Role of Heat Shock Protein 27 and Lyn Tyrosine Kinase in Regulation of Androgen Receptor Expression and Activity in Prostate Cancer

ROLE OF HEAT SHOCK PROTEIN 27 AND LYN TYROSINE KINASE IN REGULATION OF ANDROGEN RECEPTOR EXPRESSION AND ACTIVITY IN PROSTATE CANCER

Anousheh Zardan

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

The Faculty of Graduate Studies

(Experimental Medicine)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

April 2012

Prostate Cancer (PCa) is the most common male cancer and the second leading cause of

cancer‐related deaths in North America. While many gains have been made in early detection

and treatment of localized PCa, many men still die of the metastatic disease. Androgen ablation

therapy remains the most effective therapy for patients with advanced disease. While ~80% of

patients respond initially to this treatment, most patients progress to Castrate Resistant

Prostate Cancer (CRPC) stage. Current literature indicates that CRPC tumours are not uniformly

hormone refractory and may remain sensitive to therapies directed against the AR axis.

Therefore, several new classes of AR‐targeting agents are now in clinical development, including more potent AR antagonists (MDV3100) and inhibitors of steroidogenesis

(abiraterone). Although enthusiasm for this approach remains high, prostate tumour

heterogeneity and the inevitable development of resistance dictates a critical need to better understand the mechanisms of resistance in which AR remain active.

In the current doctoral thesis role of heat shock protein (Hsp) 27 and Lyn tyrosine kinase in regulation of AR protein expression was investigated. The central hypothesis is that increased expression and activity of Hsp27 and Lyn kinase stabilizes and activates AR protein and leads to prostate cancer progression through promoting prostate cancer cell survival.

Three specific objectives were accomplished in this thesis. First, the relationship between Hsp27 and AR was studied. To this end, it was demonstrated that expression and

ii activity of Hsp27 via a nongenomic mechanism regulates AR protein stability, shuttling and

transcriptional activity. In the next step, the underlying molecular mechanisms through which

Lyn tyrosine kinase regulates AR activity in the castrated environment was investigated. The experiments demonstrated that Lyn kinase regulates AR protein expression and transcriptional

activity and that it plays a key role in PCa progression to the castrated resistant stage. Finally, a

novel role for Lyn kinase in Epidermal Growth Factor‐mediated (EGF‐mediated) AR activity was

defined.

The results obtained in this thesis defined new pathways involved in regulation of AR

protein stability and justified further investigation of Hsp27 and Lyn kinase as therapeutic targets for CRPC.

iii Preface

The publications presented in this thesis are based on the work that I carried out towards the completion of my PhD program. Manuscripts listed in this thesis either have already been published or will be submitted for publication as co‐authored works.

A version of chapter 2 of this thesis has been published in Cancer Research as noted below:

Chapter 2: Cooperative interactions between androgen receptor and Hsp27 facilitate

AR transcriptional activity. Amina Zoubeidi, Anousheh Zardan, Eliana Beraldi, Ladan Fazli,

Richard Sowery, Paul S. Rennie, Colleen C. Nelson, Martin E. Gleave, Cancer Research. 2007 Nov

1;67(21):10455‐65. Dr. Martin Gleave was the principal investigator of this manuscript. The

main idea of studying the interaction between Hsp27 and AR was introduced by Dr. Amina

Zoubeidi. I designed and performed all the in vitro experiments to demonstrate a) the

interaction between AR/Hsp27 and b) the role of Hsp27 on AR protein stability. Dr. Amina

Zoubeidi designed and performed all the experiments to demonstrate the role of Hsp27 on AR transcriptional activity (transactivation assays, immunofluorescence, EMSA). Mrs. Eliana Beraldi performed the ChIP analysis. Ms. Virginia Yago and Ms. Mary Bowden helped with the in vivo experiments. Preparation and analysis of protein samples from tumours was done by myself.

Dr. Ladan Fazli, the research pathologist at the Vancouver Prostate Centre, was involved in the analysis of all the immunohistochemistry staining of prostate tissues. Dr. Amina Zoubeidi

iv drafted the manuscript and finalized it for publication. Dr. Richard Sowery, Dr. Paul Rennie, Dr.

Colleen Nelson and Dr. Martin Gleave reviewed the work and provided insightful comments.

Chapter 3: Lyn tyrosine kinase regulates androgen receptor expression and activity in

castrate resistant prostate cancer. Anousheh Zardan, Eliana Beraldi, Ladan Fazli, KaMun Nip,

Michael E. Cox, Martin E. Gleave and Amina Zoubeidi. A version of chapter 3 will be submitted

for publication. Dr. Amina Zoubeidi was the principal investigator for the manuscript. All the in

vitro and in vivo experiments performed in this chapter were designed, performed and analyzed

by myself and reviewed by Dr. Amina Zoubeidi and Dr. Michael Cox. Ms. Kamun Nip provided

some help with the initial western blot analysis and Mrs. Eliana Beraldi performed the caspase‐

3 activity assay. Ms. Virginia Yago and Mr. Igor Moskalev were involved in mice bleeding. Dr.

Ladan Fazli analyzed all of the immunohistochemistry staining of the prostate tissues. Dr.

Martin Gleave reviewed the data and provided helpful comments. The manuscript was drafted

by myself and reviewed by Dr. Amina Zoubeidi, Dr. Michael Cox and Dr. Martin Gleave.

Chapter 4: Lyn tyrosine kinase promotes castration resistant prostate cancer

progression through EGF‐mediated phosphorylation of androgen receptor. Anousheh Zardan,

Eliana Beraldi, Martin Gleave, Michael Cox, Amina Zoubedi. A version of chapter 4 will be

submitted for publication. Dr. Amina Zoubeidi is the principal investigator of this manuscript. All

the experiments in this chapter were designed, performed and analyzed by myself, Anousheh

Zardan, and reviewed by Dr. Amina Zoubeidi. Mrs. Eliana Beraldi helped with the caspase‐3

activity assay. The manuscript was drafted by myself and reviewed by Dr. Amina Zoubeidi, Dr.

Michael Cox and Dr. Martin Gleave.

v The work presented in this thesis has been carried out with the approval of the

University of British Columbia Animal Care and Ethics Board Committees under the following certificate numbers respectively: A10 – 0165, 4597 – 11.

vi Table of Contents

Abstract ...... ii

Preface ...... iv

Table of Contents ...... vii

List of Figures ...... x

List of Abbreviations ...... xii

Acknowledgements ...... xvi

CHAPTER 1: Introduction ...... 1 1.1 The Prostate ...... 1 1.1.1 Origin, Anatomy and Function ...... 1 1.1.2 Histology and Cells ...... 2 1.2 Androgens ...... 5 1.2.1 Production, Function and Metabolism ...... 5 1.3 Androgen‐Receptor (AR) ...... 8 1.3.1 Structure, Biology and Function ...... 8 1.3.2 AR Co‐Regulators (Co‐activator and Co‐Repressors) ...... 12 1.4 Prostate Cancer (PCa) ...... 13 1.4.1 Development ...... 13 1.4.2 Epidemiology and Risk Factors ...... 13 1.4.3 Diagnosis and Prognosis ...... 15 1.5 Treatment ...... 17 1.6 Development of Castration Resistant Prostate Cancer (CRPC) ...... 21 1.7 Chaperone Proteins ...... 27 1.7.1 Biology and Function ...... 27 1.7.2 Small Heat Shock Proteins (sHsps) ...... 30 1.7.3 The Importance of Hsps in AR Stability and Function ...... 30 1.7.4 Heat Shock Protein 27 (Hsp27) ...... 31 1.8 Protein Kinases ...... 33 1.8.1 Tyrosine Kinases and Their Role in Cancer Progression ...... 34 1.8.2 Tyrosine Kinases and Their Role and PCa ...... 35 1.8.3 Lyn Tyrosine Kinase ...... 36 1.9 Prostate Cancer Cell Line Models ...... 39 1.10 Thesis Hypothesis and Specific Objectives ...... 40

vii CHAPTER 2: Cooperative Interactions between Androgen Receptor and Hsp27 Facilitate AR Transcriptional Activity ...... 45 2.1 Introduction ...... 45 2.2 Materials and Methods ...... 47 2.2.1 Cell Culture and ASO Transfection ...... 47 2.2.2 Plasmids and Reagents and Antibodies ...... 48 2.2.3 Cell Proliferation and Apoptosis Assays ...... 48 2.2.4 Western Blot Analysis and Immunoprecipitation ...... 48 2.2.5 Immunofluorescence ...... 49 2.2.6 Transfection and Luciferase Assay ...... 49 2.2.7 Northern Blot Analysis ...... 50 2.2.8 Electromobility Shift Assay (EMSA) ...... 50 2.2.9 Chromatin Immunoprecipitation (ChIP) ...... 50 2.2.10 Reverse Transcription‐PCR ...... 51 2.2.11 Protein Stability ...... 51 2.2.12 In vivo Imaging of Luciferase Activity ...... 51 2.2.13 Animal Treatment ...... 52 2.3 Results ...... 52 2.3.1 Androgens and Hsp27 Protect LNCaP Cells from Apoptotic Stress ...... 52 2.3.2 Androgens Lead to Rapid Hsp27 Phosphorylation via p38 MAPK Pathway ...... 54 2.3.3 Androgen‐induced Hsp27 Phosphorylation is AR‐dependent ...... 57 2.3.4 Effect of Hsp27 on Genomic Activity of AR ...... 60 2.3.5 Hsp27 Knockdown Induces AR Degradation via the Proteasome‐mediated Pathway ...... 64 2.3.6 Hsp27 Knockdown Disrupts AR‐Hsp90 Association and Increases AR‐MDM2 Association and Ubiquitination ...... 68 2.3.7 In vivo Hsp27 Knockdown by OGX‐427 Decreases LNCaP Proliferation Rates, Serum PSA Levels, and AR Client Protein Expression Levels ...... 68 2.4 Discussion ...... 72

CHAPTER 3: Lyn Tyrosine Kinase Regulates Androgen Receptor Expression and Activity in Castrate Resistant Prostate Cancer ...... 76 3.1 Introduction ...... 76 3.2 Materials and Methods ...... 78 3.2.1 Cell Culture and siRNA Transfection ...... 78 3.2.2 Plasmid, Reagents and Antibodies ...... 78 3.2.3 Cell Proliferation and Apoptosis Assays ...... 79 3.2.4 Cell Cycle Analysis ...... 79 3.2.5 Transfection and Luciferase Assay ...... 80 3.2.6 Chromatin Immunoprecipitation (ChIP) ...... 80 3.2.7 Quantitative Reverse Transcription‐PCR ...... 80 3.2.8 Protein Stability ...... 81 3.2.9 Animal Treatment ...... 81 3.2.10 Immunohistochemistry Analysis ...... 82 3.3 Results ...... 83 3.3.1 Lyn Expression Is Increased with Progression to CRPC ...... 83

viii 3.3.2 Lyn and p‐Lyn Y396 Expression Is Elevated in CRPC Specimens ...... 84 3.3.3 In vivo Lyn Over‐Expression Accelerates Castrate‐Resistant LNCaP Tumour Growth and Serum PSA Relapse to Pre‐Castration Levels ...... 86 3.3.4 Lyn Knockdown Leads to AR Degradation through the Proteasome‐Mediated Pathway ...... 90 3.3.5 Lyn Regulates AR Transcriptional Activity ...... 94 3.3.6 Lyn Knockdown Induces Cell Cycle Arrest and Apoptosis in LNCaP Cells ...... 97 3.4 Discussion ...... 99

CHAPTER 4: Lyn Tyrosine Kinase Promotes Castration Resistant Prostate Cancer Progression through EGF‐Mediated Phosphorylation of Androgen Receptor ...... 102 4.1 Introduction ...... 102 4.2 Materials and Methods ...... 104 4.2.1 Cell Culture and siRNA Transfection ...... 104 4.2.2 Plasmid, Reagents and Antibodies ...... 104 4.2.3 Cell Apoptosis Assays ...... 105 4.2.4 Immunoprecipitation Analysis ...... 105 4.2.5 Transfection and Luciferase Assay ...... 105 4.3 Results ...... 106 4.3.1 Lyn is Phospho‐Activated on Y396 upon EGF ...... 106 4.3.2 Lyn Knockdown Inhibits EGF‐Induced ERK Phosphorylation ...... 107 4.3.3 Lyn Knockdown Inhibits R1881 and EGF induced AR Transcriptional Activity ...... 108 4.3.4 Lyn Kinase Binds to AR Directly and Regulates AR Tyrosine Phosphorylation ...... 110 4.3.5 Lyn Knockdown Induces Apoptosis in LNCaP Cells in The Presence of EGF and R1881 ...... 113 4.4 Discussion ...... 115

CHAPTER 5: Conclusion and Suggestions for Future Work ...... 118 5.1 General Discussion and Conclusion ...... 118 5.2 Suggestions for Future Work ...... 127

Bibliography ...... 130

Appendix 1: Androgen Prevents Apoptosis Induced by Paclitaxel ...... 169

Appendix 2: AR Interacts with Hsp27 via the N‐terminal and Ligand‐Binding Domains 170

Appendix 3: Validation of Pb‐Luc Functionality in vitro and in cellulo ...... 171

Appendix 4: OGX‐427 Suppresses Probasin Luciferase (Pb‐Luc) ...... 173

Appendix 5: Effect of OGX‐427 on AR, Hsp27 and Hsp90 Levels in LNCaP Xenografts .. 174

Appendix 6: Expression of Hsp27 Modulates UPR ...... 175

Appendix 7: Role of Hsp27 Expression on Accumulation of Ubiquitinated Proteins ..... 178

Appendix 8: Hsp27 Knockdown Induces Autophagy in PC3 Cells ...... 180

ix List of Figures

Figure 1.1. Schematic depiction of the male reproductive system...... 2 Figure 1.2. Schematic illustration of the cell types within a section of the human prostatic ducts...... 3 Figure 1.3. Hypothalamus‐pituitary‐gonadal hormonal Axis...... 7 Figure 1.4. Protein structure of AR...... 8 Figure 1.5. Mechanism of androgen action in a prostate cell...... 11 Figure 1.6. The steroidogenesis pathways...... 24 Figure 1.7. Molecular mechanisms involved in the progression of CRPC...... 27 Figure 1.8. The stress‐response pathway in cancer cells...... 29 Figure 1.9. Structural schematic of the Lyn tyrosine kinases in their inactive and active configurations...... 38 Figure 2.1. Androgen enhances LNCaP cell survival...... 54 Figure 2.2. Androgen phosphorylation of Hsp27 requires p38 MAPK pathway...... 56 Figure 2.3. Androgen‐induced Hsp27 phosphorylation requires AR...... 59 Figure 2.4. Effect of Hsp27 on AR trans‐activation...... 64 Figure 2.5. Effect of Hsp27 knockdown on AR expression and stability...... 67 Figure 2.6. OGX‐427 suppresses probasin luciferase (Pb‐Luc) bioluminescence as well as AR, Hsp90 and Hsp27 levels in vivo...... 71 Figure 3.1. Lyn expression in PCa progression...... 86 Figure 3.2. Lyn over‐expression accelerates castrate‐resistant LNCaP tumour growth and serum PSA relapse to pre‐castration levels...... 90 Figure 3.3. Effect of Lyn knockdown on AR expression and stability...... 93 Figure 3.4. Effect of Lyn of AR transactivation...... 96 Figure 3.5. Effect of Lyn knockdown on LNCaP cell survival...... 98 Figure 4.1. Lyn is activated in EGF pathway but not in Il‐6 pathway...... 107

x Figure 4.2. Effect of Lyn knockdown on EGF‐induced ERK phosphorylation and R1881 and EGF induced AR transcriptional activity...... 109 Figure 4.3. Lyn directly interacts and affects tyrosine phosphorylation and transactivaion of AR...... 112 Figure 4.4. Lyn knockdown induces apoptosis in LNCaP cells...... 114 Figure 5.1. Regulation of AR by Lyn in CRPC...... 127

Figure A.1. Androgen prevents apoptosis induced by paclitaxel...... 169 Figure A.2. AR interacts with Hsp27 via the N‐terminal and Ligand‐Binding domains. . 170 Figure A.3. Validation of Pb‐Luc functionality in vitro and in cellulo...... 172 Figure A.4. OGX‐427 suppresses Probasin luciferase (Pb‐Luc)...... 173 Figure A.5. Effect of OGX‐427 on AR, Hsp27 and Hsp90 levels in LNCaP xenografts. .... 174 Figure A.6. Expression of Hsp27 modulates UPR...... 177 Figure A.7. Effect of Hsp27 knockdown on accumulation of ubiquitinated proteins. ... 179 Figure A.8. Hsp27 knockdown induces autophagy in PC3 cells...... 180

xi List of Abbreviations

AA Amino Acid ACTH Adrenocorticotropic Hormone AD Androgen Deprivation ADT Androgen Deprivation Therapy AF‐1 Activation Function‐1 AF‐2 Activation Function‐2 AIS Androgen Insensitivity Syndrome AND Androstenedione AR Androgen Receptor ARA55 Androgen Receptor Associated protein 55 ARA70 Androgen Receptor Associated protein 70 ARE Androgen Response Element ASO Antisense Oligonucleotide ATP Adenosine‐5'‐triphosphate Bcl‐2 B‐cell lymphoma 2 BPH Benign Prostate Hyperplasia BRCA2 Breast Cancer 2 susceptibility protein CA Constitutively Active CAIS Complete Androgen Insensitivity Syndrome ChIP Chromatin Immunoprecipitation CREB cAMP Response Element Binding protein CRH Corticotropin‐Releasing Hormone CRPC Castrate Resistant Prostate Cancer c‐Src cellular‐Src CSS Charcoal Stripped fetal bovine Serum CTD COOH‐Terminal Domain CYP17A1 Cytochrome P450 17A1 DHEA Dehydroepiandrosterone DHT Dihydrotestosterone DN Dominant Negative DNA Deoxyribonucleic Acid DRE Digital Rectal Exam EBRT External Beam Radiation Therapy EGF Epidermal Growth Factor EGF Epidermal Growth Factor EGFR Epidermal Growth Factor Receptor EMSA Electrophoretic Mobility Shift Assay EMT Epithelial‐Mesenchymal Transition

xii EPCA Early Prostate Cell Antigen ER Endoplasmic Reticulum ER Estrogen Receptor ERG Ets Related Gene ERK Extracellular signal‐Regulated Kinase FACS Fluorescence‐Activated Cell Sorting FAK Focal Adhesion Kinase FBS Fetal Bovine Serum FDA Food and Drug Administration FGFR Fibroblast Growth Factor Receptor FKBP52 FK506‐Binding Protein 52 FSH Follicle‐Stimulating Hormone GnRH Gonadotropin‐Releasing Hormone gp130 Glycoprotein 130 GRIP1 Glucocorticoid Receptor Interacting Protein 1 GST Glutathione S‐Transferase HAT Histone Acetyltransferase HDAC Histone Deacetylases HER‐2 Human Epidermal growth factor Receptor 2 HGFR Hepatocyte Growth Factor Receptor HSE Heat Shock Element HSF‐1 Heat Shock Factor 1 Hsp Heat Shock Protein IGF‐1 Insulin Growth Factor‐1 IgG Immunoglobulin IL‐4 Interleukin‐4 IL‐6 Interleukin‐6 JAK Janus Kinase KLK3 Kallikrein‐related peptidase 3 LBD Ligand Binding Domain LH Luteinizing Hormone LHRH Luteinizing Hormone‐Releasing Hormone LMTK2 Lemur Tyrosine Kinase 2 M Metastasis MAPK Mitogen‐Activated Protein Kinase MM Mismatch mRNA messenger Ribonucleic Acid MSMB Microseminoprotein Beta NCoR Nuclear Co‐Repressor NES Nuclear Export Signal NGFR Nerve Growth Factor Receptor NLS Nuclear Localization Signal NRTK None‐Receptor Tyrosine Kinase NTD NH2‐Terminal Domain ODN Oligodeoxynucleotide

xiii PAP Prostatic Acid Phosphatase PARP Poly Adenosine diphosphate Ribose Polymerase PCa Prostate Cancer PCA3 Prostate Cancer Antigen 3 PCR Polymerase Chain Reaction PD‐1 Programmed Death 1 PI3K Phosphoinositide 3‐Kinase PKB Protein Kinase B PPII Polyproline type II PR Progesterone Receptor PSA Prostate Specific Antigen PSCA Prostate Stem Cell Antigen PSMA Prostate‐Specific Membrane Antigen PTEN Phosphatase and Tensin homolog RNA Ribonucleic Acid RTK Receptor Tyrosine Kinase RTK Receptor Tyrosine Kinase Ser Serine SFK Src Family Kinase SH1 Src Homology 1 SH2 Src Homology 2 SH3 Src Homology 3 SHBG Sex Hormone‐Binding Globulin shRNA short hairpin Ribonucleic Acid sHSP small Heat Shock Protein siRNA small interfering Ribonucleic Acid SMRT Silencing Mediator for Retinoic and Thyroid hormone receptors Src Sarcoma SRC‐1 Steroid Receptor Co‐activator 1 STAT3 Signal Transducer and Activator of Transcription 3 T Testosterone TGF‐α Transforming Growth Factor‐α TIF2 Transcriptional Intermediary Factor 2 TM Triple Mutant TMA Tissue Microarray TMPRSS2 Transmembrane Protease, Serine 2 TNF‐α Tumor Necrosis Factor‐α TNM Tumour Node Metastasis TPR Tetratricopeptide Repeat TRUS Transrectal Ultrasound TURP Trans‐Urethral Resection of Prostate Tyr Tyrosine UGE Urogenital Sinus Epithelium UGM Urogenital Sinus Mesenchyme UGS Urogenital Sinus

xiv UPS Ubiquitin‐Proteasome System UV Ultraviolet VEGF Vascular Endothelial Growth Factor v‐Src viral‐Sarcoma WT Wild Type

xv Acknowledgements

First and foremost, I would like to express my sincere gratitude to my research

supervisors, Dr. Martin Gleave and Dr. Amina Zoubeidi for their continued support, motivation

and enthusiasm throughout my PhD study. It has truly been a great honour to work under their

supervision and benefit from their inspirational guidance.

Besides my research supervisors, I would like to thank my other thesis advisory

committee members, Dr. Michael Cox, Dr. Christopher Ong and Dr. Sandra Dunn for their

encouragement and insightful comments. I would particularly like to thank Dr. Michael Cox for

being more than a committee member for me. Without his guidance and endless support and

immense knowledge I could not finish this work.

I am grateful to all the members of the Vancouver Prostate Centre and all my graduate

friends and fellow lab mates in Dr. Gleave, Dr. Cox and Dr. Zoubeidi’s research groups: Jenny

Bazov, Eliana Beraldi, Thomas Cordonnier, Susan Ettinger, Ladan Fazli, Yubin Gao, Mazyar

Ghaffari, Killian Gust, Masaki Shiota, Darya Habibi, Masafumi Kumano, Hidetoshi Kuruma,

François Lamoureux, Na Li, Susan Moore, Igor Moskalev, Ka Mun Nip, Mitali Pandey, Manju

Sharma, Payman Tavassoli, Virginia Yago and Fan Zhang for their friendship and invaluable

support.

I wish to also thank the following organizations whose financial support made this work

possible: The Terry Fox Foundation, the National Cancer Institute of Canada (Canadian Cancer

xvi Society Research Institute), University of British Columbia (Four Year Fellowship Award, Faculty

of Medicine Graduate Student Award, Faculty of Medicine Albert B and Mary Steiner Summer

Research Award, Faculty of Medicine Roman M Babicki Fellowship in Medical Research), the

Prostate Cancer Foundation BC (Prostate Disease Fellowship) and the Australian‐Canadian

Prostate Cancer Research Alliance (Travel Award).

Last but not the least, I am grateful to have the love and support of my parents, Mina and Alireza, my brother Arshia, my best friend Yasamin and my caring husband Mehran. They stood by me in the ups and downs of this journey and made it all very much worthwhile.

xvii

To my husband and best friend

Mehran

xviii CHAPTER 1: Introduction

1.1 The Prostate

1.1.1 Origin, Anatomy and Function

Development of the prostate gland is a result of epithelial invaginations of the posterior

urogenital sinus (UGS) (1, 2). This process occurs under the direct influence of the underlying mesenchyme during the third fetal month (1‐3). UGS develops into the prostate, prostatic urethra and bulbourethral glands in males, the lower vagina and urethra in females, and the bladder in males and females (4). At the time of birth, prostate weighs only a few grams which

increases to about 20 g by the age of 30 (5). Both histology and weight of the prostate are

stable for the next 25 years (5).

The prostate gland is located on the pelvic floor, inferior to the bladder and anterior to

the rectum in the extraperitoneal compartment (6). The main function of the adult prostate, as

an accessory sex organ, is in male reproduction where it plays a major role as a secretory gland

to promote successful fertilization (5). As an exocrine gland, the prostate produces and secretes several components of the seminal fluid including the enzymes involved in coagulation, gelation and liquefaction to facilitate the female egg fertility (3, 7). Furthermore, prostatic fluid reduces

the acidity of the urethra, enhances sperm motility and is involved in the nutrition of

spermatozoa (5). The prostate has a highly developed smooth muscle stromal component that

functions as a secondary urinary sphincter and controls urine output and the transmission of

1 seminal fluid during ejaculation (5). Prostate also acts as an endocrine gland by converting testosterone (T) to its biologically active and more potent form dihydrotestostrone (DHT) which controls the development of the gland.

Figure 1.1. Schematic depiction of the male reproductive system. The schematic demonstrates the relative location of prostate gland to the nearby organs.

1.1.2 Histology and Cells

The prostate is composed of the glandular and fibromuscular components (8, 9).

Histologically, the branched ductal glandular structure of the prostate consists of secretory

luminal epithelial cells, which are surrounded by the stromal tissue. The epithelium of the prostate is composed of two cell layers: a secretory luminal layer of columnar cells and a basal layer of cuboidal cells (1, 10). A third population of cells with neuroendocrine characteristics are present sporadically throughout the prostatic epithelium with cell bodies in the basal layer and

2 projections to the luminal surface which are scattered throughout the other two lineages (10,

11). The fibromuscular stroma of the prostate gland is composed primarily of: smooth muscle

cells, fibroblast and endothelial cells (12).

Figure 1.2. Schematic illustration of the cell types within a section of the human prostatic ducts. The epithelium of the prostate consists of two cell layers: the secretory luminal layer and the basal layer of epithelial cells. Neuroendocrine cells are the third population of cells that are present in the prostatic epithelium which are scattered throughout the other two lineages.

Secretory luminal epithelial cells of the prostate are the exocrine component of the

gland which are responsible for the production of the enzymes such as prostate specific antigen

(PSA), prostatic acid phosphatase (PAP) and human kallikrein‐2 into the glandular lumen (10,

11). Secretory cells express androgen receptor (AR) at high levels and require testosterone for

maintaining their secretory activity (11, 13, 14). The basal cells of the prostate are androgen‐

independent and nonsecretory epithelial cells (14, 15). It is believed that the basal cells

3 modulate and mediate the endocrine and paracrine functions and are the proliferative section of the gland (14). While less is known about the function of the neuroendocrine cells of the prostate epithelium, these cells are characterized as non‐proliferative and androgen‐ independent (16, 17). They can be characterized by the expression of the neuropeptides such

as chromogranin A and calcitonin and have been attributed with regulating glandular

homeostasis (14, 18, 19). In mature gland, the fibromuscular compartment of the prostate

provides a supportive matrix for the ductal epithelial cells. The smooth‐muscle cells of the

stroma mediate the required contractions for the prostatic secretion from the gland (20, 21).

Cunha et al. has shown that the interaction between the stroma and epithelial compartments of the prostate gland play a major role in the normal prostate development (22).

Differential expression of AR in epithelial and mesenchymal compartments of urogenital sinus revealed the central role of the AR signaling during the embryonic development of the prostate

(23‐25). In the course of the embryonic development, AR is initially only expressed in the mesenchymal compartment of the urogenital sinus (UGM) and the epithelial compartment

(UGE) is AR negative (24, 25). Testosterone acts through the AR in the UGM and results in the

production of paracrine growth factors known as andromedins which induce the formation of

the prostatic buds from the undifferentiated UGE (23, 26). Furthermore, andromedins promote

the growth, branching morphogenesis and differentiation of prostatic epithelial into the

secretory epithelial cells (23). Conversely, the developing epithelium induces the differentiation

of the primitive mesenchymal cells into the smooth muscle cells (22, 27). In the absence of

epithelial compartment the urogenital sinus mesenchyme will not form smooth muscles (22).

Expression of AR in epithelial cells of the prostate begins shortly after birth (28).

4 1.2 Androgens

1.2.1 Production, Function and Metabolism

In mammals, gonadal steroids are responsible for the gender‐specific characteristics

(29). Androgens and estrogens are a subclass of gonadal steroids which are formed in males and females and play a physiologic role in both genders (30). Testosterone is the major circulating androgen in mature males. It is synthesized from cholesterol through a series of

enzymatic steps by the testicular Leydig cells (31‐33). In addition to Leydig cells, extragonadal synthesis of two weak androgens, dehydroepiandostrone and androstenedione, from adrenal glands and in small amounts from the brain cells has been reported (17, 31, 34).

During embryonic development, testosterone is produced by the foetal testis, under

stimulation of maternal luteinizing hormone‐releasing hormone (LHRH) , and is needed for the

development of the Wolffian ducts which give rise to the formation of epididymis and seminal

vesicles (35). During this stage, production of androgens is also pivotal for the development of

the prostate and the penis (35). However, in adult male body androgens produced by the

Leydig cells of the testes and adrenal glands play a major role in the maintenance of male

reproduction (35). Androgens play a crucial role in the control of prostate gland growth at the

time of puberty and in maintaining it in maturity (36). Growth of the prostate gland during

puberty includes both the stromal and epithelial elements of the prostate (36). It has been

reported that growth of the prostate gland does not occur in males following prepubertal

castration (37). Androgens are also required for development and maintenance of other

characteristics such as the muscle formation, body composition, bone mineralization, fat

metabolism and cognitive functions (31, 32, 35, 38).

5 The important role of androgens in regulation of prostate cell proliferation and survival was established in twentieth century by Charles Huggins (39). In 1947, Huggins demonstrated that castration causes regression of the hyperplastic prostate (37). His experiments revealed that only in the presence of the physiologically sufficient amount of androgenic hormones,

cystic hyperplasia of the prostate occurs in senile dogs (40). Interestingly, removal of testes

resulted in marked atrophy in both normal and cystic prostates and daily injection of androgen

led to the reconstruction of the gland in the dogs (40). Huggins experiments for the first time

revealed the hormone‐dependent nature of the prostate gland and gave rise to the concept of

hormonal‐therapy for the treatment of prostate cancer.

Regulation of androgen production from the gonads is through the secretion of gonadotropin releasing hormone (GnRH) from the hypothalamus as well as the gonadotropins, luteinizing hormone (LH) and follicle stimulating hormone (FSH) from the anterior pituitary

gland (the hypothalamic‐pituitary‐gonadal axis) (31, 32). In adult male body, secretion of the

GnRH from the specialized neurons of the hypothalamus stimulates the anterior pituitary gland

to release the Luteinizing hormone (LH) (41). Release of LH in turn stimulates the production of

androgens in Leydig cells of the testes (41, 42). LH interacts with the testicular LH receptor and

activates the steroidogenic pathways within the Leydig cells of the testes which lead to the

secretion of androgens (32). The presence of the estradiol, a testosterone metabolite inhibits

further secretion of both GnRH and LH/FSH production through a negative‐feedback loop (32).

Figure 1.3. Hypothalamus‐pituitary‐gonadal hormonal Axis. Regulation of androgen production from the gonads is through the secretion of gonadotropin releasing hormone (GnRH) from the hypothalamus as well as the gonadotropins, luteinizing hormone (LH) and follicle stimulating hormone (FSH) from the anterior pituitary gland (the hypothalamic‐pituitary‐gonadal axis). This process is regulated through a negative feedback loop. DHEA: Dehydroepiandrosterone, ACTH: Adenocorticotropic Hormone, CRH: Corticotropin‐releasing hormone.

In the circulation testosterone is bound to albumin and sex‐hormone‐binding globulin

(SHBG) and a small fraction of it is dissolved freely in the serum (43). Within the prostate gland

testosterone is converted to its more potent form DHT, which has five fold higher affinity for AR compared to the testosterone, by the enzyme 5‐α reductase (35). Three isoforms of this

enzyme have been cloned, type 1, type 2 and type 3 (35, 44, 45). The 5‐α reductase type 1

enzyme is widely distributed in the body; however, the expression of the type 2 enzyme is limited to the androgen‐dependent organs (44). The newly identified 5‐α reductase type 3

7 enzyme is shown to be structurally different from type 1 and type 2 isoforms and its role in vivo

as a 5α‐reductase remains to be established (45, 46).

1.3 Androgen‐Receptor (AR)

1.3.1 Structure, Biology and Function

Testosterone exerts its biological functions via binding to the AR (35). AR belongs to the nuclear hormone receptor superfamily which includes the following families of receptors: steroid hormone receptors, thyroid/retinoid and vitamin D receptors as well as several other orphan receptors (47, 48). It has been shown that products of lipid metabolism such as cholesterol derivatives bind to the nuclear receptors and regulate gene expression (47, 49). In

males, AR is expressed predominantly in sexual organs including the prostate, testes, seminal vesicle and ejaculatory duct (50, 51). Expression of AR in non‐sexual organs such as liver, kidney, brain and skeletal muscle has also been reported in males (50, 51). In females,

expression of AR in reproductive organs such as uterus, ovary and endometrium has been shown (51, 52). All nuclear receptors typically contain a NH2‐terminal region (NTD), a ligand

binding domain (LBD) and a COOH‐terminal region (CTD) (47, 49, 53).

Figure 1.4. Protein structure of AR. Location of the N‐terminus domain, DNA binding domain, Hinge region and Ligand binding domain of human AR protein.

8 The human AR gene is located on the X‐chromosome and includes eight exons (53, 54).

Exon one of AR gene codes for the N‐terminal domain (NTD) of AR (49, 53). Exons two and exon three code for the DNA‐binding domain (DBD) of AR and exon four to eight code for the ligand

binding domain which is located at the C‐terminal domain (CTD) of the protein (49, 53). AR protein also contains a hinge region which is located in between the DBD and the LBD (48, 49,

53). Two transactivation domains have been characterized in AR protein: the Activation

function‐1 (AF1) and the Activation function‐2 (AF2) (55‐57). The AF1 is located in the NTD and

has the main transactivation potential and the AF2 is located in the LBD (55, 58‐60).

The NTD of AR is the main transcriptional regulatory region of the AR protein and has

been reported to be highly flexible with minimal secondary structures (53, 61). It has been

shown that in the absence of androgenic ligands the NTD of AR can become phosphorylated

and activated by protein kinase pathways (62‐64). The central part of the AR protein contains

the DBD which includes three alpha helices structures that are organized into two zinc finger motifs and are linked through eight cysteine residues (53, 61). These alpha helices motifs play

an important role in the recognition and binding of AR to the androgen response elements

(AREs) on the DNA of the AR target genes (57, 61). The LBD of AR has been characterized by crystallography and is important in the recognition of androgenic ligands by AR (61, 65). Hinge region of AR has long been considered a flexible region that connects the DBD to the LBD, and helps with proper dimerization and binding of AR to DNA (66, 67). However, recent studies have demonstrated that the hinge region of AR plays an active role in binding of AR to DNA as well as

AR nuclear localization (67, 68).

9 The ligand unbound AR is located in the cytoplasm associated with chaperone proteins such as heat shock proteins (Hsps) (69‐71). Hsps such as Hsp90 tether AR in the cytoplasm and modulate AR conformation to prepare it for optimal ligand binding (71‐73). Binding of AR to testosterone or DHT, induces a conformational change within the LBD of AR that leads to

dissociation of AR from the Hsps (71). This conformational change allows AR to interact with co‐

regulators such as ARA70, Filamin‐A and importin‐α, that bind to the nuclear localization signal

(NLS) of the AR and facilitate receptor dimerization and nuclear localization (71). In the nucleus

AR binds to AREs and recruits the histone acetyltransferase (HAT) enzymes, an array of co‐

regulators (co‐activator and co‐repressors) and also the general transcription machinery (48,

71, 74). Formation of these multiprotein transcriptional complexes results in a tight transcriptional regulation of a number of genes involved in the growth, maintenance and differentiation of the prostate (55, 61, 75). Loss of ligand (testosterone or DHT) from AR promotes the nuclear export signal (NES) to shuttle AR back to the cytoplasm where it can be tethered by the Hsps in preparation for ligand binding (71, 74).

Figure 1.5. Mechanism of androgen action in a prostate cell. Hsps, tether AR in the cytoplasm and modulate AR conformation to prepare it for optimal ligand binding. Binding of AR to testosterone or DHT, induces a conformational change within the LBD of AR that leads to dissociation of AR from the Hsps, receptor dimerization and nuclear localization. In the nucleus AR binds to AREs and through a tight transcriptional regulation of a number of genes promotes the growth and maintenance and differentiation of the prostate cells. Loss of ligand (testosterone or DHT) from AR promotes the nuclear export signal (NES) to shuttle AR back to the cytoplasm where it can be tethered by the Hsps in preparation for ligand binding. AR: Androgen Receptor, Hsp: Heat Shock Protein, SHBG: Sex Hormone‐Binding Globulin, SRD5A2(1,3): steroid‐5‐α‐reductases.

11 1.3.2 AR Co‐Regulators (Co‐activator and Co‐Repressors)

Nearly 200 androgen receptor co‐regulators have been characterized (76, 77). The co‐ regulators of AR are described as the transcription chaperones and can be classified in four main categories: a) the molecular chaperones, b) the histone modifiers, c) the DNA structure

modifiers and d) the transcription coordinators (14, 77). They act in different subcellular locations and can influence DNA binding, nuclear localization, stability of AR as well as linking it to the transcriptional machinery (14, 78). The co‐regulators of AR can be either co‐activators or co‐repressors. The former function to enhance the transactivation of AR while the latter function to inhibit AR transcription initiation (71).

The p160 family of co‐activators including the Steroid Receptor Co‐activator 1 (SRC‐1),

Transcriptional Intermediary Factor 2 (TIF2) and Glucocorticoid Receptor Interacting Protein 1

(GRIP1) is the first identified and one of the well‐studied families of AR co‐activators (71). These

co‐activators stabilize ligand‐bound AR which results in enhancing AR transactivation (71, 79,

80). Another class of co‐activators is the histone acetyltransferases (HATs), such as cAMP

Response Element Binding protein (CREB)‐binding protein, which interact and link AR with the

transcriptional machinery (71, 81, 82).

