (39±2%), and

FGF2 HMWKO (34±2%) (Figure 53A) or NTg (31± 3%) and 24 kD Tg (line 20: 33± 1% and

line 28:35±3%) (Figure 53B).

Myocardial cell injury, indicated as CK release, was measured at designated time-points of baseline (equilibration), ischemia, and reperfusion (Figure 8). There was no difference

between Wt and FGF2 HMWKO or NTg and human FGF2 HMW 24 kD Tg groups at any

timepoints evaluated (Table 20 and 21). Previous work in the dissertation showed that there was also no difference in creatine kinase release in Wt, Fgf2 KO and FGF2 LMWKO hearts (See

Chapter 2, Figure 16). Our previous data showed a decrease in myocardial infarction and creatine kinase release into coronary effluent in mice overexpressing all FGF isoforms (LMW and HMW)

compared to wildtype hearts73. Therefore, these data suggest that all FGF2 isoforms are

necessary to protect the heart from myocardial infarction and cell injury.

212

A. 100 90 Wt 80 FGF2 HMWKO 70 60 50 40

Infarct Size 30 20 10 (% of area at risk [whole heart]) 0

100 NTg 24 kD Tg line 20 90 24 kD Tg line 28 80 70 60 50 40 Infarct Size 30 20 10 (% of area at risk [whole heart]) 0

Figure 53: Myocardial infarction depicted as a percent of area at risk in Wt (black bar), and FGF2 HMWKO (striped bar) and NTg (black bar, panel B), 24 kD Tg (line 20: crossed bar and line 28: dotted bar) hearts following ex vivo 60 minutes global low-flow ischemia and 120 minutes reperfusion. There was no difference in infarct size in either (A) Wt and FGF2 HMWKO groups or (B) NTg and 24 kD Tg (line 20 and line 28). n= 6 for Wt, n=7 for FGF2 HMWKO hearts, n=9 for NTg, n=4 for 24 kD Tg line 20 and n=5 for 24 kD Tg line 28.

213

Table 20: Creatine kinase release from Wt and FGF2 HMWKO hearts.

Baseline (Equilibration) Ischemia Early Reperfusion Late Reperfusion 0.010±0.005 0.002±0.001 0.032±0.012† 0.008±0.005 Wt

0.007±0.002 0.001±0.001 0.025±0.010† 0.011±0.006 FGF2 HMWKO

All values depicted as mean±SEM of n independent experiments. Creatine kinase release was represented by Unit/min*g. Baseline: last 10 minutes of baseline. Ischemia: first 30 minutes and last 15 minutes of ischemia. Early reperfusion: 0-14 minutes of reperfusion. Late reperfusion: 114-120 minutes of reperfusion. n=7/groups. †p<0.05 vs. baseline

Table 21: Creatine kinase release from NTg and 24 kD Tg (line 20 and line 28) hearts.

Baseline Ischemia Early Reperfusion Late Reperfusion 0.008±0.003 0.002±0.001 0.019±0.005† 0.010±0.009 NTg 24 kD Tg 0.007±0.003 0.001±0.000 0.023±0.011† 0.011±0.009 (line 20) 24 kD Tg 0.008±0.003 0.001±0.000 0.020±0.007† 0.007±0.003 (line 28) All values depicted as mean±SEM of n independent experiments. Creatine kinase release was represented by Unit/min*g. Baseline: last 10 minutes of baseline. Ischemia: first 30 minutes and last 15 minutes of ischemia. Early reperfusion: 0-14 minutes of reperfusion. Late reperfusion: 114-120 minutes of reperfusion. n=7/groups. †p<0.05 vs. baseline. 214

214

Effect of alterating the protein level of FGF2 HMW isoforms on downstream signaling

pathways

To understand the mechanism of FGF2 HMW isoforms in ischemia-reperfusion injury,

elucidating the downstream signaling pathway(s) that are modulated by FGF2 HMW isoforms in

the heart will be of great importance. Our previous data suggested that ablation of FGF2 LMW

isoform decreased translocation of PKC δ and did not affect the activation of PKC ε, α and ζ

signaling pathway in non-ischemic hearts (See Chapter 2, Figures 18-21); however, ablation of

FGF2 LMW isoform caused an increase in JNK activation, a decrease in p38 MAPK activation

and a decrease in Akt activation in non-ischemic hearts (See Chapter 2, Figures 23-25). Study

demonstrates the ability of FGF2 HMW isoforms to regulate PKC δ, ε, and ERK signaling in

vitro444, leading to chromatin compaction and cell death777. However, there is no in vivo evidence

indicating what downstream signaling pathway(s) are regulated by the FGF2 HMW isoforms.

To elucidate whether overexpression of the human FGF2 24 kD HMW isoform affects

PKC translocation, “priming” the non-ischemic heart against a stress stimulus, the translocation

of PKC isoforms were examined in 24 kD Tg hearts. There was no significant difference in PKC

ε and δ translocation between NTg and 24 kD Tg hearts (line 20 and line 28) (Figure 54B and C).

However, there was a significant decrease in PKC α translocation in 24 kD Tg hearts (line 20

and line 28) compared NTg hearts (Figure 54A, p<0.05). These data suggest that manipulation of

24 kD FGF2 HMW protein isoform expression modulates PKC α activation under basal condition. No difference in PKC α, ε and δ protein expression was observed between NTg and

24 kD Tg hearts.

The activation of MAPK, as measured by phosphorylation, was also determined in non- ischemic NTg and 24 kD Tg mouse. There was no significant difference in ERK1, p38 MAPK

215

and JNK activation (phosphorylation) between NTg and 24 kD Tg (line 20 and line 28) mouse

hearts (Figure 55A, 56A and 57A). Furthermore, overexpression of the human FGF2 24 kD

HMW isoform did not alter the total protein expression level of ERK1, p38 MAPK and JNK

(Figure 55B, 56B and 57B). Consistent with our previous data (See Chapter 2, Figure 26), Akt

activation was slightly, but significantly, increased in non-ischemic hearts overexpressing the

human 24 kD HMW isoform. Moreover, when all of the FGF2 isoforms (LMW and HMW) were

overexpressed (FGF2 Tg), a greater Akt activation was observed (Figure 58), suggesting that the

LMW and HMW isoforms may work synergistically to activate Akt signaling and ultimately,

cell survival during ischemia-reperfusion injury. No change was observed in total Akt expression

in any group. Overall, these findings suggest a potential link between FGF2 and PI3K/Akt signaling in the heart; thereby, potentially affecting the cardioprotective phenotype.

Furthermore, ablation of FGF2 LMW isoform caused an increase in apoptotic signaling305 (See Chapter 2, Figure 27) and in vitro evidence suggested that FGF2 HMW

isoforms cause compact chromatin accompanied by increased cytosolic cytochrome C777. In non-

ischemic 24 kD overexpressing hearts, there was no significant difference in cytochrome C release compared to NTg hearts (Figure 59).

216

A. NTg 24 kD Tg Line 20 PKC α

2.5 24 kD Tg Line 28 ) α 2 *p<0.05 vs. NTg tosol ratio

y 1.5 * 1 *

0.5 Translocation of PKC membrane vs. c (

B. PKC δ

) 1.6 δ

1.4 1.2 tosol ratio

y 1 0.8 0.6 0.4 Translocation of PKC

membrane vs. c 0.2 (

217

C. NTg 24 kD Tg Line 20 4.5 PKC ε 24 kD Tg Line 28

ε 4

3.5 3 2.5 2 1.5 1 0.5 Translocation of PKC (membrane vs. cytosol ratio)

D. NTg 24 kD Tg line 20 24 kD Tg line 28 Cy M Cy M Cy M PKC α

PKC δ

PKC ε

Figure 54: PKC activation, as measured by translocation, in non-ischemic NTg (black) and 24 kD Tg [line 20 (crossed bar) and line 28 (dotted bar)] hearts. There was a significant decrease in PKC ε translocation in 24 kD Tg hearts (line 20 and line 28) compared to NTg hearts (A); however, there was no difference in either PKC δ translocation (B) or PKC ε translocation (C). (D) Representative Western blot depicting activation of PKC α, δ and ε in non-ischemic NTg, 24 kD Tg line 20 and line 28 hearts. n=4 for NTg and 24 kD Tg (line 20 and line 28). Cy: cytosolic fraction. M: membrane fraction. *p<0.05 vs. NTg.

218

A. NTg ERK1 24 kD Tg Line 20 1.4 24 kD Tg Line 28 1.2 1 0.8 0.6 0.4

Activation of ERK 1 0.2 (phospho- vs. total ERK1) 0 B.

18000 16000 14000 12000 10000 8000 6000 4000

Total ERK1 (Arbitrary Unit) 2000 0

219

NTg 24 kD Tg 24 kD Tg NTg 24 kD Tg 24 kD Tg line 20 line 28 line 20 line 28

ERK1

Phospho-ERK1 Total ERK1

Figure 55: ERK1 activation, as measured by phosphorylation, in non-ischemic NTg (black) and 24 kD Tg [line 20 (crossed bar) and line 28 (dotted bar)] hearts. (A) There was no significant difference in ERK activation in non-ischemic NTg and 24 kD Tg hearts. (B) There was no significant difference in total ERK1 protein level between the groups. (C) Representative Western blot depicting activation of ERK1 in non-ischemic NTg, 24 kD Tg line 20 and line 28 hearts. n=4 NTg, 24 kD Tg line 20 and 24 kD Tg line 28 groups.

220

A. p38 MAPK NTg 1.2 24 kD Tg Line 20 24 kD Tg Line 28 1

0.8

0.6

0.4

0.2 Activation of p38 MAPK

(phospho- vs. total p38 MAPK) 0 B.

12000

10000

8000

6000

4000

2000 Total p38 MAPK (Arbitrary Unit) Total p38 MAPK (Arbitrary Unit) 0

221

C. 24 kD Tg 24 kD Tg 24 kD Tg 24 kD Tg NTg line 20 line 28 NTg line 20 line 28 p38 MAPK

Phospho-p38 MAPK Total p38 MAPK

Figure 56: p38 MAPK activation, as measured by phosphorylation, in non-ischemic NTg (black) and 24 kD Tg [line 20 (crossed bar) and line 28 (dotted bar)] hearts. (A) There was no significant difference in p38 MAPK activation in non-ischemic NTg and 24 kD Tg hearts. (B) There was no significant difference in total p38 MAPK protein level between the groups. (C) Representative Western blot depicting activation of p38 MAPK in non-ischemic NTg, 24 kD Tg line 20 and line 28 hearts. n=4 NTg, 24 kD Tg line 20 and 24 kD Tg line 28 groups.

222

A. 0.7 JNK NTg 24 kD Tg Line 20 0.6 24 kD Tg Line 28 0.5 0.4 0.3 0.2

Activation of JNK 0.1 (phospho- vs. total JNK) 0 B. 9000 8000 7000 6000 5000 4000 3000 2000 Total JNK (Arbitrary Unit) 1000 0

223

24 kD Tg 24 kD Tg 24 kD Tg 24 kD Tg NTg line 20 line 28 NTg line 20 line 28

JNK

Phospho-JNK Total JNK

Figure 57: JNK activation, as measured by phosphorylation, in non-ischemic NTg (black) and 24 kD Tg [line 20 (crossed bar) and line 28 (dotted bar)] hearts. (A) There was no significant difference in JNK activation in non-ischemic NTg and 24 kD Tg hearts. (B) There was no significant difference in total JNK protein level between the groups. (C) Representative Western blot depicting activation of JNK in non-ischemic NTg, 24 kD Tg line 20 and line 28 hearts. n=4 NTg, 24 kD Tg line 20 and 24 kD Tg line 28 groups.

224

A. * p<0.05 vs. NTg 2.5 NTg FGF2 Tg 24 kD Tg 2 *

1.5

1 *

Activation of Akt 0.5 (phospho- vs. total Akt) 0 B.

9000 8000 7000 6000 5000 4000 3000 2000 Total Akt (Arbitrary Unit) 1000 0

225

NTg FGF2 Tg 24 kD Tg NTg FGF2 Tg 24 kD Tg

Akt

Phospho-Akt Total Akt

Figure 58: Akt activation, as measured by phosphorylation, in non-ischemic NTg (black bar), FGF2 Tg (diamond bar) and 24 kD Tg (dotted bar) hearts. (A) There was a significant increase in Akt activation in non-ischemic FGF2 Tg and a slight, but significant 24 kD Tg hearts compared to NTg hearts. (B) There was no significant difference in total Akt protein level between the three groups. (C) Representative Western blot depicting activation of Akt in non-ischemic NTg, FGF2 Tg and human FGF2 HMW 24 kD Tg hearts. n=4 Wt, FGF2 Tg and 24 kD Tg groups. *p<0.05 vs. Wt hearts.

226

1.2 NTg 24 kD Tg line 20 1 24 kD Tg line 28

) 0.8

0.6

membrane 0.4

0.2 Cytochrome C release (cytosol vs

NTg 24 kD Tg line 20 24 kD Tg line 28

Cy M Cy M Cy M

Cytochrome C

Figure 59: Cytochrome C release in non-ischemic NTg (black) and 24 kD Tg [line 20 (crossed bar) and line 28 (dotted bar)] hearts. (A) There was no significant difference in cytochrome C release in non-ischemic NTg and 24 kD Tg hearts. (B) Representative Western blot depicting activation of cytochrome C in non-ischemic NTg, 24 kD Tg line 20 and 24 kD Tg line 28 hearts. Cy: cytosolic fraction. M: membrane fraction. n=4 NTg, 24 kD Tg line 20 and 24 kD Tg line 28 groups.

227

The localization of FGF2 HMW isoforms in non-ischemic and ischemic-reperfused hearts

Our previous data suggested that in non-ischemic hearts, the FGF2 LMW isoform was localized both in the cytoplasm and nucleus (See Chapter 2, Figure 46); while the HMW FGF2 isoforms are localized in the nucleus (See Chapter 2 Figure 46). However, it’s still unknown whether ablation of FGF2 HMW isoforms alters the cellular localization of the LMW isoform that is still present in FGF2 HMWKO hearts. Furthermore, whether there would be any release of FGF2 isoforms during I/R in order to activate FGFRs is also unknown.

To elucidate the localization of FGF2 isoforms in adult hearts, cytoplasmic and nuclear fractions from non-ischemic Wt and FGF2 HMWKO hearts were obtained and the presence of a particular FGF2 isoform in the cytosol or nucleus was determined by Western blot. In FGF2

HMWKO (in which only the LMW isoform was present), the LMW isoform was localized to both cytoplasm and nucleus, similar to LMW isoform localization in Wt hearts (Figure 60).

Furthermore, in Wt hearts, the FGF2 HMW isoforms were localized only in the nucleus (Figure

60).

Although the HMW isoforms have been implicated to elicit an intracrine action, it is unknown whether any of the HMW effects may be due to secretion of these isoforms leading to receptor activation. Coronary effluent samples, collected at various time-points of baseline and reperfusion from Wt, LMWKO, and HMWKO hearts, demonstrated that secretion of the HMW isoforms did not occur in the FGF2 LMWKO hearts (Table 22), which suggests that the HMW effects in the heart are most likely due to intracrine signaling. In the FGF2 HMWKO hearts, the

LMW isoform was secreted from the cell during ischemia-reperfusion injury (Table 22), which may act on FGFR to elicit its action.

228

Cy NNCy Cy NNCy

β−actin

Histone-1

HMW: m22 kD HMW: m21 kD LMW: m18 kD

Wt FGF2 HMWKO

Figure 60. Representative Western blot of FGF2 isoform localization in non-ischemic wildtype (Wt) and FGF2 HMWKO mouse hearts. In Wt hearts, the LMW, 18 kD isoform was localized to the cytosolic (Cy) and nuclear (N) fractions of the heart; whereas, the HMW, 21 and 22 kD, isoforms were nuclear localized. In the absence of the HMW isoforms (FGF2 HMWKO), the LMW isoform was localized in the cytoplasm and nucleus of the heart. β-actin is a cytosolic protein and used as a marker of cytosolic fraction enrichment. Histone-1 is a nuclear protein and used as a marker of nuclear fraction enrichment. n=2 per group.

229

Table 22. Concentration (in pg/min/g heart weight) of FGF2 secreted in coronary effluent at baseline and reperfusion (Rep)

Wildtype LMWKO HMWKO

Baseline 8.3±3.3 not detected (ND) 14.5±4.3 (Equilibration)

Early Rep 10.6±4.0 ND 15.7±3.6 (0-14 min)

Late Rep 12.3±4.3 ND 16.8±7.1 (110-120 min)

LMWKO: hearts deficient of the LMW isoform. HMWKO: deficient of HMW isoforms. n=4/group.

230

The involvement of FGFR in ischemia-reperfusion injury and cardioprotection

To determine whether the secreted FGF2 LMW isoform, from FGF2 HMWKO hearts,

acts through FGFR to elicit cardioprotection, Wt and FGF2 HMWKO hearts were subjected to

60 minutes of global, low-flow ischemia and 120 minutes of reperfusion, and treated with

vehicle (DMSO) or PD173074 (25 nM), a FGFR inhibitor that binds the tyrosine kinase motif on the FGFR and inhibits the tyrosine kinase activity of FGFR692. There was no difference in basal cardiac function in DMSO- and PD173074-treated Wt and FGF2 HMWKO hearts (Table 23).

Following ischemia-reperfusion injury, systolic and diastolic dysfunction as measured by left ventricular systolic pressure (LVSP), +dP/dt (derivative of change in contractile pressure over

time), left ventricular end-diastolic pressure (LVEDP), and -dP/dt (derivative of change in

relaxation pressure over time) was significantly less in ischemic-reperfused, DMSO-treated

FGF2 HMWKO vs. DMSO-treated Wt hearts (p<0.05, Table 23). Furthermore, there was a

significant increase in post-ischemic recovery of contractile function in DMSO-treated FGF2

HMWKO hearts (94±6%) vs. Wt (49±5%) hearts (p<0.05, Figure 61). With similar FGF2 LMW

isoform release in Wt and FGF2 HMWKO hearts observed (Table 23), the cardioprotective

effect in FGF2 HMWKO hearts is not only due to the presence of FGF2 LMW isoform, but also

due to the absence of FGF2 HMW isoforms. After PD173074 treatment, percent recovery of

post-ischemic contractile function was significantly attenuated in Wt (35±3%), and FGF2

HMWKO (32±2%) hearts (p<0.05, Figure 61), indicating that FGFR is involved in ischemia-

reperfusion injury and the cardioprotective effect of FGF2. Furthermore, the percent decrease in

post-ischemic contractile function in FGF2 HMWKO (~60%) hearts was significantly higher

than in Wt hearts (~14%). This indicates that not only does the released FGF2 LMW isoform in

FGF2 HMWKO hearts act on FGFR and elicit cardioprotection, but also the FGF2 HMW

231

isoforms may modify the downstream signals of FGFR stimulation. Collectively, these results indicate that the FGF2 LMW isoform can act on its cell surface receptor FGFR and produce cardioprotective effects and FGF2 HMW isoform may act on the signaling pathway(s) mediated by FGFR.

232

120 Wt

# 100 FGF2 HMWKO

80 *p<0.05 vs. DMSO cohort #p<0.05 vs. DMSO Wt 60

40 * *

contractile function (%) 20

Percent recovery of post-ischemic 0 DMSO PD173074 (25 nM) B.

90 # *p<0.05 vs. DMSO cohort

80 #p<0.05 vs. DMSO Wt 70 60 50 40 * * 30 20

relaxation function (%) 10 0

Percent recovery of post-ischemic DMSO PD173074 (25 nM)

Figure 61: Percent recovery of post-ischemic cardiac function in Wt (black bar) and FGF2 HMWKO (striped bar) hearts following DMSO or PD173074 (25 nM) treatment. Inhibition of FGFR with PD173074 completely the FGF2 HMWKO post- ischemic recovery of contractile function (A) and relaxation function (B) in Wt groups. Furthermore, in Wt groups, the cardioprotective effect is abolished significantly decreased. Percent recovery of cardiac function is depicted as the ratio of +dP/dt (contractile) or –dP/dt (relaxation) at 120 minutes reperfusion to baseline measure. n=6 for DMSO- and PD173074-treated Wt and FGF2 HMWKO hearts. *p<0.05 vs. DMSO-treated cohort. #p<0.05 vs. DMSO-treated Wt hearts.

233

Table 23. Cardiac function in DMSO- and PD173074-treated Wt and FGF2 HMWKO hearts. Baseline (Equilibration) 60’ischemia/120’reperfusion

Wt FGF2 Wt FGF2 Wt FGF2 HMWKO Wt FGF2 HMWKO (DMSO) HMWKO (PD173074) HMWKO (DMSO) (DMSO) (PD173074) (PD173074) (DMSO) (PD173074) LVSP 98±2 98±1 95±1 97±3 39±9† 88±4#† 48±5 50±7* (mmHg)

LVEDP 6±1 5±1 7±1 8±2 24±3† 14±2#† 27±5 31±6* (mmHg)

+dP/dt 4305±70 4198±154# 3933±95 4040±127 2045±202† 3837±159#† 1397±140*† 1268±104*#† (mmHg/s)

-dP/dt -3319±125 -3062±89# -3159±76 -3060±189 -1301±154† -2482±212#† -1060±58*† -1051±113*† (mmHg/s)

All values were presented as mean ± SEM of n independent experiments. LVSP: left ventricle systolic pressure. LVEDP: left ventricle end diastolic pressure. ±dP/dt: derivative of change in contractile and relaxation pressure over time. n=12/group. *p<0.05 vs. DMSO-treated cohort. #p<0.05 vs. DMSO-treated Wt. †<0.05 vs. baseline cohort.

234

Effect of FGFR inhibition on myocardial cell injury

Myocardial infarct size was measured after 60 minutes global, low-flow ischemia and

120 minutes reperfusion. There was no difference in DMSO-treated groups: Wt (26±6%) and

FGF2 HMWKO (28±3%) (Figure 62). Following FGFR inhibition with PD173074, there was a significant increase in myocardial infarct size in both Wt (36±2%) and FGF2 HMWKO (42±1%)

(p<0.05, Figure 62) compared to DMSO-treated cohorts.

Myocardial cell injury, represented as CK release, was measured from coronary effluent at designated time points of baseline, ischemia and reperfusion (Figure 8). There was no significant difference in CK release between Wt and FGF2 HMWKO hearts. Following

PD173074 treatment, creatine kinase release had a slight increase in Wt and FGF2 HMWKO groups at baseline level (p<0.05, Table 24), but no difference in early reperfusion. This evidence suggests that inhibition of FGFR resulted in an increased myocardial cell death independent of

FGF2 isoforms.

235

100 Wt 90 *p<0.05 vs. DMSO cohort FGF2 HMWKO 80 70 60 50 *

Infarct Size 40 * 30 20 (% of area at risk [whole heart]) 10 0 DMSO PD173074 (25 nM)

Figure 62: Myocardial cell injury, measured as myocardial infarct size, in Wt (black bar) and FGF2 HMWKO (striped bar) hearts following 60 minutes global, low-flow ischemia and 120 minutes reperfusion. There was no difference in infarct size in DMSO-treated groups. However, after FGFR inhibition, myocardial infarct size was significantly increased in both Wt (black bar) and FGF2 HMWKO hearts (striped bar). n= 5 for DMSO-treated Wt, n=6 for PD-treated Wt, n=5 for DMSO-treated FGF2 HMWKO and n=6 for PD-treated FGF2 HMWKO hearts. *p<0.05 vs. DMSO-treated cohort.

236

Table 24. Creatine kinase release from vehicle- and PD173074-treated Wt, and FGF2 HMWKO hearts. Baseline Ischemia Early Reperfusion Late Reperfusion vehicle 0.004±0.002 0.000±0.001 0.008±0.003 0.008±0.004 Wt PD173074 0.011±0.003* 0.002±0.001 0.010±0.005 0.007±0.003 (25 nM) vehicle 0.004±0.002 0.001±0.000 0.01±0.006 0.005±0.001 FGF2 HMWKO PD173074 0.008±0.004 0.001±0.001 0.009±0.004 0.006±0.003 (25 nM) All values depicted as mean ± SEM of n independent experiments. The release of creatine kinase depicted as U/min*g. Baseline: last 10 minutes of baseline. Ischemia: first 30 minutes of ischemia and last 15 minutes of ischemia. Early reperfusion: 0-14 minutes of reperfusion. Late reperfusion: 114-120 minutes of reperfusion. n=10/group. *p<0.05 vs. vehicle treated-cohort. 237

237

Effect of FGFR inhibition on FGFR activation

PD173074 inhibits FGFR activation by binding the tyrosine kinase cleft of the FGFR to

inhibit the autophosphorylation of the receptor692. To determine whether PD173074 inhibited

phosphorylation in Wt and FGF2 HMWKO mouse hearts subjected to I/R injury, Western

immunoblotting was performed and activation via phosphorylation of FGFR1 and FGFR4 was

evaluated. Following 60 minutes low-flow ischemia and 120 minutes reperfusion,

phosphorylation of FGFR1 was significantly decreased in PD173074-treated Wt and FGF2

HMWKO hearts compared to DMSO-treated cohort (p<0.05, Figure 63A). In addition, there was no difference in FGFR1 expression between DMSO-treated Wt and FGF2 HMWKO hearts

(Figure 63B). Cardiac expression of FGFR4 was not observed in any mouse model. These findings suggest that 25 nM PD173074 inhibited the activation of FGFR1, which is the predominant subtype of FGFR expressed on rodent hearts.

238

A. 1.4 *p<0.05 vs. DMSO cohort Wt 1.2 HMWKO

1 0.8 * 0.6 * 0.4

Activation of FGFR1 0.2 (phospho- vs. total FGFR1) 0 DMSO PD173074 (25 nM) B. 7000 6000

)

nit 5000 U

y 4000 itar b 3000 Ar ( 2000 Expression of FGFR1 1000 0 DMSO PD173074 (25 nM)

239

DMSO PD173074 DMSO PD173074 (25 nM) (25 nM)

Wt FGF2 Wt FGF2 Wt FGF2 Wt FGF2 HMWKO HMWKO HMWKO HMWKO

FGFR1 Phospho-FGFR1 Total FGFR1

Figure 63: FGFR1 activation, as measured by phosphorylation state, in DMSO- and PD173074-treated Wt and FGF2 HMWKO hearts. (A) There was a significant decrease in FGFR1 phosphorylation in PD173074-treated groups compared to DMSO- treated groups. (B) FGFR1 expression was not different in DMSO- and PD173074- treated Wt and FGF2 HMWKO hearts following from 60 minutes ischemia and 120 minutes reperfusion. (C) Representative Western blot depicting activation of FGFR1 in DMSO- and PD173074- treated Wt and FGF2 HMWKO hearts. n=4/group. *p<0.05 vs. DMSO-treated cohort.

240

Effect of FGF2 HMW isoform on calcium homeostasis

Our previous data indicated that phospholamban activation was significantly increased in

FGF2 LMWKO hearts compared to Wt hearts (See Chapter 2, Figure 28), suggesting that the

LMW isoform may modulate the activity of phospholamban, contributing to the outcome of cardiac function in I/R injury. Also, data in this dissertation showed an increased cardiac contractile function in FGF2 LMWKO hearts (Chapter 2, Table 12) and in 24 kD FGF2 HMW isoform Tg hearts (Table 19), but a decrease in cardiac contractile function in FGF2 HMWKO hearts compared to Wt hearts (Table 18). How the FGF2 HMW isoforms regulate cardiac function is unclear. Regulation of calcium cycling is important for proper cardiac function807, thus the activation of phospholamban and the expression of calsequestrin were evaluated in non- ischemic NTg and 24 kD Tg (line 20 and line 28).

Cardiac contraction is triggered by a calcium-induced calcium release in depolarized myocytes808. Intracellular calcium homeostasis is regulated by several major proteins on the

sarcoplasmic reticulum, including, but not exclusively to, phospholamban, calsequestrin,

ryanodine receptor and SERCA796. In this dissertation, two of these major SR proteins,

phospholamban and calsequestrin, were measured. There was no significant difference in

calsequestrin expression between NTg and 24 kD Tg (line 20 and line 28) mouse hearts (Figures

64B and C). Furthermore, activation of phospholamban, indicated as the ratio of phospho-ser16-

vs. total phospholamban was not altered in 24 kD Tg hearts compared to NTg hearts (Figures

64A and C). These data indicate that overexpression of the FGF2 HMW 24 kD isoform did not

alter activity or expression of these two calcium handling proteins. Whether this overexpression

will alter the function (i.e., binding activity with calcium or other SR proteins) of these two

calcium handling proteins needs further study.

241

A. NTg 1.8 24 kD Tg line 20 1.6 24 kD Tg line 28 1.4 1.2 1 0.8 0.6

phospholamban) phospholamban) 0.4 0.2

(phospho- phospholamban vs. total (phospho- phospholamban 0 Phosphorylation of Phospholamban Phosphorylation of Phospholamban

1000

800

600

400 Calsequestrin (Arbitrary Unit) 200

242

C. 24 kD Tg 24 kD Tg 24 kD Tg 24 kD Tg NTg line 20 line 28 NTg line 20 line 28

Phospholamban Phospho Total

24 kD Tg NTg 24 kD Tg line 20 line 28

Calsequestrin

Figure 64: Calcium handling protein expression in non-ischemic NTg and human FGF2 24 kD HMW Tg (line 20 and line 28) hearts. (A) There was no significant difference in activation of phospholamban, as measured by phosphorylation at Ser16 site, in non-ischemic 24 kD Tg hearts compared to NTg hearts. (B) There was no significant alteration in calsequestrin protein expression between the groups. (C) Representative Western blot depicting activation of phospholamban and calsequestrin expression in Wt and 24 kD Tg hearts. n=6 NTg and 24 kD Tg (line 20 and line 28) groups.

243

Effect of FGF2 HMW isoforms on NF-κB regulation and gene expression

This dissertation showed that the FGF2 HMW isoforms were localized to the nucleus in

non-ischemic Wt and FGF2 LMWKO hearts, while the LMW isoform was localized to nuclear

and cytoplasmic regions in non-ischemic Wt and FGF2 HMWKO hearts (Figure 60, Table 22).

Furthermore, during ischemia-reperfusion injury, it is the LMW isoform that is released from the

cell to act on FGFR (Figure 22). The nuclear localization of the FGF2 HMW isoforms suggests

that these protein isoforms may act as transcription factors in the nucleus and regulate gene

expression under normal or stress conditions.

FGF2 modulates the regulation of the transcription factor NF-κB313, which is involved in

ischemia-reperfusion injury318,629. To elucidate which FGF2 isoforms are involved in regulating this transcription factor, nuclear extract from Wt, Fgf2 KO, FGF2 LMWKO, NTg, FGF2 Tg and human 24 kD Tg hearts were subjected to electrophoretic mobility shift assays (EMSA). The

activation of NF-κB in Fgf2 KO and FGF2 LMWKO was too low to be detected (Figure 65A)

and therefore difficult to quantify. Since the loading control was not used, a semi-quantitative

method was performed here. There was a trend increase in NF-κB activation in 24 kD Tg hearts

(Figure 65). There was no difference in NF-κB activation between NTg and FGF2 Tg hearts.

These data suggest that the expression of the FGF2 LMW isoform and FGF2 HMW isoforms

“balances out” the regulation of NF-κB activity and when this balance is interrupted (i.e.,

overexpression of human FGF2 24 kD HMW isoform), the activity of NF-κB is altered.

Furthermore, when the balance is maintained (i.e., overexpression all human FGF2 isoforms),

there was no alteration in NF-κB activity.

This dissertation also demonstrated that the FGF2 LMW isoform can regulate the

expression of several genes after ischemia-reperfusion injury (See Chapter 2, Table 17), but

244

whether the nuclear-localized FGF2 HMW isoforms influence gene expression in the heart

remains to be elucidated. To evaluate whether the FGF2 HMW isoforms affect gene expression,

Fgf2 KO and FGF2 LMWKO cardiac mRNA from non-ischemic hearts was analyzed via DNA microarray technology. By comparing the FGF2 LMWKO and Fgf2 KO hearts, it will provide some preliminary data regarding the genes regulated by the FGF2 HMW isoforms. However, further elucidation, utilizing the FGF2 HMWKO and FGF2 HMW Tg mice, will provide more in-depth information on the genes regulated by FGF2 HMW isoforms. A total of ninety-one genes were significantly increased or decreased in non-ischemic hearts which only expressed the murine HMW isoforms of FGF2 (FGF2 LMWKO vs. Fgf2 KO, p<0.05). These genes involved in immune response, development, metabolism and oxidation, calcium transport, and transcription are indicated to be regulated basally by FGF2 HMW isoforms. Many of these genes such as CREB809, calsequestrin810, potassium voltage-gated channel811, calpain 3812, proviral intergration site for murine leukemia virus (Pim)813 and H+-transporting ATPase814 have been

implicated in ischemic-reperfusion injury or apoptosis (Table 25).

Moreover and more importantly, DNA microarray technology was employed on mRNA

from Fgf2 KO and FGF2 LMWKO hearts subjected to I/R injury to elucidate the genes that were

regulated by FGF2 HMW isoform during I/R injury. Fifty-one genes were significantly increased

or decreased in ischemic-reperfused FGF2 LMWKO hearts compared to sham-treated FGF2

LMWKO hearts (sham-treated FGF2 LMWKO vs. I/R-treated FGF2 LMWKO, p<0.05, Figure

66, circle A, Table 26). These genes, relating to immune response, metabolism, calcium channel, apoptosis, transcription factor and oxidation, were regulated by I/R injury. A total of 152 genes, relating to membrane structure, mitotic processes, calcium transport, metabolism, apoptosis, oxidation, immune response, ion channels, cell differentiation, and transcription, were significantly increased or decreased in ischemic-reperfused Fgf2 KO compared to ischemic-

245

reperfused FGF2 LMWKO which only expressed the murine HMW isoforms of FGF2 (FGF2

LMWKO vs. Fgf2 KO, p<0.05, Figure 66, circle B, Table 27). These 152 genes were regulated by FGF2 HMW isoform. Nine genes fell in the overlap between these two groups; these are the genes that are up- or down-regulated by the nuclear localized FGF2 HMW isoforms during I/R

injury. These genes can be categorized to those involved in immune response (adiponectin,

hemoglobin beta, immunoglobulin kappa chain), metabolism (phosphoenolpyruvate carboxykinase, carbonic anhydrase 3 and adipsin), calcium signaling (calmodulin 4), and apoptosis (cell death-inducing effector and cAMP dependent regulatory protein kinase). The mRNA level of these genes was up-regulated during I/R injury in FGF2 LMWKO hearts, while they were down-regulation in Fgf2 KO hearts compared to FGF2 LMWKO hearts after I/R injury. This gene expression data suggests that the absence of FGF2 HMW isoforms in Fgf2 KO hearts resulted in a further decrease in those deleterious genes upregulated by I/R injury compared to FGF2 LMWKO hearts. Some of these genes had a deleterious effect in either apoptosis (cell death-inducing DFFA-like effector c815 and carbonic anhydrase 3816), or I/R

injury (calmodulin 4)817 and phosphoenolpyruvate carboxykinase818), and this could be potential

mechanism for the cardioprotection that was observed in FGF2 HMWKO hearts.

246

FGF2 NTg 24 kD FGF2 Wt Fgf2 A. Tg Tg KO LMW KO

p65 p65 p50 p50

18000 NTg 16000 FGF2 Tg 14000 24 kD Tg 12000 Unit

y 10000 8000

Arbitrar 6000 4000 2000 0

Figure 65: NF-κB activation in non-ischemic NTg, FGF2 Tg and 24 kD HMW Tg hearts. (A) Representative EMSA depicting the p65 and p50 subunit of NF-κB and DNA binding complex. There was a slight increase in NF-κB activation in 24 kD Tg hearts with no difference in NF-κB activation between NTg and FGF2 Tg hearts (left panel). The activation of NF-κB in Fgf2 KO and FGF2 LMWKO was too low to be detected (right panel). (B) Quantification of NF-κB activation in NTg, FGF2 Tg, and 24 kD HMW Tg hearts. There was a trend increase in NF-κB activation in non-ischemic 24 kD Tg hearts with no difference in NF-κB activation between NTg and FGF2 Tg hearts. n=3 for each group.

247

FGF2 LMWKO Fgf2 KO Non-ischemic

B. FGF2 LMWKO Fgf2 KO Sham A

Ischemic-reperfused (I/R) B

A 51 9 152 B

Genes regulated by FGF2 HMW isoforms during ischemia-reperfusion injury

Figure 66: Schematic for DNA microarray analysis of gene expression. (A) Non-ischemic FGF2 LMWKO and Fgf2 KO hearts were subjected to microarray study and the genes whose expression were altered were those regulated by FGF2 HMW isoforms. (B) Hearts deficient of LMW isoform (FGF2 LMWKO, square) hearts, and hearts deficient of all FGF2 isoforms (Fgf2 KO, triangle) were subjected to sham (3.5 hour perfusion) or I/R injury. Competitive hybridization to microarrays of cDNA targets generated from 4 separate RNA samples were done individually, in triplicate. The Venn diagram demonstrates how intersections between sets of genes allowed for identification of those most likely to be involved in ischemia-reperfusion injury [Red circle, A] and those regulated by the HMW FGF2 protein isoforms [Green circle, B]. Yellow overlay shows the genes changed both in A and B thus indicating those genes regulated by FGF2 HMW isoforms during ischemia-reperfusion injury.

248

Table 25: mRNA expression of representative genes regulated by FGF2 HMW isoforms in non-ischemic condition.

Functional Gene name Fold-increase (+) or group Fold-decrease (-) (p<0.005) Immune interferon-inducible protein 203 -3.07 response Development fibroblast growth factor 2 +3.48 growth hormone releasing hormone receptor -2.33 insulin-like growth factor binding protein 3 +1.72 Calcium calsequestrin 1 +2.51 signaling Ion transport potassium voltage-gated channel, subfamily h +1.68 (voltage-related), member 2 Apoptosis calpain 3 -2.40 proviral intergration site for murine leukemia +1.91 virus Transcription upstream transcription factor 1 -3.00 factor cAMP responsive element binding protein 1 -1.62 (CREB) heat shock protein 1 (HSP90) -2.30 DNA cytosine-specific methyltransferase 3b -2.53 ATP-binding cassette, sub-family b (mdr/tap), member 1b Oxidation H+ transporting ATPase +1.88 aldo-keto reductase family 1, member b8 +1.51 phosphofructokinase -2.17 dual specificity phosphatase 23 +1.61 cytochrome p450, family 2, subfamily b, +2.73 polypeptide 10 Membrane microfibrillar-associated protein 4 +1.94 protein tetraspanin 4 -2.21 biglycan +1.97 low density lipoprotein receptor-related protein 8, -2.50 apolipoprotein e receptor

249

Table 26: mRNA expression of representative genes involved in ischemia-reperfusion injury (Circle A).

