INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA - INPA PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA, CONSERVAÇÃO E BIOLOGIA EVOLUTIVA
Filogenia da subfamília Todirostrinae (Aves, Rhynchocyclidae) e biogeografia dos complexos Lophotriccus e Oncostoma
Glauco Kohler
Manaus, Amazonas Março, 2017 GLAUCO KOHLER
Filogenia da subfamília Todirostrinae (Aves, Rhynchocyclidae) e biogeografia dos complexos Lophotriccus e Oncostoma
Orientadora: Dra. Camila Cherem Ribas Coorientador: Dr. Mario Cohn-Haft
Tese apresentada ao Instituto Nacional de Pesquisas da Amazônia como parte dos requisitos para obtenção do título de Doutor em Genética, Conservação e Biologia Evolutiva
Manaus, Amazonas Março, 2017 III IV
Sinopse:
Foram inferidas as relações filogenéticas dentro da subfamília Todirostrinae, a fim de conhecer suas relações evolutivas e a biogegrafia de dois gêneros.
Palavras chave: relações filogenéticas, filogeografia, neotrópico, taxonomia. V
AGRADECIMENTOS
A minha família, por todo o apoio emocional ainda que a distância. Aos amigos Marcelo e Renata, por me darem a oportunidade de estar em Manaus durante os primeiros meses da minha chegada. Aos meus orientadores, Camila Ribas e Mario Cohn-Haft, pela confiança depositada, ensinamentos, puxões de orelha e por dar todo o suporte necessário para a execução deste trabalho. A minha orientadora Camila Ribas, por me dar a oportunidade da realização de trabalhos de campo na Amazônia e por todos os valiosos ensinamentos no campo da biogeografia e filogenética. Ao Instituto Nacional de Pesquisas da Amazônia e ao PPG-GCBev pela suporte físico para realização deste trabalho e ao CNPq pela concessão da bolsa. A Alexandre Aleixo (MPEG), Cristina Myiaki (LGEMA), Luís Fábio Silveira (USP), Anderson Vieira Chaves (UFMG), Robb T. Brumfield (LSU), Chris Witt (MSB), Ben Marks (FMNH), Jorge Perez (MBUCV), Jon Fjeldsa (ZMUC) e Mark Robbins (KU) por gentilmente fornecerem material para a execução deste trabalho. Aos grandes profissionais da ornitologia que me incentivaram a aprofundar neste fascinante mundo de pesquisa, dos quais destaco Carlos Zimmerman, Rudi Laps, Marcos Bornschein e Carlos Borchardt. Aos parceiros de campo de tempos de graduação, Evair Legal e Tiago João Cadorin, cuja parceria engrandeceu meus conhecimentos na área de ornitologia. Aos colegas de orientação e laboratório do INPA, Mateus Ferreira, Romina Batista, Roberta Canton, Maysa Mattos, Elisama Bezerra e Giselle Moura, pelas aulas de laboratório e diversas dúvidas esclarecidas. Aos amigos Érico Polo e Erik Choueri pela parceria em campo e laboratório. Ao Érico Polo, meu coorientador de assuntos bioinformáticos e filogenéticos, por todas as ajudas e pela valiosa amizade e parceria. Por fim a minha namorada Andressa, por todo o apoio, compreensão e carinho nos momentos mais difíceis. VI
SUMÁRIO
RESUMO...... XIV
ABSTRACT ...... XV
INTRODUÇÃO GERAL ...... 1
CAPÍTULO 1 ...... 9
1. Abstract ...... 10
2. Introdução ...... 11
3. Material e métodos ...... 12
3.1 Amostragem e marcadores moleculares ...... 12 3.2 Extração de DNA, amplificação e sequenciamento...... 13 3.3 Análises filogenéticas ...... 13 3.4 Species tree e datação molecular...... 14
4. Resultados ...... 14
4.1 Análises filogenéticas ...... 14 4.2 Species tree e datação molecular...... 17
5.Discussão ...... 17
5.1 Relações filogenéticas e sistemática da Tribo Hemitriccini...... 18 5.2 Tribo Hemitriccini ...... 21 5.3 Relações filogenéticas e sistemática da Tribo Todirostrini...... 26 5.4 Tribo Todirostrini ...... 27 5.5 Diversificação e biogeografia de Todirostrinae...... 29
6.Conclusão ...... 31
7.Agradecimentos ...... 31
8.Referências ...... 32
9. Figuras ...... 40
10. Material Suplementar ...... 47
CAPÍTULO 2 ...... 58 VII
11. Abstract ...... 58
12. Introdução ...... 59
13. Material e métodos ...... 61
13.1 Amostragem e seleção de marcadores moleculares...... 61 13.2 Extração de DNA, amplificação e sequenciamento...... 61 13.3 Análises filogenéticas do DNA mitocondrial e estrutura dos marcadores nucleares...... 62 13.4 Species tree e datação molecular...... 63 13.5 Testando hipóteses de delimitação de espécies ...... 63 13.6 Reconstrução de áreas ancestrais ...... 64
14. Resultados ...... 64
14.1 Análises filogenéticas do DNA mitocondrial e estrutura dos marcadores nucleares...... 64 14.2 Species tree e datação molecular...... 66 14.3 Delimitação de espécies ...... 66 14.4 Reconstrução de áreas ancestrais ...... 67
15.Discussão ...... 67
15.1 Sistemática e relações filogenéticas em Lophotriccus ...... 67 15.2 Diversificação no Neotrópico ...... 71 15.3 Diversificação na Amazônia ...... 74
16.Conclusão ...... 75
17.Agradecimentos ...... 76
18.Referências ...... 76
19. Figuras ...... 85
20. Tabelas ...... 91
21. Material Suplementar ...... 92
22. Conclusão Geral ...... 113
23. Referências Gerais ...... 114 VIII
LISTA DE FIGURAS
FIGURAS DA INTRODUÇÃO GERAL
FIGURA 1: relações filogenéticas em Todirostrinae, segundo Tello et al., 2009 ...... 3 FIGURA 2: Relações filogenéticas em Todirostrinae a nível específico, segundo Tello et al., 2009 ...... 4 FIGURA 3: Relações filogenéticas dos Todirostrinae, baseadas em caracteres da morfologia de siringe, septos nasal e interorbital, segundo Lanyon, 1988c ...... 4 FIGURA 4: Distribuição das espécies de Lophotriccus e Oncostoma, mostrando o padrão geral de sobreposição nas distribuições no bioma amazônico, Andes e América Central ...... 6 FIGURA 5: relações filogenéticas nos complexos Lophotriccus e Oncostoma, segundo Tello e Bates, 2007 ...... 6
FIGURAS DO CAPÍTULO 1
Fig. 1 BI tree based on entire concatenated dataset of five genes (cytb, ND2, G3PDH, Musk and RAG2, totalizing 3106 bp). The color of the circles at nodes indicates posterior probability support, > 0.95 (black), 0.95–0.75 (gray) ...... 42 Fig. 2 ML tree based on entire concatenated dataset of five genes (cytb, ND2, G3PDH, Musk and RAG2, 3106 bp). The color of the circles at nodes indicates posterior probability support, > 95 (black), 95–70 (gray) ...... 44
Fig. 3 Species tree estimated by *BEAST using the entire dataset of five genes (cytb, ND2, G3PDH, Musk and RAG2, 3106 bp). The names of proposed genera are shown besides each clade containing names of currently recognized taxa. Proposed tribes (Hemitriccini and Todirostrini) are also shown. The color of the circles at nodes indicates posterior probability support, > 0.95 (black) ...... 46 IX
Fig. 4 Species tree estimated by *BEAST using the entire dataset of five genes (cytb, ND2, G3PDH, Musk and RAG2, totalizing 3106 bp) showing phylogenetic relationships between proposed genera. Proposed tribes (Hemitriccini and Todirostrinae) are also shown. The color of the circles at nodes indicates posterior probability support, > 0.95 (black) ...... 46
FIGURAS DO CAPÍTULO 2
Figure 1. BI gene tree based on the concatenated mtDNA (cytb and ND2) matrix (1830 bp) showing relationships between the two clades of Lophotriccus and the outgroups. BI and ML support values are shown respectively. * indicates maximum support on both analyses (1/100), while - indicates support below 0.8/50 ...... 86 Figure 2. BI gene tree based on the concatenated mtDNA (cytb and ND2) matrix (1830 bp) showing Clade 1. BI and ML support values are shown respectively. * indicates maximum support on both analyses (1/100), while - indicates support below 0.8/50. Shaded areas correspond to known distributions of species according to the current classification ...... 87 Figure 3. BI gene tree based on the concatenated mtDNA (cytb and ND2) matrix (1830 bp) showing Clades 2 and 3. BI and ML support values are shown respectively. * indicates maximum support on both analyses (1/100), while - indicates support below 0.8/50. Shaded areas correspond to known distributions of species according to the current classification ...... 89 Figure 4. Bayesian analysis of population structure in BAPS showing the best K for admixture: A. all markers (best K=2), B. G3PDH (best K=3), C. MUSK (best K=6) and D. RAG2 (best K=4) ...... 91 Figure 5. Ancestral areas reconstruction analysis in BioGeoBEARS, based on the species tree estimated by *BEAST. Only nodes with posterior probabilities above 0.8 are shown. Nodes shown confidence intervals as bars. Colors represent biogeographic areas: yellow – Belém AE, light green – Tapajós AE, orange – Guyana AE, light X blue – Jaú AE, dark green – Napo AE, red – Inambari AE, black – Peruvian Andean Center brown – Chocó AE, pink – Perijan Montane Center, dark blue – Central America ...... 91 Figure S1. BI gene tree based on a concatenated mitochondrial DNA (cytb and ND2) matrix (1830 bp) showing phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor. We used Hemitriccus diops and Hemitriccus zosterops as outgroups. Branch lengths have been adjusted to better tree view. Only nodes p>0.8 are shown ...... 94 Figure S2. ML gene tree based on a concatenated mitochondrial DNA (cytb and ND2) matrix (1830 bp) showing phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor. We used Hemitriccus diops and Hemitriccus zosterops as outgroups. Only nodes with bootstrap >50 are shown ...... 96 Figure S3. BI gene tree based on G3PDH nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor ...... 98 Figure S4. BI gene tree based on MUSK nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor ...... 98 Figure S5. BI gene tree based on RAG2 nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor ...... 99 Figure S6. ML gene tree based on G3PDH nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor ...... 101 Figure S7. ML gene tree based on MUSK nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor ...... 101 Figure S8. ML gene tree based on RAG2 nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor ...... 102 XI
LISTA DE TABELAS
TABELAS DO CAPÍTULO 1
Table S1. List of tissue samples used in this study. Acronyms: INPA (Instituto Nacional de Pesquisas da Amazônia), MPEG (Museu Paraense Emílio Goeldi), LSUMZ (Louisiana State University Museum of Zoology), MSB (Museum of Southwestern Biology-University of New Mexico), KU (Kansas University Biodiversity Institute and Natural History Museum) and MBUCV (Museo de Biología de la Universidad Central de Venezuela), FMNH (Field Museum of Natural History), ZMUC (Zoological Museum of University of Copenhagen), LGEMA (Laboratório de Genética e Evolução Molecular de Aves da Universidade de São Paulo) and MZUSP (Museu de Zoologia da Universidade de São Paulo) and UFMG (Universidade Federal de Minas Gerais) ...... 47 Table S2. Primers used in the present study and respective temperature meltdown (Tm) for each one ...... 57
TABELAS DO CAPÍTULO 2
Table 1. Species delimitations in BPP analysis and the posterior probabilities (p) of different combinations of algorithms for species delimitations and species model priors (SMP). Variables ε, α and m represent finetune parameters and the priors θ and τ are priors designate population size parameters and divergence time at the root of the trees ...... 91 Table 2. BioGeoBEARS results showing the values of log-likelihood (LnL), dispersal (d), extinction (e), founder (j), and AIC of all models tested. Best model suggested in bold ...... 92 Table S1. List of tissue samples used in this study. Acronyms: INPA (Instituto Nacional de Pesquisas da Amazônia), MPEG (Museu Paraense Emílio Goeldi), LSUMZ (Louisiana State University Museum of Zoology), MSB (Museum of XII
Southwestern Biology-University of New Mexico), KU (Kansas University Biodiversity Institute and Natural History Museum) and MBUCV (Museo de Biología de la Universidad Central de Venezuela) ...... 102 Table S2. Primers used in the present study and respective temperature meltdown (Tm) for each one ...... 110 Table S3. Proposed taxa based in species delimitations ...... 112 XIII
“No man’s knowledge here can go beyond his experience”.
John Locke XIV
RESUMO
A subfamília Todirostrinae (Tello, Moyle, Marchese & Cracraft, 2009) compreende sete gêneros e cerca de 51 táxons reconhecidos distribuídos do sul do México ao nordeste da Argentina, ocorrendo em vários tipos de ambientes florestais. Sua taxonomia e sistemática são tradicionalmente baseadas em sinapomorfias de pequeno tamanho corporal e formato do bico, levando a uma histórica controvérsia sobre sua taxonomia e relações evolutivas. Neste estudo objetivou-se, por meio de uma abordagem multilocus (5 loci, 3153 pb) da maior filogenia construída para o grupo, inferir as relações filogenéticas em Todirostrinae, reconhecendo gêneros válidos e estimando o tempo de diversificação. Foi encontrada parafilia em quatro gêneros de Todirostrinae e também em cinco táxons do grupo. O gênero Hemitriccus corresponde a nove linhagens parafiléticas, quatro das quais, correspondendo a gêneros novos e mais cinco gêneros previamente reconhecidos em literatura, de forma similar aos gêneros Myiornis e Lophotriccus (ambos com duas linhagens parafiléticas). O gênero Poecilotriccus apresenta quatro linhagens parafiléticas, três das quais correspondendo a gêneros novos. Os resultados das reconstruções filogenéticas serviram como base para a proposta de um novo arranjo taxonômico para o grupo. A origem e diversificação dos gêneros pode ser explicada por eventos geológicos nos Andes e Escudo Brasileiro bem como ciclos glaciais do Pleistoceno. O gênero Lophotriccus, amplamente distribuído em planícies e florestas montanas em todo o Neotrópico setentrional e América Central, possui taxonomia controversa e limites de espécies pouco definidos. Adicionalmente, objetivou-se estimar a filogenia, limites das espécies e biogeografia histórica de Lophotriccus, utilizando uma abordagem multilocus (5 loci, 3153 pb) cobrindo todos os táxons descritos. Descobriu-se que o gênero Lophotriccus é parafilético em relação a Oncostoma e Hemitriccus minor. Além disso, todos os Lophotriccus tradicionalmente reconhecidos são parafiléticos, exceto L. eulophotes. A análise de delimitação de espécies suporta um status de espécie para todas as subespécies do gênero e quatro clados geograficamente estruturados em L. galeatus. A reconstrução biogeográfica otimizou a Amazônia XV ocidental e os Andes Centrais como áreas ancestrais mais prováveis e sugere múltiplos eventos de diversificação nos Andes, nas planícies amazônicas e na América Central, coincidindo com os ciclos glaciais do Pleistoceno.
ABSTRACT
Phylogeny of the subfamily Todirostrinae (Aves, Rhynchocyclidae) and biogeography of Lophotriccus and Oncostoma
The subfamily Todirostrinae (Tello, Moyle, Marchese & Cracraft, 2009) comprises seven genera and about 51 recognized taxa distributed from southern Mexico to the northeast of Argentina, occurring in several forest environments. Its taxonomy and systematics are traditionally based on synapomorphies of small body size and beak shape, leading to a historical controversy over its taxonomy and evolutionary relationships. In this study, a multilocus (5 loci, 3153 bp) approach of the highest phylogeny constructed for the group was used to infer phylogenetic relationships in Todirostrinae, recognizing valid genera and estimating the time of diversification. Paraphily was found in four genera of Todirostrinae and also in five taxa of the group. The genus Hemitriccus corresponds to nine paraphyletic lines, four of which correspond to new genera and five genera previously recognized in the literature, similar to the genera Myiornis and Lophotriccus (both with two paraphyletic lineages). The genus Poecilotriccus presents four paraphyletic lines, three of which correspond to new genera. The results of the phylogenetic reconstructions served as basis for the proposal of a new taxonomic arrangement for the group. The origin and diversification of the genera can be explained by geological events in the Andes and Brazilian Shield as well as Pleistocene glacial cycles. The genus Lophotriccus, widely distributed in lowland and montane forests throughout the northern Neotropics and Central America, has controversial taxonomy and poorly known species limits. In addition, the objective was to estimate the phylogeny, species limits and historical biogeography of Lophotriccus using a multilocus approach (5 loci, 3153 bp) covering XVI all taxa described. It has been found that the genus Lophotriccus is paraphyletic in relation to Oncostoma and Hemitriccus minor. In addition, all traditionally recognized Lophotriccus are paraphyletic, except L. eulophotes. The species delimitation analysis supports a species status for all subspecies of the genus and four geographically structured clades in L. galeatus. Biogeographic reconstruction has optimized western Amazonia and Central Andes as more probable ancestor areas and suggests multiple diversification events in the Andes, Amazon plains and Central America, coinciding with the Pleistocene glacial cycles. 1
INTRODUÇÃO GERAL
A região Neotropical possui as maiores taxas de endemismo e diversidade biológica do globo (Haffer, 1978, 1985, 1987, 1993; Haffer e Prance, 2001; Cracraft, 1985), e por mais de um século tem intrigado naturalistas e evolucionistas a esclarecer como essa diversidade é gerada ao longo do tempo (Ribas et al., 2011), sendo ainda hoje foco de diversos estudos a cerca de sua complexa distribuição, diversidade de habitats e ameaças ao longo das gerações (Ribas et al., 2009). A origem do atual padrão de biodiversidade da região neotropical tem sido matéria prima de discussões desde as primeiras expedições naturalistas do século XIX (Rull 2011). Em 1852 o naturalista britânico Alfred Russell Wallace postulou as primeiras hipóteses evolutivas na tentativa de explicar como os padrões de diversidade de vertebrados são gerados na região Neotropical (Wallace 1852) e desde então várias conjecturas alternativas têm sido propostas buscando esclarecer estes padrões (Haffer 1969, 1993, 2008; Endler 1977; Colinvaux 1993; Bush 1994; Marroig e Cerqueira 1997). Análises recentes sugerem que a biodiversidade atual não é oriunda da ação de um ou poucos conjuntos de eventos cíclicos (Rull, 2011), mas sim de eventos estocásticos aliados a processos históricos tais como tectonismos do Neógeno (Hoorn et al., 1995; Hoorn et al., 2010) e reorganizações paleogeográficas (Rull 2008) originadas pela ação de mudanças climáticas do Pleistoceno (Duellman, 1982; Haffer e Prance 2001). Adicionalmente, processos biológicos intrínsecos geram biodiversidade por mecanismos de especiação aliados a eventos de dispersão de populações ou linhagens, sujeitas à seleção. A especiação é produto do prolongado isolamento geográfico de populações (Brumfield 2012) e embora os efeitos da atual configuração da paisagem sobre a diferenciação genética das populações e consequente especiação seja evidente, ainda pouco se sabe sobre a influência dos eventos históricos neste processo (Burney e Brumfield 2009; Brumfield 2012). De modo geral, se sugere que a especiação simpátrica surge da competição entre as populações levando à posterior separação de nicho ecológico, ao passo que a especiação em alopatria necessariamente invoca a 2 presença de uma barreira geográfica (Struwe et al., 2009). Os recentes estudos em filogenia molecular suportados por dados do registro fóssil ilustram um padrão geral de acelerada especiação na região Neotropical desde o Neogeno até o presente (Derryberry et al., 2011), além de um acúmulo na diversidade da avifauna, como produto dos processos descritos a atuar sobre a especiação, dispersão e extinção de linhagens ao longo de milhões de anos nestas latitudes. As aves representam o grupo de organismos mais bem estudado desta região, e o conhecimento de suas distribuições e relações filogenéticas tem se prestado como subsídio no desenvolvimento de modelos de diversificação histórica (Brumfield, 2012). Neste contexto encontra-se a família Tyrannidae, exclusiva do continente americano composta por cerca de 100 gêneros e 430 espécies, constituindo uma das maiores radiações ecológicas e evolutivas da região Neotropical (Rheindt et al., 2008). Historicamente seus gêneros são definidos com base em caracteres morfológicos como a forma do bico, asas e cauda além dos padrões e coloração da plumagem (Birdsley, 2002). O grupo tem sido foco de diversas investigações filogenéticas recentes, na tentativa de organização de suas relações evolutivas, taxonomia e sistemática (ver Lanyon, 1984, 1985a, 1985b, 1986, 1988a, 1988b, 1988c; Birdsley, 2002; Ohlson et al., 2008; Tello e Bates, 2007; Chaves et al., 2008; Rheindt et al., 2008; Tello et al., 2009) bem como o entendimento dos mecanismos evolutivos que geraram a enorme diversidade adaptativa e comportamental oriunda de sua radiação (Rheindt et al., 2008). Recentemente, um estudo molecular de Tello et al., 2009 relocou 7 gêneros (Hemitriccus, Poecilotriccus, Todirostrum, Atalotriccus, Oncostoma, Lophotriccus e Myiornis) para um grupo denominado Todirostrinae (Tello, Moyle, Marchese & Cracraft, 2009), dentro da familia Rynchocyclidae (Figura 1) filogeneticamente relacionado aos Tyrannidae. Esta subfamilia compreende atualmente 52 espécies reconhecidas, exclusivas da região neotropical (Traylor 1979) e encontradas principalmente na América Central, região amazônica, porção norte andina, vertente atlântica, região central e planície chaquenha até o norte da Argentina (Ridgely e Tudor, 1994; Fitzpatrick et al., 2004). São morfologicamente muito similares, em 3 especial nos caracteres de padrão de plumagem e formato do bico (Cohn-Haft, 2000) e habitam principalmente o interior de ambientes florestais mais maduros, não possuindo grande capacidade de dispersão, são territorialistas, monogâmicas e não migratórias (Cohn-Haft, 2000). Alimentam-se de artrópodes, e seus padrões de vocalizações assemelham-se muito aos de algumas espécies de anuros ou insetos (Cohn-Haft, 2000). Sua polifilia é argumentada por diversos autores, baseada em caracteres morfológicos (Hellmayr, 1927; Fitzpatrick 1976; Traylor 1977; Lanyon 1988a, 1988b; Cohn-Haft, 1996) bem como análise molecular (Tello e Bates 2007; Tello et al., 2009), servindo de subsídio para propostas de reformas em sua sistemática e taxonomia original (Lanyon, 1988c; Cohn-Haft, 1996; Tello e Bates 2007).
FIGURA 1: Relações filogenéticas em Todirostrinae, segundo Tello et al., 2009.
Analisando dados moleculares de uma espécie atlântica (H. diops), Tello et al., 2009, sugerem relação filogenética desta última com os gêneros Atalotriccus, Lophotriccus e Oncostoma, restritos ao bioma amazônico da América do Sul e América Central respectivamente. Este seria então, segundo os mesmos autores, grupo irmão de H. iohannis (restrito ao interflúvio Solimões e Madeira) e H. margaritaceiventer, de ampla distribuição na América do Sul (Fitzpatrick et al., 2004), sendo que estes últimos formam um clado que é irmão de H. josephinae (limitado a porção leste do escudo das Guianas) e Myiornis ecaudatus, de ampla distribuição no bioma amazônico. Este forma um clado que é irmão de Poecilotriccus e Todirostrum (Tello et al., 2009) (Figura 2), ambos de ampla distribuição na América do Sul. As 4 relações dentro deste grupo são também suportadas por caracteres morfológicos compartilhados dos septos nasal e interorbital, além da convergência no formato dos ninhos (Lanyon 1988c) (Figura 3). Assim, investigações em nível filogenético necessariamente demandam a inclusão de todos os gêneros do grupo, uma vez que sua situação taxonômica e sistemática atual encontra-se, ainda, em insatisfatória resolução.
FIGURA 2: Relações filogenéticas em Todirostrinae a nível específico, segundo Tello et al., 2009.
FIGURA 3: Relações filogenéticas dos Todirostrinae, baseadas em caracteres da morfologia de siringe, septos nasal e interorbital, segundo Lanyon, 1988c. 5
Filogenias representam hipóteses sobre relações históricas entre espécies na forma de árvores dicotômicas (Hennig et al., 1966; Stadler e Bokma, 2012). Tem se evidenciado que o eixo do tempo das filogenias (eventos de bifurcação dos ramos) fornece informação sobre as taxas de extinção e especiação nas linhagens apesar da supressão das espécies extintas (Stadler e Bokma 2012). Comparações de caracteres moleculares tem se mostrado úteis em avaliar relações filogenéticas entre táxons de vertebrados superiores (Lanyon 1985a). São conhecidas cinco subespécies de Lophotriccus pileatus, que distribuem-se pelos Andes, Tepuis e regiões montanhosas da América Central sendo luteiventris (leste de Honduras, Costa Rica e Panamá); sanctaeluciae (nordeste da Venezuela até áreas adjacentes na Colombia; squamaecrista (Andes da Colombia e oeste do Ecuador); pileatus (Andes do leste do Ecuador e leste do Peru) e hypochlorus(sudeste do Peru de Cuzco a Puno). Para Lophotriccus vitiosus há a separação de duas grandes áreas de distribuição, estando uma no escudo das Guianas e outra na planície do sopé dos Andes. São reconhecias cinco subespécies: guianensis (Guianas, norte do Amazonas, norte do Pará e Amapá); affinis (sudeste da Colômbia, alto Rio Negro no Brasil, leste do Ecuador e nordeste do Peru); vitiosus (leste do Peru) e congener (sudeste do Amazonas no Brasil e leste do Peru). A distribuição de Lophotriccus eulophotes vai do sudeste do Peru e nordeste da Bolívia, alcançando o sudoeste da amazônia brasileira no Rio Purus. Lophotriccus galeatus distribui-se do leste da Venezuela ás Guianas, leste da Colombia, nordeste do Peru e Amazônia brasileira (norte do Amazonas até o Amapá e sul do Amazonas a leste do Rio Tapajós até o Maranhão). Atalotriccus pilaris tem sua distribuição assinalada do oeste do Panamá, leste da Colômbia, centro-leste da Venezuela a oeste da Guiana. As espécies do gênero Oncostoma tem distribuição predominantemente centro-americana sendo Oncostoma cinereigule (sul do México a oeste do Panamá) e Oncostoma olivaceum (região central e leste do Panama e noroeste da Colômbia). O conhecimento dos padrões filogeográficos deste grupo informam a respeito de eventos que moldaram a paisagem amazônica e distribuição de sua biota. 6
Neste contexto, o complexo Lophotriccus/Oncostoma (Tello e Bates, 2007; Tello et al., 2009) (Figura 5), apresenta sobreposição das áreas de ocorrência de suas espécies dentro do bioma amazônico das Américas Central e do Sul (Figura 4), o que presumidamente reflete padrões de irradiação morfológica e ecológica de uma linhagem.