AR co‐repressors inhibit the transcription initiation of AR through interacting with the

NTD and LBD (71). Two classes of well‐characterized AR co‐repressors are the nuclear repressor

co‐repressors (NCoR) and Silencing Mediator for Retinoid and Thyroid hormone receptors

(SMRT) (71). SMRT activity can be enhanced both in the presence and in the absence of the ligand, while NCOR only gets activated in the presence of ligand (48, 71, 83). Both SMRT and

NCOR mediate AR repression through recruitment of histone deacetylases (HDAC) which

12 stimulates DNA packaging into nucleosomes and inhibits the interaction between transcription machinery and nuclear receptors (71, 84).

1.4 Prostate Cancer (PCa)

1.4.1 Development

Cancer of the prostate is a result of the disrupted cellular homeostasis of the prostate

gland (85). There are two major theories about the underlying molecular mechanisms of

prostate cancer initiation. The first theory indicates that disruption in cellular homeostasis is

mainly the result of the accumulation of molecular abnormalities that result in genomic

instabilities (86, 87). Genomic instability leads to uncontrolled proliferation potential which

serves as the first step in the process of tumour initiation (87, 88). Additional mutations over

the course of cancer progression confer advantages to the cell to increase the survival, invasion

and metastasis potential (88). The second theory proposes that cancer stem cells, which are a

rare phenotypically‐distinct subpopulation of cells with the potential to form new tumours, are

responsible for the initiation of PCa (89, 90). More than 90% of prostate cancers are

adenocarcinoma and arise from the epithelial compartment of the gland (91). Prostate cancer is

multifocal and heterogeneous cancer in nature with as many as 5 or 6 tumours occurring in a

single prostate (92, 93).

1.4.2 Epidemiology and Risk Factors

PCa is the third leading cause of cancer‐related mortality and the most frequent non‐

skin cancer in Canadian men (94). In 2011, PCa will continue as the leading cause of cancer, with an estimated 25,500 newly diagnosed cases, resulting in approximately 4,100 deaths

13 among Canadian men (94). Worldwide PCa is the second most diagnosed and the sixth leading cause of cancer‐related mortalities (95).

Several risk factors have been described to increase the chance of PCa development and progression (96). Age is the number one risk factor associated with PCa development and progression (96, 97). Studies on PCa autopsies have shown that even by the age of 20, around

10% of men have PCa cells in their prostate gland (96, 97). The risk increases to about 30% by

the age of 50 and 80% by the age of 80 (96‐99).

Family history is another important factor in PCa development (100, 101). Risk of PCa development has been shown to be higher in male relatives of PCa patients (101‐103). It has been reported that there is a 2.41 fold increased risk of PCa development for men with first degree relatives with PCa (100, 103). There is also evidence that chances of PCa diagnosis is

15% higher for men who had a father or brother diagnosed with PCa in comparison with 8% in

the control population (100, 104). The common loci associated with PCa has been reported to

be at 8q24 and 17q (105). There are a number of genes reported by different groups to have correlation with PCa susceptibility such as AR, SRD5A2, BRCA2, MSMB, LMTK2, KLK3, CYP17A1

(105, 106).

A further important factor in incident, progression and mortality rate of PCa is

Race/ethnicity (96). African American men are more likely to have a worse prognosis and a

higher mortality rate compared to White men (96, 97, 107). The PCa incidence rates and its associated mortality rates have been shown to be much lower in most of Asian countries (99,

107, 108).

14 Diet and the average dietary fat intake also appear to have an impact in PCa development, progression and mortality rate (96, 109).

1.4.3 Diagnosis and Prognosis

Routine PSA blood test screening and digital rectal exam (DRE) in North America has helped to shift the stage of disease at the time of diagnosis to a much earlier and more curable

stage (110). PSA blood test was developed in the late 20th century and is considered to be the

most important biomarker for detection and monitoring of PCa in the early stages (91, 111).

Elevation of PSA levels to more than 4.0 ng/ml in the blood is considered as suspected for

cancer (85, 112). PSA is a member of the family of kallikrein proteases (HK3) which is mainly produced by the luminal secretory epithelial cells of the prostate (91). PSA blood test is a sensitive, relatively inexpensive and non‐invasive procedure (113, 114). The main disadvantage of PSA test is that it is not specific to the cancer of the prostate and common pathological

conditions including benign prostate hyperplasia (BPH) and prostatitis can result in false

positive test results (91, 114).

DRE is another basic tool for early detection of prostate cancer which often detects

cancers missed by other methods (91). The main advantage of DRE is that it may detect cancer

in men with small, well differentiated tumours that have normal PSA levels (91, 115).

Moreover, DRE is also a well‐tolerated and relatively inexpensive procedure (91). The main limitation of this test is that important cancers are located in parts of the gland that are distant and evasive to digital palpation (91). PSA combined with DRE appears to be the most effective

15 screening tool for early detection of PCa, however the important adverse effect of PCa screening has been shown to be the overdiagnosis and overtreatment of the patients (91, 116).

Transrectal ultrasound (TRUS) and needle biopsy are used as further steps to confirm diagnosis and aid the grading of the cancer (91). These procedures are highly sensitive and play

a very important role in screening and early diagnosis of PCa (91). Any positive case detected from these procedures will usually be followed up by histological examination to determine the stage of cancer as well as to detect any localized cancer outside the prostate (91).

The most commonly used system for histological classification of PCa is Gleason grading

(117, 118). In this method, grades from 1‐5 are given to the tumour biopsies taken from the

patient (117). Histological grading of the cancer is determined based on the Gleason score

which is described as the sum of the grades assigned to the most common patterns of glandular structures observed within the tumour sample (119). Gleason grade 1 indicates a normal pattern and Gleason grade 5 demonstrates that no glandular structure was observed (119).

Gleason scores between 2‐4 are considered as low grade/well differentiated, scores between 5‐

7 indicate a moderate grade/moderately differentiated and scores from 8‐10 are the high

grade/poorly differentiated cancers (119). The Tumour, Node, Metastasis (TNM) staging system

is another system used by physicians to determine the stage of the prostate cancer (120). The

TNM system includes a) the size and local growth of the tumour (T) b) the extent of lymph node metastasis (N) and 3) the incidence of distant metastasis (M) (120).

As discussed the established biomarkers for PCa screening have limitations and there is a need for identification of biomarkers with more diagnostic and prognostic values. There are a

16 number of promising biomarker candidates under investigation for PCa including the human kallikrein 2, Prostate Membrane‐Specific Antigen (PSMA), circulating tumour cells, Prostate

Stem Cell Antigen (PSCA), Early Prostate Cell Antigen (EPCA), TMPRSS2‐ERG gene fusion

rearrangement, serum calcium, caveolin‐1, the Prostate Cancer Antigen 3 (PCA3 or DD3) and

exosomes (91, 121). Data obtained from these studies will hopefully have an impact on the

discovery of PCa in early stages as well as prediction of malignant phenotype.

1.5 Treatment

Stage of the disease is the most important factor in choosing the right treatment option

for patients with PCa (122). When confined to the prostate gland, active surveillance, radiation

therapy and surgery are the treatment options for patients (123‐126).

Active surveillance is a strategy used for patients with low risk disease or those in relatively early stages of PCa when patient’s age and health status predict a short life

expectancy (122, 127). These patients are closely monitored by prostate biopsies, PSA level

measurements and DRE at regular intervals, and the decisions are made based on individual

patient’s condition and the rate of disease progression (122, 127, 128). In recent years,

however, active surveillance and monitoring by biopsy, PSA test and DRE have been adopted by

many physicians as a common treatment strategy to overcome the overdiagnosis and

overtreatment of patients with clinically insignificant disease (128, 129).

Radiation therapy, is another treatment option for patients with localized PCa (122). PCa

patients who prefer to avoid the risks of invasive surgery choose radiation therapy (130). There

17 are two forms of radiation therapy used for the treatment of PCa patients: the external beam radiation therapy (EBRT) and internal radiation therapy (brachytherapy) (131, 132).

Radical prostatectomy is a surgical procedure to remove the prostate gland and the attached seminal vesicles (133). Radical prostatectomy is one of the most effective treatment

approaches to maximize the quality of life of the patients with locally confined PCa (134, 135).

However, it is an invasive procedure and it is associated with side effects such as erectile

dysfunction and decline in urinary function (135, 136).

Almost 10‐20% of patients diagnosed with PCa progress to the advanced‐metastatic

castration resistant prostate cancer (58, 137). The only treatment option available to the

patients with metastatic PCa is hormone ablation therapy (138). Hormone ablation therapy can

be performed either through the orchiectomy (surgical removal of testicles) or medical castration (inhibition of hormone production) (138, 139).

Despite the early response to hormone ablation therapy, almost all patients will

advance to the castration resistant stage (140). Until recently, only docetaxel‐based

chemotherapy was shown to improve survival in patients with CRPC (58). The improved

understanding of the underlying mechanisms that lead to the development of CRPC resulted in

development of new drugs with promising therapeutic potential as discussed below:

A. AR antagonists: One of the major mechanisms that contribute to the development of the

CRPC is maintained AR signaling (58, 140, 141). Two classes of steroidal and nonsteroidal

anti androgens are developed which act by competing with endogenous androgen to bind

to AR (58, 142). It has been shown that steroidal AR antagonists such as cyproterone

18 acetate and mifepristone and nonsteroidal AR antagonists including nilutamide, flutamide

and bicalutamide have a modest benefit to the patients (58, 143, 144).

MDV‐3100 is a new and promising AR antagonist. It has approximately eight fold more

affinity for AR in comparison with bicalutamide and reduces the efficiency of AR nuclear

localization (58, 145). In the phase I/II clinical trial, total of 140 patients with progressive

CRPC, in two subgroups of chemotherapy‐naïve and post‐chemotherapy, were treated with

30‐600 mg/day of MDV3100. A 62% and 51% decline from the baseline in serum PSA was

observed respectively. Two phase III clinical trials of MDV3100 on progressive CRPC patients

(in two groups of progressive chemotherapy‐naïve and docetaxel‐pretreated) are ongoing

with interim promising results (146, 147).

B. CYP17 inhibitors: Abiraterone acetate is a small molecule inhibitor of cytochrome P450

(CYP17) enzyme (148, 149). Cytochrome P450 is one of the key enzymes for both adrenal

and intratumoural de novo synthesis of androgens (58, 150). In a phase II clinical trial with

47 chemotherapy‐naïve CRPC patients, a 50% decline from the baseline in serum PSA was

observed in 30% of the patients (146). When combined with prednisone (corticosteroid

drug), a 50% decline from the baseline in serum PSA was observed in 79% of the

chemotherapy‐naïve CRPC patients (146). In a phase III clinical trial 1195 patients with

metastatic CRPC post‐docetaxel therapy were treated with abiraterone plus prednisone

resulted in longer overall survival time compared with the patients treated with prednisone

plus placebo (14.8 versus 10.9 months) (146). A second phase III trial with abiraterone in

chemotherapy‐naïve metastatic CRPC patients has completed in 2011 (146). Based on the

19 favourable results obtained in the clinical trials this drug was approved by FDA to be used

for the treatment of patients with progressing CRPC after docetaxel therapy (58).

Similar to abiraterone acetate, TAK‐700 is another novel inhibitor of cytochrome P450

(CYP17) enzyme that shows initial positive results in phase I/II clinical trials (146).

C. Chemotherapy: A number of chemotherapeutic agents have been employed for the

treatment of CRPC, but docetaxel was the only one with both palliative and life‐prolonging

results (151‐153). Based on promising results obtained from two phase III clinical trials,

docetaxel was approved by FDA for treatment of men with metastatic CRPC (151, 152).

Unfortunately, despite the promising clinical trial results, all patients treated with docetaxel

eventually either developed resistance to this treatment agent or were not able to tolerate

its side effects in long term (153). In 2010, cabazitaxel received FDA approval as a second‐

line treatment option for patients who failed the docetaxel therapy (58, 154).

D. Immunotherapy: Development of an immunotherapy for PCa has been a challenging task

(58). Recently, it has been reported that PCa is more immunogenic than previously

appreciated (155) and the first immunotherapeutic compound for the treatment of CRPC

was approved in 2010 by FDA (156). This immunotherapeutic agent is called Sipuleucel‐T

which is a immunotherapy antibody against immune checkpoint programmed death‑1 (PD‑

1) protein (58). Sipuleucel‐T is approved for the treatment of asymptomatic or minimally

symptomatic metastatic CRPC (156, 157).

There are a number of other promising drug candidates for the treatment of CRPC such

as Orteronel or TOK‐001 (CYP17 inhibitors) (58, 158), Alpharadin (Immunogenic drug) (58),

20 inhibitors of cytoprotective chaperones (OGX‐011, OGX‐427, Hsp90 inhibitors), Src (Sarcoma) family kinase inhibitor drugs (Dasatinib, Bosutinib) (159‐161) now in clinical trials. It is a hopeful period in finding the treatment of CRPC and with continued efforts in understanding the underlying molecular mechanisms of this part of the disease, better therapeutic strategies are

expected to be developed.

1.6 Development of Castration Resistant Prostate Cancer (CRPC)

All prostate tumours depend on androgen (AD) and regress in response to the removal

of circulating androgen by castration (162). Despite the initial response to the removal of androgens almost all patients with advanced PCa progress to a stage called castration resistant

prostate cancer (CRPC), in which the prostate cells grow despite the low levels of androgens available to them (162). Some of the proposed theories for progression of PCa to the CRPC stage will be discussed in this section:

A. Role of AR in the development of CRPC: In recent years it was reported that despite

androgen deprivation therapies, very low levels of androgens are still detectable in the

serum and tissue of patients with CRPC (163‐165). Therefore, CRPC is described as the

advanced form of PCa which is resistant to hormone ablation but is not free of androgens

(163). AR was observed to be expressed and functionally active in the castrate resistant

prostate tumours (163, 165). It has been reported by different groups that AR stimulates

the proliferation and survival of PCa cells and stays active in advanced forms of the disease

(163, 166). The following theories describe how AR becomes active in a low androgen

condition and play a role in the development of CRPC:

21 i. Hypersensitive pathway: This theory indicates that AR, through mutations,

amplifications of its gene becomes extremely sensitive to the low levels of androgens

available in a castrated environment (139, 167). ii. Ligand independent activation: The pathway describes the mechanisms through which

AR becomes activated by growth factors and receptor tyrosine kinases. Growth factors

and cytokines such as Insulin Growth Factor‐1 (IGF‐1), Epidermal Growth Factor (EGF)

and Interleukin‐4 and‐6 have been shown to be overexpressed in CRPC. These growth

factors and cytokines activate receptor tyrosine kinases (RTKs) and lead to AR

phosphorylation via either protein kinase B (Akt) or mitogen‐activated protein kinase

(MAPK), resulting in activation of AR in the absence of androgens (139, 167‐170). iii. Promiscuous pathway: This pathway describes how ligands other than DHT such as

non‐androgenic steroids (progestins and estrogens) and anti‐androgens (flutamide

and hydroxyflutamide) can activate AR. Activation of AR through this pathway is the

result of mutations in the LBD of AR that leads to nonspecific binding of AR to ligands

other than DHT. The most frequently found mutations in LBD of AR in patient tumours

are the H874Y, T877A, and T877S (139, 163, 168). iv. Co‐activators and co‐repressors: Increased expression of AR co‐activators such as SRC‐

1, TIF‐2 and ARA70 has been reported in CRPC. Overexpression of AR co‐activators in

CRPC has been shown to increase the transcriptional activity of AR in response to

nonspecific ligands such as adrenal androgens and other steroids. Furthermore,

several kinase pathways have been reported to enhance the transcriptional activity of

AR via phosphorylation of the AR co‐activators (139, 171‐173).

22 v. Intracrine androgen metabolism: In recent years reports from several groups indicated

a significant mechanism for the development of CRPC. These reports demonstrated

that although the concentration of serum testosterone was significantly low after

castration, levels of intratumoural androgens were sufficient for activation of AR.

Intraprostatic androgens were shown to be synthesized from cholesterol via a de novo

steroidogenesis pathway mediated by steroidogenic enzymes. Expression of all the

steroidogenic enzymes involved in the biosynthesis of androgens including

cytochrome P450 (CYP17), was demonstrated to be up‐regulated in CRPC tumour

specimens (164, 174). CRPC tumours build an intratumoural signaling system via which

they attain the ability to convert adrenal steroids to androgen at concentrations

adequate to activate AR (174, 175). This discovery opened a new door to describe why

prostate cells survive the androgen deprivation therapies (139, 175‐177).

Figure 1.6. The steroidogenesis pathways. All steroid hormones are synthesized from cholesterol. Expression of all the steroidogenic enzymes involved in the biosynthesis of androgens is demonstrated to be up‐regulated in CRPC tumour specimens. CRPC tumours build an intratumoural signaling system via which they attain the ability to convert adrenal steroids to androgen at concentrations adequate to activate AR.

vi. AR splice variants: Discovery of AR splice variants, as a result of alternative gene

splicing in CRPC, which lack the LBD of AR (ARΔLBD) is yet another significant discovery

of the recent years. Several AR splice isoforms have been found in both normal and

pathologic conditions (178). The mRNA encoding for AR45 which is a naturally

occurring AR splice variant has been identified in human placenta tissue (178, 179).

This splice variant of AR is a result of alternative splicing of a newly described exon

located inside intron one of AR gene which substitutes the exon one of wild‐type AR

24 (178, 179). This mRNA gives rise to a 45 KDa AR protein variant that contains the DBD and CTD of wild‐type AR as well as a unique seven amino acid sequence replacing the

NTD of wild‐type AR (178, 179). There are still debates on whether this mRNA is translated into a AR protein variant in normal tissue but its ectopic expression has revealed that this AR splice variant binds to androgens and translocates to the nucleus and negatively regulates wild‐type AR (178).

Furthermore, a number of other AR splice mRNAs have been reported to be present in pathologic conditions such as AIS (Androgen insensitivity syndrome) and CAIS

(Complete Androgen Insensitivity Syndrome) which give rise to dysfunctional AR proteins (178). In addition, Gain‐of‐function variants of AR have been recently discovered in malignant prostate cells and their expression level have been shown to increase significantly with the progression to the CRPC stage (178). These splice variants possess the NTD and DBD of wild‐type AR and have been shown to promote growth and survival of prostate cells in the castrated environment (178). Proteolytic degradation of full‐length AR by calpain‐2 as well as alternative splicing are the proposed mechanisms for synthesis of these AR splice variants (178). The AR1/2/2b and

AR1/2/3/2b, AR3, AR4, AR5, AR23 are some of the variants that have been characterized in hormone‐refractory prostate cancer cell lines including CWR22 and 22RV1 by different groups (178). In contrast to wild‐type AR which is responsible for androgen‐ dependent expression of AR target genes and androgen‐dependent prostate cell growth, AR splice variants are shown to be responsible for androgen‐independent expression of AR target genes and androgen‐independent prostate cancer cell growth

25 (178). Therefore, the expression and activity of these AR variants is independent of

the presence of androgens or anti‐androgens which indicates a correlation to

androgen independence in prostate cancer cells (139, 180, 181).

B. Bypass pathway: This theory indicates that activation of oncogenes or inactivation of

tumour suppressors in CRPC results in up‐regulation of growth and survival signals via

pathways other than AR pathway. Up‐regulation of Chaperone proteins (Hsp27, Hsp90,

Clusterin), growth factors (IGF‐1, EGF), Bcl‐2 protein and PI3K pathway are examples of

some of the alterations that have been reported in CRPC which result in growth and survival

of prostate cells in the castrated environment (139, 182).

An accumulating body of evidence indicates a central role for AR and its underlying signaling pathway in the development of CRPC. A detailed understanding of the principal mechanisms leading to the activation of AR in CRPC will support the development of more promising therapeutic strategies for patients in this stage.

Figure 1.7. Molecular mechanisms involved in the progression of CRPC. CRPC progression depend on several interconnected mechanisms that render cell survival either via maintaining the activity of AR or through keeping the growth and survival of prostate cells by bypassing the AR pathway. The schematic demonstrates some of the major molecular mechanisms involved in the progression of CRPC.

1.7 Chaperone Proteins

1.7.1 Biology and Function

The term molecular chaperone was coined in 1987 to define a newly recognized group of proteins which interact and stabilize other proteins to obtain their functionally active state without being physically involved in their final structure (183‐185). This group of proteins are

27 composed of several different and unrelated families of proteins with highly similar function

(184).

In normal cellular condition chaperone proteins are involved in (a) proper de novo protein folding, (b) re‐folding of denatured proteins after stress, (b) assembly and disassembly of multi‐subunit proteins, (c) facilitation of protein trafficking across the intracellular organelles

such as the: endoplasmic reticulum (ER), nucleus and mitochondria and (d) removal of

misfolded and aggregated proteins through the protein degradation pathways (ubiquitin‐

proteasome system (UPS) and autophagy system) (184, 186).

Expression of chaperone proteins rapidly increases under stressful conditions such as

heat shock and UV irradiation (187). Therefore, they are also categorized as heat shock proteins

(Hsps) or cell stress proteins (187). Chaperone proteins are classified based on their molecular weight (184, 187). The high molecular weight chaperone proteins act in a ATP‐dependent manner and the small chaperone proteins are ATP‐independent (184). Mammalian chaperone

proteins are categorized in 4 major families of Hsp60, Hsp70, Hsp90 and the small heat shock

proteins including Hsp27 (188).

Expression of Hsps is regulated by transcription factor, heat shock factor 1 (HSF1) (189).

This transcription factor becomes activated upon several different protein‐denaturing cellular

stresses such as hypoxia, heat shock and UV irradiation (189, 190). Activation of HSF1 leads to

increased expression of Hsps and helps the process of protein refolding and inhibits protein

aggregation inside the cell (189). Interestingly, it has been reported that HSF1 deficiency lowers

the incidence of tumours in mice (189, 191). Furthermore, short hairpin RNAs (shRNAs)

28 knockdown of HSF1 in human cancer cell lines demonstrated the significant role of HSF1 in cancer cell viability and human malignancies (189‐191). The mechanism through which HSF1 functions in promoting the tumourigenesis is believed to be through the up‐regulation of Hsps and other chaperone proteins which functions to provide relief to the stress experienced by cancer cells (189).

Figure 1.8. The stress‐response pathway in cancer cells. The stress‐response pathway in cancer cells occurs via the activation of HSF1. Activation of HSF1 leads to increased expression of chaperone proteins including the Hsps which direct the unfolded proteins towards refolding or proteasome degradation and protect the cancer cells from the accumulation of misfolded proteins which leads to apoptosis.

29 1.7.2 Small Heat Shock Proteins (sHsps)

Small heat shock proteins are ATP‐independent molecular chaperones that are characterized by a conserved sequence of 80‐100 AA, which is called the α‐crystalline domain

(192). This domain has been shown to play an important role in dimerization and proper function of the sHsps (192, 193). The N‐terminal domain of sHsps is hydrophobic and plays a role in substrate binding and oligomer formation. However, their C‐terminal domain is flexible

and amorphous and is mainly involved in the stability and assembly of oligomers (194). In

recent years, expression of sHsps has been reported by several groups to be involved in many

human diseases including cancer (188, 195‐198). Expression of sHsps has been shown to

increase after cellular insults such as toxic radicals, carcinogens, hormone therapy and

chemotherapy (199‐201). Cancer cells are frequently exposed to rapid changes in their environment (including nutrient deprivation and hypoxia) and must be able to adapt effectively

to survive (202, 203). Increased expression of sHsps has been shown to be one of the common

mechanisms that cancer cells use to cope with these cellular insults (202).

1.7.3 The Importance of Hsps in AR Stability and Function

Chaperone proteins play a major role in the process of conformational maturation, stability and transcriptional activity of cytoplasmic steroid receptors (204). Association of AR with chaperone proteins such as Hsp90, Hsp70, and Hsp56 (FKBP52) play a key role in the

process of assembly, maturation, stability and function of AR (204, 205). Interaction of AR with these proteins is required for maintaining the high‐affinity, ligand‐binding conformation (204,

205).

30 In the absence of androgenic ligand Hsp90, Hsp70 and Hsp56 interact directly with LBD of AR and keep it in an inactive but highly responsive state (206, 207). In the presence of ligand,

AR goes through a conformational change into the DNA‐binding state which is assisted by

Hsp90 (206, 208). Hsp90 dissociates from the ligand‐bound AR and this leads to the

dimerization and nuclear localization of AR (209). Chaperone proteins such as Hsp70 have been

shown to be involved in the process of nuclear localization and transactivation of AR (206).

Interaction with these chaperone proteins play an important role in AR stability and

manipulation of Hsps results in AR ubiquitination and degradation via the proteasome pathway

(206).

Increased expression of Hsp90, Hsp70 and Hsp56 has been reported to promote AR

transcriptional activity and to be associated with PCa development (206, 210‐212). Therefore,

understanding the mechanism through which chaperone proteins regulate AR protein stability

and activity during the PCa progression to advanced stages is essential (206). Employment of

treatment strategies to inhibit the function of these proteins serves as a potential therapeutic

option for treatment of PCa (206).

1.7.4 Heat Shock Protein 27 (Hsp27)

In 1982, Hickey et al. demonstrated that incubation of HeLa cells at high temperature resulted in accumulation of a previously unknown protein with the molecular weight of 27kDa

(213, 214). Hsp27 belongs to the family of sHsps and its activity is regulated by phosphorylation

(202). This Hsp is expressed in almost all human tissues in normal conditions and its expression

is reported to dramatically increase under certain pathological conditions such as cardiac

31 disease and cancer (195, 214‐216). Regulation of Hsp27 expression is under the control of transcription factor, HSF‐1 which interacts with two heat shock elements (HSE) in the promoter of Hsp27 gene (202, 214). In normal conditions Hsp27 is mainly located in the cytoplasm of the cells: however under stress conditions the amount of Hsp27 in the nucleus increases (214, 217).

Human Hsp27 protein consists of 205 residues and its structure involves an NH2‐terminal

domain (which includes the WDPF‐motif), the α‐crystallin domain and a short C‐terminal

domain (which play an important role in Hsp27 oligomerization) (214). Hsp27 protein is

phosphorylated at multiple sites by few protein kinases (214, 218). Ser15, Ser78 and Ser82 have

been characterized as the main phosphorylation sites of Hsp27 (214).

Under stress conditions, it has been shown that expression of Hsp27 increases to

prevent protein aggregation and facilitate elimination of misfolded proteins (219). Hsp27 also

plays a role as a scaffolding protein to facilitate protein‐protein interactions as well as

phosphorylation of signaling pathways (219, 220). Moreover, It has also been reported that

Hsp27 interacts with key regulators of apoptosis such as procaspase‐3 and cytochrome C and

inhibits cell death (221, 222). Overexpression and activity of Hsp27 is associated with several malignancies including PCa (197, 202, 223‐225). Hsp27 overexpression is considered a powerful

biomarker and a potential therapeutic target of aggressive PCa (219, 226‐228).

Our laboratory has previously reported that knockdown of Hsp27 results in a suppression of prostate tumour growth and sensitizes prostate cancer cells to chemo‐therapy,

hormone‐therapy, and radiation‐therapy (226, 228, 229). Based on the promising results

obtained in our lab and reports in the literature indicating a potential role for Hsp27 as a

32 therapeutic target for advanced PCa, OGX‐427, a selective second generation antisense oligonucleotide (ASO) inhibitor of Hsp27 was developed which is now in the phase I/II clinical trials for several cancer types (219). Hsp27 knockdown demonstrates promising results in the clinical trials, thus, a better understanding of its mechanism of action is needed.

1.8 Protein Kinases

Phosphorylation is one of the major control mechanisms for the cellular functions (230‐

232). Phosphorylation and dephosphorylation of target substrates such as proteins and lipids

inside the cell orchestrates the activation of signaling pathways in response to extracellular and

intracellular signals to regulate the growth, proliferation and survival of cells (232). 539 protein

kinase genes have been identified to be encoded by the human genome (232). Based on the target amino acid (s) that protein kinases phosphorylate, they are divided into three different

categories of (a) Serine/Threonine kinases, (b) Tyrosine kinases, and (c) Dual‐specificity kinases

(230). Protein kinases catalyze a reversible chemical reaction through which a phosphate group

from ATP of the donor molecule is transferred to the serine, threonine or tyrosine of the target

protein (233).

Deregulation of protein kinases activity has been implicated with various disorders including immunological diseases, neurological complications and cancer (234). Study of Rous sarcoma virus which carried v‐src gene on its genome led to the discovery of first proto‐ oncogene Src protein tyrosine kinase in 1970 (235, 236). Raf kinase was the first serine/threonine kinase with Src‐like oncogenic potential to be discovered (237). Oncogenic

33 signals initiated from mutated serine/threonine and tyrosine kinases have been shown to result in anchorage‐independent growth, excessive cell proliferation and cancer cell metastasis (238).

1.8.1 Tyrosine Kinases and Their Role in Cancer Progression

Tyrosine phosphorylation plays a fundamentally important role in regulation of different cellular functions including: cell proliferation, transcriptional activation, differentiation and

development (239). Tyrosine kinases are divided into two classes: 1) Receptor tyrosine kinases

(RTKs), and 2) non‐receptor (cytosolic) tyrosine kinases (NRTKs) (239, 240). RTKs are type I

transmembrane proteins which possess an N‐terminal extracellular domain, a single

transmembrane domain, and a C‐terminal cytoplasmic domain (239). They can bind the

activating ligands through their NTD and their CTD include the catalytic domain (239, 240).

NRTKs are characterized as intracellular proteins, however, a subset of them are found to be associated with membranes through a membrane targeting post‐translationally modified

N‐terminus (239). The membrane‐associated NRTKs act as the catalytic subunits for receptors which lack catalytic function (239). Both RTKs and NRTKs are activated in a ligand‐induced fashion resulting in tyrosine phosphorylation of the cytoplasmic proteins and thereby activation of their underlying signaling pathways (239). Aberrant activation of tyrosine kinases has been reported in different human malignancies and a number of tyrosine kinase inhibitor drugs have been approved for clinical implications (239).

34 1.8.2 Tyrosine Kinases and Their Role and PCa

Both receptor and non‐receptor tyrosine kinases have been shown to play a significant role in the growth and metastatic progression of prostate cancer (241, 242). Epidermal Growth

Factor Receptor (EGFR), Insulin‐like Growth Factor‐1 (IGF‐1R), Human Epidermal growth factor

Receptor 2 (HER‐2), Nerve Growth Factor Receptor (NGFR), c‐MET Receptor and Fibroblast

Growth Factor Receptor (FGFR) are examples of some of the RTKs that have been associated with PCa carcinogenesis (241, 243‐245). These RTKs have been reported to be involved in different aspects of PCa carcinogenesis including tumour growth, metastasis and drug

resistance (241). For instance, elevated expression of HER2 and IGF‐1R in advanced stages of

PCa has been reported to confer androgen independence (241, 246, 247). On the other hand,

activation of AR downstream of EGFR and IGF1‐R signaling has been described to promote

prostate cancer cell proliferation and survival in the absence of androgenic ligands (241, 248).

Furthermore, overexpression of c‐MET receptor and its ligand, HGF (Hepatocyte growth factor), is shown to be involved in drug resistance and metastasis of PCa tumours (241, 249).

Several NRTKs have also been associated with prostate cancer carcinogenesis (169, 170,

242). Amongst the NRTKs, members of the Src, FAK, ETK, JAK1/2 and ACK NRTKs have been shown to play a major role in both early and advanced stages of PCa (242). Src kinase as well as its two other family members Lyn and Fyn are reported to be involved in PCa progression

through the regulation of PCa cell growth, migration, metastasis (241, 242, 250, 251).

Furthermore, it was recently shown that Src kinase plays a key role in tyrosine phosphorylation

and transcriptional activity of AR in the castrated environment (169, 241). Members of the FAK

family of NRTKs are shown to be involved in prostate cancer cell adhesion and migration and

35 their presence was demonstrated to be essential for castration‐resistant formation of PCa (241,

252). The ETK and JAK1/2 family members are reported to be associated with regulation of PCa cell survival, migration and angiogenesis (241, 253). Moreover, similar to Src kinase, Ack‐1 kinase has also been revealed to interact directly and tyrosine phosphorylate AR (170). Tyrosine

phosphorylation of AR via Ack‐1 likewise plays an important role in regulation of AR

transcriptional activity (170, 241).

Increased expression and activity of different members of the RTKs and NRTKs have

been implicated in prostate carcinogenesis (241). These proteins regulate key aspects of

prostate cancer progression, particularly in the development of CRPC (241). Therefore, inhibition of their activity is an encouraging therapeutic option for CRPC. Several inhibitors of tyrosine kinases are now in clinical trials; thus it is key to increase our understanding of their role in different stages of prostate cancer progression to help the development of more

effective and specific drugs to inhibit their function.

1.8.3 Lyn Tyrosine Kinase

Lyn tyrosine kinase was identified in 1987 as a member of the Src family of NRTKs (254).

Src family of NRTKs includes eleven family members of Src, Lyn, Yes, Lck, Hck, Fgr, Blk, Brk, Srm,

Fyn and Frk (255). All the members of the Src family contain the following domain structures: a

unique myristylated N‐terminal domain, SH3 and SH2 domains, a kinase catalytic domain (SH1)

and a regulatory C‐terminal domain (255, 256). The NTD of Lyn kinase mediates the association

of the protein with the plasma membrane (256). The SH2 and SH3 domains of the protein play a role in recognition of substrate or adaptor proteins as well as fixation of the protein in its

36 inactive state (256). The kinase domain of the protein is required for enzyme activity of the protein (256).

Lyn is ordinarily maintained in a closed inactive conformation through two major intramolecular inhibitory interactions, namely binding of the phosphorylated C‐terminal tyrosine residue, Tyr508 to the Src Homology 2 (SH2) domain and interaction of a PPII

(polyproline type II helical) motif in the SH2‐kinase linker with the SH3 domain (257‐259). The activation of Lyn involves disruption of these inhibitory interactions through multiple

mechanisms, such as dephosphorylation of Tyr508, displacement of the tail from the SH2

domain, displacement of the PPII motif from the SH3 domain and is characterized by autophosphorylation of the specific Lyn Tyr396 in the activation‐loop (259, 260).

Figure 1.9. Structural schematic of the Lyn tyrosine kinases in their inactive and active configurations. Lyn is ordinarily maintained in a closed inactive conformation (left) through two major intramolecular inhibitory interactions, namely binding of the phosphorylated C‐terminal tyrosine residue, Tyr508 to the Src Homology 2 (SH2) domain and interaction of a PPII (polyproline type II helical) motif in the SH2‐kinase linker with the SH3 domain. The activation of Lyn (right) involves disruption of these inhibitory interactions through multiple mechanisms, such as dephosphorylation of Tyr508, displacement of the tail from the SH2 domain, displacement of the PPII motif from the SH3 domain and is characterized by autophosphorylation of the specific Lyn Tyr396 in the activation‐loop.

Lyn kinase is expressed primarily by hematopoietic cells and plays a key role in signal transduction from cell surface receptors such as B cells and cytokine receptors (256, 261).

Involvement of Lyn in other cellular functions such as cell proliferation, apoptosis and

38 cytoskeletal change has been reported (256, 262, 263). Alternative splicing of exon II of the Lyn gene gives rise to the two Lyn isoforms with the molecular weight of 53 and 56 KDa (264).

Expression and activity of Lyn kinase has also been reported to be associated with several types of cancers including breast and prostate cancer (52, 251, 265). Lyn kinase has

been identified as a regulator of the invasion and metastasis capacity of the breast cancer cell

lines and its knockdown resulted in the inhibition of the migration and invasion potential of the

cells (265). It is also reported that Lyn kinase is expressed in the majority of primary human PCa specimens (251) and its expression is up‐regulated in CRPC (266). Targeting Lyn expression

using antisense oligonucleotides and siRNA, or Lyn activity using inhibitory peptide against Lyn

kinase domain resulted in reduced cell proliferation in PCa cell lines (267) and reduced tumour

volume in the DU145 xenograft model (251).

Despite structural similarities between the members of the SFKs, genetic manipulations

revealed a unique role for each member of the family (52, 251, 268‐270). Growing body of

literature suggests an important role for Lyn kinase in progression of prostate cancer but the underlying mechanisms through which Lyn mediates this role remains undefined. In chapter 3

and 4 of the current thesis we will discuss the role of Lyn kinase in regulation of AR in the castrated environment and provide the mechanism through which Lyn exerts its effects.

1.9 Prostate Cancer Cell Line Models

LNCaP, PC3 and DU145 cells are the three cell lines that are most commonly used for the study of different stages of PCa in vitro (271). LNCaP cells are derived from a metastatic

39 lesion of a human prostate adenocarcinoma (272). These cells possess AR and treatment with androgens modulates their proliferation potential thus making them a suitable model for the study of androgen‐dependent prostate cancer (272). However, the AR in LNCaP cells has been reported to contain a mutation (T877A) in the LBD which results in the activation of LNCaP AR

in response to several steroids and antiandrogens (273, 274).

C4‐2 cell line is a cell line derived from LNCaP cells grown as xenografts after castration.

These are considered to be castrate resistant, but still androgen sensitive; as the AR‐mediated

gene expression is still responsive to the treatment with androgen in this cell line (275).

PC‐3 and DU145 cells are the cell line models for the in vitro study of androgen‐ independent PCa. These cells are derived from the bone and brain metastatic lesions of prostate adenocarcinoma, respectively (276, 277). Expression of AR in both of these cell lines has been reported to be negative (278).

1.10 Thesis Hypothesis and Specific Objectives

It is now clear that the AR signaling pathway plays a central role in the initiation and progression of the PCa (77, 279). It has been reported that AR is expressed in almost all primary prostate cancers (77, 280, 281). Furthermore, a correlation between the level of AR in primary and metastatic PCa and disease progression has been observed in both human and animal

models (77, 282, 283). Therefore, it is now generally accepted that the complex interplay of

multiple mechanisms, leading to aberrant activation of AR, plays an essential role in evolution

of PCa from an organ confined to the castrated‐resistant disease (77, 162, 283). Exploring the

40 mechanisms behind AR signaling in both primary and CRPC is crucial for development of the new and more clinically beneficial therapeutic strategies for PCa patients (163, 284).

The significant role of chaperone proteins and protein kinases in PCa disease initiation and progression has been reported by our research group and others (52, 285‐290). Moreover,

inhibition of chaperone proteins and protein kinases expression delay prostate xenograft

growth and castrate‐resistant progression (226, 229, 267, 291, 292). Therefore, we

hypothesized that increased expression and activity of Hsp27 and Lyn kinase play a key role in

enhancing the transcriptional activity of AR which results in prostate cancer cell survival.

In order to test this hypothesis the following objectives and specific aims were followed:

Objective #1: To attest Hsp27 promotes prostate cancer cell survival, through interaction and regulation of AR protein expression and transcriptional activity.