Functional Gene name Fold-increase (+) or group Fold-decrease (-) (p<0.005) Immune adiponectin, c1q and collagen domain containing +7.48 response T cell receptor associated transmembrane adaptor +5.84 1 chemokine (C-C motif) receptor 9 +9.22 defensin beta 4 +3.25 hemoglobin, beta adult minor chain +26.2 immunoglobulin kappa chain variable 28 (V28) +11.65 Metabolism phosphoenolpyruvate carboxykinase 1, cytosolic +7.59 cytochrome p450, family 1, subfamily a, +8.57 polypeptide 1 cytochrome p450, family 2, subfamily e, +5.39 polypeptide 1 hemoglobin beta chain complex +26.20 Calcium calmodulin 4 +3.44 signaling calcium/calmodulin-dependent protein kinase IV -1.00 calmodulin-like 3 +5.02 Metabolism carbonic anhydrase 3 +10.19 complement factor d (adipsin) 20.49 Apoptosis protein kinase, cAMP dependent regulatory, type +5.80 II beta (Prkar2b)

cell death-inducing DFFA-like effector c +6.75

Transcription lymphoid enhancer binding factor 1 +5.68 factor Membrane keratin complex 1, acidic, gene 13 +9.42 protein cornifelin +3.38 Cell keratinocyte differentiation associated protein +6.41 differentiation Oxidation uncoupling protein 1 (mitochondrial, proton +5.92 carrier) Cell signaling hepatocyte growth factor activator -5.17 G protein-coupled receptor 171 +3.55 lymphoid enhancer binding factor 1 +5.68 purinergic receptor P2Y, G-protein coupled 10 +7.09

250

Table 27: mRNA expression of representative genes by FGF2 HMW isoforms (Circle B).

Functional group Gene name Fold-increase (+) or Fold-decrease (-) (p<0.005) Immune response haptoglobin -58.38 adiponectin, c1q and collagen domain -37.11 containing hemoglobin, beta adult minor chain -148.80 immunoglobulin kappa chain variable 28 -25.50 (V28) Metabolism histidine acid phosphatase domain +3.34 containing 1 glycoprotein galactosyltransferase alpha 1, -3.60 3 aldehyde dehydrogenase family 1, -11.83 subfamily a1 microsomal glutathione s-transferase 1 -7.90 cytochrome P450, family 2, subfamily e, -15.00 polypeptide 1 phosphoenolpyruvate carboxykinase 1, -29.71 cytosolic peptidylglycine alpha-amidating -6.42 monooxygenase carbonic anhydrase 3 -61.93 Calcium signaling calmodulin 4 -5.67

Apoptosis cell death-inducing DFFA-like effector c -7.98

protein kinase, cAMP dependent -31.21

regulatory, type II beta (Prkar2b)

apolipoprotein ε -4.27 bcl-2 binding component 3 +2.18 Ion channel potassium voltage-gated channel, Shal- +1.79 related family, member 2 Membrane melanocortin 2 receptor accessory protein -8.03 protein transferrin -5.57 Cell transforming growth factor, beta receptor ii -1.93 differentiation sideroflexin 1 -4.18 Oxidation amine oxidase, copper containing 3 -3.96 Transcription nuclear receptor subfamily 1, group h, -1.99 factor member 3 general transcription factor ii e, -1.80 polypeptide 1 (alpha subunit) Membrane reticulon 1 -3.04 protein caveolin 2 -2.30 Cell signaling guanine nucleotide binding protein -3.95

Mitotic process G0/G1 switch gene 2 -4.89

251

Table 28. Genes regulated by the HMW isoforms of FGF2 during I/R injury (overlap).

Functional Gene name Fold-increase (+) or group Fold-decrease (-) (p<0.005) Immune adiponectin, c1q and collagen -37.11 response domain containing hemoglobin, beta adult minor chain -148.80 immunoglobulin kappa chain -25.50 variable 28 (V28) Metabolism phosphoenolpyruvate carboxykinase -29.71 1, cytosolic carbonic anhydrase 3 -61.93 Calcium calmodulin 4 -5.67 signaling

Apoptosis cell death-inducing DFFA-like -7.98 effector c protein kinase, cAMP dependent -31.21 regulatory, type II beta (Prkar2b)

252

Discussion

This chapter of the dissertation has demonstrated that the FGF2 HMW isoforms have a

deleterious role in myocardial dysfunction during I/R injury (Figures 50 and 51). Ablation of

murine FGF2 HMW isoforms protected the heart against irreversible ischemia-reperfusion injury

(Figure 50), while overexpression of the human FGF2 HMW 24 kD isoform exaggerated the ischemia-reperfusion injury in the heart (Figure 51). This is the first evidence to demonstrate that

FGF2 HMW isoforms play an opposite role to the LMW isoform in cardiac ischemia-reperfusion injury. Previous data in this dissertation suggested that the LMW isoform is important in

protecting the heart from myocardial dysfunction (See Chapter 2, Figure 15). Consistent with our

previous data73,305, ablation of murine FGF2 HMW isoform or overexpression of the human

FGF2 24 kD HMW isoform did not alter the degree of myocardial infarct size compared to wildtype hearts (Figure 53). Moreover, during cardiac ischemia-reperfusion, the HMW isoforms

were not released from the heart, while the LMW isoform was detected in coronary effluent

(Table 22). The amount of FGF2 LMW isoform release from FGF2 HMWKO and Wt hearts was similar, suggesting the cardioprotective effect observed in FGF2 HMWKO hearts may not only be due to the presence of the FGF2 LMW isoform, but also due to the absence of the FGF2

HMW isoforms. The LMW and HMW isoforms may regulate each other’s biological activity326,819,820. The released LMW isoform elicited its protective role by interacting with its

cell surface receptor (FGFR) since the FGFR inhibitor (PD173074) caused a significant decrease

in post-ischemic cardiac function in both Wt and FGF2 HMWKO (where the murine FGF2

HMW isoforms were ablated) (see Figure 61). More importantly, FGFR inhibition completely

abolished the cardioprotective effect in the FGF2 HMWKO hearts, indicating that the

cardioprotective effect in FGF2 HMWKO hearts may be due to either the interaction of FGF2

253

LMW isoform with its cell surface receptor FGFR and/or FGF2 HMW isoform acting on the

signaling pathway(s) mediated by FGFR.

In vitro studies by Kardami and colleagues310,343 show either myocytes exogenously

treated with murine FGF2 HMW isoforms or hearts overexpressing the human FGF2 HMW

isoforms (21-24 kD) display an increase in cardiomyocyte size. Furthermore, the same group

suggests that only the HMW FGF2 isoforms are responsible for the post-ischemic hypertrophic

growth in myocardium, possibly involving in cardiotrophin-1; whereas, the LMW isoform does

not lead to hypertrophy313. Our data are consistent with that of the Kardami group such that no

spontaneous cardiac hypertrophy was observed in FGF2 HMWKO hearts (where only the LMW

FGF2 isoform was present) (Figure 49). Interestingly, in non-ischemic 24 kD Tg hearts, there

was also no spontaneous cardiac growth (Figure 49), indicating that neither the murine FGF2

LMW isoform nor human FGF2 HMW isoform caused spontaneous hypertrophy in our mouse

models. This inconsistency in the effect of FGF2 HMW isoforms on cardiac hypertrophy may be

due to the models. In the studies by Kardami and investigators310,343, the FGF2 HMW isoforms

were given exogenously for 2 days to cardiomyocytes, while in our mouse models, the human 24

kD FGF2 HMW isoform was overexpressed chronically from birth. Also, there are other factors

such as TGF β and IGF that regulate cardiac hypertrophy in vivo which may not be part of the cell culture in vitro system (Kardami and colleagues)310,343 and could be a reason for the normal

cardiac anatomy and morphology in our mouse model.

Besides the lack of spontaneous cardiac hypertrophy, ablation of the FGF2 HMW

isoforms did not result in an alteration of the LMW isoform protein level (Figure 48).

Overexpression of the human FGF2 24 kD HMW isoform also had no influence on the

endogenous levels of murine LMW and HMW protein isoforms (Figure 48). Evidence suggests

that exogenously treated cardiomyocytes with FGF2 LMW isoform results in an increased FGF2

254

promoter activity, leading to an increase in translation of FGF2 isoforms821. There is no

evidence, however, in the literature to suggest that the LMW and HMW protein isoform

expression are co-dependent upon each other, and this is consistent with the results in the

dissertation. The effect that was observed in ischemia-reperfusion injury is through ablation of

the FGF2 HMW isoforms or overexpression FGF2 24 kD HMW isoform and not due to the

compensatory effect of the presence murine FGF2 isoforms.

FGF2 is a potent angiogenic factor254; however, in our model, there were no significant differences in blood vessel (smooth muscle-containing vessels or capillaries number) between

non-transgenic and FGF2 HMW 24 kD Tg hearts, demonstrating that overexpression of the

FGF2 HMW isoform did not affect angiogenesis. Our finding is opposite that of studies by

Sriramarao and Mignatti822. This group showed that overexpression of human FGF2 HMW 24

kD isoform in either tumor or endothelial cells, causes a significant increase in cell proliferation

independent of its cell surface receptor compared to wildtype cells. These observed differences

between the dissertation and Sriramarao and Mignatti may be due to the compensatory effect of

other angiogenic factors expressed in vivo, including VEGF85, IGF823, FGF1824, FGF3126,127,

FGF5129 and FGF6130, which are lacking in cell culture studies. For example, the FGF2 LMW

isoform induces VEGF release in osteoblasts in a dose-dependent manner825. Additionally, the

study by Sriramaroa and Mignatti822 was performed on cells in culture where there is a big

difference between isolated cell proliferation to angiogenesis (blood vessel growth, in vivo).

Angiogenesis is a more complicated process compared to cell proliferation. The angiogenesis

process begins with the degradation of the basement membrane by proteases secreted by

activated endothelial cells that will then migrate and proliferate, leading to the formation of solid

endothelial cell sprouts into the stromal space. Then, vascular loops are formed and capillary

tubes develop with formation of tight junctions and deposition of new basement membrane826. It

255

is possible that the HMW isoforms are affecting the cell proliferation but not directly affecting

the whole angiogenesis process. It is not known whether the FGF2 HMW isoforms affect the

activity of other angiogenic or mitogenic factors. Also, this dissertation demonstrated that

vascular growth was not affected in FGF2 HMWKO hearts, similar to that observed in FGF2

LMWKO and Fgf2 KO hearts. These findings demonstrate that manipulation of FGF2 LMW or

HMW isoform expression in vivo does not affect vessel growth or development in the hearts. It is

surprising that no alterations in angiogenesis or cardiac growth are observed as initial functional

characterization for this growth factor revealed its importance in angiogenesis and mitogenesis254.

Therefore, the lack of modification of vessel or cardiac growth may be due to compensation by other angiogenic/mitogenic factors or that angiogenesis is not triggered in the myocardium until stress situations such as hypoxia, ischemia or remodeling which then activates growth factor release and angiogenic/mitogenic signaling. Furthermore, this dissertation also indicated that there was no correlation between percent recovery of post-ischemic cardiac function or myocardial infarction to coronary flow, indicating that any change in hemodynamics (i.e., coronary flow) did not influence the cardioprotective or cardiotoxic outcome.

Most studies on FGF2 in I/R injury focused on the LMW isoform, where it has been shown to be a cardioprotective molecule both in vivo and in vitro65,86,87,89,229,232,341,343,827,828. Until recently, there was no evidence implicating a role of FGF2 HMW isoforms in I/R injury.

Kardami and colleagues313 showed that exogenous administration of the recombinant rat FGF2

23 kD HMW isoform results in an increase in post-ischemic contractile function and a decrease

in myocardial infarction at 24 hours post-MI. Over the long-term (1-8 weeks), however, post-

ischemic cardiac function in FGF2 HMW isoform-treated hearts show no difference as compared to saline-treated hearts313. This group concluded that the FGF2 23 kD HMW isoform protects the

heart from myocardial dysfunction in the short-term but not long-term, most likely due to the

256

hypertrophic response triggered by the FGF2 HMW isoform313. This dissertation has shown that

endogenous HMW isoforms or overexpression of the human HMW 24 kD isoform is detrimental

to the recovery of post-ischemic cardiac function and infarct size following acute I/R injury. Our

findings are the opposite of those Kardami and colleagues observed with the recombinant rat

HMW isoform. These differences can be explained as follows: 1) since FGF2 HMW isoforms

and the FGF2 LMW isoform bind to heparan with similar affinity, it is likely that the

exogenously administered FGF2 HMW isoform can interact with FGFR, eliciting a similar

cardioprotective effect as the FGF2 LMW isoform; 2) the FGF2 HMW isoform effects in the

myocardium could be duration dependent such that in the short term, FGF2 HMW isoforms may elicit a cardioprotective phenomenon. If the expression of FGF2 HMW protein isoforms are manipulated for a long period of time, the activation status of proteins involved in cardioprotection or cardiotoxicity might change, causing an opposite effect on post-ischemic cardiac function. This may also be a reason why Kardami and colleagues did not observe cardioprotection long-term. Also, since this group demonstrated that the HMW isoform induces a hypertrophic response313, cardiac function may decrease because of the cardiac pathology

initiated by the hypertrophic response. What role the endogenous nuclear-localized FGF2 HMW

isoforms has in I/R injury remains to be elucidated. This dissertation has confirmed that FGF2

HMW isoforms are localized to the nucleus, while the LMW isoform is localized both to the

cytosol and nucleus (Figure 60). This localization may indicate as well as dictate the unique

activity of FGF2 HMW isoforms in I/R injury. Ablation of the nuclear targeted murine 21 and 22

kD FGF2 HMW isoforms resulted in a significant increase in percent recovery of post-ischemic

cardiac function compared to wildtype hearts (Figures 50 and 52A, Table 18). This suggests that

the presence of the FGF2 LMW alone is beneficial in protecting the heart from myocardial

dysfunction, and this may occur because of either the presence of beneficial isoform (the LMW

257

isoform) or the removal of the deleterious isoforms (the HMW isoforms). The data suggest that

both explanations are probable as the percent recovery of post-ischemic cardiac function in

FGF2 HMWKO hearts (presence of the protective LMW isoform) was even greater than

wildtype hearts even though both mice had similar levels of FGF2 LMW isoform release during

I/R injury, suggesting the LMW and the HMW isoforms might work in opposition to induce

cardioprotection. It has been speculated that HMW and LMW FGF2 may serve different

functions by controlling each other’s biological activity depending on their relative concentration

and/or localization326,820. To further support the idea that the FGF2 HMW isoforms are

deleterious, ischemic-reperfused hearts overexpressing the human FGF2 24 kD HMW isoform

had a significant decrease in percent recovery of post-ischemic cardiac function (Figure 51,

Table 19) compared to non-transgenic hearts. Both LMWKO (only HMW isoforms present) and

HMW Tg studies showed, for the first time, the nuclear-targeted FGF2 HMW isoforms had a

deleterious role in protecting the heart from myocardial dysfunction.

Similar to previous data presented in the dissertation (See Chapter 2, Figure 16), there

was no significant difference in myocardial cell injury, measured by TTC staining and CK

release, in FGF2 HMWKO hearts compared to wildtype hearts (Figure 53, Table 20). Also,

overexpressing the human FGF2 24 kD HMW isoform did not alter myocardial cell injury

compared to non-transgenic hearts (Figure 53, Table 21). Based on these findings, both the

LMW and the HMW isoforms seem to be important in protecting the heart from myocardial

infarction. Evidence indicates that the effect of the FGF2 HMW isoforms on apoptosis is related

to its concentration given, such that a high concentration of FGF2 HMW promotes cell growth

and inhibits apoptosis, while a low concentration of FGF2 HMW promotes cell apoptosis829.

This dual effect of FGF2 HMW isoforms in apoptosis may contribute to the lack of change in myocardial infarction between groups. Furthermore, consistent with other studies, the level of

258

myocardial infarction is not always a predictor of post-ischemic improvement in left ventricular

function after I/R injury830,831.

Even though most studies demonstrate that the biological role of FGF2 HMW isoforms is

FGFR independent and the effects of the FGF2 LMW isoform is receptor dependent267,335, much evidence indicates that the FGF2 HMW isoforms can also modulate signaling pathways, including ERK444,777, c-Jun618, PKC δ444, and PKC ε444, through an intracrine effect. There have

also been in vitro reports, however, that FGF2 HMW isoforms can be released from cells and

interact with FGFR189,832,833 to modulate signaling pathways. This dissertation evlaulated the role

of FGF2 HMW isoforms in modulating PI3K/Akt, PKC and MAPK pathways and whether the

HMW isoforms get secreted out of the heart to activate the FGFR.

This dissertation, for the first time, revealed that in non-ischemic hearts, Akt activation

was slightly, but significantly increased in hearts overexpressing the human FGF2 HMW 24 kD

isoform; moreover, when all of the FGF2 isoforms (LMW and HMW) were overexpressed

(FGF2 Tg), a greater Akt activation was observed (Figure 58), suggesting that the LMW and

HMW isoforms may work synergistically to activate Akt signaling and ultimately, cell survival

during ischemia-reperfusion injury. These data and assumption fit nicely with findings

previously observed in our lab in which cardiac-specific overexpression of all FGF2 isoforms

(FGF2 Tg) results in a significant reduction in myocardial infarct size following ischemia-

reperfusion injury compared to wildtype hearts73. As a major survival protein that can be

activated in many cell types639,681,824, the activation of PI3 kinase could contribute to the better

recovery of post-ischemic contractile function previously observed in FGF2 Tg hearts73. Since there was a poorer recovery of post-ischemic contractile function in 24 kD Tg hearts and no alteration in myocardial cell death, the activation of PI3K/Akt pathway did not provide a

259

protective effect in contractile cardiac function and may not be the predominant signaling

pathway that is mediated by the FGF2 HMW 24 kD isoform during I/R injury.

The activation of PKC isoforms (PKC α, δ and ε) was also studied in non-ischemic FGF2

HMW 24 kD Tg hearts in this dissertation. There was no difference in PKC δ and ε activation, as measured by translocation, in non-ischemic 24 kD Tg hearts compared to non-transgenic hearts

(Figures 54B and C). There was, however, a significant decrease in PKC α activation in non- ischemic 24 kD Tg hearts compared to non-transgenic hearts (Figure 54A), suggesting that activation of this PKC isoform may influence the post-ischemic functional recovery following ischemia-reperfusion injury in this mouse model. Molkentin’s group834 identified PKC α as a fundamental regulator of cardiac contractility and Ca2+ handling. These investigators834 showed that PKC α has a negative effect in regulating cardiac function by upregulating phosphatase-1 activity which results in phospholamban hypophosphorylation, promoting a greater inhibition of sarcoendoplasmic reticulum calcium ATPase (SERCA2) which leads to a dampened contractile response. The decrease in PKC α activation in 24 kD Tg hearts may contribute to an increase in intracellular Ca2+ concentration which may lead to calcium overload and a poorer recovery of

post-ischemic cardiac function.

There was no significant difference in ERK, p38 MAPK, and JNK activation in non-

ischemic human FGF2 HMW 24 kD Tg hearts compared to non-transgenic hearts (Figures 55,

56 and 57). Unlike the FGF2 LMW isoform, these findings showed that overexpression of the

human FGF2 HMW 24 kD isoform did not alter MAPK signaling, suggesting that the LMW and

HMW isoforms have distinct and unique roles in regulating intracellular signaling pathways.

FGF2 activity is, in part, mediated through its interaction with FGFR209. The FGFR1 has been suggested to have a role in protection against myocardial dysfunction229,705,709. The cardioprotective effect of the exogenous LMW FGF2 requires an interaction with FGFR1 as

260

binding to the low affinity HSPG sites alone is not sufficient for cardioprotection229. This dissertation found that after FGFR1 inhibition (PD173074), the post-ischemic recovery of cardiac function was not only inhibited in Wt hearts, but also in FGF2 HMWKO hearts (Figure

61, Table 23). Although, there was no difference between PD-treated FGF2 HMWKO and Wt hearts, in the presence of FGFR1 inhibition, the degree of decrease in recovery of post-ischemic cardiac function in FGF2 HMWKO hearts (~60%) was significantly greater than Wt (~14%)

(Figure 61). These data reveal two important aspects: 1) FGFR1 is involved in I/R injury, since, even in Wt hearts, the recovery of post-ischemic cardiac function was significantly decreased after inhibition of FGFR by PD173074 and 2) the cardioprotective effect in FGF2 HMWKO hearts was receptor-mediated since FGFR1 inhibition completely abolished the protection.

However, whether this receptor-mediated action is due to FGF2 LMW isoform’s interaction with

FGFR1 and/or due to the ablation of FGF2 HMW isoforms affecting downstream targets of

FGFR1 signaling remains to be elucidated. Furthermore, consistent with our previously published data305, there was no difference in myocardial cell injury, as measured by myocardial infarct size and creatine kinase release between DMSO-treated Wt and FGF2 HMWKO hearts

(Figure 62), suggesting that all FGF2 isoforms are necessary to protect the heart from myocardial cell death. This dissertation demonstrated that upon FGFR1 inhibition with PD173074, there was a significant increase in myocardial infarction and creatine kinase release in Wt and FGF2

HMWKO hearts compared to DMSO-treated cohort (Figure 62, Table 24). These findings indicate that FGFR1 activation is involved in protecting the heart from myocardial cell death.

The FGF ligands that can interact with FGFR1 include FGF1, FGF2, FGF3, FGF4,

FGF5, FGF6 and FGF10234. Among those that bind to FGFR1, FGF1 and FGF5, in addition to

FGF2, can elicit a cardioprotective action either via angiogenic-dependent or independent

actions66,705,706,709,827. Since FGF1, FGF2, and FGF5 can bind to FGFR and elicit

261

cardioprotection, it is conceivable that they may share the same signaling pathway(s) in

protecting the heart from I/R injury. Inhibiting FGFR1 may also block the signaling pathways

triggered by FGF1 or FGF5 that lead to cardioprotection and therefore, this could be the reason

why a reduction in recovery cardiac function and myocardial cell damage after I/R injury was

observed in Wt hearts. These data are similar to that of a study by Kardami and colleagues229,835 in which they showed that the mutated FGF2 LMW isoform, a form that binds to the low-affinity

HSPG sites with unchanged affinity, but had diminished affinity for FGFR1, abolished the

cardioprotective effect both in terms of post-ischemic contractile function and troponin T level in

ex-vivo perfused rat hearts. Previous findings showed that FGFR1 inhibition does not block

FGF1-mediated protection against myocardial cell injury705,709. These data provide evidence that

FGF1 and FGF2 isoforms do not share the same signaling pathway to protect the heart from

myocardial cell injury.

It is known that FGF2 HMW isoform release may be facilitated by heat shock protein-

27832 or the shedding of membrane vesicles189 in endothelial cells, particularly during stress (i.e.,

tumorigenesis, hypoxia)819 while the internalization and translocation of the LMW isoform is

through a putative nuclear localization signal or heparan sulfate proteoglycans187,716,717,836. Less

is known about whether or which FGF2 isoforms will be released during I/R injury to facilitate

the cardioprotective effect. This dissertation has begun to delineate whether any of the HMW or

LMW effects during ischemia-reperfusion injury are due to secretion of these isoforms, leading

to activation of receptor or direct regulation on intracellular signaling. Evidence obtained from

Wt, FGF2 LMWKO and FGF2 HMWKO coronary effluent samples, collected at various time-

points of baseline equilibration, early reperfusion and late reperfusion, showed release of FGF2

LMW isoform from the heart, but no FGF2 HMW isoforms, were detected in coronary effluent

during I/R injury (Table 22). Therefore, the cardioprotective effect in FGF2 HMWKO hearts

262

may potentially be due to the release of the LMW isoform and its interaction with cell surface

receptor FGFR. However, the amount of FGF2 LMW isoform release in FGF2 HMWKO hearts

is similar to that in Wt hearts; yet the percent recovery of post-ischemic cardiac function in FGF2

HMWKO hearts is significantly higher compared to Wt hearts. This finding indicates that beside the interaction between the LMW isoform and FGFR1, the absence of the FGF2 HMW isoforms

elicits cardioprotection through a yet to be identified mechanism(s). Since there was a similar

level of FGF LMW isoform release in FGF2 HMWKO and Wt hearts, the ablation of FGF2

HMW isoforms might affect the downstream target(s) of FGFR1 activation, and this effect

would be inhibited when PD173074 compound was employed. FGF2 HMW isoforms are shown

to modulate PKC δ, ε, and ERK1/2 activation, independent of FGFR receptor stimulation444 and the human FGF2 HMW 24 kD isoform can regulate fibroblast proliferation through c-Jun, a important downstream substrate of JNK618. This in vitro evidence demonstrates the possibility

that intracellular signaling may also be modulated by FGF2 HMW isoforms in the heart.

The HMW and LMW FGF2 isoforms are speculated to associate, either directly or

indirectly, in a reciprocal mechanism, controlling each other’s biological activity in a

concentration- and/or localization-dependent manner326,820. The absence of the HMW FGF2

isoforms in FGF2 HMWKO hearts may affect the biological function of the LMW isoform.

However, it is unknown whether the FGF2 HMW isoforms can also interact with FGFR1 in our

models. To elucidate the relationship between FGF2 HMW isoforms and FGFR in I/R injury, it

will be necessary to utilize the FGFR inhibitor, PD173074, on the hearts overexpressing FGF2

HMW isoforms. The employed human FGF HMW 24 kD Tg hearts contains the endogenous

murine FGF2 LMW and HMW isoforms and it would therefore be difficult to exclude the

influence of endogenous murine isoforms on the FGFR1 inhibitor results. Also, the FGF2

LMWKO heart (where only HMW isoforms are present) is not an appropriate model to use to

263

study the interaction between FGF HMW isoforms and FGFR in I/R injury. There was no FGF2

HMW isoforms detected in coronary effluent during I/R injury from the LMWKO heart model,

which could interact with FGFR. The appropriate study is to utilize the FGFR inhibitor on FGF2

HMW isoform overexpressing hearts, containing no endogenous murine FGF2 LMW and HMW

isoforms, and this is a planned future study for the elucidation of the role of FGF2 HMW

isoforms and its relationship with the FGFR1 in I/R injury.

This dissertation showed that there are basal differences in cardiac function, depending

on the expression of a particular FGF2 isoform. Non-ischemic FGF2 HMWKO hearts had a

significant decrease in contractile function; whereas, in human FGF2 HMW 24 kD Tg and FGF2

LMWKO hearts a significant increase in contractile function was observed. There are data for

and against the importance of the FGF2 LMW isoform in regulating calcium

homeostasis65,362,363,461. In fibroblasts, the FGF2 LMW isoform causes a long-lasting calcium

influx362. A similar phenomenon is observed in a human melanoma cell line where FGF2 LMW isoform induces a transient peak of intracellular calcium837. However, in cardiomyocytes, the

FGF2 LMW isoform decreases intracellular calcium by 46% during systole367. These varying

results may be cell type dependent. In our mouse model, that FGF2 LMWKO had an increased contractile function (Chapter 2, Table 12) which is consistent with data by Ishibashi and group367 showing that FGF2 LMW isoform decreased intracellular calcium. Thus, ablation of the FGF2

LMW isoform resulted in an increase in contractile function, possibly by increasing intracellular calcium concentration. However, in Fgf2 KO hearts (where all the isoforms were absent), there was a decreased contractile function, while FGF2 LMWKO hearts showed a significant increase in contractile function compared to wildtype hearts (see Chapter 2, Table 12). There was a decrease in cardiac function in FGF2 HMWKO hearts (Table 18). Similar to that observed in

LMWKO hearts (presence of HMW isoforms), an increase in cardiac function in human FGF2

264

HMW 24 kD isoform occurred (Table 19). These data indicate that the FGF2 HMW isoforms

and FGF2 LMW isoform have opposing roles in the outcome, and most likely, the regulation of

basal cardiac function. These data suggest that the FGF2 HMW isoforms may positively regulate

cardiac contractile function. There currently is no evidence showing any relationship between

FGF2 HMW isoforms and calcium homeostasis. To elucidate how FGF2 HMW isoforms

modulate contractile function, this dissertation initiated preliminary studies to evaluate the role of FGF2 HMW isoforms on proteins involved in calcium handling in SR, including phospholamban and calsequestrin. This dissertation showed that overexpression of the human

FGF2 HMW 24 kD isoform did not alter the expression of calsequestrin and had no effect on phospholamban activations, measured by phosphorylation at the PKA phosphorylation site,

Ser16 (Figure 64). This result indicates that the alteration of cardiac function in human FGF2

HMW 24 kD Tg hearts is not through the FGF2 HMW 24 kD isoform’s action on phospholamban and calsequestrin. Due to the opposite basal contractile function observed in human FGF2 24 kD Tg versus FGF2 HMWKO hearts, other sarcoendoplasmic reticulum proteins (i.e., SERCA, junctin, triadin, histidine-rich calcium binding protein), sarcolemmal proteins (i.e., sodium calcium exchanger, L-type calcium channel) or contractile apparatus proteins (i.e., troponin T, troponin I, actins, myosin) must modulate FGF2 HMW isoforms’ actions on calcium homeostasis and cardiac function. The exact intracellular mechanism leading

to the alterations in contraction and relaxation is not clear from the present study, and further

studies (e.g., sarcolemmal calcium current using a patch-clamp technique and the Ca2+ uptake/release function of the sarcoplasmic reticulum), focusing on the biochemical and

functional effects of calcium in relation to FGF2 isoform expression, are needed.

The nuclear localization of the FGF2 HMW isoforms (Figure 60) suggests that these isoforms might affect gene transcription indirectly by acting as co-factors or directly by

265

functioning as transcription factors. A well studied transcription factor in the heart is ΝFκB, and it functions in a variety of cardiovascular pathologies838 including atherosclerosis839, viral myocarditis840, angina841,842, ischemic preconditioning (IPC)843, ischemia/reperfusion (I/R)

injury844, congestive heart failure845, and cardiac hypertrophy846. Studies indicate that ΝF-κB has both anti- and pro-apoptotic roles during I/R injury847-849, which make it a likely candidate

transcription factor involved in FGF2 isoforms-mediated cardioprotection. There is evidence that the FGF2 LMW isoform can either increase or inhibit NF-κB activity319,850. In a cancer cell line,

the FGF2 LMW isoform stimulates the interaction of Akt and IKK (inhibitor of NF-κB kinase),

resulting in an increase in NF-κB activation319. On the other hand, the FGF LMW isoform

inhibits the TNF-mediated activation of ΝF-κB by blocking phosphorylation and degradation of

IKK in endothelial cells850. It appears that the FGF2 LMW isoform regulates NF-κB activity via

IKK activation, but not by alterations in NF-κB expression. The complexity of FGF2 isoforms in

regulating NF-κB activity raised the question whether the activity of NF-κB could be modulated

either by the FGF2 LMW or HMW isoforms. In this dissertation, when both isoforms are

overexpressed, the LMW isoform or HMW isoforms have opposing roles on NF-κB activity as

there was no change in FGF2 Tg hearts (Figure 65). NF-κB can activate either pro-survival

genes such as Bcl-2848 and Bcl-xL796 or pro-apoptotic genes including Fas ligand and IL-1838. In our model, it seems that even though NF-κB activation is increased in human FGF2 HMW 24 kD Tg hearts, the percent recovery of post-ischemic cardiac function in human FGF2 HMW 24 kD Tg hearts is opposite. This evidence confirms what has been suggested in the literature: the exact role of NF-κB in I/R injury is variable depending on the stimulus to induce NF-κB activity.

The LMW isoform and HMW isoforms are different stimuli, which can regulate NF-κB activity and result in opposing outcome in I/R injury. Furthermore, the LMW and HMW isoforms may

266

act on distinctive pathways to activate NF-κB, resulting in different outcomes following I/R

injury848,838. It will be of great interest to further study the exact role of NF-κB in I/R injury upon the stimulation of the LMW isoform or HMW isoforms.

As the HMW isoforms are nuclear localized suggesting an indirect or direct function with gene transcription, cardiac mRNA from non-ischemic FGF2 LMWKO (only HMW isoforms were present) and Fgf2 KO (all FGF2 isoforms were ablated) hearts was subjected to gene microarray analysis. Ninety-one gene transcripts, implicated in the immune response, development, transcription factor function, or apoptosis, were either up-regulated or down- regulated by FGF2 HMW isoforms (Table 25). The classes of genes identified is in general agreement with the results (cell-adhesion/extracellular matrix molecules, DNA binding, biosynthesis and structural protein) of descriptive DNA microarray surveys from fibroblasts transfected with FGF2 HMW 22, 22.5 and 24 kD isoforms326. However, our microarray surveys

identified other genes regulated by FGF2 HMW isoforms that were different than those

described by Quarto and colleagues326. This difference may be due to the different systems used in the microarray studies. Also, the duration of the transfected FGF2 HMW isoforms was only

48 hours while our study utilized hearts that were exposed to alterations in HMW isoform expression since birth. In our study, there are some genes that are potential future candidates in the evaluation of the FGF2 HMW isoforms in I/R injury.

Calpain 3: Calpains are a family of non-lysosomal neutral cysteine proteases851. Their proteolytic activity is absolutely dependent on calcium, but is also regulated by phospholipids and by a specific endogenous inhibitor (calpastatin)852. Calpain 3 can modulate ischemia-

reperfusion injury in liver853, brain559 and the heart854, possibly by affecting the activation of NF-

κB855. Calpain 3 results in apoptosis through a impairment of Na+/K+-ATPase activity during

267

early reperfusion856, and inhibition of calpain 3 results in a cytoprotective effect after I/R injury in rat hearts857 and mouse brain858, indicating that calpain 3 is detrimental in I/R injury and inhibition calpain 3 can lead to protection after I/R injury. The FGF2 LMW isoform can decrease calpain activity in Schwaan cells859. On the other hand, a calpain inhibitor increases the secretion

of FGF2 LMW isoform in HUVEC cells860. It seems that FGF2 LMW isoform and calpain have

a positive feed-back loop, where decreased calpain activity results in an increase in FGF2 LMW

isoform release, and this increased release may feedback to inhibit calpain activity. There is no

evidence demonstrating an interaction between the FGF2 HMW isoforms and calpain function.

In our microarray study, the absence of the FGF2 HMW isoforms resulted in a 2-fold decrease in

calpain mRNA expression, suggesting that the FGF2 HMW isoforms may have a positive role in

regulating the cytotoxic protein calpain, leading to HMW’s detrimental action in I/R injury.

Upstream transcription factor 1 (USF1): USF1 is a transcription factor that participates in many

cellular responses including stress861, immunologic862, cell proliferation863, cell cycle864, and lipid metabolism865. USF1 regulates the tumor suppression gene p53863, which is a transcription factor

and plays a major role in regulating the response of mammalian cells to stress and damage866. A dominant-negative form of USF positively regulates the activity of human telomerase reverse transcriptase (hTERT)867. Administration of hTERT reduces cerebral infarct volume and

improves neuronal function683. In fibroblasts, FGF2 can stimulate FGF-inducible response

element (FiRE) which has a binding site for USF1868. From the microarray data, the absence of

FGF2 HMW isoforms resulted in a decrease in USF1 mRNA level. It is hypothesized that this decrease might cause an increased hTERT level and result in cardioprotection.

268

CREB: CREB is a 43 kD transcription factor that plays a critical role in regulating gene

expression in response to a variety of extracellular signals869,870. CREB phosphorylation and

activation can be mediated by a variety of intracellular signaling pathways, including protein kinase A871, calmodulin-dependent kinase872 and ribosomal S6 kinase 2 in response to activation

of Ras873 and cyclic GMP signaling874. CREB also is involved in many pathophysiological states,

including cardiac hypertrophy875, heart failure875, cancer876, and inflammatory disease877. CREB activation leads to activation of protective molecules including Bcl-2878 and Akt879. The FGF2

LMW isoform can increase CREB phosphorylation, potentially eliciting cardioprotective

effect322. However, in our microarray data, the absence of FGF2 HMW isoforms caused a

decrease in CREB mRNA expression. This decrease of CREB mRNA expression did not

correlate with the detrimental outcome of HMW isoforms in I/R injury. This finding suggests

that the transcription factor CREB is not the predominant transcription factor that involved in

HMW’s effects. Another reason could also be that the phosphorylation level of CREB is more

important to elicit its biological function in I/R injury880, and its phosphorylation state was not

determined in this dissertation.

These genes, including calpain, USF1 and CREB, which were modulated by FGF2 HMW isoforms basally, are involved in either cell damage in response to stress, ischemia-reperfusion injury, or cardiac hypertrophy861,862,856,322. These could be potential targets to focus on in the

future; asking the question if these targets are important in the “priming” of FGF2 HMW

isoforms’ cardioprotective (reduction in myocardial infarction) or cardiotoxic (enhanced

myocardial dysfunction) phenotype upon ischemia-reperfusion injury.

Cardiac mRNA from sham or ischemic-reperfused FGF2 LMWKO and Fgf2 KO hearts was also subjected to DNA microarray analysis. Fifty-one genes were altered in ischemic-

269

reperfused FGF2 LMWKO compared to sham-treated FGF2 LMWKO hearts (Table 26) and

these 51 genes is involved in immune response, apoptosis, calcium signaling, metabolism,

oxidation and transcriptional regulation were regulated by the I/R. These data are similar to

results of gene expression analysis on rat hearts after I/R injury881. Most of the genes showing

altered expression are involved in cell structure, immune response, calcium signaling and cell

division/differentiation881. One hundred fifty-two genes were either up-regulated or down- regulated in ischemic-reperfused Fgf2 KO hearts compared to ischemic-reperfused FGF2

LMWKO hearts (Table 27). These gene are regulated by FGF2 HMW isoforms and are classified as genes important in the immune response, cell signaling, calcium handling, metabolism, and apoptosis882,883,65,362,363,461. Among these 152 genes, nine were also altered by

I/R injury (Table 28). These nine genes were regulated by FGF2 HMW isoforms during I/R

injury and have functions in immune response, metabolism, calcium signaling, and apoptosis.

Among these nine genes, three are involved in cardiac physiology or cardiac function and could

be potential candidate genes that participate in I/R injury.

Phosphoenolpyruvate carboxykinase-1(PEPCK): PEPCK is an enzyme that is involved in

gluconeogenesis884. Transcription of PEPCK can be activated by glucogen, glucocorticoids,

retinoic acid, and adenosine 3’,5’-monophosphate (cAMP) and is inhibited by insulin885. During

I/R injury in the liver, PEPCK mRNA level increases dramatically886, which was similar to that

observed (7-fold increase in mRNA after I/R injury) in this dissertation. FGF2 HMW isoforms

positively regulate mRNA level of PEPCK (Table 27). Evidence suggests that acidosis can

increase PEPCK protein level, and this increase acts as a positive feedback loop and facilitating

glucogenesis and increasing intracellular acidosis887. I/R injury can cause acidosis in

cardiomyocytes and subsequently increase PEPCK mRNA level888 and this increase may lead to

270

more acidosis in the organ887. Although there is no other demonstration between the FGF2

isoforms and PEPCK activity besides that in this dissertation, it is hypothesized that the

detrimental role of the FGF2 HMW isoforms in I/R injury may partially due to its positive

regulation of PEPCK, which may lead to a more acidotic myocardium, resulting in further cell

damage.

Carbonic anhydrase 3: Carbonic anhydrase is a family of metalloenzymes that catalyze the rapid

conversion of carbon dioxide to bicarbonate and protons883. Administration of acetazolamide, an inhibitor of carbonic anhydrase 3, results in an increase in mouse brain blood flow889. Ischemia-

reperfusion injury causes an increase carbonic anhydrase 3 mRNA level890. The absence of FGF2

HMW isoforms caused a 60-fold decrease in carbonic anhydrase 3 mRNA. Due to its vasoconstrictive effect on the brain, it is suspected that it may have a similar effect on the coronary arteries. In this dissertation, coronary flow was not different in FGF2 HMWKO hearts

compared to Wt hearts during I/R injury. This suggest that either carbonic anhydrase 3 play a different role on cardiovascular system compare to its role in the brain or there may be some other unknown factors compensate the vasoconstric action of carbonic anhydrase 3 in the

HMWKO hearts.

Calmodulin 4: Calmodulin (CaM) 4 is a ubiquitous, calcium-binding protein that can bind to and regulate a multitude of protein targets, thereby affecting many different cellular functions817.

CaM regulates nitric oxide synthase (NOS) and activates Ca/CaM-dependent protein kinases

(CaMK), and a protein phosphatase (calcineurin)891. CaM mediates processes such as

inflammation892, apoptosis893, short-term and long-term memory894, and nerve growth895.