FIGURA 4: Distribuição das espécies de Lophotriccus e Oncostoma, mostrando o padrão geral de sobreposição nas distribuições no bioma amazônico, Andes e América Central.
FIGURA 5: Relações filogenéticas nos complexos Lophotriccus e Oncostoma, segundo Tello e Bates,
2007.
Baseado na definição conceitual da biogeografia de vicariância, estudos sobre a diversificação de aves neotropicais inferem sobre processos biogeográficos por meio 7 da congruência entre relações de área de distribuição (d'Horta et al., 2012). Embora muitos táxons experimentem similar histórico de evolução da paisagem, tais padrões de diversificação apresentam diferenças espaço-temporais atribuídas a processos estocásticos e ecológicos (Burney e Brumfield 2009; d'Horta et al. 2012). Com o advento das análises filogeográficas e coalescentes do sequenciamento de DNA mitocondrial, tornou-se possível conhecer a influência de eventos históricos, biogeográficos e ecológicos sobre as populações (Avise, 2000), inferindo novas interpretações da história biogeográfica das espécies e dando suporte aos estudos de variações de caracteres morfológicos com a área de distribuição (Alexander e Burns 2006). A abordagem filogeográfica trabalha os arranjos espaciais das linhagens genéticas, a nível inter e intraespecífico. Estudos comparativos de filogeografia se prestam principalmente a revelar a natureza demográfica e histórica da evolução intra e interespecífica (Avise, 2009).
No presente estudo as hipóteses são de que (1) as relações filogenéticas entre as espécies de Todirostrinae, revelados pelos dados moleculares, não refletem a sistemática atual inferida com base em caracteres de plumagem, morfologia e uso de habitat e de que (2) os atuais padrões de distribuição dos grupos Lophotriccus e Oncostoma no bioma amazônico, Andes e América Central refletem uma radiação morfológica e ecológica recente.
Objetivos
Geral:
- Determinar as relações filogenéticas entre todas as espécies da subfamília Todirostrinae. Com base nesse resultado, detalhar o padrão biogeográfico para os complexos Lophotriccus e Oncostoma.
Específicos:
- Inferir as relações filogenéticas na subfamília Todirostrinae
- Revisar a taxonomia e sistemática da subfamília. 8
- Detalhar os padrões biogeográficos dos complexos Lophotriccus e Oncostoma, relacionando-os a eventos históricos da região Neotropical.
- Determinar os limites de espécies nos dois complexos 9
CAPÍTULO 1
Corresponding author: Glauco Kohler, Programa de Pós-Graduação em Genética, Conservação e Biologia Evolutiva, Instituto Nacional de Pesquisas da Amazônia, Av. André Araújo 2936, Manaus, AM 69060-001, Brazil. email: [email protected]
Phylogeny, taxonomic reassessment and biogeography of subfamily Todirostrinae (Aves, Rhynchocyclidae).
Kohler, G., Cohn-Haft, M., Aleixo, A., Brumfield, R.T. & Ribas, C.C.
Phylogeny and biogeography of Todirostrinae
Kohler et al.
Texto formatado segundo as normas da revista Zoologica Scripta 10
1. Kohler, G., Cohn-Haft, M., Aleixo, A., Brumfield, R.T. & Ribas, C. (2017). Phylogeny, taxonomic reassessment and biogeography of subfamily Todirostrinae (Aves, Rhynchocyclidae). Zoologica Scripta, 00, 000-000. The subfamily Todirostrinae (Tello, Moyle, Marchese & Cracraft, 2009) comprises seven genera and about 51 recognized taxa distributed from southern Mexico to the northeast of Argentina, occurring in several types of forest environments. Its taxonomy and systematics are traditionally based on synapomorphies of small body size and bill shape, leading to a historical controversy over its taxonomy and evolutionary relationships. In this study, a multilocus dataset (5 loci, 3153 bp) was used to infer phylogenetic relationships in Todirostrinae, to determine valid genera and to estimate the time of diversification. Paraphyly was found in four genera and five taxa of Todirostrinae. The genus Hemitriccus corresponds to nine paraphyletic lineages, four of which correspond to new genera and five of which conform to previously recognized genera in the literature. The genera Myiornis and Lophotriccus were also found to be paraphyletic (both with two paraphyletic lineages). The genus Poecilotriccus represents four paraphyletic lineages, three of which correspond to new genera. Based on the phylogenetic reconstructions we propose a revised taxonomic arrangement. The origin and diversification of the genera can be related to geological events in the Andes and the Brazilian Shield as well as Pleistocene glacial cycles. Glauco Kohler, Programa de Pós-Graduação em Genética, Conservação e Biologia Evolutiva, Instituto Nacional de Pesquisas da Amazônia, Av. André Araújo 2936, Manaus, AM 69060-001, Brazil. E-mail: [email protected] Mario Cohn-Haft, Coordenação de Biodiversidade e Coleções Zoológicas, Instituto Nacional de Pesquisas da Amazônia, Av. André Araújo 2936, Manaus, AM 69060-001, Brazil. E-mail: [email protected] Alexandre Aleixo, Coordenação de Zoologia, Museu Paraense Emílio Goeldi, Campus de Pesquisa. Av. Perimetral, 1901, 66077-530 Belém, PA, Brazil. E-mail: [email protected] 11
Robb T. Brumfield, Museum of Natural Science, Louisiana State University, 70803 Baton Rouge, LA, USA. E-mail: [email protected] Camila Ribas, Coordenação de Biodiversidade e Coleções Zoológicas, Instituto Nacional de Pesquisas da Amazônia, Av. André Araújo 2936, Manaus, AM 69060-001, Brazil. E-mail: [email protected]
2. Introduction
The Neotropical region harbors the highest amounts of avian endemism and diversity on Earth (Haffer 1969; Cracraft 1985; Haffer & Prance 2001). Birds are the best-known Neotropical faunal group and have figured in the development of models of historical diversification in this region (Ribas et al. 2012; d’Horta et al. 2013; Smith et al. 2014), although data on species distributions as well as studies on evolutionary and ecological processes are still incipient (Brumfield 2012). Contemporary estimates of avian species diversity in the Neotropics almost certainly underestimate the real diversity of lineages, with many subspecies likely representing full species (Tobias et al. 2008; Brumfield 2012). The subfamily Todirostrinae (Tello, Moyle, Marchese & Cracraft, 2009) comprises seven genera and about 51 recognized species distributed from south of Mexico to northeast Argentina occurring in several types of forest environments. Its taxonomy and systematics are traditionally based on synapomorphies of small body size (which gives them the vernacular names of ‘tody-tyrants’ or ‘pygmy-tyrants’) and bill shapes (Hellmayr 1927). Historically, the taxonomic organization based on external morphology led the various genera to be assigned to different subfamilies within Tyrannidae. Sclater (1888) and Berlepsch (1907) placed the tody-tyrants in the subfamily Platyrhynchinae, while Hellmayr (1927) placed this group in the subfamily Euscarthminae, originally described by Ihering (1904) based on the shared building pattern of pendant and pyriform nests. Later, Traylor (1977) placed them in his Elaeniinae based on external morphology, although he lacked explicit criteria for the 12 inclusion of tody-tyrants in this subfamily. Nevertheless, this external morphology-based organization led to taxonomic instability throughout its history, and it has been pointed out that characters of the nasal capsule (Lanyon 1984, 1985, 1986, 1988a, 1988b, 1988c), syringeal morphology (Ames 1971) and cranial features (Warter 1965) would be more useful for this purpose. Tello et al. (2009), based on molecular analysis of mitochondrial and nuclear genes for 95% of the genera within Tyrannidae, moved the tody-tyrants to the subfamily Todirostrinae within the family Rhynchocyclidae. However, several authors, based on phenotypic (Fitzpatrick 1976; Traylor 1977; Lanyon 1988a, 1988b; Cohn-Haft 1996) and molecular data (Tello & Bates 2007; Tello et al. 2009), have suggested that several genera currently placed in Todirostrinae are not part of the clade. Here we present a phylogenetic analysis including 68 of 109 recognized taxa (including species and subspecies) within Todirostrinae. Based on the phylogeny obtained we revise the subfamily systematic arrangement, delimiting valid genera consistent with the phenotypic variation observed and described in the literature. We also discuss the phylogenetic relationships among the currently recognized taxa within Todirostrinae and propose a timeframe for the diversification of the group.
3. Materials and methods
3.1 Sampling and molecular markers
Samples were obtained from vouchered tissue collections, including all Todirostrinae taxa (Table S1) except for Todirostrum viridanum Hellmayr, 1927 and Poecilotriccus pulchellus (Sclater, 1874). It is thought that T. viridanum forms a superspecies with T. cinereum and that P. pulchellus forms a superspecies with P. calopterus (Ridgley and Tudor 1994, Fitzpatrick 2004); we sampled both of these presumed sister species in this study. We used Rhynchocyclus olivaceus (Temminck, 1820) and Taeniotriccus andrei (Berlepsch & Hartert, 1902) as outgroups, based on Tello et al. (2009). 13
We obtained sequences from the mitochondrial genes NADH dehydrogenase subunit 2 (ND2, 140 individuals) and cytochrome b (cytb, 113 individuals) and from three nuclear regions, G3PDH (124 individuals), MUSK (107 individuals) and RAG2 (88 individuals) for at least one individual per biological species (Table S1).
3.2 DNA extraction, PCR-amplification and sequencing
DNA was extracted using a Promega DNA Purification Kit (A1125). The following PCR conditions were used: 94ºC for 4 minutes, followed by 30 cycles of 94ºC for 1 min, 50ºC for 1 min and 72ºC for 2 min, ending in 72ºC for 10 min. The meltdown temperatures were adjusted according to specific primers used (see details in Table S2). PCR products were purified using PEG (polietilenoglicol) 8000 20% NaCl 2.5 M. Sequencing reaction follows Platt et al. (2007) with specific modifications for each primer, using a BigDye Terminator 3.1 kit and run in a 3130x Applied Biosystems automated sequencer.
3.3 Phylogenetic analysis
Chromatograms were checked and edited using Geneious version R9 (Kearse et al. 2012), and aligned using Aliview (Larsson 2014). The best partition and nucleotide substitution model was selected using PartitionFinder 1.1.1 (Lanfear et al. 2012), partitioning by gene under a Bayesian Information Criteria (BIC). Bayesian haplotype reconstruction for the nuclear loci was performed using SeqPHASE (Flot 2010) and PHASE 2.1 (Stephens et al. 2001). Phylogenetic reconstructions were performed with the entire concatenated dataset of 5 loci (mtDNA plus 4 introns) using Bayesian Inference (BI) in MrBayes 3.2.1 (Ronquist et al. 2012) where we ran 1 chain of 2 parallel runs of 106 generations sampling every 1000 generations, and a 10% burnin. This same concatenated dataset was used to perform phylogenetic reconstructions under Maximum Likelihood (ML) inference by a rapid bootstrap (1000 replicates) search under a GTR substitution model in the software RAxML (Stamatakis 2006). 14
3.4 Bayesian species tree and molecular dating
We used the entire dataset of five loci (mtDNA plus four introns) to perform a Bayesian species tree analysis using *BEAST (Heled & Drummond 2010) in Beast 1.8.2 (Drummond et al. 2012). We assigned hypothesized species based on the currently described subspecies and in the well-supported clades recovered in the ML and Bi analyses. Sampling multiple loci from multiple individuals of each lineage improves phylogenetic inference and molecular dating by directly modeling intraspecific polymorphism and incomplete lineage sorting (Shang et al. 2015). We used the cytb mutation rate of 0.0105 substitution/site/lineage/million years (Weir & Schluter 2008) in an uncorrelated lognormal relaxed clock, setting the cytb.ucld.mean prior to a normal distribution with mean 0.0105 and stdev of 0.002. We applied a Yule speciation tree model and set the species.popMean and species.yule.birthRate priors to a proper Exponential (mean=1). Two independent runs of 2 x 108 generations were performed sampling trees every 20000 generations. Posterior distributions, ESS values and burnin were checked in Tracer1.6 (Rambaut et al. 2014).
4. Results
4.1 Phylogenetic relationships
Both BI and ML inferences recovered two major, well-supported clades within Todirostrinae (Figs 1-2). Clade 1 comprises species of the genera Hemitriccus, Poecilotriccus, Atalotriccus, Lophotriccus, Oncostoma and Myiornis. Clade 2 includes species of the genera Hemitriccus, Poecilotriccus and Todirostrum. The genus Hemitriccus is highly polyphyletic, comprising nine independent lineages within Clade 1 as well as Hemitriccus furcatus (Lafresnaye, 1846) in Clade 2 15
(Figs 1-2). Clade 1 contains H. spodiops (Berlepsch, 1901) and H. cohnhafti (Zimmer, Whittaker, Sardelli, Guilherme & Aleixo, 2013) as sister taxa, which are sister to a large clade containing nine of the 14 Lophotriccus taxa we sampled, as well as Hemitriccus minor pallens (Todd, 1925) and both Oncostoma species and (Figs 1-2). We found that Hemitriccus minor (Snethlage, 1907) was polyphyletic, with one taxon (H. m. pallens) embedded within Lophotriccus (p=1; bootstrap=100) and the remaining samples forming a well-supported clade (p=1; bootstrap=100) that is sister to a clade composed of H. spodiops, H. cohnhafti, Lophotriccus, Oncostoma and H. m. pallens (Figs 1-2). The genus Lophotriccus is also polyphyletic and includes two clades (Figs 1-2). The first clade includes a paraphyletic Lophotriccus galeatus (Boddaert, 1783) plus Lophotriccus eulophotes Todd, 1925 (p=1; bootstrap=100). Lophotriccus galeatus is composed of three distinct lineages (Figs 1-2). The population from the Tapajós Area of Endemism (AE) (Lophotriccus galeatusTPJ) is a new taxon, sister to L. eulophotes (Figs 1-2). The lineage from the Belém AE (Lophotriccus galeatusBC) is sister to the nominate form found on the Guiana Shield (Figs 1-2), but with low support in both BI (p=0.69) and ML (bootstrap=53). A third lineage of L. galeatus (Lophotriccus galeatusBR) includes individuals collected along the Branco River within the Guiana Shield (Figs 1-2), and is sister to a clade comprising the nominate (L. galeatus) and the Belém AE lineage with high support in BI (p=1) and low support in ML (bootstrap=69). The second clade, containing taxa assigned to Lophotriccus (Lophotriccus pileatus luteiventris Taczanowski, 1884, L. p. squamaecrista (Lafresnaye, 1846), L. p. sanctaeluciae Todd, 1952, L. p. hypochlorus Berlepsch & Stolzmann, 1906, L. p. pileatus (Tschudi, 1844), L. vitiosus congener Todd, 1925, L. v. vitiosus (Bangs & Penard, 1921), L. v. guianensis Zimmer, 1940, L. v. affinis Zimmer, 1940 and H. m. pallens (Todd, 1925)) is sister to a clade that includes Oncostoma olivaceum (Lawrence, 1862), Oncostoma cinereigulare (Sclater, 1857) with high support (p=1; bootstrap=83). Poecilotriccus senex (Pelzeln, 1868) is sister to a clade comprising H. zosterops (Pelzeln, 1868), H. griseipectus (Snethlage, 16
1907), Atalotriccus pilaris (Cabanis, 1847), H. minor, H. spodiops/cohnhafti, Lophotriccus (including H. m. pallens) and O. olivaceum/cinereigulare with high support in BI (p=1), and moderate support in ML (bootstrap=69), rendering the genus Poecilotriccus paraphyletic (Figs 1-2). The genus Myiornis is polyphyletic (Figs 1-2) and forms one well-supported clade comprising Myiornis auricularis (Vieillot, 1818), Myiornis albiventris (Berlepsch & Stolzmann, 1894) and Myiornis sp . This clade is sister to a clade comprising Poecilotriccus senex, H. zosterops/griseipectus, Atalotriccus pilaris, H. minor, H. spodiops/cohnhafti, Lophotriccus (including H. minor pallens) and O. olivaceum/cinereigulare (Figs 1-2). H. zosterops and H. griseipectus form a clade that is sister to Atalotriccus pilaris, H. minor, H. spodiops, H. cohnhafti, Lophotriccus, Oncostoma and H. m. pallens (Figs 1-2). There was low support in both analyses for the basal relationships within Clade 1. This resulted in weakly supported topological conflicts between BI and ML analyses in placing the Hemitriccus diops (Temminck, 1822) and Hemitriccus obsoletus (Ribeiro, 1905) clade and the Hemitriccus flammulatus Berlepsch, 1901 and Hemitriccus josephinae (Chubb, 1914) clades (Figs 1-2). Both approaches recovered Hemitriccus mirandae (Snethlage, 1925) as paraphyletic, with one individual sister to Hemitriccus orbitatus (Wied-Neuwied, 1831) and the second individual sister to these two (Figs 1-2). We recovered a strongly supported clade comprising Hemitriccus inornatus (Pelzeln, 1868) and Hemitriccus minimus (Todd, 1925) that is sister to Myiornis ecaudatus (Orbigny & Lafresnaye, 1837) plus Myiornis atricapillus (Lawrence, 1875) (Figs 1-2). We found that H. minimus is paraphyletic, because one individual was sister to H. inornatus (Figs 1-2). Hemitriccus margaritaceiventer (Orbigny & Lafresnaye, 1837) was also paraphyletic, with Hemitriccus nidipendulus (Wied-Neuwied, 1831) individuals embedded within it (Figs 1-2). The genus Poecilotriccus was polyphyletic, with one species (P. senex) embedded in Clade 1 (Figs 1-2). The remaining lineages of Poecilotriccus are 17 restricted to Clade 2. A well-supported clade comprises Poecilotriccus capitalis (Sclater, 1857) and Poecilotriccus albifacies (Blake, 1959) as sister taxa, with H. furcatus sister to them. This clade is sister to two other clades: one comprising all remaining Poecillotriccus species and the other including species of the genus Todirostrum (Figs 1-2).
4.2 Bayesian species tree and molecular dating
The species tree was estimated using the entire dataset of 4 loci (mtDNA, G3PDH, Musk and RAG2, 3106 bp), and recovered the two main clades found in the previous analyses with high support. The only weakly supported node corresponded to the relationships among the three main clades within Clade 2 (Todirostrini) (Fig.3) The two main clades are estimated to have originated in the mid-Pliocene at 3.9 Myr (CI: 5.0-2.8), and then diversified during the Pleistocene (Fig. 4). The topology recovered by the species tree analysis corroborated most relationships found in the BI (Figs 1-3). The species tree analysis improved support for the basal relationships within Clade 1 (tribe Hemitriccini), establishing the relationships among the clades H. flammulatus/josephinae, Hemitriccus kaempferi (Zimmer, 1953)/mirandae/orbitatus, H. obsoletus/diops and Hemitriccus cinnamomeipectus Fitzpatrick & O'Neill, 1979/ Hemitriccus granadensis (Hartlaub, 1843)/Hemitriccus rufigularis (Cabanis, 1873) that had no support in BI and ML (Fig. 3). Within Clade 2, the species tree analysis placed the clade H. furcatus/P. albifacies/capitalis as sister to Todirostrum with low support (p=0.53), although BI and ML placed this clade as sister to Todirostrum plus Poecilotriccus (p=1; bootstrap=97) (Fig. 3).
5. Discussion
Our results illustrate that four of the seven currently recognized genera within the Todirostrinae are not monophyletic. This lack of monophyly is not too surprising 18 given the superficial similarity of species in this clade, which has long presented challenges to avian taxonomists. Some of the clades we identified are in alignment with genera formerly proposed based on external morphology (Hellmayr 1927; Zimmer 1940, 1953; Fitzpatrick 1976; Traylor 1977). We also corroborated clades proposed more recently based on molecular data (Tello & Bates 2007; Tello et al. 2009). However, in accord with recent studies (e.g. Maurício et al. 2008; Mata et al. 2009; Rheindt et al. 2013; Rheindt et al. 2015; Ferreira et al. 2016; Schultz et al. 2017) showing that many Neotropical bird taxa represent complexes of independent lineages, we encountered multiple instances in which a species or genus turned out to not be monophyletic. Many of these will require further investigation and denser population sampling. Most of the well-supported clades recovered by our phylogenetic analyzes correspond to genera proposed in previous studies, some of which remain recognized. Although these well-supported clades are steadily recovered in all phylogenetic methods, we did observe some poorly supported basal nodes (Figs 1-3). These could result from incomplete lineage sorting, which is well documented among several avian lineages (Flórez-Rodríguez et al. 2011; Suh et al. 2015), or to rapid diversification, as has been observed in other bird species complexes (Pérez-Emán 2005; DuBay & Witt 2012). It is worth mentioning that despite weak support for some basal relationships, all phylogenetic approaches recovered a main division within Todirostrinae. This division was noted in previous studies based on internal morphological characters (Lanyon 1984, 1985, 1986, 1988a, 1988b, 1988c). Here, we treat these two major divisions within the Todirostrinae as tribes Todirostrini and Hemitriccini.
5.1 Phylogenetic relationships and systematics within the Tribe Hemitriccini (Clade 1) 19
This group also have its monophyly supported by morphological features of syrinx (Lanyon 1988c). We found paraphyly in four (Hemitriccus, Poecilotriccus, Lophotriccus and Myiornis) of the six recognized genera. The genus Hemitriccus comprises nine distinct lineages within Hemitriccini. Its paraphyly was already pointed out by previous morphological (Hellmayr 1927; Zimmer 1953; Meyer de Schauensee 1966; Short 1975; Cohn-Haft 1996; Cohn-Haft 2000) and molecular (Cohn-Haft 2000; Tello & Bates 2007; Tello et al. 2009) studies. Based on morphology and geographic distributions, Cohn-Haft (2000) noted that H. inornatus and H. minimus comprised a complex of species dubbed the “inornatus-minimus clade”. The clade including H. iohannis, H. striaticollis, H. margaritaceiventer and H. nidipendulus was proposed by Hellmayr (1927) based on external morphology. Previous molecular data (Tello et al. 2009) suggested H. iohannis and H. margaritaceiventer were related taxa. Cohn-Haft (2000) placed Hemitriccus zosterops as sister to H. griseipectus, but made no statement about its relation to the other Hemitriccus species. A previous classification based on morphology (Hellmayr 1927) placed H. zosterops as sister to H. griseipectus, H. inornatus, H. minimus, H. iohannis, H. striaticollis, H. margaritaceiventer, H. nidipendulus, H. spodiops, H. granadensis , H. rufigularis and H. orbitatus in the genus Euscarthmornis. A molecular study (Tello & Bates 2007) found Hemitriccus zosterops to be sister to H. minor, Lophotriccus, Atalotriccus and Oncostoma, corroborating our results. Previous morphological data placed H. minor pallens as sister to H. spodiops (Cohn-Haft, 1996), which was not corroborated by our results where pallens was recovered as sister to Lophotriccus vitiosus affinis. We found H. spodiops to be sister to H. cohnhafti and that the clade is sister to L. pileatus luteiventris, L. p. squamaecrista, L. p. sanctaeluciae, L. p. hypochlorus, L. p. pileatus, L. vitiosus congener, L. v. vitiosus, L. v. guianensis, H. m. pallens and L. v. affinis. Thus, Hemitriccus minor represents a paraphyletic complex and its relation to Atalotriccus, Lophotriccus and Oncostoma was already supported in previous molecular studies 20
(Tello & Bates 2007). It has been pointed out that H. m. pallens should be treated as a separate species (Cohn-Haft 1996) and that the remaining taxa (minor and snethlageae) should be synonyms (Cohn-Haft 2000), which is corroborated by our results. Fitzpatrick & O’Neill (1978) proposed in the description of H. cinnamomeipectus that it would form a species complex with H. kaempferi and H. mirandae. However, our phylogenetic analysis placed cinnamomeipectus in a well-supported clade containing H. granadensis and H. rufigularis (Figs 1-3). Previous studies suggested H. granadensis and H. rufigularis were sister species related to H. zosterops, H. griseipectus, H. inornatus, H. minimus, H. iohannis, H. striaticollis, H. margaritaceiventer, H. nidipendulus, H. spodiops and H. orbitatus (Hellmayr 1927; Zimmer 1940). Zimmer (1953) proposed that H. kaempferi, H. mirandae and H. orbitatus form a species complex, with mirandae being more related to orbitatus than to kaempferi, a result confirmed by our phylogenetic analysis (Figs 1-3). Our results also indicate that the taxon mirandae needs a detailed revision, because it represents a paraphyletic lineage (Figs 1-3). Hemitriccus flammulatus was formely treated as a subspecies of H. diops (Hellmayr 1927) and, later, as a distinct species (Zimmer 1953); however, our analyses place flammulatus as sister to H. josephinae (Figs 1-3). Hellmayr (1927) placed Hemitriccus obsoletus as a subspecies of Hemitriccus diops, but our analysis recovered H. obsoletus as an independent lineage sister to Hemitriccus diops (Figs 1-3), similar to the taxonomy proposed by Zimmer (1953). Poecilotriccus senex was placed in the genus Todirostrum by Hellmayr (1927) and Fitzpatrick (1976) placed it in his “sylvia group”, together with P. fumifrons, P. sylvia, P. latirostris, P. russatus and P. plumbeiceps. We recovered senex as an independent lineage sister to a clade comprising the H. zosterops/griseipectus clade, Atalotriccus pilaris, H. minor, H. spodiops/cohnhafti, Lophotriccus (including H. minor pallens) and Oncostoma (Figs 1-4). Previous works placed Atalotriccus pilaris in Colopteryx (Lophotriccus) based on the distinctive morphology of reduced primary 21 feathers of the wings shared with another species in that genus (C. galeatus), as well as syrinx morphology (Lanyon 1988c). Additionally, we found that Lophotriccus as currently recognized, represents two paraphyletic lineages (Figs 1-3), contrary to the traditional proposals of monophyly based on the shared character of the crest (Hellmayr 1927; Traylor 1977). The taxonomy of Lophotriccus, as well as its species limits are discussed in a separate publication (Kohler et al. in prep). Traditionally, Oncostoma has been considered more closely related to Hemitriccus than to Lophotriccus or Atalotriccus (Hellmayr 1927; Fitzpatrick 1976) and treated as a separated genus (Hellmayr 1927; Fitzpatrick 1976; Traylor 1977) although Lanyon (1988c) supported the merger of both Atalotriccus and Lophotriccus in Oncostoma based on syrinx morphology. Our phylogenetic analysis placed Oncostoma as sister to Lophotriccus (Figs 1-4) and, in order to prioritize the traditional classification, we maintain Oncostoma as a separate genus. Since Hellmayr (1927) the taxa Myiornis auricularis, M. albiventris, M. Atricapillus and M. ecaudatus have been placed in Myiornis. Zimmer (1940) believed that the recognition of Perissotriccus (M. atricapillus and M. ecaudatus), which was based on the species having an extremely short tail, had no support. However, our phylogenetic analysis indicates that Myiornis as currently recognized represents a paraphyletic genus, including one clade (Myiornis auricularis and M. albiventris) sister to Poecilotriccus senex, H. zosterops/griseipectus, Atalotriccus pilaris, H. minor, H. spodiops/cohnhafti, Lophotriccus complex (including H. minor pallens) and O. olivaceum/cinereigulare; and another clade (M. atricapillus and M. ecaudatus) sister to both Hemitriccus inornatus and H. minimus. Previous works in morphology (Lanyon 1988c) and molecular characters (Tello et al. 2009) already suggested that Myiornis was related to Hemitriccus. Our results lead us to split the current genus Myiornis into two genera.