Specific aims: (a) to investigate the relationship between AR and Hsp27 in prostate

cancer cells; (b) to determine the possible effect(s) of Hsp27 gain or loss of function on AR

protein expression and activity; (c) to evaluate the in vivo effect(s) of Hsp27 knockdown on prostate cancer progression using the LNCaP xenograft model.

Objective #2: To attest Lyn tyrosine kinase regulates AR pathway and participates in

prostate cancer progression to castrate resistant stage.

Specific Aims: (a) to determine the expression level of Lyn in the prostate cancer cell

lines as well as in human tissue specimens and the importance of Lyn expression in PCa progression to CRPC; (b) to investigate the possible role of Lyn in regulation of AR; (c) to define

the molecular mechanism through which Lyn contributes to PCa progression.

41 Objective #3: To attest Lyn facilitates CRPC by integrating the growth factors and/or cytokines signaling pathways, thereby enhancing AR transcriptional activity via tyrosine phosphorylation which ultimately promotes prostate cancer cell survival.

Specific Aims: (a) to determine if epidermal growth factor (EGF)‐ and/or interleukin‐6

(IL‐6)‐signaling pathway(s) lead to Lyn phosphorylation in CRPC; (b) to investigate the molecular

mechanisms through which Lyn phosphorylation modulate AR transcriptional activity.

To address the first objective three specific aims were generated. First, we performed experiments to study the interaction between AR and Hsp27. Data obtained from this part of the experiments revealed that Hsp27 is rapidly phospho‐activated upon treatment with

androgens and interacts with AR directly. Based on these observations, we then designed experiments to examine our second objective. Using gain‐ and loss‐ of function experiments we

determined that Hsp27 expression regulates the transcriptional activity of AR. Furthermore, we

showed that Hsp27 knockdown leads to decreased AR protein expression levels without

affecting the mRNA levels of AR. Our results indicated that, absence of Hsp27 destabilizes AR

through disruption of AR/Hsp90 complex and leads to the binding of AR to the E3 ligase MDM2

and its rapid degradation via the proteasome. As the last step and to confirm our in vitro

findings we examined the in vivo effect of Hsp27 knockdown on the progression of prostate

cancer using LNCaP xenograft model. Treatment of mice tumours with OGX‐427 (ASO drug

targeting Hsp27) resulted in 15% decrease in tumour volume and 60% reduction in serum PSA.

This set of data further confirmed the in vitro results and shed light on the importance of Hsp27 in regulation of AR in PCa (chapter 2).

42 Current literature suggests that Lyn kinase promotes prostate cancer cell survival in vivo and in vitro. Therefore, in chapter 3 we focused on investigating the molecular mechanisms through which Lyn tyrosine kinase regulates the proliferation and survival of PCa cells. In addressing this objective three specific aims were followed. First, expression of Lyn kinase was

analyzed and consistent increase in expression of Lyn kinase in the low androgen environment

was detected in both in vitro and in vivo models of PCa. Furthermore, the role of Lyn kinase in

CRPC progression was investigated through the in vivo experiments using Lyn overexpressing

LNCaP cells to look for the effect of Lyn on the progression of PCa to the CRPC stage. Results obtained from our in vivo experiments revealed that Lyn overexpression caused a higher rate of tumour growth and PSA relapse after castration. Next, we investigated the mechanism through which Lyn contributes to the progression of CRPC and examined whether this role is through the regulation of AR. Data gained from this part proved that Lyn kinase has a key role in

regulation of AR transcriptional activity. Finally, the underlying mechanism through which Lyn regulates AR transcriptional activity was investigated. Results obtained from this part indicated

that Lyn knockdown disrupts the binding between AR/Hsp90 and therefore leads to AR

destabilization, ubiquitination and degradation. Effect of Lyn knockdown on AR stability was

shown to be reflected in the cell survival and proliferation potential of LNCaP cells (chapter 3).

Lyn kinase participates in signal transduction via cell surface receptors that lack intrinsic

tyrosine kinase activity in response to a wide range of extracellular stimuli, such as growth

factors and cytokines. It has been reported that in the absence of androgens, signal

transduction pathways, downstream of the growth factors and cytokines, phosphorylate and

activate AR. Therefore, in chapter 4 we explored the signaling pathway(s) leading to Lyn

43 phosphorylation in PCa cells and also investigated whether Lyn modulates AR transcriptional activity downstream of growth factor or cytokine signaling pathways. First, we demonstrated that Lyn kinase is phosphorylated upon EGF and not upon IL‐6 stimulation. This set of data suggested that Lyn can be involved in EGF‐mediated AR transactivation. Further studies

demonstrated that Lyn knockdown inhibits the EGF‐mediated phosphorylation of ERK. ERK kinase has been reported to regulate AR transcriptional activity through the phosphorylation of

AR co‐activators, SRC‐1 and SRC‐2. Therefore, regulation of AR transcriptional activity indirectly, through EGF‐mediated ERK phosphorylation, was one of the possible mechanisms that we described for Lyn‐mediated regulation of AR transactivation. Next, through

immunoprecipitation analysis we observed that AR and Lyn interact directly. Additionally, using

Lyn kinase dominant negative (DN) and constitutively active (CA) constructs, we demonstrated

that AR tyrosine phosphorylation is decreased in the presence of Lyn DN construct. The last set

of experiments performed in this part indicated that Lyn kinase plays a key role in regulation of

growth factor‐induced AR transcriptional activity (chapter 4).

These data have identified for the first time that protein expression and transactivation

of AR can be modulated by Hsp27 and Lyn tyrosine kinase. Furthermore, we identified the

underlying molecular mechanisms involved in this process. Data obtained in this thesis helps improve understanding of the molecular mechanisms involved in the regulation of PCa cell survival by Lyn and Hsp27 towards development of better treatment strategies to inhibit their

function.

44 CHAPTER 2: Cooperative Interactions between Androgen Receptor and Hsp27 Facilitate AR Transcriptional Activity1

2.1 Introduction

The AR, a ligand‐dependent transcription factor and member of the class I subgroup of

the nuclear receptor superfamily, plays a key role in prostate carcinogenesis and progression. In

response to androgen, cytoplasmic AR rapidly translocates to the nucleus and interacts with sequence specific Androgen Response Elements (ARE) in the transcriptional regulatory regions

of target genes (75, 293). The classical model of androgen‐regulated AR transcriptional activity

has not fully defined the many diverse effects of androgens on PCa cell survival and growth. In

addition to this transcriptional genomic action, androgens and other steroid hormones like

progesterone and estrogen can exert rapid non‐genomic effects that are initiated at the plasma

membrane, presumably in conjunction with surface receptors (49, 294).

Similar to progesterone (PR) and estrogen (ER) receptors, AR can interact with the intracellular tyrosine kinase c‐Src to activate MAPK pathway (295, 296). In androgen sensitive

LNCaP PCa cells, AR interacts with the SH3 domain of Src within minutes of androgen treatment to promote cell survival, proliferation, and differentiation (295, 296). Androgens also rapidly stimulate Raf‐1 and Erk‐2, both components of the MAPK signaling cascade (295), suggesting that androgen‐stimulated MAPK activation occurs via non‐genomic mechanisms. This non‐

1 A version of this chapter has been published. Zoubeidi A, Zardan A, Beraldi E, Fazli L, Sowery R, Rennie P, Nelson C, Gleave M. Cooperative interactions between androgen receptor (AR) and heat‐shock protein 27 facilitate AR transcriptional activity. Cancer Research. (2007) Nov 1; 67(21):10455‐65.

45 genomic action of androgen can also influence classical genomic AR activity, including modulation of AR by co‐activators (297). PI3 kinase/Akt is another pathway involved in non‐ genomic activity of ER and PR (298, 299) as well as AR (294, 300). In fact, androgen‐activated

PI3K and Akt enhance cell growth and survival in AR positive cells, which can be inhibited by

PI3K inhibitors or dominant‐negative Akt. AR is found in a large protein complex with p85α‐PI3K

and Src, both required for androgen‐stimulated PI3K/Akt activation (294, 300).

Molecular chaperones are involved in processes of folding, activation, trafficking, and

transcriptional activity of most steroid receptors, including AR. In the absence of ligand, AR is predominately cytoplasmic, maintained in an inactive, but highly responsive state by a large dynamic heterocomplex composed of heat shock proteins (Hsps), co‐chaperones, and tetratricopeptide repeat (TPR)‐containing proteins. Ligand binding leads to a conformational

change in the AR and a dissociation from the large Hsp complex. Subsequently, the AR

dimerizes, translocates to the nucleus, binds to its ARE and interacts with co‐activators, to

modulate target gene expression (301).

Dissociation of the AR‐chaperone complex after ligand binding is viewed as a general

regulatory mechanism of AR signaling (301). However, molecular chaperones remain important

players in the events downstream of receptor activation, and throughout the life cycle of the

AR. For example, the Hsp90 inhibitor, geldanamycin, destabilizes AR and increases its

proteasomal degradation, thereby decreasing expression of AR‐regulated genes (209). Recent

reports further highlight the important roles of other co‐chaperones on AR activation. Bag‐1L is

overexpressed in hormone refractory PCa (302) and enhances transactivation of the AR by

46 using its NH2 and COOH‐terminal domains to bind to COOH‐ and NH2‐terminal sequences of AR

(73) . Another co‐chaperone, FKBP52 (Hsp52), also increases AR transactivation (303, 304) and

FKBP52 knockout mice exhibit defects in male reproductive tissues including ambiguous external genitalia and defects in prostate and seminal vesicle development.

Another class of Hsps that complex with ER and glucocorticoid receptor (GR) are ATP‐ independent and include Hsp27 (305). Hsp27 is a cytoprotective chaperone expressed in response to many stress signals to regulate key effectors of the apoptotic machinery including

the apoptosome, the caspase activation complex (221, 306), and proteasome‐mediated

degradation of apoptosis‐regulatory proteins (307, 308). Antisense knockdown of Hsp27 delays

PCa xenograft growth and androgen‐independent progression (226, 229). While Hsp27

expression, in prostate, is induced by estrogens and glucocorticoids (309, 310), its relationship

with AR and androgens is undefined. Here we identify a feed‐forward loop whereby androgen

bound AR induces rapid Hsp27 phosphorylation that in turn cooperatively facilitates genomic

activity of the AR, thereby enhancing PCa cell survival.

2.2 Materials and Methods

2.2.1 Cell Culture and ASO Transfection

LNCaP cells are maintained in RPMI with 5% fetal bovine serum (311) and treated with

Hsp27 ASO designated OGX‐427 (OncoGenex Technology, Inc, Vancouver, B.C) or mismatch

(MM) control oligonucleotide (ODN) with oligofectamine, in serum free OPTI‐MEM (Invitrogen‐

Life Technologies, Inc., Burlington, Ontario, Canada) for 20 min. 4 h later, 5% FBS was added.

47 Cells were treated once daily for two successive days and harvested 48 h after the second treatment.

2.2.2 Plasmids and Reagents and Antibodies

An Hsp27 wild type (WT) was subcloned into pcDNA3.1‐GFP (Invitrogen‐Life Technology,

Inc). The Hsp27 triple mutant was generated by introducing direct mutagenesis replacing Serine

15, 78 and 82 with alanine using QuikChange® II XL, site directed mutagenesis Kit according to

manufacture instructions (Stratagene, La Jolla, CA). R1881 (Perkin‐Elmer, Boston, MA) was

dissolved in 100% ethanol. Cyclohexamide, MG‐132, SB 203580, LY 294002 were purchased

from (Clabiochem, San Diego, CA), Hsp27, pHsp27, Hsp90 (StressGen Victoria, British Columbia,

Canada), MDM2, AR N‐20, AR‐441 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), pAkt/Akt,

pp38/p38; PARP (Cell Signaling, CA).

2.2.3 Cell Proliferation and Apoptosis Assays

LNCaP cells were plated in RPMI with 5% FBS and switched to CSS the next day with or without 10 nM R1881. After a time course exposure, LNCaP cell growth was measured using the crystal violet assay, as previously described (229). Detection and quantitation of apoptotic cells were performed by flow cytometric analysis, as previously described (229). Each assay was

performed six times.

2.2.4 Western Blot Analysis and Immunoprecipitation

Total whole cell lysate (500 µg) were pre‐cleared with protein‐G sepharose (Invitrogen‐

Life Technologies, Inc.) for 1 h at 4˚C and immunoprecipitated with 2 µg of anti‐Hsp27, anti‐AR,

or IgG as a control overnight at 4˚C. The immune complexes were recovered with protein‐G

48 sepharose for 2 h and then washed with RIPA buffer, centrifuged, and subjected to SDS‐PAGE following by western blotting.

2.2.5 Immunofluorescence

LNCaP cells were grown on coverslips and treated +/‐ R1881 for 15 min. For Hsp27 knockdown, cells were treated with 50 nM Hsp27 ASO as described above. After treatment

cells were fixed MeOH+3% acetone for 10 min at ‐20 ˚C. Cells were then washed 3 times with

PBS and incubated with 0.2% Triton/PBS for 10 min, followed by washing and 30 min blocking in

3% non‐fat milk prior addition of antibodies overnight to detect Hsp27 (1:500), and AR (1:250).

Antigens were visualized using anti‐rabbit or anti‐mouse antibodies coupled to FITC or

Rhodamine, respectively (1:500; 30 min). Photomicrographs were taken at a 20X magnification

using Zeiss Axioplan II fluorescence microscope followed by analysis with imaging software

(Northern Eclipse, Empix Imaging, Inc., Mississauga, Ontario, Canada).

2.2.6 Transfection and Luciferase Assay

LNCaP cells (2.5 X 105) were cultured on 6‐well plates and transfected using lipofectin (6

µl/well) (Invitrogen‐Life Technologies, Inc.). The total amount of plasmid DNA used was

normalized to 2 µg/well by the addition of a control plasmid (Empty pcDNA 3.1). 24 h after

transfection media was replaced to CSS +/‐ R1881 for 24 h. Luciferase activities measured using

Dual‐Luciferase Reporter Assay System (Promega) with the aid of a microplate luminometer

(EG&G Berthold). All experiments were carried out in triplicate wells and repeated 5 times using different preparation of plasmids.

49 2.2.7 Northern Blot Analysis

Total RNA was isolated from LNCaP cells treated with treated with OGX‐427 or MM control, transfected with Empty vector, Hsp27‐WT or Hsp27‐TM, and treated with SB203580 prior to R1881 (10 nM) treatment for 24 h using TRIZOL/chloroform extraction (Invitrogen Life

Technology Inc.). 10 µg aliquot from each sample was subjected to horizontal electrophoresis and followed by hybridization with Hsp27 (700 pb) or PSA (2 kb) cDNA probe as described (229), human glyceraldehyde phosphate dehydrogenase (GAPDH) cDNA probe for normalization of loading levels.

2.2.8 Electromobility Shift Assay (EMSA)

LNCaP cells were treated with indicated concentrations of OGX‐427 or MM control. 48 h after the second treatment, nucleoplasmic proteins were extracted using CeLytic NuCLEAR

Extraction Kit (Sigma). Nuclear extract (10 µg) was incubated in a final volume of 20 µl containing DNA‐binding buffer, and 1.5 g of pol (deoxyiosinic‐deoxycytidic acid) (Roche) for 10

min at room temperature, then incubated for 20 min at room temperature with double‐ stranded 32P‐labeled (with specific activity around 300,000 cpm) PSA‐ARE oligonucleotide (312).

2.2.9 Chromatin Immunoprecipitation (ChIP)

LNCaP cells were treated with 10 nM of R1881 for 4 h and parafolmaldehyde‐crosslinked and sonicated. ChIP assay was performed using EZ ChIP kit according to the manufacture

(Upstate) on the PSA gene regions ARE I and ARE III as described by (313).

50 2.2.10 Reverse Transcription‐PCR

4 µg of total RNA were reverse transcribed to produce cDNA using 100 pmol of random hexamer primers (Pharmacia) and Moloney murine leukemia virus reverse transcriptase (Life

Technologies). The cDNA was successively amplified with 2 pairs of AR specific primers. 5 µl of cDNA were used as the starting DNA template in the PCR assay. To verify RNA quality, each sample was amplified with a set of primers specific to b‐actin (5’‐TGA TCC ACA TCT GCT GGA

AGG TGG‐3’ sense) and 5’‐GGA CCT GAC TGA CTA CCT CAT GAA‐3’ antisense). Analysis of PCR

products was done by electrophoresis in 2% agarose gel and visualized ethidium bromide staining.

2.2.11 Protein Stability

LNCaP cells were plated and treated with OGX‐427 or MM control, or transfected with

Hsp27 WT or Empty vector as described above. Media was changed 48 h later to RPMI + 5%

serum containing 10 µM of cyclohexamide incubated at 37°C for 2‐6 or 16 h. Western blot was

performed using AR, Hsp27 and vinculin antibodies.

2.2.12 In vivo Imaging of Luciferase Activity

Bioluminescent imaging was performed with a highly sensitive, cooled CCD camera mounted in a light‐tight specimen box (Xenogen Corporation, Alameda, CA), using protocol as

previously described (314). Before imaging, mice were injected intra‐peritoneal with 100 mg/Kg

of the substrate D‐luciferin and anesthetized with 1% of isoflurane. 15 min post injection, mice

were imaged by IVIS 200 and the Bioluminescence was monitored by Living Image software.

51 2.2.13 Animal Treatment

Male athymic nude mice (Harlan Sprague‐Dawley, Inc., Indianapolis, IN) were injected subcutaneously with 1x106 LNCaP‐Probasin‐driven luciferase cells. Once tumours were palpable

with serum PSA levels ~ 25 ng/ml and bioluminescence detectable using the IVIS‐Imaging

System, mice were treated with 20 mg/Kg of OGX‐427 or MM control intra‐peritoneal once

daily for 7 days. Tumour volume, serum PSA, and bioluminescence measurements were done at

baseline and on days 4 and 8.

Statistical Analysis: All data were analyzed by two‐tailed unpaired student’s t test or

one‐way analysis of variance (ANOVA) with post‐hoc test. Levels of statistical significance were

set at P < 0.05.

2.3 Results

2.3.1 Androgens and Hsp27 Protect LNCaP Cells from Apoptotic Stress

Androgen is an important survival factor in prostate epithelial cells. The synthetic

androgen R1881 enhances LNCaP cell survival in the presence of cytotoxic stress, including

etoposide (315), cyclohexamide (300), and PI3K inhibitors (316). We recently reported that

Hsp27 conferred resistance to androgen ablation in LNCaP (229) and next set out to explore whether androgen‐ and Hsp27‐induced pro‐survival activities were interrelated. Before

beginning to study relationships between androgen and Hsp27, we first confirmed that R1881

added to androgen depleted, charcoal‐stripped serum (CSS) increased LNCaP cell growth

(Figure 2.1. A left) and decreased apoptotic (Figure 2.1. A right) rates compared to CSS alone.

R1881 protected LNCaP cells to paclitaxel treatment, lowering apoptotic rates and increasing

52 cell growth (Appendix 1). R1881 also protected LNCaP cells from apoptosis induced by OGX‐

427, a 2nd generation ASO that potently decreases Hsp27 levels (229). OGX‐427‐induced knockdown of Hsp27 was associated with decreased apoptotic rates in R1881‐treated cells, as measured by FACS and PARP cleavage (Figure 2.1. B, C). Collectively, these results indicate that

androgens suppress apoptosis induced by Hsp27 knockdown or paclitaxel.

53 C

Figure 2.1. Androgen enhances LNCaP cell survival. A, left: R1881 enhances LNCaP cell growth. Cells were treated with 1 nM R1881 for 2, 4, and 6 days and cell growth rates determined by MTS assay and compared with control (day of treatment defined as 100%). A, right: R1881 protects LNCaP cells from apoptosis. Cells were treated with 1 nM R1881 for 4 days, and proportion of cells in sub G0, G0‐G1, S, G2‐M was determined by Propidium iodide staining. B and C: R1881 protects cells from apoptosis induced by OGX‐427. B, left: Cell growth rates were compared to control (one day after transfection) using MTS assay 2 and 5 days post transfection. B, right: Apoptotic rates were determined 5 days post transfection. C: LNCaP cells were pretreated with 10 nM R1881 or CSS for 48 h prior to treatment with OGX‐427 or MM control. PARP cleavage and Hsp27 expression levels were measured by western blot. All experiments were repeated at least 3 times.

2.3.2 Androgens Lead to Rapid Hsp27 Phosphorylation via p38 MAPK Pathway

Androgens stimulate growth and survival via both genomic and non‐genomic pathways.

Recently identified non genomic effects include activation of Src, PI3 Kinase and Akt (294, 300).

Since Akt has been reported to phosphorylate Hsp27 in intact neutrophils (317), we tested whether androgen leads to Hsp27 phosphorylation. Interestingly, androgen induced rapid phosphorylation of Hsp27 on both Ser 78 and Ser 82 residues in a dose‐ and time‐dependent manner (Figure 2.2. A). Within 15 min after incubation with 10 nM R1881, Ser 78 and Ser 82 phosphorylation levels increased 3.2 and 5.3 fold, respectively (Figure 2.2. A, right).

54 To identify upstream effectors of androgen‐induced Hsp27 phosphorylation, we

analyzed R1881‐induced changes in p38 kinase and Akt phosphorylation levels, both previously

associated with Hsp27 activation (317, 318). R1881 enhances p38 kinase and Akt phosphorylation in a time‐dependent manner, with maximum stimulation at 15 min and 5 min, respectively (Figure 2.2. B, left‐right). These results suggest that Hsp27 may be phosphorylated via p38 and/or Akt pathways. Pre‐incubation of LNCaP cells with the p38 kinase inhibitor, SB

203580, abolished R1881‐induced Hsp27 phosphorylation (Figure 2.2. C, left), while the Akt inhibitor, LY98059, did not alter androgen‐induced Hsp27 phosphorylation (Figure 2.2. C, right),

indicating that androgen‐induced Hsp27 phosphorylation occurs via the p38 kinase pathway.

55 B

Figure 2.2. Androgen phosphorylation of Hsp27 requires p38 MAPK pathway. A: R1881 leads to rapid phosphorylation of Hsp27 on both Ser 78 and 82 residues in a dose (left) and time dependent (right) manner: LNCaP cells were maintained in CSS for 16 h before R1881 treatment. Total proteins were analyzed by western blotting with anti‐phospho‐Hsp27 Ser 78 or 82 or anti‐Total Hsp27 for control loading. B: R1881 leads to phosphorylation of p38 kinase (left) and Akt (right) in a time dependent manner as shown using anti‐phospho‐Akt or anti‐phospho‐p38 antibodies. Anti‐total Akt or anti‐total p38 was used for control loading. C: The p38 inhibitor SB203580 (10 µM) (left), but not the Akt inhibitor LY98059 (right), inhibits R1881 induced Hsp27 phosphorylation. After 5 min or 15 min R1881 (for Akt or p38 respectively), total lysates were analyzed by western blotting Hsp27 anti‐phospho‐ Hsp27 Ser 78 or 82 or anti‐Total Hsp27 for control loading.

56 2.3.3 Androgen‐induced Hsp27 Phosphorylation is AR‐dependent

To determine whether AR is required for androgen‐induced phosphorylation of Hsp27, changes in Ser 78 and Ser 82 phosphorylation levels were analyzed after treatment with R1881

+/‐ the anti‐androgen bicalutimide. Bicalutimide inhibited R1881‐induced Hsp27 phosphorylation at both sites (Figure 2.3. A), suggesting that ligand binding to AR is required for

Hsp27 phosphorylation by R1881. Next, PC3 cells, which do not express endogenous AR, were

transfected with increasing amounts of AR or Empty vector with or without R1881. As shown in

Figure 2.3. B, Hsp27 phosphorylation levels at both Ser 78 and Ser 82 sites increased with

increasing AR levels after R1881 treatment. In AR negative PC3 cells, Hsp27 phosphorylation is

insensitive to androgens but is enhanced when AR is transiently over‐expressed in PC3 cells.

These results confirm that AR is required for androgen‐induced Hsp27 phosphorylation.

To further define mechanisms of androgen‐induced Hsp27 phosphorylation, we

determined whether Hsp27 and AR interact using co‐immunoprecipitation for Hsp27 and AR in

LNCaP cells. Hsp27 is detected in AR immunoprecipitated complexes and conversely, AR is

detected in Hsp27 immunoprecipitated complexes (Figure 2.3. C, left). The domain of AR

required for the interaction with Hsp27 was next analyzed using GST‐pull down assays. GST‐pull

down after initial equimolar normalization of GST‐AR domain fusion as previously described

(319), indicates that Hsp27 binds with N‐terminal and ligand binding (C‐terminal) domains, but

not the DNA‐binding domain of AR (Appendix 2). Furthermore, immunofluorescence illustrates

that Hsp27 and AR co‐localize in the cytoplasm of LNCaP cells cultured in the absence of

androgens. Importantly, and of potential functional relevance, both proteins translocate and co‐localize in the nucleus after R1881 treatment (Figure 2.3. C, right).

57 Prior to ligand binding, AR exists in a complex with Hsp90 and other co‐chaperones. The

AR‐Hsp90 interaction maintains AR in a ligand‐binding conformation necessary for efficient response to hormone (320). Upon ligand binding, AR is released from Hsp90 and is translocated

into the nucleus. Interestingly, AR immunoprecipitation blots show that shortly after androgen treatment, Hsp27 levels rise in complex with AR as Hsp90 levels decrease (Figure 2.3. D), suggesting that upon ligand binding, phospho‐activated Hsp27 replaces Hsp90 to chaperone AR into the nucleus.

58 C

Figure 2.3. Androgen‐induced Hsp27 phosphorylation requires AR. A: Bicalutimide inhibits R1881‐induced Hsp27 phosphorylation. LNCaP cells were starved for 16 h before adding 10 nM R1881 for 15 min +/‐ 1 µM bicalutamide, and total protein analyzed by Western blotting with anti‐phospho‐Hsp27 Ser 78 or 82, or anti‐Total Hsp27 for control loading. B: Androgen increases phospho‐Hsp27 levels in AR‐transfected PC‐3 cells. PC3 cells were transiently transfected with 100‐500 ng of pcDNA‐hAR followed by 10 nM R1881 for 15 min and total protein then analyzed by Western blotting with anti‐AR, anti‐phospho‐ Hsp27 Ser 78 or 82, or anti‐Total Hsp27 for control loading. C: AR interacts with Hsp27. 500 µg of total extract were immunoprecipitated with 2 µg of anti‐Hsp27, anti‐AR, or IgG as a control overnight at 4ºC. The immune complexes were recovered with protein‐G sepharose for 2 h and submitted to western blotting with anti‐AR or anti‐Hsp27 (left). AR and Hsp27 co‐localize and translocate into the nucleus after R1881: LNCaP cells were treated +/‐ R1881 for 15 min and fixed in Methanol/Acetone for immunofluorescence staining with anti‐Hsp27 and anti‐AR antibodies (right). D: Androgen increases Hsp27 levels in complex with AR as Hsp90 levels decrease. LNCaP cells were maintained in CSS for 16 h and treated for indicated times with 10 nM R1881. 500 µg of total extract were immunoprecipitated using AR and western blot were performed using Hsp90, Hsp27 and AR antibodies.

59 2.3.4 Effect of Hsp27 on Genomic Activity of AR

Many proteins participate in the activation of AR, either by direct binding or as part of a tertiary complex regulating activity of other transactivators. Since Hsp27 co‐localizes with and shuttles ligand‐activated AR during nuclear translocation, we next investigated how Hsp27

expression and phosphorylation affected AR transcriptional activity. This was done by gain‐of‐

function strategies using over‐expressing wild‐type (WT) Hsp27, as well as loss‐of‐function

strategies using an Hsp27 ASO (OGX‐427), dominant‐negative Hsp27 phosphorylation triple

mutant (TM) or an Hsp27 phosphorylation inhibitor (p38 kinase inhibitor, SB 203580). PSA

transactivation assays were performed using LNCaP cells transiently transfected with the

luciferase reporter plasmid regulated by the PSA enhancer‐promoter region (6.1 Kb) in the

presence or absence of increasing amount of exogenous WT Hsp27 plasmid (0, 0.25, 0.5 and 1

µg). R1881 treatment increased AR reporter gene expression 34‐fold, while WT Hsp27 overexpression increases androgen‐stimulated transcriptional activity of PSA a further 3‐fold

(Figure 2.4. A, left). In contrast, Hsp27 knockdown using OGX‐427 decreased transactivation of

the androgen regulated PSA reporter in a dose‐dependent manner, further supporting a role

for Hsp27 in AR transactivation (Figure 2.4. A, right).

To determine whether Hsp27 phosphorylation is required for R1881‐induced AR‐ mediated gene activation, we over‐expressed an Hsp27 triple mutant (Ser15, 78 and 82 substituted by alanine) in a dose‐dependent manner and tested its ability to affect R1881‐

stimulated PSA transactivation. As shown in Figure 2.4. B (left), Hsp27 TM transfection inhibited

luciferase transactivation from the PSA enhancer in response to R1881. Similarly, inhibition of

androgen‐induced, p38 kinase‐mediated Hsp27 phosphorylation using the p38 kinase inhibitor,

60 SB 203580, suppressed R1881‐mediated transactivation of PSA enhancer driven‐luciferase activity (Figure 2.4. B, right). Collectively, these results indicate that androgen‐induced p38 kinase‐mediated phosphorylation of Hsp27 is important for AR‐mediated PSA expression.

The preceding data identified a role for phospho‐Hsp27 in the transactivation of PSA. To provide further evidence to substantiate this hypothesis, northern blot analyses were performed (Figure 2.4. C) and indicated that levels of AR‐regulated endogenous PSA mRNA decreases significantly after Hsp27 knockdown (OGX‐427) (Figure 2.4. C, left), p38 kinase inhibition (SB 203580) (Figure 2.4. C, right) or Hsp27 phosphorylation inhibition (Hsp27 TM)

(Figure 2.4. C, middle). These results confirm that Hsp27 levels and phosphorylation status

enhance AR‐mediated PSA mRNA expression.

As a transcription factor, AR translocates to the nucleus after androgen binding where it

interacts with androgen response element (ARE) to transactivate its target genes. Suppression

of Hsp27 levels or phosphorylation negatively regulates androgen‐stimulated transcriptional

activity of PSA. To determine whether AR interaction with its response elements is affected by

Hsp27 levels, we next analyzed effects of Hsp27 knockdown on AR binding to PSA‐ARE using

Electrophoretic Mobility Shift Assay (EMSA) with nuclear lysates of LNCaP cells treated with

OGX‐427. As shown in Figure 2.4. D, 10 nM R1881 increased AR binding to ARE, and this effect

was specifically blocked by excess cold PSA oligonucleotide. Hsp27 knockdown using OGX‐427

decreased AR binding to its ARE, confirming that Hsp27 knockdown decreases AR binding to its

ARE. Collectively, the preceding data indicates that phospho‐activated Hsp27 plays a critical

role in androgen‐induced nuclear translocation and transcriptional activity of the AR.

61 We next explored whether Hsp27 forms a complex with AR on the ARE of the PSA promoter using ChIP assay in LNCaP cells ‐/+ R1881 (β‐actin fragment was amplified as control).

As shown in Figure 2.4. E, Hsp27 is present, along with AR (which serves as a positive control) on the AREs. In the presence of R1881, higher levels of AR and Hsp27 were recruited to the promoter proximal region (ARE I) and also to the enhancer region (ARE III) of the PSA promoter.

These data indicate that Hsp27 continues to interact with the AR transcriptional complex at the

level of the ARE, and appears to be regulated by androgen.

62 C

63 Figure 2.4. Effect of Hsp27 on AR trans‐activation. A: Hsp27 over‐expression increases AR transactivation. LNCaP cells were transiently co‐ transfected with 1 µg of PSA‐Luciferase and indicated concentrations of WT Hsp27, followed by R1881 or vehicle for 24 h. Total amount of plasmid DNA transfected was normalized to 2 µg/well by addition of Empty vector (left). Hsp27 knockdown decreases AR transactivation. LNCaP cells were treated with indicated dose of OGX‐427 or MM control (right). Cells were harvested and luciferase activity was determined. Data represents means of at least 3 independent experiments performed in triplicate. Fold is measured relative to PSA activation with no treatment. B: Effect of Hsp27 phosphorylation on AR transactivation. LNCaP cells were transiently co‐transfected with 1 µg of PSA‐Luciferase with indicated concentrations of Hsp27 TM (Ser 15, 78 and 82 were mutated to alanine) followed by R1881 or vehicle for 24 h. The total amount of plasmid DNA transfected was normalized to 2 µg/well by addition of Empty vector (left). LNCaP cells were transfected with 1 µg/well of PSA‐Luciferase prior to indicated concentration of SB 203580 for 1 h prior to R1881 treatment (right). Data represents means of at least 3 independent experiments performed in triplicate. Fold is measured relative to PSA activation with no treatment. C: Hsp27 knockdown decreases PSA mRNA expression (left). LNCaP cells were treated as indicated and RNA extracted for Northern blot analysis of PSA and Hsp27, using GAPDH as a loading control. Hsp27 triple mutant decreases PSA mRNA expression (middle). LNCaP cells were transfected with Hsp27 TM, 24h after transfection, cells were treated with R1881 for 16 h and RNA was extracted for Northern blot analysis. p38 kinase inhibition decreases PSA mRNA expression (right). LNCaP cells were treated for 2 h with SB203580 (10 µM) prior to R1881 and RNA were extracted for Northern blot analysis. D: Hsp27 knockdown decreases AR binding to its response elements. EMSA was performed using radiolabeled PSA oligonucleotides with nuclear cell extracts isolated from LNCaP treated with different concentrations of Hsp27 ASO. For controls, 10 µg of nuclear protein were incubated 20 min with cold PSA oligonucleotide. E: Hsp27 recruitment to the promoter of PSA gene. LNCaP cells were treated with 10 nM R1881 for 4 h. Soluble chromatin was prepared from formaldehyde‐cross‐linked and sonicated cell culture. Immunoprecipitation was performed using AR or Hsp27 antibodies, along with IgG as control. The final DNA extractions were amplified using the primers for AREI and ARE III.

2.3.5 Hsp27 Knockdown Induces AR Degradation via the Proteasome‐mediated Pathway

Hsp27 knockdown or inhibition of phosphorylation inhibits androgen stimulated nuclear translocation of the AR with subsequent suppression of AR regulated gene expression. In order to investigate the fate of AR after Hsp27 knockdown, changes in AR mRNA and protein levels after treatment with OGX‐427 were evaluated. AR mRNA levels did not change after Hsp27

64 knockdown (Figure 2.5. A, left). In contrast Hsp27 knockdown decreased AR (Figure 2.5. A, middle) and Hsp90 (Figure 2.5. A, right) protein levels in a dose dependent manner. The effect of Hsp27 knockdown on AR protein stability was next evaluated using cyclohexamide, which inhibits protein synthesis. As shown in Figure 2.5. B, left, AR protein levels decrease significantly

with rapid degradation after OGX‐427‐induced knockdown of Hsp27. In contrast, Hsp27 overexpression prolonged AR half‐life compared to Empty vector‐transfected controls (Figure

2.5. B, right). AR degradation after Hsp27 knockdown occurs via the proteasome pathway, since treatment with the proteasome inhibitor MG‐132 suppressed Hsp27 knockdown‐induced AR

degradation (Figure 2.5. C). Taken together these findings indicate that Hsp27 knockdown

induces AR degradation via a proteasome‐mediated pathway.

65 A

66 D

Figure 2.5. Effect of Hsp27 knockdown on AR expression and stability. A: AR mRNA levels are not affected by Hsp27 knockdown (left). LNCaP cells were treated in a dose dependent manner with OGX‐427 or MM control oligos, and AR, Hsp27 mRNA levels in LNCaP cells was analyzed by RT‐PCR and actin was monitored as a control. AR and Hsp90 protein levels are decreased by Hsp27 knockdown. LNCaP cells were treated with indicated concentration of OGX‐427 or MM controls and protein levels of AR (middle) Hsp90 (right) and Hsp27 determined by western blot. Vinculin was used as a loading control. B: Hsp27 levels affect AR stability. LNCaP cells were treated with 70 nM OGX‐427 or MM control (left panel) or transfected with Empty vector or Hsp27 WT and then treated with 10 µmol/L cycloheximide for indicated time period. DMSO was used as control. AR and Hsp27 protein levels were measured by Western blot analysis. C: Hsp27 knockdown accelerates proteasomal degradation of AR. LNCaP cells were treated with OGX‐427 or MM control and 10 µmol/L MG‐132 for 6 h. DMSO was used as control. AR protein level was measured by western blot analysis. D: Effect of Hsp27 knockdown on AR/Hsp90 association: LNCaP cells were treated with 70 nM OGX‐427 or MM control in the presence of FBS. Immunoprecipitation was performed using AR antibody and western blot analysis was done using Hsp90 antibodies (left). Effect of Hsp27 knockdown on AR/MDM2 association. LNCaP cells were treated with 70 nM OGX‐427 in the presence of MG‐132 (10 µmol/L) for 6 h. AR immunoprecipitation and western blot was performed with anti‐MDM2 (middle). Effect of Hsp27 knockdown on AR/ubiquitin association. LNCaP cells were treated with 70 nM OGX‐427 in the presence of MG‐132 (10 µmol/L) for 6 h. AR immunoprecipitation and western blot was performed with anti‐ubiquitin antibody (right). Input was blotted with Hsp27 antibody.

67 2.3.6 Hsp27 Knockdown Disrupts AR‐Hsp90 Association and Increases AR‐MDM2 Association and Ubiquitination

AR forms a heterodimer complex with Hsp90 to provide stability for ligand‐unbound AR

(76). Indeed, without Hsp90 binding, the unfolded protein will be recognized and degraded by the ubiquitin‐proteasome system (209, 320). Hsp27 knockdown by OGX‐427 significantly

disrupts the association between AR and Hsp90 (Figure 2.5. D, left). This indicates that Hsp27 knockdown‐induced dissociation between AR and Hsp90 may render the AR‐Hsp90 heterocomplex vulnerable to degradation by the proteasome‐mediated pathway. Since AR has been reported to be ubiquitinated by the E3 ligase, MDM2 (321, 322), we next set out to

determine whether interaction between MDM2 and AR increased after OGX‐427‐induced

Hsp27 knockdown. As predicted, Hsp27 knockdown increased the association between

endogenous MDM2 and AR as shown by co‐immunoprecipitation experiments in Figure 2.5. D,

middle. Furthermore, Hsp27 knockdown increased levels of ubiquitinated AR (Figure 2.5. D,

right). These results indicate that OGX‐427‐induced Hsp27 knockdown dissociates the Hsp90‐AR heterocomplex, and increases MDM2‐mediated AR ubiquitination and degradation.