Inhibition of calmodulin 4, exhibits a cardioprotective effect by inhibiting caspase 3 activation

271

and tyrosine nitration in rat hearts891. Alterations in intracellular calcium concentration can

activate calmodulin and subsequently activate CaMK896. Calmodulin can also activate CaMK

which inhibits inducible NOS (iNOS) trafficking and activity897. iNOS is a cardioprotective

molecule as shown both by our lab898,899 and other investigators900-902. The role of FGF2 in the

regulation of intracellular calcium concentration is variable65,362,363,461. For example, FGF2 can

enhance the neuronal intracellular calcium concentration via NMDA receptors360. Conversely,

FGF2 LMW isoform decreases cardiac intracellular calcium by 46% during systole367. FGF2

HMW isoforms increased calmodulin 4 mRNA expression (Table 27). This increase may lead to an inhibition of iNOS and elicit a deleterious effect in cardioprotection.

This evidence indicates that FGF2 HMW isoforms significantly increase the detrimental gene mRNA expression level. Furthermore, the microarray data provides new information and potential candidate genes to evaluate in FGF2 HMW isoforms in I/R injury. FGF2 LMWKO and

Fgf2 KO groups were compared to elucidate the role of FGF2 HMW isoforms on gene expression during I/R injury. Some genes, however, might be regulated by FGF2 LMW and

HMW isoforms and it is hard to differentiate those genes by this comparison. Furthermore, there are many genes, including those involved in membrane structure/function, metabolism, apoptosis, immune response, and ion transport, that are altered by the HMW isoforms independent of I/R injury (data not shown). These genes could be potentially important during prolong I/R injury and need to be further studied. To elucidate the exclusive effect of individual FGF2 isoform on gene expression, individual isoform knockout and overexpressing mice will need to be studied further. In addition, it is necessary to verify the microarray data by using RT-PCR and immunoblotting to correlate the mRNA expression level to protein level. Furthermore, it is still unknown that whether FGF2 HMW isoforms are acting as transcriptional factor itself or as a co-

272

factor that interact with transcription factor. Chromatin immunoprecipitation (ChIP) can be

performed to determine this question.

In summary, this dissertation provided evidence that the FGF2 HMW isoforms were

detrimental for post-ischemic recovery of function and both LMW and HMW FGF2 isoforms

were necessary in protecting the heart from myocardial cell injury/death. The HMW effects in the heart are most likely due to intracrine signaling, while the LMW effect in the heart is due to its action with FGFR1. A FGFR inhibitor, PD173074, administrated during ischemia-reperfusion completely abolished the cardioprotective effect in Wt and FGF2 HMWKO hearts and reduced myocardial cell death. FGF2 LMW and HMW biological actions on NF-κB depend on their

relative expression level, providing more complexity in the identification of the functions of the

FGF2 isoforms in I/R injury and cardioprotection. In addition, the detrimental role of FGF2

HMW isoforms may be through upregulation of cardiotoxic genes. This evidence reveals a

critical role of FGF2 HMW isoforms in I/R injury which may aid in the development of novel strategies for the reduction of morbidity and mortality from ischemic heart disease.

273

Summary

In summary, this dissertation has provided important insights into the in vivo role(s) of

FGF2 LMW and HMW isoforms in ischemia-reperfusion injury. The FGF2 LMW isoform is

beneficial in protecting the heart from myocardial dysfunction, while the FGF2 HMW isoforms

have a deleterious role with regard to protecting the heart from myocardial dysfunction after

global, low-flow I/R injury. These actions of the FGF2 isoforms in I/R injury are independent of

angiogenic activity of this growth factor. Ablation of the FGF2 LMW isoform resulted in a

decrease in post-ischemic cardiac function, while ablation of FGF2 HMW isoforms caused an

increase in post-ischemic cardiac function. Furthermore, overexpression of the human FGF2

HMW 24 kD isoform exacerbated the cardiac injury after I/R compared to non-transgenic hearts.

Overexpression or exogenous administration of the FGF2 LMW isoform can protect the heart

from myocardial dysfunction and/or myocardial infarction65,86,343,827 which is similar to our

findings. Furthermore, recent evidence suggests that FGF2 HMW might be cytotoxic by

increasing cytochrome C release and pro-apoptotic protein Bax in human embryonic kidney

cells777. This dissertation is the first demonstration that FGF2 HMW isoforms have a deleterious effect in cardiac I/R injury.

Myocardial cell injury/death in Fgf2 KO, FGF2 LMWKO and FGF2 HMWKO hearts

were similar compared to Wt hearts while there is a decreased myocardial cell injury in mice

overexpressing all isoforms of FGF2 (FGF2 Tg)73. Therefore, both LMW and HMW isoforms appear to be necessary in protecting the heart from myocardial cell injury.

The mechanisms underlying the LMW and the HMW isoforms effects in I/R injury are different. The LMW isoform elicits its cardioprotection by inhibiting the MKK4/7/JNK signaling pathway and blocking c-Jun activity and apoptosis, and further evidence reveals that FGFR1 is

274

involved in FGF2 LMW isoform-mediated cardioprotection. Besides regulating the JNK

signaling pathway, ablation of FGF2 LMW isoform also caused a decrease in p38 MAPK, Akt

and PKC δ activation (Table 29) which have all been shown to be involved in I/R injury436,448,564,577,633,903,904. These regulations may initiate a synergetic effect on cardioprotection

since just blocking p38 MAPK did not affect percent recovery of cardiac function in Fgf2 KO

and FGF2 LMWKO hearts after I/R injury. Furthermore, the nuclear localization of FGF2 LMW

isoform suggests that it may also regulate gene expression during I/R. In fact, genes involved in

metabolism, calcium signaling, apoptosis, and DNA transcription factor were altered by the

LMW isoform. These genes could be potential targets of the FGF2 LMW isoform in I/R injury

and cardioprotection.

Conversely, during I/R injury, the percent recovery of post-ischemic cardiac function in

FGF2 HMWKO was significantly higher compared to Wt hearts. The exact mechanism of FGF2

HMW isoforms’ activity in I/R injury remains to be determined. This dissertation proposed

several potential mechanisms of FGF2 HMW isoforms in I/R injury. Although evidence suggests

that the FGF2 HMW isoforms can be released under stress events (hypoxic or

tumorigenesis)189,905, no FGF2 HMW isoforms were detected in coronary effluent obtained at

baseline, ischemia and reperfusion. The subcellular location of the FGF2 HMW isoforms in the

heart indicates that their actions are intracrine. Even though the FGFR1 inhibitor completely

abolished the protective effect observed in FGF2 HMWKO hearts, it is speculated that the FGF2

HMW isoforms can affect downstream targets of FGFR signaling. Human FGF2 HMW 24 kD

isoform decreased PKC α activation, which may have potential influence on intracellular

calcium content since PKC α has a negative inotropic effect on cardiac function834. In addition, human FGF2 HMW 24 kD isoform caused a slight increase in Akt activation and the LMW and

HMW isoforms also worked synergistically to activate Akt signaling and ultimately, cell survival

275

during ischemia-reperfusion injury. When the expression level of individual LMW and HMW isoforms is balanced, they have an opposite role on NF-κB activity. However, when this balance

is interrupted and one of the isoforms becomes the predominant isoform in the heart, the HMW

has a trend toward positive regulation on NF-κB activity. It is speculated that FGF2 HMW

isoforms and the LMW isoform can associate, either directly or indirectly and that a reciprocal

mechanism may translocate each form either to the nucleus or the cytoplasm depending on

factors such as their relative expression. In addition, to modulating intracellular signals like NF-

κB and Akt, the nuclear localized FGF2 HMW isoforms can regulate the genes basally and

following I/R injury (Figure 67). However, it is unknown whether FGF2 HMW isoforms act as a

co-factor or transcription factor to regulate these genes.

Overall, this dissertation has demonstrated the distinct and unique roles of FGF2 LMW

and HMW isoforms in ischemia-reperfusion injury. These findings may aid in the development

of new strategies to reduce the morbidity and mortality, which results from ischemic heart

disease.

276

Table 29: Summary of activation of PKC and MAPK signaling pathway in FGF2 LMWKO and FGF2 HMW 24 kD Tg non-ischemic hearts.

FGF2 LMWKO FGF2 HMW 24 kD Tg

ERK ------

p38 MAPK ↓ ------

JNK ↑ ------

PKC α ------↓

PKC ε ------

PKC δ ↓ ------

PKC ζ ------

Akt ↑ ↑

------: No change in activation compared to Wt or NTg hearts LMW ↑: Increased activation compared to Wt or NTg hearts FGF ↓: Decreased activation compared to Wt or NTg hearts

LMW LMW FGF FGF

LMW FGF

277

LMW LMW LMW FGF2 FGF2 FGF2

MKK4/7 LMW FGF2 p38 MAPK Recovery post- Akt PKC α ischemic cardiac function JNK Cytochrome C

JNK c-Jun Apoptosis NF-κB

HMW FGF2 HMW FGF2

Myocardial cell injury Transcription of Transcription of cardioprotective genes cardiotoxic genes

Figure 66: Working model of fibroblast growth factor 2 isoform signaling in cardioprotection. The LMW isoform has a beneficial role, while the HMW isoforms are deleterious in myocardial dysfunction. Both LMW and HMW isoforms appear to be necessary to protect the heart from myocardial cell injury. The LMW isoform is localized both in the cytosol and nucleus and mediates its cardioprotective effect by inhibiting the JNK pathway and activatign of FGFR. The LMW isoform can activate Akt, p38 MAPK and NFκB activation. The HMW isoforms are localized to the nucleus. FGF2 HMW isoform can also inhibit PKC α activation and increase Akt activation. Both LMW and HMW isoform can regulate gene expression involved in cytotoxicity and cardioprotection. The FGF2 LMW isoform can increase mRNA level of cardioprotective genes and decrease mRNA level of cytotoxic genes. On the other hand, FGF2 HMW isoforms can increase mRNA level of cytotoxic genes and decrease mRNA level of cardioprotective genes. : INHIBIT : ACTIVATE : UNKNOWN INTERACTION

278

Clinical relevance and future directions

Coronary artery disease is the leading cause of death in the US and other industrialized

countries1. Recent studies suggest the possibility of a novel therapeutic approach to protect the

heart from ischemia-reperfusion injury that relies on stimulation of collateral blood vessel

growth via FGF2906-912. Current clinical trials utilize recombinant human FGF2 in the treatment

of coronary artery disease (Table 29). These current studies are evaluating the angiogenic

properties of FGF2 to treat patients with coronary heart disease. Most of the studies only focus

on testing the safety and efficacy of FGF2 in patients with coronary artery disease906,907,909,913.

With the treatment, patients in the FGF2 group had no angina three months after bypass surgery

compared to placebo group which had recurrent angina906,907. These effects are dose-dependent

compared to the placebo-controlled group907. Further studies show that the delivery of FGF2

results in attenuation of stress-induced ischemia and an improvement in resting myocardial

perfusion injury up to 180 days after treatment909, but with a dose-dependent hypertensive

effect909. However, a recent study failed to show improvement of cardiac function after

exercise912, indicating inconsistency and potential side effects of the clinical usage of FGF2. The

chronic angiogenic effect of FGF2 is a feasible therapeutic for patients with coronary heart

disease and this treatment modalitiy could be employed in patients at risk for coronary artery

disease. However, when a patient has an acute ischemic event, the angiogenic effect of FGF2

will not take effect immediately. Therefore, exploring the non-angiogenic actions of FGF2 will

be of great importance to provide a novel therapy which may be used in patients with acute

ischemic heart disease. This dissertation elucidated the non-angiogenic role(s) of FGF2 LMW

and HMW isoforms in cardioprotection. The LMW isoform and the HMW isoforms have

opposing roles in I/R injury and cardioprotection, which might be the reason that several ongoing

clinical trials did not observe sustained improvement in cardiac function906,907,909,913. Most of the

279

studies ignored the presence of the HMW isoform, which might counteract the beneficial role

induced by FGF2 LMW isoform. If a therapy could harness the beneficial effect of both

isoforms, it will produce a more positive cardioprotective effect. Furthermore, this dissertation

also provides some preliminary data indicating the involvement of FGFR1 in the FGF2 LMW

isoform-mediated cardioprotection. The inhibitor of FGFR employed in this dissertation is

currently in clinical trial for cancer treatment914. However, usage of the inhibitor in cancer treatment and its action in the cardiovascular system to abrogate the cardioprotective nature of

FGF2 (according to the data from this dissertation) needs to be taken into consideration. The role of FGFR4, which is expressed in human myocardium, in ischemia-reperfusion injury and cardioprotection, remains to be elucidated. This dissertation also identifies potential downstream

targets that may be involved in FGF2 isoform-mediated cardioprotection, and could be ideal

future therapeutic candidates for patients suffering from ischemic heart disease.

280

Table 30: Complication of clinical trials that employed recombinant FGF2 for the treatment of coronary artery disease. Adapted from Detillieux et al Cardiovascular Research 2003. Trial name, type, Mode of delivery Number Results date of patients Sellke et al., 1998 Heparan–alginate slow 8 Safety and technical [558], Phase I release device feasibility demonstrated Laham et al., 1999 Heparan–alginate slow 24 Safety and technical [559], Phase I release microcapsules feasibility demonstrated Unger et al., 2000 Bolus injection in main 25 Acute hypotension, some sustained [560], Phase I left coronary artery; 3– hypotension (1–3 days); no long- 100 mg/kg term adverse effects Udelson et al., 2000 Intracoronary or 59 ↓ stress-induced ischemia, [561], Phase I intravenous injection; ↑ resting myocardial perfusion 0.33–48 mg/kg Laham et al., 2000 Single 20-min 52 Hypotension was dose-limiting [562], Phase I intracoronary infusion; (max. 36 mg/kg) Some evidence of 0.33–48 mg/kg improved quality of life and exercise tolerance; ↑ regional wall thickening ↓ extent of ischemic area Simons et al. Single intracoronary 337 No improvement in exercise 2002‘FIRST’, [563], infusion; 0–30 mg/kg tolerance or myocardial perfusion; Phase II some symptomatic improvement at 90 (but not 180) days

Some of mechanism(s) for the FGF2 LMW and HMW isoforms in I/R injury have been identified from this dissertation research and include the MKK/JNK pathway and FGFR1 signaling. There are, however, still a number important questions that need to be addressed relating to the role of FGF2 LMW and HMW isoforms in I/R injury. These include:

1) Role of FGF2 isoforms in reperfusion injury: FGF2 LMW isoform has been shown to

protect the heart from reperfusion injury when exogenously administered immediately at

reperfusion229. This mode is more clinically relevant and should be evaluated further in

order to develop therapies for ischemic heart disease. Furthermore, the role of FGF2

HMW isoforms in reperfusion injury is unknown.

281

2) Translocation and expression of FGF2 isoforms during ischemia-reperfusion injury:

FGF2 mRNA level can be altered either by many stress stimuli, including hypoxia and

ischemia915, or in response to angiotensin-II916 and adrenergic stimulation917.

Additionally, FGF2 can modulate its own promoter activity821. The localization of FGF2

isoforms may dictate whether their actions are autocrine (FGFR-dependent) or intracrine

(FGFR-independent). Both FGF2 LMW and HMW isoforms are present in the

nucleus91,184. The LMW isoform is also found in the cytosol, basement membrane and in

the extracellular environment95,189,832,918. The question remains as to whether the LMW

and HMW isoforms will alter their localization to accommodate for the intracellular need

during stressful stimuli (i.e., I/R injury). It is speculated that the LMW and HMW

isoforms associate and translocate with each other, depending on their own expression

level819. It will be important to understand the expression and localization of FGF2

isoforms during I/R injury which will aid with understanding their effect in

cardioprotection.

3) Role of FGF2 isoforms on transcription: This dissertation showed that both the LMW

and HMW isoforms activated NF-κB basally. Due to the dual role of NF-κB in I/R injury,

it will be important to understand the regulation of FGF2 LMW and HMW isoforms on

NF-κB during I/R injury. Furthermore, inhibition of NF-κB during I/R on Fgf2 KO,

FGF2 LMWKO, FGF2 HMWKO and human 24 kD Tg hearts will elucidate the

involvement of NF-κB in FGF2 isoform action on cardioprotection.

4) Involvement of FGFR: This dissertation demonstrated that the FGF2 LMW isoform

elicited its cardioprotective effect through FGFR1 activation. Studies have reported that

FGF2 are internalized along with FGFR, indicating that its action may continue

intracellularly919-922. Even though this dissertation indicated that FGF2 HMW isoforms

282

were not released during I/R, it is unknown whether the intracellular FGF2 HMW

isoforms will interact with the internalized FGFR1 and affect the heart during I/R injury

is unknown.

5) Importance of heparan sulfate proteoglycans (HSPGs) in FGF2 isoforms’ actions

during ischemia-reperfusion injury: Current clinical trials have tested several modes of

FGF2 delivery methods906,907 and intracoronary administration reached its therapeutic

target, while central venous bolus injection, intravenous infusion and pericardial injection

failed to enhance collateral perfusion910. However, the pharmacokinetics of the injected

LMW FGF2 isoform (i.e. ½ life, metabolism, clearance, distribution) remains to be

determined. HSPGs serve as storage sites for FGF2 and also protect FGF2 from

proteolysis prolonging the exposure of the myocardium to FGF2220. Furthermore, HSPGs

can facilitate the internalization of FGF2 isoforms212,221. The studies indicate that HSPGs

are novel therapeutic targets that either indirectly or directly may be involved in FGF2

isoforms’ action during I/R injury.

6) Role of FGF2 isoforms on calcium homeostasis: This dissertation showed that FGF2

LMW isoform regulated the activation of phospholamban and FGF2 HMW isoforms

regulated activation of PKC α which could both subsequently regulate calcium cycling in

the hearts. However, no further studies have been performed to elucidate the role of

FGF2 isoforms on basal calcium cycling or during I/R. Studies focusing on the effects of

FGF2 isoforms on sarcolemmal calcium current using a patch-clamp technique and the

Ca2+ uptake/release function of the sarcoplasmic reticulum are needed. The activation of

other calcium cycling proteins including SERCA, L-type calcium channel, S100 proteins,

troponin T and I and ryanodine receptor are also necessary.

283

7) Further characterization of the signaling involved in actions of FGF2 HMW

isoforms during I/R injury: This dissertation demonstrated that FGF2 HMW isoforms

regulated PKC α and Akt activation. In addition, microarray data identified several

targeted genes that could be important in the cardiac outcome of FGF2 HMW isoforms.

Further pharmacological studies need to be performed to elucidate the involvement of

these genes in the effect of FGF2 HMW isoform on cardioprotection. Additionally, to

identify the specific FGF2 isoform(s) which mitigate the cardioprotective effect, mice

that overexpress either the low molecular weight (FGF2 LMW Tg) or the high molecular

weight (FGF2 HMW Tg) isoforms will be employed. The endogenous FGF2 isoforms

can be removed by crossing with Fgf2 KO mice, removing any influence of endogenous

murine FGF2 isoforms. In addition to the FGF2 isoform-specific knockout mice

evaluated in this dissertation research, this will also allow study of the exact role of

individual FGF2 isoforms in I/R injury and their signaling pathways.

8) Effects of other FGFs or growth factors involved in FGF2 isoforms actions in I/R

injury: This dissertation research project demonstrated that alteration in protein

expression level of the FGF2 LMW isoform affects other FGF mRNA levels. Twelve

FGF isoforms (FGF 1, 2, 6, 7, 8, 10, 12, 13, 16, 18, 19 and 20) are found in the heart704,

and among these twelve FGF isoforms, FGF1 has been demonstrated to also be a

cardioprotective molecule705,706,735-740. FGF6 mainly participates in muscle maintenance

and regeneration710. FGF2 LMW isoform also induces VEGF release in osteoblasts in a

dose-dependent manner825. Several growth factors including VEGF and IGF have been

shown to be cardioprotective through their angiogenic properties923-925. The interaction of

FGF2 isoforms with other FGFs or growth factors might participate in I/R injury.

284

Overall, this dissertation revealed several novel roles of FGF2 isoforms in ischemia-

reperfusion injury and cardioprotection. Further characterization of the function of each isoform

in the heart during I/R injury and the substrates of these signaling pathways may lead to the

development of novel therapeutic targets to increase cardiac resistance in susceptible cardiac patients.

285

References:

1. 2007 Heart and Stroke Statistical Update American Heart Association. 2007.

2. Reimer KA JR. Myocardial ischemia, hypoxia, and infarction. In: Fozzard HA, Haber E,

Jennings RB, Katz AM, Morgan HE, editors. The heart and cardiovascular system:

scientific foundations. 1991; 2nd ed. New York Raven Press,:187-1973.

3. Reimer KA, Ideker RE. Myocardial ischemia and infarction: anatomic and biochemical

substrates for ischemic cell death and ventricular arrhythmias. Hum Pathol. 1987;18:462-

75.

4. Buja LM. Myocardial ischemia and reperfusion injury. Cardiovasc Pathol. 2005;14:170-

5. Kloner RA, Jennings RB. Consequences of brief ischemia: stunning, preconditioning, and

their clinical implications: part 1. Circulation. 2001;104:2981-9.

6. Yellon DM RS, Opie LH. Ischemic injury and myocardial protection: evolving concepts.

New Ischemic Syndromes: Beyond angina and Infarction Lippincott-Raven, NY, NY.

1997:10-20.

7. Braunwald E, Kloner RA. The stunned myocardium: prolonged, postischemic ventricular

dysfunction. Circulation. 1982;66:1146-9.

8. Heyndrickx GR, Millard RW, McRitchie RJ, Maroko PR, Vatner SF. Regional

myocardial functional and electrophysiological alterations after brief coronary artery

occlusion in conscious dogs. J Clin Invest. 1975;56:978-85.

9. Opie L. The heart: Physiology, from cell to circulation. Lippincott-Raven New York NY.

1998:515-589.

10. Hearse DJ. Oxygen deprivation and early myocardial contractile failure: a reassessment

of the possible role of adenosine triphosphate. Am J Cardiol. 1979;44:1115-21.

286

11. Bolli R, Marban E. Molecular and cellular mechanisms of myocardial stunning. Physiol

Rev. 1999;79:609-34.

12. Karmazyn M, Moffat MP. Role of Na+/H+ exchange in cardiac physiology and

pathophysiology: mediation of myocardial reperfusion injury by the pH paradox.

Cardiovasc Res. 1993;27:915-24.

13. White BC, Wiegenstein JG, Winegar CD. Brain ischemic anoxia. Mechanisms of injury.

Jama. 1984;251:1586-90.

14. Ji LL. Exercise-induced modulation of antioxidant defense. Ann N Y Acad Sci.

2002;959:82-92.

15. Patterson CE, Rhoades RA. Protective role of sulfhydryl reagents in oxidant lung injury.

Exp Lung Res. 1988;14 Suppl:1005-19.

16. Chang T, Wu L. Methylglyoxal, oxidative stress, and hypertension. Can J Physiol

Pharmacol. 2006;84:1229-38.

17. Takano H, Zou Y, Hasegawa H, Akazawa H, Nagai T, Komuro I. Oxidative stress-

induced signal transduction pathways in cardiac myocytes: involvement of ROS in heart

diseases. Antioxid Redox Signal. 2003;5:789-94.

18. Hearse DJ. Stunning: a radical re-view. Cardiovasc Drugs Ther. 1991;5:853-76.

19. Zorov DB, Filburn CR, Klotz LO, Zweier JL, Sollott SJ. Reactive oxygen species (ROS)-

induced ROS release: a new phenomenon accompanying induction of the mitochondrial

permeability transition in cardiac myocytes. J Exp Med. 2000;192:1001-14.

20. Becker LB. New concepts in reactive oxygen species and cardiovascular reperfusion

physiology. Cardiovasc Res. 2004;61:461-70.

21. Maxwell SR, Lip GY. Reperfusion injury: a review of the pathophysiology, clinical

manifestations and therapeutic options. Int J Cardiol. 1997;58:95-117.

287

22. Park JL, Lucchesi BR. Mechanisms of myocardial reperfusion injury. Ann Thorac Surg.

1999;68:1905-12.

23. Moens AL, Claeys MJ, Timmermans JP, Vrints CJ. Myocardial ischemia/reperfusion-

injury, a clinical view on a complex pathophysiological process. Int J Cardiol.

2005;100:179-90.

24. Schluter KD, Jakob G, Ruiz-Meana M, Garcia-Dorado D, Piper HM. Protection of

reoxygenated cardiomyocytes against osmotic fragility by nitric oxide donors. Am J

Physiol. 1996;271:H428-34.

25. Siegmund B, Schlack W, Ladilov YV, Balser C, Piper HM. Halothane protects

cardiomyocytes against reoxygenation-induced hypercontracture. Circulation.

1997;96:4372-9.

26. Schafer C, Ladilov Y, Inserte J, Schafer M, Haffner S, Garcia-Dorado D, Piper HM. Role

of the reverse mode of the Na+/Ca2+ exchanger in reoxygenation-induced cardiomyocyte

injury. Cardiovasc Res. 2001;51:241-50.

27. Opie LH, Coetzee WA. Role of calcium ions in reperfusion arrhythmias: relevance to

pharmacologic intervention. Cardiovasc Drugs Ther. 1988;2:623-36.

28. Di Paola R, Cuzzocrea S. Peroxisome proliferator-activated receptors ligands and

ischemia-reperfusion injury. Naunyn Schmiedebergs Arch Pharmacol. 2007;375:157-75.

29. Chen LY, Nichols WW, Hendricks J, Mehta JL. Myocardial neutrophil infiltration, lipid

peroxidation, and antioxidant activity after coronary artery thrombosis and thrombolysis.

Am Heart J. 1995;129:211-8.

30. Ferrari R, Ceconi C, Curello S, Cargnoni A, Pasini E, Visioli O. The occurrence of

oxidative stress during reperfusion in experimental animals and men. Cardiovasc Drugs

Ther. 1991;5 Suppl 2:277-87.

288

31. Jordan JE, Zhao ZQ, Vinten-Johansen J. The role of neutrophils in myocardial ischemia-

reperfusion injury. Cardiovasc Res. 1999;43:860-78.

32. Zweier JL, Duke SS, Kuppusamy P, Sylvester JT, Gabrielson EW. Electron paramagnetic

resonance evidence that cellular oxygen toxicity is caused by the generation of

superoxide and hydroxyl free radicals. FEBS Lett. 1989;252:12-6.

33. Clark WM, Lutsep HL. Potential of anticytokine therapies in central nervous system

ischaemia. Expert Opin Biol Ther. 2001;1:227-37.

34. Shizukuda Y, Iwamoto T, Mallet RT, Downey HF. Hypoxic preconditioning attenuates

stunning caused by repeated coronary artery occlusions in dog heart. Cardiovasc Res.

1993;27:559-64.

35. Murry CE, Jennings RB, Reimer KA. Preconditioning with ischemia: a delay of lethal

cell injury in ischemic myocardium. Circulation. 1986;74:1124-36.

36. Shizukuda Y, Mallet RT, Lee SC, Downey HF. Hypoxic preconditioning of ischaemic

canine myocardium. Cardiovasc Res. 1992;26:534-42.

37. Grover GJ, Garlid KD. ATP-Sensitive potassium channels: a review of their

cardioprotective pharmacology. J Mol Cell Cardiol. 2000;32:677-95.

38. de Jong JW, de Jonge R, Keijzer E, Bradamante S. The role of adenosine in

preconditioning. Pharmacol Ther. 2000;87:141-9.

39. Schultz JE, Gross GJ. Opioids and cardioprotection. Pharmacol Ther. 2001;89:123-37.

40. Yellon DM, Baxter GF, Garcia-Dorado D, Heusch G, Sumeray MS. Ischaemic

preconditioning: present position and future directions. Cardiovasc Res. 1998;37:21-33.

41. Kloner RA, Rezkalla SH. Preconditioning, postconditioning and their application to

clinical cardiology. Cardiovasc Res. 2006;70:297-307.

289

42. de Zeeuw S, Van den Doel MA, Duncker DJ, Verdouw PD. New insights into

cardioprotection by ischemic preconditioning and other forms of stress. Ann N Y Acad Sci.

1999;874:178-91.

43. Lochner A, Marais E, Genade S, Moolman JA. Nitric oxide: a trigger for classic

preconditioning? Am J Physiol Heart Circ Physiol. 2000;279:H2752-65.

44. Baines CP, Goto M, Downey JM. Oxygen radicals released during ischemic

preconditioning contribute to cardioprotection in the rabbit myocardium. J Mol Cell

Cardiol. 1997;29:207-16.

45. Das DK, Maulik N, Sato M, Ray PS. Reactive oxygen species function as second

messenger during ischemic preconditioning of heart. Mol Cell Biochem. 1999;196:59-67.

46. Cain BS, Meldrum DR, Cleveland JC, Jr., Meng X, Banerjee A, Harken AH. Clinical L-

type Ca(2+) channel blockade prevents ischemic preconditioning of human myocardium.

J Mol Cell Cardiol. 1999;31:2191-7.

47. McCully JD, Toyoda Y, Uematsu M, Stewart RD, Levitsky S. Adenosine-enhanced

ischemic preconditioning: adenosine receptor involvement during ischemia and

reperfusion. Am J Physiol Heart Circ Physiol. 2001;280:H591-602.

48. Schultz JE, Rose E, Yao Z, Gross GJ. Evidence for involvement of opioid receptors in

ischemic preconditioning in rat hearts. Am J Physiol. 1995;268:H2157-61.

49. Schulz R, Post H, Vahlhaus C, Heusch G. Ischemic preconditioning in pigs: a graded

phenomenon: its relation to adenosine and bradykinin. Circulation. 1998;98:1022-9.

50. Ryter SW, Kim HP, Hoetzel A, Park JW, Nakahira K, Wang X, Choi AM. Mechanisms

of cell death in oxidative stress. Antioxid Redox Signal. 2007;9:49-89.

290

51. Huang PL, Huang Z, Mashimo H, Bloch KD, Moskowitz MA, Bevan JA, Fishman MC.

Hypertension in mice lacking the gene for endothelial nitric oxide synthase. Nature.

1995;377:239-42.

52. Jones SP, Girod WG, Palazzo AJ, Granger DN, Grisham MB, Jourd'Heuil D, Huang PL,

Lefer DJ. Myocardial ischemia-reperfusion injury is exacerbated in absence of

endothelial cell nitric oxide synthase. Am J Physiol. 1999;276:H1567-73.

53. Chen JK, Chow SE. Antioxidants and myocardial ischemia: reperfusion injuries. Chang

Gung Med J. 2005;28:369-77.

54. Das DK, Engelman RM, Maulik N. Oxygen free radical signaling in ischemic

preconditioning. Ann N Y Acad Sci. 1999;874:49-65.

55. Heusch G. Myocardial stunning: a role for calcium antagonists during ischaemia?

Cardiovasc Res. 1992;26:14-9.

56. Wetzels JF, Burke TJ, Schrier RW. Calcium channel blockers: protective effects in

ischemic acute renal failure. Ren Fail. 1992;14:327-32.

57. Riksen NP, Smits P, Rongen GA. Ischaemic preconditioning: from molecular

characterisation to clinical application--part II. Neth J Med. 2004;62:409-23.

58. Riksen NP, Smits P, Rongen GA. Ischaemic preconditioning: from molecular

characterisation to clinical application--part I. Neth J Med. 2004;62:353-63.

59. Liem DA, Verdouw PD, Ploeg H, Kazim S, Duncker DJ. Sites of action of adenosine in

interorgan preconditioning of the heart. Am J Physiol Heart Circ Physiol. 2002;283:H29-

37.

60. Liem DA, te Lintel Hekkert M, Manintveld OC, Boomsma F, Verdouw PD, Duncker DJ.

Myocardium tolerant to an adenosine-dependent ischemic preconditioning stimulus can

291

still be protected by stimuli that employ alternative signaling pathways. Am J Physiol

Heart Circ Physiol. 2005;288:H1165-72.

61. Schultz JE, Hsu AK, Gross GJ. Ischemic preconditioning in the intact rat heart is

mediated by delta1- but not mu- or kappa-opioid receptors. Circulation. 1998;97:1282-9.

62. Goto M, Liu Y, Yang XM, Ardell JL, Cohen MV, Downey JM. Role of bradykinin in

protection of ischemic preconditioning in rabbit hearts. Circ Res. 1995;77:611-21.

63. Ebrahim Z, Yellon DM, Baxter GF. Bradykinin elicits "second window" myocardial

protection in rat heart through an NO-dependent mechanism. Am J Physiol Heart Circ

Physiol. 2001;281:H1458-64.

64. Molin D, Post MJ. Therapeutic angiogenesis in the heart: protect and serve. Curr Opin

Pharmacol. 2007;7:158-63.

65. Padua RR, Sethi R, Dhalla NS, Kardami E. Basic fibroblast growth factor is

cardioprotective in ischemia- reperfusion injury. Mol Cell Biochem. 1995;143:129-35.

66. Cuevas P, Reimers D, Carceller F, Martinez-Coso V, Redondo-Horcajo M, Saenz de

Tejada I, Gimenez-Gallego G. Fibroblast growth factor-1 prevents myocardial apoptosis

triggered by ischemia reperfusion injury. Eur J Med Res. 1997;2:465-8.

67. Nishijima K, Ng YS, Zhong L, Bradley J, Schubert W, Jo N, Akita J, Samuelsson SJ,

Robinson GS, Adamis AP, Shima DT. Vascular endothelial growth factor-A is a survival

factor for retinal neurons and a critical neuroprotectant during the adaptive response to

ischemic injury. Am J Pathol. 2007;171:53-67.

68. Wang JM, Hayashi T, Zhang WR, Sakai K, Shiro Y, Abe K. Reduction of ischemic brain

injury by topical application of insulin-like growth factor-I after transient middle cerebral

artery occlusion in rats. Brain Res. 2000;859:381-5.

292

69. Salloum FN, Takenoshita Y, Ockaili RA, Daoud VP, Chou E, Yoshida K, Kukreja RC.

Sildenafil and vardenafil but not nitroglycerin limit myocardial infarction through

opening of mitochondrial K(ATP) channels when administered at reperfusion following

ischemia in rabbits. J Mol Cell Cardiol. 2007;42:453-8.

70. Obata T. Blocking cardiac ATP-sensitive K+ channels reduces hydroxyl radicals caused

by potassium chloride-induced depolarization in the rat myocardium. Anal Biochem.

2006;356:59-65.

71. Liu J, Long C, Ji B, Zhang H, Wen F. Myocardial protective effects of nicorandil, an

opener of potassium channels on senile rat heart. Perfusion. 2006;21:179-83.

72. Schultz JE, Hsu AK, Gross GJ. Morphine mimics the cardioprotective effect of ischemic

preconditioning via a glibenclamide-sensitive mechanism in the rat heart. Circ Res.

1996;78:1100-4.

73. House SL, Bolte C, Zhou M, Doetschman T, Klevitsky R, Newman G, Schultz Jel J.

Cardiac-specific overexpression of fibroblast growth factor-2 protects against myocardial

dysfunction and infarction in a murine model of low-flow ischemia. Circulation.

2003;108:3140-8.

74. Ping P, Song C, Zhang J, Guo Y, Cao X, Li RC, Wu W, Vondriska TM, Pass JM, Tang

XL, Pierce WM, Bolli R. Formation of protein kinase C(epsilon)-Lck signaling modules

confers cardioprotection. J Clin Invest. 2002;109:499-507.

75. Dorn GW, 2nd, Souroujon MC, Liron T, Chen CH, Gray MO, Zhou HZ, Csukai M, Wu

G, Lorenz JN, Mochly-Rosen D. Sustained in vivo cardiac protection by a rationally

designed peptide that causes epsilon protein kinase C translocation. Proc Natl Acad Sci U

S A. 1999;96:12798-803.

293

76. Saurin AT, Pennington DJ, Raat NJ, Latchman DS, Owen MJ, Marber MS. Targeted

disruption of the protein kinase C epsilon gene abolishes the infarct size reduction that

follows ischaemic preconditioning of isolated buffer-perfused mouse hearts. Cardiovasc

Res. 2002;55:672-80.

77. Chen C, Mochly-Rosen D. Opposing effects of delta and xi PKC in ethanol-induced

cardioprotection. J Mol Cell Cardiol. 2001;33:581-5.

78. Gray MO, Karliner JS, Mochly-Rosen D. A selective epsilon-protein kinase C antagonist

inhibits protection of cardiac myocytes from hypoxia-induced cell death. J Biol Chem.

1997;272:30945-51.

79. Chen L, Hahn H, Wu G, Chen CH, Liron T, Schechtman D, Cavallaro G, Banci L, Guo Y,

Bolli R, Dorn GW, 2nd, Mochly-Rosen D. Opposing cardioprotective actions and parallel

hypertrophic effects of delta PKC and epsilon PKC. Proc Natl Acad Sci U S A.

2001;98:11114-9.

80. Liu GS, Cohen MV, Mochly-Rosen D, Downey JM. Protein kinase C-epsilon is

responsible for the protection of preconditioning in rabbit cardiomyocytes. J Mol Cell

Cardiol. 1999;31:1937-48.

81. Inagaki K, Begley R, Ikeno F, Mochly-Rosen D. Cardioprotection by epsilon-protein

kinase C activation from ischemia: continuous delivery and antiarrhythmic effect of an

epsilon-protein kinase C-activating peptide. Circulation. 2005;111:44-50.

82. Morrison DK, Davis RJ. Regulation of MAP kinase signaling modules by scaffold

proteins in mammals. Annu Rev Cell Dev Biol. 2003;19:91-118.

83. Lei K, Nimnual A, Zong WX, Kennedy NJ, Flavell RA, Thompson CB, Bar-Sagi D,

Davis RJ. The Bax subfamily of Bcl2-related proteins is essential for apoptotic signal

transduction by c-Jun NH(2)-terminal kinase. Mol Cell Biol. 2002;22:4929-42.

294

84. Gross GJ. Mitochondrial ATP-sensitive potassium channels and myocardial hypertrophy.

J Mol Cell Cardiol. 2005;38:237-9.

85. Frelin C, Ladoux A, D'Angelo G. Vascular endothelial growth factors and angiogenesis.

Ann Endocrinol (Paris). 2000;61:70-4.

86. Padua RR, Merle PL, Doble BW, Yu CH, Zahradka P, Pierce GN, Panagia V, Kardami E.

FGF-2-induced negative inotropism and cardioprotection are inhibited by chelerythrine:

involvement of sarcolemmal calcium-independent protein kinase C. J Mol Cell Cardiol.

1998;30:2695-709.

87. Harada K, Grossman W, Friedman M, Edelman ER, Prasad PV, Keighley CS, Manning

WJ, Sellke FW, Simons M. Basic fibroblast growth factor improves myocardial function

in chronically ischemic porcine hearts. J Clin Invest. 1994;94:623-30.

88. Horrigan MC, MacIsaac AI, Nicolini FA, Vince DG, Lee P, Ellis SG, Topol EJ.

Reduction in myocardial infarct size by basic fibroblast growth factor after temporary

coronary occlusion in a canine model. Circulation. 1996;94:1927-33.

89. Unger EF, Banai S, Shou M, Lazarous DF, Jaklitsch MT, Scheinowitz M, Correa R,

Klingbeil C, Epstein SE. Basic fibroblast growth factor enhances myocardial collateral

flow in a canine model. Am J Physiol. 1994;266:H1588-95.

90. Yamashita T, Yoshioka M, Itoh N. Identification of a novel fibroblast growth factor,

FGF-23, preferentially expressed in the ventrolateral thalamic nucleus of the brain.

Biochem Biophys Res Commun. 2000;277:494-8.