5.2 Tribe Hemitriccini
Atalotriccus Ridgway 1905 22
Type species: Atalotriccus pilaris (Cabanis, 1847). Included species: Atalotriccus pilaris (Cabanis, 1847).
Inambariornis Conh-Haft, Kohler, Aleixo, Brumfield & Ribas gen. nov. Type species: Hemitriccus spodiops (Berlepsch, 1901). Included species: Inambariornis spodiops (Berlepsch, 1901) and Inambariornis cohnhafti (Zimmer, Whittaker, Sardelli, Guilherme & Aleixo, 2013). Etymology: The masculine generic name is taken from the word Inambari (western amazonian Area of Endemism proposed by Cracraft, 1985) and ornis (bird) to refers to geographic region where the group occurs. Diagnosis: Distinguished by bill quite broad-based, large rounded nostrils; crown and upperparts dark olive-green, crown with elongated feathers forming short crest; lores greyish-buff; wings with two indistinct yellowish-olive wingbars; throat and breast greyish-olive with indistinct whitish streaking, lower belly clear yellowish-white. No sexual dimorphism. Habitat: Andean montane forest with bamboo at 800–2450 m, shrubby forest borders, second growth forests and bamboo forests at Purus-Madeira interfluve.
Lophotriccus Berlepsch, 1884 Type species: Lophotriccus squamaecrista (Lafresnaye, 1846). Included species: Lophotriccus squamaecrista (Lafresnaye, 1846); Lophotriccus luteiventris Taczanowski, 1884; Lophotriccus sanctaeluciae Todd, 1952; Lophotriccus pileatus (Tschudi, 1844); Lophotriccus hypochlorus Berlepsch & Stolzmann, 1906; Lophotriccus vitiosus (Bangs & Penard, 1921); Lophotriccus affinis Zimmer, 1940 Lophotriccus congener Todd, 1925; Lophotriccus guianensis Zimmer, 1940 and Lophotriccus pallens (Todd, 1925).
Oncostoma Sclater, 1862 Type species: Oncostoma cinereigulare (Sclater, 1857). 23
Included species: Oncostoma cinereigulare (Sclater, 1857) and Oncostoma olivaceum (Lawrence, 1862).
Colopteryx Ridgway, 1888 Type species: Lophotriccus galeatus (Boddaert, 1783). Included species: Colopteryx galeatus (Boddaert, 1783) and Colopteryx eulophotes (Todd, 1925).
Snethlagea Berlepsch, 1909 Type species: Hemitriccus minor (Snethlage, 1907). Included species: Snethlagea minor (Snethlage, 1907).
Idioptilon Berlepsch, 1907 Type species: Hemitriccus zosterops (Pelzeln, 1868). Included species: Idioptilon zosterops (Pelzeln, 1868) and Idioptilon griseipectus (Snethlage, 1907).
Lanyonia Cohn-Haft, Kohler, Aleixo, Brumfield & Ribas gen. nov. Type species: Poecilotriccus senex (Pelzeln, 1868). Included species: Lanyonia senex (Pelzeln, 1868). Etymology: The feminine generic name is taken from the surname of ornithologist Wesley E. Lanyon, Curator Emeritus of Ornithology Department of American Museum of Natural History for his studies addressing morphology of syringes and nasal/interorbital septum, which greatly contributed to the understanding of the evolutionary relationships within the tody-tyrants. Diagnosis: Males are distinguished from other genera by slate-grey forehead and forecrown with black spots, dark olive hindcrown with feathers slightly elongated into a rather weak crest; light pinkish-cinnamon loral and facial areas; bright olive 24 upperparts, blackish tail and wings, two conspicuous yellowish-white wingbars; white below, narrow dark streaks on throat. Female not described. Habitat: Thick, low-stature forest growing at edge of black-water rivers at Madeira basin.
Myiornis Bertoni, 1901 Type species: Myiornis auricularis (Vieillot, 1818). Included species: Myiornis auricularis (Vieillot, 1818); Myiornis albiventris and Myiornis sp.
Andinotriccus Kohler, Cohn-Haft, Aleixo, Brumfield & Ribas nov. gen. Type species: Hemitriccus granadensis (Hartlaub, 1843) Included species: Andinotriccus granadensis (Hartlaub, 1843); Andinotriccus cinnamomeipectus (Fitzpatrick & O'Neill, 1979); Andinotriccus rufigularis (Cabanis, 1873). Etymology: The masculine generic name is taken from name Andes (name of the mountain range that crosses the entire west coast of South America latitudinally), where the species of this group are distributed and trikkos (little bird). Diagnosis: Distinguished from other genera by crown and upperparts dark olive, whitish loral and ocular area forming broad eyering; wings dark olive, bend of wing bright yellow; tail dark dusky olive. No sexual dimorphism.
Habitat: Andean humid mossy montane and cloud forests 1800–3300 m.
Hemitriccus Cabanis & Heine, 1860 Type species: Hemitriccus diops (Temminck, 1822). Included species: Hemitriccus diops (Temminck, 1822) and Hemitriccus obsoletus (Miranda-Ribeiro, 1906).
Bornscheinia Kohler, Cohn-Haft, Aleixo, Brumfield & Ribas nov. gen. 25
Type species: Hemitriccus orbitatus (Wied, 1831) Included species: Bornscheinia orbitata (Wied, 1831); Bornscheinia mirandae (Snethlage, 1925) and Bornscheinia kaempferi (Zimmer, 1953). Etymology: The feminine generic name is taken from the surname of Marcos Ricardo Bornschein, ornithologist from Paraná state, southern Brazil, who studies the biogeography and evolution of Atlantic Forest birds and who has developed projects for the conservation of Hemitriccus kaempferi in the southern Brazilian states of Paraná and Santa Catarina. Diagnosis: Distinguished from other genera by crown and upperparts plain dark olive; wings olive, prominent white border on outer webs of innermost remiges; tail dusky olive; breast washed olive, rest of underparts yellow. No sexual dimorphism.
Habitat: Atlantic second growth forests, from sea-level to 600 m.
Microcochlearius Chubb, 1919 Type species: Hemitriccus josephinae (Chubb, 1914) Included species: Microcochlearius josephinae (Chubb, 1914) and Microcochlearius flammulatus (Berlepsch, 1901).
Campina Cohn-Haft, Kohler, Aleixo, Brumfield & Ribas gen. nov. Type species: Hemitriccus inornatus (Pelzeln, 1868). Included species: Campina inornata (Pelzeln, 1868) and Campina minima (Todd, 1925) Etymology: The feminine generic name is taken from the term campina used in literature on Amazonian landscape ecology to designate open areas that grow on seasonally soaked sandy soil that have a pattern of distribution in spots throughout Amazonia and are the habitat of the species of this genus. Diagnosis: Distinguished from other genera by crown and upperparts brownish-olive, lores and narrow eyering whitish; wings and tail dusky olive-brown; throat and underparts white with indistinct greyish streaking. No sexual dimorphism. 26
Habitat: Patchily distributed white-sand woodland “campina” across Amazonia.
Perissotriccus Oberholser, 1902 Type species: Myiornis ecaudatus (d'Orbigny & Lafresnaye, 1837). Included species: Perissotriccus ecaudatus (d'Orbigny & Lafresnaye, 1837) and Perissotriccus atricapillus (Lawrence, 1875).
Euscarthmornis Oberholser, 1923 Type species: Hemitriccus nidipendulus (Wied, 1831). Included species: Euscarthmornis nidipendulus (Wied, 1831); Euscarthmornis iohannis (Snethlage, 1907); Euscarthmornis striaticollis (Lafresnaye, 1853); Euscarthmornis margaritaceiventer (d'Orbigny & Lafresnaye, 1837).
5.3 Phylogenetic relationships and systematics within the Tribe Todirostrini (Clade 2)
Representatives of this group have already been analyzed by Lanyon (1985a, 1988c), who found shared features of the syrinx and nasal/interorbital septum. We found paraphyly in two genera within this group (Poecilotriccus and Hemitriccus) for which we propose a new taxonomic assessment (Fig. 3). Species currently included in the genus Poecilotriccus appear in three distinct and well-supported clades, and two of them have been assigned as new genera (Figs 3-4). Paraphyly of this genus was already suggested in previous molecular studies (Tello et al. 2009). Lanyon (1988c) pointed out that previous works placed P. capitalis and P. albifacies as sister species, a relationship recovered in a recent molecular study (Tello & Bates 2007) and corroborated by our phylogenetic analysis (Figs 1-3). Despite previous suggestions by Sclater (1888) and Fitzpatrick (1976) that P. capitalis was closely related to Todirostrum, our BI and ML analysis place H. furcatus, P. capitalis and P. albifacies as sister to a clade containing species of 27
Todirostrum and Poecilotriccus with high support (p=1; bootstrap=97), while the species tree analysis cannot resolve this relationship. The well-supported clade recovered by our phylogenetic analysis, named by Fitzpatrick (1976) as “sylvia group” and containing P. fumifrons, P. sylvia, P. latirostris, P. russatus and P. plumbeiceps was also found by Lanyon (1988c) based on syrinx morphology. Ridgway (1907) placed P. calopterus and P. ruficeps in the same clade, as we recovered in our phylogenetic analysis (Figs 1-3). However, according to Lanyon (1988c), based in in syrinx morphology, this group is related to P. fumifrons, P. sylvia, P. latirostris, P. russatus and P. plumbeiceps. Also Fitzpatrick (1976) placed P. calopterus with T. chrysocrotaphum, T. nigriceps, T. pictum, T. poliocephalum, T. cinereum and T. maculatum in his “cinereum group”. The genus Todirostrum remains monophyletic, corroborating analyses based on syrinx (Lanyon, 1988c) and external morphology (Fitzpatrick 1976; Traylor 1977). Hemitriccus furcatus (Lafresnaye, 1846) was already treated as a separated genus based on its similar patterns of dimorphism to P. capitalis (Hellmayr 1927).
5.4 Tribe Todirostrini
Ceratotriccus Cabanis, 1874 Type species: Hemitriccus furcatus (Lafresnaye, 1846) Included species: Ceratotriccus furcatus (Lafresnaye, 1846).
Krotalotriccus Kohler, Cohn-Haft, Aleixo, Brumfield & Ribas gen. nov. Type species: Poecilotriccus capitalis (Sclater, 1857) Included species: Krotalotriccus capitalis (Sclater, 1857); Krotalotriccus albifacies (Blake, 1959). Etymology: The masculine generic name is taken from the Greek krotala (an ancient Greek musical instrument that produces a rhythmic continuous noise) and trikkos (little bird) referring to the noisy vocal pattern shared by the species in this group. 28
Diagnosis: Males distinguished from all remaining taxa in Todirostrinae/Tyrannidae by a combination of glossy black upperparts, white supraloral spot and eyering; entirely white below, except for black intruding on upper side of throat and upper breast side, pale yellow tinge on flanks and crissum. Females have chestnut cap, buffy lores and eyering, olive upperparts, blackish tail and wings, grey on side of head and upper breast side, remaining underparts white except for pale yellow flanks and crissum.
Habitat: Found up to 1350m in bamboo and tangled viny thickets along streams, roads, and edges of humid lowland and foothill forest in Amazon basin.
Poecilotriccus Berlepsch, 1884 Type species: Poecilotriccus ruficeps (Kaup, 1852) Included species: Poecilotriccus ruficeps (Kaup, 1852); Poecilotriccus luluae Johnson & Jones, 2001; Poecilotriccus calopterus (Sclater, 1857) and probably Poecilotriccus pulchellus (Sclater, 1874).
Physatriccus Kohler, Cohn-Haft, Aleixo, Brumfield & Ribas gen. nov. Type species: Poecilotriccus sylvia (Desmarest, 1806) Included species: Physatriccus sylvia (Desmarest, 1806); Physatriccus plumbeiceps (Lafresnaye, 1846); Physatriccus russatus (Salvin & Godman, 1884); Physatriccus fumifrons (Hartlaub, 1853); Physatriccus latirostris (Pelzeln, 1868). Etymology: The masculine generic name is taken from the Greek suffix physa (onomatopoeic word which refers the sound of an emptying bladder) and trikkos (little bird) referring to the vocal pattern shared by the species in this group. Diagnosis: Distinguished from other genera by grey crown and nape, white supraloral line and eyering; olive upperparts, blackish wings, two bold yellow wingbars; greyish-white below, streaked greyish on lower throat and breast, flanks tinged olive. No sexual dimorphism. 29
Habitat: Dense thickets along forest edges and overgrown shrubby roadsides, clearings from lowlands to 1100 m and gallery forests understorey.
Todirostrum Lesson, 1831 Type species: Todirostrum cinereum (Linnaeus, 1766) Included species: Todirostrum maculatum (Desmarest, 1806); Todirostrum poliocephalum (Wied, 1831); Todirostrum cinereum (Linnaeus, 1766); Todirostrum pictum Salvin, 1897; Todirostrum chrysocrotaphum Strickland, 1850; Todirostrum nigriceps Sclater, 1855 and probably Todirostrum viridanum Hellmayr, 1927.
5.5 Diversification and Biogeography of Todirostrinae
Current taxonomy precludes an understanding of the diversification and biogeography of Todirostrinae, since a significant number of genera are paraphyletic, including lineages with independent evolutionary histories influenced by different factors. The two tribes within Todirostrinae originated in the mid-Pliocene at 3.9 Myr (CI: 5.0-2.8), with a rapid diversification during the Pleistocene (Fig. 4). The tribe Hemitriccini originated in the mid-Pliocene at 3.83 Myr (CI: 2.81-4.92) and diversified during the Plio-Pleistocene, in 16 lineages that we recognize as distinct genera (Figs 3-4). Similar what is observed for the tribe Todirostrini, most of genera in this tribe have their stem ages at mid-Pliocene. This could explain several divergences within genera such as Euscarthmornis, which originated at 3.16 Myr (CI: 2.11- 4.25) due its fragmented species distribution across South America. This is also concordant with the disjoint distributions north and south of the Amazon River in Idioptilon (at ca. 3.13 Myr; CI: 2.22-4.01) and Microcochlearius (3.82 Myr; 2.81-4.89) and west and east disjoint distribution in South America as in Myiornis (3.60 Myr; CI: 2.64-4.62). 30
The Late Pliocene–Early Pleistocene (2–3 Myr) was also marked by intense geomorphological activity in the entire Neotropical region (Gregory-Wodzicki 2000), leading to the generalized Andean uplift (Hoorn et al. 2010) and several vicariant events on the Brazilian Plateau (Silva 1995; Porzecanski & Cracraft 2005) which may have promoted diversification in Neotropical avian communities. Thus, the origin and diversification of the genus Andinotriccus at 3.55 Myr (CI: 2.58-4.66) may be related to this scenario of intense geological activity, given the fragmented distributions of its taxa along the Andes and the asynchronous uplift pattern, whereby the northern Andes appeared after the southern and central Andes (Gregory-Wodzicki 2000; Hoorn et al. 2010; Garzione et al. 2008). The Pleistocene origin and diversification of the genera Colopteryx at 1.82 Myr (CI: 1.27-2.38), Lophotriccus and Oncostoma at 1.62 Myr (CI: 1.08-2.14) and Inambariornis at 1.82 Myr (CI: 1.27-2.38) are discussed in detail on a separate publication (Kohler et al. in. prep) which points out the influence of vegetation changes during the Quaternary, acting in the Amazon Basin (Peterson & Ammann 2012; Cheng et al. 2013), Andes (Marchant et al. 2002; Burns et al. 2015) and Central America (Smith et al. 2012), as a main driver of diversification in these groups. Similarly, the genus Snethlagea originated at 2.28 Myr (CI: 1.62-2.95) and may have had its origin and diversification probably promoted by climatic cycles in the Amazon Basin (Cheng et al. 2013; Wang et al. 2017) during the Quaternary. These two processes would also explain the diversification of some Atlantic Forest taxa (Amaral et al. 2013; Batalha-Filho & Myiaki 2016; Cabanne et al. 2016; Françoso et al. 2016) such as Hemitriccus at 3.55 Myr (CI: 2.58-4.66), Bornscheinia at 3.78 Myr (CI: 2.74-4.82), as well as the genus Myiornis. The tribe Todirostrini diversified in five lineages that we recognize as five distinct genera (Figs 3-4). Previous works have suggested the influence of climate changes and glaciation during the Pleistocene as one of the main factors in shaping landscape evolution in South America (Peizhen et al. 2001; Harris & Mix 2011) and consequently in promoting diversification through fragmentation of ancestral 31 populations. Indeed, these patterns of climate changes due to glaciations are congruent with the Pleistocene stem ages of several genera addressed to tribe Todirostrini. Todirostrum is the oldest recognized genus. It originated in mid Pliocene at 3.66 Myr (CI: 2.61-4.71) and diversifyied during Pleistocene probably influenced by these climatic changes, as proposed by Fitzpatrick (1976), also to Physatriccus. Similarly, the divergence between the genera Poecilotriccus and Physatriccus dates to ca. 3.60 Myr (CI: 2.64-4.76) and could be assigned to populations divergences between highlands and lowlands. Poecilotriccus diversified during the Pleistocene possibly affected by changes in vegetation cover within the mountains due to paleoclimatic changes during the glacial cycles (Marchant et al. 2002; Burns et al. 2015).
6. Conclusion
Our results reinforce the importance of dense taxonomic sampling in studies aimed at understanding the patterns of diversification in Neotropical birds, as well as to evaluate if the taxonomy reflects the genetic and phenotypic diversity of the group. The importance of a broad sampling also extends to the field of systematics, since this should reflect the evolutionary history of the species. They also elucidated the strong incongruity between the traditional classification and the history of Todirostrinae diversification, reinforcing the need of a systematic arrangement more integrated to evolutionary biology. Since many of the well-supported clades recovered by our phylogenetic analyzes correspond to genera already recognized by the traditional classification, it seems to us rational and feasible to recognize the proposals of the new taxonomic arrangement presented here. In this sense, given the slight inconsistency between the results of our phylogenetic approaches, it is perfectly desirable that future work 32 involving a larger scale taxonomic sampling (e.g. at the family level) and employing complementary approaches reveal more precisely the relationships among the clades investigated. Further, as this study aimed to establish relationships among groups of taxa (at the genus level), it is recommended that future studies investigate in a more consistent and extended way the relationships among some taxa that we have shown to harbor cryptic diversity (e.g. Todirostrum cinereum, T. chrysocrotaphum, Poecilotriccus latirostris, P. sylvia, Hemitriccus margaritaceiventer, Lophotriccus complex, Hemitriccus minor complex, Hemitriccus mirandae).
7. Acknowledgments
We thank the curatorial staff of the University of Kansas Natural History Museum (KU), Lawrence, USA; Louisiana State University Museum of Natural Science (LSUMZ), Baton Rouge, USA; University of New Mexico Museum of Southwestern Biology (MSB), Albuquerque, USA; Centro Museo de Biología de la Universidad Central de Venezuela (MBUCV), Caracas, Venezuela; Field Museum of Natural History (FMNH), Chicago, USA; Zoological Museum of University of Copenhagen (ZMUC), Copenhagen, Denmark; Laboratório de Genética e Evolução Molecular de Aves da Universidade de São Paulo (LGEMA), São Paulo, Brazil; Museu de Zoologia da Universidade de São Paulo (MZUSP), São Paulo, Brazil and Museu Paraense Emílio Goeldi (MPEG), Belém, Brazil for allowing us to borrow tissues samples and study specimens under their care. The first author thanks CNPq (process 140903/2013-5) for a Ph. D. scholarship. AA and CR were supported by CNPq research productivity fellowships (respectively #310880/2012-2 and #307951/2012-0). The authors thank Chrysoula Gubili for helping with Greek words and suffixes. Invaluable support was also obtained through a collaborative grant, Dimensions US-Biota-São Paulo: Assembly and evolution of the Amazon biota and its environment: an integrated approach, co-funded by the US National Science Foundation (NSF DEB 1241056), National Aeronautics and Space Administration 33
(NASA), and the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP grant #2012/50260-6).