2.3.7 In vivo Hsp27 Knockdown by OGX‐427 Decreases LNCaP Proliferation Rates, Serum PSA Levels, and AR Client Protein Expression Levels

Our results establish a novel mechanism whereby ligand‐activated AR phospho‐activates

Hsp27 to cooperatively enhance AR nuclear translocation and transcriptional activity. Hsp27

knockdown leads to AR degradation, and reduced PSA transcription and LNCaP cell growth in vitro. We sought to determine whether in vivo Hsp27 knockdown with OGX‐427 decreased AR

activity in LNCaP xenografts. Male nude mice were injected subcutaneously with 1x106 LNCaP‐

Probasin‐driven luciferase transfected cells (Appendix 3) and once tumours were palpable with

68 serum PSA levels ~25 ng/ml and bioluminescence was detectable using the IVIS Xenogen monitor, mice were treated with 20 mg/kg of OGX‐427 or mismatch control. A bioluminescent signal first became detectable when serum PSA levels reached ~5 ng/ml, and was easily detected at serum PSA levels above 20 ng/ml. Mice were subjected to three different types of

measurements: bioluminescence of probasin‐promoter driven luciferase activity (a measure of

in vivo AR activity in LNCaP xenografts), serum PSA levels, and tumour volume. Measurements

were done at baseline before treatment (day 0), during treatment (day 4), and at the end of

treatment (day 8). Beginning day 4, OGX‐427 decreased bioluminescence and reduced

circulating PSA levels by 60% (p <0.01) with a slight 15% decrease in tumour volume (Figure 2.6.

A and B), individual data are presented in (Appendix 4). In contrast, mice treated with MM

control ODN showed an anticipated increasing trend on bioluminescence and PSA levels,

coincident with increasing tumour volume during the 8 day treatment period. Western blot of

snap frozen xenograft samples (Figure 2.6. C) and immuno‐staining data (Appendix 5) indicates

that OGX‐427 decreased LNCaP xenograft levels of AR, Hsp27, and Hsp90. In addition, OGX‐427

also decreased Ki67 staining (Appendix 5). Collectively, these data suggest that the in vivo anti‐

cancer activity of OGX‐427 results, in part, from AR disruption, and that serum PSA may prove a

useful surrogate of pharmacodynamic activity as OGX‐427 moves into human trials.

69 A

70 D

Figure 2.6. OGX‐427 suppresses probasin luciferase (Pb‐Luc) bioluminescence as well as AR, Hsp90 and Hsp27 levels in vivo. A: In vivo imaging of LNCaP‐Pb‐Luc xenografts after OGX‐427 treatment by IVIS imaging system: Intact male mice were injected subcutaneously with 1x106 LNCaP‐Pb‐Luc cells and once tumours formed with serum PSA levels ~25ng/ml, were treated with 20 mg/Kg of OGX‐427 or MM for 7 days. Bioluminescence indicates probasin luciferase activity before (day 0), during (day 4), and after (day 8) treatment. B: Effect of OGX‐427 treatment on serum PSA levels. Changes in serum PSA levels from mice treated with OGX‐427 or MM control were measured using IMX immunoassays (left). Effect of OGX‐427 treatment on LNCaP tumour volume. Xenograft volume was measured by caliper at indicated time (right). Data represents average ± SEM of 5 mice/group. C: Total LNCaP xenograft proteins were extracted in RIPA buffer after MM or OGX‐427 treatment (5 mice/group) and western blots performed with AR, Hsp90, and Hsp27 antibodies; Vinculin was used as a loading control. D: Schema illustrating cooperative interactions between ligand‐activated AR and Hsp27 phosphorylation: Androgen binding to AR leads to rapid Hsp27 phosphorylation via p38 kinase pathway, which displaces Hsp90 and chaperones AR to the nucleus to enhance activation of AR‐regulated genes (left). OGX‐427 induced Hsp27 knockdown destabilizes AR/Hsp90 heterocomplex and leads to MDM2‐mediated ubiquitination and AR proteasomal degradation (right).

71 2.4 Discussion

Hsp27 is an ATP‐independent chaperone that is phospho‐activated by cell stress to form

dimers or small oligomers that prevent aggregation and/or regulate activity/degradation of

certain client proteins. The chaperone activity of Hsp27 is regulated by stress‐induced changes

in phosphorylation and oligomerization (323). As a cytoprotective chaperone situated as a ‘Hub’

at the center of many pathways regulating cellular response to therapeutic stress, targeted

inhibition of Hsp27 would inhibit many pathways implicated in cancer progression and resistance. The cytoprotective effects of Hsp27 result from its ubiquitin binding and degradation of I‐ĸB (307), direct interference of caspase activation, modulation of oxidative

stress, and regulation of the cytoskeleton (306, 324). Higher levels of Hsp27 are commonly detected in many cancers including prostate (226, 229, 325), and is associated with metastasis,

poor prognosis and resistance to chemotherapy or radiation (326, 327). We recently reported

that over‐expression of Hsp27 in LNCaP cells suppressed castration‐induced apoptosis and

confers androgen‐resistance (229), while Hsp27 knockdown using ASO potently decreases

Hsp27 levels, increases caspase‐3 cleavage and apoptosis, enhances paclitaxel chemosensitivity,

and delays tumour progression in vivo (226, 229).

Human Hsp27 is phosphorylated on three serine residues, Ser15, Ser78 and Ser82. p38

kinase and Akt were reported to be the Hsp27 kinases (317, 318) although PKC α, δ and cAMP‐

dependent kinase can also phosphorylate Hsp27 (328). Hsp27 becomes phosphorylated when

exposed to angiotensin (328), IL‐6 , IL‐1, heat shock and TNF‐α (329). Using LNCaP cells, which

express AR and are sensitive to androgens, we demonstrate that androgens increase phospho‐

Hsp27 levels within minutes in a dose, time, and p38 Kinase pathway dependent manner. This

72 rapid androgen/AR‐mediated Hsp27 phosphorylation identifies a non‐genomic mechanism for

AR in LNCaP cells. These findings are in agreement with previous studies indicating that steroids

can act via classical steroid receptors or through atypical membrane receptors and that AR

mediates non‐genomic activation in response to androgens (296, 300). Ligand binding to AR

induces its association with Src via Src SH3 domain and AR proline‐rich domain triggering Src‐

dependent pathway activation (296, 300). In AR‐negative COS‐1 and PC3 cells, transfection of

AR is necessary for R1881 induction of c‐Src/Raf/ERK and Akt, respectively. In AR positive LNCaP

cells, the anti‐androgen bicalutamide suppresses R1881‐stimulated Hsp27 phosphorylation. In

AR negative PC3 cells, Hsp27 phosphorylation is insensitive to androgens but is enhanced when

AR is transiently over‐expressed in PC3 cells. This non‐genomic stimulation is supported further

by interaction and co‐localization of Hsp27 with AR. Hsp27 binds with AR via its N‐terminal

domain and may directly or indirectly involve other AR co‐regulators including STAT3 and

ARA55, both of which have been reported to associate with Hsp27 (330, 331).

In the classical model of androgen action, in response to androgens, AR dissociates from

Hsp90 (301). Interestingly, we found that following androgen treatment Hsp27 becomes more

abundantly associated with AR as AR dissociates from Hsp90, suggesting a dynamic role for

molecular chaperones in AR shuttling. This non‐genomic action of AR ultimately influences its

classical genomic effects. Once in the nucleus, ligand‐bound nuclear receptors like AR are recruited to target gene promoters either through direct binding to hormone response elements or association with other promoter‐bound transcription factors (301). Many proteins

participate in the activation of AR, some through directly binding to AR, and others via a tertiary complex with other transactivators. Hsp27 has now been identified as a chaperone interacting

73 with the AR transcriptional complex at the level of its ARE. Recent reports indicate that the AR co‐activators STAT3 and ARA55 also interact with Hsp27 (229, 330). Hence, Hsp27 and AR may complex with either ARA55 or STAT3 to cooperatively promote AR translocation and transactivation. Interestingly, PSA transactivation in LNCaP cells is enhanced by Hsp27

overexpression and suppressed by Hsp27 knockdown or inhibition of Hsp27 phosphorylation.

Similarly, in ER+ MCF‐7 breast cancer cells, inhibition of p38 kinase signaling also blocks ER‐

mediated transcription by inhibiting nuclear translocation of ERα (332). Furthermore, Hsp27

knockdown decreases AR nuclear translocation and binding to its ARE.

Previous studies emphasize the importance of Hsps in steroid receptor stability. For

example, Hsp90 inhibitors such as geldanamycin induce steroid receptor degradation by

directly binding to the ATP‐binding pocket of Hsp90 and thereby inhibiting its function (209,

320). Results shown in Figure 2.5. and Figure 2.6. indicate that Hsp27 knockdown de‐stabilizes

AR by inducing dissociation of the AR/Hsp90 heterocomplex and increasing AR association with

the E3 ligase MDM2, with subsequent ubiquitin‐proteasome‐mediated AR degradation.

Although both OGX‐427 and geldanamycin share the ability to abrogate the interaction

between AR and Hsp90, they do so by different mechanisms. Interestingly, OGX‐427 induces

degradation of Hsp27, AR, and Hsp90, while geldanamycin binding to the ATP‐binding pocket of

Hsp90 inhibits its chaperone activity (333), induces degradation of client proteins (334), and is accompanied by stress‐activated increases in Hsp70 and Hsp27 (335).

The effects of OGX‐427 on AR expression and activity in vitro were recapitulated in vivo.

OGX‐427 induced rapid decreases in probasin‐luciferase reporter driven bioluminescence that

74 correlated with early decreases in serum PSA, and decreased LNCaP xenograft levels of AR and its chaperones, Hsp90 and Hsp27. In PCa where the AR is critically important, ligand‐activated AR leads to rapid p38 kinase‐mediated phosphorylation of Hsp27, which in turn, complexes with and chaperones the AR to enhance its stability, shuttling, and transcriptional activity. OGX‐427‐

induced knockdown of Hsp27 destabilizes the AR and enhances its ubiquitination and degradation.

Collectively, these data identify a novel mechanism for Hsp27 as an AR chaperone (as

summarized in model illustrated in Figure 2.6. D) and justifies further investigation targeting

Hsp27 as therapeutic for PCa.

75 CHAPTER 3: Lyn Tyrosine Kinase Regulates Androgen Receptor Expression and Activity in Castrate Resistant Prostate Cancer2

3.1 Introduction

PCa is the second leading cause of cancer‐related death in North American men (95).

Despite improvement in the disease diagnosis, management options for patients with advanced forms of the disease are limited to androgen‐ablation therapy. This treatment induces apoptosis in androgen‐sensitive tumour cells; however most of the patients suffer from disease

progression to CRPC within 2 years of treatment initiation (336‐341). AR stays active and plays a

crucial role during progression of PCa to CRPC (176, 177). A growing body of evidence supports

the relevant role of tyrosine kinases in AR reactivation during CRPC progression (169, 342).

Src family of non‐receptor tyrosine kinases (SFKs) including Src, Frk, Fyn, Yes, Hck, Lck,

Blk, Fgr, Yrk, Brk and Srm modulate a wide range of cellular processes including cell migration,

differentiation and proliferation (343, 344). Different members of the Src family share similar

domain structure but recent studies revealed that each family member may possess unique

roles (344, 345). Src family members can confer signaling through their ability to phosphorylate

2 A version of this chapter will be submitted for publication. Zardan A, Beraldi E, Fazli L, Nip K, Lamoureux F, Gust K, Cox ME, Gleave ME and Zoubeidi A. Lyn tyrosine kinase regulates androgen receptor expression and activity in castrate resistant prostate cancer.

76 particular substrate or by their spatial compartmentalization in membrane micro‐domains and subcellular distribution (113, 258, 259, 346, 347). Lyn tyrosine kinase is an SFK that like other members of the SFK is thought to participate in signal transduction via cell surface receptors that lack intrinsic tyrosine kinase activity in response to a large number of extracellular stimuli,

such as growth factors and cytokines (251, 261).

Lyn kinase like other members of the family is ordinarily maintained in a closed inactive

conformation through two major intramolecular inhibitory interactions, namely binding of the

phosphorylated C‐terminal tyrosine residue, Tyr508, to the Src homology 2 (SH2) domain and interaction of the polyproline type II helical motif in the SH2‐kinase linker with the SH3 domain

(257, 258). Lyn activation involves disruption of these inhibitory interactions through the

combined effects of Tyr508 dephosphorylation, displacement of the tail from the SH3 domain, displacement of the PPII motif from the SH3 domain and autophosphorylation of the specific

Lyn Tyr396 in the activation loop.

Knockout studies clearly indicate that each SFK member plays unique physiological function (270). In vitro analysis of PCa cells demonstrated that targeting Lyn expression, using

ASO and siRNA, or Lyn activity , using inhibitory peptide, affects proliferation and tumour volume in the DU145 xenograft model, whereas Src knockdown affects migration and invasion

(267, 348). Furthermore, Lyn‐deficient mice display a compromised prostate gland development (251, 275) while Src‐deficient mice fail to remodel bone indicating impaired osteoclast function and exhibit osteoporosis (275, 348). Unlike Src, Lyn was found to be up‐ regulated in leukemia patients resistant to the Bcr‐Abl inhibitor, Imatinib/Gleevec (349). Lyn is

77 expressed in normal prostate epithelium and majority of the primary human PCa specimens and

is up‐regulated in CRPC (266). Current literature suggests a distinctive role for Src and Lyn

kinase, even when expressed in the same cell types in normal and cancer circumstances (52,

267).

Here we report that both expression and activation state of Lyn kinase positively correlates with PCa progression to CRPC. We also show that Lyn kinase regulates expression

and activity of AR. Furthermore, inhibition of Lyn expression and activity using siRNA techniques disrupts the binding of AR to heat shock protein 90 (Hsp90) and increases the

ubiquitination and degradation of AR.

3.2 Materials and Methods

3.2.1 Cell Culture and siRNA Transfection

LNCaP cells were maintained in RPMI with 5% fetal bovine serum (311) and treated with

Lyn siRNA or scrambled siRNA control with oligofectamine in serum free OPTI‐MEM (Invitrogen‐

Life Technologies, Inc., Burlington, Ontario, Canada) for 20 min. 4 h later, 5% FBS was added.

Cells were treated once daily for two successive days and harvested 48 h after the second treatment.

3.2.2 Plasmid, Reagents and Antibodies

Lyn wild‐type, Empty vector, dominant negative and constitutively active plasmids were generously provided by Dr. Charles W. Emala (Columbia University, New York, New York) (350).

AR (N‐20), Lyn (H‐6), PSA (C‐19) antibodies were purchased from Santa Cruz Biotechnology, Inc.,

78 and Src, PARP antibodies were purchased from Cell Signaling, California., Actin antibody (Clone

C4) was purchased from Millipore, California., Anti‐Lyn (phosphor‐Y396) antibody was purchased from Abcam. Lyn siRNA (human, sc‐29393) was purchased from Santa Cruz

Biotechnology, Inc. Transfection reagent OligofectAMINE, lipofectin and serum‐free OPTI‐MEM media were purchased from Invitrogen Life Technologies Inc.

3.2.3 Cell Proliferation and Apoptosis Assays

LNCaP cells were transfected with Lyn siRNA or scrambled siRNA control twice. 72 h post second transfection, cell growth was measured using the crystal violet assay. Detection and quantitation of apoptotic cells were done by flow‐cytometry (described below) and

western blotting analysis. Each assay was done three times. Caspase‐3 activity was assessed using the kit CaspACE Assay System, Fluorometric (Promega, Madison, WI, USA). 50 µg of total

cell lysate were incubated with caspase‐3 substrate AC‐DEVD‐AMC at room temperature for 4

h. The caspase‐3 activity was quantified in a fluorometer with excitation at 360 nm and

emission 460 nm.

3.2.4 Cell Cycle Analysis

LNCaP cells were transfected twice with Lyn siRNA or scrambled siRNA control. 5 days post transfection, cells were trypsinized, washed twice and incubated in PBS containing 0.12%

Triton X‐100, 0.12 mM EDTA and 100 μg/ml ribonuclease A. Cellular total DNA content was

measured by staining fixed cells with 50 μg/ml propidium iodide for 20 min at 4°C and cell cycle distribution was analyzed by flow cytometry (Beckman Coulter Epics Elite, Beckman, Inc.,

79 Miami, FL), based on the percentage of cells at the sun G0, G1, S and G2 phases. Each assay was done in triplicate.

3.2.5 Transfection and Luciferase Assay

LNCaP cells (2.5 X 105) were plated on 6‐well plates and transfected using lipofectin (6

µl/well) (Invitrogen‐Life Technologies, Inc.). The total amount of plasmid DNA used was

normalized to 2 µg/well by the addition of a control plasmid. Media was replaced by CSS +/‐

R1881, 24 h after transfection for another 24 h. Luciferase activities measured using the

microplate luminometer (EG&G Berthold). All experiments were carried out in triplicate.

3.2.6 Chromatin Immunoprecipitation (ChIP)

LNCaP cells were treated with 10 nM of R1881 for 4 h and subsequently, were cross‐ linked with paraformaldehyde and sonicated. ChIP assay was performed using EZ ChIP kit according to the manufacture (Upstate) on the PSA gene regions ARE I.

3.2.7 Quantitative Reverse Transcription‐PCR

Total RNA was extracted from cultured cells after 48 h of treatment using TRIzol reagent

(Invitrogen Life Technologies, Inc.). 2 μg of total RNA was reversed transcribed using the

Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science).

Real time monitoring of PCR amplification of complementary DNA (cDNA) was

performed using DNA primers Lyn forward primer: CAGGGAGGAGCCCATTTACA

and Lyn Reverse primer: CAGCACTTTGCCACCTTCATC, on ABI PRISM 7900 HT Sequence

Detection System (applied Biosystems) with SYBR PCR Master Mix (Applied Biosystems). Target

80 gene expression was normalized to β‐actin levels in respective samples as an internal standard.

The comparative cycle threshold (Ct) method was used to calculated relative quantification of target mRNAs. Each assay was performed in triplicate.

3.2.8 Protein Stability

LNCaP cells were plated and treated with Lyn siRNA or scrambled siRNA control, or

transfected with Lyn WT or Empty vector as described above. Media was changed 48 h later to

RPMI + 5% serum containing 10 µM of cyclohexamide incubated at 37°C for 2‐6 or 16 h.

Western blot was performed using AR, Lyn and Vinculin antibodies.

3.2.9 Animal Treatment

LNCaP cells stably overexpressing Lyn kinase (LNCaPLyn) or Empty vector (LNCaPEmpty)

were generated using clonal selection. Male athymic nude mice (Harlan Sprague‐Dawley, Inc.)

were injected subcutaneously with 2 × 106 LNCaPEmpty or LNCaPLyn cells (suspended in 0.1 mL

Matrigel; BD Biosciences). The mice were castrated once tumours reach between 300 and 500

mm3 or the PSA level increased above 50 ng/mL. Rate of tumour growth and PSA relapse was

determined after castration. Each experimental group consisted of 6 mice. Tumour volume was

measured once weekly (V= 4/3 πR3). Serum PSA level was determined weekly by enzymatic

immunoassay (Abbott IMX). PSA doubling time (PSA dt) and velocity were calculated by the log‐

mt slope method (PSAt = PSAinitial × e ) (160). Data points were expressed as average tumour

volume ± SEM or average PSA concentration ± SEM.

When tumour volume reached 10% or more of body weight, mice were sacrificed and tumours were harvested for evaluation of protein expression by Western blot analyses and

81 immunohistochemistry. All animal procedures were carried out according to the guidelines of the Canadian Council on Animal Care and appropriate institutional certification (Animal protocol: A10‐0165).

3.2.10 Immunohistochemistry Analysis

PCa tissue specimens were obtained from Vancouver Prostate Centre Tissue Bank. The

H&E slides were reviewed to mark the desired areas and the corresponding paraffin blocks.

Three TMAs were manually constructed (Beecher Instruments, MD, USA) by punching duplicate cores of 1mm for each sample. All the specimen were from radical prostatectomy except 12

CRPC samples which were obtained from transurethral resection of the prostate (TURP).

Immunohistochemical staining was conducted by Ventana autostainer model Discover XT™

(Ventana Medical System, Tuscan, Arizona) with enzyme labeled biotin streptavidin system and solvent resistant DAB Map kit by using 1:10 concentration of Lyn (H‐6), p‐Lyn and Src

antibodies.

Statistical Analysis: All data were analyzed by two‐tailed unpaired student’s t test or

one‐way analysis of variance (ANOVA) with post‐hoc test. Overall survival was analyzed using

Kaplan–Meier curves, and statistical significance between the groups was assessed with the log‐ rank test (GraphPad Prism). Levels of statistical significance were set at P < 0.05.

82 3.3 Results

3.3.1 Lyn Expression Is Increased with Progression to CRPC

To elucidate the role of Lyn in PCa progression to CRPC, we first analyzed the expression of Lyn in three cell lines routinely used in the field (LNCaP, C4‐2 and PC‐3). This panel of cell lines includes cells with androgen‐dependent and androgen‐independent growth features, as

well as positivity and negativity in terms of AR protein expression. Levels of endogenous Lyn were detected by western blot analysis. Whole protein cell lysates were prepared from

androgen‐dependent LNCaP cells, the LNCaP lineage‐derived castrate‐resistant subline, C4‐2

cells, and an independently derived AR‐deficient castrate‐resistant cell line, PC‐3 cells. C4‐2

cells express functional AR and can be grown in an androgen‐independent manner which makes

them an excellent model representing transition of the initial androgen‐dependent disease to the CRPC state. As shown in Figure 3.1. A, left, Lyn expression was very low in PC‐3 cells which

lack AR compared to LNCaP and C4‐2 cells which express AR. Furthermore, up‐regulation of Lyn

kinase expression was more significant in castrate resistant C4‐2 cells in comparison with

castrate sensitive LNCaP cells (Figure 3.1. A, left). These findings suggest that Lyn expression correlates with AR protein expression and progression to CRPC. We next evaluated changes in

Lyn expression levels in the LNCaP xenograft model, which mimics progression to CRPC, after castration. Consistent with results from the LNCaP and C4‐2 cell lines, western blots of

treatment‐naïve and castrate‐resistant LNCaP tumours showed that Lyn levels clearly increased

after castration (Figure 3.1. A, right). To further confirm that the up‐regulation of Lyn is a

consequence of androgen ablation, LNCaP cells were cultured in charcoal striped serum (CSS) to

83 mimic androgen ablation in vitro and Lyn expression was analyzed at the protein level. Figure

3.1. A, (middle), shows that androgen ablation up‐regulates Lyn in a time dependent manner.

3.3.2 Lyn and p‐Lyn Y396 Expression Is Elevated in CRPC Specimens

To support and further clarify the findings from the model systems,

immunohistochemistry analysis was performed using a human prostate tissue microarray

(TMA). This TMA was constructed from 152 naïve PCa specimens and 20 CRPC specimens

(obtained via transurethral resection of the prostate). Using this TMA, we first measured the expression level of total Lyn kinase and found that Lyn expression level was on average 2‐fold

higher in CRPC specimens as compared with naïve tumour specimens (*, P < 0.05; Figure 3.1. B).

Expression level of Src kinase was likewise measured using the same TMA. Interestingly, in comparison with Lyn expression level, which was 2 fold higher in CRPC specimens, Src kinase expression was only increased 0.5‐fold (ns, not significant, Figure 3.1. D). Next we stained a

TMA constructed from 146 naïve PCa and 14 CRPC, specimens to look for the activated form of

Lyn kinase, p‐Lyn Y396. A significantly positive correlation was also observed with the expression

level of p‐Lyn Y396 and tumour progression to CRPC (**, P < 0.01; Figure 3.1. C). The

immunohistochemistry data further suggest the important and specific role of Lyn in CRPC

development.

84 B

85 Figure 3.1. Lyn expression in PCa progression. A, left: Lyn expression in PCa cell lines: Total proteins from LNCaP, C4‐2 and PC‐3 cells were extracted using RIPA buffer. Western blot were performed using Lyn, and PSA antibodies; Actin was used as loading control. A, right: Lyn expression in CRPC progression in LNCaP xenograft model, Proteins were extracted from LNCaP xenografts before castration (intact) or after progression to castration resistant. Western blots were performed using Lyn antibody and Actin was used as a loading control. A, middle: Lyn expression after R1881 and CSS Treatment: LNCaP cells were cultured in R1881 or CSS media and Lyn expression was analyzed at the protein level. B, C and D: Immunohistochemistry analysis for total Lyn, p‐Lyn Y396 and total Src expression level in PCa tumours (*, P < 0.05; **, P < 0.01; ns, not significant; respectively). Specimens from untreated tumours (PCa naïve) and CRPC patients were submitted to immunohistochemical staining conducted by Ventana autostainer model Discover XT™ (Ventana Medical System, Tuscan, Arizona) with enzyme labeled biotin streptavidin system and solvent resistant DAB Map kit by using: 1/10 concentration of Lyn (H‐6): sc‐7274, Anti‐Lyn (p‐Lyn Y396): ab40660, Anti‐Src: SC‐130124. Specimens were graded from 0 to +3 intensity representing the range from no staining to heavy staining by visual scoring and automated quantitative image analysis by pro‐plusimage software.

3.3.3 In vivo Lyn Over‐Expression Accelerates Castrate‐Resistant LNCaP Tumour Growth and Serum PSA Relapse to Pre‐Castration Levels

To further study the role of Lyn kinase in progression of PCa to castrate resistant stage,

LNCaP xenograft model was used. LNCaP cells stably overexpressing Lyn kinase (LNCaPLyn) or

Empty vector (LNCaPEmpty) were generated using clonal selection. Two clones that exhibited increased expression of Lyn kinase compared to control cells were selected for further studies

(Figure 3.2. A, left). Serum PSA level and tumour volumes were followed weekly and mice were castrated when serum PSA values reached 50 ng/ml. We did not observe a significant difference in the rate of tumour take or disease initiation between the mice injected with LNCaPLyn and

LNCaPEmpty (data not shown). Interestingly, a higher rate of tumour growth and PSA relapse was observed after castration in mice bearing the LNCaPLyn xenograft tumour compare to the

LNCaPEmpty xenograft tumour (*, P < 0.05; ***, P < 0.001; respectively, Figure 3.2. B and C, n=6).

The PSA velocity (rate of change of PSA overtime) was analyzed and the results confirmed a

86 significant higher rate in LNCaPLyn‐ compared to the LNCaPEmpty‐tumour bearing mice (**, P <

0.01; Figure 3.2. D) (160). Consequently, significant prolongation of the progression‐free survival was observed in LNCaPEmpty compared with the LNCaPLyn group (**, P < 0.01, Figure 3.2.

E). Total protein was extracted from the xenograft tumours and levels of AR, PSA, FKBP52, Akt,

pAkt were analyzed (Figure 3.2. F). Results of protein analysis revealed a higher AR protein expression as well as its target genes, PSA and FKBP52 in the extracts obtained from LNCaPLyn

tumours compared with the LNCaPEmpty. Furthermore, a higher protein expression and activity

of Akt, a key mediator of cell survival, was observed in the LNCaPLyn tumour extracts in comparison with the LNCaPEmpty. Since the expression of indicated AR target genes was shown

to be higher in the LNCaPLyn‐bearing tumours, we sought to investigate the effect of Lyn overexpression on the AR transcriptional activity. Interestingly, our results indicated that Lyn

Wild Type (WT) overexpression enhances R1881 inducing AR transcriptional activity (as

measured by PSA luciferase activity) (**, P < 0.01; Figure 3.2. G).

87 B

88 E

89 Figure 3.2. Lyn over‐expression accelerates castrate‐resistant LNCaP tumour growth and serum PSA relapse to pre‐castration levels. A Left: Generating the stable cell lines over‐expression Lyn kinase or Empty vector. LNCaP cells stably overexpressing Lyn kinase (LNCaPLyn) or Empty vector (LNCaPEmpty) were generated using clonal selection. Control cells and Clone #4 were used for the in vivo injection. A right and B: Comparison of tumour size between LNCaPLyn and LNCaPEmpty xenografts tumours post castration (*, P < 0.05; data represents average ± SEM of 6 mice/group). Lyn overexpression accelerated the tumour growth post castration. C: Lyn overexpression accelerated tumour PSA relapse to pre‐castration level (***, P < 0.001; data represents average ± SEM of 6 mice/group). D: PSA velocity change in mice bearing LNCaPLyn tumour compare to the LNCaPEmpty tumour (**, P < 0.01; data represents average ± SEM of 6 mice/group). Analysis shows the rate of change of PSA level in mice, from the time of castration to the time of sacrifice of the mice. E: Comparison of progression‐free survival between LNCaPLyn and LNCaPEmpty xenografts tumours post castration (**, P < 0.01; data represents average ± SEM of 6 mice/group). Progression‐free survival was defined as time for the first tumour volume doubling. Significant prolongation of the progression‐free survival was observed in the LNCaPEmpty xenograft bearing mice compared with LNCaPLyn bearing mice. F: Western blot analysis of total protein extracted from the xenograft tumours. Total protein was extracted from the xenograft tumours and levels of AR, PSA, FKBP52, Akt, pAkt were analyzed. G: Effect of Lyn overexpression on AR transcriptional activity. 1 µg/well of PSA‐ Luciferase with 6 µg of Lyn WT or Lyn Empty plasmids were transiently transfected to the LNCaP cells followed by R1881 or vehicle for 24h. **, P < 0.01; Data represents means of at least 3 independent experiments performed in triplicate. Fold is measured relative to PSA activation with no treatment.

3.3.4 Lyn Knockdown Leads to AR Degradation through the Proteasome‐Mediated Pathway

Lyn expression and activity demonstrated a direct correlation with CRPC progression and PSA relapse post‐castration, both in vivo and in vitro, as well as in human tissue samples.

Furthermore, Lyn overexpression increased AR transcriptional activity. Thus, we sought to further investigate the potential association between AR and Lyn. First, we investigated the effect of Lyn kinase knockdown on AR protein expression and compared it with Src knockdown.

90 Western blot analysis showed that protein expression of AR and PSA, an AR‐regulated gene, were decreased by Lyn but not Src knockdown (Figure 3.3. A, left, middle).

To investigate the molecular mechanisms for AR protein degradation, we first examined the effect of Lyn knockdown on AR mRNA expression and found that Lyn knockdown did not

influence AR mRNA level (Figure 3.3. A, right). Next, we studied the effect of Lyn knockdown on

AR protein stability. To do this, LNCaP cells were treated with Lyn siRNA or scrambled control

followed by cyclohexamide treatment for 3 h, 6 h and 16 h. AR protein decay was monitored under RPMI containing 15% FBS condition. We observed a reduction in AR protein stability after the Lyn knockdown treatment (Figure 3.3. B, left). Moreover, in order to examine the effect of

Lyn overexpression on AR protein stability, we performed the same experiment using LNCaPLyn

and LNCaPEmpty cells and observed that overexpression of Lyn kinase resulted in an increase in

the stability of AR (Figure 3.3. B, right). To test whether Lyn knockdown enhances AR

degradation through the proteasome pathway, LNCaP cells were treated, 48 h post Lyn siRNA

(10nM) treatment, with the proteasome inhibitor MG‐132 for 6 h. MG‐132 treatment resulted

in suppression of Lyn knockdown‐induced AR degradation and indicated that Lyn knockdown

leads to AR degradation via the proteasome pathway (Figure 3.3. C).

Next, we sought to investigate the mechanism through which Lyn knockdown directs AR

for degradation via the proteasome pathway. To study this, AR protein was

immunoprecipitated from whole‐cell extracts of Lyn siRNA‐ and scrambled siRNA‐treated LNCaP cells followed by western blot analysis to detect the AR/Hsp90 association as well as the amount of ubiquitinated AR protein. Results obtained from the immunoprecipitation

91 experiment revealed that Lyn knockdown disrupts the association between AR and Hsp90

(Figure 3.3. D). Moreover, AR was shown to be more ubiquitinated in Lyn siRNA‐treated cells compared with control siRNA‐treated cells (Figure 3.3. D). Therefore, these data suggest that

Lyn knockdown results in dissociation of AR from Hsp90 which in turn leads to ubiquitination of

unstably‐folded AR and its degradation by the proteasome‐mediated pathway.

92 C

Figure 3.3. Effect of Lyn knockdown on AR expression and stability. A: AR mRNA levels are not affected by Lyn knockdown (right). LNCaP cells were treated with Lyn siRNA or scrambled siRNA control and AR and Lyn mRNA levels in LNCaP cells were analyzed by RT‐PCR. β‐actin was monitored as internal control. AR protein level is decreased by Lyn knockdown but not Src knockdown (left and middle). Vinculin was used as a loading control. B: Lyn kinase levels affect AR stability. LNCaP cells were treated with 10 nM Lyn siRNA or scrambled siRNA control (left panel) or transfected with Empty vector or Lyn WT (right panel) and then treated with 10 µmol/L cycloheximide for indicated time period. AR and Hsp27 protein levels were measured by Western blot analysis. C: Lyn knockdown accelerates proteasomal degradation of AR. LNCaP cells were treated with Lyn siRNA or scrambled siRNA control and 10 µmol/L MG‐132 for 6 h. AR protein level was measured by western blot analysis. D: Effect of Hsp27 knockdown on AR/Hsp90 and AR/ubiquitin association: LNCaP cells were treated with 10 nM Lyn siRNA or scrambled siRNA control in the presence of FBS. Immunoprecipitation was performed using AR antibody and western blot analysis was done using Hsp90 and ubiquitin antibodies. Input was blotted with AR, Lyn and Hsp90 antibodies. Vinculin was used as a loading control.

93 3.3.5 Lyn Regulates AR Transcriptional Activity

To further clarify the effect of Lyn knockdown on AR activity, modulation of AR transcriptional activity and expression of AR downstream target genes were investigated after

Lyn knockdown. Our results demonstrated that Lyn knockdown using siRNA, abrogates ligand dependent activation of AR (as measured by PSA luciferase activity) (****, P < 0.0001; Figure

3.4. A). To confirm AR transactivation assay results, we evaluated the expression of well‐ characterized, ARE‐containing, AR‐dependent genes using qRT‐PCR. We found that Lyn knockdown decreased the expression of the androgen‐dependent endogenous genes like

FKBP52 and NKX3.1 (Figure 3.4. B). These results demonstrates that Lyn is an important

regulator of ligand‐dependent AR transcriptional activity. Next, we explored whether Lyn

knockdown affects the binding of AR to the ARE of the PSA promoter using ChIP assay in LNCaP

cells ‐/+ R1881. Results obtained from this study indicated that binding of AR to the promoter

proximal region (ARE I) is abrogated in the absence of Lyn kinase (Figure 3.4. C). Since Src

tyrosine kinase has been reported to modulate AR transcriptional activity (169) we sought to

compare the effect of Src knockdown with Lyn knockdown. The result showed that Lyn

abrogates AR transcriptional activity 21 times more than Src knockdown (****, P < 0.0001;

Figure 3.4. D).

94 A

95 C

Figure 3.4. Effect of Lyn of AR transactivation. A: Lyn siRNA inhibits androgen inducing AR transactivation. LNCaP were transfected with 10 nM siRNA Lyn or control. After 24 h, cells were transfected with PSA‐Luciferase promoter and 24 h later were stimulated with 10nM of R1881 for 4 h followed by Luciferase activity measurement. ****, P < 0.0001; Columns, means of at least three independent experiments done in triplicate. B: Lyn knockdown decreases AR‐dependent genes. RNA was extracted from LNCaP cells treated with siRNA Lyn or siRNA Ctr. Lyn, FKBP52 and NKX3.1 mRNA levels were analyzed by qRT‐PCR and normalized to β‐actin. C: AR recruitment to the promoter of PSA gene after Lyn knockdown. LNCaP cells were treated with 10 nM siRNA Lyn or control followed by 24 h treatment with R1881 (1 nM). Soluble chromatin was prepared from formaldehyde‐cross‐linked and sonicated cell culture. Immunoprecipitation was performed using AR antibody, along with IgG as control. The final DNA extractions were amplified using the primers for ARE I. D: Effect of Lyn and Src knockdown on AR transcription activity. LNCaP cells were transfected with 10 nM siRNA Lyn, Src and control. After 24 h, cells were transfected with PSA‐luciferase promoter and 24 h later were stimulated with 10 nM R1881 for 4 h. Luciferase activities were subsequently measured. ****, P < 0.0001; Columns, means of at least three independent experiments done in triplicate.

96 3.3.6 Lyn Knockdown Induces Cell Cycle Arrest and Apoptosis in LNCaP Cells

Since AR mediates cell proliferation and survival in LNCaP cells, we hypothesized that long‐term treatment with Lyn siRNA leads to inhibition of LNCaP cell growth and survival through inhibition of AR function. Inhibition of AR protein expression is observed 48 h post Lyn

siRNA transfection without affecting the LNCaP cell viability. However, 72 h post transfection we started to observe a decrease in LNCaP cell proliferation potential (60%) measured by crystal violet assay (****, P < 0.0001; Figure 3.5. A). This was accompanied by decreased levels of cell‐cycle proteins, Cyclin B1, Cyclin D1 and CDC25A (Figure 3.5. B). Next, we studied the

long‐term (5 days) effect of Lyn knockdown on cell cycle progression using Fluorescence‐

Activated Cell Sorting (FACS) analysis. Results demonstrated that Lyn siRNA treatment led to an

increase in the fraction of cells undergoing apoptosis (sub‐G1 fraction) compared with the

scrambled treated cells (****, P < 0.0001; Figure 3.5. C). Consequently, a reduction in the

percentage of cells in the G1, S and G2/M fractions were detected (***, P < 0.001; ns, not

significant; ****, P < 0.0001; respectively; Figure 3.5. C). Furthermore, our western blot analysis

showed that Lyn knockdown induces PARP cleavage (Figure 3.5. D, right) and increases caspase‐

3 activation 5 days post transfection (****, P < 0.0001; Figure 3.5. D, left). These results revealed that Lyn kinase contributes to LNCaP cells proliferative potential through the regulation of AR protein expression and activity.