91. [http://www.ncbi.nlm.nih.gov/Genbank/index.html] G.

92. Ornitz DM, Itoh N. Fibroblast growth factors. Genome Biol. 2001;2.

295

93. Plotnikov AN, Hubbard SR, Schlessinger J, Mohammadi M. Crystal structures of two

FGF-FGFR complexes reveal the determinants of ligand-receptor specificity. Cell.

2000;101:413-24.

94. Dow JK, deVere White RW. Fibroblast growth factor 2: its structure and property,

paracrine function, tumor angiogenesis, and prostate-related mitogenic and oncogenic

functions. Urology. 2000;55:800-6.

95. Kardami E, Murphy LJ, Liu L, Padua RR, Fandrich RR. Characterization of two

preparations of antibodies to basic fibroblast growth factor which exhibit distinct patterns

of immunolocalization. Growth Factors. 1990;4:69-80.

96. Miyake A, Konishi M, Martin FH, Hernday NA, Ozaki K, Yamamoto S, Mikami T,

Arakawa T, Itoh N. Structure and expression of a novel member, FGF-16, on the

fibroblast growth factor family. Biochem Biophys Res Commun. 1998;243:148-52.

97. Miyamoto M, Naruo K, Seko C, Matsumoto S, Kondo T, Kurokawa T. Molecular

cloning of a novel cytokine cDNA encoding the ninth member of the fibroblast growth

factor family, which has a unique secretion property. Mol Cell Biol. 1993;13:4251-9.

98. Ohmachi S, Watanabe Y, Mikami T, Kusu N, Ibi T, Akaike A, Itoh N. FGF-20, a novel

neurotrophic factor, preferentially expressed in the substantia nigra pars compacta of rat

brain. Biochem Biophys Res Commun. 2000;277:355-60.

99. Giri D, Ropiquet F, Ittmann M. FGF9 is an autocrine and paracrine prostatic growth

factor expressed by prostatic stromal cells. J Cell Physiol. 1999;180:53-60.

100. Mignatti P, Morimoto T, Rifkin DB. Basic fibroblast growth factor, a protein devoid of

secretory signal sequence, is released by cells via a pathway independent of the

endoplasmic reticulum-Golgi complex. J Cell Physiol. 1992;151:81-93.

296

101. Miyakawa K, Hatsuzawa K, Kurokawa T, Asada M, Kuroiwa T, Imamura T. A

hydrophobic region locating at the center of fibroblast growth factor-9 is crucial for its

secretion. J Biol Chem. 1999;274:29352-7.

102. Revest JM, DeMoerlooze L, Dickson C. Fibroblast growth factor 9 secretion is mediated

by a non-cleaved amino-terminal signal sequence. J Biol Chem. 2000;275:8083-90.

103. Smallwood PM, Munoz-Sanjuan I, Tong P, Macke JP, Hendry SH, Gilbert DJ, Copeland

NG, Jenkins NA, Nathans J. Fibroblast growth factor (FGF) homologous factors: new

members of the FGF family implicated in nervous system development. Proc Natl Acad

Sci U S A. 1996;93:9850-7.

104. Yamamoto S, Mikami T, Ohbayashi N, Ohta M, Itoh N. Structure and expression of a

novel isoform of mouse FGF homologous factor (FHF)-4. Biochim Biophys Acta.

1998;1398:38-41.

105. Munoz-Sanjuan I, Smallwood PM, Nathans J. Isoform diversity among fibroblast growth

factor homologous factors is generated by alternative promoter usage and differential

splicing. J Biol Chem. 2000;275:2589-97.

106. Wang Q, McEwen DG, Ornitz DM. Subcellular and developmental expression of

alternatively spliced forms of fibroblast growth factor 14. Mech Dev. 2000;90:283-7.

107. Murphy E, Steenbergen C. Cardioprotection in females: a role for nitric oxide and altered

gene expression. Heart Fail Rev. 2007;12:293-300.

108. Ping P, Murphy E. Role of p38 mitogen-activated protein kinases in preconditioning: a

detrimental factor or a protective kinase? Circ Res. 2000;86:921-2.

109. Chien GL, Van Winkle DM. Naloxone blockade of myocardial ischemic preconditioning

is stereoselective. J Mol Cell Cardiol. 1996;28:1895-900.

297

110. Chandra D, Choy G, Tang DG. Cytosolic accumulation of HSP60 during apoptosis with

or without apparent mitochondrial release: evidence that its pro-apoptotic or pro-survival

functions involve differential interactions with caspase-3. J Biol Chem. 2007;282:31289-

301.

111. Freshney NW, Rawlinson L, Guesdon F, Jones E, Cowley S, Hsuan J, Saklatvala J.

Interleukin-1 activates a novel protein kinase cascade that results in the phosphorylation

of Hsp27. Cell. 1994;78:1039-49.

112. Stokoe D, Engel K, Campbell DG, Cohen P, Gaestel M. Identification of MAPKAP

kinase 2 as a major enzyme responsible for the phosphorylation of the small mammalian

heat shock proteins. FEBS Lett. 1992;313:307-13.

113. Clifton AD, Young PR, Cohen P. A comparison of the substrate specificity of MAPKAP

kinase-2 and MAPKAP kinase-3 and their activation by cytokines and cellular stress.

FEBS Lett. 1996;392:209-14.

114. Xiao XH, Allen DG. Activity of the Na(+)/H(+) exchanger is critical to reperfusion

damage and preconditioning in the isolated rat heart. Cardiovasc Res. 2000;48:244-53.

115. Sato H, Miki T, Vallabhapurapu RP, Wang P, Liu GS, Cohen MV, Downey JM. The

mechanism of protection from 5 (N-ethyl-N-isopropyl)amiloride differs from that of

ischemic preconditioning in rabbit heart. Basic Res Cardiol. 1997;92:339-50.

116. Snabaitis AK, Yokoyama H, Avkiran M. Roles of mitogen-activated protein kinases and

protein kinase C in alpha(1A)-adrenoceptor-mediated stimulation of the sarcolemmal

Na(+)-H(+) exchanger. Circ Res. 2000;86:214-20.

117. Avkiran M, Yokoyama H. Adenosine A(1) receptor stimulation inhibits alpha(1)-

adrenergic activation of the cardiac sarcolemmal Na(+)/H(+) exchanger. Br J Pharmacol.

2000;131:659-62.

298

118. Gumina RJ, Mizumura T, Beier N, Schelling P, Schultz JJ, Gross GJ. A new

sodium/hydrogen exchange inhibitor, EMD 85131, limits infarct size in dogs when

administered before or after coronary artery occlusion. J Pharmacol Exp Ther.

1998;286:175-83.

119. Baines CP, Wang L, Cohen MV, Downey JM. Protein tyrosine kinase is downstream of

protein kinase C for ischemic preconditioning's anti-infarct effect in the rabbit heart. J

Mol Cell Cardiol. 1998;30:383-92.

120. Vahlhaus C, Schulz R, Post H, Rose J, Heusch G. Prevention of ischemic preconditioning

only by combined inhibition of protein kinase C and protein tyrosine kinase in pigs. J

Mol Cell Cardiol. 1998;30:197-209.

121. Kitakaze M, Node K, Asanuma H, Takashima S, Sakata Y, Asakura M, Sanada S,

Shinozaki Y, Mori H, Kuzuya T, Hori M. Protein tyrosine kinase is not involved in the

infarct size-limiting effect of ischemic preconditioning in canine hearts. Circ Res.

2000;87:303-8.

122. Gospodarowicz D. Purification of a fibroblast growth factor from bovine pituitary. J Biol

Chem. 1975;250:2515-20.

123. Gospodarowicz D, Neufeld G, Schweigerer L. Molecular and biological characterization

of fibroblast growth factor, an angiogenic factor which also controls the proliferation and

differentiation of mesoderm and neuroectoderm derived cells. Cell Differ. 1986;19:1-17.

124. Gospodarowicz D, Neufeld G, Schweigerer L. Fibroblast growth factor: structural and

biological properties. J Cell Physiol Suppl. 1987;Suppl 5:15-26.

125. Baird A, Ueno N, Esch F, Ling N. Distribution of fibroblast growth factors (FGFs) in

tissues and structure-function studies with synthetic fragments of basic FGF. J Cell

Physiol Suppl. 1987;Suppl 5:101-6.

299

126. Galdemard C, Brison O, Lavialle C. The proto-oncogene FGF-3 is constitutively

expressed in tumorigenic, but not in non-tumorigenic, clones of a human colon carcinoma

cell line. Oncogene. 1995;10:2331-42.

127. Bocci G, Danesi R, Benelli U, Innocenti F, Di Paolo A, Fogli S, Del Tacca M. Inhibitory

effect of suramin in rat models of angiogenesis in vitro and in vivo. Cancer Chemother

Pharmacol. 1999;43:205-12.

128. Fuhrmann V, Kinkl N, Leveillard T, Sahel J, Hicks D. Fibroblast growth factor receptor 4

(FGFR4) is expressed in adult rat and human retinal photoreceptors and neurons. J Mol

Neurosci. 1999;13:187-97.

129. Kornmann M, Ishiwata T, Beger HG, Korc M. Fibroblast growth factor-5 stimulates

mitogenic signaling and is overexpressed in human pancreatic cancer: evidence for

autocrine and paracrine actions. Oncogene. 1997;15:1417-24.

130. Asada M, Yoneda A, Oda Y, Ota K, Ozawa K, Fukuta K, Omae F, Asanagi M, Orikasa N,

Suzuki M, Oka S, Makino T, Imamura T. Characterization of fibroblast growth factor-6

expressed by Chinese hamster ovary cells as a glycosylated mitogen for human vascular

endothelial cells. Growth Factors. 1999;16:293-303.

131. Michelson PH, Tigue M, Panos RJ, Sporn PH. Keratinocyte growth factor stimulates

bronchial epithelial cell proliferation in vitro and in vivo. Am J Physiol. 1999;277:L737-

42.

132. Tichelaar JW, Lu W, Whitsett JA. Conditional expression of fibroblast growth factor-7 in

the developing and mature lung. J Biol Chem. 2000;275:11858-64.

133. Graeff RW, Wang G, McCray PB, Jr. KGF and FGF-10 stimulate liquid secretion in

human fetal lung. Pediatr Res. 1999;46:523-9.

300

134. Valve E, Penttila TL, Paranko J, Harkonen P. FGF-8 is expressed during specific phases

of rodent oocyte and spermatogonium development. Biochem Biophys Res Commun.

1997;232:173-7.

135. Emoto H, Tagashira S, Mattei MG, Yamasaki M, Hashimoto G, Katsumata T, Negoro T,

Nakatsuka M, Birnbaum D, Coulier F, Itoh N. Structure and expression of human

fibroblast growth factor-10. J Biol Chem. 1997;272:23191-4.

136. Yamamoto S, Mikami T, Konishi M, Itoh N. Stage-specific expression of a novel isoform

of mouse FGF-14 (FHF-4) in spermatocytes. Biochim Biophys Acta. 2000;1490:121-4.

137. McWhirter JR, Goulding M, Weiner JA, Chun J, Murre C. A novel fibroblast growth

factor gene expressed in the developing nervous system is a downstream target of the

chimeric homeodomain oncoprotein E2A-Pbx1. Development. 1997;124:3221-32.

138. Nishimura T, Utsunomiya Y, Hoshikawa M, Ohuchi H, Itoh N. Structure and expression

of a novel human FGF, FGF-19, expressed in the fetal brain. Biochim Biophys Acta.

1999;1444:148-51.

139. Konishi M, Mikami T, Yamasaki M, Miyake A, Itoh N. Fibroblast growth factor-16 is a

growth factor for embryonic brown adipocytes. J Biol Chem. 2000;275:12119-22.

140. Xu J, Lawshe A, MacArthur CA, Ornitz DM. Genomic structure, mapping, activity and

expression of fibroblast growth factor 17. Mech Dev. 1999;83:165-78.

141. Hu MC, Qiu WR, Wang YP, Hill D, Ring BD, Scully S, Bolon B, DeRose M, Luethy R,

Simonet WS, Arakawa T, Danilenko DM. FGF-18, a novel member of the fibroblast

growth factor family, stimulates hepatic and intestinal proliferation. Mol Cell Biol.

1998;18:6063-74.

301

142. Hajihosseini MK, Heath JK. Expression patterns of fibroblast growth factors-18 and -20

in mouse embryos is suggestive of novel roles in calvarial and limb development. Mech

Dev. 2002;113:79-83.

143. Nishimura T, Nakatake Y, Konishi M, Itoh N. Identification of a novel FGF, FGF-21,

preferentially expressed in the liver. Biochim Biophys Acta. 2000;1492:203-6.

144. Cote MF, Laroche G, Gagnon E, Chevallier P, Doillon CJ. Denatured collagen as support

for a FGF-2 delivery system: physicochemical characterizations and in vitro release

kinetics and bioactivity. Biomaterials. 2004;25:3761-72.

145. Gospodarowicz D, Ferrara N, Schweigerer L, Neufeld G. Structural characterization and

biological functions of fibroblast growth factor. Endocr Rev. 1987;8:95-114.

146. Shibata F, Baird A, Florkiewicz RZ. Functional characterization of the human basic

fibroblast growth factor gene promoter. Growth Factors. 1991;4:277-87.

147. Murphy PR, Knee RS. Identification and characterization of an antisense RNA transcript

(gfg) from the human basic fibroblast growth factor gene. Mol Endocrinol. 1994;8:852-9.

148. Murphy PR, Sato Y, Sato R, Friesen HG. Regulation of multiple basic fibroblast growth

factor messenger ribonucleic acid transcripts by protein kinase C activators. Mol

Endocrinol. 1988;2:1196-201.

149. Knee R, Li AW, Murphy PR. Characterization and tissue-specific expression of the rat

basic fibroblast growth factor antisense mRNA and protein. Proc Natl Acad Sci U S A.

1997;94:4943-7.

150. Kimelman D, Kirschner MW. An antisense mRNA directs the covalent modification of

the transcript encoding fibroblast growth factor in Xenopus oocytes. Cell. 1989;59:687-

96.

302

151. Zuniga Mejia Borja A, Meijers C, Zeller R. Expression of alternatively spliced bFGF first

coding exons and antisense mRNAs during chicken embryogenesis. Dev Biol.

1993;157:110-8.

152. Koonin EV. A highly conserved sequence motif defining the family of MutT-related

proteins from eubacteria, eukaryotes and viruses. Nucleic Acids Res. 1993;21:4847.

153. Sommer A, Brewer MT, Thompson RC, Moscatelli D, Presta M, Rifkin DB. A form of

human basic fibroblast growth factor with an extended amino terminus. Biochem Biophys

Res Commun. 1987;144:543-50.

154. Doble BW, Fandrich RR, Liu L, Padua RR, Kardami E. Calcium protects pituitary basic

fibroblast growth factors from limited proteolysis by co-purifying proteases. Biochem

Biophys Res Commun. 1990;173:1116-22.

155. Powell PP, Klagsbrun M. Three forms of rat basic fibroblast growth factor are made from

a single mRNA and localize to the nucleus. J Cell Physiol. 1991;148:202-10.

156. Dono R, Zeller R. Cell-type-specific nuclear translocation of fibroblast growth factor-2

isoforms during chicken kidney and limb morphogenesis. Dev Biol. 1994;163:316-30.

157. Liu X, McFarland DC, Nestor KE, Velleman SG. Expression of fibroblast growth factor

2 and its receptor during skeletal muscle development from turkeys with different growth

rates. Domest Anim Endocrinol. 2003;25:215-29.

158. Holz DR, Helm J, Zhang YD, Rothschild MF. Rapid communication: linkage and

physical mapping of the porcine basic fibroblast growth factor (FGF2) gene. J Anim Sci.

2002;80:1384-5.

159. Dirks RP, Potter SJ, Griep AE. Novel fibroblast growth factor 2 transcripts are expressed

in mouse embryos. Biochem Biophys Res Commun. 2001;287:900-9.

303

160. Zhou M. Role of fibroblast growth factor-2 in cardiovascular development and function.

Dissertation, University of Cincinnati. 1997.

161. Foletti A, Ackermann J, Schmidt A, Hummler E, Beermann F. Absence of fibroblast

growth factor 2 does not prevent tumor formation originating from the RPE. Oncogene.

2002;21:1841-7.

162. Dono R, Texido G, Dussel R, Ehmke H, Zeller R. Impaired cerebral cortex development

and blood pressure regulation in FGF-2-deficient mice. Embo J. 1998;17:4213-25.

163. Schultz JE, Witt SA, Nieman ML, Reiser PJ, Engle SJ, Zhou M, Pawlowski SA, Lorenz

JN, Kimball TR, Doetschman T. Fibroblast growth factor-2 mediates pressure-induced

hypertrophic response. J Clin Invest. 1999;104:709-19.

164. Pellieux C, Foletti A, Peduto G, Aubert JF, Nussberger J, Beermann F, Brunner HR,

Pedrazzini T. Dilated cardiomyopathy and impaired cardiac hypertrophic response to

angiotensin II in mice lacking FGF-2. J Clin Invest. 2001;108:1843-51.

165. Arnaud E, Touriol C, Boutonnet C, Gensac MC, Vagner S, Prats H, Prats AC. A new 34-

kilodalton isoform of human fibroblast growth factor 2 is cap dependently synthesized by

using a non-AUG start codon and behaves as a survival factor. Mol Cell Biol.

1999;19:505-14.

166. Arese M, Chen Y, Florkiewicz RZ, Gualandris A, Shen B, Rifkin DB. Nuclear activities

of basic fibroblast growth factor: potentiation of low-serum growth mediated by natural

or chimeric nuclear localization signals. Mol Biol Cell. 1999;10:1429-44.

167. Eriksson AE, Cousens LS, Weaver LH, Matthews BW. Three-dimensional structure of

human basic fibroblast growth factor. Proc Natl Acad Sci U S A. 1991;88:3441-5.

304

168. Zhu X, Komiya H, Chirino A, Faham S, Fox GM, Arakawa T, Hsu BT, Rees DC. Three-

dimensional structures of acidic and basic fibroblast growth factors. Science.

1991;251:90-3.

169. Moy FJ, Seddon AP, Bohlen P, Powers R. High-resolution solution structure of basic

fibroblast growth factor determined by multidimensional heteronuclear magnetic

resonance spectroscopy. Biochemistry. 1996;35:13552-61.

170. Feige JJ, Baird A. Basic fibroblast growth factor is a substrate for protein

phosphorylation and is phosphorylated by capillary endothelial cells in culture. Proc Natl

Acad Sci U S A. 1989;86:3174-8.

171. Plouet J, Mascarelli F, Loret MD, Faure JP, Courtois Y. Regulation of eye derived

growth factor binding to membranes by light, ATP or GTP in photoreceptor outer

segments. Embo J. 1988;7:373-6.

172. Thompson SA. The disulfide structure of bovine pituitary basic fibroblast growth factor.

J Biol Chem. 1992;267:2269-73.

173. Presta M, Rusnati M, Urbinati C, Sommer A, Ragnotti G. Biologically active synthetic

fragments of human basic fibroblast growth factor (bFGF): identification of two Asp-

Gly-Arg-containing domains involved in the mitogenic activity of bFGF in endothelial

cells. J Cell Physiol. 1991;149:512-24.

174. Hebert JM, Basilico C, Goldfarb M, Haub O, Martin GR. Isolation of cDNAs encoding

four mouse FGF family members and characterization of their expression patterns during

embryogenesis. Dev Biol. 1990;138:454-63.

175. Cordon-Cardo C, Vlodavsky I, Haimovitz-Friedman A, Hicklin D, Fuks Z. Expression of

basic fibroblast growth factor in normal human tissues. Lab Invest. 1990;63:832-40.

305

176. Giordano S, Sherman L, Morrison R. Multiple molecular weight forms of basic fibroblast

growth factor are developmentally regulated in the rat central nervous system. Ann N Y

Acad Sci. 1991;638:420-3.

177. Liu L, Doble BW, Kardami E. Perinatal phenotype and hypothyroidism are associated

with elevated levels of 21.5- to 22-kDa basic fibroblast growth factor in cardiac ventricles.

Dev Biol. 1993;157:507-16.

178. Kamiguchi H, Yoshida K, Wakamoto H, Inaba M, Sasaki H, Otani M, Toya S. Cytokine-

induced selective increase of high-molecular-weight bFGF isoforms and their subcellular

kinetics in cultured rat hippocampal astrocytes. Neurochem Res. 1996;21:701-6.

179. Bugler B, Amalric F, Prats H. Alternative initiation of translation determines cytoplasmic

or nuclear localization of basic fibroblast growth factor. Mol Cell Biol. 1991;11:573-7.

180. Quarto N, Finger FP, Rifkin DB. The NH2-terminal extension of high molecular weight

bFGF is a nuclear targeting signal. J Cell Physiol. 1991;147:311-8.

181. Dono R, James D, Zeller R. A GR-motif functions in nuclear accumulation of the large

FGF-2 isoforms and interferes with mitogenic signalling. Oncogene. 1998;16:2151-8.

182. Sorensen V, Nilsen T, Wiedlocha A. Functional diversity of FGF-2 isoforms by

intracellular sorting. Bioessays. 2006;28:504-14.

183. Renko M, Quarto N, Morimoto T, Rifkin DB. Nuclear and cytoplasmic localization of

different basic fibroblast growth factor species. J Cell Physiol. 1990;144:108-14.

184. Claus P, Doring F, Gringel S, Muller-Ostermeyer F, Fuhlrott J, Kraft T, Grothe C.

Differential intranuclear localization of fibroblast growth factor-2 isoforms and specific

interaction with the survival of motoneuron protein. J Biol Chem. 2003;278:479-85.

185. Sheng Z, Lewis JA, Chirico WJ. Nuclear and nucleolar localization of 18-kDa fibroblast

growth factor-2 is controlled by C-terminal signals. J Biol Chem. 2004;279:40153-60.

306

186. Bouche G, Baldin V, Belenguer P, Prats H, Amalric F. Activation of rDNA transcription

by FGF-2: key role of protein kinase CKII. Cell Mol Biol Res. 1994;40:547-54.

187. Hsia E, Richardson TP, Nugent MA. Nuclear localization of basic fibroblast growth

factor is mediated by heparan sulfate proteoglycans through protein kinase C signaling. J

Cell Biochem. 2003;88:1214-25.

188. Choi J, Ko MK, Kay EP. Subcellular localization of the expressed 18 kDa FGF-2 isoform

in corneal endothelial cells. Mol Vis. 2000;6:222-31.

189. Taverna S, Ghersi G, Ginestra A, Rigogliuso S, Pecorella S, Alaimo G, Saladino F, Dolo

V, Dell'Era P, Pavan A, Pizzolanti G, Mignatti P, Presta M, Vittorelli ML. Shedding of

membrane vesicles mediates fibroblast growth factor-2 release from cells. J Biol Chem.

2003;278:51911-9.

190. Abraham JA, Whang JL, Tumolo A, Mergia A, Friedman J, Gospodarowicz D, Fiddes JC.

Human basic fibroblast growth factor: nucleotide sequence and genomic organization.

Embo J. 1986;5:2523-8.

191. Jaye M, Howk R, Burgess W, Ricca GA, Chiu IM, Ravera MW, O'Brien SJ, Modi WS,

Maciag T, Drohan WN. Human endothelial cell growth factor: cloning, nucleotide

sequence, and chromosome localization. Science. 1986;233:541-5.

192. Walter P, Gilmore R, Blobel G. Protein translocation across the endoplasmic reticulum.

Cell. 1984;38:5-8.

193. Mellman I, Warren G. The road taken: past and future foundations of membrane traffic.

Cell. 2000;100:99-112.

194. Rothman JE, Wieland FT. Protein sorting by transport vesicles. Science. 1996;272:227-

34.

307

195. Cooper DN, Barondes SH. Evidence for export of a muscle lectin from cytosol to

extracellular matrix and for a novel secretory mechanism. J Cell Biol. 1990;110:1681-91.

196. Folkman J, Klagsbrun M, Sasse J, Wadzinski M, Ingber D, Vlodavsky I. A heparin-

binding angiogenic protein--basic fibroblast growth factor--is stored within basement

membrane. Am J Pathol. 1988;130:393-400.

197. Kessler DA, Langer RS, Pless NA, Folkman J. Mast cells and tumor angiogenesis. Int J

Cancer. 1976;18:703-9.

198. Thompson RW, Whalen GF, Saunders KB, Hores T, D'Amore PA. Heparin-mediated

release of fibroblast growth factor-like activity into the circulation of rabbits. Growth

Factors. 1990;3:221-9.

199. Gajdusek CM, Carbon S. Injury-induced release of basic fibroblast growth factor from

bovine aortic endothelium. J Cell Physiol. 1989;139:570-9.

200. Witte L, Fuks Z, Haimovitz-Friedman A, Vlodavsky I, Goodman DS, Eldor A. Effects of

irradiation on the release of growth factors from cultured bovine, porcine, and human

endothelial cells. Cancer Res. 1989;49:5066-72.

201. McNeil PL, Ito S. Gastrointestinal cell plasma membrane wounding and resealing in vivo.

Gastroenterology. 1989;96:1238-48.

202. Schafer T, Zentgraf H, Zehe C, Brugger B, Bernhagen J, Nickel W. Unconventional

secretion of fibroblast growth factor 2 is mediated by direct translocation across the

plasma membrane of mammalian cells. J Biol Chem. 2004;279:6244-51.

203. Florkiewicz RZ, Anchin J, Baird A. The inhibition of fibroblast growth factor-2 export by

cardenolides implies a novel function for the catalytic subunit of Na+,K+-ATPase. J Biol

Chem. 1998;273:544-51.

308

204. Zehe C, Engling A, Wegehingel S, Schafer T, Nickel W. Cell-surface heparan sulfate

proteoglycans are essential components of the unconventional export machinery of FGF-

2. Proc Natl Acad Sci U S A. 2006;103:15479-84.

205. Fujita M, Ikemoto M, Kishishita M, Otani H, Nohara R, Tanaka T, Tamaki S, Yamazato

A, Sasayama S. Elevated basic fibroblast growth factor in pericardial fluid of patients

with unstable angina. Circulation. 1996;94:610-3.

206. Cuevas P, Barrios V, Gimenez-Gallego G, Martinez-Coso V, Cuevas B, Benavides J,

Garcia-Segovia J, Asin-Cardiel E. Serum levels of basic fibroblast growth factor in acute

myocardial infarction. Eur J Med Res. 1997;2:282-4.

207. Hasdai D, Barak V, Leibovitz E, Herz I, Sclarovsky S, Eldar M, Scheinowitz M. Serum

basic fibroblast growth factor levels in patients with ischemic heart disease. Int J Cardiol.

1997;59:133-8.

208. Prudovsky I, Bagala C, Tarantini F, Mandinova A, Soldi R, Bellum S, Maciag T. The

intracellular translocation of the components of the fibroblast growth factor 1 release

complex precedes their assembly prior to export. J Cell Biol. 2002;158:201-8.

209. Powers CJ, McLeskey SW, Wellstein A. Fibroblast growth factors, their receptors and

signaling. Endocr Relat Cancer. 2000;7:165-97.

210. Bernfield M, Gotte M, Park PW, Reizes O, Fitzgerald ML, Lincecum J, Zako M.

Functions of cell surface heparan sulfate proteoglycans. Annu Rev Biochem.

1999;68:729-77.

211. Esko JD, Selleck SB. Order out of chaos: assembly of ligand binding sites in heparan

sulfate. Annu Rev Biochem. 2002;71:435-71.

212. Iozzo RV. Heparan sulfate proteoglycans: intricate molecules with intriguing functions. J

Clin Invest. 2001;108:165-7.

309

213. Rosenberg RD, Shworak NW, Liu J, Schwartz JJ, Zhang L. Heparan sulfate

proteoglycans of the cardiovascular system. Specific structures emerge but how is

synthesis regulated? J Clin Invest. 1997;99:2062-70.

214. Rosenberg RD, Damus PS. The purification and mechanism of action of human

antithrombin-heparin cofactor. J Biol Chem. 1973;248:6490-505.

215. Cheng CF, Oosta GM, Bensadoun A, Rosenberg RD. Binding of lipoprotein lipase to

endothelial cells in culture. J Biol Chem. 1981;256:12893-8.

216. Simons M, Horowitz A. Syndecan-4-mediated signalling. Cell Signal. 2001;13:855-62.

217. Pellegrini L. Role of heparan sulfate in fibroblast growth factor signalling: a structural

view. Curr Opin Struct Biol. 2001;11:629-34.

218. McKeehan WL, Wang F, Kan M. The heparan sulfate-fibroblast growth factor family:

diversity of structure and function. Prog Nucleic Acid Res Mol Biol. 1998;59:135-76.

219. Kan M, Wang F, Xu J, Crabb JW, Hou J, McKeehan WL. An essential heparin-binding

domain in the fibroblast growth factor receptor kinase. Science. 1993;259:1918-21.

220. Detillieux KA, Sheikh F, Kardami E, Cattini PA. Biological activities of fibroblast

growth factor-2 in the adult myocardium. Cardiovasc Res. 2003;57:8-19.

221. Colin S, Jeanny JC, Mascarelli F, Vienet R, Al-Mahmood S, Courtois Y, Labarre J. In

vivo involvement of heparan sulfate proteoglycan in the bioavailability, internalization,

and catabolism of exogenous basic fibroblast growth factor. Mol Pharmacol. 1999;55:74-

82.

222. Johnson DE, Lee PL, Lu J, Williams LT. Diverse forms of a receptor for acidic and basic

fibroblast growth factors. Mol Cell Biol. 1990;10:4728-36.

310

223. Werner S, Duan DS, de Vries C, Peters KG, Johnson DE, Williams LT. Differential

splicing in the extracellular region of fibroblast growth factor receptor 1 generates

receptor variants with different ligand- binding specificities. Mol Cell Biol. 1992;12:82-8.

224. Duan DS, Werner S, Williams LT. A naturally occurring secreted form of fibroblast

growth factor (FGF) receptor 1 binds basic FGF in preference over acidic FGF. J Biol

Chem. 1992;267:16076-80.

225. Hughes SE. Differential expression of the fibroblast growth factor receptor (FGFR)

multigene family in normal human adult tissues. J Histochem Cytochem. 1997;45:1005-

19.

226. Cool SM, Sayer RE, van Heumen WR, Pickles JO, Nurcombe V. Temporal and spatial

expression of fibroblast growth factor receptor 4 isoforms in murine tissues. Histochem J.

2002;34:291-7.

227. Mima T, Ueno H, Fischman DA, Williams LT, Mikawa T. Fibroblast growth factor

receptor is required for in vivo cardiac myocyte proliferation at early embryonic stages of

heart development. Proc Natl Acad Sci U S A. 1995;92:467-71.

228. Liu L, Pasumarthi KB, Padua RR, Massaeli H, Fandrich RR, Pierce GN, Cattini PA,

Kardami E. Adult cardiomyocytes express functional high-affinity receptors for basic

fibroblast growth factor. Am J Physiol. 1995;268:H1927-38.

229. Jiang ZS, Padua RR, Ju H, Doble BW, Jin Y, Hao J, Cattini PA, Dixon IM, Kardami E.

Acute protection of ischemic heart by FGF-2: involvement of FGF-2 receptors and

protein kinase C. Am J Physiol Heart Circ Physiol. 2002;282:H1071-80.

230. Muinck ED, Nagy N, Tirziu D, Murakami M, Gurusamy N, Goswami SK, Ghatpande S,

Engelman RM, Simons M, Das DK. Protection against myocardial ischemia-reperfusion

311

injury by the angiogenic Masterswitch protein PR 39 gene therapy: the roles of

HIF1alpha stabilization and FGFR1 signaling. Antioxid Redox Signal. 2007;9:437-45.

231. Fujisawa H, Koide N, Kono T, Takayama K, Tsukioka K, Wada Y, Zhang T, Kitahara H,

Nakano H, Suzuki JI, Isobe M, Amano J. Expression of basic fibroblast growth factor and

its receptor-1 in cardiac myxoma. J Cardiovasc Surg (Torino). 2002;43:589-94.

232. Sheikh F, Fandrich RR, Kardami E, Cattini PA. Overexpression of long or short FGFR-1

results in FGF-2-mediated proliferation in neonatal cardiac myocyte cultures. Cardiovasc

Res. 1999;42:696-705.

233. Pennisi DJ, Ballard VL, Mikawa T. Epicardium is required for the full rate of myocyte

proliferation and levels of expression of myocyte mitogenic factors FGF2 and its receptor,

FGFR-1, but not for transmural myocardial patterning in the embryonic chick heart. Dev

Dyn. 2003;228:161-72.

234. Ornitz DM, Xu J, Colvin JS, McEwen DG, MacArthur CA, Coulier F, Gao G, Goldfarb

M. Receptor specificity of the fibroblast growth factor family. J Biol Chem.

1996;271:15292-7.

235. Ozawa F, Friess H, Tempia-Caliera A, Kleeff J, Buchler MW. Growth factors and their

receptors in pancreatic cancer. Teratog Carcinog Mutagen. 2001;21:27-44.

236. Segev A, Aviezer D, Safran M, Gross Z, Yayon A. Inhibition of vascular smooth muscle

cell proliferation by a novel fibroblast growth factor receptor antagonist. Cardiovasc Res.

2002;53:232-41.

237. Burgess WH, Dionne CA, Kaplow J, Mudd R, Friesel R, Zilberstein A, Schlessinger J,

Jaye M. Characterization and cDNA cloning of phospholipase C-gamma, a major

substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated

tyrosine kinase. Mol Cell Biol. 1990;10:4770-7.

312

238. Klint P, Kanda S, Claesson-Welsh L. Shc and a novel 89-kDa component couple to the

Grb2-Sos complex in fibroblast growth factor-2-stimulated cells. J Biol Chem.

1995;270:23337-44.

239. Larsson H, Klint P, Landgren E, Claesson-Welsh L. Fibroblast growth factor receptor-1-

mediated endothelial cell proliferation is dependent on the Src homology (SH) 2/SH3

domain-containing adaptor protein Crk. J Biol Chem. 1999;274:25726-34.

240. Anderson D, Koch CA, Grey L, Ellis C, Moran MF, Pawson T. Binding of SH2 domains

of phospholipase C gamma 1, GAP, and Src to activated growth factor receptors. Science.

1990;250:979-82.

241. Musacchio A, Gibson T, Lehto VP, Saraste M. SH3--an abundant protein domain in

search of a function. FEBS Lett. 1992;307:55-61.

242. Bonni A, Brunet A, West AE, Datta SR, Takasu MA, Greenberg ME. Cell survival

promoted by the Ras-MAPK signaling pathway by transcription-dependent and -

independent mechanisms. Science. 1999;286:1358-62.

243. Friesel RE, Maciag T. Molecular mechanisms of angiogenesis: fibroblast growth factor

signal transduction. Faseb J. 1995;9:919-25.

244. Berridge MJ. Cell signalling. A tale of two messengers. Nature. 1993;365:388-9.

245. Kouhara H, Hadari YR, Spivak-Kroizman T, Schilling J, Bar-Sagi D, Lax I, Schlessinger

J. A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the

Ras/MAPK signaling pathway. Cell. 1997;89:693-702.

246. Cross MJ, Lu L, Magnusson P, Nyqvist D, Holmqvist K, Welsh M, Claesson-Welsh L.

The Shb adaptor protein binds to tyrosine 766 in the FGFR-1 and regulates the

Ras/MEK/MAPK pathway via FRS2 phosphorylation in endothelial cells. Mol Biol Cell.

2002;13:2881-93.

313

247. van Weering DH, de Rooij J, Marte B, Downward J, Bos JL, Burgering BM. Protein

kinase B activation and lamellipodium formation are independent phosphoinositide 3-

kinase-mediated events differentially regulated by endogenous Ras. Mol Cell Biol.

1998;18:1802-11.

248. Jin L, Hu X, Feng L. NT3 inhibits FGF2-induced neural progenitor cell proliferation via

the PI3K/GSK3 pathway. J Neurochem. 2005;93:1251-61.

249. Gospodarowicz D. Biological activities of fibroblast growth factors. Ann N Y Acad Sci.

1991;638:1-8.

250. Risau W, Sariola H, Zerwes HG, Sasse J, Ekblom P, Kemler R, Doetschman T.

Vasculogenesis and angiogenesis in embryonic-stem-cell-derived embryoid bodies.

Development. 1988;102:471-8.

251. Coffin JD, Poole TJ. Embryonic vascular development: immunohistochemical

identification of the origin and subsequent morphogenesis of the major vessel primordia

in quail embryos. Development. 1988;102:735-48.

252. Klagsbrun M, D'Amore PA. Regulators of angiogenesis. Annu Rev Physiol. 1991;53:217-

39.

253. Moscatelli D, Presta M, Rifkin DB. Purification of a factor from human placenta that

stimulates capillary endothelial cell protease production, DNA synthesis, and migration.

Proc Natl Acad Sci U S A. 1986;83:2091-5.

254. Montesano R, Vassalli JD, Baird A, Guillemin R, Orci L. Basic fibroblast growth factor

induces angiogenesis in vitro. Proc Natl Acad Sci U S A. 1986;83:7297-301.

255. Mignatti P, Rifkin DB. Biology and biochemistry of proteinases in tumor invasion.

Physiol Rev. 1993;73:161-95.

314

256. Klein S, Giancotti FG, Presta M, Albelda SM, Buck CA, Rifkin DB. Basic fibroblast

growth factor modulates integrin expression in microvascular endothelial cells. Mol Biol

Cell. 1993;4:973-82.

257. Li VW, Folkerth RD, Watanabe H, Yu C, Rupnick M, Barnes P, Scott RM, Black PM,

Sallan SE, Folkman J. Microvessel count and cerebrospinal fluid basic fibroblast growth

factor in children with brain tumours. Lancet. 1994;344:82-6.

258. Kwabi-Addo B, Ozen M, Ittmann M. The role of fibroblast growth factors and their

receptors in prostate cancer. Endocr Relat Cancer. 2004;11:709-24.

259. Atiqur Rahman M, Toi M. Anti-angiogenic therapy in breast cancer. Biomed

Pharmacother. 2003;57:463-70.

260. Nguyen M, Watanabe H, Budson AE, Richie JP, Hayes DF, Folkman J. Elevated levels

of an angiogenic peptide, basic fibroblast growth factor, in the urine of patients with a

wide spectrum of cancers. J Natl Cancer Inst. 1994;86:356-61.

261. Meyer-Ingold W. Wound therapy: growth factors as agents to promote healing. Trends

Biotechnol. 1993;11:387-92.

262. Bouten DBaC. New Tissue Repair Strategies. Pressure Ulcer Research, Springer Berlin

Heidelberg. 2005.

263. Grazul-Bilska AT, Johnson ML, Bilski JJ, Redmer DA, Reynolds LP, Abdullah A,

Abdullah KM. Wound healing: the role of growth factors. Drugs Today (Barc).

2003;39:787-800.

264. Bennett NT, Schultz GS. Growth factors and wound healing: biochemical properties of

growth factors and their receptors. Am J Surg. 1993;165:728-37.

315

265. Broadley KN, Aquino AM, Woodward SC, Buckley-Sturrock A, Sato Y, Rifkin DB,

Davidson JM. Monospecific antibodies implicate basic fibroblast growth factor in normal

wound repair. Lab Invest. 1989;61:571-5.

266. Tsuboi R, Rifkin DB. Recombinant basic fibroblast growth factor stimulates wound

healing in healing-impaired db/db mice. J Exp Med. 1990;172:245-51.

267. Bikfalvi A, Klein S, Pintucci G, Quarto N, Mignatti P, Rifkin DB. Differential

modulation of cell phenotype by different molecular weight forms of basic fibroblast

growth factor: possible intracellular signaling by the high molecular weight forms. J Cell

Biol. 1995;129:233-43.