8. References
Amaral, F. R., Albers, P. K., Edwards, S. V. & Miyaki, C. Y. (2013). Multilocus tests of Pleistocene refugia and ancient divergence in a pair of Atlantic Forest antbirds (Myrmeciza). Molecular Ecology, 22, 3996-4013. Ames, P. L. (1971). The morphology of the syrinx in passerine birds. Peabody Museum of Natural History Yale University Bulletin, 37, 194 pp. Batalha-Filho, H. & Miyaki, C. Y. (2016). Late Pleistocene divergence and postglacial expansion in the Brazilian Atlantic Forest: multilocus phylogeography of (Aves: Passeriformes). Journal of Zoological Systematics and Evolutionary Research, 54, 137-147. Berlepsch, H. G. (1907). Studien über Tyranniden. Ornis, 14, 463-493. Brumfield, R. T. (2012). Inferring the origins of lowland neotropical birds. The Auk, 129, 367−376. Burns, S. J. L., Kanner, C., Cheng, H. & Edwards, R. L. (2015). A tropical speleothem record of glacial inception, the South American Summer Monsoon from 125 to 115 ka. Climate of the Past, 11, 931–938. Cabanne, G. S., Calderon, L., Arias, N. T., Flores, P., Pessoa, R., d’Horta, F. M. & Miaky, C. Y. (2016). Effects of Pleistocene climate changes on species ranges and evolutionary processes in the Neotropical Atlantic Forest. Biological Journal of the Linnean Society, 119, 856–872. Cheng, H., Sinha, A., Cruz, W., Wang, X., Edwards, R. L., d’Horta, F. M., Ribas, C. C., Vuille, M., Stott, L. D. & Auler, A. S. (2013). Climate change patterns in Amazonia and biodiversity. Nature Communications, 4, 1-6. Cohn-Haft, M. (1996). Why the Yungas Tody-Tyrant (Hemitriccus spodiops) is a Snethlagea, and why it matters. The Auk, 133, 709-714. 34
Cohn-Haft, M. (2000). A case study Amazonian biogeography: vocal and DNA-sequence variation in Hemitriccus flycatchers. PhD thesis, Louisiana State University, Baton Rouge, EUA, 136p. Cracraft, J. (1985). Historical biogeography and patterns of differentiation within the southamerican avifauna: areas of endemism. Ornithology Monographs, 36, 49–84. Cicero, C. & Johnson, N. K. (2001). Higherlevel phylogeny of New World vireos (Aves: Vireonidae) based on sequences of multiple mitochondrial DNA genes. Molecular Phylogenetics and Evolution, 20, 27–40. d’Horta F. M., Cuervo, A. M., Ribas, C. C., Brumfield, R. T. & Miyaki, C. Y. (2013). Phylogeny and comparative phylogeography of Sclerurus (Aves: Furnariidae) reveal constant and cryptic diversification in an old radiation of rain forest understorey specialists. Journal of Biogeography, doi:10.1111/j.1365-2699.2012.02760.x. Drummond, A. J. & Rambaut, A. (2012). BEAST. Ver. 1.8.2 Available at http:// http://beast.bio.ed.ac.uk DuBay, S. G., & Witt, C. C. ( 2012). An improved phylogeny of the Andean tit-tyrants (Aves, Tyrannidae): More characters trump sophisticated analyses. Molecular Phylogenetics and Evolution, 64, 285-296. Ferreira, M., Aleixo, A., Ribas, C. C. & Santos, M. P. D. (2016). Biogeography of the Neotropical genus Malacoptila (Aves: Bucconidae): the influence of the Andean orogeny, Amazonian drainage evolution and palaeoclimate. Journal of Biogeography, doi:10.1111/jbi.12888. Fitzpatrick, J. W. (1976). Systematics and biogeography of the tyrannid genus Todirostrum and related genera (Aves). Bulletin of the Museum of Comparative Zoology, 147, 435-463. Fitzpatrick, J. W. & O’Neill, J. P. (1979). A new Tody-tyrant from northern Peru. The Auk, 96, 443-447. 35
Fjeldså, J., Zuccon, D., Irestedt, M., Johansson, U. S. & Ericson, P. G. P. (2003). Sapayoa aenigma: a New World representative of 'Old World suboscines'. Proceedings of the Royal Society B, doi: 10.1098/rsbl.2003.0075 Flórez-Rodríguez, A., Carling, M. D. & Cadena C. D. (2011). Reconstructing the phylogeny of "Buarremon" brush-finches and near relatives (Aves, Emberizidae) from individual gene trees. Molecular Phylogenetics and Evoution, 58, 297-303. Flot, J. F. (2010). Seqphase: a web tool for interconverting phase input/output files and fasta sequence alignments. Molecular Ecology Resources, 10, 162-6. Françoso, E., Zuntini, A. R., Carnaval, A. C., Arias, M. C. (2016). Comparative phylogeography in the Atlantic forest and Brazilian savannas: pleistocene fluctuations and dispersal shape spatial patterns in two bumblebees. BMC Evolutionary Biology, doi: 10.1186/s12862-016-0803-0. Garzione, C. N., Hoke, G. D., Libarkin, J. C., Withers, S., MacFadden, B., Eiler, J., Ghosh, P., Mulch, A. (2008). Rise of the Andes. Science, 320, 1304–1307. Gregory-Wodzicki, K. M. (2000). Uplift history of the central and northern Andes: a review. GSA Bulletin, 112, 1091–1105. Haffer, J. (1969). Speciation in Amazonian forest birds. Science, 165, 131–137. Haffer, J. & Prance, G. T. (2001). Climatic forcing of evolution in Amazonia during the Cenozoic: On the refuge theory of biotic differentiation. Amazoniana, 16, 579-608. Harris, S. E. & Mix, A. C. (2010). Climate and tectonic influences on continental erosion of tropical South America, 0-13 Ma. Geology, 30, 447-450. Heled, J. & Drummond, A. J. (2010). Bayesian inference of species trees from multilocus data. Molecular Biology and Evolution, 27, 570-80. Hellmayr, C. E. (1927). Catalogue of birds of the Americas and the adjacent islands, part 5. Publication. Field Museum of Natural History. Zoological series, 13, 517 p. Hoorn, C., Wesselingh, F. P., ter Steege, H., Bermudez, M.A., Mora, A., Sevink, J., Sanmartın, I., Sanchez-Meseguer, A., Anderson, C.L., Figueiredo, J.P., Jaramillo, C., Riff, D., Negri, F.R., Hooghiemstra, H., Lundberg, J., Stadler, T., Särkinen, T. 36
& Antonelli, A. (2010). Amazonia through time: Andean uplift, climate change, landscape evolution, and biodiversity. Science, 330, 927–931. Ihering, H. (1904). The biology of the Tyrannidae with respect to their systematic arrangement. The Auk, 21, 313-322. Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper. A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P. & Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28, 1647-1649. Kimball, R. T., Braun, E. L., Barker, F. K., Bowie, R. C., Braun, M. J., Chojnowski, J. L., Hackett, S. J., Han, K. L., Harshman, J., Heimer-Torres, V., Holznagel, W., Huddleston, C. J., Marks, B. D., Miglia, K. J., Moore, W. S., Reddy, S., Sheldon, F. H., Smith, J. V., Witt C. C. & Yuri, T. (2009). A well-tested set of primers to amplify regions spread across the avian genome. Molecular Phylogenetics and Evolution, 50, 654-60. Lanfear, R., Calcott, B., Ho, S. Y. & Guindon, S. (2012). Partitionfinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution, 29, 1695-701. Lanyon, W. E. (1984). A phylogeny of the kingbirds and their allies. American Museum Novitates, 2797. Lanyon, W. E. (1985a). Molecular perspective on higher-level relationships in the Tyrannoidea (Aves). Systematic Zoology, 34, 404–418. Lanyon, W. E. (1985b). A phylogeny of the myiarchine flycatchers. Ornithological Monographs, 36, 361–380. Lanyon, W. E. (1986). A phylogeny of the thirty-three genera in the Empidonax assemblage of tyrant flycatchers. American Museum Novitates, 2846. Lanyon, W. E. (1988a). A phylogeny of the thirty-two genera in the Elaenia assemblage of tyrant flycatchers. AmericanMuseum Novitates, 2914. 37
Lanyon, W. E. (1988b). The phylogenetic affinities of the flycatcher genera Myiobius Darwin and Terenotriccus Ridgeway. American Museum Novitates, 2915. Lanyon, W. E. (1988c). A phylogeny of the flatbill and tody-tyrant assemblage of tyrant flycatchers. American Museum Novitates, 2923, 1-41. Larsson, A. (2014). AliView: a fast and lightweight alignment viewer and editor for large data sets. Bioinformatics, 30, 3276-3278. Marchant, R., Behling, H., Berrio, J. C., Cleef, A., Duivenvoorden, J., Hooghiemstra, H., Kuhry, P., Melief, B., Schreve-Brinkman, E., Van Geel, B., Van Der Hammen, T., Van Reenen, G. & Wille, M. (2002). Pollen-based biome reconstructions for Colombia at 3000, 6000, 9000, 12 000, 15 000 and 18 000 14C yr ago: Late Quaternary tropical vegetation dynamics. Journal of Quaternary Science, 17, 113-129. Mata, H., Fontana, C. S., Maurício, G. N., Bornschein, M. R., Vasconcelos, M. F. & Bonatto, S. L. (2009). Molecular phylogeny and biogeography of the eastern Tapaculos (Aves: Rhinocryptidae: Scytalopus, Eleoscytalopus): Cryptic diversification in Brazilian Atlantic Forest. Molecular Phylogenetics and Evolution, 53, 450-462. Maurício, G. N., Mata, H., Bornschein, M. R., Cadena, C. D., Alvarenga, H. & Bonatto, S. L. (2008). Hidden generic diversity in Neotropical birds: Molecular and anatomical data support a new genus for the Scytalopus indigoticus species-group (Aves: Rhinocryptidae). Molecular Phylogenetics and Evolution, 49, 125-135. Meyer de Schauensee, R. (1966). The species of birds of South America and their distribution. Philadelphia: Publications of Academy of Natural Sciences, 577 pp. Peizhen, Z., Molnar, P. & Downs, W. R. (2001). Increased sedimentation rates and grain sizes 2–4 Myr ago due to the influence of climate change on erosion rates. Nature, 410, 891–897. Pérez-Emán, J. L. (2005). Molecular phylogenetics and biogeography of the Neotropical redstarts (Myioborus; Aves, Parulinae). Molecular Phylogenetics and Evolution, 37, 511–528. 38
Peterson, A. T., Ammann, C. M. (2012). Global patterns of connectivity and isolation of populations of forest bird species in the late Pleistocene. Global Ecology and Biogeography, doi: 10.1111/geb.12010. Porzecanski A. L. & Cracraft, J. (2005). Cladistic analysis of distributions and endemism (CADE): using raw distributions of birds to unravel the biogeography of the South American aridlands. Journal of Biogeography, 32, 261–275. Rambaut, A., Suchard, M. A., Xie, D. & Drummond, A. J. (2014). Tracer v1.6. Available at: http://tree.bio.ed.ac.uk/ software/tracer/. Rheindt, F. E., Cuervo, A. M. & Brumfield, R. T. (2013). Rampant polyphyly indicates cryptic diversity in a clade of Neotropical flycatchers (Aves: Tyrannidae). Biological Journal of the Linnean Society, 108, 889-900. Rheindt, F. E., Krabbe, N., Wee, A. K. S. & Christidis, L. (2015). Cryptic speciation in the Lesser Elaenia Elaenia chiriquensis (Aves: Passeriformes: Tyrannidae). Zootaxa, 4032, 251-263. Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D. L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M. A. & Huelsenbeck, J. P. (2012). MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61,1-4. Ribas, C. C., Aleixo, A., Nogueira, A. C. R., Miyaki, C. Y. & Cracraft, J. (2012). A palaeobiogeographic model for biotic diversification within Amazonia over the past three million years. Procedings of the Royal Society B, 279, 681–689. Ridgway, R. (1907). The birds of North and Middle America, part 4. Bulletin of United States National Museum, 50, 973 pp. Schultz, E. D., Burney, C. W., Brumfield, R. T., Polo E. M., Cracraft, J. & Ribas, C. C. (2017). Systematics and biogeography of the Automolus infuscatus complex (Aves; Furnariidae): Cryptic diversity reveals western Amazonia as the origin of a transcontinental radiation. Molecular Phylogenetics and Evolution, 107, 503–515. Sclater, P. L. (1888). Catalogue of the birds in the British Museum, vol. 14. London: British Museum (Natural History), 494 pp. 39
Shang, H. Y., Li, Z. H., Dong, M., Adams, R. M., Miehe, G., Opgenoorth, L. & Maoa, K. S. (2015). Evolutionary origin and demographic history of an ancient conifer (Juniperus microsperma) in the Qinghai-Tibetan Plateau. Scientific Reports, 5, 1-15. Silva, J. M. C. (1995). Biogeographic analysis of the South American Cerrado avifauna. Steenstrupia, 21, 49–67. Short, L. (1975). A zoogeographic analysis of the South American chaco avifauna. Bulletin of the American Museum of Natural History, 154, 163-352. Smith, B. T., Amei, A. & Klicka, J. (2012). Evaluating the role of contracting and expanding rainforest in initiating cycles of speciation across the Isthmus of Panama. Proceedings of Royal Society B, 279, 3520–3526. Smith, B. T., McCormack, J. E., Cuervo, A. M., Hickerson, M. J., Aleixo, A., Cadena, C. D., Pérez-Emán, J., Burney, C. W., Xie, X., Harvey, M. G., Faircloth, B. C., Glenn, T. C., Derryberry, E. P., Prejean, J., Fields, S. & Brumfield, R. T. (2014). The drivers of tropical speciation. Nature, 515, 406–9. Sorenson, M. D., Ast, J. C., Dimcheff, D. E., Yuri, T., Mindell D. P. (1999). Primers for a PCR-based approach to mitochondrial genome sequencing in birds and other vertebrates. Molecular Phylogenetics and Evolution, 12, 105-114. Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688-2690. Stephens, M., Smith, N. J., & Donnelly, P. (2001). A new statistical method for haplotype reconstruction from population data. American Journal of Human Genetics, 68, 978-89. Suh, A., Smeds, L. & Ellegren, H. (2015). The Dynamics of Incomplete Lineage Sorting across the Ancient Adaptive Radiation of Neoavian Birds. PLOS Biology, 13, 1-18. Tello, J. G. & Bates, J. M. (2007). Molecular phylogenetics of the tody-tyrant and flatbill assemblage of tyrant flycatchers (Tyrannidae). The Auk, 124, 134–154. 40
Tello, J. G., Moyle, R. G., Marchese, D. J. & Cracraft, J. (2009). Phylogeny and phylogenetic classification of the tyrant flycatchers, cotingas, manakins, and their allies (Aves: Tyrannides). Cladistics, 25, 429–467. Tobias, J. A., Bates, J. M., Hackett, S. J. & Seddon, N. (2008). Comment on “The latitudinal gradient in recent speciation and extinction rates of birds and mammals.” Science, 319, 901. Traylor, M. A., (1977). A classification of the tyrant flycatchers (Tyrannidae). Bulletin of the Museum of Comparative Zoology, 148, 129-184. Wang, X., Edwards, R. L., Auler, A. S., Cheng, H., Kong, X., Wang, Y., Cruz, F. W., Dorale, J. A. & Chiang, H. W. (2017). Hydroclimate changes across the Amazon lowlands over the past 45,000 years. Nature, 541, 204-207. Warter, S. L. (1965). The cranial osteology of the New World Tyrannoidea and its taxonomic implications. Ph.D. diss., Louisiana State Univ. Microfilms, Ann Arbor, Michigan, order no. 66-761. Weir, J. T. & Schluter, D. (2008). Calibrating the avian molecular clock. Molecular Ecology, 17, 2321-2328. Zimmer, J. T. (1940). Studies of Peruvian birds. No. 34. The genera Todirostrum, Euscarthmornis, Snethlagea, Poecilotriccus, Lophotriccus, Myiornis, Pseudotriccus, and Hemitriccus. American Museum Novitates, 1066, 1-23. Zimmer, J. T. (1953). Notes on tyrant flycatchers (Tyrannidae). American Museum novitates, 1605, 1-16.
9. Figures 41 42
Fig. 1 BI tree based on entire concatenated dataset of five genes (cytb, ND2, G3PDH, Musk and RAG2, totalizing 3106 bp). The color of the circles at nodes indicates posterior probability support, > 0.95 (black), 0.95–0.75 (gray). 43 44
Fig. 2 ML tree based on entire concatenated dataset of five genes (cytb, ND2, G3PDH, Musk and RAG2, 3106 bp). The color of the circles at nodes indicates posterior probability support, > 95 (black), 95–70 (gray). 45 46
Fig. 3 Species tree estimated by *BEAST using the entire dataset of five genes (cytb, ND2, G3PDH, Musk and RAG2, 3106 bp). The names of proposed genera are shown besides each clade containing names of currently recognized taxa. Proposed tribes (Hemitriccini and Todirostrini) are also shown. The color of the circles at nodes indicates posterior probability support, > 0.95 (black).
Fig. 4 Species tree estimated by *BEAST using the entire dataset of five genes (cytb, ND2, G3PDH, Musk and RAG2, totalizing 3106 bp) showing phylogenetic relationships between proposed genera. Proposed tribes (Hemitriccini and Todirostrinae) are also shown. The color of the circles at nodes indicates posterior probability support, > 0.95 (black). 47
10. Supplementary material
Table S1. List of tissue samples used in this study. Acronyms: INPA (Instituto Nacional de Pesquisas da Amazônia), MPEG (Museu Paraense Emílio Goeldi), LSUMZ (Louisiana State University Museum of Zoology), MSB (Museum of Southwestern Biology-University of New Mexico), KU (Kansas University Biodiversity Institute and Natural History Museum) and MBUCV (Museo de Biología de la Universidad Central de Venezuela), FMNH (Field Museum of Natural History), ZMUC (Zoological Museum of University of Copenhagen), LGEMA (Laboratório de Genética e Evolução Molecular de Aves da Universidade de São Paulo) and MZUSP (Museu de Zoologia da Universidade de São Paulo).
sample collection species subspecies country locality Atalotriccus Region 9; Ireng River, B48550 LSUMZ pilaris griseiceps Guyana km Karasabai Panamá Province, 0.5 Atalotriccus km SSW mouth Rio B28419 LSUMZ pilaris wilcoxi Panama Farfan Hemitriccus cinnamomeipectu Zamora-Chiape near 125252 ZMUC s - Ecuador Chinapinza (-4 -78,45) Hemitriccus San Martín 22 km W cinnamomeipectu Florida, pomacoches; B44430 LSUMZ s - Peru 2400m Acre, Assis Brasil, ca. 10 Hemitriccus km E , Estrada da AB001 MPEG cohnhafti - Brazil Pedreira Acre, Assis Brasil, ca. 10 Hemitriccus km E , Estrada da AB002 MPEG cohnhafti - Brazil Pedreira Acre, Assis Brasil, Hemitriccus Estrada da Pedreira, ASS001 MPEG cohnhafti - Brazil "Museu" Minas Gerais, Mata da Hemitriccus Família Cobra, 15402 LGEMA diops - Brazil Munícipio de Ladainha Minas Gerais, Fazenda Hemitriccus Duas Barras, Município 15541 LGEMA diops - Brazil Santa Maria do Salto Hemitriccus Amazonas, Margem flammulatus A4785 INPA flammulatus Brazil esquerda do Rio Purus; 48
Flona Purus; Rio Inauini; "Colônia Vista Alegre"; ca 45 km NW Boca do Acre Ucayali Department, SE Hemitriccus slope Cerro Tahuayo, ca B11287 LSUMZ flammulatus flammulatus Peru km ENE Pucallpa Hemitriccus Porta do Bosque Penedo, 82515 MZUSP furcatus - Brazil Itatiaia, RJ. Cajamarca, Quebrada Hemitriccus Lanchal ca. 8 Km ESE B32223 LSUMZ granadensis - Peru Sallique Hemitriccus Pasco, Cumbre de Ollon, B1877 LSUMZ granadensis - Peru 12 km E Oxapampa Pernambuco, Barreiros, Hemitriccus Engenho Cachoeira CP092 MPEG griseipectus - Brazil Linda Pará, Serra dos Carajas, floresta nacional Hemitriccus Tapirape - Aquiri, B25533 LSUMZ griseipectus - Brazil Projecto Salobo Alagoas, Ibateouara, Hemitriccus Envenho Ceimba, Usina 399301 FMNH griseipectus - Brazil Serra Grande Hemitriccus - A2642 INPA griseipectus Brazil Amazonas, Ipixuna La Paz, T C O Campamento Araona, Hemitriccus "Palmasola", Rio 391178 FMNH griseipectus - Bolivia Manupari Ucayali Department, SE Hemitriccus slope Cerro Tahuayo, ca B11036 LSUMZ griseipectus - Peru ENE Pucallpa Hemitriccus - Roraima, Parque inornatus Nacional Viruá, margem esquerda do Rio Iruá, localidade A1009 INPA Brazil "Campinarana" Amazonas, Margem direita do Rio Daraha, afluente da margem Hemitriccus esquerda Rio Negro; ca A6410 INPA inornatus - Brazil 25 km E Santa Isabel 35676 LSUMZ Hemitriccus - Brazil Amazonas, N. bank Rio 49
iohannis Solimoes, ca 4.5 km NE Sao Paulo de olivenca Hemitriccus Pará, Almeirim, REBIO CN856 MPEG josephinae - Brazil Maicuru Hemitriccus Pará, Almeirim, REBIO CN890 MPEG josephinae - Brazil Maicuru Hemitriccus Santa Catarina, Mun. 82516 MZUSP kaempferi - Brazil Antonio Carlos Santa Catarina: Joinville; Hemitriccus São Marcos; Estrada do A17063 INPA kaempferi - Brazil Arataca Hemitriccus margaritaceivent B17174 LSUMZ er margaritaceiventer Argentina Needs editing Roraima, Caracaraí; Vila Hemitriccus Petrolina; Estrada margaritaceivent breweri Perdida; ca 30 Km da er base do Parque Nacional A1821 INPA Brazil do Viruá Hemitriccus Pará, Canaã dos Carajás; margaritaceivent Flona Carajás; Serra do A3337 INPA er margaritaceiventer Brazil Tarzan Hemitriccus Amazonas, Rodovia A4045 margaritaceivent Apuí. Novo Aripuanã ca. INPA er margaritaceiventer Brazil 35 km Norte de Apuí Hemitriccus San Martín Department, margaritaceivent Chuchial, ca 37 km SE B38444 LSUMZ er margaritaceiventer Bolivia Samaipata Hemitriccus Amazonas, Ca 100 km B25582 LSUMZ minor snethlageae Brazil W Humaita Hemitriccus Pará, Marajó, Breves, MAYA050 MPEG minor minor Brazil Sítio do Waldir Santa Cruz, Velasco; Parque Nacional Noel Hemitriccus Keonpff Mercado 86 km B18354 LSUMZ minor snethlageae Bolivia ESE Florida Acre, Senador Hemitriccus Guiomard, Ramal Nabor UFAC321 MPEG minor minor Brazil Júnior, km 26 Amazonas, Munic. Novo Hemitriccus Airao; Arquipelago das B20248 LSUMZ minor pallens Brazil Anavilhanas Hemitriccus Amazonas, Japurá, Rio JAP548 MPEG minor pallens Brazil Acanauí 50
Hemitriccus Acre, Guajará, 35 km AA10 MPEG minimus - Brazil NW de Cruzeiro do Sul Amazonas, Parque Hemitriccus Nacional do Jau', Lago B25472 LSUMZ minimus - Brazil Supia' Santa Cruz, Velasco; Pre Parque Nacional Noel Hemitriccus Kempff Mercado, 30 km B15280 LSUMZ minimus - Bolivia E Aserradero Moira Ceará, Mun. Hemitriccus Guaramiranga, Serra de 10403 LGEMA mirandae - Brazil Baturité Ceará, Mun. Guaramiranga, Serra de Hemitriccus Baturité, Hotel Remanso 10423 LGEMA mirandae - Brazil da Serra
Hemitriccus 2404 LGEMA nidipendulus paulistus Brazil São Paulo, Juquitiba Hemitriccus 2412 LGEMA nidipendulus paulistus Brazil São Paulo, Juquitiba Minas Gerais, Pedra de Hemitriccus São Domingos, 2213 UFMG obsoletus obsoletus Brazil município de Gonçalves Hemitriccus FRA147 LGEMA obsoletus zimmeri Brazil Paraná, Quatro Barras Hemitriccus São Paulo, Fazenda 2078 LGEMA orbitatus Brazil Barreiro Rico, Anhembi Santa Catarina, Hemitriccus Blumenau, Vila SC021 MPEG orbitatus - Brazil Itoupava, Sítio Paraíso Hemitriccus 1247 LGEMA orbitatus - Brazil São Paulo, Buri Loreto, Ca 86 km SE Hemitriccus Juanjui on E bank upper B40212 LSUMZ rufigularis - Peru Rio Pauya La Paz Department, Prov. B. Saavedra, 83 Hemitriccus km by road E charazani, B22606 LSUMZ rufigularis Bolivia Cerro Asunta Pata. La Paz Department, Prov. B. Saavedra, 83 Hemitriccus km by road E. B22877 LSUMZ spodiops - Bolivia Charazani, Cerro Asunta 51
Pata. Hemitriccus Puno Department, 25 km B58390 LSUMZ spodiops - Peru NE San Juan de Oro Hemitriccus Maranhão, Centro Novo, GUR007 MPEG striaticollis striaticollis Brazil REBIO Gurupi Amazonas, Localidade "Bom Lugar"; Hemitriccus striaticollis interflúvio striaticollis Madeira-Purus; ca 45 A4726 INPA Brazil Km NE Boca do Acre Hemitriccus San Martín Department, B45999 LSUMZ striaticollis striaticollis Peru Ca 10 km NW Prioja Amapá, Sonho Meu, ca Hemitriccus 8 km by road W Porto B25545 LSUMZ zosterops zosterops Brazil Grande Amazonas, Parque Nacional do Jaú; Hemitriccus margem direita Rio Jaú, A2029 INPA zosterops zosterops Brazil "trilha do Nazaré" Hemitriccus Loreto Department, 79 B27526 LSUMZ zosterops zosterops Peru km WNW Contamana Amazonas, Munic. Manaus; km 34 Zf-3, Hemitriccus Faz. Esteio, ca 80 km N. B20168 LSUMZ zosterops zosterops Brazil Manaus Amazonas, Campinas Boca do Acre, Margem esquerda do Rio Purus; Lophotriccus - Flona Purus; Rio Inauini; eulophotes "Colônia Vista Alegre"; ca 45 km NW Boca do A4775 INPA Brazil Acre Lophotriccus 37200 MSB eulophotes - Peru Madre de Dios, Alerta Acre, Santa Rosa, Lophotriccus margem esquerda Rio UFAC1450 MPEG eulophotes - Brazil Purus, ca. 3 km da foz Lophotriccus BAR030 MPEG galeatus Belém Center Brazil Pará, Barcarena Roraima, 15 km WSW Caracarai; margem Lophotriccus esquerda R Branco, A1686 INPA galeatus Branco River Brazil vicinal Agua Boa MPDS1338 MPEG Lophotriccus Tapajós Center Brazil Pará, Jacareacanga, 52
galeatus FLONA Crepori, Porto Seguro, Serra Grande Lophotriccus Maranhão, Centro Novo, GUR260 MPEG galeatus Belém Center Brazil REBIO Gurupi Amazonas, Rio Japurá, margem esquerda, ca 50 Lophotriccus Km SE Vila Bittencourt, A18422 INPA galeatus - Brazil comunidade Taboca Amazonas, Margem esquerda do Rio Negro, Lophotriccus - ca 10 km E São Gabriel galeatus da Cachoeira, estrada da A1102 INPA Brazil Olaria Lophotriccus Pará, Itaituba, PARNA TM053 MPEG galeatus Tapajós Center Brazil Jamanxin Roraima, Parque Nacional Viruá, margem Lophotriccus esquerda do Rio Branco, A1740 INPA galeatus Branco River Brazil "Sitio do Neri" Lophotriccus Amazonas, São Gabriel A13588 INPA galeatus - Brazil da Cachoeira, PPBIO Lophotriccus KU1386 KU galeatus - Guyana Iwokrama Reserve Lophotriccus Sipaliwini District, Lely B65855 LSUMZ galeatus - Suriname Gebergte Cajamarca Department, Lophotriccus Ca 3km NNE San Jose B33079 LSUMZ pileatus pileatus Peru de Lourdes Lophotriccus 27349 MSB pileatus hypochlorus Peru Cusco, San Pedro Lophotriccus 36788 MSB pileatus hypochlorus Peru Cusco, Cadena Chiriquí Province, Dist. Gualaca, Cordillera Lophotriccus Central, 4.3 km by road B28166 LSUMZ pileatus luteiventris Panama S Lago Fortuna dam Estado Zulia, Perijá, Serranía de; Serranía Las Anatenas, Las Lajas, Lophotriccus Campamemto 900; IC892 MBUCV pileatus sanctaeluciae Venezuela Estado Zulia San José Province, Lophotriccus Moravia, Bajo La B81956 LSUMZ pileatus luteiventris Costa Rica Hondura 53
Lophotriccus B44510 LSUMZ pileatus pileatus Peru San Martín Department Lophotriccus B66697 LSUMZ pileatus squamaecrista Peru Tumbes Department Lophotriccus Amazonas, 13 km S B25501 LSUMZ vitiosus congener Brazil Benjamin Constant Roraima, Caracaraí; Vista Alegre; margem Lophotriccus esquerda do Rio Branco; vitiosus ca 30 Km W da base do Parque Nacional do A2153 INPA gianensis Brazil Viruá Lophotriccus CAM091 MPEG vitiosus vitiosus Brazil Amazonas, Guajará Amazonas, RDS Lophotriccus Cujubim, margem E Rio CUJ140 MPEG vitiosus congener Brazil Jutaí Lophotriccus Loreto Department, 7km B42457 LSUMZ vitiosus affinis Peru SW Jeberos Ucayali Department, SE Lophotriccus slope Cerro Tahuayo, ca B11251 LSUMZ vitiosus vitiosus Peru km ENE Pucallpa Lophotriccus Pará, Óbidos, Flota do CN221 MPEG vitiosus guianensis Brazil Trombetas Lophotriccus 27776 MSB vitiosus affinis Peru San Martín, Sianbal Puno Department, Below Myiornis Putina, ca 25 km NE San B58394 LSUMZ albiventris - Peru Juan de Oro Myiornis Esmeraldas Province, Ca B30018 LSUMZ atricapillus - Ecuador 2.7 km E Alto Tambo Myiornis Darrien Province, Cana, B2247 LSUMZ atricapillus - Panama on E slope Cerro Pirré Myiornis Santa Catarina, Indaial, SC155 MPEG auricularis auricularis Brazil Ribeirão Quati Roraima, 10 Km NW Boa Vista; Estação Myiornis Ecológica Maracá, A1765 INPA ecaudatus miserabilis Brazil "grid" Mato Grosso, Cotriguaçu, margem Myiornis esquerda Rio Juruena, A5104 INPA ecaudatus ecaudatus Brazil Fazenda São Nicolau GUR159 MPEG Myiornis sp. - Brazil Maranhão, Centro Novo, 54
REBIO Gurupi Maranhão, Centro Novo, GUR231 MPEG Myiornis sp. - Brazil REBIO Gurupi Atlántida Department, Oncostoma Pasque Nacional pico B60634 LSUMZ cinereigulare - Honduras Bonito, EL Naranjo. Bocas del Toro Province, Rio Oncostoma Changuinola Arriba, W B46457 LSUMZ cinereigulare - Panama bank Panamá Province, Old Oncostoma Gamboa Road, 5 km B26945 LSUMZ olivaceum - Panama NW Paraiso Oncostoma Darién Province, Cana, B2222 LSUMZ olivaceum - Panama on E slope Cerri Pirré Madre de Dios, Moskitania, 13.4 km Poecilotriccus NNW Atalaya, l bank 433657 FMNH albifacies - Peru Alto Madre de Dios Loreto Department, 1.5 km S Libertad, S. bank Poecilotriccus Rio Napo, 80 km N B3214 LSUMZ calopterus - Peru Iquitos Rondonia, Sitio Amaro, Poecilotriccus 30 km sw Cachoeira 334377 FMNH capitale - Brazil Nazare on Jaru road Amazonas, Parque Estadual Sucunduri; margem esquerda R. Poecilotriccus Sucunduri, localidade A851 INPA capitalis - Brazil "Terra Preta" Poecilotriccus 391497 FMNH fumifrons penardi Brazil Amapa Amazonas, Serra do Poecilotriccus Tapirapecó, Aldeia A138 INPA fumifrons penardi Brazil Marari Poecilotriccus Amazonas, Borba, MAD534 MPEG latirostris austroriparius Brazil Puruzinho, Ilha Loreto Department, 1 Poecilotriccus km. N Rio Napo, 157 km 2847 LSUMZ latirostris caniceps Peru by river NNE Iquitos. Santa Cruz Department, Poecilotriccus Serrania de Huanchaca, 14792 LSUMZ latirostris aochropterus Bolivia 25 km SE Catarata Arco 55
Iris Poecilotriccus Amazonas Department, 44684 LSUMZ luluae - Peru Ca 20 km NE Florida Poecilotriccus Amazonas Department, 44685 LSUMZ luluae - Peru Ca 20 km NE Florida Poecilotriccus 1161 LGEMA plumbeiceps plumbeiceps Brazil São Paulo, Juquitiba Minas Gerais, Mata da Poecilotriccus Família Cobra, 15401 LGEMA plumbeiceps plumbeiceps Brazil Munícipio de Ladainha Cajamarca Department, Poecilotriccus Cordillera del Condor; B33793 LSUMZ ruficeps peruanum Peru Picorana Poecilotriccus Bolivar, Santa Elena 339653 FMNH russatus - Venezuela Highway, Km 122 Rondônia, ca 18 km N Poecilotriccus Abunã, margem direita A185 INPA senex - Brazil do Rio Madeira Amazonas, Margem direita do Rio Aripuanã, Poecilotriccus ca 100 km S Novo A275 INPA senex - Brazil Aripuanã Rondônia, Rio Mutumparaná, ca 145 km WSW Porto Velho, Poecilotriccus margem direita do Rio A128 INPA senex - Brazil Madeira Roraima, Fazenda Santa Cecilia, E bank Rio Poecilotriccus Branco, opposite Boa 389228 FMNH sylvia sylvia Brazil Vista Poecilotriccus Pará, Parauapebas; Flona A3333 INPA sylvia schulzi Brazil Carajás; Serra do N1 Panamá Province, Old Gamboa Road--golf Poecilotriccus course, 4km NW of B16532 LSUMZ sylvia schistaceiceps Panama Paraiso Roraima, Mun. Alto Alegre - Faz. Kannedy, Taeniotriccus margem direita do Rio MPDS0426 MPEG andrei - Brazil Mucajái Taeniotriccus Pará, Rio Xingu, Área 1 BMP021 MPEG andrei - Brazil - Ilha Grande B25518 LSUMZ Todirostrum illigeri Brazil Amazonas, 59 km E 56
chrysocrotaphum hwy. BR-319 by road Manaus - Antazes Pará, Aveiro, Rio Todirostrum Tapajós, margem A5290 INPA chrysocrotaphum simile Brazil esquerda, Escrivão Amazonas, Japura, Rio 457429 FMNH Todirostrum chrysocrotaphum Brazil Acanaui Pará, Canaã dos Carajás; Todirostrum cearae Flona Carajás; Serra Sul; A3584 INPA cinereum Brazil Bloco B Todirostrum El Beni, Laguna Suarez, 334485 FMNH cinereum coloreum Bolivia 5 km sw Trinidad Todirostrum San Martin, Rioja, 1 km 473764 FMNH cinereum peruanum Peru E Pará, Aveiro, Rio Tapajós, margem Todirostrum esquerda, Igarapé A5344 INPA maculatum mannectens Brazil Aricoré Roraima, Caracaraí; Vista Alegre; Ilha do Todirostrum Pascoal; Rio Branco; ca mannectens maculatum 26 Km W da base do Parque Nacional do A2147 INPA Brazil Viruá Todirostrum Amazonas, Manaus; A3149 INPA maculatum mannectens Brazil INPA V8 Limón Province, Todirostrum Reserva Biologica Hitoy B82078 LSUMZ nigriceps - Costa Rica Cerere Colón Province, Achiote Todirostrum Road, Ca 2 Km-bridge at B28763 LSUMZ nigriceps - Panama Rio Providencia Amazonas, Rio Araca', Todirostrum "Bacabal," ca -- km N B25451 LSUMZ pictum - Brazil Barcelos Amazonas, Munic. Manaus; km 34 ZF-3, Todirostrum Faz. Esteio, ca 80 km N B20229 LSUMZ pictum - Brazil Manaus. Minas Gerais, Mata da Todirostrum Família Cobra, 15406 LGEMA poliocephalum - Brazil Munícipio de Ladainha Todirostrum Minas Gerais, Fazenda 15478 LGEMA poliocephalum - Brazil Duas Barras, Município 57
Santa Maria do Salto Table S2. Primers used in the present study and respective temperature meltdown (Tm) for each one.