97 A B

C D

Figure 3.5. Effect of Lyn knockdown on LNCaP cell survival. A: Effect of Lyn knockdown on LNCaP cell proliferation. LNCaP cells were plated on 12 wells and treated with 10nM of Lyn siRNA or control siRNA. Cell proliferation was measured 72 h post transfection using a crystal violet assay (****, P < 0.0001; experiment was repeated at least 3 times). B: Effect of Lyn knockdown on the expression of cell cycle proteins. LNCaP cells were treated with 10nM Lyn siRNA and scrambled siRNA control. Total protein was extracted from the cells 72 h post Lyn siRNA transfection and subjected to western blot analysis for cell cycle proteins such as Cyclin B1, Cyclin D1 and CDC2. C: Lyn knockdown induces cell cycle arrest in LNCaP cells. LNCaP cells were treated with 10 nM Lyn siRNA or scrambled siRNA control. Proportion of cells in sub G0, G1, S and G2 was determined by propidium iodide (PI) staining (****, P < 0.0001; ***, P < 0.001; ns, not significant; ****, P < 0.0001; respectively). D: Lyn knockdown 5 days post Lyn siRNA transfection induces Caspase‐3 activity and PARP‐Cleavage. Total proteins (50 μg) from each condition were lysed and monitored for their ability to cleave the fluorogenic substrate Ac‐DEVD‐AMC. Fluorescence generated by the cleavage was quantified by using a spectrofluorometer. (****, P < 0.0001; experiment was repeated at least 3 times).

98 3.4 Discussion

In androgen‐dependent tumours prostate cells proliferate as a result of androgen stimulation (171). By contrast, during the development of CRPC, prostate cells increase their sensitivity to the low levels of androgens and up‐regulate various oncogenic molecular pathways where the AR is activated by growth factors and AR antagonists. The crosstalk

between oncogenic signaling pathways makes it difficult for development of an effective

therapy against this form of the disease. Targeting tyrosine kinases which play key roles in the

interaction between various signaling pathways together with combination treatments has

been shown to yield promising results (351).

The significant role of SFKs in the development of PCa and progression to its CRPC stage

has been shown by different groups (352‐354) but it is not clear which, if any SFK member plays

the dominant role. A recent study suggests that Lyn kinase does not play a role in PCa disease

initiation in comparison with Src and Fyn (355). Our results indicate that in fact Lyn tyrosine kinase expression decreases in the presence of androgens and increases in the absence of

androgens both in vivo and in vitro. In human tissues expression of Lyn kinase increases more

than 2 fold in CRPC tissue samples compared to PCa naïve tumours. Src kinase shows a high

expression level in naïve tumours and its expression does not increase significantly with disease progression. This result further indicates that different Src family kinase members correlate to

different stages of PCa progression.

Transcriptional activity of AR is essential in sexual development and maintenance of

normal male reproductive organs. It also plays a significant role in progression of PCa to

99 advanced stages (356, 357). Our results suggest that Lyn kinase regulates AR activity in the androgen‐deprived condition in vitro and, after castration, in vivo. As shown in Figure 3.2. AR signaling stays active in LNCaPLyn xenograft tumours after castration and plays a key role in

transcription of androgen‐regulated genes, involved in prostate cancer cell growth and survival,

such as PSA. Furthermore, knockdown of endogenous Lyn inhibited transcriptional activity of

androgen‐stimulated AR and expression of androgen target genes (Figure 3.5. D).

In the classic model of androgen action, AR dissociates from Hsp90 in response to androgens and translocates to the nucleus (358). In the absence of ligand, dissociation of AR from Hsp90 leads to AR ubiquitination and degradation (359). We found that Lyn knockdown results in dissociation of AR from Hsp90. As a result of this dissociation the unstably‐folded AR

protein was shown to be recognized and degraded by the ubiquitin‐proteasome system. To our

knowledge Lyn kinase knockdown is the only known tyrosine kinase that affects the stability of

AR protein. Src and Ack‐1 (169, 170) kinases have been reported to regulate AR transcriptional

activity but this occurs without affecting the AR protein stability. This data points to a role for

Lyn kinase in stabilizing AR in the androgen deprived conditions rather than in disease initiation.

Growth factor signaling has been shown to play an important role in CRPC progression

and regulation of AR in the low androgen condition (246, 360‐364). Indeed, IL‐6 and EGF both

have been shown to activate tyrosine kinases in PCa (365, 366) and induce AR phosphorylation

on tyrosine (pTyr) via Src and Ack‐1 (169, 366, 367). Since phosphorylation has been reported to

be one of the major mechanisms in regulation of AR stability (169, 170, 368, 369) it is important to investigate the potential role of Lyn kinase in tyrosine phosphorylation of AR. Future studies

100 will be necessary to explore the other possible mechanisms through which Lyn kinase could regulate AR stability and activity in the low androgen environment. This will help us to improve our understanding of the role of Lyn kinase as well as the therapeutic effect of Lyn inhibition in the progression of PCa to the CRPC stage.

101 CHAPTER 4: Lyn Tyrosine Kinase Promotes Castration Resistant Prostate Cancer Progression through EGF‐Mediated Phosphorylation of Androgen Receptor 3

4.1 Introduction

AR plays a key role in proliferation of both normal and cancerous prostate cells (12).

Interaction with growth factor signaling pathways is one of the main mechanisms through

which AR maintains the homeostasis of normal prostate gland (12, 370‐372). Alterations in

expression level of peptide growth factors and their receptors are very commonly found in PCa

tumours (370‐373). Fibroblast growth factors (FGFs), insulin‐like growth factors (IGFs),

epidermal growth factor (EGF) and transforming growth factor α (TGF‐α) are some of the

growth factor families that play a key role in the growth and survival of normal prostate cells and are mostly up‐regulated in cancerous prostate cells (12, 373‐376). In cancer cells

interaction of AR with these signaling pathways through a non‐genomic mechanism induces cell

proliferation and survival in prostate epithelial cells (377, 378).

Epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR) have been

reported to be involved in androgen‐independent growth of PCa (12). Up‐regulation of EGF and

EGFR is directly correlated with progression of PCa to advanced stages (379). One of the main

3 A version of this chapter will be submitted for publication. Zardan A, Beraldi E, Cox ME, Gleave ME and Zoubeidi A. Lyn Tyrosine Kinase Facilitates Castration Resistant Prostate Cancer through EGF‐Mediated Phosphorylation of Androgen Receptor.

102 mechanisms through which EGF and EGFR promote growth and survival of PCa cells is through the phosphorylation and regulation of AR transcriptional activity, specifically in the absence of androgens (169, 170). Several studies have reported that EGF stimulation activates a kinase pathway involving serine/threonine and tyrosine kinases and leads to direct phosphorylation of

AR or its co‐activators (169, 170, 380‐382). The Serine/Threonine kinase, Extracellular signal

regulated kinase (ERK) is one of the kinases that can regulate AR transcriptional activity upon

EGF stimulation, by phosphorylating AR as well as its co‐activators such as ARA70 (361).

Recently, it has been demonstrated that EGF stimulation of PCa cells also results in a rapid

tyrosine phosphorylation of AR on Tyr267 and Tyr534 via Ack‐1 and Src tyrosine kinase which

accelerates transcriptional activity of AR (169, 170). These findings revealed the important role

of tyrosine phosphorylation in ligand‐independent activation of AR.

Genetic knockout of different SFKs has been shown to result in particular developmental defects and indicated a specific role for each Src family member (52, 348, 383, 384). Despite structural similarities between the members of the Src family of tyrosine kinases, current literature suggests a unique role for different members of this family in initiation and progression of PCa to advanced stages (52, 242, 267). Lyn tyrosine kinase is a member of the

Src family of non‐receptor tyrosine kinases and participates in signal transduction via cell surface receptors that lack the tyrosine kinase activity (242, 265). Although Lyn kinase does not play a crucial role in PCa disease initiation (52), here we report that Lyn kinase play a main role

in EGF‐mediated regulation of AR in a castrated environment. Our results indicate that Lyn

kinase is phosphorylated and activated upon EGF treatment and its siRNA knockdown inhibits

the EGF‐mediated ERK phosphorylation and activation. Moreover, we demonstrated that Lyn

103 kinase interacts directly with AR and overexpression of a Lyn dominant negative construct in

LNCaP cells leads to a decrease in the level of AR tyrosine phosphorylation. More importantly, this data shows that transcriptional activity of AR induced by R1881 alone, EGF alone, or in combination is inhibited after Lyn knockdown. Altogether, this report demonstrates a role for

Lyn kinase in regulation of AR transcriptional activity via tyrosine phosphorylation.

4.2 Materials and Methods

4.2.1 Cell Culture and siRNA Transfection

LNCaP cells were maintained in RPMI with 5% fetal bovine serum (311) and treated with

Lyn siRNA or scrambled siRNA control with oligofectamine in serum free OPTI‐MEM (Invitrogen‐

Life Technologies, Inc., Burlington, Ontario, Canada) for 20 min. 4 h later, 5% FBS was added.

Cells were treated once daily for two successive days and harvested 48 h after the second treatment.

4.2.2 Plasmid, Reagents and Antibodies

Lyn wild‐type, Empty vector, dominant negative and constitutively active plasmids were generously provided by Dr. Charles W. Emala (Columbia University, New York, New York) (350).

AR (N‐20), Lyn (H‐6), PSA (C‐19) antibodies were purchased from Santa Cruz Biotechnology, Inc.,

and Src, PARP antibodies were purchased from Cell Signaling, California., Actin antibody (Clone

C4) was purchased from Millipore, California., Anti‐Lyn (phosphor‐Y396) antibody was

purchased from Abcam. Lyn siRNA (human, sc‐29393) was purchased from Santa Cruz

Biotechnology, Inc. Transfection reagent OligofectAMINE, lipofectin and serum‐free OPTI‐MEM

media were purchased from Invitrogen Life Technologies Inc.

104 4.2.3 Cell Apoptosis Assays

LNCaP cells were transfected twice with Lyn siRNA or scrambled siRNA control. 5 days post transfection, detection and quantitation of apoptotic cells were assessed by western blot analysis and measurement of caspase‐3 activity. Each assay was performed three times.

Caspase‐3 activity was assessed using the kit CaspACE Assay System, Fluorometric (Promega,

Madison, WI, USA). 50 µg of total cell lysate were incubated with caspase‐3 substrate AC‐DEVD‐

AMC at room temperature for 4 h. The caspase‐3 activity was quantified in a fluorometer with

excitation at 360 nm and emission 460 nm.

4.2.4 Immunoprecipitation Analysis

Total proteins (1 mg) were pre‐cleared with protein‐G sepharose (Invitrogen‐Life

Technologies, Inc) for 1 h at 4˚C and immunoprecipitated with 2 µg of anti‐Lyn, anti‐AR, or IgG

as a control overnight at 4˚C. The immune complexes were recovered with protein‐G sepharose

for 2 h and then washed with RIPA buffer at least three times, centrifuged, and subjected to

SDS‐PAGE following by western blotting.

4.2.5 Transfection and Luciferase Assay

LNCaP cells (2.5 X 105) were plated on 6‐well plates and transfected using lipofectin (6

µl/well) (Invitrogen‐Life Technologies, Inc.). The total amount of plasmid DNA used was

normalized to 2 µg/well by the addition of a control plasmid. Media was replaced by CSS +/‐

R1881, 24 h after transfection for another 24 h. Luciferase activity was measured using the

microplate luminometer (EG&G Berthold). All experiments were carried out in triplicate.

105 Statistical Analysis: All data were analyzed by two‐tailed unpaired student’s t test or one‐way analysis of variance (ANOVA) with post‐hoc test. Levels of statistical significance were set at P < 0.05.

4.3 Results

4.3.1 Lyn is Phospho‐Activated on Y396 upon EGF

Growth factors (eg. EGF) and cytokines (eg. IL‐6) have been reported to be up‐regulated

in CRPC. Both EGF and IL‐6 phosphorylate AR in tyrosine via Ack‐1 and Src and thereby enhance

AR transcriptional activity. We examined if Lyn is downstream of EGF and IL‐6 signaling

pathways. LNCaP cells were serum starved overnight and treated with 50 ng/ml of EGF or IL‐6

for 15min. Lyn phosphorylation on its active site Tyr396 was analyzed after EGF and IL‐6 stimulation. We found that only EGF induces Lyn phosphorylation on Tyr396 (Figure 4.1. A) but not IL‐6 (Figure 4.1. B). Phosphorylation of ERK and STAT‐3 were used as positive controls. This

data suggests that Lyn can be involved in EGF‐induced activation of AR phosphorylation and transcriptional activity. Our finding in parallel with data in the literature helped us to formulate

a working model whereby treatment induced by androgen withdrawal up‐regulates EGF

pathway that is known to mediate CRPC. We propose that Lyn is a part of EGF signaling pathway to facilitate CRPC via phosphorylation and/or stabilization of AR and thereby enhancing AR transcription activity and cell survival.

106 A B

Figure 4.1. Lyn is activated in EGF pathway but not in Il‐6 pathway. LNCaP cells were serum starved for 24 h and treated with 50 ng/ml EGF (A) or 50 ng/ml IL‐6 (B) for 5 min. Proteins were extracted and direct western blots were performed using phospho‐specific antibodies against Lyn and Erk for EGF pathway and Lyn and STAT Tyr727 for IL‐6 pathway. Total proteins (T‐Erk and T‐STAT3) as well as Vinculin were used as controls.

4.3.2 Lyn Knockdown Inhibits EGF‐Induced ERK Phosphorylation

Phosphorylation and activation of ERK upon EGF treatment in LNCaP cells has been reported before (385, 386), however the possible role of Lyn in modulating this response has not yet been reported. Since ERK activation was reported to enhance transcriptional activity of

AR (361), we next examined the possible effect of Lyn knockdown on the phosphorylation and activation of ERK kinase. LNCaP cells were transfected with 10 nM of Lyn siRNA or scrambled control twice and were serum starved before EGF stimulation overnight. Treatment of cells with

50 ng/ml EGF for 15 min resulted in ERK phosphorylation and activation in control but not Lyn knockdown cells (Figure 4.2. A). This result points to a role for Lyn as regulator of EGF‐mediated

ERK phosphorylation and AR transcriptional activity.

107 4.3.3 Lyn Knockdown Inhibits R1881 and EGF induced AR Transcriptional Activity

Binding of R1881 to AR leads to the conformational change in AR protein and its dimerization, nuclear localization and DNA binding (43). It has been reported that EGF stimulation enhances AR transcriptional activity (172). To further investigate the effect of Lyn

kinase on EGF‐enhanced AR transcriptional activity LNCaP cells were transfected with Lyn siRNA or scrambled control. Cells were then treated with R1881 (10 nM), EGF (50 nM) or R1881 (10

nM) + EGF (50 nM) overnight and AR transcriptional activity was measured by PSA luciferase

activity (**, P < 0.01; ***, P < 0.001, ***, P < 0.001; respectively; Figure 4.2. B). as reported

previously, R1881 treatment induced AR transcriptional activity and this effect was further

increased when R1881 was combined with EGF in the control cells (387) (Figure 4.2. B).

Conversely, Lyn knockdown abrogated the effect of R1881 and/or EGF on AR transcriptional

activity. Data obtained from this experiment suggest that Lyn kinase might also play a role as mediator of EGF‐enhanced AR transcriptional activity.

108 A

Figure 4.2. Effect of Lyn knockdown on EGF‐induced ERK phosphorylation and R1881 and EGF induced AR transcriptional activity. A: Lyn knockdown inhibits EGF induced ERK phosphorylation. LNCaP cells were transfected with 10 nM of Lyn siRNA or scrambled siRNA control twice and then were serum starved for 24 h before stimulation with EGF (50 ng/ml) for 15 min. Total protein was analyzed by Western blotting with anti‐Total ERK and anti‐phospho‐ERK. Anti‐ Vinculin was used as loading control. B: Lyn knockdown abrogates R1881 and/or EGF induced AR transcriptional activity. LNCaP cells were transfected with 10 nM of Lyn siRNA or scrambled siRNA control. Cells were then transfected with 1 µg of PSA‐Luciferase for 24 h followed by treatment with R1881 (1 nM), EGF (50 ng/ml) or both for 24 h. Cells were harvested and PSA‐luciferase activity was measured. **, P < 0.01; ***, P < 0.001, ***, P < 0.001; respectively; Data represents means of at least 3 independent experiments performed in triplicate. Fold is measured relative to PSA‐luciferase activation with no treatment.

109 4.3.4 Lyn Kinase Binds to AR Directly and Regulates AR Tyrosine Phosphorylation

The NTD of AR has been reported to be phosphorylated via alternate pathways such as cAMP/PKA, IL‐6 and EGF in the androgen‐deprived environment and to affect transcriptional activity of AR (364, 388, 389). Tyrosine phosphorylation of AR, upon EGF stimulation by Src and

Ack1, has been recently reported to accelerate AR transcriptional activity (169, 170). It has been shown that both Src and Ack1 kinase bind and phosphorylate AR upon EGF treatment (169,

170). Our data indicated that Lyn kinase is phosphorylated upon EGF stimulation and its knockdown inhibits the EGF‐enhanced AR transcriptional activity. Therefore, we sought to investigate whether Lyn could directly interact and phosphorylate AR, similar to Src and Ack‐1, to modulate AR transcriptional activity. To address this, immunoprecipitation analysis was performed where AR was detected in Lyn immunoprecipitated complex. We tried the converse

immunoprecipitation to look for Lyn kinase in AR immunoprecipitated complex; however, binding of Lyn kinase to AR was not detectable due to interference with IgG heavy chain (Figure

4.3. A).

Next, we studied the effect of Lyn knockdown on AR NTD transcriptional activity which

is known to be the result of phosphorylation. LNCaP cells were first treated with either Lyn or

scrambled siRNA. Then, they were transfected with plasmids containing both AR N‐terminus

and luciferase reporter (regulated by the PSA enhancer‐promoter region). Finally, cells were

serum starved overnight and stimulated with ‐/+ EGF (50 nM) for 24 h. Measuring

transactivation of AR NTD using Luciferase assay showed a reduction after Lyn knockdown

compared with control cells (***, P < 0.001; ***, P < 0.001; respectively; Figure 4.3. B).

110 Furthermore, we investigated the effect of Lyn kinase dominant negative and constitutively active overexpression on tyrosine phosphorylation status of AR using immunoprecipitation analysis. To do this we introduced Lyn dominant negative and constitutively active plasmids into LNCaP cells, followed by serum starvation and stimulation

with ‐/+ EGF (50 nM) for 5 min. AR was immunoprecipitated from these cells and its tyrosine

phosphorylation status was analyzed. We observed that AR tyrosine phosphorylation decreased in LNCaP cells that were transfected with Lyn dominant negative compared with the cells in

which the constitutively active construct was transfected (Figure 4.3. C). Thus, it appears that

Lyn kinase binds and tyrosine phosphorylates NTD of AR which leads to enhanced AR transcriptional activity.

111 B

Figure 4.3. Lyn directly interacts and affects tyrosine phosphorylation and transactivaion of AR. A: Lyn interacts with AR. 500 µg of total protein extracts were immunoprecipitated with 2 µg of anti‐AR, or IgG as a control overnight at 4ºC. The immune complexes were recovered with protein‐G sepharose for 2 h and submitted to western blotting with anti‐ Lyn or anti‐AR antibodies. B: Lyn knockdown abrogates AR NTD, transcriptional activity. LNCaP cells were treated with 10 nM of Lyn siRNA or scrambled siRNA control twice. Cells were then transfected with 1 µg of plasmids containing both AR N‐terminus and luciferase reporter (regulated by the PSA enhancer‐promoter region) followed by treatment with EGF (50 ng/ml) for 24 h. Cells were harvested and luciferase activity was measured. (***, P < 0.001; ***, P < 0.001; respectively; Data represents means of at least 3 independent experiments performed in triplicate. Fold is measured relative to PSA activation with no treatment. C: Lyn dominant negative (DN) expression leads to decreased AR tyrosine phosphorylation. LNCaP cells were transfected with plasmids expressing Lyn dominant

112 negative or constitutively active constructs followed by treatment with EGF (50 ng/ml) for 5 min. 500 µg of total extract were immunoprecipitated with 2 µg of anti‐AR, or IgG as a control overnight at 4ºC. The immune complexes were recovered with protein‐G sepharose for 2 h and submitted to western blotting with anti‐phophotyrosine and AR antibodies. Vinculin was used as loading control.

4.3.5 Lyn Knockdown Induces Apoptosis in LNCaP Cells in The Presence of EGF and R1881

AR plays a crucial role in maintaining PCa cell survival through ligand dependent and independent mechanisms. EGF treatment has been shown to have a positive effect on PCa cell survival, especially in combination with R1881 (12, 172). Since Lyn knockdown led to the inhibition of AR transcriptional activity in the presence of both EGF and R1881, we decided to

analyze the effect of long‐term (5 days) Lyn knockdown on LNCaP cell survival in the presence

of R1881 and EGF. LNCaP cells were transfected with 10 nM Lyn siRNA or scrambled control.

Caspase‐3 activation and cleaved‐PARP were used to measure the rate of cell death 5 days post transfection. The results indicated that Lyn knockdown significantly increased the activation

level of caspase‐3 (****, P < 0.0001; ****, P < 0.0001; ****, P < 0.0001; ****, P < 0.0001;

respectively; Figure 4.4. A) as well as the amount of cleaved PARP even in the presence of

R1881 (10 nm) and EGF (50 nM) (Figure 4.4. B). This demonstrates that Lyn kinase is involved in

promoting LNCaP cell survival via regulating EGF and/or R1881‐enhanced AR transcriptional

activity.

113 A

Figure 4.4. Lyn knockdown induces apoptosis in LNCaP cells. A: Lyn knockdown increases the amount of cleaved PARP in LNCaP cells. LNCaP cells were treated with 10 nM siRNA Lyn or scrambled siRNA control twice followed by CSS, R1881 (10 nM), EGF (50 nM) or R1881+EGF treatment for 5 days. Total protein was extracted and analyzed by Western blotting with anti‐Lyn, anti‐PARP antibodies. Vinculin was used as loading control. B: Lyn knockdown increases caspase‐3 activity. Total proteins (50 μg) from each condition were lysed and monitored for their ability to cleave the fluorogenic substrate Ac‐DEVD‐AMC. Fluorescence generated by the cleavage was quantified by using a spectrofluorometer (****, P < 0.0001; ****, P < 0.0001; ****, P < 0.0001; ****, P < 0.0001; respectively). All experiments were repeated at least 3 times.

114 4.4 Discussion

Under low or absent androgen condition, growth factor signaling pathways play a crucial

role in maintaining the growth and survival of PCa cells (43, 386). It has been shown that

growth factor‐mediated transcriptional activity of AR is one of the key mechanisms through which PCa cells survive and proliferate in the low androgen condition (386). Up‐regulation of several peptide growth factor families including EGF, IGF, FGF and TGF‐α and their downstream signaling pathways have been reported to correlate with progression of PCa to advanced stages

(12, 373‐376). In the absence of androgens, peptide growth factors activate a number of

serine/threonine or tyrosine kinases and these kinases activate AR either through direct

phosphorylation or indirectly via phosphorylation of AR co‐activators (63, 169, 170, 379). Src

and Ack‐1 both belong to the family of NRTKs and have been reported to interact directly and

tyrosine phosphorylate AR. This tyrosine phosphorylation then leads to enhanced AR

transcriptional activity in the absence of ligand (169, 170).

Lyn tyrosine kinase is a member of the Src family of NRTKs and has been shown to be

up‐regulated in PCa and play a role in disease progression (52, 251, 266, 267). Our results

demonstrate for the first time that Lyn kinase is phophoactivated upon EGF stimulation and that Lyn knockdown inhibits EGF‐mediated ERK phosphorylation. This decrease in the phosphorylation of ERK then results in a decrease in transcriptional activity of AR in the presence of EGF, R1881 as well as the combination of both. ERK has been reported to play a

role in modulation of AR transcriptional activity in the androgen‐deprived conditions (360, 361).

Therefore, we concluded that one of the mechanisms through which Lyn kinase regulates AR transcriptional activity is via modulation of ERK. As the next step we looked for the possibility of

115 any direct interaction between AR and Lyn kinase and observed a direct interaction between

Lyn and AR. Since binding of AR to the previously identified NRTKs resulted in the AR tyrosine phosphorylation and modulation of its transcriptional activity, we subsequently examined the effect of Lyn kinase DN and CA overexpression on the tyrosine phosphorylation status of AR.

Overexpression of Lyn DN construct resulted in a decrease in AR tyrosine phosphorylation

compared with the CA overexpressing cells. Furthermore, we studied the effect of Lyn kinase expression and activity on AR ligand‐independent transcriptional activity through analysis of the effect of Lyn kinase on AR NTD transcriptional activity. Ligand independent regulatory

phosphorylation of AR has been mostly associated with its NTD (63, 163, 364). Thus, we overexpressed AR NTD in LNCaP cells previously treated with Lyn siRNA or scrambled control and analyzed the effect of Lyn kinase on AR NTD transcriptional activity after EGF treatment.

This result showed a significant decrease in transcriptional activity of AR NTD after Lyn

knockdown.

In this study we indicated that Lyn kinase can play a role in tyrosine phosphorylation of

AR upon EGF treatment. Tyrosine phosphorylation of AR upon EGF stimulation via Ack1 on

Tyr267 and via Src on Tyr534 has been previously reported (169, 170). However, dasatinib, a small molecule inhibitor of Src and Ack1, abrogated EGF induced AR phosphorylation on Tyr534 but not EGF inducing AR phosphorylation on Tyr267. This data suggests the existence of an additional unidentified tyrosine kinase involved in this process. Lyn tyrosine kinase can potentially be the tyrosine kinase that also phosphorylates AR on Tyr267.

116 The members of the Src family of NRTKs share structural similarities, although recent reports suggest a distinct role for each member of the family. A number of different Src family kinase inhibitors such as dasatinib are currently in clinical trials for the treatment of CRPC (390).

A better understanding of the mechanisms through which SFKs affect different aspects of PCa

from initiation to CRPC progression will help the researchers to develop more effective drugs.

117 CHAPTER 5: Conclusion and Suggestions for Future Work

5.1 General Discussion and Conclusion

Development of PCa requires a functional AR and its underlying signaling pathway (284,

391). Inherited syndromes, such as androgen insensitivity and spinal or bulbar muscular

atrophy, in which AR signaling is absent or reduced, result in immature prostate and will not

develop the carcinoma of the prostate (284, 391, 392). Androgen deprivation therapy remains

the most effective treatment option for men with advanced forms of PCa. Unfortunately, ADT

only provides a short‐term survival benefit for patients due to the development of lethal CRPC.

Recent literature suggests an important role for AR and AR signaling pathway during the

progression to CRPC. A number of different mechanisms have been associated with the

emergence of CRPC including re‐activation of AR axis, elevated expression of AR spliced

variants, activation of alternative signaling pathways and up‐regulation of stress‐induced

survival genes.

Over the course of my PhD two new drugs, abiraterone acetate (FDA approved) and

MDV3100 (in phase three clinical trial), were developed and indicated survival benefit to

patients with metastatic CRPC who are no longer responding to the chemotherapeutic drug

docetaxel (148, 393, 394). Abiraterone acetate is a potent and selective inhibitor of CYP17, one

of the key enzymes in androgen biosynthesis, and MDV‐3100 is an AR antagonist that blocks the

binding of androgens to AR and inhibits the nuclear translocation of AR (145, 148, 394, 395).

Despite the promising results from administration of these two drugs disease still progress

118 (396). Interestingly the progression in most cases corresponds to an increase in the serum PSA levels, which suggests the reactivation of AR signaling pathway (396‐398). Thus, we believe that the critical question at this time is to find out the underlying mechanisms that result in reactivation of AR and development of resistance to MDV3100 and abiraterone acetate. These

drugs do not affect the protein expression of AR; therefore, the AR protein is still present in the

prostate cells and can always become re‐activated via the crosstalk with several known and

unknown interconnected signaling networks leading to disease progression. Therefore, indirect

targeting of AR via targeting the mechanisms that result in stabilization of AR appears to be a

more effective approach. In this thesis we used two approaches to look for the mechanisms that lead to AR stabilization in order to help the development of the therapies for more effective AR targeting. The first approach was to study the role of chaperone proteins in AR stability which led to the identification of Hsp27 as a chaperone protein with the potential to regulate AR protein stability as well as activation. Next, based on the interesting findings in the literature, role of tyrosine kinases in regulation of AR was investigated. This approach resulted

in the identification of Lyn kinase as the only known tyrosine kinase with the capacity to regulate protein stability of AR. The results obtained in this thesis will be discussed in detail below:

Previous reports indicated the important role of heat shock proteins in steroid receptor

stabilization (209, 303, 320). Direct or indirect interaction of chaperone proteins such as Hsp90

and FKBP52 with AR has been indicated to play a role in regulation of AR stability and

transcriptional activity (212, 399, 400). Inhibition of Hsp90 expression has been shown to result

in AR destabilization and degradation via the proteasome degradation pathway (209, 320).

119 Therefore, over the last few years inhibition of chaperone protein activity has been studied as a potential strategy for treatment of patients with PCa (209, 320). Hsp90 is one of the chaperone proteins that has been shown to be overexpressed in CRPC. Aside from AR, Hsp90 interacts with and stabilizes many proteins involved in promoting the cell growth and survival of prostate

cells such as Akt (401). Therefore, a number of Hsp90 inhibitors have been developed to target

this chaperone protein for the treatment of the CRPC (402, 403). However, inhibition of Hsp90

as monotherapy with agents such as geldanamycin (small‐molecule inhibitor) was not

efficacious (404). As reported in the literature, some of the major mechanisms that contribute

to resistance to Hsp90 inhibitors were a) the induction of a heat shock response which leads to increased expression of other Hsps such as Hsp70 and Hsp27 which attenuates drug

effectiveness (160) and b) activation of tyrosine kinase c‐Src signaling which promoted the

growth of prostate carcinoma cells (405).

Previous reports by our group indicated that expression level of Hsp27 increases with

disease progression to CRPC (226). It was further revealed that Hsp27 has a cytoprotective

function in CRPC and inhibition of its expression leads to PCa cell death (226). Therefore, we sought to investigate the possible role of Hsp27 in modulation of AR stability which could also play a role in antagonizing the anticancer effect of Hsp90 inhibitors for the treatment of CRPC.

To address this hypothesis as described in detail in chapter 2, we designed a series of

experiments through which we indicated that treatment with androgens results in rapid, AR‐

dependent phosphorylation of Hsp27 via the p38MAPK pathway on both Ser78 and Ser82

phosphorylation sites. As the next step we performed experiments to find out whether AR and

Hsp27 interact directly. Our results showed that Hsp27 interacts directly with the NTD and LBD

120 of AR, colocalizes with AR in cytoplasm and translocate to the nucleus upon androgen treatment. This set of data suggested that Hsp27 could play an important role in chaperoning

AR to the nucleus and modulating AR transcriptional activity. To test this hypothesis we performed a series of gain and loss of function experiments and demonstrated that Hsp27

phosphorylation is required for AR transcriptional activity and that Hsp27 knockdown using

OGX‐427 inhibits AR‐mediated gene activation. Since, it was previously reported that other heat

shock proteins such as Hsp90 modulate AR nuclear localization and transcriptional activity

(209), we sought to investigate the specific mechanism through which Hsp27 regulates AR

transactivation. Interestingly, our results indicated that unlike Hsp90 that interacts with the

ligand‐unbound AR (320), Hsp27 interacts with ligand‐bound AR, and in fact Hsp27 replaces

Hsp90 in the AR complex. We further provided evidence that Hsp27 modulates the binding of

AR to ARE in the nucleus and that it continues to interact with AR at the level of ARE.

In chapter 2 of this thesis, for the first time, we demonstrated the mechanisms through which Hsp27 modulates AR protein stability. Our results indicated that Hsp27 knockdown destabilizes AR and leads to AR protein degradation through the proteasomal degradation pathway. We believe this finding describes one of the possible mechanisms through which

Hsp27 promotes PCa cell survival. Our in vivo experiments using LNCaP xenograft tumours

further confirmed our in vitro findings. We observed that treatment of LNCaP xenografts with

antisense inhibitor of Hsp27 (OGX‐427) decreases AR transcriptional activity, serum PSA levels

as well as tumour volume. Our western blot and immunostaining analysis indicated that protein

levels of AR, Hsp27 and Hsp90 decrease after treatment with OGX‐427. Collectively, our in vitro

121 and in vivo data in chapter 2 indicates a central role for Hsp27 in regulation of AR transcriptional activity through modulation of its protein stability.

Castration‐ and chemo‐resistance are the main obstacles in treatment of patients in advanced stages of PCa. Hsp27 protein was identified as a prognostic marker for PCa in our

group in an attempt to better understand the mechanisms of treatment resistant and to

determine new therapeutic targets. Previously, it has been shown by our research group and others that Hsp27 expression level increases after chemotherapy and hormone therapy and that is associated with CRPC progression (226, 325). Interestingly, some previous studies indicated that expression of Hsp27 plays an essential role in maintaining the activity of steroid hormone receptors (305). Based on the previous reports we thought it was essential to investigate the possible role of Hsp27 in regulation of AR activity. Our findings in chapter 2 provided supportive evidence that targeting Hsp27 is a promising therapeutic strategy in treatment of CRPC. OGX‐427, the antisense inhibitor of Hsp27, is currently in phase II clinical trials for treatment of prostate, bladder, ovarian, breast and lung cancers in United States and

Canada. The data presented in chapter 2 helped improve the overall understanding of Hsp27 mechanism of action in regulation of AR in PCa.

Expression of Hsp27 has also been reported to increase after the treatment with anticancer agents to confer therapeutic resistance (197). Preliminary data generated in the last year of my PhD (Appendix 6, 7 and 8) demonstrated an important role for Hsp27 in regulation

of two of the interlinked protein degradation pathways: a) the Unfolded Protein Response

(UPR) and b) Autophagy. These two pathways have been reported to be activated in response

122 to the Endoplasmic Reticulum (ER) stress caused by accumulation of misfolded proteins in cell stress conditions (406, 407). Many different stressors can disturb protein folding including anticancer therapeutics (408). Activation of UPR as a cytoprotective mechanism results in either improved protein folding or degradation of proteins via the proteasome‐degradation pathway

(408). If the accumulated misfolded proteins cannot be degraded via the proteasome pathway

the UPR up‐regulates the autophagy machinery which is one of the major lysosomal

degradation pathways to degrade the misfolded protein aggregates (408, 409).

Since investigating the mechanisms that lead to drug resistance such as resistance to

MDV3100 is the new research focus in our laboratory, we took a step to investigate the potential role of Hsp27 in regulation of UPR and autophagy cytoprotective pathways. Hsp27 appears to play a key role in regulation of UPR and autophagy in PCa cells (Appendix 6, 7 and 8).

Inhibition of proteasome activity via treatment with MG132 was used to model the

accumulation of the misfolded proteins in the ER and initiation of the UPR (Appendix 6).

Initiation of UPR led to an increase in expression and activity of Hsp27 in correlation with up‐

regulation of the UPR‐related proteins expression (Appendix 6). Furthermore, Hsp27

knockdown with both siRNA and ASO resulted in an increase in accumulation of ubiquitinated

proteins and induction of UPR (Appendix 7 and 8). However, Hsp27 overexpression caused a

decrease in the amount of ubiquitinated proteins as well as UPR induction (Appendix 7 and 8).

Moreover, Hsp27 knockdown affected the expression level of the autophagy protein LC3

(Appendix 8). The ongoing research in our laboratory investigates the molecular mechanisms through which Hsp27 regulates the UPR and autophagy pathways of cell survival. Both UPR and autophagy have been shown to play a role in cancer cell survival and development of

123 therapeutic resistance (408, 410). Our preliminary observations suggest a central role for Hsp27 in regulation of PCa cell survival and development of therapeutic resistance through the regulation of UPR and autophagy.

As noted earlier, crosstalk between AR and growth factor signaling pathways is another important mechanism through which PCa cells survive and proliferate despite androgen

deprivation therapy (380). NRTKs play a key role in integrating signal transduction for multiple

growth factor receptors involved in the proliferation, invasion and metastasis of PCa cells (411,

412). In 2005, Guo et al. brought to attention a new role for the NRTK, Src, in regulating AR

transcriptional activity via direct interaction and tyrosine phosphorylation of AR upon growth factor stimulation (169). Another report in 2007 by Mahajan et al. further confirmed the importance of NRTK, Ack‐1 in regulation of AR transcriptional activity via similar mechanism

(170). Previously, it was reported that expression of NRTK, Lyn is higher in poorly differentiated

regions of prostate tumours and correlates with PCa disease progression to advanced stages

(251). Moreover, knockdown of Lyn kinase in PCa cells reduces the PCa cell growth (251, 267).

Despite the evidence suggesting an important role for Lyn kinase in PCa disease progression there are few reports on the underlying mechanism through which Lyn kinase

renders this effect. In chapter 3 we first confirmed that expression and activity of Lyn kinase

increases with the progression of PCa to CRPC both in vivo and in vitro. In LNCaP xenograft

model overexpression of Lyn kinase accelerated the castrate‐resistant tumour growth and

serum PSA relapse to pre‐castration level; however, it did not affect the tumour incidence or tumour growth before castration. Cai et al. observed similar results through their in vivo

124 experiments performed in search of finding the quantitative variation in transformation of prostate epithelium by SFK members and further confirmed that ectopic expression of Lyn kinase had no effect on PCa disease initiation (52). We believe that unlike Src kinase that has a strong oncogenic potential, Lyn kinase is a key regulator of PCa cell survival after castration.

Interestingly, as shown in chapter 3, expression level of Lyn kinase seems to be negatively regulated by the level of androgens. Treatment with the synthetic androgen R1881 suppressed

the expression of Lyn kinase, whereas LNCaP cells which were kept in the androgen‐deprived medium CSS for 24 h exhibited a higher level of Lyn kinase expression.

Serine/threonine and tyrosine phosphorylation of AR protein at multiple residues have been shown to regulate AR nuclear localization and transcriptional activity (413‐416).

Phosphorylation of AR on these residues has been reported to regulate AR transcriptional activity in the absence of androgenic stimuli and to promote the development of CRPC (169,

170, 414). Our results indicated that Lyn kinase expression is negatively regulated by androgens and positively correlates with the progression of PCa to CRPC stage (chapter 3). Moreover, in vivo Lyn overexpression accelerated the castrate‐resistant tumour growth and serum PSA

relapse to pre‐castration level. These results suggested a role for Lyn kinase in PCa progression

via regulation of AR activity in the absence or low levels of androgenic stimuli. In chapter 3, we

demonstrated that Lyn kinase regulates the protein stability of AR and, as a result, affects its transcriptional activity. Phosphorylation of AR has been reported to be one of the major mechanisms involved in AR protein stability (169, 170, 368, 369, 417). Our data indicated that

Lyn kinase is phosphorylated upon EGF treatment and that its expression affects EGF‐mediated

ERK phosphorylation (chapter 4). Furthermore, knockdown of Lyn kinase reduced the

125 transcriptional activity of AR N‐terminus upon EGF stimulation (chapter 4). Through immunoprecipitation analysis we also demonstrated that overexpression of the Lyn kinase dominant negative construct resulted in a decrease in total tyrosine phosphorylation of AR

(chapter 4). Collectively, data obtained in chapter 3 and 4 of this thesis suggests that Lyn kinase

plays an important role in regulation of AR protein stability and tyrosine phosphorylation in the

absence of androgens. This data also supports and provides a rationale mechanism for the

results reported by Park et al. indicating that Lyn kinase knockdown affects PCa cellular

proliferation (267). AR is the central regulator of both normal and cancerous prostate cell

survival. Thus, effect of Lyn kinase knockdown on AR protein expression disrupts the central

proliferation pathway in prostate cells and results in inhibition of cell proliferation in prostate

cells.