268. Allouche M, Bikfalvi A. The role of fibroblast growth factor-2 (FGF-2) in hematopoiesis.

Prog Growth Factor Res. 1995;6:35-48.

269. Gabbianelli M, Sargiacomo M, Pelosi E, Testa U, Isacchi G, Peschle C. "Pure" human

hematopoietic progenitors: permissive action of basic fibroblast growth factor. Science.

1990;249:1561-4.

270. Wilson EL, Rifkin DB, Kelly F, Hannocks MJ, Gabrilove JL. Basic fibroblast growth

factor stimulates myelopoiesis in long-term human bone marrow cultures. Blood.

1991;77:954-60.

271. Gabrilove JL, Wong G, Bollenbacher E, White K, Kojima S, Wilson EL. Basic fibroblast

growth factor counteracts the suppressive effect of transforming growth factor-beta 1 on

human myeloid progenitor cells. Blood. 1993;81:909-15.

272. Gabrilove JL, White K, Rahman Z, Wilson EL. Stem cell factor and basic fibroblast

growth factor are synergistic in augmenting committed myeloid progenitor cell growth.

Blood. 1994;83:907-10.

316

273. Williams GT, Smith CA, Spooncer E, Dexter TM, Taylor DR. Haemopoietic colony

stimulating factors promote cell survival by suppressing apoptosis. Nature. 1990;343:76-

274. Le Bousse-Kerdiles MC, Chevillard S, Charpentier A, Romquin N, Clay D, Smadja-Joffe

F, Praloran V, Dupriez B, Demory JL, Jasmin C, Martyre MC. Differential expression of

transforming growth factor-beta, basic fibroblast growth factor, and their receptors in

CD34+ hematopoietic progenitor cells from patients with myelofibrosis and myeloid

metaplasia. Blood. 1996;88:4534-46.

275. Nakayama T, Mutsuga N, Tosato G. Effect of fibroblast growth factor 2 on stromal cell-

derived factor 1 production by bone marrow stromal cells and hematopoiesis. J Natl

Cancer Inst. 2007;99:223-35.

276. Allouche M, Bayard F, Clamens S, Fillola G, Sie P, Amalric F. Expression of basic

fibroblast growth factor (bFGF) and FGF-receptors in human leukemic cells. Leukemia.

1995;9:77-86.

277. Davies DE, Wicks J, Powell RM, Puddicombe SM, Holgate ST. Airway remodeling in

asthma: new insights. J Allergy Clin Immunol. 2003;111:215-25; quiz 226.

278. Han RN, Liu J, Tanswell AK, Post M. Expression of basic fibroblast growth factor and

receptor: immunolocalization studies in developing rat fetal lung. Pediatr Res.

1992;31:435-40.

279. Ledoux D, Mereau A, Jaye M, Miskulin M, Barritault D, Courty J. Adult brain but not

kidney, liver, lung, intestine, and stomach membrane preparations contain detectable

amounts of high-affinity receptors to acidic and basic growth factors. Ann N Y Acad Sci.

1991;638:397-9.

317

280. Brettell LM, McGowan SE. Basic fibroblast growth factor decreases elastin production

by neonatal rat lung fibroblasts. Am J Respir Cell Mol Biol. 1994;10:306-15.

281. Fuks Z, Persaud RS, Alfieri A, McLoughlin M, Ehleiter D, Schwartz JL, Seddon AP,

Cordon-Cardo C, Haimovitz-Friedman A. Basic fibroblast growth factor protects

endothelial cells against radiation-induced programmed cell death in vitro and in vivo.

Cancer Res. 1994;54:2582-90.

282. Tee PG, Travis EL. Basic fibroblast growth factor does not protect against classical

radiation pneumonitis in two strains of mice. Cancer Res. 1995;55:298-302.

283. Henke C, Marineili W, Jessurun J, Fox J, Harms D, Peterson M, Chiang L, Doran P.

Macrophage production of basic fibroblast growth factor in the fibroproliferative disorder

of alveolar fibrosis after lung injury. Am J Pathol. 1993;143:1189-99.

284. Goldsmith KT, Gammon RB, Garver RI, Jr. Modulation of bFGF in lung fibroblasts by

TGF-beta and PDGF. Am J Physiol. 1991;261:L378-85.

285. Jeon SG, Lee CG, Oh MH, Chun EY, Gho YS, Cho SH, Kim JH, Min KU, Kim YY,

Kim YK, Elias JA. Recombinant basic fibroblast growth factor inhibits the airway

hyperresponsiveness, mucus production, and lung inflammation induced by an allergen

challenge. J Allergy Clin Immunol. 2007;119:831-7.

286. Funakoshi Y, Matsuda S, Uryu K, Fujita H, Okumura N, Sakanaka M. An

immunohistochemical study of basic fibroblast growth factor in the developing chick.

Anat Embryol (Berl). 1993;187:415-23.

287. Weise B, Janet T, Grothe C. Localization of bFGF and FGF-receptor in the developing

nervous system of the embryonic and newborn rat. J Neurosci Res. 1993;34:442-53.

288. Meisinger C, Grothe C. Differential expression of FGF-2 isoforms in the rat adrenal

medulla during postnatal development in vivo. Brain Res. 1997;757:291-4.

318

289. Henning SJ. Plasma concentrations of total and free corticosterone during development in

the rat. Am J Physiol. 1978;235:E451-6.

290. Grothe C, Haastert K, Jungnickel J. Physiological function and putative therapeutic

impact of the FGF-2 system in peripheral nerve regeneration--lessons from in vivo

studies in mice and rats. Brain Res Rev. 2006;51:293-9.

291. Unsicker K, Engels S, Hamm C, Ludecke G, Meier C, Renzing J, Terbrack HG, Flanders

K. Molecular control of neural plasticity by the multifunctional growth factor families of

the FGFs and TGF-beta s. Ann Anat. 1992;174:405-7.

292. Unsicker K, Westermann R. Basic fibroblast growth factor promotes transmitter storage

and synthesis in cultured chromaffin cells. Brain Res Dev Brain Res. 1992;65:211-6.

293. Miyagawa T, Saito H, Nishiyama N. Branching enhancement by basic fibroblast growth

factor in cut neurite of hippocampal neurons. Neurosci Lett. 1993;153:29-31.

294. Pollock JD, Krempin M, Rudy B. Differential effects of NGF, FGF, EGF, cAMP, and

dexamethasone on neurite outgrowth and sodium channel expression in PC12 cells. J

Neurosci. 1990;10:2626-37.

295. Rane SG, Pollock JD. Fibroblast growth factor-induced increases in calcium currents in

the PC12 pheochromocytoma cell line are tyrosine phosphorylation dependent. J

Neurosci Res. 1994;38:590-8.

296. Haastert K, Lipokatic E, Fischer M, Timmer M, Grothe C. Differentially promoted

peripheral nerve regeneration by grafted Schwann cells over-expressing different FGF-2

isoforms. Neurobiol Dis. 2006;21:138-53.

297. Kardami E, Liu L, Doble BW. Basic fibroblast growth factor in cultured cardiac

myocytes. Ann N Y Acad Sci. 1991;638:244-55.

319

298. Kardami E, Fandrich RR. Basic fibroblast growth factor in atria and ventricles of the

vertebrate heart. J Cell Biol. 1989;109:1865-75.

299. Kardami E, Stoski RM, Doble BW, Yamamoto T, Hertzberg EL, Nagy JI. Biochemical

and ultrastructural evidence for the association of basic fibroblast growth factor with

cardiac gap junctions. J Biol Chem. 1991;266:19551-7.

300. Sugi Y, Sasse J, Barron M, Lough J. Developmental expression of fibroblast growth

factor receptor-1 (cek-1; flg) during heart development. Dev Dyn. 1995;202:115-25.

301. Pasumarthi KB, Kardami E, Cattini PA. High and low molecular weight fibroblast

growth factor-2 increase proliferation of neonatal rat cardiac myocytes but have

differential effects on binucleation and nuclear morphology. Evidence for both paracrine

and intracrine actions of fibroblast growth factor-2. Circ Res. 1996;78:126-36.

302. Sun G, Doble BW, Sun JM, Fandrich RR, Florkiewicz R, Kirshenbaum L, Davie JR,

Cattini PA, Kardami E. CUG-initiated FGF-2 induces chromatin compaction in cultured

cardiac myocytes and in vitro. J Cell Physiol. 2001;186:457-67.

303. Bogoyevitch MA, Glennon PE, Andersson MB, Clerk A, Lazou A, Marshall CJ, Parker

PJ, Sugden PH. Endothelin-1 and fibroblast growth factors stimulate the mitogen-

activated protein kinase signaling cascade in cardiac myocytes. The potential role of the

cascade in the integration of two signaling pathways leading to myocyte hypertrophy. J

Biol Chem. 1994;269:1110-9.

304. Sasame A, Nakajima H, Tamura K, Miyagi M, Rakue H, Usui M, Katoh T, Naitoh Y,

Ibukiyama C. A study to determine if basic fibroblast growth factor (bFGF) reduces

myocardial infarct size in acute coronary arterial occlusion. Jpn Heart J. 1999;40:165-78.

320

305. Liao S, Porter D, Scott A, Newman G, Doetschman T, Schultz Jel J. The cardioprotective

effect of the low molecular weight isoform of fibroblast growth factor-2: the role of JNK

signaling. J Mol Cell Cardiol. 2007;42:106-20.

306. Stein O, Stein Y. Smooth muscle cells and atherosclerosis. Curr Opin Lipidol.

1995;6:269-74.

307. Francis DJ, Parish CR, McGarry M, Santiago FS, Lowe HC, Brown KJ, Bingley JA,

Hayward IP, Cowden WB, Campbell JH, Campbell GR, Chesterman CN, Khachigian

LM. Blockade of vascular smooth muscle cell proliferation and intimal thickening after

balloon injury by the sulfated oligosaccharide PI-88: phosphomannopentaose sulfate

directly binds FGF-2, blocks cellular signaling, and inhibits proliferation. Circ Res.

2003;92:e70-7.

308. Post MJ, Laham RJ, Kuntz RE, Novicki D, Simons M. The effect of intracoronary

fibroblast growth factor-2 on restenosis after primary angioplasty or stent placement in a

pig model of atherosclerosis. Clin Cardiol. 2002;25:271-8.

309. House SL. Role of fibroblast growth factor 2 in cardiac ischemia-reperfusion injury and

hypertrophy. Dissertation, University of Cincinnati. 2005.

310. Kardami E, Jiang ZS, Jimenez SK, Hirst CJ, Sheikh F, Zahradka P, Cattini PA. Fibroblast

growth factor 2 isoforms and cardiac hypertrophy. Cardiovasc Res. 2004;63:458-66.

311. Kaye D, Pimental D, Prasad S, Maki T, Berger HJ, McNeil PL, Smith TW, Kelly RA.

Role of transiently altered sarcolemmal membrane permeability and basic fibroblast

growth factor release in the hypertrophic response of adult rat ventricular myocytes to

increased mechanical activity in vitro. J Clin Invest. 1996;97:281-91.

312. Parker TG, Packer SE, Schneider MD. Peptide growth factors can provoke "fetal"

contractile protein gene expression in rat cardiac myocytes. J Clin Invest. 1990;85:507-14.

321

313. Jiang ZS, Jeyaraman M, Wen GB, Fandrich RR, Dixon IM, Cattini PA, Kardami E.

High- but not low-molecular weight FGF-2 causes cardiac hypertrophy in vivo; possible

involvement of cardiotrophin-1. J Mol Cell Cardiol. 2007;42:222-33.

314. Amalric F, Bouche G, Bonnet H, Brethenou P, Roman AM, Truchet I, Quarto N.

Fibroblast growth factor-2 (FGF-2) in the nucleus: translocation process and targets.

Biochem Pharmacol. 1994;47:111-5.

315. Nakanishi Y, Kihara K, Mizuno K, Masamune Y, Yoshitake Y, Nishikawa K. Direct

effect of basic fibroblast growth factor on gene transcription in a cell-free system. Proc

Natl Acad Sci U S A. 1992;89:5216-20.

316. Delrieu I, Arnaud E, Ferjoux G, Bayard F, Faye JC. Overexpression of the FGF-2 24-kDa

isoform up-regulates IL-6 transcription in NIH-3T3 cells. FEBS Lett. 1998;436:17-22.

317. Delrieu I, Faye JC, Bayard F, Maret A. Inhibition of interleukin-6 promoter activity by

the 24 kDa isoform of fibroblast growth factor-2 in HeLa cells. Biochem J. 1999;340 ( Pt

1):201-6.

318. Hoshi S, Goto M, Koyama N, Nomoto K, Tanaka H. Regulation of vascular smooth

muscle cell proliferation by nuclear factor-kappaB and its inhibitor, I-kappaB. J Biol

Chem. 2000;275:883-9.

319. Vandermoere F, El Yazidi-Belkoura I, Adriaenssens E, Lemoine J, Hondermarck H. The

antiapoptotic effect of fibroblast growth factor-2 is mediated through nuclear factor-

kappaB activation induced via interaction between Akt and IkappaB kinase-beta in breast

cancer cells. Oncogene. 2005;24:5482-91.

320. Van den Berghe L, Laurell H, Huez I, Zanibellato C, Prats H, Bugler B. FIF [fibroblast

growth factor-2 (FGF-2)-interacting-factor], a nuclear putatively antiapoptotic factor,

interacts specifically with FGF-2. Mol Endocrinol. 2000;14:1709-24.

322

321. Sahni M, Raz R, Coffin JD, Levy D, Basilico C. STAT1 mediates the increased apoptosis

and reduced chondrocyte proliferation in mice overexpressing FGF2. Development.

2001;128:2119-29.

322. Sung JY, Shin SW, Ahn YS, Chung KC. Basic fibroblast growth factor-induced

activation of novel CREB kinase during the differentiation of immortalized hippocampal

cells. J Biol Chem. 2001;276:13858-66.

323. Silverman ES, Khachigian LM, Santiago FS, Williams AJ, Lindner V, Collins T.

Vascular smooth muscle cells express the transcriptional corepressor NAB2 in response

to injury. Am J Pathol. 1999;155:1311-7.

324. Rich CB, Fontanilla MR, Nugent M, Foster JA. Basic fibroblast growth factor decreases

elastin gene transcription through an AP1/cAMP-response element hybrid site in the

distal promoter. J Biol Chem. 1999;274:33433-9.

325. Fu X, Jiang L, Sun T, Yang Y, Gu X, Sheng Z. Expression of oncoproteins c-fos and c-

jun in hypertrophic scars and chronic dermal ulcers and their regulation of basic

fibroblast growth factor. Chin Med J (Engl). 2001;114:852-6.

326. Quarto N, Fong KD, Longaker MT. Gene profiling of cells expressing different FGF-2

forms. Gene. 2005;356:49-68.

327. Xuan YT, Guo Y, Han H, Zhu Y, Bolli R. An essential role of the JAK-STAT pathway in

ischemic preconditioning. Proc Natl Acad Sci U S A. 2001;98:9050-5.

328. Bogoyevitch MA, Gillespie-Brown J, Ketterman AJ, Fuller SJ, Ben-Levy R, Ashworth A,

Marshall CJ, Sugden PH. Stimulation of the stress-activated mitogen-activated protein

kinase subfamilies in perfused heart. p38/RK mitogen-activated protein kinases and c-Jun

N-terminal kinases are activated by ischemia/reperfusion. Circ Res. 1996;79:162-73.

323

329. Higuchi Y, Chan TO, Brown MA, Zhang J, DeGeorge BR, Jr., Funakoshi H, Gibson G,

McTiernan CF, Kubota T, Jones WK, Feldman AM. Cardioprotection afforded by NF-

kappaB ablation is associated with activation of Akt in mice overexpressing TNF-alpha.

Am J Physiol Heart Circ Physiol. 2006;290:H590-8.

330. Xi L, Taher M, Yin C, Salloum F, Kukreja RC. Cobalt chloride induces delayed cardiac

preconditioning in mice through selective activation of HIF-1alpha and AP-1 and iNOS

signaling. Am J Physiol Heart Circ Physiol. 2004;287:H2369-75.

331. Gualandris A, Coltrini D, Bergonzoni L, Isacchi A, Tenca S, Ginelli B, Presta M. The

NH2-terminal extension of high molecular weight forms of basic fibroblast growth factor

(bFGF) is not essential for the binding of bFGF to nuclear chromatin in transfected NIH

3T3 cells. Growth Factors. 1993;8:49-60.

332. Patry V, Bugler B, Maret A, Potier M, Prats H. Endogenous basic fibroblast growth

factor isoforms involved in different intracellular protein complexes. Biochem J.

1997;326 ( Pt 1):259-64.

333. Shen B, Arese M, Gualandris A, Rifkin DB. Intracellular association of FGF-2 with the

ribosomal protein L6/TAXREB107. Biochem Biophys Res Commun. 1998;252:524-8.

334. Montero A, Okada Y, Tomita M, Ito M, Tsurukami H, Nakamura T, Doetschman T,

Coffin JD, Hurley MM. Disruption of the fibroblast growth factor-2 gene results in

decreased bone mass and bone formation. J Clin Invest. 2000;105:1085-93.

335. Zhou M, Sutliff RL, Paul RJ, Lorenz JN, Hoying JB, Haudenschild CC, Yin M, Coffin

JD, Kong L, Kranias EG, Luo W, Boivin GP, Duffy JJ, Pawlowski SA, Doetschman T.

Fibroblast growth factor 2 control of vascular tone. Nat Med. 1998;4:201-7.

324

336. Ortega S, Ittmann M, Tsang SH, Ehrlich M, Basilico C. Neuronal defects and delayed

wound healing in mice lacking fibroblast growth factor 2. Proc Natl Acad Sci U S A.

1998;95:5672-7.

337. Liu Y, Cai S, Shu XZ, Shelby J, Prestwich GD. Release of basic fibroblast growth factor

from a crosslinked glycosaminoglycan hydrogel promotes wound healing. Wound Repair

Regen. 2007;15:245-51.

338. Davis MG, Zhou M, Ali S, Coffin JD, Doetschman T, Dorn GW, 2nd. Intracrine and

autocrine effects of basic fibroblast growth factor in vascular smooth muscle cells. J Mol

Cell Cardiol. 1997;29:1061-72.

339. Coffin JD, Florkiewicz RZ, Neumann J, Mort-Hopkins T, Dorn GW, 2nd, Lightfoot P,

German R, Howles PN, Kier A, O'Toole BA, et al. Abnormal bone growth and selective

translational regulation in basic fibroblast growth factor (FGF-2) transgenic mice. Mol

Biol Cell. 1995;6:1861-73.

340. Dhalla NS, Elmoselhi AB, Hata T, Makino N. Status of myocardial antioxidants in

ischemia-reperfusion injury. Cardiovasc Res. 2000;47:446-56.

341. Horrigan MC, Malycky JL, Ellis SG, Topol EJ, Nicolini FA. Reduction in myocardial

infarct size by basic fibroblast growth factor following coronary occlusion in a canine

model. Int J Cardiol. 1999;68 Suppl 1:S85-91.

342. Cuevas P, Carceller F, Martinez-Coso V, Asin-Cardiel E, Gimenez-Gallego G. Fibroblast

growth factor cardioprotection against ischemia-reperfusion injury may involve K+ ATP

channels. Eur J Med Res. 2000;5:145-9.

343. Sheikh F, Sontag DP, Fandrich RR, Kardami E, Cattini PA. Overexpression of FGF-2

increases cardiac myocyte viability after injury in isolated mouse hearts. Am J Physiol

Heart Circ Physiol. 2001;280:H1039-50.

325

344. Gross GJ, Auchampach JA. Reperfusion injury: does it exist? J Mol Cell Cardiol.

2007;42:12-8.

345. Hausenloy DJ, Yellon DM. Survival kinases in ischemic preconditioning and

postconditioning. Cardiovasc Res. 2006;70:240-53.

346. Garcia-Dorado D, Rodriguez-Sinovas A, Ruiz-Meana M, Inserte J, Agullo L, Cabestrero

A. The end-effectors of preconditioning protection against myocardial cell death

secondary to ischemia-reperfusion. Cardiovasc Res. 2006;70:274-85.

347. Jiang ZS, Srisakuldee W, Soulet F, Bouche G, Kardami E. Non-angiogenic FGF-2

protects the ischemic heart from injury, in the presence or absence of reperfusion.

Cardiovasc Res. 2004;62:154-66.

348. House SL, Melhorn SJ, Newman G, Doetschman T, Schultz Jel J. The protein kinase C

pathway mediates cardioprotection induced by cardiac-specific overexpression of

fibroblast growth factor-2. Am J Physiol Heart Circ Physiol. 2007;293:H354-65.

349. Doble BW, Dang X, Ping P, Fandrich RR, Nickel BE, Jin Y, Cattini PA, Kardami E.

Phosphorylation of serine 262 in the gap junction protein connexin-43 regulates DNA

synthesis in cell-cell contact forming cardiomyocytes. J Cell Sci. 2004;117:507-14.

350. Srisakuldee W, Nickel BE, Fandrich RR, Jiang ZS, Kardami E. Administration of FGF-2

to the heart stimulates connexin-43 phosphorylation at protein kinase C target sites. Cell

Commun Adhes. 2006;13:13-9.

351. Doble BW, Chen Y, Bosc DG, Litchfield DW, Kardami E. Fibroblast growth factor-2

decreases metabolic coupling and stimulates phosphorylation as well as masking of

connexin43 epitopes in cardiac myocytes. Circ Res. 1996;79:647-58.

352. West DJ, Williams AJ. Pharmacological regulators of intracellular calcium release

channels. Curr Pharm Des. 2007;13:2428-42.

326

353. Vaughan-Jones RD. Excitation and contraction in heart: the role of calcium. Br Med Bull.

1986;42:413-20.

354. Koss KL, Kranias EG. Phospholamban: a prominent regulator of myocardial contractility.

Circ Res. 1996;79:1059-63.

355. Miyawaki H, Zhou X, Ashraf M. Calcium preconditioning elicits strong protection

against ischemic injury via protein kinase C signaling pathway. Circ Res. 1996;79:137-46.

356. Porter MJ, Heidkamp MC, Scully BT, Patel N, Martin JL, Samarel AM. Isoenzyme-

selective regulation of SERCA2 gene expression by protein kinase C in neonatal rat

ventricular myocytes. Am J Physiol Cell Physiol. 2003;285:C39-47.

357. Liao P, Wang SQ, Wang S, Zheng M, Zhang SJ, Cheng H, Wang Y, Xiao RP. p38

Mitogen-activated protein kinase mediates a negative inotropic effect in cardiac myocytes.

Circ Res. 2002;90:190-6.

358. Kageyama K, Ihara Y, Goto S, Urata Y, Toda G, Yano K, Kondo T. Overexpression of

calreticulin modulates protein kinase B/Akt signaling to promote apoptosis during cardiac

differentiation of cardiomyoblast H9c2 cells. J Biol Chem. 2002;277:19255-64.

359. Puro DG, Mano T. Modulation of calcium channels in human retinal glial cells by basic

fibroblast growth factor: a possible role in retinal pathobiology. J Neurosci.

1991;11:1873-80.

360. Abe K, Saito H. Selective enhancement by basic fibroblast growth factor of NMDA

receptor-mediated increase of intracellular Ca2+ concentration in hippocampal neurons.

Brain Res. 1992;595:128-32.

361. Koike H, Saito H, Matsuki N. Effect of fibroblast growth factors on calcium currents in

acutely isolated neuronal cells from rat ventromedial hypothalamus. Neurosci Lett.

1993;150:57-60.

327

362. Munaron L, Distasi C, Carabelli V, Baccino FM, Bonelli G, Lovisolo D. Sustained

calcium influx activated by basic fibroblast growth factor in Balb-c 3T3 fibroblasts. J

Physiol. 1995;484 ( Pt 3):557-66.

363. Merle PL, Feige JJ, Verdetti J. Basic fibroblast growth factor activates calcium channels

in neonatal rat cardiomyocytes. J Biol Chem. 1995;270:17361-7.

364. Merle PL, Usson Y, Robert-Nicoud M, Verdetti J. Basic FGF enhances calcium

permeable channel openings in adult rat cardiac myocytes: implication in the bFGF-

induced increase of free Ca2+ content. J Mol Cell Cardiol. 1997;29:2687-98.

365. Debiais F, Hott M, Graulet AM, Marie PJ. The effects of fibroblast growth factor-2 on

human neonatal calvaria osteoblastic cells are differentiation stage specific. J Bone Miner

Res. 1998;13:645-54.

366. Wiecha J, Munz B, Wu Y, Noll T, Tillmanns H, Waldecker B. Blockade of Ca2+-

activated K+ channels inhibits proliferation of human endothelial cells induced by basic

fibroblast growth factor. J Vasc Res. 1998;35:363-71.

367. Ishibashi Y, Urabe Y, Tsutsui H, Kinugawa S, Sugimachi M, Takahashi M, Yamamoto S,

Tagawa H, Sunagawa K, Takeshita A. Negative inotropic effect of basic fibroblast

growth factor on adult rat cardiac myocyte. Circulation. 1997;96:2501-4.

368. Rahimi F, Hsu K, Endoh Y, Geczy CL. FGF-2, IL-1beta and TGF-beta regulate fibroblast

expression of S100A8. Febs J. 2005;272:2811-27.

369. Hinkle DA, Harney JP, Cai A, Hilt DC, Yarowsky PJ, Wise PM. Basic fibroblast growth

factor-2 and interleukin-1 beta regulate S100 beta expression in cultured astrocytes.

Neuroscience. 1998;82:33-41.

370. Schneider M, Kostin S, Strom CC, Aplin M, Lyngbaek S, Theilade J, Grigorian M,

Andersen CB, Lukanidin E, Lerche Hansen J, Sheikh SP. S100A4 is upregulated in

328

injured myocardium and promotes growth and survival of cardiac myocytes. Cardiovasc

Res. 2007;75:40-50.

371. Kettlewell S, Most P, Currie S, Koch WJ, Smith GL. S100A1 increases the gain of

excitation-contraction coupling in isolated rabbit ventricular cardiomyocytes. J Mol Cell

Cardiol. 2005;39:900-10.

372. Asaoka Y, Nakamura S, Yoshida K, Nishizuka Y. Protein kinase C, calcium and

phospholipid degradation. Trends Biochem Sci. 1992;17:414-7.

373. Dekker LV, Parker PJ. Protein kinase C--a question of specificity. Trends Biochem Sci.

1994;19:73-7.

374. Oancea E, Meyer T. Protein kinase C as a molecular machine for decoding calcium and

diacylglycerol signals. Cell. 1998;95:307-18.

375. Castagna M, Takai Y, Kaibuchi K, Sano K, Kikkawa U, Nishizuka Y. Direct activation

of calcium-activated, phospholipid-dependent protein kinase by tumor-promoting phorbol

esters. J Biol Chem. 1982;257:7847-51.

376. Denning MF, Wang Y, Nickoloff BJ, Wrone-Smith T. Protein kinase Cdelta is activated

by caspase-dependent proteolysis during ultraviolet radiation-induced apoptosis of human

keratinocytes. J Biol Chem. 1998;273:29995-30002.

377. Mizukami Y, Kobayashi S, Uberall F, Hellbert K, Kobayashi N, Yoshida K. Nuclear

mitogen-activated protein kinase activation by protein kinase czeta during reoxygenation

after ischemic hypoxia. J Biol Chem. 2000;275:19921-7.

378. Hsieh YH, Wu TT, Huang CY, Hsieh YS, Hwang JM, Liu JY. p38 mitogen-activated

protein kinase pathway is involved in protein kinase Calpha-regulated invasion in human

hepatocellular carcinoma cells. Cancer Res. 2007;67:4320-7.

329

379. Puceat M, Vassort G. Signalling by protein kinase C isoforms in the heart. Mol Cell

Biochem. 1996;157:65-72.

380. Nishizuka Y. The molecular heterogeneity of protein kinase C and its implications for

cellular regulation. Nature. 1988;334:661-5.

381. Ochoa WF, Garcia-Garcia J, Fita I, Corbalan-Garcia S, Verdaguer N, Gomez-Fernandez

JC. Structure of the C2 domain from novel protein kinase Cepsilon. A membrane binding

model for Ca(2+)-independent C2 domains. J Mol Biol. 2001;311:837-49.

382. House C, Kemp BE. Protein kinase C contains a pseudosubstrate prototope in its

regulatory domain. Science. 1987;238:1726-8.

383. Ono Y, Fujii T, Ogita K, Kikkawa U, Igarashi K, Nishizuka Y. Protein kinase C zeta

subspecies from rat brain: its structure, expression, and properties. Proc Natl Acad Sci U

S A. 1989;86:3099-103.

384. Kaibuchi K, Fukumoto Y, Oku N, Takai Y, Arai K, Muramatsu M. Molecular genetic

analysis of the regulatory and catalytic domains of protein kinase C. J Biol Chem.

1989;264:13489-96.

385. Parker PJ, Coussens L, Totty N, Rhee L, Young S, Chen E, Stabel S, Waterfield MD,

Ullrich A. The complete primary structure of protein kinase C--the major phorbol ester

receptor. Science. 1986;233:853-9.

386. Burack WR, Shaw AS. Signal transduction: hanging on a scaffold. Curr Opin Cell Biol.

2000;12:211-6.

387. Mochly-Rosen D. Localization of protein kinases by anchoring proteins: a theme in

signal transduction. Science. 1995;268:247-51.

388. Erdbrugger W, Keffel J, Knocks M, Otto T, Philipp T, Michel MC. Protein kinase C

isoenzymes in rat and human cardiovascular tissues. Br J Pharmacol. 1997;120:177-86.

330

389. Disatnik MH, Buraggi G, Mochly-Rosen D. Localization of protein kinase C isozymes in

cardiac myocytes. Exp Cell Res. 1994;210:287-97.

390. Rybin V, Steinberg SF. Do adult rat ventricular myocytes express protein kinase C-alpha?

Am J Physiol. 1997;272:H2485-91.

391. Puceat M, Hilal-Dandan R, Strulovici B, Brunton LL, Brown JH. Differential regulation

of protein kinase C isoforms in isolated neonatal and adult rat cardiomyocytes. J Biol

Chem. 1994;269:16938-44.

392. Ping P, Zhang J, Qiu Y, Tang XL, Manchikalapudi S, Cao X, Bolli R. Ischemic

preconditioning induces selective translocation of protein kinase C isoforms epsilon and

eta in the heart of conscious rabbits without subcellular redistribution of total protein

kinase C activity. Circ Res. 1997;81:404-14.

393. Wieczorek DF, Periasamy M, Butler-Browne GS, Whalen RG, Nadal-Ginard B. Co-

expression of multiple myosin heavy chain genes, in addition to a tissue-specific one, in

extraocular musculature. J Cell Biol. 1985;101:618-29.

394. Barman SA. Vasoconstrictor Effect of Endothelin-1 on Hypertensive Pulmonary Arterial

Smooth Muscle Involves Rho Kinase and Protein Kinase C. Am J Physiol Lung Cell Mol

Physiol. 2007.

395. Karimi G, Fatehi Z, Gholamnejad Z. The role of nitric oxide and protein kinase C in

lipopolysaccharidemediated vascular hyporeactivity. J Pharm Pharm Sci. 2006;9:119-23.

396. Henderson KK, Byron KL. Vasopressin-induced vasoconstriction: two concentration-

dependent signaling pathways. J Appl Physiol. 2007;102:1402-9.

397. Dorn GW, 2nd, Force T. Protein kinase cascades in the regulation of cardiac hypertrophy.

J Clin Invest. 2005;115:527-37.

331

398. Kwiatkowska-Patzer B, Domanska-Janik K. Increased 19 kDa protein phosphorylation

and protein kinase C activity in pressure-overload cardiac hypertrophy. Basic Res Cardiol.

1991;86:402-9.

399. Gu X, Bishop SP. Increased protein kinase C and isozyme redistribution in pressure-

overload cardiac hypertrophy in the rat. Circ Res. 1994;75:926-31.

400. Bowman JC, Steinberg SF, Jiang T, Geenen DL, Fishman GI, Buttrick PM. Expression of

protein kinase C beta in the heart causes hypertrophy in adult mice and sudden death in

neonates. J Clin Invest. 1997;100:2189-95.

401. De Windt LJ, Lim HW, Haq S, Force T, Molkentin JD. Calcineurin promotes protein

kinase C and c-Jun NH2-terminal kinase activation in the heart. Cross-talk between

cardiac hypertrophic signaling pathways. J Biol Chem. 2000;275:13571-9.

402. Strait JB, 3rd, Martin JL, Bayer A, Mestril R, Eble DM, Samarel AM. Role of protein

kinase C-epsilon in hypertrophy of cultured neonatal rat ventricular myocytes. Am J

Physiol Heart Circ Physiol. 2001;280:H756-66.

403. Armstrong SC. Protein kinase activation and myocardial ischemia/reperfusion injury.

Cardiovasc Res. 2004;61:427-36.

404. Wilson S, Song W, Karoly K, Ravingerova T, Vegh A, Papp J, Tomisawa S, Parratt JR,

Pyne NJ. Delayed cardioprotection is associated with the sub-cellular relocalisation of

ventricular protein kinase C epsilon, but not p42/44MAPK. Mol Cell Biochem. 1996;160-

161:225-30.

405. Fryer RM, Schultz JE, Hsu AK, Gross GJ. Importance of PKC and tyrosine kinase in

single or multiple cycles of preconditioning in rat hearts. Am J Physiol. 1999;276:H1229-

35.

332

406. Tian R, Miao W, Spindler M, Javadpour MM, McKinney R, Bowman JC, Buttrick PM,

Ingwall JS. Long-term expression of protein kinase C in adult mouse hearts improves

postischemic recovery. Proc Natl Acad Sci U S A. 1999;96:13536-41.

407. Wang GY, Zhou JJ, Shan J, Wong TM. Protein kinase C-epsilon is a trigger of delayed

cardioprotection against myocardial ischemia of kappa-opioid receptor stimulation in rat

ventricular myocytes. J Pharmacol Exp Ther. 2001;299:603-10.

408. Balafanova Z, Bolli R, Zhang J, Zheng Y, Pass JM, Bhatnagar A, Tang XL, Wang O,

Cardwell E, Ping P. Nitric oxide (NO) induces nitration of protein kinase Cepsilon

(PKCepsilon ), facilitating PKCepsilon translocation via enhanced PKCepsilon -RACK2

interactions: a novel mechanism of no-triggered activation of PKCepsilon. J Biol Chem.

2002;277:15021-7.

409. Valtchanova-Matchouganska A, Ojewole JA. Mechanisms of opioid delta (delta) and

kappa ( kappa) receptors' cardioprotection in ischaemic preconditioning in a rat model of

myocardial infarction. Cardiovasc J S Afr. 2003;14:73-80.

410. Obal D, Weber NC, Zacharowski K, Toma O, Dettwiler S, Wolter JI, Kratz M,

Mullenheim J, Preckel B, Schlack W. Role of protein kinase C-epsilon (PKCepsilon) in

isoflurane-induced cardioprotection. Br J Anaesth. 2005;94:166-73.

411. Bright R, Mochly-Rosen D. The role of protein kinase C in cerebral ischemic and

reperfusion injury. Stroke. 2005;36:2781-90.

412. Bright R, Raval AP, Dembner JM, Perez-Pinzon MA, Steinberg GK, Yenari MA,

Mochly-Rosen D. Protein kinase C delta mediates cerebral reperfusion injury in vivo. J

Neurosci. 2004;24:6880-8.

333

413. Di-Capua N, Sperling O, Zoref-Shani E. Protein kinase C-epsilon is involved in the

adenosine-activated signal transduction pathway conferring protection against ischemia-

reperfusion injury in primary rat neuronal cultures. J Neurochem. 2003;84:409-12.

414. Piccoletti R, Bendinelli P, Arienti D, Bernelli-Zazzera A. State and activity of protein

kinase C in postischemic reperfused liver. Exp Mol Pathol. 1992;56:219-28.

415. Liu Y, Ytrehus K, Downey JM. Evidence that translocation of protein kinase C is a key

event during ischemic preconditioning of rabbit myocardium. J Mol Cell Cardiol.

1994;26:661-8.

416. Ward CA, Moffat MP. Signal transduction mechanisms in the ischemic and reperfused

myocardium. Exs. 1996;76:191-207.

417. Mitchell MB, Meng X, Ao L, Brown JM, Harken AH, Banerjee A. Preconditioning of

isolated rat heart is mediated by protein kinase C. Circ Res. 1995;76:73-81.

418. Anagnostopoulos CE, Connery CP, Dumont H, Hillel Z, Herring W, Adams L, Davis

GW. Pre-clamp cardioprotection by protein kinase C (PKC) inhibitor improves left

ventricular function following canine normothermic arrest. J Cardiovasc Surg (Torino).

1996;37:141-3.

419. Tosaki A, Maulik N, Engelman DT, Engelman RM, Das DK. The role of protein kinase

in C ischemic/reperfused preconditioned isolated rat hearts. J Cardiovasc Pharmacol.

1996;28:723-31.

420. Ladilov YV, Balser C, Piper HM. Protection of rat cardiomyocytes against simulated

ischemia and reoxygenation by treatment with protein kinase C activator. Circ Res.

1998;82:451-7.

334

421. Chen CH, Gray MO, Mochly-Rosen D. Cardioprotection from ischemia by a brief

exposure to physiological levels of ethanol: role of epsilon protein kinase C. Proc Natl

Acad Sci U S A. 1999;96:12784-9.

422. Fryer RM, Wang Y, Hsu AK, Gross GJ. Essential activation of PKC-delta in opioid-

initiated cardioprotection. Am J Physiol Heart Circ Physiol. 2001;280:H1346-53.

423. Nakano A, Cohen MV, Downey JM. Ischemic preconditioning: from basic mechanisms

to clinical applications. Pharmacol Ther. 2000;86:263-75.

424. Liu Y, Cohen MV, Downey JM. Chelerythrine, a highly selective protein kinase C

inhibitor, blocks the anti-infarct effect of ischemic preconditioning in rabbit hearts.

Cardiovasc Drugs Ther. 1994;8:881-2.

425. Cross HR, Murphy E, Bolli R, Ping P, Steenbergen C. Expression of Activated PKC

Epsilon (PKC epsilon) Protects the Ischemic Heart, without Attenuating Ischemic H(+)

Production. J Mol Cell Cardiol. 2002;34:361-7.

426. Kawamura S, Yoshida K, Miura T, Mizukami Y, Matsuzaki M. Ischemic preconditioning

translocates PKC-delta and -epsilon, which mediate functional protection in isolated rat

heart. Am J Physiol. 1998;275:H2266-71.

427. Zhao J, Renner O, Wightman L, Sugden PH, Stewart L, Miller AD, Latchman DS,

Marber MS. The expression of constitutively active isotypes of protein kinase C to

investigate preconditioning. J Biol Chem. 1998;273:23072-9.

428. Ytrehus K, Liu Y, Downey JM. Preconditioning protects ischemic rabbit heart by protein

kinase C activation. Am J Physiol. 1994;266:H1145-52.

429. Zhang Y, Chen ZW, Girwin M, Wong TM. Remifentanil mimics cardioprotective effect

of ischemic preconditioning via protein kinase C activation in open chest of rats. Acta

Pharmacol Sin. 2005;26:546-50.

335

430. Numaguchi K, Shimokawa H, Nakaike R, Egashira K, Takeshita A. PKC inhibitors

prevent endothelial dysfunction after myocardial ischemia-reperfusion in rats. Am J

Physiol. 1996;270:H1634-9.