Tm Gene Primer Sequence (Celsius) Reference
Sorenson et Cytb L14990 AACATCTCCGCATGATGAAA 45 al., 1999
Tim Birt Cytb H16065 GTCTTCAGTTTTTGGTTTACAAGAC 45 unpublished
Cicero & Johnson, ND2 L5204 TAACTAAGCTATCGGGCCCAT 50 2001
Sorenson et ND2 H6313 CTCTTATTTAAGGCTTTGAAGGC 50 al., 1999
G3P-13 Fjeldså et G3PDH B TCCACCTTTGATGCGGGTGCTGGCAT 65 al., 2003
G3P-14 Fjeldså et G3PDH B AAGTCCACAACACGG TTGTA 65 al., 2003
MUSK- Kimball et MUSK 13F CTTCCATGCACTACAATGGGAAA 50 al., 2009
MUSK- Kimball et MUSK 13R CTCTGAACATTGTGGATCCTCAA 50 al., 2009
Tello et al., RAG2 R2-1 TCTTTTTTGGGCAGAAGGGATG 55 2009
Tello et al., RAG2 R2-6 TTTCTGGTTGTCAGACTGGTAG 55 2009 58
CAPÍTULO 2
The genus Lophotriccus (Aves: Rhynchocyclidae) 'exploded': hidden taxonomic diversity and fast Pleistocene diversification in Amazonia and across the Andes
GLAUCO KOHLER1*, MARIO COHN-HAFT2, ÉRICO M. POLO1, ALEXANDRE
ALEIXO3 and CAMILA C. RIBAS2
1 Programa de Pós-Graduação em Genética, Conservação e Biologia Evolutiva, Instituto
Nacional de Pesquisas da Amazônia, Av. André Araújo 2936, Manaus, AM 69060-001,
Brazil
2 Coordenação de Biodiversidade e Coleções Zoológicas, Instituto Nacional de Pesquisas da Amazônia, Av. André Araújo 2936, Manaus, AM 69060-001, Brazil
3Coordenação de Zoologia, Museu Paraense Emílio Goeldi, Campus de Pesquisa. Av.
Perimetral, 1901, 66077-530 Belém, PA, Brazil.
* Corresponding author. Email: [email protected]
Running Title: Phylogeny and Biogeography of Lophotriccus
11. ABSTRACT
The genus Lophotriccus Berlepsch, 1884, is widely distributed in lowlands and montane forests across the northern Neotropics and Central America. Despite controversial taxonomy, its relationships, species limits and relationships with closest relatives are poorly understood. In this study, we aim to estimate the phylogeny and reconstruct species limits and the historical biogeography of Lophotriccus, using a multilocus approach (5 loci, 3153 bp) covering all described taxa. We found that genus Lophotriccus is paraphyletic with respect to Oncostoma Sclater, 1862, and Hemitriccus minor (Snethlage, 1907). We also found that all traditionally recognized Lophotriccus are paraphyletic, except Lophotriccus eulophotes Todd, 1925. Species delimitation analysis supports a species status for all currently subspecies in the genus plus four geographically structured clades in Lophotriccus galeatus (Boddaert,1783). Historical ranges reconstruction optimized the western Amazonia and Central Andes as the most likely ancestral ranges, and suggests multiple diversification events across the Andes, Amazonian lowlands, and Central America coinciding with Pleistocene glacial cycles.
Texto formatado segundo as normas da revista Biological Journal of Linnean Society 59
ADDITIONAL KEYWORDS: ancestral ranges – Areas of Endemism – climatic cycles –
Lophotriccus - Neotropics – paraphyly – phylogenetics – Pleistocene – species limits.
12. INTRODUCTION
The Neotropical region harbors the highest rates of avian endemism and diversity on Earth (Haffer, 1969; Cracraft, 1985; Haffer & Prance, 2001). For more than a century, understanding how this diversity was generated and maintained over time has been a challenge for naturalists and researchers (Ribas et al., 2012; Smith et al., 2014). Several hypotheses aim to explain this pattern (Wallace, 1852; Ayres & Clutton-Brock, 1992; Haffer, 1969; Endler, 1977; Aleixo, 2004; Haffer & Prance 2001; Cheng et al., 2013; Batalha-Filho et al., 2014) and the results obtained so far suggest that Neotropical biodiversity is derived from a complex conjunction of processes (Bush, 1994; Bush & Oliveira, 2006; Rull, 2011).
Since the first documented observations of Wallace (1852) that the large Amazonian rivers acted as boundaries for species distributions, accumulating information on distribution patterns of better known groups, such as birds and primates, has led to the definition of Neotropical areas of endemism (Haffer, 1974; Cracraft, 1985; Borges & Silva, 2012). The origin of these areas may in part be related to landscape evolution, but more information both on landscape history and on diversification patterns are needed to establish clear causal relationships (Ribas et al., 2012; d’Horta et al., 2013; Fernandes et al., 2013; Thom & Aleixo, 2015).
Neotropical highlands comprise mountain chains extending from Mexico south to Argentina and Chile, in a complex mosaic of topographic units belonging to diverse geological formations (Gregory-Wodzicki, 2000) and play a key role in Neotropical diversification (Kattan et al., 2004). Andean mountain ranges are considered to be a biodiversity hotspot (Sedano & Burns, 2010; Fjeldså & Irestedt, 2009) harboring the richest avifauna in the Neotropics (Bonnacorso, 2009; Kattan et al., 2004, Hawkins et al., 2007). The complex mosaic of Andean habitats results from a series of orogenic events, creating a diverse array of new environments and promoting a series of vicariant events since the Miocene (Gregory-Wodzicki, 2000; Kattan et al., 2004), followed by Pleistocenic climatic fluctuations that produced cycles of range contraction and expansion leading to fragmentation of populations promoting speciation (Kattan et al., 60
2004; Cadena, Klicka & Ricklefs, 2007). In addition, the establishment of contact with Central and North American faunas via the Panama Isthmus, contributed to this biogeographic complexity by allowing faunal exchanges and posterior diversification of new lineages in situ (Kattan et al., 2004; Bacon et al., 2015, O'Dea et al., 2016). Andean orogenesis has also greatly influenced the evolution of Amazonian lowlands by reshaping the drainage system and consequently influencing the distribution of flooded and upland forests, and the position of large rivers that currently delimit species distributions (Hoorn et al., 2010; Latrubesse et al., 2010; Nogueira, Silveira & Guimarães, 2013).
Nevertheless, some authors have argued that a large proportion of the Andean avifauna is indeed derived from colonization from lowland forest habitats (Chapman, 1926; Moritz et al., 2000; Brumfield & Edwards, 2006) via long-distance dispersal (Descimon, 1986; Monasterio & Vuilleumier, 1986; van der Hammen & Cleef, 1986) or population displacement mediated by climatic cycles that changed the availability of optimal habitats in time and space (Brumfield & Edwards, 2007) leading to diversification. Data also suggest that Andean uplift has a key role in promoting diversification between lowland or mid-montane populations at both sides (Ribas et al., 2007; Miller et al., 2008; Fernandes et al., 2014; Harvey & Brumfield, 2015) as well as along the Andes (Antonelli et al., 2009; Chaves, Weir & Smith, 2011).
The genus Lophotriccus Berlepsch, 1884, is widely distributed in forest environments across the northern Neotropics including lowland and montane habitats. There are five Lophotriccus pileatus (Tschudi, 1844) subspecies distributed in the Andes, Tepuis and Central American mountains, while Lophotriccus vitiosus (Bangs & Penard, 1921) includes five subspecies from the Amazonian lowlands. The two remaining species in the genus, Lophotriccus eulophotes Todd, 1925 and Lophotriccus galeatus Boddaert, 1783 are also strictly lowland Amazonian. Considering its distribution, encompassing both lowland and montane forests, Lophotriccus is a good model to infer biogeographic history of the Neotropics, both within and across the Andes, and within the Amazonian lowlands, where a preponderance of the taxa occurs. However, as is the case with many Neotropical taxa, taxonomy of the family is underexplored (Tello & Bates 2007; Tello et al., 2009), and studies with dense sampling have not been performed for the genus, nor is it clear whether the genus is in fact monophyletic. Thus, including broad coverage of all other closely related species that could conceivably fall within the focal genus, here we aim to: (1) infer the phylogenetic relationships among all recognized taxa within 61
Lophotriccus; (2) understand the temporal patterns of diversification within the genus, relating them to landscape history of the Amazonian lowlands, the northern Andes and Central America; (3) investigate the demographic history of Andean and Amazonian taxa to test if there is a relationship with proposed patterns of paleoclimatic change in these regions.
13. METHODS
13.1 SAMPLING AND MOLECULAR MARKERS SELECTION
Samples were obtained from vouchered tissue collections, including all Lophotriccus taxa (Table S1). The genus Lophotriccus has a controversial taxonomy (see Lanyon, 1988, for details). We included samples of Atalotriccus pilaris (Cabanis, 1847), Hemitriccus minor (Snethlage, 1907), Oncostoma cinereigulare (Sclater, 1857) and Oncostoma olivaceum (Lawrence, 1862), as these taxa are closely related to Lophotriccus (Lanyon, 1988; Tello & Bates 2007; Tello et al., 2009). We also included Hemitriccus spodiops (Berlepsch, 1901), as it is related to Hemitriccus minor (Cohn-Haft, 1996) and to the recently described Hemitriccus cohnhafti Zimmer et al., 2013. We used Hemitriccus diops (Temminck, 1822) and H. zosterops (Pelzeln, 1868) as outgroups. We obtained sequences from the mitochondrial genes NADH dehydrogenase subunit 2 (ND2, 112 individuals) and cytochrome b (cytb, 92 individuals) and from three nuclear introns, G3PDH (88 individuals), MUSK (36 individuals) and RAG2 (38 individuals) for at least one individual per mtDNA clade.
13.2 DNA EXTRACTION, PCR-AMPLIFICATION AND SEQUENCING
DNA was extracted using a Promega DNA Purification Kit (A1125). The following PCR conditions were used: 94ºC for 4 minutes, followed by 30 cycles of 94ºC for 1 min, 50ºC for 1 min and 72ºC for 2 min, ending in 72ºC for 10 min. The meltdown temperatures were adjusted according to specific primers used (see details in Table S2). PCR products were purified using PEG (polietilenoglicol) 8000 20% NaCl 2.5 M. Sequencing reaction follows Platt, Woodhall & George (2007) with specific 62 modifications for each primer, using a BigDye Terminator 3.1 kit and run in a 3130x Applied Biosystems automated sequencer.
13.3 PHYLOGENETIC ANALYSIS OF MTDNA AND STRUCTURE OF NUCLEAR MARKERS
Chromatograms were checked and edited using Geneious version R9 (Kearse et al., 2012), and aligned using Aliview (Larsson, 2014). The best partition and nucleotide substitution model was selected using PartitionFinder 1.1.1 (Lanfear et al., 2012), partitioning by gene under a Bayesian Information Criteria (BIC). Bayesian haplotype reconstruction for the nuclear loci was performed using SeqPHASE (Flot, 2010) and PHASE 2.1 (Stephens, Smith & Donnelly, 2001). Phylogenetic reconstructions were performed with the mtDNA concatenated dataset using Bayesian Inference (BI) and Maximum Likelihood (ML) methods in MrBayes 3.2.1 (Ronquist et al., 2012) and RAxML (Stamatakis, 2006), respectively. For BI we ran 1 chain of 2 parallel runs of 106 generations sampling every 1000 generations, and a 10% burnin. The ML tree was obtained by a rapid bootstrap (1000 replicates) search under a GTR substitution model. We performed a population structure analysis of the nuclear markers (G3PDH, MUSK and RAG2) under the assumption of large effective population sizes and extended time for lineage sorting, using Bayesian Analysis of Population Structure, BAPS 6.0 (Corander et al., 2008). We aimed with this analysis to define the number of subpopulations in our nuclear sampling, assigning individuals to each cluster by a mixture analysis, taking into account the linkage among sites from the same marker (Corander & Tang, 2007). These results were in turn used to perform admixture analysis, allowing identification of ancestral polymorphisms or gene flow by assignments of portions of the genotype in each of the subpopulations found (Corander & Marttinen, 2006). We calculated the likelihoods for each number of subpopulations (K values), in a 1-20 range 3 times in the mixture analysis, accepting the best K values. We performed subsequent runs with decreasing K values, to search for groupings among each defined subpopulation. The admixture analysis started with 50 iterations, 50 reference individuals and 10 iterations per individual, with these parameters being doubled until results converged. 63
13.4 BAYESIAN SPECIES TREE AND MOLECULAR DATING
We used the entire dataset of 5 loci (mtDNA plus 4 introns) to perform a Bayesian species tree analysis using *BEAST (Heled & Drummond, 2010) in Beast 1.8.2 (Drummond et al., 2012). We assigned hypothesized species based on well-supported clades (p<0.95) in the mtDNA topology that were also geographically structured. Sampling multiple loci from multiple individuals of each lineages improves phylogenetic inference and molecular dating by directly modeling intraspecific polymorphism and incomplete lineage sorting (Shang et al., 2015). We used the cytb mutation rate of 0.0105 substitution/site/lineage/million years (Weir & Schluter, 2008) in an uncorrelated lognormal relaxed clock, setting the cytb.ucld.mean prior to a normal distribution with mean 0.0105 and stdev of 0.003. We applied a Birth-death speciation tree model and set the species.popMean and species.birthDeath.meanGrowthRate priors to a proper Exponential (mean=1). A birth-death model of speciation is more realistic as it takes into account both processes of speciation and extinction of lineages during the process of diversification (Gernhard, 2008) Two independent runs of 2 x 108 generations were performed sampling trees every 20000 generations. Posterior distributions, ESS values and burnin were checked in Tracer1.6 (Rambaut et al., 2014).
13.5 TESTING SPECIES DELIMITATION HYPOTHESES
The resulting species tree was used as a guide tree for a Bayesian Population Phylogenetic (BPP) analysis (McKay et al., 2013; Satler, Carstens & Hedin, 2013), a species delimitation method that evaluates speciation models using a reversal jump Markov Chain Monte Carlo (rjMCMC) algorithm to determine whether to collapse or retain nodes in a phylogeny. This approach aims to determine the evolutionary units (species) and allows inferring cryptic diversity in lineages that present genetic structure not necessarily related to geography. We also aim to test whether the subspecies described and recovered as monophyletic groups in the mtDNA analysis can be treated as full species. For this analysis we used the entire dataset of 5 loci (mtDNA plus 4 introns). We tested four combinations of settings: 1) species delimitation set to 1, species model prior set to 2, algorithm 0, fine-tune parameter (ε) set to 2; 2) species delimitation 1, species model prior 2, algorithm 1, fine-tune parameter (α, m) set to 2 and 1; 3) species delimitation set to 1, species model prior set to 3, algorithm 0, fine-tune parameter (ε) set 64 to 2; 4) species delimitation set to 1, species model prior set to 3, algorithm 1, fine-tune parameter (α, m) set to 2 and 1. Analyses were run for 200,000 generations, with a sampling interval of 2 and burn-in of 4000. Population size parameters (θ) were assigned the gamma prior (2,2000), with mean 0.001. The divergence time at the root of the species tree (τ) was assigned the gamma prior (10,1000), while the other divergence time parameters were assigned the Dirichlet prior (Yang & Rannala, 2010).
13.6 ANCESTRAL RANGES RECONSTRUCTION
We reconstructed ancestral ranges using the R package BioGeoBEARS (Matzke, 2014), that implements several historical biogeography models under a likelihood approach, where the model that best fits the data is selected. Models include a likelihood version of DIVA (“DIVALIKE”), LAGRANGE’s DEC (Dispersal-Extinction‐Cladogenesis), and BAYAREA (Landis et al., 2013), with the option of including founder‐event speciation “+J” for all models. We considered 10 biogeographic regions following Cracraft (1985) and Borges & Silva (2012): Perijan Montane Center (PMC), Peruvian Andean Center (PAC), Central America (CA), Chocó Center (CH), Napo Center (NA), Inambari Center (IN), Tapajós Center (TC), Belém Center (BC), Guyana Shield (GU), and Jaú Center (JA). We used an area adjacency matrix, as several Lophotriccus species have overlapping distributions within some Areas of Endemism (hereafter AE) and some of them are adjacent.
14. RESULTS
14.1 PHYLOGENETIC ANALYSIS OF MTDNA AND POPULATION STRUCTURE OF NUCLEAR MARKERS
The BI based on the concatenated mitochondrial dataset (cytb and ND2, 1830 bp) recovered Atalotriccus as sister to a clade formed by Hemitriccus minor and the Lophotriccus/Oncostoma complex (Fig. 1, S1 and S2). We also found that the support of H. cohnhafti and H. spodiops to be sister to a clade that includes Lophotriccus, Oncostoma and H. m. pallens is weak (Fig. 3). The BI recovered a polyphyletic Lophotriccus distributed in two main groups (Fig. 1, 2 and 3): one, monophyletic, 65 including only some Amazonian Lophotriccus taxa from both sides of the Amazon River (Clade 1); and a second group (Clade 2) whereby Andean/Central American and Amazonian Lophotriccus taxa are paraphyletic with respect to Hemitriccus minor pallens (Todd, 1925), and these are subsequently sisters to Oncostoma spp. and the H. cohnhafti/spodiops clade (Fig. 3, 6). The cohnhafti/spodiops clade had weak support to be sister to the rest of taxa in Clade 2 in the mtDNA analysis, thus, this group could belong either in Clade 2 or Clade 1. The relationship sister between clades 1 and 2 is well supported in BI, although the weak support in Clade 2 would mean that Lophotriccus taxa in this clade are at least more closely related to Oncostoma than to the remaining Lophotriccus taxa sampled in Clade 1 (Fig. 3).
The results also suggest that the polytypic L. vitiosus and L. pileatus are paraphyletic and represent species complexes (Fig. 3). Currently described subspecies within these complexes are monophyletic, and their distributions correspond to Neotropical areas of endemism. Lophotriccus galeatus is also paraphyletic, and, although it is regarded as a monotypic species, the phylogeographic structure found also coincides with Neotropical areas of endemism (Fig. 2). We also found paraphyly in Hemitriccus minor, with subspecies H. m. pallens being sister to L. v. affinis (Fig. 3, 6). The ML analysis resulted in several nodes with lower support when compared to the BI analysis (Fig. 1, 2 and 3).
Our BAPS analysis including all three nuclear markers recovered two clusters corresponding to mtDNA clades 1 and 2, with some mixed genotypes between them (Fig. 4A). Higher structure was found when each marker was analyzed individually (Fig. 4 B-D). We used for these analysis from Clade 1: L. eulophotes (13 individuals), L. galeatus of Tapajós AE (6), L. galeatus of Branco River (6), L. galeatus of Belém AE (3), L. galeatus (18) and Clade 2: L. p. luteiventris (4), L. p. squamaecrista (1), L. p. sanctaeluciae (1), L. p. hypochlorus (11), L. p. pileatus (3), L. v. congener (2), L. v. vitiosus (4), L. v. guianensis (5), L. v. affinis (15), O. olivaceum (3), O. cinereigulare (4), H. m. pallens (2), H. cohnhafti (3) and H. spodiops (2). 66
14.2 BAYESIAN SPECIES TREE AND MOLECULAR DATING
The species tree (Fig. 5) was estimated using the entire dataset of 4 loci (mtDNA, G3PDH, MUSK and RAG2, 3153 bp) and recovered the same topology of BI and ML inferences based on the mtDNA (Fig. 2, 3).We found higher support for clade 2 in this analysis, contrasting the weak support of the mtDNA tree.The Amazonian Clade 1 had higher internal support than that found with mtDNA alone, with the paraphyly of L. galeatus confirmed (Fig. 5). MtDNA clades 1 and 2 appear as sister groups with high support (p=1) in the Bayesian species tree. Within the Clade 2, there is a moderately supported clade (p=0.97) including northwestern Amazonian, Andean, Chocó and Central American taxa that is also well supported in our mtDNA analysis (p=1, bootstrap=100). According to our dating analysis (Fig. 5), Clades 1 and 2 diverged in the early Pleistocene (1.83 Myr CI: 2.53 – 1.17). The first split within the Amazonian Clade 1 occurred much more recently, at about 0.43 Myr (CI: 0.72-0.19).