Another important aspect of this thesis was the comparative studies between Src and

Lyn kinase. These two members of the SFKs seem to play a predominant role in PCa, although

evidence from different studies suggest that either member has a very specific role in the

disease progression (52, 267). Our results indicated that Src kinase is highly expressed in both

primary and advanced PCa tissue specimens, whereas, expression of Lyn kinase increases with

the progression of PCa to the castrate resistant stage. This finding suggests a specific role for

Lyn kinase in the androgen deprived environment. We also observed that the effect of Lyn

kinase on AR transcriptional activity was more potent than Src kinase. This could be due to the

fact that the knockout of Lyn but not Src kinase affected the protein expression of AR. This set

of data supports the previous findings on the distinguishable role of Src and Lyn kinase (52,

126 267). Therefore, targeting specific members of the SFKs in different stages of PCa progression

might be a more promising therapeutic approach.

Figure 5.1. Regulation of AR by Lyn in CRPC. AR signaling pathway in androgen‐dependent PCa and our hypothetical model showing Lyn as a downstream effectors of EGF signaling pathway regulating AR in CRPC.

5.2 Suggestions for Future Work

The work presented in this thesis demonstrated the detailed mechanism through which

Hsp27 and Lyn tyrosine kinase regulate AR protein stability and transcriptional activity in different stages of PCa. Both Hsp27 and Lyn kinase have been characterized to be potential

127 therapeutic targets for the treatment of CRPC, therefore a better understanding of the mechanisms through which they promote the survival and proliferation of PCa cells is essential.

Our data in chapter 2 indicated the role of Hsp27 in PCa cell survival in an androgen‐ dependent manner. Our group and others have also demonstrated that Hsp27 is a central

regulator of prostate cell survival in an androgen‐deprived condition (197, 216, 226, 229).

Expression of Hsp27 is reported to increase after hormone ablation and chemotherapy and is associated with CRPC (226, 229, 325). Hsp27 has been reported to become phospho‐activated

downstream of Akt and MAPK pathway upon growth factor stimulation and to promote survival and proliferation of PCa cells in the absence of androgens (216, 418, 419). Investigation of the exact mechanism through which Hsp27 promotes proliferation and survival of PCa cells in the

castrated environment is a great area for future research.

Hsp27 has been linked to epithelial to mesenchymal transition (EMT), migration,

invasion and metastasis in solid tumours such as breast and kidney cancer (218, 420‐422). In

prostate cell lines, it has been reported that Hsp27 knockdown inhibits the VEGF‐induced cell migration and TGFβ‐induced cell invasion (423). These results suggest a potential role for Hsp27

in PCa invasion, migration and EMT and further highlight the need for future investigation of

the role of Hsp27 in PCa cell invasion and metastasis.

As mentioned earlier, we have preliminary data (Appendix 6, 7 and 8) suggesting a

central role for Hsp27 in regulation of UPR and autophagy. These two pathways have been

shown to play an important role in conferring cytoprotection and therapy resistance (408, 410).

Therefore, investigating the specific molecular mechanisms through which Hsp27 regulates UPR

128 and autophagy will help understanding and modeling of the mechanisms of drug resistance and supports that Hsp27 is a promising therapeutic target for PCa.

Our results in chapter 3 and 4 shed light on the specific role of Lyn kinase in regulation of AR protein expression and transactivation in the castrated environment. Similar to Hsp27,

Lyn kinase expression and activity have been associated with cancer metastasis and the process

of EMT in other cancers such as Ewing’s Sarcoma and breast cancer (265, 424). Since recent report by Cai et al. demonstrated a more important role for Lyn kinase in acceleration of

tumorigenesis than tumour initiation (52), we suggest further investigation on the potential role of Lyn kinase in regulation of PCa invasion, metastasis and EMT.

The data obtained in chapter 3 and 4, also demonstrated that Lyn kinase affects AR tyrosine phosphorylation; however, due to the fact that phospho‐tyrosine AR antibodies are

not commercially available, the exact tyrosine phosphorylation site on AR, that is

phosphorylated by Lyn kinase, was not determined. Previous reports have shown that EGF

treatment results in AR phosphorylation on Tyr267 via Ack‐1 and Tyr534 via Src kinase. It has also

been shown that a small molecule inhibitor, dasatinib, targeting Src and Ack‐1 activity abrogates EGF inducing AR phosphorylation on Tyr534 but not EGF inducing AR phosphorylation

on Try267. Lyn kinase could potentially be the additional unidentified kinase involved in this

process. Thus, it is important to identify the tyrosine phosphorylation site of Lyn on AR and clarify if the Tyr267 is phosphorylated by Lyn kinase.

129 Bibliography

1. (2009) Prostate Cancer, Cambridge University Press

2. Cunha, G. R., Tuohimaa, P., and Visakorpi, T. (2004) Steroids and prostate cancer. J Steroid Biochem Mol Biol 92, 219‐220

3. Thomson, A. A., Cunha, G. R., and Marker, P. C. (2008) Prostate development and pathogenesis. Differentiation 76, 559‐564

4. Staack, A., Donjacour, A. A., Brody, J., Cunha, G. R., and Carroll, P. (2003) Mouse urogenital development: a practical approach. Differentiation 71, 402‐413

5. Kumar, V. L., and Majumder, P. K. (1995) Prostate gland: structure, functions and regulation. Int Urol Nephrol 27, 231‐243

6. Lee, C. H., Akin‐Olugbade, O., and Kirschenbaum, A. Overview of prostate anatomy, histology, and pathology. Endocrinol Metab Clin North Am 40, 565‐575

7. Walsh, P. C. (1992) Why make an early diagnosis of prostate cancer. The Journal of urology 147, 853‐854

8. McNeal, J. E. (1972) The prostate and prostatic urethra: a morphologic synthesis. The Journal of urology 107, 1008‐1016

9. Dixon, S. C., Kruger, E. A., Bauer, K. S., and Figg, W. D. (1999) Thalidomide up‐regulates prostate‐specific antigen secretion from LNCaP cells. Cancer Chemother Pharmacol 43 Suppl, S78‐84

10. Long, R. M., Morrissey, C., Fitzpatrick, J. M., and Watson, R. W. (2005) Prostate epithelial cell differentiation and its relevance to the understanding of prostate cancer therapies. Clin Sci (Lond) 108, 1‐11

11. McNeal, J. E. (1988) Normal histology of the prostate. Am J Surg Pathol 12, 619‐633

12. Russell, P. J., Bennett, S., and Stricker, P. (1998) Growth factor involvement in progression of prostate cancer. Clinical chemistry 44, 705‐723

130 13. Bonkhoff, H., Stein, U., and Remberger, K. (1995) Endocrine‐paracrine cell types in the prostate and prostatic adenocarcinoma are postmitotic cells. Hum Pathol 26, 167‐170

14. Neill, J. D. (2006) Knobil and Neill's physiology of reproduction Vol. 2

15. Bonkhoff, H., Stein, U., and Remberger, K. (1994) The proliferative function of basal cells in the normal and hyperplastic human prostate. The Prostate 24, 114‐118

16. Bordini, B., and Rosenfield, R. L. (2011) Normal pubertal development: part II: clinical aspects of puberty. Pediatr Rev 32, 281‐292

17. Mainwaring, W. I. (1977) The mechanism of action of androgens. Monogr Endocrinol 10, 1‐178

18. Abrahamsson, P. A., and di Sant'Agnese, P. A. (1993) Neuroendocrine cells in the human prostate gland. Journal of andrology 14, 307‐309

19. Bonkhoff, H. (1998) Neuroendocrine cells in benign and malignant prostate tissue: morphogenesis, proliferation, and androgen receptor status. The Prostate. Supplement 8, 18‐22

20. Chung, L. W., Gleave, M. E., Hsieh, J. T., Hong, S. J., and Zhau, H. E. (1991) Reciprocal mesenchymal‐epithelial interaction affecting prostate tumour growth and hormonal responsiveness. Cancer Surv 11, 91‐121

21. (2005) Textbook of Benign Prostatic Hyperplasia, Taylor and Francis Group

22. Cunha, G. R., Fujii, H., Neubauer, B. L., Shannon, J. M., Sawyer, L., and Reese, B. A. (1983) Epithelial‐mesenchymal interactions in prostatic development. I. morphological observations of prostatic induction by urogenital sinus mesenchyme in epithelium of the adult rodent urinary bladder. J Cell Biol 96, 1662‐1670

23. Cunha, G. R., Hayward, S. W., and Wang, Y. Z. (2002) Role of stroma in carcinogenesis of the prostate. Differentiation 70, 473‐485

24. Takeda, H., and Chang, C. (1991) Immunohistochemical and in‐situ hybridization analysis of androgen receptor expression during the development of the mouse prostate gland. The Journal of endocrinology 129, 83‐89

25. Cooke, P. S., Young, P., and Cunha, G. R. (1991) Androgen receptor expression in developing male reproductive organs. Endocrinology 128, 2867‐2873

131 26. Isaacs, J. T., and Isaacs, W. B. (2004) Androgen receptor outwits prostate cancer drugs. Nature medicine 10, 26‐27

27. Chung, L. W., and Cunha, G. R. (1983) Stromal‐epithelial interactions: II. Regulation of prostatic growth by embryonic urogenital sinus mesenchyme. The Prostate 4, 503‐511

28. Pu, Y., Huang, L., Birch, L., and Prins, G. S. (2007) Androgen regulation of prostate morphoregulatory gene expression: Fgf10‐dependent and ‐independent pathways. Endocrinology 148, 1697‐1706

29. Wilson, J. D. (1999) The role of androgens in male gender role behavior. Endocrine reviews 20, 726‐737

30. Zumpe, D., and Michael, R. P. (1985) Effects of testosterone on the behavior of male cynomolgus monkeys (Macaca fascicularis). Horm Behav 19, 265‐277

31. Michels, G., and Hoppe, U. C. (2008) Rapid actions of androgens. Front Neuroendocrinol 29, 182‐198

32. Dufau, M. L., Winters, C. A., Hattori, M., Aquilano, D., Baranao, J. L., Nozu, K., Baukal, A., and Catt, K. J. (1984) Hormonal regulation of androgen production by the Leydig cell. J Steroid Biochem 20, 161‐173

33. Makridakis, N. M., and Reichardt, J. K. (2001) Molecular epidemiology of hormone‐ metabolic loci in prostate cancer. Epidemiol Rev 23, 24‐29

34. Labrie, F. (2004) Adrenal androgens and intracrinology. Semin Reprod Med 22, 299‐309

35. Dohle, G. R., Smit, M., and Weber, R. F. A. (2003) Androgens and male fertility. World journal of urology 21, 341‐345

36. Wilson, J. D. (2011) The critical role of androgens in prostate development. Endocrinol Metab Clin North Am 40, 577‐590

37. Huggins, C. (1947) The Etiology of Benign Prostatic Hypertrophy. Bull N Y Acad Med 23, 696‐704

38. Svechnikov, K., Izzo, G., Landreh, L., Weisser, J., and Soder, O. (2010) Endocrine disruptors and Leydig cell function. J Biomed Biotechnol vol. 2010

39. Huggins, C., and Hodges, C. V. (1972) Studies on prostatic cancer. I. The effect of castration, of estrogen and androgen injection on serum phosphatases in metastatic carcinoma of the prostate. CA: a cancer journal for clinicians 22, 232‐240

132 40. Huggins, C., and Clark, P. J. (1940) Quantitative Studies of Prostatic Secretion : Ii. The Effect of Castration and of Estrogen Injection on the Normal and on the Hyperplastic Prostate Glands of Dogs. J Exp Med 72, 747‐762

41. Bordini, B., and Rosenfield, R. L. (2011) Normal pubertal development: Part I: The endocrine basis of puberty. Pediatr Rev 32, 223‐229

42. Chen, H. C., Shimohigashi, Y., Dufau, M. L., and Catt, K. J. (1982) Characterization and biological properties of chemically deglycosylated human chorionic gonadotropin. Role of carbohydrate moieties in adenylate cyclase activation. J Biol Chem 257, 14446‐14452

43. Feldman, B. J., and Feldman, D. (2001) The development of androgen‐independent prostate cancer. Nat Rev Cancer 1, 34‐45

44. Pozzi, P., Bendotti, C., Simeoni, S., Piccioni, F., Guerini, V., Marron, T. U., Martini, L., and Poletti, A. (2003) Androgen 5‐alpha‐reductase type 2 is highly expressed and active in rat spinal cord motor neurones. J Neuroendocrinol 15, 882‐887

45. Uemura, M., Tamura, K., Chung, S., Honma, S., Okuyama, A., Nakamura, Y., and Nakagawa, H. (2008) Novel 5 alpha‐steroid reductase (SRD5A3, type‐3) is overexpressed in hormone‐refractory prostate cancer. Cancer science 99, 81‐86

46. Cai, C., and Balk, S. P. (2011) Intratumoral androgen biosynthesis in prostate cancer pathogenesis and response to therapy. Endocrine‐related cancer 18, R175‐182

47. Aranda, A., and Pascual, A. (2001) Nuclear hormone receptors and gene expression. Physiol Rev 81, 1269‐1304

48. Heinlein, C. A., and Chang, C. (2002) Androgen receptor (AR) coregulators: an overview. Endocrine reviews 23, 175‐200

49. Heinlein, C. A., and Chang, C. (2002) The roles of androgen receptors and androgen‐ binding proteins in nongenomic androgen actions. Mol Endocrinol 16, 2181‐2187

50. Keller, E. T., Ershler, W. B., and Chang, C. (1996) The androgen receptor: a mediator of diverse responses. Front Biosci 1, d59‐71

51. Morales, M. M., Carroll, T. P., Morita, T., Schwiebert, E. M., Devuyst, O., Wilson, P. D., Lopes, A. G., Stanton, B. A., Dietz, H. C., Cutting, G. R., and Guggino, W. B. (1996) Both the wild type and a functional isoform of CFTR are expressed in kidney. Am J Physiol 270, F1038‐1048

133 52. Cai, H., Smith, D. A., Memarzadeh, S., Lowell, C. A., Cooper, J. A., and Witte, O. N. (2011) Differential transformation capacity of Src family kinases during the initiation of prostate cancer. Proc Natl Acad Sci U S A 108, 6579‐6584

53. Gelmann, E. P. (2002) Molecular biology of the androgen receptor. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 20, 3001‐3015

54. Brinkmann, A. O., Blok, L. J., de Ruiter, P. E., Doesburg, P., Steketee, K., Berrevoets, C. A., and Trapman, J. (1999) Mechanisms of androgen receptor activation and function. J Steroid Biochem Mol Biol 69, 307‐313

55. Lavery, D. N., and McEwan, I. J. (2005) Structure and function of steroid receptor AF1 transactivation domains: induction of active conformations. Biochem J 391, 449‐464

56. Jenster, G., van der Korput, H. A., Trapman, J., and Brinkmann, A. O. (1995) Identification of two transcription activation units in the N‐terminal domain of the human androgen receptor. J Biol Chem 270, 7341‐7346

57. Jenster, G., van der Korput, H. A., van Vroonhoven, C., van der Kwast, T. H., Trapman, J., and Brinkmann, A. O. (1991) Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 5, 1396‐1404

58. Yap, T. A., Zivi, A., Omlin, A., and de Bono, J. S. (2011) The changing therapeutic landscape of castration‐resistant prostate cancer. Nat Rev Clin Oncol 8, 597‐610

59. Oefelein, M. G., Agarwal, P. K., and Resnick, M. I. (2004) Survival of patients with hormone refractory prostate cancer in the prostate specific antigen era. The Journal of urology 171, 1525‐1528

60. Tenniswood, M. P., Guenette, R. S., Lakins, J., Mooibroek, M., Wong, P., and Welsh, J. E. (1992) Active cell death in hormone‐dependent tissues. Cancer Metastasis Rev 11, 197‐ 220

61. Lavery, D. N., and Bevan, C. L. (2011) Androgen receptor signalling in prostate cancer: the functional consequences of acetylation. J Biomed Biotechnol vol. 2011, 862125

62. Klocker, H., Culig, Z., Kaspar, F., Hobisch, A., Eberle, J., Reissigl, A., and Bartsch, G. (1994) Androgen signal transduction and prostatic carcinoma. World journal of urology 12, 99‐ 103

134 63. Ueda, T., Mawji, N. R., Bruchovsky, N., and Sadar, M. D. (2002) Ligand‐independent activation of the androgen receptor by interleukin‐6 and the role of steroid receptor coactivator‐1 in prostate cancer cells. J Biol Chem 277, 38087‐38094

64. Ueda, T., Bruchovsky, N., and Sadar, M. D. (2002) Activation of the androgen receptor N‐ terminal domain by interleukin‐6 via MAPK and STAT3 signal transduction pathways. J Biol Chem 277, 7076‐7085

65. Nahoum, V., and Bourguet, W. (2007) Androgen and estrogen receptors: potential of crystallography in the fight against cancer. Int J Biochem Cell Biol 39, 1280‐1287

66. Khorasanizadeh, S., and Rastinejad, F. (2001) Nuclear‐receptor interactions on DNA‐ response elements. Trends Biochem Sci 26, 384‐390

67. Haelens, A., Tanner, T., Denayer, S., Callewaert, L., and Claessens, F. (2007) The hinge region regulates DNA binding, nuclear translocation, and transactivation of the androgen receptor. Cancer research 67, 4514‐4523

68. Schoenmakers, E., Alen, P., Verrijdt, G., Peeters, B., Verhoeven, G., Rombauts, W., and Claessens, F. (1999) Differential DNA binding by the androgen and glucocorticoid receptors involves the second Zn‐finger and a C‐terminal extension of the DNA‐binding domains. Biochem J 341 (Pt 3), 515‐521

69. He, B., Kemppainen, J. A., Voegel, J. J., Gronemeyer, H., and Wilson, E. M. (1999) Activation function 2 in the human androgen receptor ligand binding domain mediates interdomain communication with the NH(2)‐terminal domain. J Biol Chem 274, 37219‐ 37225

70. Loy, C. J., Sim, K. S., and Yong, E. L. (2003) Filamin‐A fragment localizes to the nucleus to regulate androgen receptor and coactivator functions. Proc Natl Acad Sci U S A 100, 4562‐4567

71. Bennett, N. C., Gardiner, R. A., Hooper, J. D., Johnson, D. W., and Gobe, G. C. (2010) Molecular cell biology of androgen receptor signalling. Int J Biochem Cell Biol 42, 813‐ 827

72. Cardozo, C. P., Michaud, C., Ost, M. C., Fliss, A. E., Yang, E., Patterson, C., Hall, S. J., and Caplan, A. J. (2003) C‐terminal Hsp‐interacting protein slows androgen receptor synthesis and reduces its rate of degradation. Arch Biochem Biophys 410, 134‐140

135 73. Shatkina, L., Mink, S., Rogatsch, H., Klocker, H., Langer, G., Nestl, A., and Cato, A. C. (2003) The cochaperone Bag‐1L enhances androgen receptor action via interaction with the NH2‐terminal region of the receptor. Mol Cell Biol 23, 7189‐7197

74. He, B., Lee, L. W., Minges, J. T., and Wilson, E. M. (2002) Dependence of selective gene activation on the androgen receptor NH2‐ and COOH‐terminal interaction. J Biol Chem 277, 25631‐25639

75. Simental, J. A., Sar, M., Lane, M. V., French, F. S., and Wilson, E. M. (1991) Transcriptional activation and nuclear targeting signals of the human androgen receptor. J Biol Chem 266, 510‐518

76. Heemers, H. V., and Tindall, D. J. (2007) Androgen receptor (AR) coregulators: a diversity of functions converging on and regulating the AR transcriptional complex. Endocrine reviews 28, 778‐808

77. Lonergan, P. E., and Tindall, D. J. (2011) Androgen receptor signaling in prostate cancer development and progression. J Carcinog 10, 20

78. Lee, D. K., and Chang, C. (2003) Endocrine mechanisms of disease: Expression and degradation of androgen receptor: mechanism and clinical implication. J Clin Endocrinol Metab 88, 4043‐4054

79. Ding, X. F., Anderson, C. M., Ma, H., Hong, H., Uht, R. M., Kushner, P. J., and Stallcup, M. R. (1998) Nuclear receptor‐binding sites of coactivators glucocorticoid receptor interacting protein 1 (GRIP1) and steroid receptor coactivator 1 (SRC‐1): multiple motifs with different binding specificities. Mol Endocrinol 12, 302‐313

80. Hong, H., Darimont, B. D., Ma, H., Yang, L., Yamamoto, K. R., and Stallcup, M. R. (1999) An additional region of coactivator GRIP1 required for interaction with the hormone‐ binding domains of a subset of nuclear receptors. J Biol Chem 274, 3496‐3502

81. Shen, H. C., and Coetzee, G. A. (2005) The androgen receptor: unlocking the secrets of its unique transactivation domain. Vitam Horm 71, 301‐319

82. Shen, H. C., Buchanan, G., Butler, L. M., Prescott, J., Henderson, M., Tilley, W. D., and Coetzee, G. A. (2005) GRIP1 mediates the interaction between the amino‐ and carboxyl‐ termini of the androgen receptor. Biol Chem 386, 69‐74

83. Cheng, S., Brzostek, S., Lee, S. R., Hollenberg, A. N., and Balk, S. P. (2002) Inhibition of the dihydrotestosterone‐activated androgen receptor by nuclear receptor corepressor. Mol Endocrinol 16, 1492‐1501

136 84. Liao, G., Chen, L. Y., Zhang, A., Godavarthy, A., Xia, F., Ghosh, J. C., Li, H., and Chen, J. D. (2003) Regulation of androgen receptor activity by the nuclear receptor corepressor SMRT. J Biol Chem 278, 5052‐5061

85. Nieto, M., Finn, S., Loda, M., and Hahn, W. C. (2007) Prostate cancer: Re‐focusing on androgen receptor signaling. Int J Biochem Cell Biol 39, 1562‐1568

86. Luo, J., Duggan, D. J., Chen, Y., Sauvageot, J., Ewing, C. M., Bittner, M. L., Trent, J. M., and Isaacs, W. B. (2001) Human prostate cancer and benign prostatic hyperplasia: molecular dissection by gene expression profiling. Cancer research 61, 4683‐4688

87. Baker, S. G., Cappuccio, A., and Potter, J. D. (2010) Research on early‐stage carcinogenesis: are we approaching paradigm instability? Journal of clinical oncology : official journal of the American Society of Clinical Oncology 28, 3215‐3218

88. Kim, Y., Stolarska, M. A., and Othmer, H. G. (2011) The role of the microenvironment in tumor growth and invasion. Prog Biophys Mol Biol 106, 353‐379

89. Collins, A. T., Berry, P. A., Hyde, C., Stower, M. J., and Maitland, N. J. (2005) Prospective identification of tumorigenic prostate cancer stem cells. Cancer research 65, 10946‐ 10951

90. Hamburger, A. W., and Salmon, S. E. (1977) Primary bioassay of human tumor stem cells. Science 197, 461‐463

91. Madu, C. O., and Lu, Y. (2010) Novel diagnostic biomarkers for prostate cancer. J Cancer 1, 150‐177

92. Miller, G. J., and Cygan, J. M. (1992) Diagnostic correlations with whole mounts of radical prostatectomy specimens. Monogr Pathol, 183‐197

93. Buhmeida, A., Pyrhonen, S., Laato, M., and Collan, Y. (2006) Prognostic factors in prostate cancer. Diagn Pathol 1, 4

94. Statistics, C. C. S. s. S. C. o. C. (2011) Canadian Cancer Statistics 2011. (Toronto, O. C. C. S., ed)

95. Jemal, A., Bray, F., Center, M. M., Ferlay, J., Ward, E., and Forman, D. (2011) Global cancer statistics. CA: a cancer journal for clinicians 61, 69‐90

96. Chodak, G. (2006) Prostate cancer: epidemiology, screening, and biomarkers. Rev Urol 8 Suppl 2, S3‐8

137 97. Sakr, W. A., Haas, G. P., Cassin, B. F., Pontes, J. E., and Crissman, J. D. (1993) The frequency of carcinoma and intraepithelial neoplasia of the prostate in young male patients. The Journal of urology 150, 379‐385

98. Gronberg, H. (2003) Prostate cancer epidemiology. Lancet 361, 859‐864

99. Soos, G., Tsakiris, I., Szanto, J., Turzo, C., Haas, P. G., and Dezso, B. (2005) The prevalence of prostate carcinoma and its precursor in Hungary: an autopsy study. European urology 48, 739‐744

100. Haas, G. P., and Sakr, W. A. (1997) Epidemiology of prostate cancer. CA: a cancer journal for clinicians 47, 273‐287

101. Bostwick, D. G., Burke, H. B., Djakiew, D., Euling, S., Ho, S. M., Landolph, J., Morrison, H., Sonawane, B., Shifflett, T., Waters, D. J., and Timms, B. (2004) Human prostate cancer risk factors. Cancer 101, 2371‐2490

102. Tulinius, H., Egilsson, V., Olafsdottir, G. H., and Sigvaldason, H. (1992) Risk of prostate, ovarian, and endometrial cancer among relatives of women with breast cancer. BMJ 305, 855‐857

103. Spitz, M. R., Currier, R. D., Fueger, J. J., Babaian, R. J., and Newell, G. R. (1991) Familial patterns of prostate cancer: a case‐control analysis. The Journal of urology 146, 1305‐ 1307

104. Carter, B. S., Bova, G. S., Beaty, T. H., Steinberg, G. D., Childs, B., Isaacs, W. B., and Walsh, P. C. (1993) Hereditary prostate cancer: epidemiologic and clinical features. The Journal of urology 150, 797‐802

105. Eeles, R. A., Kote‐Jarai, Z., Giles, G. G., Olama, A. A., Guy, M., Jugurnauth, S. K., Mulholland, S., Leongamornlert, D. A., Edwards, S. M., Morrison, J., Field, H. I., Southey, M. C., Severi, G., Donovan, J. L., Hamdy, F. C., Dearnaley, D. P., Muir, K. R., Smith, C., Bagnato, M., Ardern‐Jones, A. T., Hall, A. L., O'Brien, L. T., Gehr‐Swain, B. N., Wilkinson, R. A., Cox, A., Lewis, S., Brown, P. M., Jhavar, S. G., Tymrakiewicz, M., Lophatananon, A., Bryant, S. L., Horwich, A., Huddart, R. A., Khoo, V. S., Parker, C. C., Woodhouse, C. J., Thompson, A., Christmas, T., Ogden, C., Fisher, C., Jamieson, C., Cooper, C. S., English, D. R., Hopper, J. L., Neal, D. E., and Easton, D. F. (2008) Multiple newly identified loci associated with prostate cancer susceptibility. Nat Genet 40, 316‐321

106. Lindstrom, S., Wiklund, F., Adami, H. O., Balter, K. A., Adolfsson, J., and Gronberg, H. (2006) Germ‐line genetic variation in the key androgen‐regulating genes androgen

138 receptor, cytochrome P450, and steroid‐5‐alpha‐reductase type 2 is important for prostate cancer development. Cancer research 66, 11077‐11083

107. Jones, B. A., Liu, W. L., Araujo, A. B., Kasl, S. V., Silvera, S. N., Soler‐Vila, H., Curnen, M. G., and Dubrow, R. (2008) Explaining the race difference in prostate cancer stage at diagnosis. Cancer Epidemiol Biomarkers Prev 17, 2825‐2834

108. Williams, H., and Powell, I. J. (2009) Epidemiology, pathology, and genetics of prostate cancer among African Americans compared with other ethnicities. Methods Mol Biol 472, 439‐453

109. Kelavkar, U. P., Hutzley, J., Dhir, R., Kim, P., Allen, K. G., and McHugh, K. (2006) Prostate tumor growth and recurrence can be modulated by the omega‐6:omega‐3 ratio in diet: athymic mouse xenograft model simulating radical prostatectomy. Neoplasia 8, 112‐124

110. Wolf, A. M., Wender, R. C., Etzioni, R. B., Thompson, I. M., D'Amico, A. V., Volk, R. J., Brooks, D. D., Dash, C., Guessous, I., Andrews, K., DeSantis, C., and Smith, R. A. (2010) American Cancer Society guideline for the early detection of prostate cancer: update 2010. CA: a cancer journal for clinicians 60, 70‐98

111. Chen, Z., Prestigiacomo, A., and Stamey, T. A. (1995) Purification and characterization of prostate‐specific antigen (PSA) complexed to alpha 1‐antichymotrypsin: potential reference material for international standardization of PSA immunoassays. Clinical chemistry 41, 1273‐1282

112. Crawford, E. D. (2003) Epidemiology of prostate cancer. Urology 62, 3‐12

113. Engen, J. R., Wales, T. E., Hochrein, J. M., Meyn, M. A., 3rd, Banu Ozkan, S., Bahar, I., and Smithgall, T. E. (2008) Structure and dynamic regulation of Src‐family kinases. Cell Mol Life Sci 65, 3058‐3073

114. D'Amico, A. V. (2003) Therapeutic strategies for localized and locally advanced prostate cancer: combining androgen suppression with definitive local therapy. Rev Urol 5 Suppl 6, S40‐46

115. Mahon, S. M. (2005) Screening for prostate cancer: informing men about their options. Clin J Oncol Nurs 9, 625‐627

116. Hakama, M., Coleman, M. P., Alexe, D. M., and Auvinen, A. (2008) Cancer screening: evidence and practice in Europe 2008. Eur J Cancer 44, 1404‐1413

139 117. Tabesh, A., Teverovskiy, M., Pang, H. Y., Kumar, V. P., Verbel, D., Kotsianti, A., and Saidi, O. (2007) Multifeature prostate cancer diagnosis and Gleason grading of histological images. IEEE Trans Med Imaging 26, 1366‐1378

118. Epstein, J. I. (2010) An update of the Gleason grading system. The Journal of urology 183, 433‐440

119. LaSpina, M., and Haas, G. P. (2008) Update on the diagnosis and management of prostate cancer. Can J Urol 15 Suppl 1, 3‐13; discussion 13

120. Cowherd, S. M. (2012) Tumor staging and grading: a primer. Methods Mol Biol 823, 1‐18

121. Danila, D. C., Fleisher, M., and Scher, H. I. (2011) Circulating tumor cells as biomarkers in prostate cancer. Clin Cancer Res 17, 3903‐3912

122. Pirtskhalaishvili, G., Hrebinko, R. L., and Nelson, J. B. (2001) The treatment of prostate cancer: an overview of current options. Cancer Pract 9, 295‐306

123. Bill‐Axelson, A., Holmberg, L., Ruutu, M., Haggman, M., Andersson, S. O., Bratell, S., Spangberg, A., Busch, C., Nordling, S., Garmo, H., Palmgren, J., Adami, H. O., Norlen, B. J., and Johansson, J. E. (2005) Radical prostatectomy versus watchful waiting in early prostate cancer. The New England journal of medicine 352, 1977‐1984

124. Morgan, V. A., Kyriazi, S., Ashley, S. E., and DeSouza, N. M. (2007) Evaluation of the potential of diffusion‐weighted imaging in prostate cancer detection. Acta Radiol 48, 695‐703

125. Morgan, P. B., Hanlon, A. L., Horwitz, E. M., Buyyounouski, M. K., Uzzo, R. G., and Pollack, A. (2007) Radiation dose and late failures in prostate cancer. Int J Radiat Oncol Biol Phys 67, 1074‐1081

126. Parker, C. (2004) Active surveillance of early prostate cancer: rationale, initial results and future developments. Prostate Cancer Prostatic Dis 7, 184‐187

127. Parker, C. (2004) Active surveillance: towards a new paradigm in the management of early prostate cancer. Lancet Oncol 5, 101‐106

128. Klotz, L., Zhang, L., Lam, A., Nam, R., Mamedov, A., and Loblaw, A. (2010) Clinical results of long‐term follow‐up of a large, active surveillance cohort with localized prostate cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 28, 126‐131

140 129. Klotz, L. (2009) Active surveillance for favorable risk prostate cancer. Pro. The Journal of urology 182, 2565‐2566

130. Bhatnagar, V., and Kaplan, R. M. (2005) Treatment options for prostate cancer: evaluating the evidence. Am Fam Physician 71, 1915‐1922

131. Guedea, F., Ramos, A., Herruzo, I., Sanchez Calzado, J. A., Contreras, J., Romero, J., Craven‐Bartle, J., Willisch, P., Lopez Torrecilla, J. L., Maldonado, X., Sancho, G., Zapatero, A., Ferrer, M., Pardo, Y., Fernandez, P., Marino, A., Hervas, A., Macis, V., Boladeras, A., Ferrer, F., and Davis, B. J. (2010) Treatment of localised prostate cancer with radiation therapy: evidence versus opinion. Clin Transl Oncol 12, 315‐317

132. Martin, T., Wenz, F., Bohmer, D., Sedlmayer, F., Hinkelbein, W., Henkel, T. O., Miller, K., and Wiegel, T. (2010) [Radiation therapy for prostate cancer in the new S3 guideline. Part 2: postoperative radiation therapy and brachytherapy]. Urologe A 49, 216‐220

133. Hammad, F. T. (2008) Radical prostatectomy. Ann N Y Acad Sci 1138, 267‐277

134. Rayala, H. J., and Richie, J. P. (2009) Radical prostatectomy reigns supreme. Oncology (Williston Park) 23, 863‐867

135. Fu, Q., Moul, J. W., and Sun, L. (2011) Contemporary radical prostatectomy. Prostate Cancer 2011, 645030

136. Stanford, J. L., Feng, Z., Hamilton, A. S., Gilliland, F. D., Stephenson, R. A., Eley, J. W., Albertsen, P. C., Harlan, L. C., and Potosky, A. L. (2000) Urinary and sexual function after radical prostatectomy for clinically localized prostate cancer: the Prostate Cancer Outcomes Study. JAMA 283, 354‐360

137. Pienta, K. J., and Bradley, D. (2006) Mechanisms underlying the development of androgen‐independent prostate cancer. Clin Cancer Res 12, 1665‐1671

138. Beltran, H., Beer, T. M., Carducci, M. A., de Bono, J., Gleave, M., Hussain, M., Kelly, W. K., Saad, F., Sternberg, C., Tagawa, S. T., and Tannock, I. F. (2011) New therapies for castration‐resistant prostate cancer: efficacy and safety. European urology 60, 279‐290

139. Dutt, S. S., and Gao, A. C. (2009) Molecular mechanisms of castration‐resistant prostate cancer progression. Future Oncol 5, 1403‐1413

140. Nadiminty, N., and Gao, A. C. (2011) Mechanisms of persistent activation of the androgen receptor in CRPC: recent advances and future perspectives. World journal of urology

141 141. Blumberg, J. M., Kwon, E. O., Cheetham, T. C., Niu, F., Shapiro, C. E., Pacificar, J., Loo, R. K., Williams, S. G., and Chien, G. W. (2011) Early development of castrate resistance varies with different dosing regimens of luteinizing hormone releasing hormone agonist in primary hormonal therapy for prostate cancer. Urology 77, 412‐416

142. Chen, Y., Clegg, N. J., and Scher, H. I. (2009) Anti‐androgens and androgen‐depleting therapies in prostate cancer: new agents for an established target. Lancet Oncol 10, 981‐ 991

143. Taplin, M. E., Manola, J., Oh, W. K., Kantoff, P. W., Bubley, G. J., Smith, M., Barb, D., Mantzoros, C., Gelmann, E. P., and Balk, S. P. (2008) A phase II study of mifepristone (RU‐486) in castration‐resistant prostate cancer, with a correlative assessment of androgen‐related hormones. BJU Int 101, 1084‐1089

144. Harris, W. P., Mostaghel, E. A., Nelson, P. S., and Montgomery, B. (2009) Androgen deprivation therapy: progress in understanding mechanisms of resistance and optimizing androgen depletion. Nat Clin Pract Urol 6, 76‐85

145. Scher, H. I., Beer, T. M., Higano, C. S., Anand, A., Taplin, M. E., Efstathiou, E., Rathkopf, D., Shelkey, J., Yu, E. Y., Alumkal, J., Hung, D., Hirmand, M., Seely, L., Morris, M. J., Danila, D. C., Humm, J., Larson, S., Fleisher, M., and Sawyers, C. L. (2010) Antitumour activity of MDV3100 in castration‐resistant prostate cancer: a phase 1‐2 study. Lancet 375, 1437‐1446

146. Aggarwal, R., and Ryan, C. J. (2011) Castration‐resistant prostate cancer: targeted therapies and individualized treatment. Oncologist 16, 264‐275

147. Higano, C. S., and Crawford, E. D. (2011) New and emerging agents for the treatment of castration‐resistant prostate cancer. Urol Oncol 29, 1‐8

148. Logothetis, C. J., Efstathiou, E., Manuguid, F., and Kirkpatrick, P. (2011) Abiraterone acetate. Nat Rev Drug Discov 10, 573‐574

149. (2011) Abiraterone acetate (Zytiga) for metastatic castration‐resistant prostate cancer. Med Lett Drugs Ther 53, 63‐64

150. Bianchini, D., Zivi, A., Sandhu, S., and de Bono, J. S. (2010) Horizon scanning for novel therapeutics for the treatment of prostate cancer. Expert Opin Investig Drugs 19, 1487‐ 1502

151. Tannock, I. F., de Wit, R., Berry, W. R., Horti, J., Pluzanska, A., Chi, K. N., Oudard, S., Theodore, C., James, N. D., Turesson, I., Rosenthal, M. A., and Eisenberger, M. A. (2004)

142 Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine 351, 1502‐1512

152. Petrylak, D. P., Tangen, C. M., Hussain, M. H., Lara, P. N., Jr., Jones, J. A., Taplin, M. E., Burch, P. A., Berry, D., Moinpour, C., Kohli, M., Benson, M. C., Small, E. J., Raghavan, D., and Crawford, E. D. (2004) Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. N Engl J Med 351, 1513‐1520

153. Antonarakis, E. S., and Armstrong, A. J. (2011) Evolving standards in the treatment of docetaxel‐refractory castration‐resistant prostate cancer. Prostate Cancer Prostatic Dis 14, 192‐205