431. Vahlhaus C, Schulz R, Post H, Onallah R, Heusch G. No prevention of ischemic

preconditioning by the protein kinase C inhibitor staurosporine in swine. Circ Res.

1996;79:407-14.

432. Goldberg M, Zhang HL, Steinberg SF. Hypoxia alters the subcellular distribution of

protein kinase C isoforms in neonatal rat ventricular myocytes. J Clin Invest. 1997;99:55-

61.

433. Przyklenk K, Sussman MA, Simkhovich BZ, Kloner RA. Does ischemic preconditioning

trigger translocation of protein kinase C in the canine model? Circulation. 1995;92:1546-

57.

434. Johnson JA, Gray MO, Chen CH, Mochly-Rosen D. A protein kinase C translocation

inhibitor as an isozyme-selective antagonist of cardiac function. J Biol Chem.

1996;271:24962-6.

435. Souroujon MC, Mochly-Rosen D. Peptide modulators of protein-protein interactions in

intracellular signaling. Nat Biotechnol. 1998;16:919-24.

436. Fryer RM, Hsu AK, Wang Y, Henry M, Eells J, Gross GJ. PKC-delta inhibition does not

block preconditioning-induced preservation in mitochondrial ATP synthesis and infarct

size reduction in rats. Basic Res Cardiol. 2002;97:47-54.

437. Zhang HY, McPherson BC, Liu H, Baman T, McPherson SS, Rock P, Yao Z. Role of

nitric-oxide synthase, free radicals, and protein kinase C delta in opioid-induced

cardioprotection. J Pharmacol Exp Ther. 2002;301:1012-9.

336

438. Zhao TC, Kukreja RC. Protein kinase C-delta mediates adenosine A3 receptor-induced

delayed cardioprotection in mouse. Am J Physiol Heart Circ Physiol. 2003;285:H434-41.

439. Das A, Ockaili R, Salloum F, Kukreja RC. Protein kinase C plays an essential role in

sildenafil-induced cardioprotection in rabbits. Am J Physiol Heart Circ Physiol.

2004;286:H1455-60.

440. Bouwman RA, Musters RJ, van Beek-Harmsen BJ, de Lange JJ, Boer C. Reactive

oxygen species precede protein kinase C-delta activation independent of adenosine

triphosphate-sensitive mitochondrial channel opening in sevoflurane-induced

cardioprotection. Anesthesiology. 2004;100:506-14.

441. Kolar F, Jezkova J, Balkova P, Breh J, Neckar J, Novak F, Novakova O, Tomasova H,

Srbova M, Ost'adal B, Wilhelm J, Herget J. Role of oxidative stress in PKC-delta

upregulation and cardioprotection induced by chronic intermittent hypoxia. Am J Physiol

Heart Circ Physiol. 2007;292:H224-30.

442. Neckar J, Markova I, Novak F, Novakova O, Szarszoi O, Ost'adal B, Kolar F. Increased

expression and altered subcellular distribution of PKC-delta in chronically hypoxic rat

myocardium: involvement in cardioprotection. Am J Physiol Heart Circ Physiol.

2005;288:H1566-72.

443. Hunter JC, Kostyak JC, Novotny JL, Simpson AM, Korzick DH. Estrogen deficiency

decreases ischemic tolerance in the aged rat heart: Roles of PKCdelta, PKCepsilon, Akt,

and GSK3beta. Am J Physiol Regul Integr Comp Physiol. 2007;292:R800-9.

444. Gaubert F, Escaffit F, Bertrand C, Korc M, Pradayrol L, Clemente F, Estival A.

Expression of the high molecular weight fibroblast growth factor-2 isoform of 210 amino

acids is associated with modulation of protein kinases C delta and epsilon and ERK

activation. J Biol Chem. 2001;276:1545-54.

337

445. Roisin MP, Barbin G. Differential expression of PKC isoforms in hippocampal neuronal

cultures: modifications after basic FGF treatment. Neurochem Int. 1997;30:261-70.

446. Hrzenjak M, Shain SA. Fibroblast growth factor-2 and TPA enhance prostate-cancer-cell

proliferation and activate members of the Ras and PKC signal transduction pathways.

Recept Signal Transduct. 1997;7:207-19.

447. Li F, Cao W, Steinberg RH, LaVail MM. Basic FGF-induced down-regulation of IGF-I

mRNA in cultured rat Muller cells. Exp Eye Res. 1999;68:19-27.

448. Skaletz-Rorowski A, Eschert H, Leng J, Stallmeyer B, Sindermann JR, Pulawski E,

Breithardt G. PKC delta-induced activation of MAPK pathway is required for bFGF-

stimulated proliferation of coronary smooth muscle cells. Cardiovasc Res. 2005;67:142-

50.

449. Haimovitz-Friedman A, Balaban N, McLoughlin M, Ehleiter D, Michaeli J, Vlodavsky I,

Fuks Z. Protein kinase C mediates basic fibroblast growth factor protection of endothelial

cells against radiation-induced apoptosis. Cancer Res. 1994;54:2591-7.

450. Pardo OE, Wellbrock C, Khanzada UK, Aubert M, Arozarena I, Davidson S, Bowen F,

Parker PJ, Filonenko VV, Gout IT, Sebire N, Marais R, Downward J, Seckl MJ. FGF-2

protects small cell lung cancer cells from apoptosis through a complex involving

PKCepsilon, B-Raf and S6K2. Embo J. 2006;25:3078-88.

451. Wert MM, Palfrey HC. Divergence in the anti-apoptotic signalling pathways used by

nerve growth factor and basic fibroblast growth factor (bFGF) in PC12 cells: rescue by

bFGF involves protein kinase C delta. Biochem J. 2000;352 Pt 1:175-82.

452. Peluso JJ, Pappalardo A, Fernandez G. Basic fibroblast growth factor maintains calcium

homeostasis and granulosa cell viability by stimulating calcium efflux via a PKC delta-

dependent pathway. Endocrinology. 2001;142:4203-11.

338

453. Doble BW, Ping P, Kardami E. The epsilon subtype of protein kinase C is required for

cardiomyocyte connexin-43 phosphorylation. Circ Res. 2000;86:293-301.

454. Presta M, Tiberio L, Rusnati M, Dell'Era P, Ragnotti G. Basic fibroblast growth factor

requires a long-lasting activation of protein kinase C to induce cell proliferation in

transformed fetal bovine aortic endothelial cells. Cell Regul. 1991;2:719-26.

455. Keates S, Han X, Kelly CP, Keates AC. Macrophage-inflammatory protein-3alpha

mediates epidermal growth factor receptor transactivation and ERK1/2 MAPK signaling

in Caco-2 colonic epithelial cells via metalloproteinase-dependent release of

amphiregulin. J Immunol. 2007;178:8013-21.

456. Caretti A, Morel S, Milano G, Fantacci M, Bianciardi P, Ronchi R, Vassalli G, von

Segesser LK, Samaja M. Heart HIF-1alpha and MAP kinases during hypoxia: are they

associated in vivo? Exp Biol Med (Maywood). 2007;232:887-94.

457. Jinlian L, Yingbin Z, Chunbo W. p38 MAPK in regulating cellular responses to

ultraviolet radiation. J Biomed Sci. 2007;14:303-12.

458. Wells V, Downward J, Mallucci L. Functional inhibition of PI3K by the betaGBP

molecule suppresses Ras-MAPK signalling to block cell proliferation. Oncogene. 2007.

459. Ye J, Yuan L. Inhibition of p38 MAPK reduces tumor conditioned medium-induced

angiogenesis in co-cultured human umbilical vein endothelial cells and fibroblasts. Biosci

Biotechnol Biochem. 2007;71:1162-9.

460. Yang CM, Lin MI, Hsieh HL, Sun CC, Ma YH, Hsiao LD. Bradykinin-induced p42/p44

MAPK phosphorylation and cell proliferation via Src, EGF receptors, and PI3-K/Akt in

vascular smooth muscle cells. J Cell Physiol. 2005;203:538-46.

461. Peter AT, Dhanasekaran N. Apoptosis of granulosa cells: a review on the role of MAPK-

signalling modules. Reprod Domest Anim. 2003;38:209-13.

339

462. Lu Z, Xu S. ERK1/2 MAP kinases in cell survival and apoptosis. IUBMB Life.

2006;58:621-31.

463. Thompson MA, Ohnuma K, Abe M, Morimoto C, Dang NH. CD26/dipeptidyl peptidase

IV as a novel therapeutic target for cancer and immune disorders. Mini Rev Med Chem.

2007;7:253-73.

464. Churcher I. Tau therapeutic strategies for the treatment of Alzheimer's disease. Curr Top

Med Chem. 2006;6:579-95.

465. Watanabe T, Otsu K, Takeda T, Yamaguchi O, Hikoso S, Kashiwase K, Higuchi Y,

Taniike M, Nakai A, Matsumura Y, Nishida K, Ichijo H, Hori M. Apoptosis signal-

regulating kinase 1 is involved not only in apoptosis but also in non-apoptotic

cardiomyocyte death. Biochem Biophys Res Commun. 2005;333:562-7.

466. Arbabi S, Maier RV. Mitogen-activated protein kinases. Crit Care Med. 2002;30:S74-

S79.

467. English J, Pearson G, Wilsbacher J, Swantek J, Karandikar M, Xu S, Cobb MH. New

insights into the control of MAP kinase pathways. Exp Cell Res. 1999;253:255-70.

468. Roux PP, Blenis J. ERK and p38 MAPK-activated protein kinases: a family of protein

kinases with diverse biological functions. Microbiol Mol Biol Rev. 2004;68:320-44.

469. Biondi RM, Nebreda AR. Signalling specificity of Ser/Thr protein kinases through

docking-site-mediated interactions. Biochem J. 2003;372:1-13.

470. Kornfeld K, Hom DB, Horvitz HR. The ksr-1 gene encodes a novel protein kinase

involved in Ras-mediated signaling in C. elegans. Cell. 1995;83:903-13.

471. Dickens M, Rogers JS, Cavanagh J, Raitano A, Xia Z, Halpern JR, Greenberg ME,

Sawyers CL, Davis RJ. A cytoplasmic inhibitor of the JNK signal transduction pathway.

Science. 1997;277:693-6.

340

472. Gallo KA, Johnson GL. Mixed-lineage kinase control of JNK and p38 MAPK pathways.

Nat Rev Mol Cell Biol. 2002;3:663-72.

473. Rana A, Gallo K, Godowski P, Hirai S, Ohno S, Zon L, Kyriakis JM, Avruch J. The

mixed lineage kinase SPRK phosphorylates and activates the stress-activated protein

kinase activator, SEK-1. J Biol Chem. 1996;271:19025-8.

474. Hirai S, Katoh M, Terada M, Kyriakis JM, Zon LI, Rana A, Avruch J, Ohno S.

MST/MLK2, a member of the mixed lineage kinase family, directly phosphorylates and

activates SEK1, an activator of c-Jun N-terminal kinase/stress-activated protein kinase. J

Biol Chem. 1997;272:15167-73.

475. Cuenda A, Dorow DS. Differential activation of stress-activated protein kinase kinases

SKK4/MKK7 and SKK1/MKK4 by the mixed-lineage kinase-2 and mitogen-activated

protein kinase kinase (MKK) kinase-1. Biochem J. 1998;333 ( Pt 1):11-5.

476. Tibbles LA, Ing YL, Kiefer F, Chan J, Iscove N, Woodgett JR, Lassam NJ. MLK-3

activates the SAPK/JNK and p38/RK pathways via SEK1 and MKK3/6. Embo J.

1996;15:7026-35.

477. Derijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M, Davis RJ. JNK1: a protein

kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun

activation domain. Cell. 1994;76:1025-37.

478. Kuan CY, Yang DD, Samanta Roy DR, Davis RJ, Rakic P, Flavell RA. The Jnk1 and

Jnk2 protein kinases are required for regional specific apoptosis during early brain

development. Neuron. 1999;22:667-76.

479. Yang DD, Kuan CY, Whitmarsh AJ, Rincon M, Zheng TS, Davis RJ, Rakic P, Flavell

RA. Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking the

Jnk3 gene. Nature. 1997;389:865-70.

341

480. Manning AM, Davis RJ. Targeting JNK for therapeutic benefit: from junk to gold? Nat

Rev Drug Discov. 2003;2:554-65.

481. Bogoyevitch MA, Kobe B. Uses for JNK: the many and varied substrates of the c-Jun N-

terminal kinases. Microbiol Mol Biol Rev. 2006;70:1061-95.

482. Weston CR, Davis RJ. The JNK signal transduction pathway. Curr Opin Genet Dev.

2002;12:14-21.

483. Mooney LM, Whitmarsh AJ. Docking interactions in the c-Jun N-terminal kinase

pathway. J Biol Chem. 2004;279:11843-52.

484. Sarkisian MR, Bartley CM, Chi H, Nakamura F, Hashimoto-Torii K, Torii M, Flavell RA,

Rakic P. MEKK4 signaling regulates filamin expression and neuronal migration. Neuron.

2006;52:789-801.

485. Premont RT, Gainetdinov RR. Physiological roles of G protein-coupled receptor kinases

and arrestins. Annu Rev Physiol. 2007;69:511-34.

486. McDonald PH, Chow CW, Miller WE, Laporte SA, Field ME, Lin FT, Davis RJ,

Lefkowitz RJ. Beta-arrestin 2: a receptor-regulated MAPK scaffold for the activation of

JNK3. Science. 2000;290:1574-7.

487. Deng Y, Ren X, Yang L, Lin Y, Wu X. A JNK-dependent pathway is required for

TNFalpha-induced apoptosis. Cell. 2003;115:61-70.

488. Chang L, Kamata H, Solinas G, Luo JL, Maeda S, Venuprasad K, Liu YC, Karin M. The

E3 ubiquitin ligase itch couples JNK activation to TNFalpha-induced cell death by

inducing c-FLIP(L) turnover. Cell. 2006;124:601-13.

489. Davis RJ. The mitogen-activated protein kinase signal transduction pathway. J Biol Chem.

1993;268:14553-6.

342

490. Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, Bar-Sagi D, Jones SN,

Flavell RA, Davis RJ. Requirement of JNK for stress-induced activation of the

cytochrome c-mediated death pathway. Science. 2000;288:870-4.

491. Behrens A, Sibilia M, Wagner EF. Amino-terminal phosphorylation of c-Jun regulates

stress-induced apoptosis and cellular proliferation. Nat Genet. 1999;21:326-9.

492. Lenczowski JM, Dominguez L, Eder AM, King LB, Zacharchuk CM, Ashwell JD. Lack

of a role for Jun kinase and AP-1 in Fas-induced apoptosis. Mol Cell Biol. 1997;17:170-

81.

493. Sabapathy K, Jochum W, Hochedlinger K, Chang L, Karin M, Wagner EF. Defective

neural tube morphogenesis and altered apoptosis in the absence of both JNK1 and JNK2.

Mech Dev. 1999;89:115-24.

494. Nishina H, Fischer KD, Radvanyi L, Shahinian A, Hakem R, Rubie EA, Bernstein A,

Mak TW, Woodgett JR, Penninger JM. Stress-signalling kinase Sek1 protects thymocytes

from apoptosis mediated by CD95 and CD3. Nature. 1997;385:350-3.

495. Bost F, McKay R, Bost M, Potapova O, Dean NM, Mercola D. The Jun kinase 2 isoform

is preferentially required for epidermal growth factor-induced transformation of human

A549 lung carcinoma cells. Mol Cell Biol. 1999;19:1938-49.

496. Potapova O, Anisimov SV, Gorospe M, Dougherty RH, Gaarde WA, Boheler KR,

Holbrook NJ. Targets of c-Jun NH(2)-terminal kinase 2-mediated tumor growth

regulation revealed by serial analysis of gene expression. Cancer Res. 2002;62:3257-63.

497. Shaulian E, Karin M. AP-1 as a regulator of cell life and death. Nat Cell Biol.

2002;4:E131-6.

498. Quantin B, Breathnach R. Epidermal growth factor stimulates transcription of the c-jun

proto-oncogene in rat fibroblasts. Nature. 1988;334:538-9.

343

499. Munoz E, Zubiaga AM, Huber BT. Interleukin-1 induces c-fos and c-jun gene expression

in T helper type II cells through different signal transmission pathways. Eur J Immunol.

1992;22:2101-6.

500. Trejo J, Brown JH. c-fos and c-jun are induced by muscarinic receptor activation of

protein kinase C but are differentially regulated by intracellular calcium. J Biol Chem.

1991;266:7876-82.

501. Matthews J, Wihlen B, Tujague M, Wan J, Strom A, Gustafsson JA. Estrogen receptor

(ER) beta modulates ERalpha-mediated transcriptional activation by altering the

recruitment of c-Fos and c-Jun to estrogen-responsive promoters. Mol Endocrinol.

2006;20:534-43.

502. Shih DS, Carruth LM, Anderson M, Clements JE. Involvement of FOS and JUN in the

activation of visna virus gene expression in macrophages through an AP-1 site in the viral

LTR. Virology. 1992;190:84-91.

503. Zhou H, Gao J, Lu ZY, Lu L, Dai W, Xu M. Role of c-Fos/JunD in protecting stress-

induced cell death. Cell Prolif. 2007;40:431-44.

504. Schreiber M, Kolbus A, Piu F, Szabowski A, Mohle-Steinlein U, Tian J, Karin M, Angel

P, Wagner EF. Control of cell cycle progression by c-Jun is p53 dependent. Genes Dev.

1999;13:607-19.

505. Wisdom R, Johnson RS, Moore C. c-Jun regulates cell cycle progression and apoptosis

by distinct mechanisms. Embo J. 1999;18:188-97.

506. Bakiri L, Lallemand D, Bossy-Wetzel E, Yaniv M. Cell cycle-dependent variations in c-

Jun and JunB phosphorylation: a role in the control of cyclin D1 expression. Embo J.

2000;19:2056-68.

344

507. Devary Y, Gottlieb RA, Lau LF, Karin M. Rapid and preferential activation of the c-jun

gene during the mammalian UV response. Mol Cell Biol. 1991;11:2804-11.

508. Karin M. Mitogen-activated protein kinase cascades as regulators of stress responses.

Ann N Y Acad Sci. 1998;851:139-46.

509. Shaulian E, Karin M. AP-1 in cell proliferation and survival. Oncogene. 2001;20:2390-

400.

510. Bossy-Wetzel E, Bakiri L, Yaniv M. Induction of apoptosis by the transcription factor c-

Jun. Embo J. 1997;16:1695-709.

511. Ham J, Babij C, Whitfield J, Pfarr CM, Lallemand D, Yaniv M, Rubin LL. A c-Jun

dominant negative mutant protects sympathetic neurons against programmed cell death.

Neuron. 1995;14:927-39.

512. Eferl R, Sibilia M, Hilberg F, Fuchsbichler A, Kufferath I, Guertl B, Zenz R, Wagner EF,

Zatloukal K. Functions of c-Jun in liver and heart development. J Cell Biol.

1999;145:1049-61.

513. Hilberg F, Aguzzi A, Howells N, Wagner EF. c-jun is essential for normal mouse

development and hepatogenesis. Nature. 1993;365:179-81.

514. Estus S, Zaks WJ, Freeman RS, Gruda M, Bravo R, Johnson EM, Jr. Altered gene

expression in neurons during programmed cell death: identification of c-jun as necessary

for neuronal apoptosis. J Cell Biol. 1994;127:1717-27.

515. Le-Niculescu H, Bonfoco E, Kasuya Y, Claret FX, Green DR, Karin M. Withdrawal of

survival factors results in activation of the JNK pathway in neuronal cells leading to Fas

ligand induction and cell death. Mol Cell Biol. 1999;19:751-63.

516. Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg ME. Opposing effects of ERK and

JNK-p38 MAP kinases on apoptosis. Science. 1995;270:1326-31.

345

517. Shaulian E, Schreiber M, Piu F, Beeche M, Wagner EF, Karin M. The mammalian UV

response: c-Jun induction is required for exit from p53-imposed growth arrest. Cell.

2000;103:897-907.

518. Ivanov VN, Bhoumik A, Krasilnikov M, Raz R, Owen-Schaub LB, Levy D, Horvath CM,

Ronai Z. Cooperation between STAT3 and c-jun suppresses Fas transcription. Mol Cell.

2001;7:517-28.

519. Kim SH, Gunnery S, Choe JK, Mathews MB. Neoplastic progression in melanoma and

colon cancer is associated with increased expression and activity of the interferon-

inducible protein kinase, PKR. Oncogene. 2002;21:8741-8.

520. Steer JH, Kroeger KM, Abraham LJ, Joyce DA. Glucocorticoids suppress tumor necrosis

factor-alpha expression by human monocytic THP-1 cells by suppressing transactivation

through adjacent NF-kappa B and c-Jun-activating transcription factor-2 binding sites in

the promoter. J Biol Chem. 2000;275:18432-40.

521. Wang ZY, Sato H, Kusam S, Sehra S, Toney LM, Dent AL. Regulation of IL-10 gene

expression in Th2 cells by Jun proteins. J Immunol. 2005;174:2098-105.

522. He H, Li HL, Lin A, Gottlieb RA. Activation of the JNK pathway is important for

cardiomyocyte death in response to simulated ischemia. Cell Death Differ. 1999;6:987-91.

523. Yue TL, Ma XL, Gu JL, Ruffolo RR, Jr., Feuerstein GZ. Carvedilol inhibits activation of

stress-activated protein kinase and reduces reperfusion injury in perfused rabbit heart.

Eur J Pharmacol. 1998;345:61-5.

524. Fryer RM, Patel HH, Hsu AK, Gross GJ. Stress-activated protein kinase phosphorylation

during cardioprotection in the ischemic myocardium. Am J Physiol Heart Circ Physiol.

2001;281:H1184-92.

346

525. Iliodromitis EK, Gaitanaki C, Lazou A, Bofilis E, Karavolias GK, Beis I, Kremastinos

DT. Dissociation of stress-activated protein kinase (p38-MAPK and JNKs)

phosphorylation from the protective effect of preconditioning in vivo. J Mol Cell Cardiol.

2002;34:1019-28.

526. Talmor D, Applebaum A, Rudich A, Shapira Y, Tirosh A. Activation of mitogen-

activated protein kinases in human heart during cardiopulmonary bypass. Circ Res.

2000;86:1004-7.

527. Cook SA, Sugden PH, Clerk A. Activation of c-Jun N-terminal kinases and p38-mitogen-

activated protein kinases in human heart failure secondary to ischaemic heart disease. J

Mol Cell Cardiol. 1999;31:1429-34.

528. Hreniuk D, Garay M, Gaarde W, Monia BP, McKay RA, Cioffi CL. Inhibition of c-Jun

N-terminal kinase 1, but not c-Jun N-terminal kinase 2, suppresses apoptosis induced by

ischemia/reoxygenation in rat cardiac myocytes. Mol Pharmacol. 2001;59:867-74.

529. Ferrandi C, Ballerio R, Gaillard P, Giachetti C, Carboni S, Vitte PA, Gotteland JP, Cirillo

R. Inhibition of c-Jun N-terminal kinase decreases cardiomyocyte apoptosis and infarct

size after myocardial ischemia and reperfusion in anaesthetized rats. Br J Pharmacol.

2004;142:953-60.

530. Carboni S, Hiver A, Szyndralewiez C, Gaillard P, Gotteland JP, Vitte PA. AS601245

(1,3-benzothiazol-2-yl (2-[[2-(3-pyridinyl) ethyl] amino]-4 pyrimidinyl) acetonitrile): a c-

Jun NH2-terminal protein kinase inhibitor with neuroprotective properties. J Pharmacol

Exp Ther. 2004;310:25-32.

531. Kaiser RA, Liang Q, Bueno O, Huang Y, Lackey T, Klevitsky R, Hewett TE, Molkentin

JD. Genetic inhibition or activation of JNK1/2 protects the myocardium from ischemia-

reperfusion-induced cell death in vivo. J Biol Chem. 2005;280:32602-8.

347

532. Shao Z, Bhattacharya K, Hsich E, Park L, Walters B, Germann U, Wang YM, Kyriakis J,

Mohanlal R, Kuida K, Namchuk M, Salituro F, Yao YM, Hou WM, Chen X, Aronovitz

M, Tsichlis PN, Bhattacharya S, Force T, Kilter H. c-Jun N-terminal kinases mediate

reactivation of Akt and cardiomyocyte survival after hypoxic injury in vitro and in vivo.

Circ Res. 2006;98:111-8.

533. Lee KH, Kim SE, Lee YS. SP600125, a selective JNK inhibitor, aggravates hepatic

ischemia-reperfusion injury. Exp Mol Med. 2006;38:408-16.

534. Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell. 2000;103:239-52.

535. Barr RK, Bogoyevitch MA. The c-Jun N-terminal protein kinase family of mitogen-

activated protein kinases (JNK MAPKs). Int J Biochem Cell Biol. 2001;33:1047-63.

536. Resnick L, Fennell M. Targeting JNK3 for the treatment of neurodegenerative disorders.

Drug Discov Today. 2004;9:932-9.

537. Wagner AC, Mazzucchelli L, Miller M, Camoratto AM, Goke B. CEP-1347 inhibits

caerulein-induced rat pancreatic JNK activation and ameliorates caerulein pancreatitis.

Am J Physiol Gastrointest Liver Physiol. 2000;278:G165-72.

538. Han J, Lee JD, Bibbs L, Ulevitch RJ. A MAP kinase targeted by endotoxin and

hyperosmolarity in mammalian cells. Science. 1994;265:808-11.

539. Jiang Y, Chen C, Li Z, Guo W, Gegner JA, Lin S, Han J. Characterization of the structure

and function of a new mitogen-activated protein kinase (p38beta). J Biol Chem.

1996;271:17920-6.

540. Jiang Y, Gram H, Zhao M, New L, Gu J, Feng L, Di Padova F, Ulevitch RJ, Han J.

Characterization of the structure and function of the fourth member of p38 group

mitogen-activated protein kinases, p38delta. J Biol Chem. 1997;272:30122-8.

348

541. Ono K, Han J. The p38 signal transduction pathway: activation and function. Cell Signal.

2000;12:1-13.

542. Moriguchi T, Kuroyanagi N, Yamaguchi K, Gotoh Y, Irie K, Kano T, Shirakabe K, Muro

Y, Shibuya H, Matsumoto K, Nishida E, Hagiwara M. A novel kinase cascade mediated

by mitogen-activated protein kinase kinase 6 and MKK3. J Biol Chem. 1996;271:13675-

543. Mayor F, Jr., Jurado-Pueyo M, Campos PM, Murga C. Interfering with MAP kinase

docking interactions: implications and perspective for the p38 route. Cell Cycle.

2007;6:528-33.

544. Enslen H, Brancho DM, Davis RJ. Molecular determinants that mediate selective

activation of p38 MAP kinase isoforms. Embo J. 2000;19:1301-11.

545. Raingeaud J, Gupta S, Rogers JS, Dickens M, Han J, Ulevitch RJ, Davis RJ. Pro-

inflammatory cytokines and environmental stress cause p38 mitogen-activated protein

kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem.

1995;270:7420-6.

546. Maulik N, Yoshida T, Zu YL, Sato M, Banerjee A, Das DK. Ischemic preconditioning

triggers tyrosine kinase signaling: a potential role for MAPKAP kinase 2. Am J Physiol.

1998;275:H1857-64.

547. Lee SH, Park J, Che Y, Han PL, Lee JK. Constitutive activity and differential localization

of p38alpha and p38beta MAPKs in adult mouse brain. J Neurosci Res. 2000;60:623-31.

548. Kramer RM, Roberts EF, Um SL, Borsch-Haubold AG, Watson SP, Fisher MJ,

Jakubowski JA. p38 mitogen-activated protein kinase phosphorylates cytosolic

phospholipase A2 (cPLA2) in thrombin-stimulated platelets. Evidence that proline-

349

directed phosphorylation is not required for mobilization of arachidonic acid by cPLA2. J

Biol Chem. 1996;271:27723-9.

549. Kusuhara M, Takahashi E, Peterson TE, Abe J, Ishida M, Han J, Ulevitch R, Berk BC.

p38 Kinase is a negative regulator of angiotensin II signal transduction in vascular

smooth muscle cells: effects on Na+/H+ exchange and ERK1/2. Circ Res. 1998;83:824-

31.

550. Han J, Jiang Y, Li Z, Kravchenko VV, Ulevitch RJ. Activation of the transcription factor

MEF2C by the MAP kinase p38 in inflammation. Nature. 1997;386:296-9.

551. Huang C, Chen N, Ma WY, Dong Z. Vanadium induces AP-1- and NFkappB-dependent

transcription activity. Int J Oncol. 1998;13:711-5.

552. Raingeaud J, Whitmarsh AJ, Barrett T, Derijard B, Davis RJ. MKK3- and MKK6-

regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal

transduction pathway. Mol Cell Biol. 1996;16:1247-55.

553. Kim J, Nueda A, Meng YH, Dynan WS, Mivechi NF. Analysis of the phosphorylation of

human heat shock transcription factor-1 by MAP kinase family members. J Cell Biochem.

1997;67:43-54.

554. Huang C, Ma WY, Maxiner A, Sun Y, Dong Z. p38 kinase mediates UV-induced

phosphorylation of p53 protein at serine 389. J Biol Chem. 1999;274:12229-35.

555. Waskiewicz AJ, Flynn A, Proud CG, Cooper JA. Mitogen-activated protein kinases

activate the serine/threonine kinases Mnk1 and Mnk2. Embo J. 1997;16:1909-20.

556. Deak M, Clifton AD, Lucocq LM, Alessi DR. Mitogen- and stress-activated protein

kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38, and may mediate

activation of CREB. Embo J. 1998;17:4426-41.

350

557. New L, Zhao M, Li Y, Bassett WW, Feng Y, Ludwig S, Padova FD, Gram H, Han J.

Cloning and characterization of RLPK, a novel RSK-related protein kinase. J Biol Chem.

1999;274:1026-32.

558. New L, Jiang Y, Zhao M, Liu K, Zhu W, Flood LJ, Kato Y, Parry GC, Han J. PRAK, a

novel protein kinase regulated by the p38 MAP kinase. Embo J. 1998;17:3372-84.

559. Liebermann DA, Hoffman B, Vesely D. p53 induced growth arrest versus apoptosis and

its modulation by survival cytokines. Cell Cycle. 2007;6:166-70.

560. Piva R, Belardo G, Santoro MG. NF-kappaB: a stress-regulated switch for cell survival.

Antioxid Redox Signal. 2006;8:478-86.

561. Okamoto S, Krainc D, Sherman K, Lipton SA. Antiapoptotic role of the p38 mitogen-

activated protein kinase-myocyte enhancer factor 2 transcription factor pathway during

neuronal differentiation. Proc Natl Acad Sci U S A. 2000;97:7561-6.

562. Shi Y, Gaestel M. In the cellular garden of forking paths: how p38 MAPKs signal for

downstream assistance. Biol Chem. 2002;383:1519-36.

563. Yamauchi J, Nagao M, Kaziro Y, Itoh H. Activation of p38 mitogen-activated protein

kinase by signaling through G protein-coupled receptors. Involvement of Gbetagamma

and Galphaq/11 subunits. J Biol Chem. 1997;272:27771-7.

564. Matsumoto T, Turesson I, Book M, Gerwins P, Claesson-Welsh L. p38 MAP kinase

negatively regulates endothelial cell survival, proliferation, and differentiation in FGF-2-

stimulated angiogenesis. J Cell Biol. 2002;156:149-60.

565. Ma XL, Kumar S, Gao F, Louden CS, Lopez BL, Christopher TA, Wang C, Lee JC,

Feuerstein GZ, Yue TL. Inhibition of p38 mitogen-activated protein kinase decreases

cardiomyocyte apoptosis and improves cardiac function after myocardial ischemia and

reperfusion. Circulation. 1999;99:1685-91.

351

566. Porras A, Zuluaga S, Black E, Valladares A, Alvarez AM, Ambrosino C, Benito M,

Nebreda AR. P38 alpha mitogen-activated protein kinase sensitizes cells to apoptosis

induced by different stimuli. Mol Biol Cell. 2004;15:922-33.

567. Saurin AT, Martin JL, Heads RJ, Foley C, Mockridge JW, Wright MJ, Wang Y, Marber

MS. The role of differential activation of p38-mitogen-activated protein kinase in

preconditioned ventricular myocytes. Faseb J. 2000;14:2237-46.

568. Communal C, Colucci WS, Singh K. p38 mitogen-activated protein kinase pathway

protects adult rat ventricular myocytes against beta -adrenergic receptor-stimulated

apoptosis. Evidence for Gi-dependent activation. J Biol Chem. 2000;275:19395-400.

569. Liu ZG, Hsu H, Goeddel DV, Karin M. Dissection of TNF receptor 1 effector functions:

JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death.

Cell. 1996;87:565-76.

570. Natoli G, Costanzo A, Ianni A, Templeton DJ, Woodgett JR, Balsano C, Levrero M.

Activation of SAPK/JNK by TNF receptor 1 through a noncytotoxic TRAF2-dependent

pathway. Science. 1997;275:200-3.

571. Brewster JL, de Valoir T, Dwyer ND, Winter E, Gustin MC. An osmosensing signal

transduction pathway in yeast. Science. 1993;259:1760-3.

572. Hazzalin CA, Cano E, Cuenda A, Barratt MJ, Cohen P, Mahadevan LC. p38/RK is

essential for stress-induced nuclear responses: JNK/SAPKs and c-Jun/ATF-2

phosphorylation are insufficient. Curr Biol. 1996;6:1028-31.

573. Scott PH, Paul A, Belham CM, Peacock AJ, Wadsworth RM, Gould GW, Welsh D,

Plevin R. Hypoxic stimulation of the stress-activated protein kinases in pulmonary artery

fibroblasts. Am J Respir Crit Care Med. 1998;158:958-62.

352

574. Yin T, Sandhu G, Wolfgang CD, Burrier A, Webb RL, Rigel DF, Hai T, Whelan J.

Tissue-specific pattern of stress kinase activation in ischemic/reperfused heart and kidney.

J Biol Chem. 1997;272:19943-50.

575. House SL, Branch K, Newman G, Doetschman T, Schultz Jel J. Cardioprotection induced

by cardiac-specific overexpression of fibroblast growth factor-2 is mediated by the

MAPK cascade. Am J Physiol Heart Circ Physiol. 2005;289:H2167-75.

576. Maulik N, Watanabe M, Zu YL, Huang CK, Cordis GA, Schley JA, Das DK. Ischemic

preconditioning triggers the activation of MAP kinases and MAPKAP kinase 2 in rat

hearts. FEBS Lett. 1996;396:233-7.

577. Mocanu MM, Baxter GF, Yue Y, Critz SD, Yellon DM. The p38 MAPK inhibitor,

SB203580, abrogates ischaemic preconditioning in rat heart but timing of administration

is critical. Basic Res Cardiol. 2000;95:472-8.

578. Fryer RM, Hsu AK, Gross GJ. ERK and p38 MAP kinase activation are components of

opioid-induced delayed cardioprotection. Basic Res Cardiol. 2001;96:136-42.

579. Martin JL, Avkiran M, Quinlan RA, Cohen P, Marber MS. Antiischemic effects of

SB203580 are mediated through the inhibition of p38alpha mitogen-activated protein

kinase: Evidence from ectopic expression of an inhibition-resistant kinase. Circ Res.

2001;89:750-2.

580. Kabir AM, Cao X, Gorog DA, Tanno M, Bassi R, Bellahcene M, Quinlan RA, Davis RJ,

Flavell RA, Shattock MJ, Marber MS. Antimycin A induced cardioprotection is

dependent on pre-ischemic p38-MAPK activation but independent of MKK3. J Mol Cell

Cardiol. 2005;39:709-17.

581. Otsu K, Yamashita N, Nishida K, Hirotani S, Yamaguchi O, Watanabe T, Hikoso S,

Higuchi Y, Matsumura Y, Maruyama M, Sudo T, Osada H, Hori M. Disruption of a

353

single copy of the p38alpha MAP kinase gene leads to cardioprotection against ischemia-

reperfusion. Biochem Biophys Res Commun. 2003;302:56-60.

582. Schneider S, Chen W, Hou J, Steenbergen C, Murphy E. Inhibition of p38 MAPK

alpha/beta reduces ischemic injury and does not block protective effects of

preconditioning. Am J Physiol Heart Circ Physiol. 2001;280:H499-508.

583. Marais E, Genade S, Huisamen B, Strijdom JG, Moolman JA, Lochner A. Activation of

p38 MAPK induced by a multi-cycle ischaemic preconditioning protocol is associated

with attenuated p38 MAPK activity during sustained ischaemia and reperfusion. J Mol

Cell Cardiol. 2001;33:769-78.

584. Boulton TG, Yancopoulos GD, Gregory JS, Slaughter C, Moomaw C, Hsu J, Cobb MH.

An insulin-stimulated protein kinase similar to yeast kinases involved in cell cycle

control. Science. 1990;249:64-7.

585. Diaz B, Barnard D, Filson A, MacDonald S, King A, Marshall M. Phosphorylation of

Raf-1 serine 338-serine 339 is an essential regulatory event for Ras-dependent activation

and biological signaling. Mol Cell Biol. 1997;17:4509-16.

586. Frost JA, Steen H, Shapiro P, Lewis T, Ahn N, Shaw PE, Cobb MH. Cross-cascade

activation of ERKs and ternary complex factors by Rho family proteins. Embo J.

1997;16:6426-38.

587. Jelinek T, Dent P, Sturgill TW, Weber MJ. Ras-induced activation of Raf-1 is dependent

on tyrosine phosphorylation. Mol Cell Biol. 1996;16:1027-34.

588. Vojtek AB, Hollenberg SM, Cooper JA. Mammalian Ras interacts directly with the

serine/threonine kinase Raf. Cell. 1993;74:205-14.

589. Frodin M, Gammeltoft S. Role and regulation of 90 kDa ribosomal S6 kinase (RSK) in

signal transduction. Mol Cell Endocrinol. 1999;151:65-77.

354

590. Gille H, Kortenjann M, Thomae O, Moomaw C, Slaughter C, Cobb MH, Shaw PE. ERK

phosphorylation potentiates Elk-1-mediated ternary complex formation and

transactivation. Embo J. 1995;14:951-62.

591. Roberts PJ, Der CJ. Targeting the Raf-MEK-ERK mitogen-activated protein kinase

cascade for the treatment of cancer. Oncogene. 2007;26:3291-310.

592. Giroux S, Tremblay M, Bernard D, Cardin-Girard JF, Aubry S, Larouche L, Rousseau S,

Huot J, Landry J, Jeannotte L, Charron J. Embryonic death of Mek1-deficient mice

reveals a role for this kinase in angiogenesis in the labyrinthine region of the placenta.

Curr Biol. 1999;9:369-72.

593. Huser M, Luckett J, Chiloeches A, Mercer K, Iwobi M, Giblett S, Sun XM, Brown J,

Marais R, Pritchard C. MEK kinase activity is not necessary for Raf-1 function. Embo J.

2001;20:1940-51.

594. Kling DE, Brandon KL, Sollinger CA, Cavicchio AJ, Ge Q, Kinane TB, Donahoe PK,

Schnitzer JJ. Distribution of ERK1/2 and ERK3 during normal rat fetal lung development.

Anat Embryol (Berl). 2006;211:139-53.

595. Choukroun G, Hajjar R, Kyriakis JM, Bonventre JV, Rosenzweig A, Force T. Role of the

stress-activated protein kinases in endothelin-induced cardiomyocyte hypertrophy. J Clin

Invest. 1998;102:1311-20.

596. Aikawa R, Komuro I, Yamazaki T, Zou Y, Kudoh S, Tanaka M, Shiojima I, Hiroi Y,

Yazaki Y. Oxidative stress activates extracellular signal-regulated kinases through Src

and Ras in cultured cardiac myocytes of neonatal rats. J Clin Invest. 1997;100:1813-21.