14.3 SPECIES DELIMITATION
All combinations tested by BPP using the complete dataset (mtDNA plus three introns) recovered all proposed species (well supported monophyletic groups in the mtDNA topology, see Table S3) within clades 1 and 2 (Table 1) as full species with high support (p=1 for all, except Lophotriccus pileatus squamaecrista (Lafresnaye, 1846) and Lophotriccus pileatus luteiventris Taczanowski, 1884, both with p=0.99 in all combinations. Most species recovered by our BPP analysis within Lophotriccus had already been recognized as subspecies, except for those within Lophotriccus galeatus. This latter species has no currently accepted subspecies, but we found it to be a complex comprising four species. Two of them occur north of the Amazon River, and two south of this river, in the Belém and Tapajós areas of endemism (Fig. 5). All these groups were recovered as full species (p=1). 67
14.4 RECONSTRUCTION OF ANCESTRAL RANGES
BioGeoBEARS model testing selected DIVALIKE+J as the best model that fit the data (Table 2). Ancestral ranges reconstruction suggested that the ancestral of the Lophotriccus complex occurred in the Inambari AE and the Peruvian Andean Center (Fig. 5). The ancestor of Clade 1 occurred in the Inambari AE, and the first split within this clade separated areas north (Guiana AE) and south (Tapajos AE) of the Amazon River. The northern lineage later occupied the Belem AE, south of the Amazon River. The ancestor of Clade 2 occupied the Inambari AE and then splited in the Chocó AE and Peruvian-Andean Center.
15. DISCUSSION
15.1 SISTEMATICS AND PHYLOGENETIC RELATIONSHIPS
Both mtDNA and multilocus species tree phylogenetic analysis recovered the same topology, although with some differences in the support of basal nodes in the latter (Fig. 5). We found higher support for clade 2 in species tree analysis, contrasting the weak support found in mtDNA. The Clade 1 had higher internal support in the multilocus species tree (p=1) as a whole than that found in mtDNA, with the population of L. galeatus from Tapajós AE sister to L. eulophotes (p=0.98, bootstrap=79) and support population of Guiana (p=1, bootstrap=18), Belém Center (p=1, bootstrap=100) and Branco River (p=1, bootstrap=100). Both analysis also recovered clades 1 and 2 as sister groups with high support (p=1) except in the ML (bootstrap = 53). Within the Clade 2 the node that includes Oncostoma species and all other species (except H. cohnhafti and H. spodiops) had weaker support in the species tree analysis (p=0.58) that in mtDNA (p=1, bootstrap=54). We also find weaker support in the node that includes L. v. guianensis and all other species in the species tree analysis (0.50) contrasting with mtDNA (p=0.95, boostrap=73). The node including the sister species L. v. congener and L. v. vitiosus and all other species had weaker support in species tree analysis (p=0.32) with respect to mt DNA (p=0.99, boostrap=69). There is a moderately supported clade (p=0.97) recovered in the species tree that includes the sister species L. p. hypochlorus and L. p. pileatus, the Andean/Central American lineage of L. pileatus (L. p. luteiventris, L. p. squamaecrista and L. p. sanctaeluciae) and the sister species H. m. pallens and L. v. affinis also well 68 supported in our mtDNA analysis (p=1, bootstrap=100). We also found weaker support in species tree (p=0.82) in the node that includes L. p. luteiventris, L. p. squamaecrista and L. p. sanctaeluciae and the sister species H. m. pallens and L. v. affinis contrasting with strong support in mtDNA (p=1, bootstrap=98). This suggests that there is no conflict in phylogenetic reconstruction using the two approaches of only mtDNA and the multilocus analysis using both mtDNA and nuclear genes, despite the weak supported nodes discussed. These differences in nodes supports in both approaches could be assigned to incomplete lineage sorting, which is well documented among several avian lineages (Flórez-Rodríguez, Carling & Cadena, 2011; Suh, Smeds & Ellegren, 2015), here, observed in our nuclear genes when analyzed separately (Figs S3-S8). Rapid evolving lineages seem to be common in the Andes (Pérez-Emán, 2005; Antonelli et al., 2009; DuBay & Witt, 2012), that could maintain ancestral polymorphisms, pointed out as a source of phylogenetic incongruence in several groups of organisms such as plants (López-Alvarado, 2014), birds (Bulgin et al., 2003), geckos (Šmíd et al., 2015) and even horses (Steiner et al., 2012). Retention of ancestral polymorphisms may also affect divergence time estimation (Angelis & Reis, 2015). Our results with BAPS (Fig 4A-D) illustrate this pattern of incomplete lineage sorting. However, the use of the nuclear genes contributed to reinforce the support of clades 1 and 2 in our analysis of species tree (Fig. 5), also show in our BAPS analysis using all nuclear markers (Fig4A). The nuclear markers also reinforce the terminal supports in this same analysis in contrast to mtDNA (Figs 1, 2 and 3). Our results agree with Tello & Bates (2007), with Atalotriccus pilaris being sister to a clade that includes Hemitriccus minor as sister to the Lophotriccus/Oncostoma complex. Also, Tello et al. (2009) recovered Oncostoma as sister to Lophotriccus with low support according to both BI and ML analyses. These findings differed from the proposals by Lanyon (1988), who suggested that Lophotriccus included Atalotriccus and that they were sisters to Oncostoma, which, in turn, was sister to Hemitriccus based on morphological characters of nasal/interorbital septum and nest architecture. Our phylogenetic analysis suggests paraphyly or polyphyly in all traditionally recognized Lophotriccus species, except for L. eulophotes. Lophotriccus galeatus comprises a complex of three distinct lineages (Figs 1, 2 and 5). The Tapajós AE population of L. galeatus was found to be a new taxon sister to L. eulophotes (Figs 1, 2 and 5). We also found a L. galeatus lineage restricted to the Belém AE that is sister to one of the two lineages found on the Guiana Shield (Figs 1, 2 and 5). Even though Guiana 69
Shield populations of L. galeatus are structured across the Negro and Branco Rivers according to our mtDNA analysis (Fig. 2), BPP species delimitations recovered these lineages as a single species (Table 1). We found that L. galeatus individuals collected along the Branco River formed a distinct lineage within the Guiana Shield (LgaleatusBR, Fig. 5), which was also recovered as a distinct species by the BPP analysis (Table 1). Future taxonomic work should provide phenotypic diagnoses and formally describe "L. galeatus" species level lineages recovered herein distributed in the Tapajós (LgaleatusTPJ) and Belém (LgaleatusBC) AEs as well as along the Branco River (LgaleatusBR).
Lophotriccus vitiosus comprises four distinct lineages corresponding to described subspecies, Lophotriccus vitiosus guianensis Zimmer, 1940 is sister to all other Lophotriccus taxa from Clade 2. Lophotriccus vitiosus congener Todd, 1925 and Lophotriccus vitiosus vitiosus (Bangs & Penard, 1921) are sister taxa, related to all other Lophotriccus in Clade 2 (Figs 1,3 and 5). Within the Clade 2, L. v. affinis is recovered as sister to H. m. pallens wich also indicates that Hemitriccus minor is also paraphyletic (Figs 1,3 and 5).
Lophotriccus pileatus comprises five distinct paraphyletic lineages corresponding to described subspecies where Lophotriccus pileatus sanctaeluciae Todd, 1952 is sister to L. p. luteiventris Taczanowski, 1884, plus L. p. squamaecrista and this clade is sister to L. v. affinis plus H. m. pallens (Figs 1,3 and 5). These two clades are sisters to L. p. pileatus and L. p. hypochlorus (Figs 1,3 and 5). Hemitriccus cohnhafti and H. spodiops are recovered as sister species and differed from the proposals of Cohn-Haft (1996) to be sister to H. m. pallens, although the specific relationships inferred for H. spodiops in that study, which did not include Lophotriccus or Oncostoma. Most remarkable in our phylogenetic reconstruction is that what have been considered two distinct and non-controversial genera, Lophotriccus and Oncostoma, based on plumage characteristics and bill morphology, are actually embedded within what has been treated as a single species (H. minor). This is consistent with previous molecular studies, but could not have been detected without the complete taxon sampling presented in the present study. It is now evident that the principal morphological characters used to delimit H. minor are actually ancestral traits in our study's ingroup, subsequently lost in all taxa heretofore treated as Lophotriccus and Oncostoma. In particular, the round and exposed nostrils, highly unusual in tyrant flycatchers in general 70 and treated as a synapomorphy for the subgenus Snethlagea (Cohn-Haft, 1996), because it is found only in H. minor, H. spodiops, and also in the recently described H. cohnhafti, would appear to have been retained in some taxa and lost in other complete lineages. This suggests important roles for natural selection and phylogenetic inertia in the presence or absence of this trait and offers a stunning example of the risk of using morphological characters in phylogenetic reconstruction.
Given the paraphyly of the genus Lophotriccus as a whole and the polyphyly or paraphyly of most of its species as recovered herein, current taxonomy does not represent accurately either the diversity or their evolutionary relationships. In this first study ever to sample all recognized taxa in Lophotriccus, two major groups were recovered: one grouping L. eulophotes and L. galeatus (Clade 1) and another grouping taxa of L. pileatus and L. vitiosus, which is nested within our Clade 2 (Figs. 2 and 3). Since the type species of Lophotriccus is L. pileatus (Amadon et al., 1979), the genus name should be applied to the clade uniting all taxa currently listed under L. pileatus and L. vitiosus. As for Clade 1, the taxon Colopteryx Ridgway, 1888, whose type species is L. galeatus (Amadon et al., 1979), is available as a genus name to group both L. galeatus and L. eulophotes taxa. Support for the monophyly of Colopteryx is high according to both mtDNA and species trees, as well as its complete evolutionary independence from the 'true' Lophotriccus taxa nested in Clade 2.
Recognizing both Colopteryx and Lophotriccus as outlined above would have the advantage of not affecting the recognition of the genus Oncostoma as currently defined, which was recovered as monophyletic by both mtDNA and species trees with high statistical support (Figs 3 and 5). Mutually diagnostic phenotypic characters diagnosing Oncostoma and 'true' Lophotriccus exist, such as the curved bill distinguishing the former and the crest characterizing the latter, therefore also supporting their treatment as distinct yet closely related genera. Finally, with the redefinition of the Lophotriccus as proposed herein, at least one taxon formerly grouped under Hemitriccus (H. minor pallens) should also be placed in Lophotriccus. Even though all generated trees placed Hemitriccus spodiops and Hemitriccus cohnhafti in Clade 2, and therefore as closer to both 'true' Lophotriccus (including L. pallens) and Oncostoma rather than the remaining Hemitriccus species, our results corroborate previous suggestions that Hemitriccus is non monophyletic (Tello & Bates 2007; Tello et al., 2009) and call for a reassessment of its systematics, which we plan to deal in a separate publication. 71
15.2 DIVERSIFICATION IN THE NEOTROPICS
It has been proposed that diversification patterns in the Andes may have been influenced by both their complex tectonic evolution during the Neogene (Chapman, 1926; Cracraft, 1985) and climatic oscillations during the Pleistocene (Haffer, 1974; Fjeldså, 1995). Our species tree inference shows that the two main Andean clades within the Lophotriccus/Oncostoma complex originated during the Pleistocene (Fig. 5), when the mountains were already high. Thus, these speciation events between taxa from western Amazonian lowlands and from Andean mid-montane forests might be more related to gradual changes in the habitat due to climatic cycles, with consequent adaptation of populations to different altitudinal ranges, than to the orogenesis itself. This pattern supports the hypothesis of ‘colonization’ proposed by Brumfield & Edwars (2007) for Thamnophilus antshrikes, where speciation processes could have been mediated by climatic perturbations resulting in displacement of appropriate habitats between highlands and lowlands. The optimization of ancestral distribution suggests a local extinction in mid montane forests after the basal vicariance between clades 1 and 2, since the most recent common ancestors of both clades occupied Inambari AE, with posterior recolonization of Andean habitats.
Data on speleothems (Burns et al., 2015) and palinological environmental reconstructions (Marchant et al., 2002) show that glacial-interglacial cycles affected Andean environments, and several studies attributed the rapid diversification in Andean birds and anurans to these cycles (Pérez-Emán, 2005; Ribas et al., 2007; Sanchez-Gonzalez, 2015; Beckman & Witt, 2015; García-R et al., 2012). Such cycles led to altitudinal shifts in biome distributions and changes in rainforest communities (Wesselingh et al., 2010). This interpretation could be applied to the subsequent south-to-north rapid diversification of the Andean lineage reaching Central America at 1.43 Myr (CI: 2.02-0.90) where the timing is relatively short between each divergence event (Fig. 5). This is also true when considering the split between the Andean lineages L. p. hypochlorus and L. p. pileatus at 0.3 Myr (CI: 0.47-0.12). Otherwise, combination of both Pleistocene climatic cycles and the complex topography of the Andes is expected to result in higher rates of diversification (Roy et al., 1997; Lagomarsino et al., 2016). Furthermore, due the dependency of our group of study to forest environments we cannot exclude the hypothesis of diversification by ecological specialization, which has already 72 been proposed for birds (Caro et al., 2013; Podos, Dybboe & Jensen, 2013), butterflies (Elias et al., 2009; Ebel et al., 2015) and annolis lizards (Muñoz et al., 2013).
It is possible to consider the hypothesis of a connected ancestral population widely distributed across middle-elevation forests in the Andes and western Amazonia at about 1.44 Myr (CI: 2.02-0.90) that was subsequently fragmented originating Clade 2. The first split within this clade isolates the ancestor of H. cohnhafti and H. spodiops from the Inambari and Peruvian Andean Center, respectively, from an ancestor in the Chocó area of endemism, west of the Andes, that will then center the diversification of the remaining taxa within Clade 2. The split between H. cohnhafti and H. spodiops is comparable to the splits between western Amazonia and the Andes foothills observed for other bird species (Brumfield & Edwards, 2006; Sousa-Neves, Aleixo & Sequeira, 2013; Thom & Aleixo 2015). The Chocoan ancestor, on the other hand, originates the Oncostoma clade, including the northern Central America endemic O. cinereigulare and the northern Chocó/southern Central America O. olivaceum at 1.35 Myr (CI: 1.69-0.85). A potential explanation for this event is presented by Smith, Amei & Klicka (2012) and relates to cycles of contraction and expansion of rainforest environments in Central America. These authors argue that forests in that region contracted and expanded multiple times in the last 2 Myr and that bird communities may be the result of multiple asynchronous range fragmentation events over a long period of time followed by isolation of populations leading to speciation. These cycles corroborate the recent splits between the Chocó L. p. squamaecrista, the Central American L. p. luteiventris at 0.17 Myr (CI: 0.26 – 0.07) and the Perijan Montane Center L. p. sancataeluciae at 0.36 Myr (0.59-0.20) (Fig. 5).
Cracraft (1985) pointed out that the Chocó AE may have an avifauna shared with Central America and the Amazonian lowlands (both sides of Amazon River). Our biogeographical reconstruction suggests shifts in ancestral ranges from Inambari to Chocó and the Guianan shield in Clade 2 (Fig. 5). This pattern can be assigned to the proposal of population displacements (Brumfield & Edwards 2007) where optimal ranges expand and contract over time mediated by climatic cycles causing the isolation of populations and subsequent diversification in habitat patches. Thus, the hypothetical widely distributed ancestral population of Clade 2 may have undergone multiple range fragmentations on both sides of the Andes over time. 73
This could also explain the split at 1.18 Myr (CI: 1.65-0.82) of the Guianan Shield lineage L. v. guianensis from the Chocó ancestor (Fig. 5), similar to the pattern found by Miller et al., 2008 in the avian genus Mionectes whereby populations from the Guianan Shield are more closely related to those from the western slope of the Andes. Recent studies have pointed out that the Guianan highlands (Tepuis) avifauna has an Andean origin (Pérez-Emán, 2005; Mauck & Burns, 2009; Bonaccorso & Guayasamin, 2013) and for all these cases, the hypothesis of population displacements by climatic cycles better explain the patterns of diversification. Thus, past connections of forest areas crossing the Andes from the Chocó to the Guianan highlands may have displaced the ancestral population of L. v. guianensis. Biogeographic connections between the Andes and the Guiana shield were also described for other organisms such as mammals (Patterson, Solari & Vela, 2014) and plants (Michelangeli et al., 2013).
The origin of the western Amazonian lineage that includes L. v. congener and L. v. vitiosus was inferred to be at 0.94 Myr (CI: 1.54 – 0.74) from an ancestral population that previous occupied the Guianan Shield (Fig. 5) and could be assigned to the establishment of Rio Madeira drainage (2.0–1.0 Myr) and the formation of the Inambari AE (Ribas et al., 2012). Additionally, the emergence of a complex fluvial system in western Amazonia may have caused significant community rearrangements and promoted successive speciation events (Rosseti et al., 2015). These dynamics could also explain the recent (0.21 Ma, CI: 0.36-0.07) divergence of these two taxa which replace each other within the Inambari AE.
Another instance of speciation related to altitudinal shifts occurs in the origin of the lineage from North-western Amazonian lowlands (Napo and Jaú AEs, H. m. pallens and L. v. affinis) from a Perijan ancestor at 0.56 ma (CI: 0.87-0.35). This and the subsequent split between H. m. pallens and L. v. affinis, appears to be a case of speciation by ecological specialization, as H. m. pallens is a várzea restricted species whereas L. v. affinis occupies terra firme forests in the Napo AE up to montane forests in the northeastern Peruvian Andean foothills. The hypothesis of ecological speciation is corroborated by the congruence of the divergence time between these two species at 0.30 Myr (CI: 0.48-0.21) and the Mid/Late Pleistocene dated paleo-varzeas (Irion, 1976; Rossetti et al., 2015). Still, it is possible that vicariant events may caused the divergence of ancestral populations and posterior evolution of ecological differentiation. This pattern of related taxa occurring in adjacent Napo/Jaú AE’s was also observed in Psophia 74 trumpeters (Ribas et al., 2012), Automolus foliage-gleaners (Schultz et al., 2017) and several others birds species (Borges & Silva, 2012). It has been argued that the contact region of this two AE's is characterized by large areas of white sand soil, that support a distinct kind of forest (Borges & Silva, 2012) and may segregate birds populations with different habitats preferences.
15.3 DIVERSIFICATION WITHIN AMAZONIA
Recent studies based on speleothem records (Cheng et al., 2013) and palynology (Behling, Bush & Hooghiemstra, 2010) suggest the persistence of continuous forest environments in western Amazonia during the Pleistocene. According to our biogeographic reconstruction, the ancestor of Amazonian Lophotriccus taxa from Clade 1 was restricted to western Amazonia and eastern Andean foothills during a large period in the Pleistocene, with posterior rapid diversification starting at 0.43 Myr (CI: 0.72-0.2) (Fig. 5).
Capurucho et al. (2013) propose that Pleistocene glacial cycles enabled the dispersion of Xenopipo atronitens populations from the Guiana Shield to southern Amazonia and also pointed out the influence of climatic cycles in promoting maintenance of populations through the time as well as promoting genetic diversification. Indeed, it has been proposed that lower global sea level combined with a low volume of water in the Amazon River during Pleistocene could have facilitated dispersal events (Peterson & Ammann, 2012). These same features can be invoked to explain the divergence of the Bélem AE endemic L. galeatus lineage from a Guianian ancestor at 0.26 Myr (CI: 0.37-0.12) (Fig. 5). The sympatric divergence within the Guiana Shield between the nominate lineage of L. galeatus (distributed eastward to Guyana and westward to Japurá) to a clade associated with the Rio Branco (LgaleatusBR) occurred at 0.06 Myr (CI: 0.12-0.01). Phylogenetic divergences in the absence of visible geographic barriers were already described Guiana Shield (Naka, 2011; Naka et al., 2012). These authors argue that this pattern could be mainly attributed to ecological speciation, notoriously in the northwestern Guiana Shield along Branco River, a region that harbors a mosaic of environmental conditions promoting ecological diversification.
Southern Amazonia appeared to have experienced multiple river channel displacements in the Late Pleistocene (Latrubesse, 2002; Hayakawa & Rosseti, 2015) that 75 could have contributed to the expansion of open areas. In contrast, recent data have reinforced the idea of a widespread forest environments throughout the Amazon Basin (Rossetti et al., 2012) and stable climatic conditions in the west of Amazonia (Cheng et al., 2013). It has been also proposed that glacial–interglacial climatic perturbations might have been produced deep influence in biodiversity in eastern Amazonia, where forests may have been experienced several events of fragmentation in response to larger fluctuations in rainfall patterns (Cheng et al., 2013). This dynamics could explain the divergence of the western Amazonian bamboo specialist L. eulophotes from the forest dwelling Tapajós AE endemic lineage of L. galeatus (LgaleatusTPJ) at 0.25 Myr (CI: 0.55-0.1). Our results on BioGeoBEARS may reinforce this hypothesis, as we identified a pattern of range shift from the Inambari AE to the Tapajós AE (0.43 Myr, CI: 0.72-0.2) and from the Tapajós back to the Inambari (0.25 Myr, CI: 0.55-0.1). Although the distributions of some taxa match the known areas of endemism (Cracraft, 1985), the very recent diversification of Clade 1 within Amazonia (last 0.5 Myr) suggests that it occupied the east coming from the west in a period when the drainage system was already established, so that the large rivers currently act as distribution limits for these taxa.
16. CONCLUSION
Our findings reinforce the importance of good taxonomic resolution for biogeographic studies in the Neotropics. Besides not reflecting the history of diversification of the group, current taxonomy underestimates true diversity. Here we show that most species previously recognized within the group are paraphyletic and find unexpected relationships between some species, such as the relationship of L. pallens to L. affinis and the relationship of the clade H. cohnhafti/H. spodiops to Clade 2. As all subspecies described within L. vitiosus and L. pileatus are diagnosable based on morphological characters, and molecular species delimitations suggested that they are indeed independent evolutionary lineages, all of them should be recognized as full species. In addition, the monotypic Lophotriccus galeatus is actually a species complex that includes well-supported clades corresponding to areas of endemism, and further studies on phenotypic variation in the group are desirable to help reveal the taxonomic status of these lineages. Yet, we endorse the proposal to recognize both L. galeatus complex and L. eulophotes as Colopteryx Ridgway, 1888, given the high support found in all our phylogenetic analyzes. In general, we refrain here from taxonomic revision, especially at the genus and higher levels, pending inclusion of the remaining taxa in 76
Hemitriccus and related genera, and the inclusion of samples from type localities to guarantee correct name attributions.
Moreover, it is remarkable to note that the processes of diversification within Lophotriccus are associated with multiple sets of factors, rather than a single one, and that Pleistocene climate dynamics appear to be especially important. However, given the recognized association of this group with forest environments and the observation of diversification events in the absence of physical barriers, future work at the population level will be important to investigate intrinsic patterns in each evolutionary unit and help test the diversification hypotheses presented above.
17. ACKNOWLEDGMENTS
We thank the curator and curatorial assistants of the University of Kansas Natural History Museum (KU), Lawrence, USA; Louisiana State University Museum of Natural Science (LSUMZ), Baton Rouge, USA; University of New Mexico Museum of Southwestern Biology (MSB), Albuquerque, USA; Centro Museo de Biología de la Universidad Central de Venezuela (MBUCV), Caracas, Venezuela; and Museu Paraense Emílio Goeldi, Belém, Brazil (MPEG), for allowing us to borrow tissues samples and study specimens under their care. The first author thanks CNPq (process 140903/2013-5) for a Ph. D. scholarship. AA and CR are supported by CNPq research productivity fellowships (respectively #310880/2012-2 and #307951/2012-0). The authors thank João Capurucho (FMNH) for critically reviewing the manuscript and to Stephan Nylinder for suggestions in the Beast analysis. Invaluable support was also obtained through a collaborative grant, Dimensions US-Biota-São Paulo: Assembly and evolution of the Amazon biota and its environment: an integrated approach, co-funded by the US National Science Foundation (NSF DEB 1241056), National Aeronautics and Space Administration (NASA), and the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP grant #2012/50260-6).
18. REFERENCES
Aleixo A. 2004. Historical diversification of a terra-firme forest bird superspecies: a phylogeographic perspective on the role of different hypotheses of Amazonian diversification. Evolution 58: 1303–1317. 77
Amadon D, Mayr E, Snow DW, Traylor-Jr MA, Zimmer JT. 1979. Check-list of birds of the world: a continuation of the work of James L. Peters. Cambridge: Harvard University Press. 1-365.
Angelis K, Reis M. 2015. The impact of ancestral population size and incomplete lineage sorting on Bayesian estimation of species divergence times. Current Zoology 61: 874–885.
Antonelli A, Nylander JAA, Persson C, Sanmartín I. 2009. Tracing the impact of the Andean uplift on Neotropical plant evolution. Proceedings of the National Academy of Sciences of the USA 106: 9749-9754.
Ayres JC, Clutton-Brock TH. 1992. River boundaries and species range size in Amazonian primates. The American Naturalist 140: 531–537.
Bacon CD, Silvestro D, Jaramillo C, Smith BT, Chakrabarty P, Antonelli A. 2015. Biological evidence supports an early and complex emergence of the Isthmus of Panama, Proceedings of Natural Academy of Science 112: 6110–6115.
Batalha-Filho H, Fjeldså J, Fabre PH, Miyaki CY. 2012. Connections between the Atlantic and the Amazonian forest avifaunas represent distinct historical events. Journal of Ornithology 154: 41-50.