154. de Bono, J. S., Oudard, S., Ozguroglu, M., Hansen, S., Machiels, J. P., Kocak, I., Gravis, G., Bodrogi, I., Mackenzie, M. J., Shen, L., Roessner, M., Gupta, S., and Sartor, A. O. (2010) Prednisone plus cabazitaxel or mitoxantrone for metastatic castration‐resistant prostate cancer progressing after docetaxel treatment: a randomised open‐label trial. Lancet 376, 1147‐1154

155. Wang, X., Yu, J., Sreekumar, A., Varambally, S., Shen, R., Giacherio, D., Mehra, R., Montie, J. E., Pienta, K. J., Sanda, M. G., Kantoff, P. W., Rubin, M. A., Wei, J. T., Ghosh, D., and Chinnaiyan, A. M. (2005) Autoantibody signatures in prostate cancer. The New England journal of medicine 353, 1224‐1235

156. Kantoff, P. W., Higano, C. S., Shore, N. D., Berger, E. R., Small, E. J., Penson, D. F., Redfern, C. H., Ferrari, A. C., Dreicer, R., Sims, R. B., Xu, Y., Frohlich, M. W., and Schellhammer, P. F. (2010) Sipuleucel‐T immunotherapy for castration‐resistant prostate cancer. N Engl J Med 363, 411‐422

157. Higano, C. S., Small, E. J., Schellhammer, P., Yasothan, U., Gubernick, S., Kirkpatrick, P., and Kantoff, P. W. (2010) Sipuleucel‐T. Nat Rev Drug Discov 9, 513‐514

158. Handratta, V. D., Vasaitis, T. S., Njar, V. C., Gediya, L. K., Kataria, R., Chopra, P., Newman, D., Jr., Farquhar, R., Guo, Z., Qiu, Y., and Brodie, A. M. (2005) Novel C‐17‐heteroaryl steroidal CYP17 inhibitors/antiandrogens: synthesis, in vitro biological activity, pharmacokinetics, and antitumor activity in the LAPC4 human prostate cancer xenograft model. J Med Chem 48, 2972‐2984

159. Saad, F., Hotte, S., North, S., Eigl, B., Chi, K., Czaykowski, P., Wood, L., Pollak, M., Berry, S., Lattouf, J. B., Mukherjee, S. D., Gleave, M., and Winquist, E. (2011) Randomized phase II trial of Custirsen (OGX‐011) in combination with docetaxel or mitoxantrone as second‐line therapy in patients with metastatic castrate‐resistant prostate cancer progressing after first‐line docetaxel: CUOG trial P‐06c. Clin Cancer Res 17, 5765‐5773

143 160. Lamoureux, F., Thomas, C., Yin, M. J., Kuruma, H., Beraldi, E., Fazli, L., Zoubeidi, A., and Gleave, M. E. (2011) Clusterin inhibition using OGX‐011 synergistically enhances Hsp90 inhibitor activity by suppressing the heat shock response in castrate‐resistant prostate cancer. Cancer research 71, 5838‐5849

161. Edwards, J. (2010) Src kinase inhibitors: an emerging therapeutic treatment option for prostate cancer. Expert Opin Investig Drugs 19, 605‐614

162. Scher, H. I., and Sawyers, C. L. (2005) Biology of progressive, castration‐resistant prostate cancer: directed therapies targeting the androgen‐receptor signaling axis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 23, 8253‐8261

163. Lamont, K. R., and Tindall, D. J. (2011) Minireview: Alternative activation pathways for the androgen receptor in prostate cancer. Mol Endocrinol 25, 897‐907

164. Mohler, J. L. (2008) Castration‐recurrent prostate cancer is not androgen‐independent. Adv Exp Med Biol 617, 223‐234

165. Lamont, K. R., and Tindall, D. J. (2010) Androgen regulation of gene expression. Adv Cancer Res 107, 137‐162

166. Debes, J. D., and Tindall, D. J. (2002) The role of androgens and the androgen receptor in prostate cancer. Cancer Lett 187, 1‐7

167. Arnold, J. T., and Isaacs, J. T. (2002) Mechanisms involved in the progression of androgen‐independent prostate cancers: it is not only the cancer cell's fault. Endocrine‐ related cancer 9, 61‐73

168. Dehm, S. M., and Tindall, D. J. (2005) Regulation of androgen receptor signaling in prostate cancer. Expert Rev Anticancer Ther 5, 63‐74

169. Guo, Z., Dai, B., Jiang, T., Xu, K., Xie, Y., Kim, O., Nesheiwat, I., Kong, X., Melamed, J., Handratta, V. D., Njar, V. C., Brodie, A. M., Yu, L. R., Veenstra, T. D., Chen, H., and Qiu, Y. (2006) Regulation of androgen receptor activity by tyrosine phosphorylation. Cancer Cell 10, 309‐319

170. Mahajan, N. P., Liu, Y., Majumder, S., Warren, M. R., Parker, C. E., Mohler, J. L., Earp, H. S., and Whang, Y. E. (2007) Activated Cdc42‐associated kinase Ack1 promotes prostate cancer progression via androgen receptor tyrosine phosphorylation. Proc Natl Acad Sci U S A 104, 8438‐8443

144 171. Grossmann, M. E., Huang, H., and Tindall, D. J. (2001) Androgen receptor signaling in androgen‐refractory prostate cancer. Journal of the National Cancer Institute 93, 1687‐ 1697

172. Gregory, C. W., Fei, X., Ponguta, L. A., He, B., Bill, H. M., French, F. S., and Wilson, E. M. (2004) Epidermal growth factor increases coactivation of the androgen receptor in recurrent prostate cancer. J Biol Chem 279, 7119‐7130

173. Attar, R. M., Takimoto, C. H., and Gottardis, M. M. (2009) Castration‐resistant prostate cancer: locking up the molecular escape routes. Clin Cancer Res 15, 3251‐3255

174. Molina, A., and Belldegrun, A. (2011) Novel therapeutic strategies for castration resistant prostate cancer: inhibition of persistent androgen production and androgen receptor mediated signaling. The Journal of urology 185, 787‐794

175. Mohler, J. L., Titus, M. A., Bai, S., Kennerley, B. J., Lih, F. B., Tomer, K. B., and Wilson, E. M. (2011) Activation of the androgen receptor by intratumoral bioconversion of androstanediol to dihydrotestosterone in prostate cancer. Cancer research 71, 1486‐ 1496

176. Montgomery, R. B., Mostaghel, E. A., Vessella, R., Hess, D. L., Kalhorn, T. F., Higano, C. S., True, L. D., and Nelson, P. S. (2008) Maintenance of intratumoral androgens in metastatic prostate cancer: a mechanism for castration‐resistant tumor growth. Cancer research 68, 4447‐4454

177. Locke, J. A., Guns, E. S., Lubik, A. A., Adomat, H. H., Hendy, S. C., Wood, C. A., Ettinger, S. L., Gleave, M. E., and Nelson, C. C. (2008) Androgen levels increase by intratumoral de novo steroidogenesis during progression of castration‐resistant prostate cancer. Cancer research 68, 6407‐6415

178. Dehm, S. M., and Tindall, D. J. (2011) Alternatively spliced androgen receptor variants. Endocrine‐related cancer 18, R183‐196

179. Ahrens‐Fath, I., Politz, O., Geserick, C., and Haendler, B. (2005) Androgen receptor function is modulated by the tissue‐specific AR45 variant. FEBS J 272, 74‐84

180. Guo, Z., and Qiu, Y. (2011) A new trick of an old molecule: androgen receptor splice variants taking the stage?! Int J Biol Sci 7, 815‐822

181. Watson, P. A., Chen, Y. F., Balbas, M. D., Wongvipat, J., Socci, N. D., Viale, A., Kim, K., and Sawyers, C. L. (2010) Constitutively active androgen receptor splice variants expressed in

145 castration‐resistant prostate cancer require full‐length androgen receptor. Proc Natl Acad Sci U S A 107, 16759‐16765

182. Shi, X. B., Ma, A. H., Tepper, C. G., Xia, L., Gregg, J. P., Gandour‐Edwards, R., Mack, P. C., Kung, H. J., and deVere White, R. W. (2004) Molecular alterations associated with LNCaP cell progression to androgen independence. The Prostate 60, 257‐271

183. Ellis, J. (1987) Proteins as molecular chaperones. Nature 328, 378‐379

184. Hartl, F. U., Bracher, A., and Hayer‐Hartl, M. (2011) Molecular chaperones in protein folding and proteostasis. Nature 475, 324‐332

185. Hartl, F. U., and Hayer‐Hartl, M. (2009) Converging concepts of protein folding in vitro and in vivo. Nat Struct Mol Biol 16, 574‐581

186. Hayes, S. A., and Dice, J. F. (1996) Roles of molecular chaperones in protein degradation. J Cell Biol 132, 255‐258

187. Evstigneeva, R. P., and Pal'keeva, M. E. (2000) [Methods of searching for antigenic determinants for proteins with known primary structure]. Bioorg Khim 26, 243‐262

188. So, A., Hadaschik, B., Sowery, R., and Gleave, M. (2007) The role of stress proteins in prostate cancer. Curr Genomics 8, 252‐261

189. Solimini, N. L., Luo, J., and Elledge, S. J. (2007) Non‐oncogene addiction and the stress phenotype of cancer cells. Cell 130, 986‐988

190. Luo, J., Solimini, N. L., and Elledge, S. J. (2009) Principles of cancer therapy: oncogene and non‐oncogene addiction. Cell 136, 823‐837

191. Dai, C., Whitesell, L., Rogers, A. B., and Lindquist, S. (2007) Heat shock factor 1 is a powerful multifaceted modifier of carcinogenesis. Cell 130, 1005‐1018

192. Bhattacharyya, J., Padmanabha Udupa, E. G., Wang, J., and Sharma, K. K. (2006) Mini‐ alphaB‐crystallin: a functional element of alphaB‐crystallin with chaperone‐like activity. Biochemistry 45, 3069‐3076

193. Sun, Y., and MacRae, T. H. (2005) Small heat shock proteins: molecular structure and chaperone function. Cell Mol Life Sci 62, 2460‐2476

194. Lindner, R. A., Carver, J. A., Ehrnsperger, M., Buchner, J., Esposito, G., Behlke, J., Lutsch, G., Kotlyarov, A., and Gaestel, M. (2000) Mouse Hsp25, a small shock protein. The role

146 of its C‐terminal extension in oligomerization and chaperone action. Eur J Biochem 267, 1923‐1932

195. Ciocca, D. R., and Calderwood, S. K. (2005) Heat shock proteins in cancer: diagnostic, prognostic, predictive, and treatment implications. Cell Stress Chaperones 10, 86‐103

196. Calderwood, S. K., Khaleque, M. A., Sawyer, D. B., and Ciocca, D. R. (2006) Heat shock proteins in cancer: chaperones of tumorigenesis. Trends Biochem Sci 31, 164‐172

197. Andrieu, C., Taieb, D., Baylot, V., Ettinger, S., Soubeyran, P., De‐Thonel, A., Nelson, C., Garrido, C., So, A., Fazli, L., Bladou, F., Gleave, M., Iovanna, J. L., and Rocchi, P. (2010) Heat shock protein 27 confers resistance to androgen ablation and chemotherapy in prostate cancer cells through eIF4E. Oncogene 29, 1883‐1896

198. Hadchity, E., Aloy, M. T., Paulin, C., Armandy, E., Watkin, E., Rousson, R., Gleave, M., Chapet, O., and Rodriguez‐Lafrasse, C. (2009) Heat shock protein 27 as a new therapeutic target for radiation sensitization of head and neck squamous cell carcinoma. Mol Ther 17, 1387‐1394

199. Cotto, J. J., and Morimoto, R. I. (1999) Stress‐induced activation of the heat‐shock response: cell and molecular biology of heat‐shock factors. Biochem Soc Symp 64, 105‐ 118

200. Lebret, T., Watson, R. W., Molinie, V., O'Neill, A., Gabriel, C., Fitzpatrick, J. M., and Botto, H. (2003) Heat shock proteins HSP27, HSP60, HSP70, and HSP90: expression in bladder carcinoma. Cancer 98, 970‐977

201. Lebret, T., Watson, R. W., and Fitzpatrick, J. M. (2003) Heat shock proteins: their role in urological tumors. The Journal of urology 169, 338‐346

202. Fulda, S., Gorman, A. M., Hori, O., and Samali, A. (2010) Cellular stress responses: cell survival and cell death. Int J Cell Biol 2010, 214074

203. Fulda, S. (2010) Evasion of apoptosis as a cellular stress response in cancer. Int J Cell Biol 2010, 370835

204. Ni, L., Yang, C. S., Gioeli, D., Frierson, H., Toft, D. O., and Paschal, B. M. (2010) FKBP51 promotes assembly of the Hsp90 chaperone complex and regulates androgen receptor signaling in prostate cancer cells. Mol Cell Biol 30, 1243‐1253

205. Tao, Y. J., and Zheng, W. (2011) Chaperones and the maturation of steroid hormone receptor complexes. Oncotarget 2, 104‐106

147 206. Prescott, J., and Coetzee, G. A. (2006) Molecular chaperones throughout the life cycle of the androgen receptor. Cancer Lett 231, 12‐19

207. Pratt, W. B., and Toft, D. O. (1997) Steroid receptor interactions with heat shock protein and immunophilin chaperones. Endocrine reviews 18, 306‐360

208. Terouanne, B., Paris, F., Servant, N., Georget, V., and Sultan, C. (2002) Evidence that chlormadinone acetate exhibits antiandrogenic activity in androgen‐dependent cell line. Mol Cell Endocrinol 198, 143‐147

209. Vanaja, D. K., Mitchell, S. H., Toft, D. O., and Young, C. Y. (2002) Effect of geldanamycin on androgen receptor function and stability. Cell Stress Chaperones 7, 55‐64

210. Suzuki, Y., Kondo, Y., Hara, S., Kimata, R., and Nishimura, T. (2010) Effect of the hsp90 inhibitor geldanamycin on androgen response of prostate cancer under hypoxic conditions. Int J Urol 17, 281‐285

211. Tan, S. S., Ahmad, I., Bennett, H. L., Singh, L., Nixon, C., Seywright, M., Barnetson, R. J., Edwards, J., and Leung, H. Y. (2010) GRP78 up‐regulation is associated with androgen receptor status, Hsp70‐Hsp90 client proteins and castrate‐resistant prostate cancer. J Pathol

212. De Leon, J. T., Iwai, A., Feau, C., Garcia, Y., Balsiger, H. A., Storer, C. L., Suro, R. M., Garza, K. M., Lee, S., Kim, Y. S., Chen, Y., Ning, Y. M., Riggs, D. L., Fletterick, R. J., Guy, R. K., Trepel, J. B., Neckers, L. M., and Cox, M. B. (2011) Targeting the regulation of androgen receptor signaling by the heat shock protein 90 cochaperone FKBP52 in prostate cancer cells. Proc Natl Acad Sci U S A 108, 11878‐11883

213. Hickey, E. D., and Weber, L. A. (1982) Modulation of heat‐shock polypeptide synthesis in HeLa cells during hyperthermia and recovery. Biochemistry 21, 1513‐1521

214. Mymrikov, E. V., Seit‐Nebi, A. S., and Gusev, N. B. (2011) Large potentials of small heat shock proteins. Physiol Rev 91, 1123‐1159

215. Huang, Q., Ye, J., Chen, W., Wang, L., Lin, W., Lin, J., and Lin, X. (2010) Heat shock protein 27 is over‐expressed in tumor tissues and increased in sera of patients with gastric adenocarcinoma. Clin Chem Lab Med 48, 263‐269

216. Zoubeidi, A., Zardan, A., Wiedmann, R. M., Locke, J., Beraldi, E., Fazli, L., and Gleave, M. E. (2010) Hsp27 promotes insulin‐like growth factor‐I survival signaling in prostate cancer via p90Rsk‐dependent phosphorylation and inactivation of BAD. Cancer research 70, 2307‐2317

148 217. McClaren, M., and Isseroff, R. R. (1994) Dynamic changes in intracellular localization and isoforms of the 27‐kD stress protein in human keratinocytes. J Invest Dermatol 102, 375‐ 381

218. Kostenko, S., and Moens, U. (2009) Heat shock protein 27 phosphorylation: kinases, phosphatases, functions and pathology. Cell Mol Life Sci 66, 3289‐3307

219. (2010) Drug Management for Prostate Cancer, Springer

220. Wu, R., Kausar, H., Johnson, P., Montoya‐Durango, D. E., Merchant, M., and Rane, M. J. (2007) Hsp27 regulates Akt activation and polymorphonuclear leukocyte apoptosis by scaffolding MK2 to Akt signal complex. J Biol Chem 282, 21598‐21608

221. Paul, C., Manero, F., Gonin, S., Kretz‐Remy, C., Virot, S., and Arrigo, A. P. (2002) Hsp27 as a negative regulator of cytochrome C release. Mol Cell Biol 22, 816‐834

222. Pandey, P., Farber, R., Nakazawa, A., Kumar, S., Bharti, A., Nalin, C., Weichselbaum, R., Kufe, D., and Kharbanda, S. (2000) Hsp27 functions as a negative regulator of cytochrome c‐dependent activation of procaspase‐3. Oncogene 19, 1975‐1981

223. Zhang, Y., and Shen, X. (2007) Heat shock protein 27 protects L929 cells from cisplatin‐ induced apoptosis by enhancing Akt activation and abating suppression of thioredoxin reductase activity. Clin Cancer Res 13, 2855‐2864

224. Taba, K., Kuramitsu, Y., Ryozawa, S., Yoshida, K., Tanaka, T., Maehara, S., Maehara, Y., Sakaida, I., and Nakamura, K. (2010) Heat‐shock protein 27 is phosphorylated in gemcitabine‐resistant pancreatic cancer cells. Anticancer Res 30, 2539‐2543

225. Zhu, Z., Xu, X., Yu, Y., Graham, M., Prince, M. E., Carey, T. E., and Sun, D. (2010) Silencing heat shock protein 27 decreases metastatic behavior of human head and neck squamous cell cancer cells in vitro. Mol Pharm 7, 1283‐1290

226. Rocchi, P., So, A., Kojima, S., Signaevsky, M., Beraldi, E., Fazli, L., Hurtado‐Coll, A., Yamanaka, K., and Gleave, M. (2004) Heat shock protein 27 increases after androgen ablation and plays a cytoprotective role in hormone‐refractory prostate cancer. Cancer research 64, 6595‐6602

227. Garrido, C., Fromentin, A., Bonnotte, B., Favre, N., Moutet, M., Arrigo, A. P., Mehlen, P., and Solary, E. (1998) Heat shock protein 27 enhances the tumorigenicity of immunogenic rat colon carcinoma cell clones. Cancer research 58, 5495‐5499

149 228. Kamada, M., So, A., Muramaki, M., Rocchi, P., Beraldi, E., and Gleave, M. (2007) Hsp27 knockdown using nucleotide‐based therapies inhibit tumor growth and enhance chemotherapy in human bladder cancer cells. Mol Cancer Ther 6, 299‐308

229. Rocchi, P., Beraldi, E., Ettinger, S., Fazli, L., Vessella, R. L., Nelson, C., and Gleave, M. (2005) Increased Hsp27 after androgen ablation facilitates androgen‐independent progression in prostate cancer via signal transducers and activators of transcription 3‐ mediated suppression of apoptosis. Cancer research 65, 11083‐11093

230. Millward, T., Cron, P., and Hemmings, B. A. (1995) Molecular cloning and characterization of a conserved nuclear serine(threonine) protein kinase. Proc Natl Acad Sci U S A 92, 5022‐5026

231. Witters, L. A. (1990) Protein phosphorylation and dephosphorylation. Curr Opin Cell Biol 2, 212‐220

232. Brognard, J., and Hunter, T. (2011) Protein kinase signaling networks in cancer. Curr Opin Genet Dev 21, 4‐11

233. Ventura, J. J., and Nebreda, A. R. (2006) Protein kinases and phosphatases as therapeutic targets in cancer. Clin Transl Oncol 8, 153‐160

234. Zhang, J., Yang, P. L., and Gray, N. S. (2009) Targeting cancer with small molecule kinase inhibitors. Nat Rev Cancer 9, 28‐39

235. Sourvinos, G., Tsatsanis, C., and Spandidos, D. A. (2000) Mechanisms of retrovirus‐ induced oncogenesis. Folia Biol (Praha) 46, 226‐232

236. Martin, G. S. (2004) The road to Src. Oncogene 23, 7910‐7917

237. Kolch, W., Kotwaliwale, A., Vass, K., and Janosch, P. (2002) The role of Raf kinases in malignant transformation. Expert Rev Mol Med 4, 1‐18

238. Tsatsanis, C., and Spandidos, D. A. (2004) Oncogenic kinase signaling in human neoplasms. Ann N Y Acad Sci 1028, 168‐175

239. Hunter, T. (2009) Tyrosine phosphorylation: thirty years and counting. Curr Opin Cell Biol 21, 140‐146

240. Manning, G., Whyte, D. B., Martinez, R., Hunter, T., and Sudarsanam, S. (2002) The protein kinase complement of the human genome. Science 298, 1912‐1934

150 241. Kung, H. J. (2011) Targeting tyrosine kinases and autophagy in prostate cancer. Horm Cancer 2, 38‐46

242. Chang, Y. M., Kung, H. J., and Evans, C. P. (2007) Nonreceptor tyrosine kinases in prostate cancer. Neoplasia 9, 90‐100

243. Damon, S. E., Plymate, S. R., Carroll, J. M., Sprenger, C. C., Dechsukhum, C., Ware, J. L., and Roberts, C. T., Jr. (2001) Transcriptional regulation of insulin‐like growth factor‐I receptor gene expression in prostate cancer cells. Endocrinology 142, 21‐27

244. Ozen, M., Giri, D., Ropiquet, F., Mansukhani, A., and Ittmann, M. (2001) Role of fibroblast growth factor receptor signaling in prostate cancer cell survival. Journal of the National Cancer Institute 93, 1783‐1790

245. Ricciardelli, C., Jackson, M. W., Choong, C. S., Stahl, J., Marshall, V. R., Horsfall, D. J., and Tilley, W. D. (2008) Elevated levels of HER‐2/neu and androgen receptor in clinically localized prostate cancer identifies metastatic potential. The Prostate 68, 830‐838

246. Wen, Y., Hu, M. C., Makino, K., Spohn, B., Bartholomeusz, G., Yan, D. H., and Hung, M. C. (2000) HER‐2/neu promotes androgen‐independent survival and growth of prostate cancer cells through the Akt pathway. Cancer research 60, 6841‐6845

247. Marelli, M. M., Moretti, R. M., Procacci, P., Motta, M., and Limonta, P. (2006) Insulin‐like growth factor‐I promotes migration in human androgen‐independent prostate cancer cells via the alphavbeta3 integrin and PI3‐K/Akt signaling. Int J Oncol 28, 723‐730

248. Culig, Z., Hobisch, A., Cronauer, M. V., Radmayr, C., Trapman, J., Hittmair, A., Bartsch, G., and Klocker, H. (1994) Androgen receptor activation in prostatic tumor cell lines by insulin‐like growth factor‐I, keratinocyte growth factor, and epidermal growth factor. Cancer research 54, 5474‐5478

249. Fan, S., Meng, Q., Laterra, J. J., and Rosen, E. M. (2009) Role of Src signal transduction pathways in scatter factor‐mediated cellular protection. J Biol Chem 284, 7561‐7577

250. Saito, Y. D., Jensen, A. R., Salgia, R., and Posadas, E. M. (2010) Fyn: a novel molecular target in cancer. Cancer 116, 1629‐1637

251. Goldenberg‐Furmanov, M., Stein, I., Pikarsky, E., Rubin, H., Kasem, S., Wygoda, M., Weinstein, I., Reuveni, H., and Ben‐Sasson, S. A. (2004) Lyn is a target gene for prostate cancer: sequence‐based inhibition induces regression of human tumor xenografts. Cancer research 64, 1058‐1066

151 252. Slack‐Davis, J. K., Hershey, E. D., Theodorescu, D., Frierson, H. F., and Parsons, J. T. (2009) Differential requirement for focal adhesion kinase signaling in cancer progression in the transgenic adenocarcinoma of mouse prostate model. Mol Cancer Ther 8, 2470‐ 2477

253. Qiu, Y., and Kung, H. J. (2000) Signaling network of the Btk family kinases. Oncogene 19, 5651‐5661

254. Yamanashi, Y., Fukushige, S., Semba, K., Sukegawa, J., Miyajima, N., Matsubara, K., Yamamoto, T., and Toyoshima, K. (1987) The yes‐related cellular gene lyn encodes a possible tyrosine kinase similar to p56lck. Mol Cell Biol 7, 237‐243

255. Parsons, S. J., and Parsons, J. T. (2004) Src family kinases, key regulators of signal transduction. Oncogene 23, 7906‐7909

256. Kinoshita, T., Miyano, N., Nakai, R., Yokota, K., Ishiguro, H., and Tada, T. (2008) Protein purification and preliminary crystallographic analysis of human Lyn tyrosine kinase. Protein Expr Purif 58, 318‐324

257. Moarefi, I., LaFevre‐Bernt, M., Sicheri, F., Huse, M., Lee, C. H., Kuriyan, J., and Miller, W. T. (1997) Activation of the Src‐family tyrosine kinase Hck by SH3 domain displacement. Nature 385, 650‐653

258. Sicheri, F., Moarefi, I., and Kuriyan, J. (1997) Crystal structure of the Src family tyrosine kinase Hck. Nature 385, 602‐609

259. Williams, J. C., Weijland, A., Gonfloni, S., Thompson, A., Courtneidge, S. A., Superti‐ Furga, G., and Wierenga, R. K. (1997) The 2.35 A crystal structure of the inactivated form of chicken Src: a dynamic molecule with multiple regulatory interactions. J Mol Biol 274, 757‐775

260. Trentin, L., Frasson, M., Donella‐Deana, A., Frezzato, F., Pagano, M. A., Tibaldi, E., Gattazzo, C., Zambello, R., Semenzato, G., and Brunati, A. M. (2008) Geldanamycin‐ induced Lyn dissociation from aberrant Hsp90‐stabilized cytosolic complex is an early event in apoptotic mechanisms in B‐chronic lymphocytic leukemia. Blood 112, 4665‐ 4674

261. Hibbs, M. L., and Dunn, A. R. (1997) Lyn, a src‐like tyrosine kinase. Int J Biochem Cell Biol 29, 397‐400

152 262. Suzuki, T., Shoji, S., Yamamoto, K., Nada, S., Okada, M., Yamamoto, T., and Honda, Z. (1998) Essential roles of Lyn in fibronectin‐mediated filamentous actin assembly and cell motility in mast cells. J Immunol 161, 3694‐3701

263. Simon, H. U., Yousefi, S., Dibbert, B., Hebestreit, H., Weber, M., Branch, D. R., Blaser, K., Levi‐Schaffer, F., and Anderson, G. P. (1998) Role for tyrosine phosphorylation and Lyn tyrosine kinase in fas receptor‐mediated apoptosis in eosinophils. Blood 92, 547‐557

264. Iqbal, M. S., Tsuyama, N., Obata, M., and Ishikawa, H. (2010) A novel signaling pathway associated with Lyn, PI 3‐kinase and Akt supports the proliferation of myeloma cells. Biochemical and biophysical research communications 392, 415‐420

265. Choi, Y. L., Bocanegra, M., Kwon, M. J., Shin, Y. K., Nam, S. J., Yang, J. H., Kao, J., Godwin, A. K., and Pollack, J. R. (2010) LYN is a mediator of epithelial‐mesenchymal transition and a target of dasatinib in breast cancer. Cancer research 70, 2296‐2306

266. Tatarov, O., Mitchell, T. J., Seywright, M., Leung, H. Y., Brunton, V. G., and Edwards, J. (2009) SRC family kinase activity is up‐regulated in hormone‐refractory prostate cancer. Clin Cancer Res 15, 3540‐3549

267. Park, S. I., Zhang, J., Phillips, K. A., Araujo, J. C., Najjar, A. M., Volgin, A. Y., Gelovani, J. G., Kim, S. J., Wang, Z., and Gallick, G. E. (2008) Targeting SRC family kinases inhibits growth and lymph node metastases of prostate cancer in an orthotopic nude mouse model. Cancer research 68, 3323‐3333

268. Sen, B., and Johnson, F. M. (2011) Regulation of SRC family kinases in human cancers. J Signal Transduct 2011, 865819

269. Dunlap, D. Y., Ikeda, I., Nagashima, H., Vogel, C. F., and Matsumura, F. (2002) Effects of src‐deficiency on the expression of in vivo toxicity of TCDD in a strain of c‐src knockout mice procured through six generations of backcrossings to C57BL/6 mice. Toxicology 172, 125‐141

270. Beavitt, S. J., Harder, K. W., Kemp, J. M., Jones, J., Quilici, C., Casagranda, F., Lam, E., Turner, D., Brennan, S., Sly, P. D., Tarlinton, D. M., Anderson, G. P., and Hibbs, M. L. (2005) Lyn‐deficient mice develop severe, persistent asthma: Lyn is a critical negative regulator of Th2 immunity. J Immunol 175, 1867‐1875

271. Peehl, D. M. (2005) Primary cell cultures as models of prostate cancer development. Endocrine‐related cancer 12, 19‐47

153 272. Horoszewicz, J. S., Leong, S. S., Kawinski, E., Karr, J. P., Rosenthal, H., Chu, T. M., Mirand, E. A., and Murphy, G. P. (1983) LNCaP model of human prostatic carcinoma. Cancer research 43, 1809‐1818

273. Veldscholte, J., Berrevoets, C. A., Brinkmann, A. O., Grootegoed, J. A., and Mulder, E. (1992) Anti‐androgens and the mutated androgen receptor of LNCaP cells: differential effects on binding affinity, heat‐shock protein interaction, and transcription activation. Biochemistry 31, 2393‐2399

274. Veldscholte, J., Berrevoets, C. A., Ris‐Stalpers, C., Kuiper, G. G., Jenster, G., Trapman, J., Brinkmann, A. O., and Mulder, E. (1992) The androgen receptor in LNCaP cells contains a mutation in the ligand binding domain which affects steroid binding characteristics and response to antiandrogens. J Steroid Biochem Mol Biol 41, 665‐669

275. Thalmann, G. N., Anezinis, P. E., Chang, S. M., Zhau, H. E., Kim, E. E., Hopwood, V. L., Pathak, S., von Eschenbach, A. C., and Chung, L. W. (1994) Androgen‐independent cancer progression and bone metastasis in the LNCaP model of human prostate cancer. Cancer research 54, 2577‐2581

276. Kaighn, M. E., Narayan, K. S., Ohnuki, Y., Lechner, J. F., and Jones, L. W. (1979) Establishment and characterization of a human prostatic carcinoma cell line (PC‐3). Invest Urol 17, 16‐23

277. Stone, K. R., Mickey, D. D., Wunderli, H., Mickey, G. H., and Paulson, D. F. (1978) Isolation of a human prostate carcinoma cell line (DU 145). Int J Cancer 21, 274‐281

278. Dagvadorj, A., Tan, S. H., Liao, Z., Cavalli, L. R., Haddad, B. R., and Nevalainen, M. T. (2008) Androgen‐regulated and highly tumorigenic human prostate cancer cell line established from a transplantable primary CWR22 tumor. Clin Cancer Res 14, 6062‐6072

279. Tam, C. W., and Shiu, S. Y. (2011) Functional interplay between melatonin receptor‐ mediated antiproliferative signaling and androgen receptor signaling in human prostate epithelial cells: potential implications for therapeutic strategies against prostate cancer. J Pineal Res 51, 297‐312

280. Ruizeveld de Winter, J. A., Janssen, P. J., Sleddens, H. M., Verleun‐Mooijman, M. C., Trapman, J., Brinkmann, A. O., Santerse, A. B., Schroder, F. H., and van der Kwast, T. H. (1994) Androgen receptor status in localized and locally progressive hormone refractory human prostate cancer. Am J Pathol 144, 735‐746

154 281. Sadi, M. V., and Barrack, E. R. (1991) Androgen receptors and growth fraction in metastatic prostate cancer as predictors of time to tumour progression after hormonal therapy. Cancer Surv 11, 195‐215

282. Henshall, S. M., Quinn, D. I., Lee, C. S., Head, D. R., Golovsky, D., Brenner, P. C., Delprado, W., Stricker, P. D., Grygiel, J. J., and Sutherland, R. L. (2001) Altered expression of androgen receptor in the malignant epithelium and adjacent stroma is associated with early relapse in prostate cancer. Cancer research 61, 423‐427

283. Chen, C. D., Welsbie, D. S., Tran, C., Baek, S. H., Chen, R., Vessella, R., Rosenfeld, M. G., and Sawyers, C. L. (2004) Molecular determinants of resistance to antiandrogen therapy. Nature medicine 10, 33‐39

284. Taplin, M. E. (2007) Drug insight: role of the androgen receptor in the development and progression of prostate cancer. Nature clinical practice. Oncology 4, 236‐244

285. Keller, E. T. (2011) Role of Raf Kinase Inhibitor Protein in Pathophysiology of Prostate Cancer. For Immunopathol Dis Therap 2, 89‐94

286. Kutikov, A., Makhov, P., Golovine, K., Canter, D. J., Sirohi, M., Street, R., Simhan, J., Uzzo, R. G., and Kolenko, V. M. (2011) Interleukin‐6: a potential biomarker of resistance to multitargeted receptor tyrosine kinase inhibitors in castration‐resistant prostate cancer. Urology 78, 968 e967‐911

287. Liu, X., Yan, Z., Huang, L., Guo, M., Zhang, Z., and Guo, C. (2011) Cell surface heat shock protein 90 modulates prostate cancer cell adhesion and invasion through the integrin‐ beta1/focal adhesion kinase/c‐Src signaling pathway. Oncol Rep 25, 1343‐1351

288. Thorburn, A., and Debnath, J. (2011) Targeting chaperone‐mediated autophagy in cancer. Sci Transl Med 3, 109ps145

289. Lamoureux, F., Thomas, C., Yin, M. J., Kuruma, H., Fazli, L., Gleave, M. E., and Zoubeidi, A. (2011) A novel HSP90 inhibitor delays castrate‐resistant prostate cancer without altering serum PSA levels and inhibits osteoclastogenesis. Clin Cancer Res 17, 2301‐2313

290. Shiota, M., Zoubeidi, A., Kumano, M., Beraldi, E., Naito, S., Nelson, C. C., Sorensen, P. H., and Gleave, M. E. (2011) Clusterin Is a Critical Downstream Mediator of Stress‐Induced YB‐1 Transactivation in Prostate Cancer. Mol Cancer Res

291. Zoubeidi, A., Chi, K., and Gleave, M. (2010) Targeting the cytoprotective chaperone, clusterin, for treatment of advanced cancer. Clin Cancer Res 16, 1088‐1093

155 292. July, L. V., Akbari, M., Zellweger, T., Jones, E. C., Goldenberg, S. L., and Gleave, M. E. (2002) Clusterin expression is significantly enhanced in prostate cancer cells following androgen withdrawal therapy. The Prostate 50, 179‐188

293. Rennie, P. S., Bruchovsky, N., Leco, K. J., Sheppard, P. C., McQueen, S. A., Cheng, H., Snoek, R., Hamel, A., Bock, M. E., MacDonald, B. S., and et al. (1993) Characterization of two cis‐acting DNA elements involved in the androgen regulation of the probasin gene. Mol Endocrinol 7, 23‐36

294. Sun, M., Yang, L., Feldman, R. I., Sun, X. M., Bhalla, K. N., Jove, R., Nicosia, S. V., and Cheng, J. Q. (2003) Activation of phosphatidylinositol 3‐kinase/Akt pathway by androgen through interaction of p85alpha, androgen receptor, and Src. J Biol Chem 278, 42992‐ 43000

295. Kousteni, S., Bellido, T., Plotkin, L. I., O'Brien, C. A., Bodenner, D. L., Han, L., Han, K., DiGregorio, G. B., Katzenellenbogen, J. A., Katzenellenbogen, B. S., Roberson, P. K., Weinstein, R. S., Jilka, R. L., and Manolagas, S. C. (2001) Nongenotropic, sex‐nonspecific signaling through the estrogen or androgen receptors: dissociation from transcriptional activity. Cell 104, 719‐730

296. Migliaccio, A., Castoria, G., Di Domenico, M., de Falco, A., Bilancio, A., Lombardi, M., Barone, M. V., Ametrano, D., Zannini, M. S., Abbondanza, C., and Auricchio, F. (2000) Steroid‐induced androgen receptor‐oestradiol receptor beta‐Src complex triggers prostate cancer cell proliferation. EMBO J 19, 5406‐5417

297. Yeh, S., Lin, H. K., Kang, H. Y., Thin, T. H., Lin, M. F., and Chang, C. (1999) From HER2/Neu signal cascade to androgen receptor and its coactivators: a novel pathway by induction of androgen target genes through MAP kinase in prostate cancer cells. Proc Natl Acad Sci U S A 96, 5458‐5463

298. Haynes, M. P., Sinha, D., Russell, K. S., Collinge, M., Fulton, D., Morales‐Ruiz, M., Sessa, W. C., and Bender, J. R. (2000) Membrane estrogen receptor engagement activates endothelial nitric oxide synthase via the PI3‐kinase‐Akt pathway in human endothelial cells. Circ Res 87, 677‐682

299. Zhang, Z., Kumar, R., Santen, R. J., and Song, R. X. (2004) The role of adapter protein Shc in estrogen non‐genomic action. Steroids 69, 523‐529

300. Baron, S., Manin, M., Beaudoin, C., Leotoing, L., Communal, Y., Veyssiere, G., and Morel, L. (2004) Androgen receptor mediates non‐genomic activation of phosphatidylinositol 3‐ OH kinase in androgen‐sensitive epithelial cells. J Biol Chem 279, 14579‐14586

156 301. Edwards, J., and Bartlett, J. M. (2005) The androgen receptor and signal‐transduction pathways in hormone‐refractory prostate cancer. Part 2: Androgen‐receptor cofactors and bypass pathways. BJU Int 95, 1327‐1335

302. Yamanaka, K., Gleave, M., Muramaki, M., Hara, I., and Miyake, H. (2005) Enhanced radiosensitivity by inhibition of the anti‐apoptotic gene clusterin using antisense oligodeoxynucleotide in a human bladder cancer model. Oncol Rep 13, 885‐890

303. Cheung‐Flynn, J., Prapapanich, V., Cox, M. B., Riggs, D. L., Suarez‐Quian, C., and Smith, D. F. (2005) Physiological role for the cochaperone FKBP52 in androgen receptor signaling. Mol Endocrinol 19, 1654‐1666

304. Yang, Z., Wolf, I. M., Chen, H., Periyasamy, S., Chen, Z., Yong, W., Shi, S., Zhao, W., Xu, J., Srivastava, A., Sanchez, E. R., and Shou, W. (2006) FK506‐binding protein 52 is essential to uterine reproductive physiology controlled by the progesterone receptor A isoform. Mol Endocrinol 20, 2682‐2694