597. Ho PD, Zechner DK, He H, Dillmann WH, Glembotski CC, McDonough PM. The Raf-

MEK-ERK cascade represents a common pathway for alteration of intracellular calcium

by Ras and protein kinase C in cardiac myocytes. J Biol Chem. 1998;273:21730-5.

355

598. Andreka P, Zang J, Dougherty C, Slepak TI, Webster KA, Bishopric NH. Cytoprotection

by Jun kinase during nitric oxide-induced cardiac myocyte apoptosis. Circ Res.

2001;88:305-12.

599. Yue TL, Wang C, Gu JL, Ma XL, Kumar S, Lee JC, Feuerstein GZ, Thomas H, Maleeff

B, Ohlstein EH. Inhibition of extracellular signal-regulated kinase enhances

Ischemia/Reoxygenation-induced apoptosis in cultured cardiac myocytes and exaggerates

reperfusion injury in isolated perfused heart. Circ Res. 2000;86:692-9.

600. Knight RJ, Buxton DB. Stimulation of c-Jun kinase and mitogen-activated protein kinase

by ischemia and reperfusion in the perfused rat heart. Biochem Biophys Res Commun.

1996;218:83-8.

601. Takeishi Y, Huang Q, Wang T, Glassman M, Yoshizumi M, Baines CP, Lee JD,

Kawakatsu H, Che W, Lerner-Marmarosh N, Zhang C, Yan C, Ohta S, Walsh RA, Berk

BC, Abe J. Src family kinase and adenosine differentially regulate multiple MAP kinases

in ischemic myocardium: modulation of MAP kinases activation by ischemic

preconditioning. J Mol Cell Cardiol. 2001;33:1989-2005.

602. Behrends M, Schulz R, Post H, Alexandrov A, Belosjorow S, Michel MC, Heusch G.

Inconsistent relation of MAPK activation to infarct size reduction by ischemic

preconditioning in pigs. Am J Physiol Heart Circ Physiol. 2000;279:H1111-9.

603. Araujo EG, Bianchi C, Faro R, Sellke FW. Oscillation in the activities of MEK/ERK1/2

during cardiopulmonary bypass in pigs. Surgery. 2001;130:182-91.

604. Yoshida K, Yoshiyama M, Omura T, Nakamura Y, Kim S, Takeuchi K, Iwao H,

Yoshikawa J. Activation of mitogen-activated protein kinases in the non-ischemic

myocardium of an acute myocardial infarction in rats. Jpn Circ J. 2001;65:808-14.

356

605. Li DY, Tao L, Liu H, Christopher TA, Lopez BL, Ma XL. Role of ERK1/2 in the anti-

apoptotic and cardioprotective effects of nitric oxide after myocardial ischemia and

reperfusion. Apoptosis. 2006;11:923-30.

606. Clerk A, Fuller SJ, Michael A, Sugden PH. Stimulation of "stress-regulated" mitogen-

activated protein kinases (stress-activated protein kinases/c-Jun N-terminal kinases and

p38-mitogen-activated protein kinases) in perfused rat hearts by oxidative and other

stresses. J Biol Chem. 1998;273:7228-34.

607. Strohm C, Barancik T, Bruhl ML, Kilian SA, Schaper W. Inhibition of the ER-kinase

cascade by PD98059 and UO126 counteracts ischemic preconditioning in pig

myocardium. J Cardiovasc Pharmacol. 2000;36:218-29.

608. Liu X, Wu X, Cai L, Tang C, Su J. Hypoxic preconditioning of cardiomyocytes and

cardioprotection: phophorylation of HIF-1alpha induced by p42/p44 mitogen-activated

protein kinases is involved. Pathophysiology. 2003;9:201-205.

609. Gao Y, Shan YQ, Pan MX, Wang Y, Tang LJ, Li H, Zhang Z. Protein kinase C-

dependent activation of P44/42 mitogen-activated protein kinase and heat shock protein

70 in signal transduction during hepatocyte ischemic preconditioning. World J

Gastroenterol. 2004;10:1019-27.

610. Park SS, Zhao H, Mueller RA, Xu Z. Bradykinin prevents reperfusion injury by targeting

mitochondrial permeability transition pore through glycogen synthase kinase 3beta. J Mol

Cell Cardiol. 2006;40:708-16.

611. Ping P, Zhang J, Huang S, Cao X, Tang XL, Li RC, Zheng YT, Qiu Y, Clerk A, Sugden

P, Han J, Bolli R. PKC-dependent activation of p46/p54 JNKs during ischemic

preconditioning in conscious rabbits. Am J Physiol. 1999;277:H1771-85.

357

612. Fryer RM, Pratt PF, Hsu AK, Gross GJ. Differential activation of extracellular signal

regulated kinase isoforms in preconditioning and opioid-induced cardioprotection. J

Pharmacol Exp Ther. 2001;296:642-9.

613. L'Allemain G, Pouyssegur J, Weber MJ. p42/mitogen-activated protein kinase as a

converging target for different growth factor signaling pathways: use of pertussis toxin as

a discrimination factor. Cell Regul. 1991;2:675-84.

614. Gardner AM, Johnson GL. Fibroblast growth factor-2 suppression of tumor necrosis

factor alpha-mediated apoptosis requires Ras and the activation of mitogen-activated

protein kinase. J Biol Chem. 1996;271:14560-6.

615. Iyengar L, Patkunanathan B, Lynch OT, McAvoy JW, Rasko JE, Lovicu FJ. Aqueous

humour- and growth factor-induced lens cell proliferation is dependent on

MAPK/ERK1/2 and Akt/PI3-K signalling. Exp Eye Res. 2006;83:667-78.

616. Fu XB, Yang YH, Sun TZ, Chen W, Li JY, Sheng ZY. Rapid mitogen-activated protein

kinase by basic fibroblast growth factor in rat intestine after ischemia/reperfusion injury.

World J Gastroenterol. 2003;9:1312-7.

617. Adam RM, Roth JA, Cheng HL, Rice DC, Khoury J, Bauer SB, Peters CA, Freeman MR.

Signaling through PI3K/Akt mediates stretch and PDGF-BB-dependent DNA synthesis

in bladder smooth muscle cells. J Urol. 2003;169:2388-93.

618. Hortala M, Estival A, Pradayrol L, Susini C, Clemente F. Identification of c-Jun as a

critical mediator for the intracrine 24 kDa FGF-2 isoform-induced cell proliferation. Int J

Cancer. 2005;114:863-9.

619. Chan TO, Rittenhouse SE, Tsichlis PN. AKT/PKB and other D3 phosphoinositide-

regulated kinases: kinase activation by phosphoinositide-dependent phosphorylation.

Annu Rev Biochem. 1999;68:965-1014.

358

620. Jones PF, Jakubowicz T, Pitossi FJ, Maurer F, Hemmings BA. Molecular cloning and

identification of a serine/threonine protein kinase of the second-messenger subfamily.

Proc Natl Acad Sci U S A. 1991;88:4171-5.

621. Coffer PJ, Woodgett JR. Molecular cloning and characterisation of a novel putative

protein-serine kinase related to the cAMP-dependent and protein kinase C families. Eur J

Biochem. 1991;201:475-81.

622. James SR, Downes CP, Gigg R, Grove SJ, Holmes AB, Alessi DR. Specific binding of

the Akt-1 protein kinase to phosphatidylinositol 3,4,5-trisphosphate without subsequent

activation. Biochem J. 1996;315 ( Pt 3):709-13.

623. Bellacosa A, Chan TO, Ahmed NN, Datta K, Malstrom S, Stokoe D, McCormick F, Feng

J, Tsichlis P. Akt activation by growth factors is a multiple-step process: the role of the

PH domain. Oncogene. 1998;17:313-25.

624. Milburn CC, Deak M, Kelly SM, Price NC, Alessi DR, Van Aalten DM. Binding of

phosphatidylinositol 3,4,5-trisphosphate to the pleckstrin homology domain of protein

kinase B induces a conformational change. Biochem J. 2003;375:531-8.

625. Suhara T, Mano T, Oliveira BE, Walsh K. Phosphatidylinositol 3-kinase/Akt signaling

controls endothelial cell sensitivity to Fas-mediated apoptosis via regulation of FLICE-

inhibitory protein (FLIP). Circ Res. 2001;89:13-9.

626. Abid MR, Guo S, Minami T, Spokes KC, Ueki K, Skurk C, Walsh K, Aird WC. Vascular

endothelial growth factor activates PI3K/Akt/forkhead signaling in endothelial cells.

Arterioscler Thromb Vasc Biol. 2004;24:294-300.

627. Rena G, Guo S, Cichy SC, Unterman TG, Cohen P. Phosphorylation of the transcription

factor forkhead family member FKHR by protein kinase B. J Biol Chem.

1999;274:17179-83.

359

628. Cardone MH, Roy N, Stennicke HR, Salvesen GS, Franke TF, Stanbridge E, Frisch S,

Reed JC. Regulation of cell death protease caspase-9 by phosphorylation. Science.

1998;282:1318-21.

629. Kane LP, Shapiro VS, Stokoe D, Weiss A. Induction of NF-kappaB by the Akt/PKB

kinase. Curr Biol. 1999;9:601-4.

630. Ozes ON, Mayo LD, Gustin JA, Pfeffer SR, Pfeffer LM, Donner DB. NF-kappaB

activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature.

1999;401:82-5.

631. Zong WX, Edelstein LC, Chen C, Bash J, Gelinas C. The prosurvival Bcl-2 homolog Bfl-

1/A1 is a direct transcriptional target of NF-kappaB that blocks TNFalpha-induced

apoptosis. Genes Dev. 1999;13:382-7.

632. Chu ZL, McKinsey TA, Liu L, Gentry JJ, Malim MH, Ballard DW. Suppression of tumor

necrosis factor-induced cell death by inhibitor of apoptosis c-IAP2 is under NF-kappaB

control. Proc Natl Acad Sci U S A. 1997;94:10057-62.

633. Kim AH, Khursigara G, Sun X, Franke TF, Chao MV. Akt phosphorylates and negatively

regulates apoptosis signal-regulating kinase 1. Mol Cell Biol. 2001;21:893-901.

634. Mocanu MM, Bell RM, Yellon DM. PI3 kinase and not p42/p44 appears to be implicated

in the protection conferred by ischemic preconditioning. J Mol Cell Cardiol.

2002;34:661-8.

635. Shiraishi I, Melendez J, Ahn Y, Skavdahl M, Murphy E, Welch S, Schaefer E, Walsh K,

Rosenzweig A, Torella D, Nurzynska D, Kajstura J, Leri A, Anversa P, Sussman MA.

Nuclear targeting of Akt enhances kinase activity and survival of cardiomyocytes. Circ

Res. 2004;94:884-91.

360

636. Krieg T, Qin Q, McIntosh EC, Cohen MV, Downey JM. ACh and adenosine activate

PI3-kinase in rabbit hearts through transactivation of receptor tyrosine kinases. Am J

Physiol Heart Circ Physiol. 2002;283:H2322-30.

637. Zhang YH, Wei W, Xu H, Wang YY, Wu WX. Inducing effects of hepatocyte growth

factor on the expression of vascular endothelial growth factor in human colorectal

carcinoma cells through MEK and PI3K signaling pathways. Chin Med J (Engl).

2007;120:743-8.

638. Ebner S, Dunbar M, McKinnon RD. Distinct roles for PI3K in proliferation and survival

of oligodendrocyte progenitor cells. J Neurosci Res. 2000;62:336-45.

639. Miho Y, Kouroku Y, Fujita E, Mukasa T, Urase K, Kasahara T, Isoai A, Momoi MY,

Momoi T. bFGF inhibits the activation of caspase-3 and apoptosis of P19 embryonal

carcinoma cells during neuronal differentiation. Cell Death Differ. 1999;6:463-70.

640. Arcaro A, Doepfner KT, Boller D, Guerreiro AS, Shalaby T, Jackson SP, Schoenwaelder

SM, Delattre O, Grotzer MA, Fischer B. Novel role for insulin as an autocrine growth

factor for malignant brain tumour cells. Biochem J. 2007;406:57-66.

641. Chaudhary LR, Hruska KA. The cell survival signal Akt is differentially activated by

PDGF-BB, EGF, and FGF-2 in osteoblastic cells. J Cell Biochem. 2001;81:304-11.

642. Fliss H, Gattinger D. Apoptosis in ischemic and reperfused rat myocardium. Circ Res.

1996;79:949-56.

643. Freude B, Masters TN, Robicsek F, Fokin A, Kostin S, Zimmermann R, Ullmann C,

Lorenz-Meyer S, Schaper J. Apoptosis is initiated by myocardial ischemia and executed

during reperfusion. J Mol Cell Cardiol. 2000;32:197-208.

644. Rizzuto R, Pinton P, Ferrari D, Chami M, Szabadkai G, Magalhaes PJ, Di Virgilio F,

Pozzan T. Calcium and apoptosis: facts and hypotheses. Oncogene. 2003;22:8619-27.

361

645. von Harsdorf R, Li PF, Dietz R. Signaling pathways in reactive oxygen species-induced

cardiomyocyte apoptosis. Circulation. 1999;99:2934-41.

646. Li PF, Dietz R, von Harsdorf R. Superoxide induces apoptosis in cardiomyocytes, but

proliferation and expression of transforming growth factor-beta1 in cardiac fibroblasts.

FEBS Lett. 1999;448:206-10.

647. Carmody RJ, Cotter TG. Signalling apoptosis: a radical approach. Redox Rep. 2001;6:77-

90.

648. Jugdutt BI, Idikio HA. Apoptosis and oncosis in acute coronary syndromes: assessment

and implications. Mol Cell Biochem. 2005;270:177-200.

649. Majno G, Joris I. Apoptosis, oncosis, and necrosis. An overview of cell death. Am J

Pathol. 1995;146:3-15.

650. Desagher S, Martinou JC. Mitochondria as the central control point of apoptosis. Trends

Cell Biol. 2000;10:369-77.

651. Bhardwaj A, Aggarwal BB. Receptor-mediated choreography of life and death. J Clin

Immunol. 2003;23:317-32.

652. Strasser A, O'Connor L, Dixit VM. Apoptosis signaling. Annu Rev Biochem.

2000;69:217-45.

653. Green DR, Kroemer G. The pathophysiology of mitochondrial cell death. Science.

2004;305:626-9.

654. Nagata S. Apoptosis by death factor. Cell. 1997;88:355-65.

655. Adrain C, Creagh, E. M., and Martin, S. J. Caspase Cascades in Apoptosis. Caspases-

their role in cell death and cell survival. Ed. Marek Los and Henning Walczak.

Moleculare Biology Intelligence Unit 24. 2002:41-51.

362

656. Hague A, and Paraskeva, C. Apoptosis and disease: a matter of cell fate. Nature Cell

Death and Differentiation. 2004;3:1-7.

657. Csipo I, Montel AH, Hobbs JA, Morse PA, Brahmi Z. Effect of Fas+ and Fas- target cells

on the ability of NK cells to repeatedly fragment DNA and trigger lysis via the Fas lytic

pathway. Apoptosis. 1998;3:105-14.

658. Cretney E, Takeda K, Smyth MJ. Cancer: novel therapeutic strategies that exploit the

TNF-related apoptosis-inducing ligand (TRAIL)/TRAIL receptor pathway. Int J Biochem

Cell Biol. 2007;39:280-6.

659. Kerr JF, Wyllie AH, Currie AR. Apoptosis: a basic biological phenomenon with wide-

ranging implications in tissue kinetics. Br J Cancer. 1972;26:239-57.

660. Wyllie AH. Glucocorticoid-induced thymocyte apoptosis is associated with endogenous

endonuclease activation. Nature. 1980;284:555-6.

661. Barrett KL, Willingham JM, Garvin AJ, Willingham MC. Advances in cytochemical

methods for detection of apoptosis. J Histochem Cytochem. 2001;49:821-32.

662. Trump BF, Berezesky IK, Chang SH, Phelps PC. The pathways of cell death: oncosis,

apoptosis, and necrosis. Toxicol Pathol. 1997;25:82-8.

663. Perez JF, Chemello ME, Liprandi F, Ruiz MC, Michelangeli F. Oncosis in MA104 cells

is induced by rotavirus infection through an increase in intracellular Ca2+ concentration.

Virology. 1998;252:17-27.

664. Gottlieb RA, Burleson KO, Kloner RA, Babior BM, Engler RL. Reperfusion injury

induces apoptosis in rabbit cardiomyocytes. J Clin Invest. 1994;94:1621-8.

665. Narula J, Haider N, Virmani R, DiSalvo TG, Kolodgie FD, Hajjar RJ, Schmidt U,

Semigran MJ, Dec GW, Khaw BA. Apoptosis in myocytes in end-stage heart failure. N

Engl J Med. 1996;335:1182-9.

363

666. Mallat Z, Tedgui A, Fontaliran F, Frank R, Durigon M, Fontaine G. Evidence of

apoptosis in arrhythmogenic right ventricular dysplasia. N Engl J Med. 1996;335:1190-6.

667. Chopra M, Sharma AC. Apoptotic cardiomyocyte hypertrophy during sepsis and septic

shock results from prolonged exposure to endothelin precursor. Front Biosci.

2007;12:3052-60.

668. Maulik N, Yoshida T, Das DK. Oxidative stress developed during the reperfusion of

ischemic myocardium induces apoptosis. Free Radic Biol Med. 1998;24:869-75.

669. Scarabelli TM, Stephanou A, Pasini E, Comini L, Raddino R, Knight RA, Latchman DS.

Different signaling pathways induce apoptosis in endothelial cells and cardiac myocytes

during ischemia/reperfusion injury. Circ Res. 2002;90:745-8.

670. Zhao ZQ, Velez DA, Wang NP, Hewan-Lowe KO, Nakamura M, Guyton RA, Vinten-

Johansen J. Progressively developed myocardial apoptotic cell death during late phase of

reperfusion. Apoptosis. 2001;6:279-90.

671. Halestrap AP. Calcium, mitochondria and reperfusion injury: a pore way to die. Biochem

Soc Trans. 2006;34:232-7.

672. Nossuli TO, Lakshminarayanan V, Baumgarten G, Taffet GE, Ballantyne CM, Michael

LH, Entman ML. A chronic mouse model of myocardial ischemia-reperfusion: essential

in cytokine studies. Am J Physiol Heart Circ Physiol. 2000;278:H1049-55.

673. Bielawska AE, Shapiro JP, Jiang L, Melkonyan HS, Piot C, Wolfe CL, Tomei LD,

Hannun YA, Umansky SR. Ceramide is involved in triggering of cardiomyocyte

apoptosis induced by ischemia and reperfusion. Am J Pathol. 1997;151:1257-63.

674. Gurevitch J, Frolkis I, Yuhas Y, Paz Y, Matsa M, Mohr R, Yakirevich V. Tumor necrosis

factor-alpha is released from the isolated heart undergoing ischemia and reperfusion. J

Am Coll Cardiol. 1996;28:247-52.

364

675. Krown KA, Page MT, Nguyen C, Zechner D, Gutierrez V, Comstock KL, Glembotski

CC, Quintana PJ, Sabbadini RA. Tumor necrosis factor alpha-induced apoptosis in

cardiac myocytes. Involvement of the sphingolipid signaling cascade in cardiac cell death.

J Clin Invest. 1996;98:2854-65.

676. Ferrari R, Agnoletti L, Comini L, Gaia G, Bachetti T, Cargnoni A, Ceconi C, Curello S,

Visioli O. Oxidative stress during myocardial ischaemia and heart failure. Eur Heart J.

1998;19 Suppl B:B2-11.

677. Kajstura J, Cheng W, Reiss K, Clark WA, Sonnenblick EH, Krajewski S, Reed JC,

Olivetti G, Anversa P. Apoptotic and necrotic myocyte cell deaths are independent

contributing variables of infarct size in rats. Lab Invest. 1996;74:86-107.

678. Schulze-Bergkamen H, Schuchmann M, Fleischer B, Galle PR. The role of apoptosis

versus oncotic necrosis in liver injury: facts or faith? J Hepatol. 2006;44:984-93.

679. Kim MS, Kim CJ, Jung HS, Seo MR, Juhnn YS, Shin HY, Ahn HS, Thiele CJ, Chi JG.

Fibroblast growth factor 2 induces differentiation and apoptosis of Askin tumour cells. J

Pathol. 2004;202:103-12.

680. Jaeschke H, Lemasters JJ. Apoptosis versus oncotic necrosis in hepatic

ischemia/reperfusion injury. Gastroenterology. 2003;125:1246-57.

681. Gu Q, Wang D, Wang X, Peng R, Liu J, Jiang T, Wang Z, Wang S, Deng H. Basic

fibroblast growth factor inhibits radiation-induced apoptosis of HUVECs. I. The

PI3K/AKT pathway and induction of phosphorylation of BAD. Radiat Res.

2004;161:692-702.

682. Schamberger CJ, Gerner C, Cerni C. bFGF rescues 423-cells from serum starvation-

induced apoptosis downstream of activated caspase-3. FEBS Lett. 2004;573:19-25.

365

683. Honma T, Honmou O, Iihoshi S, Harada K, Houkin K, Hamada H, Kocsis JD.

Intravenous infusion of immortalized human mesenchymal stem cells protects against

injury in a cerebral ischemia model in adult rat. Exp Neurol. 2006;199:56-66.

684. Jackson KA, Majka SM, Wang H, Pocius J, Hartley CJ, Majesky MW, Entman ML,

Michael LH, Hirschi KK, Goodell MA. Regeneration of ischemic cardiac muscle and

vascular endothelium by adult stem cells. J Clin Invest. 2001;107:1395-402.

685. Hooper M, Hardy K, Handyside A, Hunter S, Monk M. HPRT-deficient (Lesch-Nyhan)

mouse embryos derived from germline colonization by cultured cells. Nature.

1987;326:292-5.

686. van der Lugt N, Maandag ER, te Riele H, Laird PW, Berns A. A pgk::hprt fusion as a

selectable marker for targeting of genes in mouse embryonic stem cells: disruption of the

T-cell receptor delta-chain-encoding gene. Gene. 1991;105:263-7.

687. Askew GR, Doetschman T, Lingrel JB. Site-directed point mutations in embryonic stem

cells: a gene-targeting tag-and-exchange strategy. Mol Cell Biol. 1993;13:4115-24.

688. Ganguly A, Oo TF, Rzhetskaya M, Pratt R, Yarygina O, Momoi T, Kholodilov N, Burke

RE. CEP11004, a novel inhibitor of the mixed lineage kinases, suppresses apoptotic

death in dopamine neurons of the substantia nigra induced by 6-hydroxydopamine. J

Neurochem. 2004;88:469-80.

689. Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, Van Dyk

DE, Pitts WJ, Earl RA, Hobbs F, Copeland RA, Magolda RL, Scherle PA, Trzaskos JM.

Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol

Chem. 1998;273:18623-32.

366

690. Cuenda A, Rouse J, Doza YN, Meier R, Cohen P, Gallagher TF, Young PR, Lee JC. SB

203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular

stresses and interleukin-1. FEBS Lett. 1995;364:229-33.

691. Barros LF, Young M, Saklatvala J, Baldwin SA. Evidence of two mechanisms for the

activation of the glucose transporter GLUT1 by anisomycin: p38(MAP kinase) activation

and protein synthesis inhibition in mammalian cells. J Physiol. 1997;504 ( Pt 3):517-25.

692. Mohammadi M, Froum S, Hamby JM, Schroeder MC, Panek RL, Lu GH, Eliseenkova

AV, Green D, Schlessinger J, Hubbard SR. Crystal structure of an angiogenesis inhibitor

bound to the FGF receptor tyrosine kinase domain. Embo J. 1998;17:5896-904.

693. Niethammer P, Delling M, Sytnyk V, Dityatev A, Fukami K, Schachner M. Cosignaling

of NCAM via lipid rafts and the FGF receptor is required for neuritogenesis. J Cell Biol.

2002;157:521-32.

694. Chow S, Patel H, Hedley DW. Measurement of MAP kinase activation by flow

cytometry using phospho-specific antibodies to MEK and ERK: potential for

pharmacodynamic monitoring of signal transduction inhibitors. Cytometry. 2001;46:72-8.

695. Davies SP, Reddy H, Caivano M, Cohen P. Specificity and mechanism of action of some

commonly used protein kinase inhibitors. Biochem J. 2000;351:95-105.

696. Fishbein MC, Meerbaum S, Rit J, Lando U, Kanmatsuse K, Mercier JC, Corday E, Ganz

W. Early phase acute myocardial infarct size quantification: validation of the triphenyl

tetrazolium chloride tissue enzyme staining technique. Am Heart J. 1981;101:593-600.

697. Ricke RM, Bielinsky AK. A conserved Hsp10-like domain in Mcm10 is required to

stabilize the catalytic subunit of DNA polymerase-alpha in budding yeast. J Biol Chem.

2006;281:18414-25.

367

698. Negoescu A, Lorimier P, Labat-Moleur F, Drouet C, Robert C, Guillermet C, Brambilla

C, Brambilla E. In situ apoptotic cell labeling by the TUNEL method: improvement and

evaluation on cell preparations. J Histochem Cytochem. 1996;44:959-68.

699. Bessert DA, Skoff RP. High-resolution in situ hybridization and TUNEL staining with

free-floating brain sections. J Histochem Cytochem. 1999;47:693-702.

700. Smyth GK. Linear Models and Empirical Bayes Methods for Assessing Differential

Expression in Microarray Experiments. Statistical Aications in Genetics and Molecular

Biology 3. 2004.

701. Zhu X, Lough J. Expression of alternatively spliced and canonical basic fibroblast growth

factor mRNAs in the early embryo and developing heart. Dev Dyn. 1996;206:139-45.

702. Florkiewicz RZ, Sommer A. Human basic fibroblast growth factor gene encodes four

polypeptides: three initiate translation from non-AUG codons. Proc Natl Acad Sci U S A.

1989;86:3978-81.

703. Prats H, Kaghad M, Prats AC, Klagsbrun M, Lelias JM, Liauzun P, Chalon P, Tauber JP,

Amalric F, Smith JA, et al. High molecular mass forms of basic fibroblast growth factor

are initiated by alternative CUG codons. Proc Natl Acad Sci U S A. 1989;86:1836-40.

704. Schultz JJ HJ, Sullivan C, Doetschman T. FGF and the cardiovascular system. Fibroblast

growth factor in the cardiovascular system.Munich: I. Holzapfel Publishers;. 2002:45-66.

705. Htun P, Ito WD, Hoefer IE, Schaper J, Schaper W. Intramyocardial infusion of FGF-1

mimics ischemic preconditioning in pig myocardium. J Mol Cell Cardiol. 1998;30:867-

77.

706. Buehler A, Martire A, Strohm C, Wolfram S, Fernandez B, Palmen M, Wehrens XH,

Doevendans PA, Franz WM, Schaper W, Zimmermann R. Angiogenesis-independent

cardioprotection in FGF-1 transgenic mice. Cardiovasc Res. 2002;55:768-77.

368

707. Schaper W. Angiogenesis in the adult heart. Basic Res Cardiol. 1991;86 Suppl 2:51-6.

708. de Jonge N, Goumans MJ, Lips D, Hassink R, Vlug EJ, van der Meel R, Emmerson CD,

Nijman J, de Windt L, Doevendans PA. Controlling cardiomyocyte survival. Novartis

Found Symp. 2006;274:41-51; discussion 51-7, 152-5, 272-6.

709. Palmen M, Daemen MJ, De Windt LJ, Willems J, Dassen WR, Heeneman S,

Zimmermann R, Van Bilsen M, Doevendans PA. Fibroblast growth factor-1 improves

cardiac functional recovery and enhances cell survival after ischemia and reperfusion: a

fibroblast growth factor receptor, protein kinase C, and tyrosine kinase-dependent

mechanism. J Am Coll Cardiol. 2004;44:1113-23.

710. Rescan PY. Identification of a fibroblast growth factor 6 (FGF6) gene in a non-

mammalian vertebrate: continuous expression of FGF6 accompanies muscle fiber

hyperplasia. Biochim Biophys Acta. 1998;1443:305-14.

711. Sakuma K, Watanabe K, Sano M, Uramoto I, Totsuka T. Differential adaptation of

growth and differentiation factor 8/myostatin, fibroblast growth factor 6 and leukemia

inhibitory factor in overloaded, regenerating and denervated rat muscles. Biochim

Biophys Acta. 2000;1497:77-88.

712. Kim RD, Stein GS, Chari RS. Impact of cell swelling on proliferative signal transduction

in the liver. J Cell Biochem. 2001;83:56-69.

713. Escriba PV, Wedegaertner PB, Goni FM, Vogler O. Lipid-protein interactions in GPCR-

associated signaling. Biochim Biophys Acta. 2007;1768:836-52.

714. Matsuoka M, Igisu H, Nakagawa K, Katada T, Nishina H. Requirement of MKK4 and

MKK7 for CdCl2- or HgCl2-induced activation of c-Jun NH2-terminal kinase in mouse

embryonic stem cells. Toxicol Lett. 2004;152:175-81.

369

715. Wang X, Destrument A, Tournier C. Physiological roles of MKK4 and MKK7: Insights

from animal models. Biochim Biophys Acta. 2006.

716. Bouche G, Gas N, Prats H, Baldin V, Tauber JP, Teissie J, Amalric F. Basic fibroblast

growth factor enters the nucleolus and stimulates the transcription of ribosomal genes in

ABAE cells undergoing G0----G1 transition. Proc Natl Acad Sci U S A. 1987;84:6770-4.

717. Baldin V, Roman AM, Bosc-Bierne I, Amalric F, Bouche G. Translocation of bFGF to

the nucleus is G1 phase cell cycle specific in bovine aortic endothelial cells. Embo J.

1990;9:1511-7.

718. Hu G, Kim H, Xu C, Riordan JF. Fibroblast growth factors are translocated to the nucleus

of human endothelial cells in a microtubule- and lysosome-independent pathway.

Biochem Biophys Res Commun. 2000;273:551-6.

719. Dell'Era P, Presta M, Ragnotti G. Nuclear localization of endogenous basic fibroblast

growth factor in cultured endothelial cells. Exp Cell Res. 1991;192:505-10.

720. Tessler S, Neufeld G. Basic fibroblast growth factor accumulates in the nuclei of various

bFGF-producing cell types. J Cell Physiol. 1990;145:310-7.

721. George SJ, Beeching CA. Cadherin:catenin complex: a novel regulator of vascular

smooth muscle cell behaviour. Atherosclerosis. 2006;188:1-11.

722. Yoshida M, Minamisawa S, Shimura M, Komazaki S, Kume H, Zhang M, Matsumura K,

Nishi M, Saito M, Saeki Y, Ishikawa Y, Yanagisawa T, Takeshima H. Impaired Ca2+

store functions in skeletal and cardiac muscle cells from sarcalumenin-deficient mice. J

Biol Chem. 2005;280:3500-6.

723. Rysa J, Aro J, Ruskoaho H. Early left ventricular gene expression profile in response to

increase in blood pressure. Blood Press. 2006;15:375-83.

370

724. Tiganis T, Bennett AM. Protein tyrosine phosphatase function: the substrate perspective.

Biochem J. 2007;402:1-15.

725. Miller G, Wang EL, Nassar KL, Peter AK, Crosbie RH. Structural and functional

analysis of the sarcoglycan-sarcospan subcomplex. Exp Cell Res. 2007;313:639-51.

726. Nugent MA, Iozzo RV. Fibroblast growth factor-2. Int J Biochem Cell Biol. 2000;32:115-

20.

727. Okada-Ban M, Thiery JP, Jouanneau J. Fibroblast growth factor-2. Int J Biochem Cell

Biol. 2000;32:263-7.

728. Amann K, Faulhaber J, Campean V, Balajew V, Dono R, Mall G, Ehmke H. Impaired

myocardial capillarogenesis and increased adaptive capillary growth in FGF2-deficient

mice. Lab Invest. 2006;86:45-53.

729. Xiao L, Liu P, Sobue T, Lichtler A, Coffin JD, Hurley MM. Effect of overexpressing

fibroblast growth factor 2 protein isoforms in osteoblastic ROS 17/2.8 cells. J Cell

Biochem. 2003;89:1291-301.

730. Clubb FJ, Jr., Bishop SP. Formation of binucleated myocardial cells in the neonatal rat.

An index for growth hypertrophy. Lab Invest. 1984;50:571-7.

731. Azhar M, Schultz Jel J, Grupp I, Dorn GW, 2nd, Meneton P, Molin DG, Gittenberger-de

Groot AC, Doetschman T. Transforming growth factor beta in cardiovascular

development and function. Cytokine Growth Factor Rev. 2003;14:391-407.

732. Fischer R, Dechend R, Gapelyuk A, Shagdarsuren E, Gruner K, Gruner A, Gratze P,

Qadri F, Wellner M, Fiebeler A, Dietz R, Luft FC, Muller DN, Schirdewan A.

Angiotensin II-induced sudden arrhythmic death and electrical remodeling. Am J Physiol

Heart Circ Physiol. 2007;293:H1242-53.

371

733. Speir E, Tanner V, Gonzalez AM, Farris J, Baird A, Casscells W. Acidic and basic

fibroblast growth factors in adult rat heart myocytes. Localization, regulation in culture,

and effects on DNA synthesis. Circ Res. 1992;71:251-9.

734. Hartung H, Feldman B, Lovec H, Coulier F, Birnbaum D, Goldfarb M. Murine FGF-12

and FGF-13: expression in embryonic nervous system, connective tissue and heart. Mech

Dev. 1997;64:31-9.

735. Cuevas P, Carceller F, Martinez-Coso V, Cuevas B, Fernandez-Ayerdi A, Reimers D,

Asin-Cardiel E, Gimenez-Gallego G. Cardioprotection from ischemia by fibroblast

growth factor: role of inducible nitric oxide synthase. Eur J Med Res. 1999;4:517-24.

736. Cuevas P, Revilla C, Herreras O, Largo C, Gimenez-Gallego G. Neuroprotective effect of

acidic fibroblast growth factor on seizure-associated brain damage. Neurol Res.

1994;16:365-9.

737. Cuevas P, Carceller F, Hernandez-Madrid A, Cuevas B, Martinez-Coso V, Gimenez-

Gallego G. Protective effects of acidic fibroblast growth factor against cardiac

arrhythmias induced by ischemia and reperfusion in rats. Eur J Med Res. 1997;2:33-6.

738. Cuevas P, Carceller F, Cuevas B, Gimenez-Gallego G, Martinez-Coso V. A non-

mitogenic form of acidic fibroblast growth factor reduces neutrophil infiltration in rat

ischemic reperfused heart. Eur J Med Res. 1997;2:139-43.

739. Cuevas P, Carceller F, Reimers D, Saenz de Tejada I, Gimenez-Gallego G. Acidic

fibroblast growth factor rescues gerbil hippocampal neurons from ischemic apoptotic

death. Neurol Res. 1998;20:271-4.

740. Cuevas P, Carceller F, Redondo-Horcajo M, Lozano RM, Gimenez-Gallego G. Systemic

administration of acidic fibroblast growth factor ameliorates the ischemic injury of the

retina in rats. Neurosci Lett. 1998;255:1-4.

372

741. Hearse DJ, Sutherland FJ. Experimental models for the study of cardiovascular function

and disease. Pharmacol Res. 2000;41:597-603.

742. Grupp IL, Subramaniam A, Hewett TE, Robbins J, Grupp G. Comparison of normal,

hypodynamic, and hyperdynamic mouse hearts using isolated work-performing heart

preparations. Am J Physiol. 1993;265:H1401-10.

743. Kiriazis H, Kranias EG. Genetically engineered models with alterations in cardiac

membrane calcium-handling proteins. Annu Rev Physiol. 2000;62:321-51.

744. Haghighi K, Gregory KN, Kranias EG. Sarcoplasmic reticulum Ca-ATPase-

phospholamban interactions and dilated cardiomyopathy. Biochem Biophys Res Commun.

2004;322:1214-22.

745. Frank KF, Bolck B, Brixius K, Kranias EG, Schwinger RH. Modulation of SERCA:

implications for the failing human heart. Basic Res Cardiol. 2002;97 Suppl 1:I72-8.

746. Yatani A, Kim SJ, Kudej RK, Wang Q, Depre C, Irie K, Kranias EG, Vatner SF, Vatner

DE. Insights into cardioprotection obtained from study of cellular Ca2+ handling in

myocardium of true hibernating mammals. Am J Physiol Heart Circ Physiol.

2004;286:H2219-28.

747. Chu G, Luo W, Slack JP, Tilgmann C, Sweet WE, Spindler M, Saupe KW, Boivin GP,

Moravec CS, Matlib MA, Grupp IL, Ingwall JS, Kranias EG. Compensatory mechanisms

associated with the hyperdynamic function of phospholamban-deficient mouse hearts.

Circ Res. 1996;79:1064-76.

748. Xiao RP. Beta-adrenergic signaling in the heart: dual coupling of the beta2-adrenergic

receptor to G(s) and G(i) proteins. Sci STKE. 2001;2001:RE15.

749. Christopher PT, Parker KJ. New approaches to the linear propagation of acoustic fields. J

Acoust Soc Am. 1991;90:507-21.

373

750. Kishi K, Muromoto N, Nakaya Y, Miyata I, Hagi A, Hayashi H, Ebina Y. Bradykinin

directly triggers GLUT4 translocation via an insulin-independent pathway. Diabetes.

1998;47:550-8.

751. Usui I, Imamura T, Huang J, Satoh H, Olefsky JM. Cdc42 is a Rho GTPase family

member that can mediate insulin signaling to glucose transport in 3T3-L1 adipocytes. J

Biol Chem. 2003;278:13765-74.

752. O'Brien RM, Houslay MD, Milligan G, Siddle K. The insulin receptor tyrosyl kinase

phosphorylates holomeric forms of the guanine nucleotide regulatory proteins Gi and Go.

FEBS Lett. 1987;212:281-8.

753. Klagsbrun M, Baird A. A dual receptor system is required for basic fibroblast growth

factor activity. Cell. 1991;67:229-31.

754. Malhotra A, Kang BP, Opawumi D, Belizaire W, Meggs LG. Molecular biology of

protein kinase C signaling in cardiac myocytes. Mol Cell Biochem. 2001;225:97-107.

755. Le Good JA, Ziegler WH, Parekh DB, Alessi DR, Cohen P, Parker PJ. Protein kinase C

isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1.

Science. 1998;281:2042-5.

756. Dutil EM, Toker A, Newton AC. Regulation of conventional protein kinase C isozymes

by phosphoinositide-dependent kinase 1 (PDK-1). Curr Biol. 1998;8:1366-75.

757. Behn-Krappa A, Newton AC. The hydrophobic phosphorylation motif of conventional

protein kinase C is regulated by autophosphorylation. Curr Biol. 1999;9:728-37.

758. Dutil EM, Newton AC. Dual role of pseudosubstrate in the coordinated regulation of

protein kinase C by phosphorylation and diacylglycerol. J Biol Chem. 2000;275:10697-

701.

374

759. Kraft AS, Anderson WB, Cooper HL, Sando JJ. Decrease in cytosolic

calcium/phospholipid-dependent protein kinase activity following phorbol ester treatment

of EL4 thymoma cells. J Biol Chem. 1982;257:13193-6.

760. Kraft AS, Anderson WB. Phorbol esters increase the amount of Ca2+, phospholipid-

dependent protein kinase associated with plasma membrane. Nature. 1983;301:621-3.

761. Williamson AJ, Dibling BC, Boyne JR, Selby P, Burchill SA. Basic fibroblast growth

factor-induced cell death is effected through sustained activation of p38MAPK and up-

regulation of the death receptor p75NTR. J Biol Chem. 2004;279:47912-28.