Beckman EJ, Witt CC. 2015. Phylogeny and biogeography of the New World siskins and goldfinches: rapid, recent diversification in the Central Andes. Molecular Phylogenetics and Evolution 87: 28–45.
Behling H, Bush M, Hooghiemstra H. 2010. Biotic development of Quaternary Amazonia: a palynological perspective. In: Hoorn C, Wesselingh FP, eds. Amazonia: Landscape and species evolution. Black-Willey Publisher Ltd, 335-348.
Bonaccorso E, Guayasamin JM. 2013. On the Origin of Pantepui montane biotas: A Perspective Based on the Phylogeny of Aulacorhynchus toucanets. PLoS ONE 8: 1-10.
Borges SH, Silva JMC. 2012. A new area of endemism for amazonian birds in the rio Negro basin. The Wilson Journal of Ornithology 124:15-23.
Brumfield RT, Edwards SV. 2007. Evolution into and out of the Andes: a Bayesian analysis of historical diversification in Thamnophilus antshrikes, Evolution 61: 346-367.
Bulgin NL, Gibbs HL, Vickery P, Baker AJ. 2003. Ancestral polymorphisms in genetic markers obscure detection of evolutionarily distinct populations in the endangered Florida grasshopper sparrow (Ammodramus savannarum floridanus). Molecular Ecology 12: 831-44.
Bush MB.1994. Amazonian speciation: a necessarily complex model. Journal of Biogeography 21: 5–17.
Bush MB, Oliveira PE. 2006. The rise and fall of the Refugial Hypothesis of Amazonian Speciation: a paleoecological perspective. Biota Neotropica 6: 1-17. 78
Burns SJL, Kanner C, Cheng H, Edwards RL. 2015. A tropical speleothem record of glacial inception, the South American Summer Monsoon from 125 to 115 ka Climate of the Past 11: 931–938.
Cadena CD, Klicka J, Ricklefs RE. 2007. Evolutionary differentiation in the Neotropical montane region: Molecular phylogenetics and phylogeography of Buarremon brush-finches (Aves, Emberizidae). Molecular Phylogenetics and Evolution 44: 993–1016.
Capurucho JMG, Cornelius C, Borges SH, Cohn-Haft M, Aleixo A, Metzger JP, Ribas CC. 2013. Combining phylogeography and landscape genetics of Xenopipo atronitens (Aves: Pipridae), a white sand campinas specialist, to understand Pleistocene landscape evolution in Amazonia. Biological Journal of the Linnean Society 110: 60-76.
Caro LM, Caycedo-Rosales PC, Bowie RCK, Slabbekoorn H, Cadena CD. 2013. Ecological speciation along an elevational gradient in a tropical passerine bird? Journal of Evolutionary Biology 26: 357–374.
Chaves JA, Weir JT, Smith TB. 2011. Diversification in Adelomyia hummingbirds follows Andean uplift. Molecular Ecology 20: 4564-4576.
Chapman FM. 1926. The distribution of bird life in Ecuador. Bulletin of American Museum of Natural History 55: 1–784.
Cheng H, Sinha A, Cruz W, Wang X, Edwards RL, d’Horta FM, Ribas CC, Vuille M, Stott LD, Auler AS. 2013. Climate change patterns in Amazonia and biodiversity. Nature Communications 4: 1-6.
Cicero C, Johnson NK. 2001. Higherlevel phylogeny of New World vireos (Aves: Vireonidae) based on sequences of multiple mitochondrial DNA genes. Molecular Phylogenetics and Evolution 20: 27–40.
Cohn-Haft M. 1996. Why the Yungas Tody-Tyrant (Hemitriccus spodiops) is a Snethlagea, and why it matters. The Auk 133: 709-714.
Corander J, Marttinen P, Sirén J, Tang J. 2008. Enhanced Bayesian modelling in BAPS software for learning genetic structures of populations. BMC Bioinformatics 9:539. Corander J, Marttinen P. 2006. Bayesian identification of admixture events using multi-locus molecular markers. Molecular Ecology 15: 2833-2843.
Corander J, Tang, J. 2007. Bayesian analysis of population structure based on linked molecular information. Mathematical Biosciences 205: 19-31.
Cracraft J. 1985. Historical biogeography and patterns of differentiation within the southamerican avifauna: areas of endemism. Ornithology Monographs 36: 49–84.
Descimon H. 1986. Origins of Lepidopteran faunas in the high tropical Andes. In: Vuilleumier F, Monasterio M, eds. High altitude tropical biogeography. New York: Oxford University Press. 500–532. 79 d’Horta FM, Cuervo AM, Ribas CC, Brumfield RT, Miyaki CY. 2013. Phylogeny and comparative phylogeography of Sclerurus (Aves: Furnariidae) reveal constant and cryptic diversification in an old radiation of rain forest understorey specialists. Journal of Biogeography. doi:10.1111/j.1365-2699.2012.02760.x
Drummond AJ, Rambaut A. 2012. BEAST. Ver. 1.8.2 Available at http:// http://beast.bio.ed.ac.uk
DuBay SG, Witt CC. 2012. An improved phylogeny of the Andean tit-tyrants (Aves, Tyrannidae): More characters trump sophisticated analyses. Molecular Phylogenetics and Evolution 64: 285-296.
Ebel ER, DaCosta JM, Sorenson MD, Hill RI, Briscoe AD, Willmott KR, Mullen SP. 2015. Rapid diversification associated with ecological specialization in Neotropical Adelpha butterflies. Molecular Ecology 24: 2392–2405.
Elias M, Joron M, Willmott K, Silva-Brandão KL, Kaiser V, Arias CF, Gomez Piñerez LM, Uribe S, Brower AV, Freitas AV, Jiggins CD. 2009. Out of the Andes: patterns of diversification in clearwing butterflies. Molecular Ecology 18:1716-1729.
Endler JA 1977. Geographic variation, speciation, and clines. Princeton: Princeton Univ. Press. 262 p.
Fernandes AM, Wink M, Sardelli CH, Aleixo A. 2014. Multiple speciation across the Andes and throughout Amazonia: the case of the spot-backed antbird species complex (Hylohylax naevius/Hylophylax naevioides). Journal of Biogeography 41: 1094-1104.
Fjeldså J. 1995. Geographical patterns of neoendemic and older relict species of Andean forest birds: the significance of ecologically stable areas. In: Churchill SP, Balslev H, Forero E, Luteyn JL, eds. Biodiversity and Conservation of Neotropical Montane Forests. New York: The New York Botanical Garden, 89–102.
Fjeldså J, Irestedt M. 2009. Diversification of the South American avifauna: patterns and implications for conservation in the Andes. Annals of the Missouri Botanical Garden 96: 398-409.
Fjeldså J, Zuccon D, Irestedt M, Johansson US, Ericson PGP. 2003. Sapayoa aenigma: a New World representative of 'Old World suboscines'. Proceedings of the Royal Society B. doi: 10.1098/rsbl.2003.0075
Flórez-Rodríguez A, Carling MD, Cadena CD. 2011. Reconstructing the phylogeny of "Buarremon" brush-finches and near relatives (Aves, Emberizidae) from individual gene trees. Molecular Phylogenetics and Evoution 58:297-303.
Flot JF. 2010. Seqphase: a web tool for interconverting phase input/output files and fasta sequence alignments. Molecular Ecology Resources 10: 162-6.
García-R JC, Crawford AJ, Mendoza AM, Ospina O, Cardenas H, Castro F. 2012. Comparative Phylogeography of Direct-Developing Frogs (Anura: Craugastoridae: 80
Pristimantis) in the Southern Andes of Colombia. PLoS ONE. doi:10.1371/journal.pone.0046077.
Gernhard T. 2008. The conditioned reconstructed process. Journal of Theoretical Biology 253: 769-778.
Gregory-Wodzicki KM. 2000. Uplift history of the central and northern Andes: a review. GSA Bulletin 112: 1091–1105.
Haffer J. 1969. Speciation in Amazonian forest birds. Science 165:131–137.
Haffer J. 1974. Avian speciation in tropical South America. Cambridge: Nuttall Ornithological Club. 390 p.
Haffer J, Prance GT. 2001. Climatic forcing of evolution in Amazonia during the Cenozoic: On the refuge theory of biotic differentiation. Amazoniana 16: 579-608.
Harvey MG, Brumfield RT. 2015. Genomic variation in a widespread Neotropical bird (Xenops minutus) reveals divergence, population expansion, and gene flow Molecular Phylogenetics and Evolution 83: 305–316.
Hayakawa EH, Rossetti DF. 2015. Late quaternary dynamics in the Madeira river basin, southern Amazonia (Brazil), as revealed by paleomorphological analysis. Anais da Academia Brasileira de Ciências 87: 29-49.
Hawkins BA, Diniz-Filho JAF, Jaramillo CA, Soeller SA. 2007. Climate, Niche Conservatism, and the Global Bird Diversity Gradient. The American Naturalist 170: S16-S27.
Heled J, Drummond AJ. 2010. Bayesian inference of species trees from multilocus data. Molecular Biology and Evolution 27: 570-80.
Hoorn C, Wesselingh FP, ter Steege H, Bermudez MA, Mora A, Sevink J, Sanmartín I, Sanchez-Meseguer A, Anderson CL, Figueiredo JP, Jaramillo C, Riff D, Negri FR, Hooghiemstra H, Lundberg J, Stadler T, Särkinen T, Antonelli, A. 2010. Amazonia through time: Andean uplift, climate change, landscape evolution, and biodiversity. Science 330: 927–931.
Irion G. 1976. Quaternary sediments of the upper Amazon lowlands of Brasil. Biogeographica 7: 163–167.
Kattan GH, Franco P, Rojas V, Morales G. 2004. Biological diversification in a complex region: a spatial analysis of faunistic diversity and biogeography of the Andes of Colombia. Journal of Biogeography 31: 1829–1839.
Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Mentjies P, Drummond A. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649. 81
Kimball RT, Braun EL, Barker FK, Bowie RC, Braun MJ, Chojnowski JL, Hackett SJ, Han KL, Harshman J, Heimer-Torres V, Holznagel W, Huddleston CJ, Marks BD, Miglia KJ, Moore WS, Reddy S, Sheldon FH, Smith JV, Witt CC, Yuri T. 2009. A well-tested set of primers to amplify regions spread across the avian genome. Molecular Phylogenetics and Evolution 50: 654-60.
Lagomarsino LP, Condamine FL, Antonelli A, Mulch A, Davis CC. 2016. The abiotic and biotic drivers of rapid diversification in Andean bellflowers (Campanulaceae). New Phytologist. doi:10.1111/nph.13920.
Landis M, Matzke NJ, Moore BR, Huelsenbeck JP. 2013. Bayesian analysis of biogeography when the number of areas is large. Systematic Biology 62: 789–804.
Lanfear R, Calcott B, Ho SY, Guindon S. 2012. Partitionfinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution 29: 1695-701.
Lanyon WE. 1988. A phylogeny of the flatbill and tody-tyrant assemblage of tyrant flycatchers.American Museum Novitates 2923:1-41.
Larsson A. 2014. AliView: a fast and lightweight alignment viewer and editor for large data sets. Bioinformatics 30: 3276-3278.
Latrubesse EM. 2002. Evidence of Quaternary palaeohydrological changes in middle Amazonia: the Aripuanã-Roosevelt and Jiparaná ‘fans’. Zeitschrift für Geomorphologie 129: 61–72.
Latrubesse EM, Cozzuol M, Silva-Caminha SAF, Rigsby CA, Absy MA, Jaramillo C. 2010. The late Miocene paleogeography of the Amazon Basin and the evolution of the Amazon River system. Earth Science Reviews 99: 99–124.
López-Alvarado J, Sáez L, Filigheddu R, Garcia-Jacas N, Susanna A. 2014. The limitations of molecular markers in phylogenetic reconstruction: The case of Centaurea sect. Phrygia (Compositae). Taxon 63: 1079-1091.
Mckay BD, Mays Jr HL, Wu Y, Li H, Yao C, Nishiumi I, Zou F. 2013. An empirical comparison of character-based and coalescent-based approaches to species delimitation in a young avian complex. Molecular Ecology 22: 4943–4957.
Marchant R, Behling H, Berrio JC, Cleef A, Duivenvoorden J, Hooghiemstra H, Kuhry P, Melief B, Schreve-Brinkman E, Van Geel B, Van Der Hammen T, Van Reenen G, Wille M. 2002. Pollen-based biome reconstructions for Colombia at 3000, 6000, 9000, 12 000, 15 000 and 18 000 14C yr ago: Late Quaternary tropical vegetation dynamics. Journal of Quaternary Science 17: 113-129.
Mauck WM, Burns KJ. 2009. Phylogeny, biogeography, and recurrent evolution of divergent bill types in the nectar-stealing flowerpiercers (Thraupini: Diglossa and Diglossopis). Biological Journal of the Linnean Society 98: 14–28. 82
Matzke NJ. 2014. Model selection in historical biogeography reveals that founder-event speciation is a crucial process in Island Clades. Systematic Biology 63: 951-70.
Michelangeli FA, Guimarães PJF, Penneys DS, Almeda F, Kriebel R. 2013. Phylogenetic relationships and distribution of New World Melastomeae (Melastomataceae). Botanical Journal of the Linnean Society 171: 38–60.
Miller MJ, Bermingham E, Klicka J, Escalante P, Amaral FSR, Weir JT, Winker K. 2008. Out of Amazonia again and again: episodic crossing of the Andes promotes diversification in a lowland forest flycatcher. Proceedings of the Royal Society B 275: 1133–1142.
Monasterio M, Vuilleumier, F. 1986. Introduction: high tropical mountain biota of the world. In: Monasterio M, Vuilleumier, F. eds. High altitude tropical biogeography. New York: Oxford University Press. 3–10.
Moritz C, Patton JL, Schneider CJ, Smith TB. 2000. Diversification of rainforest faunas: an integrated molecular approach. Annual Review of Ecology Systematic 31: 533–563.
Muñoz MM, Crawford NG, McGreevy-Jr TJ, Messana NJ, Tarvin RD, Revell LJ, Zandvliet RM, Hopwood JM, Mock E, Schneider AL, Schneider CJ. 2013. Divergence in coloration and ecological speciation in the Anolis marmoratus species complex. Molecular Ecology 22: 2668-2682.
Naka LN. 2011. Avian distribution patterns in the Guiana Shield: implications for the delimitation of Amazonian areas of endemism. Journal of Biogeography 38:681-696.
Naka LN, Bechtoldt CL, Henriques LMP, Brumfield RT. 2012. The Role of Physical Barriers in the Location of Avian Suture Zones in the Guiana Shield, Northern Amazonia. The American Naturalist 179: E115-E132.
Nogueira ACR, Silveira R, Guimarães JTF. 2013. Neogene-Quaternary sedimentary and paleovegetation history of the eastern Solimões Basin, central Amazon region. Journal of South American Earth Sciences 46: 89-99.
O'Dea A, Lessios HA, Coates AG, Eytan RI, Restrepo-Moreno SA, Cione AL, Collins LS, Queiroz A, Farris DW, Norris RD, Stallard RF, Woodburne MO, Aguilera O, Aubry MP, Berggren WA, Budd AF, Cozzuol MA, Coppard SE, Duque-Caro H, Finnegan S, Gasparini GM, Ethan L. Grossman, Johnson KG, Keigwin LD, Knowlton N, Leigh EG, Leonard-Pingel JS, Marko PB, Pyenson ND, Rachello-Dolmen PG, Soibelzon E, Soibelzon L, Todd JA, Vermeij GJ, Jackson JBC. 2016. Formation of the Isthmus of Panama. Science Advances 2: e1600883.
Patterson BD, Solari S, Vela PM. 2014. The role of the Andes in the diversification and biogeography of Neotropical mammals In: Patterson BD, Costa LP, eds. Bones, clones, and biomes: the history and geography of Recent Neotropical mammals. University of Chicago Press. 351-378.
Platt A, Woodhall R, George A. 2007. Improved DNA sequencing quality and efficiency using an optimized fast cycle sequencing protocol. BioTechniques 43:58-62. 83
Pérez-Emán JL. 2005. Molecular phylogenetics and biogeography of the Neotropical redstarts (Myioborus; Aves, Parulinae). Molecular Phylogenetics and Evolution 37: 511–528.
Peterson AT, Ammann CM. 2012. Global patterns of connectivity and isolation of populations of forest bird species in the late Pleistocene. Global Ecology and Biogeography, doi: 10.1111/geb.12010
Podos J, Dybboe R, Jensen MO. 2013. Ecological speciation in Darwin’s finches: Parsing the effects of magic traits. Current Zoology 59: 8–19.
Ribas CC, Aleixo A, Nogueira ACR, Miyaki CY, Cracraft J. 2012. A palaeobiogeographic model for biotic diversification within Amazonia over the past three million years. Procedings of the Royal Society B 279: 681–689.
Ribas CC, Moyle RG, Miyaki CY, Cracraft J. 2007. The assembly of montane biotas: linking Andean tectonics and climatic oscillations to independent regimes of diversification in Pionus parrots. Proceedings of Royal Society B 274: 2399–2408.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61:1-4.
Rossetti DF, Bertani TC, Zani H, Cremon EH, Hayakawa EH. 2012. Late Quaternary sedimentary dynamics in Western Amazonia: implications for the origin of open vegetation/forest contrasts. Geomorphology 177: 74–92.
Rossetti DF, Cohen MCL, Tatumi SH, Sawakuchi AO, Cremon EH, Mittani JCR, Bertani TC, Munita CJAS, Tudela DRG, Yee M, Moya G. 2015. Mid-Late Pleistocene OSL chronology in western Amazonia and implications for the transcontinental Amazon pathway. Sedimentary Geology 330: 1-15.
Roy MS, Silva JMC, Arctander P, Garcıa-Moreno J, Fjeldså J. 1997. The speciation of South American and African birds in montane regions. In: Mindell DP, ed. Avian molecular evolution and systematics. San Diego: Academic Press. 325–343.
Rull V. 2011. Neotropical biodiversity: timing and potential drivers, Trends in Ecology and Evolution 26, doi:10.1016/j.tree.2011.05.011.
Sanchez-Gonzalez LA, Navarro-Sigüenza AG, Krabbe NK, Fjeldså J, Garcıa-Moreno J. 2015. Diversification in the Andes: the Atlapetes brush-finches. Zoologica Scripta 44: 135–152.
Satler JD, Carstens BC, Hedin M. 2013. Multilocus Species Delimitation in a Complex of Morphologically Conserved Trapdoor Spiders (Mygalomorphae, Antrodiaetidae, Aliatypus). Systematic Biology 62: 805–823.
Schultz ED, Burney CW, Brumfield RT, Polo EM, Cracraft J, Ribas CC. 2017. Systematics and biogeography of the Automolus infuscatus complex (Aves; Furnariidae): 84
Cryptic diversity reveals western Amazonia as the origin of a transcontinental radiation. Molecular Phylogenetics and Evolution 107: 503–515.
Sedano RE, Burns KJ. 2010. Are the Northern Andes a species pump for Neotropical birds? Phylogenetics and biogeography of a clade of Neotropical tanagers (Aves: Thraupini). Journal of Biogeography 37: 325–343.
Shang HY, Li ZH, Dong M, Adams RM, Miehe G, Opgenoorth L, Maoa KS. 2015. Evolutionary origin and demographic history of an ancient conifer (Juniperus microsperma) in the Qinghai-Tibetan Plateau. Scientific Reports 5: 1-15.
Šmíd J, Moravec J, Kratochvíl L, Nasher AK, Mazuch T, Gvoždík V, Carranza S. 2015. Multilocus phylogeny and taxonomic revision of the Hemidactylus robustus species group (Reptilia, Gekkonidae) with descriptions of three new species from Yemen and Ethiopia. Systematics and Biodiversity 13: 346-368.
Smith BT, Amei A, Klicka J. 2012. Evaluating the role of contracting and expanding rainforest in initiating cycles of speciation across the Isthmus of Panama. Proceedings of Royal Society B 279: 3520–3526.
Smith BT, McCormack JE, Cuervo AM, Hickerson MJ, Aleixo A, Cadena CD, Pérez-Emán J, Burney CW, Xie X, Harvey MG, Faircloth BC, Glenn TC, Derryberry EP, Prejean J, Fields, S. & Brumfield, R.T. (2014) The drivers of tropical speciation. Nature 515: 406–9.
Sorenson MD, Ast JC, Dimcheff DE, Yuri T, Mindell DP. 1999. Primers for a PCR-based approach to mitochondrial genome sequencing in birds and other vertebrates. Molecular Phylogenetics and Evolution 12:105-114.
Sousa-Neves T, Aleixo A, Sequeira F. 2013. Cryptic patterns of diversification of a widespread Amazonian woodcreeper species complex (Aves: Dendrocolaptidae) inferred from multilocus phylogenetic analysis: implications for historical biogeography and taxonomy. Molecular Phylogenetics and Evolution 68: 410-424.
Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688-2690.
Stephens M, Smith NJ, Donnelly P. 2001. A new statistical method for haplotype reconstruction from population data. American Journal of Human Genetics 68: 978-89.
Suh A, Smeds L, Ellegren H. 2015. The Dynamics of Incomplete Lineage Sorting across the Ancient Adaptive Radiation of Neoavian Birds. PLOS Biology 13: 1-18.
Steiner CC, Mitelberg A, Tursi R, Ryder OA. 2012. Molecular phylogeny of extant equids and effects of ancestral polymorphism in resolving species-level phylogenies. Molecular Phylogenetics and Evolution 65: 573-581.
Tello JG, Bates JM. 2007. Molecular phylogenetics of the tody-tyrant and flatbill assemblage of tyrant flycatchers (Tyrannidae). The Auk 124:134–154. 85
Tello JG, Moyle RG, Marchese DJ, Cracraft J. 2009. Phylogeny and phylogenetic classification of the tyrant flycatchers, cotingas, manakins, and their allies (Aves: Tyrannides). Cladistics 25: 429–467.
Thom G, Aleixo A. 2015. Cryptic speciation in the white-shouldered antshrike (Thamnophilus aethiops, Aves – Thamnophilidae): The tale of a transcontinental radiation across rivers in lowland Amazonia and the northeastern Atlantic Forest. Molecular Phylogenetics and Evolution 82: 95–110. van der Hammen T, Cleef AM. 1986. Development of the high Andean Páramo flora and vegetation. In: Vuilleumier F, Monasterio M, eds. High altitude tropical biogeography. New York: Oxford University Press. 153–201.
Wallace AR. 1852. On the monkeys of the Amazon.Proccedings of the Zoological Society of London 20: 107–110.
Wesselingh FP, Hoorn C, Kroonenberg SB, Antonelli A, Lundberg JG, Vonhof HB, Hooghiemstra H. 2010. On the origin of Amazonian landscapes and biodiversity: a synthesis. In: Hoorn C, Wesselingh FP, eds. Amazonia: Landscape and species evolution. Black-Willey Publisher Ltd. 421-432.
Weir JT, Schluter D. 2008. Calibrating the avian molecular clock. Molecular Ecology 17: 2321-2328.
Zimmer KJ, Whittaker A, Sardelli C, Guilherme E, Aleixo A. 2013. A new species of Hemitriccus tody-tyrant from the state of Acre, Brazil. In: del Hoyo J, Elliott A, Christie D, eds. Handbook of the Birds of the World, Special Volume: New Species and Global Index. Barcelona: Lynx Edicions. 292-296.
19. FIGURE LEGENDS 86
Figure 1. BI gene tree based on the concatenated mtDNA (cytb and ND2) matrix (1830 bp) showing relationships between the two clades of Lophotriccus and the outgroups. BI and ML support values are shown respectively. * indicates maximum support on both analyses (1/100), while - indicates support below 0.8/50. 87
Figure 2. BI gene tree based on the concatenated mtDNA (cytb and ND2) matrix (1830 bp) showing Clade 1. BI and ML support values are shown respectively. * indicates maximum support on both analyses (1/100), while - indicates support below 0.8/50. Shaded areas correspond to known distributions of species according to the current classification. 88 89
Figure 3. BI gene tree based on the concatenated mtDNA (cytb and ND2) matrix (1830 bp) showing Clades 2 and 3. BI and ML support values are shown respectively. * indicates maximum support on both analyses (1/100), while - indicates support below 0.8/50. Shaded areas correspond to known distributions of species according to the current classification. 90 91
Figure 4. Bayesian analysis of population structure in BAPS showing the best K for admixture: A. all markers (best K=2), B. G3PDH (best K=3), C. MUSK (best K=6) and D. RAG2 (best K=4).
Figure 5. Ancestral areas reconstruction analysis in BioGeoBEARS, based on the species tree estimated by *BEAST. Only nodes with posterior probabilities above 0.8 are shown. Nodes shown confidence intervals as bars. Colors represent biogeographic areas: yellow – Belém AE, light green – Tapajós AE, orange – Guyana AE, light blue – Jaú AE, dark green – Napo AE, red – Inambari AE, black – Peruvian Andean Center brown – Chocó AE, pink – Perijan Montane Center, dark blue – Central America.
20. TABLES
Table 1. Species delimitations in BPP analysis and the posterior probabilities (p) of different combinations of algorithms for species delimitations and species model priors (SMP). Variables ε, α and m represent finetune parameters and the priors θ and τ are priors designate population size parameters and divergence time at the root of the trees.
Algorithm SMP θ τ Results
0(ε=2) 2 G(2,2000) G(10,1000) Recovers 17 groups as full species with p = 1 and two with p=0.99 0(ε=2) 3 G(2,2000) G(10,1000) Recovers 17 groups as full species with p = 1 and two with p=0.99 1(α=2,m=1) 2 G(2,2000) G(10,1000) Recovers 15 groups as full species with p = 1 and four with p=0.99 92
1(α=2,m=1) 3 G(2,2000) G(10,1000) Recovers 17 groups as full species with p = 1 and two with p=0.99
Table 2. BioGeoBEARS results showing the values of log-likelihood (LnL), dispersal (d), extinction (e), founder (j), and AIC of all models tested. Best model suggested in bold.