305. Miller, H., Poon, S., Hibbert, B., Rayner, K., Chen, Y. X., and O'Brien, E. R. (2005) Modulation of estrogen signaling by the novel interaction of heat shock protein 27, a biomarker for atherosclerosis, and estrogen receptor beta: mechanistic insight into the vascular effects of estrogens. Arterioscler Thromb Vasc Biol 25, e10‐14

306. Concannon, C. G., Orrenius, S., and Samali, A. (2001) Hsp27 inhibits cytochrome c‐ mediated caspase activation by sequestering both pro‐caspase‐3 and cytochrome c. Gene Expr 9, 195‐201

307. Parcellier, A., Schmitt, E., Gurbuxani, S., Seigneurin‐Berny, D., Pance, A., Chantome, A., Plenchette, S., Khochbin, S., Solary, E., and Garrido, C. (2003) HSP27 is a ubiquitin‐ binding protein involved in I‐kappaBalpha proteasomal degradation. Mol Cell Biol 23, 5790‐5802

308. Chauhan, D., Li, G., Podar, K., Hideshima, T., Shringarpure, R., Catley, L., Mitsiades, C., Munshi, N., Tai, Y. T., Suh, N., Gribble, G. W., Honda, T., Schlossman, R., Richardson, P., Sporn, M. B., and Anderson, K. C. (2004) The bortezomib/proteasome inhibitor PS‐341 and triterpenoid CDDO‐Im induce synergistic anti‐multiple myeloma (MM) activity and overcome bortezomib resistance. Blood 103, 3158‐3166

309. Mendelsohn, M. E., Zhu, Y., and O'Neill, S. (1991) The 29‐kDa proteins phosphorylated in thrombin‐activated human platelets are forms of the estrogen receptor‐related 27‐kDa heat shock protein. Proc Natl Acad Sci U S A 88, 11212‐11216

157 310. Barr, C. S., and Dokas, L. A. (1999) Glucocorticoids regulate the synthesis of HSP27 in rat brain slices. Brain Res 847, 9‐17

311. Gleave, M. E., Hsieh, J. T., Wu, H. C., von Eschenbach, A. C., and Chung, L. W. (1992) Serum prostate specific antigen levels in mice bearing human prostate LNCaP tumors are determined by tumor volume and endocrine and growth factors. Cancer research 52, 1598‐1605

312. Sadar, M. D., and Gleave, M. E. (2000) Ligand‐independent activation of the androgen receptor by the differentiation agent butyrate in human prostate cancer cells. Cancer research 60, 5825‐5831

313. Shang, Y., Myers, M., and Brown, M. (2002) Formation of the androgen receptor transcription complex. Mol Cell 9, 601‐610

314. Rehemtulla, A., Stegman, L. D., Cardozo, S. J., Gupta, S., Hall, D. E., Contag, C. H., and Ross, B. D. (2000) Rapid and quantitative assessment of cancer treatment response using in vivo bioluminescence imaging. Neoplasia 2, 491‐495

315. Berchem, G. J., Bosseler, M., Sugars, L. Y., Voeller, H. J., Zeitlin, S., and Gelmann, E. P. (1995) Androgens induce resistance to bcl‐2‐mediated apoptosis in LNCaP prostate cancer cells. Cancer Res 55, 735‐738

316. Carson, J. P., Kulik, G., and Weber, M. J. (1999) Antiapoptotic signaling in LNCaP prostate cancer cells: a survival signaling pathway independent of phosphatidylinositol 3'‐kinase and Akt/protein kinase B. Cancer Res 59, 1449‐1453

317. Rane, M. J., Pan, Y., Singh, S., Powell, D. W., Wu, R., Cummins, T., Chen, Q., McLeish, K. R., and Klein, J. B. (2003) Heat shock protein 27 controls apoptosis by regulating Akt activation. J Biol Chem 278, 27828‐27835

318. Rane, M. J., Coxon, P. Y., Powell, D. W., Webster, R., Klein, J. B., Pierce, W., Ping, P., and McLeish, K. R. (2001) p38 Kinase‐dependent MAPKAPK‐2 activation functions as 3‐ phosphoinositide‐dependent kinase‐2 for Akt in human neutrophils. J Biol Chem 276, 3517‐3523

319. Wafa, L. A., Cheng, H., Rao, M. A., Nelson, C. C., Cox, M., Hirst, M., Sadowski, I., and Rennie, P. S. (2003) Isolation and identification of L‐dopa decarboxylase as a protein that binds to and enhances transcriptional activity of the androgen receptor using the repressed transactivator yeast two‐hybrid system. Biochem J 375, 373‐383

158 320. Solit, D. B., Scher, H. I., and Rosen, N. (2003) Hsp90 as a therapeutic target in prostate cancer. Semin Oncol 30, 709‐716

321. Cha, T. L., Qiu, L., Chen, C. T., Wen, Y., and Hung, M. C. (2005) Emodin down‐regulates androgen receptor and inhibits prostate cancer cell growth. Cancer Res 65, 2287‐2295

322. Gaughan, L., Logan, I. R., Neal, D. E., and Robson, C. N. (2005) Regulation of androgen receptor and histone deacetylase 1 by Mdm2‐mediated ubiquitylation. Nucleic Acids Res 33, 13‐26

323. Haslbeck, M., and Buchner, J. (2002) Chaperone function of sHsps. Prog Mol Subcell Biol 28, 37‐59

324. Schneider, G. B., Hamano, H., and Cooper, L. F. (1998) In vivo evaluation of hsp27 as an inhibitor of actin polymerization: hsp27 limits actin stress fiber and focal adhesion formation after heat shock. J Cell Physiol 177, 575‐584

325. Cornford, P. A., Dodson, A. R., Parsons, K. F., Desmond, A. D., Woolfenden, A., Fordham, M., Neoptolemos, J. P., Ke, Y., and Foster, C. S. (2000) Heat shock protein expression independently predicts clinical outcome in prostate cancer. Cancer research 60, 7099‐ 7105

326. Whelan, R. D., and Hill, B. T. (1993) Differential expression of steroid receptors, hsp27, and pS2 in a series of drug resistant human breast tumor cell lines derived following exposure to antitumor drugs or to fractionated X‐irradiation. Breast Cancer Res Treat 26, 23‐39

327. Richards, I. M., Kolbasa, K. P., Hatfield, C. A., Winterrowd, G. E., Vonderfecht, S. L., Fidler, S. F., Griffin, R. L., Brashler, J. R., Krzesicki, R. F., Sly, L. M., Ready, K. A., Staite, N. D., and Chin, J. E. (1996) Role of very late activation antigen‐4 in the antigen‐induced accumulation of eosinophils and lymphocytes in the lungs and airway lumen of sensitized brown Norway rats. Am J Respir Cell Mol Biol 15, 172‐183

328. Meier, M., King, G. L., Clermont, A., Perez, A., Hayashi, M., and Feener, E. P. (2001) Angiotensin AT(1) receptor stimulates heat shock protein 27 phosphorylation in vitro and in vivo. Hypertension 38, 1260‐1265

329. Belka, C., Ahlers, A., Sott, C., Gaestel, M., Herrmann, F., and Brach, M. A. (1995) Interleukin (IL)‐6 signaling leads to phosphorylation of the small heat shock protein (Hsp)27 through activation of the MAP kinase and MAPKAP kinase 2 pathway in monocytes and monocytic leukemia cells. Leukemia 9, 288‐294

159 330. Song, H., Ethier, S. P., Dziubinski, M. L., and Lin, J. (2004) Stat3 modulates heat shock 27kDa protein expression in breast epithelial cells. Biochem Biophys Res Commun 314, 143‐150

331. Jia, Y., Ransom, R. F., Shibanuma, M., Liu, C., Welsh, M. J., and Smoyer, W. E. (2001) Identification and characterization of hic‐5/ARA55 as an hsp27 binding protein. J Biol Chem 276, 39911‐39918

332. Frigo, D. E., Basu, A., Nierth‐Simpson, E. N., Weldon, C. B., Dugan, C. M., Elliott, S., Collins‐Burow, B. M., Salvo, V. A., Zhu, Y., Melnik, L. I., Lopez, G. N., Kushner, P. J., Curiel, T. J., Rowan, B. G., McLachlan, J. A., and Burow, M. E. (2006) p38 mitogen‐activated protein kinase stimulates estrogen‐mediated transcription and proliferation through the phosphorylation and potentiation of the p160 coactivator glucocorticoid receptor‐ interacting protein 1. Mol Endocrinol 20, 971‐983

333. Whitesell, L., Mimnaugh, E. G., De Costa, B., Myers, C. E., and Neckers, L. M. (1994) Inhibition of heat shock protein HSP90‐pp60v‐src heteroprotein complex formation by benzoquinone ansamycins: essential role for stress proteins in oncogenic transformation. Proc Natl Acad Sci U S A 91, 8324‐8328

334. Neckers, L., Schulte, T. W., and Mimnaugh, E. (1999) Geldanamycin as a potential anti‐ cancer agent: its molecular target and biochemical activity. Invest New Drugs 17, 361‐ 373

335. Winklhofer, K. F., Reintjes, A., Hoener, M. C., Voellmy, R., and Tatzelt, J. (2001) Geldanamycin restores a defective heat shock response in vivo. J Biol Chem 276, 45160‐ 45167

336. Gleave, M. E., Goldenberg, S. L., Chin, J. L., Warner, J., Saad, F., Klotz, L. H., Jewett, M., Kassabian, V., Chetner, M., Dupont, C., and Van Rensselaer, S. (2001) Randomized comparative study of 3 versus 8‐month neoadjuvant hormonal therapy before radical prostatectomy: biochemical and pathological effects. J Urol 166, 500‐506; discussion 506‐507

337. Bruchovsky, N., Klotz, L. H., Sadar, M., Crook, J. M., Hoffart, D., Godwin, L., Warkentin, M., Gleave, M. E., and Goldenberg, S. L. (2000) Intermittent androgen suppression for prostate cancer: Canadian Prospective Trial and related observations. Mol Urol 4, 191‐ 199;discussion 201

338. Goldenberg, S. L., Gleave, M. E., Taylor, D., and Bruchovsky, N. (1999) Clinical Experience with Intermittent Androgen Suppression in Prostate Cancer: Minimum of 3 Years' Follow‐Up. Mol Urol 3, 287‐292

160 339. Goldenberg, S. L., Bruchovsky, N., Gleave, M. E., and Sullivan, L. D. (1996) Low‐dose cyproterone acetate plus mini‐dose diethylstilbestrol‐‐a protocol for reversible medical castration. Urology 47, 882‐884

340. Gleave, M., Goldenberg, S. L., Bruchovsky, N., and Rennie, P. (1998) Intermittent androgen suppression for prostate cancer: rationale and clinical experience. Prostate Cancer Prostatic Dis 1, 289‐296

341. Bruchovsky, N., Sadar, M. D., Akakura, K., Goldenberg, S. L., Matsuoka, K., and Rennie, P. S. (1996) Characterization of 5alpha‐reductase gene expression in stroma and epithelium of human prostate. J Steroid Biochem Mol Biol 59, 397‐404

342. Mahajan, K., Challa, S., Coppola, D., Lawrence, H., Luo, Y., Gevariya, H., Zhu, W., Chen, Y. A., Lawrence, N. J., and Mahajan, N. P. Effect of Ack1 tyrosine kinase inhibitor on ligand‐ independent androgen receptor activity. Prostate 70, 1274‐1285

343. Thomas, S. M., and Brugge, J. S. (1997) Cellular functions regulated by Src family kinases. Annu Rev Cell Dev Biol 13, 513‐609

344. Summy, J. M., and Gallick, G. E. (2003) Src family kinases in tumor progression and metastasis. Cancer Metastasis Rev 22, 337‐358

345. Osterhout, D. J., Wolven, A., Wolf, R. M., Resh, M. D., and Chao, M. V. (1999) Morphological differentiation of oligodendrocytes requires activation of Fyn tyrosine kinase. J Cell Biol 145, 1209‐1218

346. Moreau, K. L., Donato, A. J., Tanaka, H., Jones, P. P., Gates, P. E., and Seals, D. R. (2003) Basal leg blood flow in healthy women is related to age and hormone replacement therapy status. J Physiol 547, 309‐316

347. Veracini, L., Franco, M., Boureux, A., Simon, V., Roche, S., and Benistant, C. (2006) Two distinct pools of Src family tyrosine kinases regulate PDGF‐induced DNA synthesis and actin dorsal ruffles. J Cell Sci 119, 2921‐2934

348. Soriano, P., Montgomery, C., Geske, R., and Bradley, A. (1991) Targeted disruption of the c‐src proto‐oncogene leads to osteopetrosis in mice. Cell 64, 693‐702

349. Donato, N. J., Wu, J. Y., Stapley, J., Gallick, G., Lin, H., Arlinghaus, R., and Talpaz, M. (2003) BCR‐ABL independence and LYN kinase overexpression in chronic myelogenous leukemia cells selected for resistance to STI571. Blood 101, 690‐698

161 350. Kasahara, K., Nakayama, Y., Ikeda, K., Fukushima, Y., Matsuda, D., Horimoto, S., and Yamaguchi, N. (2004) Trafficking of Lyn through the Golgi caveolin involves the charged residues on alphaE and alphaI helices in the kinase domain. J Cell Biol 165, 641‐652

351. McCarty, M. F. (2004) Targeting multiple signaling pathways as a strategy for managing prostate cancer: multifocal signal modulation therapy. Integr Cancer Ther 3, 349‐380

352. Nam, S., Kim, D., Cheng, J. Q., Zhang, S., Lee, J. H., Buettner, R., Mirosevich, J., Lee, F. Y., and Jove, R. (2005) Action of the Src family kinase inhibitor, dasatinib (BMS‐354825), on human prostate cancer cells. Cancer research 65, 9185‐9189

353. Recchia, I., Rucci, N., Festuccia, C., Bologna, M., MacKay, A. R., Migliaccio, S., Longo, M., Susa, M., Fabbro, D., and Teti, A. (2003) Pyrrolopyrimidine c‐Src inhibitors reduce growth, adhesion, motility and invasion of prostate cancer cells in vitro. Eur J Cancer 39, 1927‐1935

354. Lee, L. F., Guan, J., Qiu, Y., and Kung, H. J. (2001) Neuropeptide‐induced androgen independence in prostate cancer cells: roles of nonreceptor tyrosine kinases Etk/Bmx, Src, and focal adhesion kinase. Mol Cell Biol 21, 8385‐8397

355. Cai, H., Smith, D. A., Memarzadeh, S., Lowell, C. A., Cooper, J. A., and Witte, O. N. Differential transformation capacity of Src family kinases during the initiation of prostate cancer. Proc Natl Acad Sci U S A 108, 6579‐6584

356. Chen, J., Hwang, D. J., Bohl, C. E., Miller, D. D., and Dalton, J. T. (2005) A selective androgen receptor modulator for hormonal male contraception. J Pharmacol Exp Ther 312, 546‐553

357. Notini, A. J., Davey, R. A., McManus, J. F., Bate, K. L., and Zajac, J. D. (2005) Genomic actions of the androgen receptor are required for normal male sexual differentiation in a mouse model. J Mol Endocrinol 35, 547‐555

358. Edwards, J., and Bartlett, J. M. (2005) The androgen receptor and signal‐transduction pathways in hormone‐refractory prostate cancer. Part 1: Modifications to the androgen receptor. BJU Int 95, 1320‐1326

359. Pratt, W. B., Morishima, Y., and Osawa, Y. (2008) The Hsp90 chaperone machinery regulates signaling by modulating ligand binding clefts. J Biol Chem 283, 22885‐22889

360. Craft, N., Shostak, Y., Carey, M., and Sawyers, C. L. (1999) A mechanism for hormone‐ independent prostate cancer through modulation of androgen receptor signaling by the HER‐2/neu tyrosine kinase. Nat Med 5, 280‐285

162 361. Yeh, S., Chang, H. C., Miyamoto, H., Takatera, H., Rahman, M., Kang, H. Y., Thin, T. H., Lin, H. K., and Chang, C. (1999) Differential induction of the androgen receptor transcriptional activity by selective androgen receptor coactivators. Keio J Med 48, 87‐92

362. Nazareth, L. V., and Weigel, N. L. (1996) Activation of the human androgen receptor through a protein kinase A signaling pathway. J Biol Chem 271, 19900‐19907

363. Ikonen, T., Palvimo, J. J., Kallio, P. J., Reinikainen, P., and Janne, O. A. (1994) Stimulation of androgen‐regulated transactivation by modulators of protein phosphorylation. Endocrinology 135, 1359‐1366

364. Sadar, M. D. (1999) Androgen‐independent induction of prostate‐specific antigen gene expression via cross‐talk between the androgen receptor and protein kinase A signal transduction pathways. J Biol Chem 274, 7777‐7783

365. Grasso, A. W., Wen, D., Miller, C. M., Rhim, J. S., Pretlow, T. G., and Kung, H. J. (1997) ErbB kinases and NDF signaling in human prostate cancer cells. Oncogene 15, 2705‐2716

366. Qiu, Y., Robinson, D., Pretlow, T. G., and Kung, H. J. (1998) Etk/Bmx, a tyrosine kinase with a pleckstrin‐homology domain, is an effector of phosphatidylinositol 3'‐kinase and is involved in interleukin 6‐induced neuroendocrine differentiation of prostate cancer cells. Proc Natl Acad Sci U S A 95, 3644‐3649

367. Liu, Y., Karaca, M., Zhang, Z., Gioeli, D., Earp, H. S., and Whang, Y. E. Dasatinib inhibits site‐specific tyrosine phosphorylation of androgen receptor by Ack1 and Src kinases. Oncogene 29, 3208‐3216

368. Weigel, N. L., and Moore, N. L. (2007) Steroid receptor phosphorylation: a key modulator of multiple receptor functions. Mol Endocrinol 21, 2311‐2319

369. Liu, Y., Karaca, M., Zhang, Z., Gioeli, D., Earp, H. S., and Whang, Y. E. (2010) Dasatinib inhibits site‐specific tyrosine phosphorylation of androgen receptor by Ack1 and Src kinases. Oncogene 29, 3208‐3216

370. Schuurmans, A. L., Bolt, J., and Mulder, E. (1988) Androgens and transforming growth factor beta modulate the growth response to epidermal growth factor in human prostatic tumor cells (LNCaP). Mol Cell Endocrinol 60, 101‐104

371. Story, M. T., Hopp, K. A., and Molter, M. (1996) Expression of transforming growth factor beta 1 (TGF beta 1), ‐beta 2, and‐ beta 3 by cultured human prostate cells. J Cell Physiol 169, 97‐107

163 372. Story, M. T., Hopp, K. A., and Meier, D. A. (1996) Regulation of basic fibroblast growth factor expression by transforming growth factor beta in cultured human prostate stromal cells. The Prostate 28, 219‐226

373. McKeehan, W. L. (1991) Growth factor receptors and prostate cell growth. Cancer Surv 11, 165‐175

374. Roberts, A. B., and Sporn, M. B. (1985) Transforming growth factors. Cancer Surv 4, 683‐ 705

375. Kim, I. Y., Ahn, H. J., Zelner, D. J., Shaw, J. W., Sensibar, J. A., Kim, J. H., Kato, M., and Lee, C. (1996) Genetic change in transforming growth factor beta (TGF‐beta) receptor type I gene correlates with insensitivity to TGF‐beta 1 in human prostate cancer cells. Cancer research 56, 44‐48

376. Sherwood, E. R., Fong, C. J., Lee, C., and Kozlowski, J. M. (1992) Basic fibroblast growth factor: a potential mediator of stromal growth in the human prostate. Endocrinology 130, 2955‐2963

377. Cunha, G. R., and Donjacour, A. A. (1989) Mesenchymal‐epithelial interactions in the growth and development of the prostate. Cancer Treat Res 46, 159‐175

378. Byrne, R. L., Leung, H., and Neal, D. E. (1996) Peptide growth factors in the prostate as mediators of stromal epithelial interaction. Br J Urol 77, 627‐633

379. Bonaccorsi, L., Carloni, V., Muratori, M., Formigli, L., Zecchi, S., Forti, G., and Baldi, E. (2004) EGF receptor (EGFR) signaling promoting invasion is disrupted in androgen‐ sensitive prostate cancer cells by an interaction between EGFR and androgen receptor (AR). Int J Cancer 112, 78‐86

380. Zhu, M. L., and Kyprianou, N. (2008) Androgen receptor and growth factor signaling cross‐talk in prostate cancer cells. Endocrine‐related cancer 15, 841‐849

381. Sherwood, E. R., Van Dongen, J. L., Wood, C. G., Liao, S., Kozlowski, J. M., and Lee, C. (1998) Epidermal growth factor receptor activation in androgen‐independent but not androgen‐stimulated growth of human prostatic carcinoma cells. Br J Cancer 77, 855‐ 861

382. Leotoing, L., Manin, M., Monte, D., Baron, S., Communal, Y., Lours, C., Veyssiere, G., Morel, L., and Beaudoin, C. (2007) Crosstalk between androgen receptor and epidermal growth factor receptor‐signalling pathways: a molecular switch for epithelial cell differentiation. J Mol Endocrinol 39, 151‐162

164 383. Stein, P. L., Lee, H. M., Rich, S., and Soriano, P. (1992) pp59fyn mutant mice display differential signaling in thymocytes and peripheral T cells. Cell 70, 741‐750

384. Chan, V. W., Meng, F., Soriano, P., DeFranco, A. L., and Lowell, C. A. (1997) Characterization of the B lymphocyte populations in Lyn‐deficient mice and the role of Lyn in signal initiation and down‐regulation. Immunity 7, 69‐81

385. El Sheikh, S. S., Domin, J., Abel, P., Stamp, G., and Lalani el, N. (2004) Phosphorylation of both EGFR and ErbB2 is a reliable predictor of prostate cancer cell proliferation in response to EGF. Neoplasia 6, 846‐853

386. Ghosh, P. M., Malik, S. N., Bedolla, R. G., Wang, Y., Mikhailova, M., Prihoda, T. J., Troyer, D. A., and Kreisberg, J. I. (2005) Signal transduction pathways in androgen‐dependent and ‐independent prostate cancer cell proliferation. Endocrine‐related cancer 12, 119‐ 134

387. Shigemura, K., Isotani, S., Wang, R., Fujisawa, M., Gotoh, A., Marshall, F. F., Zhau, H. E., and Chung, L. W. (2009) Soluble factors derived from stroma activated androgen receptor phosphorylation in human prostate LNCaP cells: roles of ERK/MAP kinase. The Prostate 69, 949‐955

388. Blaszczyk, N., Masri, B. A., Mawji, N. R., Ueda, T., McAlinden, G., Duncan, C. P., Bruchovsky, N., Schweikert, H. U., Schnabel, D., Jones, E. C., and Sadar, M. D. (2004) Osteoblast‐derived factors induce androgen‐independent proliferation and expression of prostate‐specific antigen in human prostate cancer cells. Clin Cancer Res 10, 1860‐ 1869

389. Quayle, S. N., Mawji, N. R., Wang, J., and Sadar, M. D. (2007) Androgen receptor decoy molecules block the growth of prostate cancer. Proc Natl Acad Sci U S A 104, 1331‐1336

390. Aleshin, A., and Finn, R. S. (2010) SRC: a century of science brought to the clinic. Neoplasia 12, 599‐607

391. Griffin, J. E. (1992) Androgen resistance‐‐the clinical and molecular spectrum. The New England journal of medicine 326, 611‐618

392. Caskey, C. T., Pizzuti, A., Fu, Y. H., Fenwick, R. G., Jr., and Nelson, D. L. (1992) Triplet repeat mutations in human disease. Science 256, 784‐789

393. Iacovelli, R., Palazzo, A., Procopio, G., Gazzaniga, P., and Cortesi, E. (2011) Abiraterone acetate in castration‐resistant prostate cancer. Anticancer Drugs

165 394. Payton, S. (2010) Prostate cancer: MDV3100 has antitumor activity in castration‐ resistant disease. Nat Rev Urol 7, 300

395. Yang, L. P. (2011) Abiraterone Acetate: In Metastatic Castration‐Resistant Prostate Cancer. Drugs

396. Seruga, B., Ocana, A., and Tannock, I. F. (2011) Drug resistance in metastatic castration‐ resistant prostate cancer. Nat Rev Clin Oncol 8, 12‐23

397. Sartor, A. O. (2011) Progression of metastatic castrate‐resistant prostate cancer: impact of therapeutic intervention in the post‐docetaxel space. J Hematol Oncol 4, 18

398. Ryan, C. J., Shah, S., Efstathiou, E., Smith, M. R., Taplin, M. E., Bubley, G. J., Logothetis, C. J., Kheoh, T., Kilian, C., Haqq, C. M., Molina, A., and Small, E. J. (2011) Phase II study of abiraterone acetate in chemotherapy‐naive metastatic castration‐resistant prostate cancer displaying bone flare discordant with serologic response. Clin Cancer Res 17, 4854‐4861

399. Chen, H., Yong, W., Hinds, T. D., Jr., Yang, Z., Zhou, Y., Sanchez, E. R., and Shou, W. (2010) Fkbp52 regulates androgen receptor transactivation activity and male urethra morphogenesis. J Biol Chem 285, 27776‐27784

400. Fang, Y., Fliss, A. E., Robins, D. M., and Caplan, A. J. (1996) Hsp90 regulates androgen receptor hormone binding affinity in vivo. J Biol Chem 271, 28697‐28702

401. Whitesell, L., and Lindquist, S. L. (2005) HSP90 and the chaperoning of cancer. Nat Rev Cancer 5, 761‐772

402. Solit, D. B., Zheng, F. F., Drobnjak, M., Munster, P. N., Higgins, B., Verbel, D., Heller, G., Tong, W., Cordon‐Cardo, C., Agus, D. B., Scher, H. I., and Rosen, N. (2002) 17‐Allylamino‐ 17‐demethoxygeldanamycin induces the degradation of androgen receptor and HER‐ 2/neu and inhibits the growth of prostate cancer xenografts. Clin Cancer Res 8, 986‐993

403. Chiosis, G., Huezo, H., Rosen, N., Mimnaugh, E., Whitesell, L., and Neckers, L. (2003) 17AAG: low target binding affinity and potent cell activity‐‐finding an explanation. Mol Cancer Ther 2, 123‐129

404. Heath, E. I., Hillman, D. W., Vaishampayan, U., Sheng, S., Sarkar, F., Harper, F., Gaskins, M., Pitot, H. C., Tan, W., Ivy, S. P., Pili, R., Carducci, M. A., Erlichman, C., and Liu, G. (2008) A phase II trial of 17‐allylamino‐17‐demethoxygeldanamycin in patients with hormone‐refractory metastatic prostate cancer. Clin Cancer Res 14, 7940‐7946

166 405. Yano, A., Tsutsumi, S., Soga, S., Lee, M. J., Trepel, J., Osada, H., and Neckers, L. (2008) Inhibition of Hsp90 activates osteoclast c‐Src signaling and promotes growth of prostate carcinoma cells in bone. Proc Natl Acad Sci U S A 105, 15541‐15546

406. Ding, W. X., Ni, H. M., Gao, W., Yoshimori, T., Stolz, D. B., Ron, D., and Yin, X. M. (2007) Linking of autophagy to ubiquitin‐proteasome system is important for the regulation of endoplasmic reticulum stress and cell viability. Am J Pathol 171, 513‐524

407. Ding, W. X., and Yin, X. M. (2008) Sorting, recognition and activation of the misfolded protein degradation pathways through macroautophagy and the proteasome. Autophagy 4, 141‐150

408. Verfaillie, T., Salazar, M., Velasco, G., and Agostinis, P. (2010) Linking ER Stress to Autophagy: Potential Implications for Cancer Therapy. Int J Cell Biol 2010, 930509

409. Ogata, M., Hino, S., Saito, A., Morikawa, K., Kondo, S., Kanemoto, S., Murakami, T., Taniguchi, M., Tanii, I., Yoshinaga, K., Shiosaka, S., Hammarback, J. A., Urano, F., and Imaizumi, K. (2006) Autophagy is activated for cell survival after endoplasmic reticulum stress. Mol Cell Biol 26, 9220‐9231

410. Janku, F., McConkey, D. J., Hong, D. S., and Kurzrock, R. (2011) Autophagy as a target for anticancer therapy. Nat Rev Clin Oncol 8, 528‐539

411. Martin, G. S. (2001) The hunting of the Src. Nat Rev Mol Cell Biol 2, 467‐475

412. Irby, R. B., and Yeatman, T. J. (2000) Role of Src expression and activation in human cancer. Oncogene 19, 5636‐5642

413. Gioeli, D., Ficarro, S. B., Kwiek, J. J., Aaronson, D., Hancock, M., Catling, A. D., White, F. M., Christian, R. E., Settlage, R. E., Shabanowitz, J., Hunt, D. F., and Weber, M. J. (2002) Androgen receptor phosphorylation. Regulation and identification of the phosphorylation sites. J Biol Chem 277, 29304‐29314

414. Kraus, S., Gioeli, D., Vomastek, T., Gordon, V., and Weber, M. J. (2006) Receptor for activated C kinase 1 (RACK1) and Src regulate the tyrosine phosphorylation and function of the androgen receptor. Cancer research 66, 11047‐11054

415. Gioeli, D., Black, B. E., Gordon, V., Spencer, A., Kesler, C. T., Eblen, S. T., Paschal, B. M., and Weber, M. J. (2006) Stress kinase signaling regulates androgen receptor phosphorylation, transcription, and localization. Mol Endocrinol 20, 503‐515

167 416. Ponguta, L. A., Gregory, C. W., French, F. S., and Wilson, E. M. (2008) Site‐specific androgen receptor serine phosphorylation linked to epidermal growth factor‐dependent growth of castration‐recurrent prostate cancer. J Biol Chem 283, 20989‐21001

417. Gioeli, D., and Paschal, B. M. (2011) Post‐translational modification of the androgen receptor. Mol Cell Endocrinol

418. Landry, J., Lambert, H., Zhou, M., Lavoie, J. N., Hickey, E., Weber, L. A., and Anderson, C. W. (1992) Human HSP27 is phosphorylated at serines 78 and 82 by heat shock and mitogen‐activated kinases that recognize the same amino acid motif as S6 kinase II. J Biol Chem 267, 794‐803

419. Rouse, J., Cohen, P., Trigon, S., Morange, M., Alonso‐Llamazares, A., Zamanillo, D., Hunt, T., and Nebreda, A. R. (1994) A novel kinase cascade triggered by stress and heat shock that stimulates MAPKAP kinase‐2 and phosphorylation of the small heat shock proteins. Cell 78, 1027‐1037

420. Wei, L., Liu, T. T., Wang, H. H., Hong, H. M., Yu, A. L., Feng, H. P., and Chang, W. W. (2011) Hsp27 participates in the maintenance of breast cancer stem cells through regulation of epithelial‐mesenchymal transition and nuclear factor‐kappa B. Breast Cancer Res 13, R101

421. Vidyasagar, A., Reese, S., Acun, Z., Hullett, D., and Djamali, A. (2008) HSP27 is involved in the pathogenesis of kidney tubulointerstitial fibrosis. Am J Physiol Renal Physiol 295, F707‐716

422. Zhang, D., Wong, L. L., and Koay, E. S. (2007) Phosphorylation of Ser78 of Hsp27 correlated with HER‐2/neu status and lymph node positivity in breast cancer. Mol Cancer 6, 52

423. Di, K., Wong, Y. C., and Wang, X. (2007) Id‐1 promotes TGF‐beta1‐induced cell motility through HSP27 activation and disassembly of adherens junction in prostate epithelial cells. Exp Cell Res 313, 3983‐3999

424. Guan, H., Zhou, Z., Gallick, G. E., Jia, S. F., Morales, J., Sood, A. K., Corey, S. J., and Kleinerman, E. S. (2008) Targeting Lyn inhibits tumor growth and metastasis in Ewing's sarcoma. Mol Cancer Ther 7, 1807‐1816

168 Appendix 1: Androgen Prevents Apoptosis Induced by Paclitaxel

A B

Figure A.1. Androgen prevents apoptosis induced by paclitaxel. A and B: LNCaP cells were pretreated with 10 nM R1881 or CSS for 48 h for 48 h prior to treatment with 25 nM of paclitaxel or vehicle. Cell growth rates (A) were determined by MTS assay and compared with control (day of treatment defined as 100%). The fraction of cells in sub G0, G0‐G1, S, G2‐M phases was determined by Propidium iodide staining (B) after 48 h paclitaxel treatment.

169 Appendix 2: AR Interacts with Hsp27 via the N‐terminal and Ligand‐Binding Domains

Figure A.2. AR interacts with Hsp27 via the N‐terminal and Ligand‐Binding domains. Left panel illustrates schema of AR deletion constructs of AR, which were expressed in bacteria and purified using GST column for pull down assays using total LNCaP cell extracts and western blot using Hsp27.

170 Appendix 3: Validation of Pb‐Luc Functionality in vitro and in cellulo

A B

C D

171 Figure A.3. Validation of Pb‐Luc functionality in vitro and in cellulo. Cloning: The probasin promoter (‐426/+28) was subcloned into pXP2 (Promega) using HindIII and BamHI restriction enzymes. LNCaP were cotransfected pXP2‐Pb‐Luciferase in combination with pSV2neo for cell selection. Stable clonal LNCaP expressing Pb‐Luc were selected using 500 µg of G418. Positive clones were tested for their capacity to express luciferase activity and to respond to R1881 in vitro. A: Effect of R1881 on Pb‐Luc in cellulo. LNCaP‐Pb‐Luc cells were treated with different concentrations of R1881 for 16 h. Bioluminescence imaging was performed IVIS system and 150 µg/ml of luciferin as a substrate. B: Effect of R1881 on Pb‐Luc in vitro. LNCaP‐Pb‐Luc treated with different concentrations of R1881 for 16 h. LNCaP‐Pb‐Luc were lysed in lysis buffer (Promega) and the luciferase activity was measured using luminometer. C: Effect of OGX‐427 on Probasin luciferase activity in cellulo. LNCaP‐Pb‐Luc cells were transfected with 70 nM of OGX 427 or MM. 24 h after transfection; cells were submitted to 16 h R1881 treatment. Bioluminescence imaging was performed IVIS system and 150 µg/ml of luciferin as a substrate. D: Effect of OGX‐427 on Probasin‐luciferase activity in vitro. LNCaP‐Pb‐Luc cells were transfected with 70 nM of OGX 427 or MM. 24 h after transfection; cells were submitted to 16 h R1881 treatment. LNCaP‐Pb‐Luc cells were lysed in lysis buffer (Promega) and the luciferase activity was measured using luminometer.

172 Appendix 4: OGX‐427 Suppresses Probasin Luciferase (Pb‐Luc)

A B

Figure A.4. OGX‐427 suppresses Probasin luciferase (Pb‐Luc). Intact male mice received a subcutaneous injection of 1x106 LNCaP‐Pb‐Luc cells and treated with 20 mg/Kg of OGX‐427 or MM for 7 days when PSA reached 25 ng/ml. A: Circulating serum PSA from mice treated with MM was measured by IMX immunoassay before (day 0) during (day 4) and after (day 8) the treatment, the PSA value was normalize to day 0. The figure showed the PSA level from different mice after MM treatment. B: Circulating serum PSA from mice treated with OGX‐427 was measured by IMX immunoassay before (day 0) during (day 4) and after (day 8) the treatment, the PSA value was normalize to day 0. The figure showed the PSA level from different mice after OGX‐427 treatment.

173 Appendix 5: Effect of OGX‐427 on AR, Hsp27 and Hsp90 Levels in LNCaP Xenografts

Figure A.5. Effect of OGX‐427 on AR, Hsp27 and Hsp90 levels in LNCaP xenografts. Mice were sacrificed on day 8 and tumour tissues were fixed in paraformaldehyde for immunohistochemistry. Hematoxylin and Eosin stained slides from 15 LNCaP xenografts were marked for areas of interest avoiding necrotic foci in donor paraffin blocks. A TMA was constructed creating a quadruplet TMA layout and ordered by group of treatment (one tumour of control, 6 tumours of MM control and 8 tumours of OGX‐427 treated mice, with a total of 60 cores. Sections cut from TMA were processed for antigen retrieval as previously described (312), and stained with antibodies against AR (N‐20), Hsp90 (Santa Cruz), Hsp‐27 (Novo Castra), Ki67 (Dako Mississauga, Ont, Canada).

174 Appendix 6: Expression of Hsp27 Modulates UPR

175 C

176 Figure A.6. Expression of Hsp27 modulates UPR. A: Treatment with 5 µM MG132 (inhibition of proteasome activity) induces UPR. Expression of Hsp27 and UPR related proteins was measured by western blot analysis. B: PC3 cells were transfected with 10 nM of Hsp27 siRNA or scrambled siRNA control twice and protein expression of Hsp27 and UPR related proteins was measured by western blot analysis. C: PC3 cells were transfected with 50 nM of OGX‐427 or MM control twice and protein expression of Hsp27 and UPR related proteins was measured by western blot analysis. D: protein expression of Hsp27 and UPR related proteins was measured by western blot analysis in PC3 cells stably overexpressing Hsp27, compared to the Empty vector overexpressing cells after treatment with indicated amounts of MG132. (Material and methods were followed as indicated in chapter 2).

177 Appendix 7: Role of Hsp27 Expression on Accumulation of Ubiquitinated Proteins

178

Figure A.7. Effect of Hsp27 knockdown on accumulation of ubiquitinated proteins. A: PC3 cells were transfected with 10 nM of Hsp27 siRNA or scrambled siRNA control twice and accumulation of ubiquitinated proteins was analyzed by western blot analysis using Ubiquitin antibody. B: PC3 cells were transfected with 25 nM of OGX‐427 or MM control twice and accumulation of ubiquitinated proteins was analyzed by western blot analysis using Ubiquitin antibody. C: Accumulation of ubiquitinated proteins was analyzed in PC3 cells overexpressing Hsp27 and compared with Empty vector overexpressing cells, after incubation with indicated concentrations of MG132. (Material and methods were followed as indicated in chapter 2).

179 Appendix 8: Hsp27 Knockdown Induces Autophagy in PC3 Cells

Figure A.8. Hsp27 knockdown induces autophagy in PC3 cells. PC3 cells were transfected with 25 nM of OGX‐427 or MM control twice and protein expression level of Hsp27 and LC3 protein was analyzed by western blot analysis. B: PC3 cells were transfected with 10 nM of Hsp27 siRNA or scrambled siRNA control twice and protein expression level of Hsp27 and LC3 protein was analyzed by western blot analysis. (Material and methods were followed as indicated in chapter 2).

180