762. Gospodarowicz D. Isolation and characterization of acidic and basic fibroblast growth

factor. Methods Enzymol. 1987;147:106-19.

763. Lin A. Activation of the JNK signaling pathway: breaking the brake on apoptosis.

Bioessays. 2003;25:17-24.

764. Sugden PH, Clerk A. "Stress-responsive" mitogen-activated protein kinases (c-Jun N-

terminal kinases and p38 mitogen-activated protein kinases) in the myocardium. Circ Res.

1998;83:345-52.

765. Guan QH, Pei DS, Zhang QG, Hao ZB, Xu TL, Zhang GY. The neuroprotective action of

SP600125, a new inhibitor of JNK, on transient brain ischemia/reperfusion-induced

neuronal death in rat hippocampal CA1 via nuclear and non-nuclear pathways. Brain Res.

2005;1035:51-9.

766. Watson A, Eilers A, Lallemand D, Kyriakis J, Rubin LL, Ham J. Phosphorylation of c-

Jun is necessary for apoptosis induced by survival signal withdrawal in cerebellar granule

neurons. J Neurosci. 1998;18:751-62.

767. Hagemann C, Blank JL. The ups and downs of MEK kinase interactions. Cell Signal.

2001;13:863-75.

375

768. Abe J, Baines CP, Berk BC. Role of mitogen-activated protein kinases in ischemia and

reperfusion injury : the good and the bad. Circ Res. 2000;86:607-9.

769. Andreka P, Nadhazi Z, Muzes G, Szantho G, Vandor L, Konya L, Turner MS, Tulassay Z,

Bishopric NH. Possible therapeutic targets in cardiac myocyte apoptosis. Curr Pharm

Des. 2004;10:2445-61.

770. Burchill SA, Westwood G. Mechanism of basic fibroblast growth factor-induced cell

death. Apoptosis. 2002;7:5-12.

771. Karsan A, Yee E, Poirier GG, Zhou P, Craig R, Harlan JM. Fibroblast growth factor-2

inhibits endothelial cell apoptosis by Bcl-2-dependent and independent mechanisms. Am

J Pathol. 1997;151:1775-84.

772. Fox JC, Shanley JR. Antisense inhibition of basic fibroblast growth factor induces

apoptosis in vascular smooth muscle cells. J Biol Chem. 1996;271:12578-84.

773. Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science.

1998;281:1322-6.

774. Liu J, Lin A. Role of JNK activation in apoptosis: a double-edged sword. Cell Res.

2005;15:36-42.

775. Brichese L, Cazettes G, Valette A. JNK is associated with Bcl-2 and PP1 in mitochondria:

paclitaxel induces its activation and its association with the phosphorylated form of Bcl-2.

Cell Cycle. 2004;3:1312-9.

776. Sharpe JC, Arnoult D, Youle RJ. Control of mitochondrial permeability by Bcl-2 family

members. Biochim Biophys Acta. 2004;1644:107-13.

777. Ma X, Dang X, Claus P, Hirst C, Fandrich RR, Jin Y, Grothe C, Kirshenbaum LA,

Cattini PA, Kardami E. Chromatin compaction and cell death by high molecular weight

376

FGF-2 depend on its nuclear localization, intracrine ERK activation, and engagement of

mitochondria. J Cell Physiol. 2007.

778. Churchill EN, Szweda LI. Translocation of deltaPKC to mitochondria during cardiac

reperfusion enhances superoxide anion production and induces loss in mitochondrial

function. Arch Biochem Biophys. 2005;439:194-9.

779. Uehara T, Bennett B, Sakata ST, Satoh Y, Bilter GK, Westwick JK, Brenner DA. JNK

mediates hepatic ischemia reperfusion injury. J Hepatol. 2005;42:850-9.

780. Lee YR, Lee CK, Park HJ, Kim H, Kim J, Lee KS, Lee YL, Min KO, Kim B. c-Jun N-

terminal kinase contributes to norepinephrine-induced contraction through

phosphorylation of caldesmon in rat aortic smooth muscle. J Pharmacol Sci.

2006;100:119-25.

781. Petrich BG, Gong X, Lerner DL, Wang X, Brown JH, Saffitz JE, Wang Y. c-Jun N-

terminal kinase activation mediates downregulation of connexin43 in cardiomyocytes.

Circ Res. 2002;91:640-7.

782. Smith JH, Green CR, Peters NS, Rothery S, Severs NJ. Altered patterns of gap junction

distribution in ischemic heart disease. An immunohistochemical study of human

myocardium using laser scanning confocal microscopy. Am J Pathol. 1991;139:801-21.

783. Peters NS, Wit AL. Gap junction remodeling in infarction: does it play a role in

arrhythmogenesis? J Cardiovasc Electrophysiol. 2000;11:488-90.

784. Poelzing S, Rosenbaum DS. Nature, significance, and mechanisms of electrical

heterogeneities in ventricle. Anat Rec A Discov Mol Cell Evol Biol. 2004;280:1010-7.

785. Ross GE, Bever FN, Uddin Z, Devireddy L, Gardin JM. Common scenarios to clarify the

interpretation of cardiac markers. J Am Osteopath Assoc. 2004;104:165-76.

377

786. Antman EM, Fox KM. Guidelines for the diagnosis and management of unstable angina

and non-Q-wave myocardial infarction: proposed revisions. International Cardiology

Forum. Am Heart J. 2000;139:461-75.

787. Wolff RA, Chien GL, van Winkle DM. Propidium iodide compares favorably with

histology and triphenyl tetrazolium chloride in the assessment of experimentally-induced

infarct size. J Mol Cell Cardiol. 2000;32:225-32.

788. Vivaldi MT, Kloner RA, Schoen FJ. Triphenyltetrazolium staining of irreversible

ischemic injury following coronary artery occlusion in rats. Am J Pathol. 1985;121:522-

30.

789. Green DR, Reed JC. Mitochondria and apoptosis. Science. 1998;281:1309-12.

790. Maloof P, Wang Q, Wang H, Stein D, Denny TN, Yahalom J, Fenig E, Wieder R.

Overexpression of basic fibroblast growth factor (FGF-2) downregulates Bcl-2 and

promotes apoptosis in MCF-7 human breast cancer cells. Breast Cancer Res Treat.

1999;56:153-67.

791. Ejercito M, Wolfe J. Caspase-like activity is required for programmed nuclear

elimination during conjugation in Tetrahymena. J Eukaryot Microbiol. 2003;50:427-9.

792. Lipton P. Ischemic cell death in brain neurons. Physiol Rev. 1999;79:1431-568.

793. Vazquez-Ortiz G, Pina-Sanchez P, Vazquez K, Duenas A, Taja L, Mendoza P, Garcia JA,

Salcedo M. Overexpression of cathepsin F, matrix metalloproteinases 11 and 12 in

cervical cancer. BMC Cancer. 2005;5:68.

794. Chatterjee PK, Todorovic Z, Sivarajah A, Mota-Filipe H, Brown PA, Stewart KN,

Mazzon E, Cuzzocrea S, Thiemermann C. Inhibitors of calpain activation (PD150606 and

E-64) and renal ischemia-reperfusion injury. Biochem Pharmacol. 2005;69:1121-31.

378

795. Mattiazzi A, Vittone L, Mundina-Weilenmann C. Ca2+/calmodulin-dependent protein

kinase: a key component in the contractile recovery from acidosis. Cardiovasc Res.

2007;73:648-56.

796. Sasaki T, Inui M, Kimura Y, Kuzuya T, Tada M. Molecular mechanism of regulation of

Ca2+ pump ATPase by phospholamban in cardiac sarcoplasmic reticulum. Effects of

synthetic phospholamban peptides on Ca2+ pump ATPase. J Biol Chem. 1992;267:1674-

797. Wheelock MJ, Johnson KR. Cadherins as modulators of cellular phenotype. Annu Rev

Cell Dev Biol. 2003;19:207-35.

798. Tansey EE, Kwaku KF, Hammer PE, Cowan DB, Federman M, Levitsky S, McCully JD.

Reduction and redistribution of gap and adherens junction proteins after ischemia and

reperfusion. Ann Thorac Surg. 2006;82:1472-9.

799. Shaw RM, Fay AJ, Puthenveedu MA, von Zastrow M, Jan YN, Jan LY. Microtubule

plus-end-tracking proteins target gap junctions directly from the cell interior to adherens

junctions. Cell. 2007;128:547-60.

800. Bianchi C, Araujo EG, Sato K, Sellke FW. Biochemical and structural evidence for pig

myocardium adherens junction disruption by cardiopulmonary bypass. Circulation.

2001;104:I319-24.

801. Ferreira-Cornwell MC, Luo Y, Narula N, Lenox JM, Lieberman M, Radice GL.

Remodeling the intercalated disc leads to cardiomyopathy in mice misexpressing

cadherins in the heart. J Cell Sci. 2002;115:1623-34.

802. Zhao J, Yang Y, you S, Cui C, Gao R. Carvedilol preserves endothelial junctions and

reduces myocardial no-reflow after acute myocardial infarction and reperfusion. Int J

Cardiol. 2007;115:334-41.

379

803. Williams EJ, Mittal B, Walsh FS, Doherty P. FGF inhibits neurite outgrowth over

monolayers of astrocytes and fibroblasts expressing transfected cell adhesion molecules.

J Cell Sci. 1995;108 ( Pt 11):3523-30.

804. El-Hariry I, Pignatelli M, Lemoine NR. FGF-1 and FGF-2 modulate the E-

cadherin/catenin system in pancreatic adenocarcinoma cell lines. Br J Cancer.

2001;84:1656-63.

805. Coral-Vazquez R, Cohn RD, Moore SA, Hill JA, Weiss RM, Davisson RL, Straub V,

Barresi R, Bansal D, Hrstka RF, Williamson R, Campbell KP. Disruption of the

sarcoglycan-sarcospan complex in vascular smooth muscle: a novel mechanism for

cardiomyopathy and muscular dystrophy. Cell. 1999;98:465-74.

806. Badorff C, Lee GH, Knowlton KU. Enteroviral cardiomyopathy: bad news for the

dystrophin-glycoprotein complex. Herz. 2000;25:227-32.

807. MacLennan DH, Kranias EG. Phospholamban: a crucial regulator of cardiac contractility.

Nat Rev Mol Cell Biol. 2003;4:566-77.

808. Maack C, O'Rourke B. Excitation-contraction coupling and mitochondrial energetics.

Basic Res Cardiol. 2007;102:369-92.

809. Tanaka K, Nogawa S, Nagata E, Suzuki S, Dembo T, Kosakai A, Fukuuchi Y. Temporal

profile of CREB phosphorylation after focal ischemia in rat brain. Neuroreport.

1999;10:2245-50.

810. Cittadini A, Monti MG, Iaccarino G, Di Rella F, Tsichlis PN, Di Gianni A, Stromer H,

Sorriento D, Peschle C, Trimarco B, Sacca L, Condorelli G. Adenoviral gene transfer of

Akt enhances myocardial contractility and intracellular calcium handling. Gene Ther.

2006;13:8-19.

380

811. Calloe K, Nielsen MS, Grunnet M, Schmitt N, Jorgensen NK. KCNQ channels are

involved in the regulatory volume decrease response in primary neonatal rat

cardiomyocytes. Biochim Biophys Acta. 2007;1773:764-73.

812. Inserte J, Garcia-Dorado D, Hernando V, Barba I, Soler-Soler J. Ischemic

preconditioning prevents calpain-mediated impairment of Na+/K+-ATPase activity

during early reperfusion. Cardiovasc Res. 2006;70:364-73.

813. Solaroglu I, Tsubokawa T, Cahill J, Zhang JH. Anti-apoptotic effect of granulocyte-

colony stimulating factor after focal cerebral ischemia in the rat. Neuroscience.

2006;143:965-74.

814. Wang Z, Rabb H, Craig T, Burnham C, Shull GE, Soleimani M. Ischemic-reperfusion

injury in the kidney: overexpression of colonic H+-K+-ATPase and suppression of NHE-

3. Kidney Int. 1997;51:1106-15.

815. Nordstrom EA, Ryden M, Backlund EC, Dahlman I, Kaaman M, Blomqvist L, Cannon B,

Nedergaard J, Arner P. A human-specific role of cell death-inducing DFFA (DNA

fragmentation factor-alpha)-like effector A (CIDEA) in adipocyte lipolysis and obesity.

Diabetes. 2005;54:1726-34.

816. Kniep EM, Roehlecke C, Ozkucur N, Steinberg A, Reber F, Knels L, Funk RH.

Inhibition of apoptosis and reduction of intracellular pH decrease in retinal neural cell

cultures by a blocker of carbonic anhydrase. Invest Ophthalmol Vis Sci. 2006;47:1185-92.

817. Vila-Petroff M, Salas MA, Said M, Valverde CA, Sapia L, Portiansky E, Hajjar RJ,

Kranias EG, Mundina-Weilenmann C, Mattiazzi A. CaMKII inhibition protects against

necrosis and apoptosis in irreversible ischemia-reperfusion injury. Cardiovasc Res.

2007;73:689-98.

381

818. Riva C, Chauvin C, Pison C, Leverve X. Cellular physiology and molecular events in

hypoxia-induced apoptosis. Anticancer Res. 1998;18:4729-36.

819. Yu PJ, Ferrari G, Galloway AC, Mignatti P, Pintucci G. Basic fibroblast growth factor

(FGF-2): the high molecular weight forms come of age. J Cell Biochem. 2007;100:1100-

820. Pintucci G, Yu PJ, Saponara F, Kadian-Dodov DL, Galloway AC, Mignatti P. PDGF-BB

induces vascular smooth muscle cell expression of high molecular weight FGF-2, which

accumulates in the nucleus. J Cell Biochem. 2005;95:1292-300.

821. Jimenez SK, Sheikh F, Jin Y, Detillieux KA, Dhaliwal J, Kardami E, Cattini PA.

Transcriptional regulation of FGF-2 gene expression in cardiac myocytes. Cardiovasc

Res. 2004;62:548-57.

822. Levin EG, Sikora L, Ding L, Rao SP, Sriramarao P. Suppression of tumor growth and

angiogenesis in vivo by a truncated form of 24-kd fibroblast growth factor (FGF)-2. Am J

Pathol. 2004;164:1183-90.

823. Wang Y, Sun Y. Insulin-like growth factor receptor-1 as an anti-cancer target: blocking

transformation and inducing apoptosis. Curr Cancer Drug Targets. 2002;2:191-207.

824. Forough R, Weylie B, Collins C, Parker JL, Zhu J, Barhoumi R, Watson DK.

Transcription factor Ets-1 regulates fibroblast growth factor-1-mediated angiogenesis in

vivo: role of Ets-1 in the regulation of the PI3K/AKT/MMP-1 pathway. J Vasc Res.

2006;43:327-37.

825. Saadeh PB, Mehrara BJ, Steinbrech DS, Spector JA, Greenwald JA, Chin GS, Ueno H,

Gittes GK, Longaker MT. Mechanisms of fibroblast growth factor-2 modulation of

vascular endothelial growth factor expression by osteoblastic cells. Endocrinology.

2000;141:2075-83.

382

826. Bicknell E. Mechanistic insights into tumor angiogenesis. In: bcknell ER, Lewis CE,

Ferrara N, eds. Tumor angiogenesis. Oxford, UK: Oxford University Press. 1997:19-28.

827. Cuevas P, Carceller F, Lozano RM, Crespo A, Zazo M, Gimenez-Gallego G. Protection

of rat myocardium by mitogenic and non-mitogenic fibroblast growth factor during post-

ischemic reperfusion. Growth Factors. 1997;15:29-40.

828. Yanagisawa-Miwa A, Uchida Y, Nakamura F, Tomaru T, Kido H, Kamijo T, Sugimoto T,

Kaji K, Utsuyama M, Kurashima C, et al. Salvage of infarcted myocardium by

angiogenic action of basic fibroblast growth factor. Science. 1992;257:1401-3.

829. Thomas-Mudge RJ, Okada-Ban M, Vandenbroucke F, Vincent-Salomon A, Girault JM,

Thiery JP, Jouanneau J. Nuclear FGF-2 facilitates cell survival in vitro and during

establishment of metastases. Oncogene. 2004;23:4771-9.

830. Cohen MV, Yang XM, Downey JM. Smaller infarct after preconditioning does not

predict extent of early functional improvement of reperfused heart. Am J Physiol.

1999;277:H1754-61.

831. Jenkins DP, Pugsley WB, Yellon DM. Ischaemic preconditioning in a model of global

ischaemia: infarct size limitation, but no reduction of stunning. J Mol Cell Cardiol.

1995;27:1623-32.

832. Piotrowicz RS, Martin JL, Dillman WH, Levin EG. The 27-kDa heat shock protein

facilitates basic fibroblast growth factor release from endothelial cells. J Biol Chem.

1997;272:7042-7.

833. Santiago JJ. Angiotensin-II stimulates expression and release of pro-hypertrophic high

molecular weight FGF-2 by cardiac fibroblasts. J Mol Cell Cardiol. 2004;38:834.

834. Braz JC, Gregory K, Pathak A, Zhao W, Sahin B, Klevitsky R, Kimball TF, Lorenz JN,

Nairn AC, Liggett SB, Bodi I, Wang S, Schwartz A, Lakatta EG, DePaoli-Roach AA,

383

Robbins J, Hewett TE, Bibb JA, Westfall MV, Kranias EG, Molkentin JD. PKC-alpha

regulates cardiac contractility and propensity toward heart failure. Nat Med. 2004;10:248-

54.

835. Zhu H, Ramnarayan K, Anchin J, Miao WY, Sereno A, Millman L, Zheng J, Balaji VN,

Wolff ME. Glu-96 of basic fibroblast growth factor is essential for high affinity receptor

binding. Identification by structure-based site-directed mutagenesis. J Biol Chem.

1995;270:21869-74.

836. Florkiewicz RZ, Baird A, Gonzalez AM. Multiple forms of bFGF: differential nuclear

and cell surface localization. Growth Factors. 1991;4:265-75.

837. Lepple-Wienhues A, Berweck S, Bohmig M, Leo CP, Meyling B, Garbe C, Wiederholt

M. K+ channels and the intracellular calcium signal in human melanoma cell

proliferation. J Membr Biol. 1996;151:149-57.

838. Jones WK, Brown M, Ren X, He S, McGuinness M. NF-kappaB as an integrator of

diverse signaling pathways: the heart of myocardial signaling? Cardiovasc Toxicol.

2003;3:229-54.

839. Han RO, Ray PE, Baughman KL, Feldman AM. Detection of interleukin and interleukin-

receptor mRNA in human heart by polymerase chain reaction. Biochem Biophys Res

Commun. 1991;181:520-3.

840. Satoh M, Tamura G, Segawa I, Tashiro A, Hiramori K, Satodate R. Expression of

cytokine genes and presence of enteroviral genomic RNA in endomyocardial biopsy

tissues of myocarditis and dilated cardiomyopathy. Virchows Arch. 1996;427:503-9.

841. Ritchie ME. Nuclear factor-kappaB is selectively and markedly activated in humans with

unstable angina pectoris. Circulation. 1998;98:1707-13.

384

842. Valen G, Hansson GK, Dumitrescu A, Vaage J. Unstable angina activates myocardial

heat shock protein 72, endothelial nitric oxide synthase, and transcription factors

NFkappaB and AP-1. Cardiovasc Res. 2000;47:49-56.

843. Maulik N, Sato M, Price BD, Das DK. An essential role of NFkappaB in tyrosine kinase

signaling of p38 MAP kinase regulation of myocardial adaptation to ischemia. FEBS Lett.

1998;429:365-9.

844. Li C, Kao RL, Ha T, Kelley J, Browder IW, Williams DL. Early activation of IKKbeta

during in vivo myocardial ischemia. Am J Physiol Heart Circ Physiol. 2001;280:H1264-

71.

845. Wong SC, Fukuchi M, Melnyk P, Rodger I, Giaid A. Induction of cyclooxygenase-2 and

activation of nuclear factor-kappaB in myocardium of patients with congestive heart

failure. Circulation. 1998;98:100-3.

846. Purcell NH, Tang G, Yu C, Mercurio F, DiDonato JA, Lin A. Activation of NF-kappa B

is required for hypertrophic growth of primary rat neonatal ventricular cardiomyocytes.

Proc Natl Acad Sci U S A. 2001;98:6668-73.

847. Bergmann MW, Loser P, Dietz R, von Harsdorf R. Effect of NF-kappa B Inhibition on

TNF-alpha-induced apoptosis and downstream pathways in cardiomyocytes. J Mol Cell

Cardiol. 2001;33:1223-32.

848. Maulik N, Sasaki H, Addya S, Das DK. Regulation of cardiomyocyte apoptosis by redox-

sensitive transcription factors. FEBS Lett. 2000;485:7-12.

849. Brown M, McGuinness M, Wright T, Ren X, Wang Y, Boivin GP, Hahn H, Feldman AM,

Jones WK. Cardiac-specific blockade of NF-kappaB in cardiac pathophysiology:

differences between acute and chronic stimuli in vivo. Am J Physiol Heart Circ Physiol.

2005;289:H466-76.

385

850. Flati V, Pastore LI, Griffioen AW, Satijn S, Toniato E, D'Alimonte I, Laglia E, Marchetti

P, Gulino A, Martinotti S. Endothelial cell anergy is mediated by bFGF through the

sustained activation of p38-MAPK and NF-kappaB inhibition. Int J Immunopathol

Pharmacol. 2006;19:761-73.

851. Guroff G. A Neutral, Calcium-Activated Proteinase from the Soluble Fraction of Rat

Brain. J Biol Chem. 1964;239:149-55.

852. Croall DE, DeMartino GN. Calcium-activated neutral protease (calpain) system: structure,

function, and regulation. Physiol Rev. 1991;71:813-47.

853. Kohli V, Madden JF, Bentley RC, Clavien PA. Calpain mediates ischemic injury of the

liver through modulation of apoptosis and necrosis. Gastroenterology. 1999;116:168-78.

854. Iwamoto H, Miura T, Okamura T, Shirakawa K, Iwatate M, Kawamura S, Tatsuno H,

Ikeda Y, Matsuzaki M. Calpain inhibitor-1 reduces infarct size and DNA fragmentation

of myocardium in ischemic/reperfused rat heart. J Cardiovasc Pharmacol. 1999;33:580-6.

855. McDonald MC, Mota-Filipe H, Paul A, Cuzzocrea S, Abdelrahman M, Harwood S,

Plevin R, Chatterjee PK, Yaqoob MM, Thiemermann C. Calpain inhibitor I reduces the

activation of nuclear factor-kappaB and organ injury/dysfunction in hemorrhagic shock.

Faseb J. 2001;15:171-186.

856. Inserte J, Garcia-Dorado D, Hernando V, Soler-Soler J. Calpain-mediated impairment of

Na+/K+-ATPase activity during early reperfusion contributes to cell death after

myocardial ischemia. Circ Res. 2005;97:465-73.

857. Hashimoto M, Takada Y, Takeuchi Y, Kasahara J, Hisa H, Shirasaki Y, Fukunaga K.

Cytoprotective effect of 3-[2-[4-(3-chloro-2-methylphenyl)-1-piperazinyl]ethyl]-5,6-

dimethoxy-1-(4- imidazolylmethyl)-1H-indazole dihydrochloride 3.5 hydrate (DY-9760e)

386

against ischemia/reperfusion-induced injury in rat heart involves inhibition of fodrin

breakdown and protein tyrosine nitration. J Pharmacol Sci. 2005;98:142-50.

858. Bando Y, Katayama T, Kasai K, Taniguchi M, Tamatani M, Tohyama M. GRP94 (94

kDa glucose-regulated protein) suppresses ischemic neuronal cell death against

ischemia/reperfusion injury. Eur J Neurosci. 2003;18:829-40.

859. Chakrabarti AK, Neuberger T, Russell T, Banik NL, DeVries GH. Immunolocalization of

cytoplasmic and myelin mcalpain in transfected Schwann cells: II. Effect of withdrawal

of growth factors. J Neurosci Res. 1997;47:609-16.

860. Kinoshita M, Shimokado K. Autocrine FGF-2 is responsible for the cell density-

dependent susceptibility to apoptosis of HUVEC : A role of a calpain inhibitor-sensitive

mechanism. Arterioscler Thromb Vasc Biol. 1999;19:2323-9.

861. Corre S, Galibert MD. Upstream stimulating factors: highly versatile stress-responsive

transcription factors. Pigment Cell Res. 2005;18:337-48.

862. Chang LA, Smith T, Pognonec P, Roeder RG, Murialdo H. Identification of USF as the

ubiquitous murine factor that binds to and stimulates transcription from the

immunoglobulin lambda 2-chain promoter. Nucleic Acids Res. 1992;20:287-93.

863. Levine AJ, Momand J, Finlay CA. The p53 tumour suppressor gene. Nature.

1991;351:453-6.

864. Hunt T. Cyclins and their partners: from a simple idea to complicated reality. Semin Cell

Biol. 1991;2:213-22.

865. Matsukawa T, Inoue Y, Oishi Y, Kato H, Noguchi T. Up-regulation of upstream

stimulatory factors by protein malnutrition and its possible role in regulation of the IGF-

binding protein-1 gene. Endocrinology. 2001;142:4643-51.

387

866. Davis PL, Miron A, Andersen LM, Iglehart JD, Marks JR. Isolation and initial

characterization of the BRCA2 promoter. Oncogene. 1999;18:6000-12.

867. Yago M, Ohki R, Hatakeyama S, Fujita T, Ishikawa F. Variant forms of upstream

stimulatory factors (USFs) control the promoter activity of hTERT, the human gene

encoding the catalytic subunit of telomerase. FEBS Lett. 2002;520:40-6.

868. Jaakkola P, Maatta A, Jalkanen M. The activation and composition of FiRE (an FGF-

inducible response element) differ in a cell type- and growth factor-specific manner.

Oncogene. 1998;17:1279-86.

869. Ginty DD, Bonni A, Greenberg ME. Nerve growth factor activates a Ras-dependent

protein kinase that stimulates c-fos transcription via phosphorylation of CREB. Cell.

1994;77:713-25.

870. Barton K, Muthusamy N, Chanyangam M, Fischer C, Clendenin C, Leiden JM. Defective

thymocyte proliferation and IL-2 production in transgenic mice expressing a dominant-

negative form of CREB. Nature. 1996;379:81-5.

871. Yamamoto KK, Gonzalez GA, Biggs WH, 3rd, Montminy MR. Phosphorylation-induced

binding and transcriptional efficacy of nuclear factor CREB. Nature. 1988;334:494-8.

872. Sheng M, Thompson MA, Greenberg ME. CREB: a Ca(2+)-regulated transcription factor

phosphorylated by calmodulin-dependent kinases. Science. 1991;252:1427-30.

873. Xing J, Ginty DD, Greenberg ME. Coupling of the RAS-MAPK pathway to gene

activation by RSK2, a growth factor-regulated CREB kinase. Science. 1996;273:959-63.

874. Pilz RB, Casteel DE. Regulation of gene expression by cyclic GMP. Circ Res.

2003;93:1034-46.

388

875. Fentzke RC, Korcarz CE, Lang RM, Lin H, Leiden JM. Dilated cardiomyopathy in

transgenic mice expressing a dominant-negative CREB transcription factor in the heart. J

Clin Invest. 1998;101:2415-26.

876. Li Y, Yin W, Wang X, Zhu W, Huang Y, Yan G. Cholera toxin induces malignant

glioma cell differentiation via the PKA/CREB pathway. Proc Natl Acad Sci U S A.

2007;104:13438-43.

877. Wang J, Wang X, Hussain S, Zheng Y, Sanjabi S, Ouaaz F, Beg AA. Distinct roles of

different NF-kappa B subunits in regulating inflammatory and T cell stimulatory gene

expression in dendritic cells. J Immunol. 2007;178:6777-88.

878. Kitagawa K. CREB and cAMP response element-mediated gene expression in the

ischemic brain. Febs J. 2007;274:3210-7.

879. Yano S, Morioka M, Kuratsu J, Fukunaga K. Functional proteins involved in regulation

of intracellular Ca(2+) for drug development: role of calcium/calmodulin-dependent

protein kinases in ischemic neuronal death. J Pharmacol Sci. 2005;97:351-4.

880. Das S, Cordis GA, Maulik N, Das DK. Pharmacological preconditioning with resveratrol:

role of CREB-dependent Bcl-2 signaling via adenosine A3 receptor activation. Am J

Physiol Heart Circ Physiol. 2005;288:H328-35.

881. Onody A, Zvara A, Hackler L, Jr., Vigh L, Ferdinandy P, Puskas LG. Effect of classic

preconditioning on the gene expression pattern of rat hearts: a DNA microarray study.

FEBS Lett. 2003;536:35-40.

882. Feng B, Li J, Kliegman RM. Differential effects of insulin-like growth factor-1 on

neonatal canine gene expression. Biochem Mol Med. 1996;59:154-60.

389

883. Nimer NA, Brownlee C, Merrett MJ. Extracellular carbonic anhydrase facilitates carbon

dioxide availability for photosynthesis in the marine dinoflagellate prorocentrum micans.

Plant Physiol. 1999;120:105-12.

884. Franko KL, Giussani DA, Forhead AJ, Fowden AL. Effects of dexamethasone on the

glucogenic capacity of fetal, pregnant, and non-pregnant adult sheep. J Endocrinol.

2007;192:67-73.

885. O'Brien RM, Lucas PC, Forest CD, Magnuson MA, Granner DK. Identification of a

sequence in the PEPCK gene that mediates a negative effect of insulin on transcription.

Science. 1990;249:533-7.

886. Gingalewski C, Theodorakis NG, Yang J, Beck SC, De Maio A. Distinct expression of

heat shock and acute phase genes during regional hepatic ischemia-reperfusion. Am J

Physiol. 1996;271:R634-40.

887. Safirstein RL. Acute renal failure: from renal physiology to the renal transcriptome.

Kidney Int Suppl. 2004:S62-6.

888. Hatazaki M, Matsuhisa M, Nakatani Y, Yoshiuchi K, Kuroda A, Hazama Y, Kaneto H,

Yamasaki Y, Hori M. Hepatic insulin resistance induced by chronic hindlimb ischemia.

Diabetes Res Clin Pract. 2005;69:209-15.

889. Lacombe P, Oligo C, Domenga V, Tournier-Lasserve E, Joutel A. Impaired cerebral

vasoreactivity in a transgenic mouse model of cerebral autosomal dominant arteriopathy

with subcortical infarcts and leukoencephalopathy arteriopathy. Stroke. 2005;36:1053-8.

890. Strniskova M, Ravingerova T, Neckar J, Kolar F, Pastorekova S, Barancik M. Changes in

the expression and/or activation of regulatory proteins in rat hearts adapted to chronic

hypoxia. Gen Physiol Biophys. 2006;25:25-41.

390

891. Fukunaga K, Han F, Shioda N, Moriguchi S, Kasahara J, Shirasaki Y. DY-9760e, a novel

calmodulin inhibitor, exhibits cardioprotective effects in the ischemic heart. Cardiovasc

Drug Rev. 2006;24:88-100.

892. Jiang H, Rao K, Liu X, Halayko AJ, Liu G, Stephens NL. Early changes in airway

smooth muscle hyperresponsiveness. Can J Physiol Pharmacol. 1994;72:1440-7.

893. Krebs J. The role of calcium in apoptosis. Biometals. 1998;11:375-82.

894. Lisman JE, Zhabotinsky AM. A model of synaptic memory: a CaMKII/PP1 switch that

potentiates transmission by organizing an AMPA receptor anchoring assembly. Neuron.

2001;31:191-201.

895. Raiteri L, Giovedi S, Benfenati F, Raiteri M, Bonanno G. Cellular mechanisms of the

acute increase of glutamate release induced by nerve growth factor in rat cerebral cortex.

Neuropharmacology. 2003;44:390-402.

896. Zhang T, Miyamoto S, Brown JH. Cardiomyocyte calcium and calcium/calmodulin-

dependent protein kinase II: friends or foes? Recent Prog Horm Res. 2004;59:141-68.

897. Jones RJ, Jourd'heuil D, Salerno JC, Smith SM, Singer HA. iNOS regulation by

calcium/calmodulin-dependent protein kinase II in vascular smooth muscle. Am J Physiol

Heart Circ Physiol. 2007;292:H2634-42.

898. Porter D HS, Newman G, Schultz JJ. Evidence for a role in nitric oxide signaling in fibroblast growth factor-2-induced cardioprotection. Gordon Research

Conference on Fibroblast Growth Factors in Development and

Disease. March 2006.

899. Carpenter G PD, Liao S, Newman G, Schultz JJ. Inducible nitric oxide synthase (iNOS),

not neuronal NOS (nNOS) in cardioprotection by fibroblast growth factor-2 (FGF-2). J

Mol Cell Cardiol. 2007.

391

900. Jones SP, Bolli R. The ubiquitous role of nitric oxide in cardioprotection. J Mol Cell

Cardiol. 2006;40:16-23.

901. Fu Y, Wang Z, Chen WL, Moore PK, Zhu YZ. Cardioprotective effects of nitric oxide-

aspirin in myocardial ischemia-reperfused rats. Am J Physiol Heart Circ Physiol.

2007;293:H1545-52.

902. Tang XQ, Yu HM, Zhi JL, Cui Y, Tang EH, Feng JQ, Chen PX. Inducible nitric oxide

synthase and cyclooxgenase-2 mediate protection of hydrogen peroxide preconditioning

against apoptosis induced by oxidative stress in PC12 cells. Life Sci. 2006;79:870-6.

903. Gao F, Yue TL, Shi DW, Christopher TA, Lopez BL, Ohlstein EH, Barone FC, Ma XL.

p38 MAPK inhibition reduces myocardial reperfusion injury via inhibition of endothelial

adhesion molecule expression and blockade of PMN accumulation. Cardiovasc Res.

2002;53:414-22.

904. Efendiev R, Bertorello AM, Pedemonte CH. PKC-beta and PKC-zeta mediate opposing

effects on proximal tubule Na+,K+-ATPase activity. FEBS Lett. 1999;456:45-8.

905. Kuwabara K, Ogawa S, Matsumoto M, Koga S, Clauss M, Pinsky DJ, Lyn P, Leavy J,

Witte L, Joseph-Silverstein J, et al. Hypoxia-mediated induction of acidic/basic fibroblast

growth factor and platelet-derived growth factor in mononuclear phagocytes stimulates

growth of hypoxic endothelial cells. Proc Natl Acad Sci U S A. 1995;92:4606-10.

906. Sellke FW, Laham RJ, Edelman ER, Pearlman JD, Simons M. Therapeutic angiogenesis

with basic fibroblast growth factor: technique and early results. Ann Thorac Surg.

1998;65:1540-4.

907. Laham RJ, Sellke FW, Edelman ER, Pearlman JD, Ware JA, Brown DL, Gold JP,

Simons M. Local perivascular delivery of basic fibroblast growth factor in patients

392

undergoing coronary bypass surgery: results of a phase I randomized, double-blind,

placebo-controlled trial. Circulation. 1999;100:1865-71.

908. Unger EF, Goncalves L, Epstein SE, Chew EY, Trapnell CB, Cannon RO, 3rd, Quyyumi

AA. Effects of a single intracoronary injection of basic fibroblast growth factor in stable

angina pectoris. Am J Cardiol. 2000;85:1414-9.

909. Udelson JE, Dilsizian V, Laham RJ, Chronos N, Vansant J, Blais M, Galt JR, Pike M,

Yoshizawa C, Simons M. Therapeutic angiogenesis with recombinant fibroblast growth

factor-2 improves stress and rest myocardial perfusion abnormalities in patients with

severe symptomatic chronic coronary artery disease. Circulation. 2000;102:1605-10.

910. Rajanayagam MA, Shou M, Thirumurti V, Lazarous DF, Quyyumi AA, Goncalves L,

Stiber J, Epstein SE, Unger EF. Intracoronary basic fibroblast growth factor enhances

myocardial collateral perfusion in dogs. J Am Coll Cardiol. 2000;35:519-26.

911. Post MJ, Laham R, Sellke FW, Simons M. Therapeutic angiogenesis in cardiology using

protein formulations. Cardiovasc Res. 2001;49:522-31.

912. Simons M, Annex BH, Laham RJ, Kleiman N, Henry T, Dauerman H, Udelson JE,

Gervino EV, Pike M, Whitehouse MJ, Moon T, Chronos NA. Pharmacological treatment

of coronary artery disease with recombinant fibroblast growth factor-2: double-blind,

randomized, controlled clinical trial. Circulation. 2002;105:788-93.

913. Laham RJ, Post M, Sellke FW, Simons M. Therapeutic Angiogenesis Using Local

Perivascular and Pericardial Delivery. Curr Interv Cardiol Rep. 2000;2:213-217.

914. Sessa C, Vigano L, Grasselli G, Trigo J, Marimon I, Llado A, Locatelli A, Ielmini N,

Marsoni S, Gianni L. Phase I clinical and pharmacological evaluation of the multi-

tyrosine kinase inhibitor SU006668 by chronic oral dosing. Eur J Cancer. 2006;42:171-8.

393

915. Endoh M, Pulsinelli WA, Wagner JA. Transient global ischemia induces dynamic

changes in the expression of bFGF and the FGF receptor. Brain Res Mol Brain Res.

1994;22:76-88.

916. Peifley KA, Winkles JA. Angiotensin II and endothelin-1 increase fibroblast growth

factor-2 mRNA expression in vascular smooth muscle cells. Biochem Biophys Res

Commun. 1998;242:202-8.

917. Detillieux KA, Meij JT, Kardami E, Cattini PA. alpha1-Adrenergic stimulation of FGF-2

promoter in cardiac myocytes and in adult transgenic mouse hearts. Am J Physiol.

1999;276:H826-33.

918. Mignatti P, Morimoto T, Rifkin DB. Basic fibroblast growth factor released by single,

isolated cells stimulates their migration in an autocrine manner. Proc Natl Acad Sci U S A.

1991;88:11007-11.

919. Wiedlocha A, Sorensen V. Signaling, internalization, and intracellular activity of

fibroblast growth factor. Curr Top Microbiol Immunol. 2004;286:45-79.

920. Stachowiak EK, Maher PA, Tucholski J, Mordechai E, Joy A, Moffett J, Coons S,

Stachowiak MK. Nuclear accumulation of fibroblast growth factor receptors in human

glial cells--association with cell proliferation. Oncogene. 1997;14:2201-11.

921. Stachowiak MK, Moffett J, Maher P, Tucholski J, Stachowiak EK. Growth factor

regulation of cell growth and proliferation in the nervous system. A new intracrine

nuclear mechanism. Mol Neurobiol. 1997;15:257-83.

922. Mason IJ. The ins and outs of fibroblast growth factors. Cell. 1994;78:547-52.

923. Gonca S, Kilickan L, Dalcik C, Dalcik H, Bayindir O. The cardioprotective effects of

thoracal epidural anestesia are induced by the expression of vascular endothelial growth

394

factor and inducible nitric oxide synthase in cardiopulmonary bypass surgery. J

Cardiovasc Surg (Torino). 2007;48:93-102.

924. Becker C, Lacchini S, Muotri AR, da Silva GJ, Castelli JB, Vassallo PF, Menck CF,

Krieger JE. Skeletal muscle cells expressing VEGF induce capillary formation and

reduce cardiac injury in rats. Int J Cardiol. 2006;113:348-54.

925. Guo P, Piao X, Ou D, Li D, Hao Y. Characterization of the antigenic specificity of

soybean protein beta-conglycinin and its effects on growth and immune function in rats.

Arch Anim Nutr. 2007;61:189-200.

395