Model LnL d e j AIC DEC -72,70 0,505 0,977 0 150,15 DEC+J -40,36 1,00E-012 1,00E-012 0,214 88,32 DIVALIKE -70,48 1,574 1,931 0 145,71 DIVALIKE+j -40,05 1,00E-012 1,00E-012 0,200 87,69 BAYAREALIKE -115,98 0,436 0,143 0 236,71 BAYAREALIKE+ J -40,87 1,00E-007 1,00E-007 0,191 89,33
21. SUPPORTING INFORMATION 93 94
Figure S1. BI gene tree based on a concatenated mitochondrial DNA (cytb and ND2) matrix (1830 bp) showing phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor. We used Hemitriccus diops and Hemitriccus zosterops as outgroups. Branch lengths have been adjusted to better tree view. Only nodes p>0.8 are shown. 95 96
Figure S2. ML gene tree based on a concatenated mitochondrial DNA (cytb and ND2) matrix (1830 bp) showing phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor. We used Hemitriccus diops and Hemitriccus zosterops as outgroups. Only nodes with bootstrap >50 are shown. 97 98
Figure S3. BI gene tree based on G3PDH nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor.
Figure S4. BI gene tree based on MUSK nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor. 99
Figure S5. BI gene tree based on RAG2 nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor. 100 101
Figure S6. ML gene tree based on G3PDH nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor.
Figure S7. ML gene tree based on MUSK nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor. 102
Figure S8. ML gene tree based on RAG2 nuclear gene showing lack of resolution in phylogenetic relationships of genus Lophotriccus, Atalotriccus pilaris and Hemitriccus minor.
Table S1. List of tissue samples used in this study. Acronyms: INPA (Instituto Nacional de Pesquisas da Amazônia), MPEG (Museu Paraense Emílio Goeldi), LSUMZ (Louisiana State University Museum of Zoology), MSB (Museum of Southwestern Biology-University of New Mexico), KU (Kansas University Biodiversity Institute and Natural History Museum) and MBUCV (Museo de Biología de la Universidad Central de Venezuela)
Map Sample Collection Species Subspecies Country Locality lat long
Atalotriccus Region 9; Ireng Ap1 B 48550 LSUMZ griseiceps Guyana 3,88 -59,58 pilaris River, km 103
Karasabai
Atalotriccus 0.5 km SSW Ap2 B 28419 LSUMZ wilcoxi Panama 8,92 -79,55 pilaris mouth Rio Farfan
Assis Brasil, ca. Hemitriccus Hc1 AB 001 MPEG - Brazil 10 km E , -10,93 -69,47 cohnhafti Estrada da Pedreira
Assis Brasil, ca. Hemitriccus Hc2 AB 002 MPEG - Brazil 10 km E , -10,93 -69,47 cohnhafti Estrada da Pedreira
Assis Brasil, Hemitriccus Hc3 ASS001 MPEG - Brazil Estrada da -10,93 -69,47 cohnhafti Pedreira, "Museu"
MAYA Hemitriccus Hmm1 MPEG minor Brazil Marajó, Breves, -1,55 -50,38 050 minor Sítio do Waldir
Hemitriccus Município de Hms1 DPN 105 MPEG snethlageae Brazil -7,03 -51,73 minor Ourilândia do Norte
JTW Hemitriccus Hms2 MPEG snethlageae Brazil Marcelândia, -11 -54,13 1138 minor Santa Rita
Paranaíta, Rio TLP(B) Hemitriccus Hms3 MPEG snethlageae Brazil Teles Pires, -9,47 -56,47 146 minor margem esquerda
W. Bank Rio Tapajos', Hemitriccus Hms4 B 25496 LSUMZ snethlageae Brazil Comunidade -2,47 -55,10 minor Maripa', ca 18 km W Alterdo Chao
Hemitriccus Hms5 B 25582 LSUMZ snethlageae Brazil Ca 100 km W -7,88 -62,18 minor Humaita
Machadinho Hemitriccus Hms6 OM 245 MPEG snethlageae Brazil D'Oeste, -8,90 -62,00 minor margem direita Rio Jiparaná
Ca 139 km WSW Hemitriccus Hms7 B 35602 LSUMZ snethlageae Brazil Santarem, w. of -2,98 -55,83 minor Rio Tapajos and Alto Rio Arapiuns
Senador UFAC Hemitriccus Hms8 MPEG snethlageae Brazil Guiomard, -9,77 -67,22 321 minor Ramal Nabor Júnior, km 26
Hemitriccus Hms9 B 35342 LSUMZ snethlageae Brazil W. bank of Rio -9,13 -57,05 minor Teles Pires, 6 104
km upriver from the mouth of Rio Sao Benedito
Serra dos Carajas, floresta Hemitriccus Hmm2 B 25530 LSUMZ minor Brazil nacional -5,83 -50,50 minor Tapirape - Aquiri, Projecto Salobo
Paranaíta, margem TLP(B) Hemitriccus Hms10 MPEG snethlageae Brazil esquerda Rio -9,55 -56,75 076 minor Paranaíta, Fazenda Aliança
Hemitriccus Querência, Hms11 MT 043 MPEG snethlageae Brazil -13,07 -52,37 minor Fazenda Tanguro
Velasco; Parque Hemitriccus Nacional Noel Hms12 B 18354 LSUMZ snethlageae Bolivia -14,37 -60,72 minor Keonpff Mercado 86 km ESE Florida
Munic. Novo Hemitriccus Hmp1 B 20248 LSUMZ pallens Brazil Airao; -2,75 -60,75 minor Arquipelago das Anavilhanas
Hemitriccus Japurá, Rio Hmp2 JAP 548 MPEG pallens Brazil -1,93 -66,60 minor Acanauí
Prov. B. Saavedra, 83 Hemitriccus Hs1 B22877 LSUMZ - Bolivia km by road E. -15,18 -69,00 spodiops Charazani, Cerro Asunta Pata.
Hemitriccus Hs2 B58390 LSUMZ - Peru 25 km NE San -14,10 -69,02 spodiops Juan de Oro
Margem esquerda do Rio Lophotriccus Le1 A 4774 INPA - Brazil Purus; Flona -8,70 -67,53 eulophotes Purus; ca 45 km NW Boca do Acre
Margem esquerda do Rio Lophotriccus Le2 A 4775 INPA - Brazil Purus; Flona -8,70 -67,53 eulophotes Purus; ca 45 km NW Boca do Acre
UFAC Lophotriccus Porto Acre, Le3 MPEG - Brazil -9,75 -67,67 022 eulophotes Reserva Humaitá Le4 UFAC MPEG Lophotriccus - Brazil -9,75 -67,60 105
1324 eulophotes Porto Acre, AC 010 linha 07, Reserva Humaitá
Rio Branco, UFAC Lophotriccus Transacreana Le5 MPEG - Brazil -9,90 -68,47 885 eulophotes (AC-090) km 70, Ramal Jarinal km 11
Santa Rosa, UFAC Lophotriccus margem Le6 MPEG - Brazil -9,15 -69,75 1450 eulophotes esquerda Rio Purus, ca. 3 km da foz Lophotriccus Le7 36996 MSB - Peru Alerta -11,71 -69,21 eulophotes
Le8 37200 MSB Lophotriccus - Peru Alerta -11,71 -69,22 eulophotes
Le9 37295 MSB Lophotriccus - Peru Alerta -11,72 -69,21 eulophotes
ESEC Rio Acre, ESEC Lophotriccus Le10 MPEG - Brazil ca. 78 km W -11,05 -70,27 323 eulophotes Assis Brasil
ESEC Lophotriccus ESEC Rio Acre, Le11 MPEG - Brazil -11,05 -70,27 326 eulophotes ca. 78 km W Assis Brasil
Parque PNSD Lophotriccus Le12 MPEG - Brazil Nacional Serra -8,73 -72,83 042 eulophotes do Divisor, Tabocal
Parque PNSD Lophotriccus Nacional Serra Le13 MPEG - Brazil -8,33 -73,30 001 eulophotes do Divisor, 106 km SW Cruzeiro do Sul
GUR Lophotriccus LgB1 MPEG Belém Center Brazil Centro Novo, -3,70 -46,75 260 galeatus REBIO Gurupi
CUR LgB2 MPEG Lophotriccus Belém Center Brazil Curuçá, Pará -0,73 -47,87 002 galeatus
BAR LgB3 MPEG Lophotriccus Belém Center Brazil Barcarena -1,87 -49,10 030 galeatus
LgG1 B 65855 LSUMZ Lophotriccus Guyana Shield Suriname Lely Gebergte 4,27 -54,73 galeatus Almeirim, Lophotriccus LgG2 CN 877 MPEG Guyana Shield Brazil REBIO 0,82 -53,92 galeatus Maicuru Lophotriccus Óbidos, ESEC LgG3 CN 1394 MPEG Guyana Shield Brazil 0,62 -55,72 galeatus Grão-Pará
West Demerara Lophotriccus LgG4 B 48293 LSUMZ Guyana Shield Guyana District; ca 27 6,33 -58,25 galeatus km S Soesdyke on Linden 106
Highway
Lophotriccus LgG5 KU 1354 KU Guyana Shield Guyana Iwokrama 4,28 -58,52 galeatus Reserve
Lophotriccus LgG6 KU 1386 KU Guyana Shield Guyana Iwokrama 4,33 -58,85 galeatus Reserve
Lophotriccus Alenquer, LgG7 CN 420 MPEG Guyana Shield Brazil -0,15 -55,18 galeatus ESEC Grão-Pará
Margem esquerda do Rio Lophotriccus LgG8 A 1219 INPA Guyana Shield Brazil Demini, Igarapé -0,18 -63,12 galeatus Jacarezinho, ca 155 km N Barcelos
Rio Araca', Lophotriccus LgG9 B 25450 LSUMZ Guyana Shield Brazil "Bacabal," ca -- 0,02 -63,18 galeatus km N Barcelos
Margem direita do Rio Daraha, Lophotriccus LgG10 A 6312 INPA Guyana Shield Brazil margem -0,42 -64,93 galeatus esquerda Rio Negro; ca 25 km E Santa Isabel
Margem esquerda do Rio Lophotriccus Negro, ca 10 km LgG11 A 1102 INPA Guyana Shield Brazil -0,07 -66,92 galeatus E São Gabriel da Cachoeira, estrada da Olaria
Lophotriccus São Gabriel da LgG12 A 13588 INPA Guyana Shield Brazil -0,15 -66,80 galeatus Cachoeira, PPBIO
Lophotriccus São Gabriel da LgG13 A 13589 INPA Guyana Shield Brazil -0,15 -66,80 galeatus Cachoeira, PPBIO
Margem direita do Rio Negro, 3 Lophotriccus km SW São LgG14 A 1164 INPA Guyana Shield Brazil -0,08 -67,08 galeatus Gabriel da Cachoeira, "trilha de Moisés"
Rio Japurá, margem Lophotriccus esquerda, ca 50 LgG15 A 18422 INPA Guyana Shield Brazil -1,72 -69,12 galeatus Km SE Vila Bittencourt, comunidade Taboca
Lophotriccus LgG16 A 13322 INPA Guyana Shield Brazil São Gabriel da -0,13 -67,02 galeatus Cachoeira, BI-1 LgR1 A 1767 INPA Lophotriccus Branco River Brazil 2,92 -60,78 107
galeatus 10 Km NW Boa Vista; Estação Ecológica Maracá, "grid"
15 km WSW Caracarai; Lophotriccus LgR2 A 1686 INPA Branco River Brazil margem 1,75 -61,08 galeatus esquerda R Branco, vicinal Agua Boa
Parque Nacional Viruá, Lophotriccus LgR3 A 1740 INPA Branco River Brazil margem 1,23 -61,12 galeatus esquerda do Rio Branco, "Sitio do Neri"
Altamira, Lophotriccus LgT1 FAL 010 MPEG Tapajós Center Brazil Floresta -5,48 -55,13 galeatus Nacional de Altamira
Lophotriccus Arioca, ca 2 km LgT2 B 25491 LSUMZ Tapajós Center Brazil -2,48 -54,97 galeatus NW Alterdo Chao
Lophotriccus Itaituba, LgT3 TM 053 MPEG Tapajós Center Brazil -5,65 -55,52 galeatus PARNA Jamanxin
Jacareacanga, MPDS Lophotriccus FLONA LgT4 MPEG Tapajós Center Brazil -7,30 -57,43 1338 galeatus Crepori, Porto Seguro, Serra Grande Lophotriccus Lph1 36609 MSB hypochlorus Peru Cadena -13,34 -70,86 pileatus
Lph2 36610 MSB Lophotriccus hypochlorus Peru Cadena -13,34 -70,86 pileatus
Lph3 36660 MSB Lophotriccus hypochlorus Peru Cadena -13,35 -70,86 pileatus
Lph4 36760 MSB Lophotriccus hypochlorus Peru Cadena -13,34 -70,86 pileatus
Lph5 36788 MSB Lophotriccus hypochlorus Peru Cadena -13,34 -70,86 pileatus
Lph6 36789 MSB Lophotriccus hypochlorus Peru Cadena -13,35 -70,86 pileatus
Lph7 36856 MSB Lophotriccus hypochlorus Peru Cadena -13,35 -70,86 pileatus
Lph8 27275 MSB Lophotriccus hypochlorus Peru Ginger Patch -13,04 -71,53 pileatus Lophotriccus Lph9 27325 MSB hypochlorus Peru Trocha Bamboo -13,05 -71,53 pileatus
Lph10 27349 MSB Lophotriccus hypochlorus Peru San Pedro -13,06 -71,55 pileatus 108
Lph11 27510 MSB Lophotriccus hypochlorus Peru Andy's Bamboo -13,04 -71,53 pileatus
Dist. Gualaca, Lophotriccus Cordillera Lpl1 B 26408 LSUMZ luteiventris Panama 8,52 -82,30 pileatus Central, 4.3 km by road S Lago Fortuna dam
Dist. Gualaca, Lophotriccus Cordillera Lpl2 B 28166 LSUMZ luteiventris Panama 8,52 -82,30 pileatus Central, 4.3 km by road S Lago Fortuna dam
Lophotriccus Lpl3 B 72240 LSUMZ luteiventris Costa Rica Navarre, 9,80 -83,92 pileatus Moneco
Moravia, Bajo Lpl4 B 81956 LSUMZ Lophotriccus luteiventris Costa Rica 10,05 -83,98 La Hondura pileatus
San Martín Lpp1 B 44510 LSUMZ Lophotriccus pileatus Peru -7,07 -76,85 Department pileatus
San Martín Lpp2 B 44022 LSUMZ Lophotriccus pileatus Peru -7,07 -76,85 Department pileatus Ca 3km NNE Lophotriccus Lpp3 B 33079 LSUMZ pileatus Peru San Jose de -5,07 -78,97 pileatus Lourdes
Perijá, Serranía de; Serranía Las Lophotriccus Anatenas, Las Lst1 IC 892 MBUCV sanctaeluciae Venezuela 9,37 -72,98 pileatus Lajas, Campamemto 900; Estado Zulia
Lophotriccus Lsq1 B 66697 LSUMZ squamaecrista Peru Tumbes -3,83 -80,32 pileatus Department
Lophotriccus 13 km S Lvc1 B 25501 LSUMZ congener Brazil -4,48 -70,00 vitiosus Benjamin Constant
Lophotriccus RDS Cujubim, Lvc2 CUJ 140 MPEG congener Brazil -4,65 -68,32 vitiosus margem E Rio Jutaí CAM Lophotriccus Lvv1 MPEG vitiosus Brazil Guajará -7,18 -72,80 068 vitiosus CAM Lophotriccus Lvv2 MPEG vitiosus Brazil Guajará -7,18 -72,80 091 vitiosus
CAM Lvv3 MPEG Lophotriccus vitiosus Brazil Guajará -7,18 -72,80 153 vitiosus SE slope Cerro Lophotriccus Lvv4 B 11251 LSUMZ vitiosus Peru Tahuayo, ca km -8,43 -74,53 vitiosus ENE Pucallpa
Lophotriccus Lva1 B 42563 LSUMZ affinis Peru Ca 4 km SE -5,30 -76,27 vitiosus Jeberos
7km SW Lva2 B 42457 LSUMZ Lophotriccus affinis Peru -5,30 -76,27 Jeberos vitiosus 109
Quebrada Lophotriccus Upaquihua ca Lva3 B 46212 LSUMZ affinis Peru -6,57 -76,28 vitiosus 26 km SSE Tartpoto Lophotriccus Lva4 27628 MSB affinis Peru Sianbal -6,65 -76,08 vitiosus
Lva5 27630 MSB Lophotriccus affinis Peru Sianbal -6,65 -76,08 vitiosus
Lva6 27647 MSB Lophotriccus affinis Peru Sianbal -6,65 -76,08 vitiosus
Lva7 27672 MSB Lophotriccus affinis Peru Sianbal -6,65 -76,08 vitiosus
Lva8 31253 MSB Lophotriccus affinis Peru Sianbal -6,65 -76,08 vitiosus
Lva9 27740 MSB Lophotriccus affinis Peru Sianbal -6,64 -76,08 vitiosus
Lva10 27776 MSB Lophotriccus affinis Peru Sianbal -6,64 -76,08 vitiosus
Lophotriccus Lva11 27785 MSB affinis Peru Sianbal -6,64 -76,08 vitiosus
Lva12 27848 MSB Lophotriccus affinis Peru Sianbal -6,64 -76,08 vitiosus
Lophotriccus Lva13 27852 MSB affinis Peru Sianbal -6,65 -76,09 vitiosus
Lva14 27948 MSB Lophotriccus affinis Peru Sianbal -6,65 -76,09 vitiosus
Lva15 28025 MSB Lophotriccus affinis Peru Sianbal -6,65 -76,08 vitiosus
Óbidos, Flona Lvg1 CN 221 MPEG Lophotriccus guianensis Brazil -0,95 -55,52 do Trombetas vitiosus Caracaraí; Vista Alegre; margem Lophotriccus esquerda do Rio Lvg2 A 2153 INPA guianensis Brazil 1,75 -61,08 vitiosus Branco; Parque Nacional do Viruá
Lophotriccus FLOTA de Lvg3 CN 155 MPEG guianensis Brazil -1,70 -57,20 vitiosus Faro, ca 70 km NW de Faro
Munic. Manaus; Lophotriccus km 34 ZF-3, Lvg4 B 20383 LSUMZ guianensis Brazil -2,22 -60,00 vitiosus Faz. Esteio, ca 80 km N Manaus.
Lophotriccus Comunidade Lvg5 B 25485 LSUMZ guianensis Brazil -2,73 -54,90 vitiosus Genipapo, ca 12 km S Belterra Oncostoma Oc4 B 46457 LSUMZ - Panama 9,18 -82,47 cinereigulare Rio 110
Changuinola Arriba, W bank
Oncostoma Reserva Oc1 B 82060 LSUMZ - Costa Rica 9,65 -83,00 cinereigulare Bioldgica Hitoy Cerere
Oncostoma Garabito, Oc2 B 81973 LSUMZ - Costa Rica 9,78 -84,60 cinereigulare Parque Nacional Carara
Pasque Oncostoma Oc3 B 60634 LSUMZ - Honduras Nacional pico 15,72 -88,82 cinereigulare Bonito, EL Naranjo
Oncostoma Oo1 B 2222 LSUMZ - Panama Cana, on E 7,92 -77,68 olivaceum slope Cerri Pirré
Oncostoma Old Gamboa Oo2 B 26945 LSUMZ - Panama 9,05 -79,65 olivaceum Road, 5 km NW Paraiso
Achiote Road Oncostoma Oo3 B 28705 LSUMZ - Panama on Rio 9,22 -80,03 olivaceum Providencia, 25m
Hemitriccus Minas Gerais, Hd1 15541 LGEMA - Brazil Santa Maria do -16,18 -40,13 diops Salto
Amazonas; km Hemitriccus 34 Zf-3, Faz. Hz1 B20168 LSUMZ zosterops Brazil Esteio, ca 80 km -2,22 -60,00 zosterops N. Manaus
Table S2. Primers used in the present study and respective temperature meltdown (Tm) for each one.
Tm Gene Primer Sequence (Celsius) Reference
Sorenson et Cytb L14990 AACATCTCCGCATGATGAAA 45 al., 1999
Tim Birt Cytb H16065 GTCTTCAGTTTTTGGTTTACAAGAC 45 unpublished
Cicero & Johnson, ND2 L5204 TAACTAAGCTATCGGGCCCAT 50 2001
ND2 H6313 CTCTTATTTAAGGCTTTGAAGGC 50 Sorenson et 111
al., 1999
G3P-13 TCCACCTTTGATGCGGGTGCTGGCA Fjeldså et G3PDH B T 65 al., 2003
G3P-14 Fjeldså et G3PDH B AAGTCCACAACACGG TTGTA 65 al., 2003
MUSK- Kimball et MUSK 13F CTTCCATGCACTACAATGGGAAA 50 al., 2009
MUSK- Kimball et MUSK 13R CTCTGAACATTGTGGATCCTCAA 50 al., 2009
Tello et al., RAG2 R2-1 TCTTTTTTGGGCAGAAGGGATG 55 2009
Tello et al., RAG2 R2-6 TTTCTGGTTGTCAGACTGGTAG 55 2009 112
Table S3. Proposed taxa based in species delimitations.
Current taxon Proposed taxon
Lophotriccus galeatus (Boddaert, 1783) (Guiana AE) Colopteryx galeatus (Boddaert, 1783)
Lophotriccus galeatus (Boddaert, 1783) (Tapajós AE) Colopteryx sp1
Lophotriccus galeatus (Boddaert, 1783) (Belém AE) Colopteryx sp2
Lophotriccus galeatus (Boddaert, 1783) (Branco River) Colopteryx sp3
Lophotriccus eulophotes Todd, 1925 Colopteryx eulophotes (Todd, 1925)
Lophotriccus pileatus pileatus (Tschudi, 1844) Lophotriccus pileatus (Tschudi, 1844)
Lophotriccus pileatus hypochlorus Berlepsch & Lophotriccus hypochlorus (Berlepsch & Stolzmann, 1906 Stolzmann, 1906)
Lophotriccus pileatus luteiventris Taczanowski, 1884 Lophotriccus luteiventris (Taczanowski, 1884)
Lophotriccus pileatus squamaecrista (Lafresnaye, 1846) Lophotriccus squamaecrista (Lafresnaye, 1846)
Lophotriccus pileatus sanctaeluciae Todd, 1952 Lophotriccus sanctaeluciae (Todd, 1952)
Lophotriccus vitiosus vitiosus (Bangs & Penard, 1921) Lophotriccus vitiosus (Bangs & Penard, 1921)
Lophotriccus vitiosus affinis Zimmer, 1940 Lophotriccus affinis (Zimmer, 1940)
Lophotriccus vitiosus congener Todd, 1925 Lophotriccus congener (Todd, 1925)
Lophotriccus vitiosus guianensis Zimmer, 1940 Lophotriccus guianensis (Zimmer, 1940)
Hemitriccus minor pallens (Todd, 1925) Lophotriccus pallens (Todd, 1925) 113
22. CONCLUSÃO GERAL
Os resultados aqui apresentados reforçam a importância de amostragens taxonômicas densas em estudos que visam a compreensão dos padrões de diversificação em aves neotropicais, bem como avaliar quão satisfatória é a taxonomia desse grupo e também se estende ao campo da sistemática, uma vez que esta deve refletir a história evolutiva dos taxons. Os dados também elucidam a forte incongruência entre a classificação tradicional e a história da diversificação na subfamília Todirostrinae. Uma vez que muitos dos clados bem suportados recuperados pelas análises filogenéticas empregadas correspondem a gêneros já reconhecidos pela classificação tradicional, parece-nos racional e viável reconhecer as propostas do novo arranjo taxonômico apresentado aqui. Nesse sentido, dada a ligeira incongruência topológica entre os resultados de nossas abordagens filogenéticas, é perfeitamente desejável que trabalhos futuros envolvendo uma taxonomia de maior escala (por exemplo, no nível de Família) e com outras abordagens possam revelar mais precisamente as relações entre os clados investigados. Além disso, como os dados aqui explorados visavam compreender as relações entre grupos de taxons (no nível de gênero), recomenda-se estudos futuros que investigam de forma mais consistente e estendida as relações dentro de alguns gêneros com o potencial de abrigar diversidade críptica (ex. Todirostrum cinereum, T. chrysocrotaphum, Poecilotriccus latirostris e P. sylvia) ou espécies que comprovadamente possuem parafilia com taxons relacionados (ex. Hemitriccus margaritaceiventer, Hemitriccus mirandae). Aqui mostramos que a maioria das espécies previamente reconhecidas dentro do grupo Lophotriccus são parafiléticas e encontram relações inesperadas entre algumas espécies, como a relação de H. m. pallens com L. v. affinis e a relação de H. cohnhafti / H. spodiops com as espécies do Clado 2. Uma vez que todas as subespécies descritas em L. vitiosus e L. pileatus são diagnosticáveis com base em caracteres morfológicos, e as análises de delimitação de espécies sugerem que elas são, na verdade, linhagens evolutivas independentes, todas elas devem ser reconhecidas como espécies plenas. Além disso, o taxon monotipico Lophotriccus galeatus foi recuperado aqui como um complexo de espécies que inclui clados bem suportados correspondentes a áreas de endemismo, e, assim sendo, estudos adicionais sobre a variação fenotípica no grupo são desejáveis para ajudar a revelar o status taxonômico dessas linhagens. Com base nestes 114 resultados e também endossados pelos padrões encontrados na filogenia de Todirostrinae, reforça-se a necessidade de propor uma reforma a nivel taxonômico para este grupo. Ainda, é notável observar que os processos de diversificação dentro do grupo Lophotriccus e seus correlatos estão associados com múltiplos conjuntos de fatores, em vez de um único, e que a dinâmica do clima Pleistoceno parece ser especialmente importante. No entanto, dada a associação reconhecida deste grupo com ambientes florestais e a observação de eventos de diversificação na ausência de barreiras físicas, futuros trabalhos a nível da populacional seriam recomendados a fim de investigar os padrões intrínsecos em cada unidade evolutiva e ajudar a testar as hipóteses de diversificação apresentadas.
23. REFERÊNCIAS GERAIS
Aleixo A. 2004. Historical diversification of a terra-firme forest bird superspecies: a phylogeographic perspective on the role of different hypotheses of Amazonian diversification. Evolution 58: 1303–1317.
Alexander, M. P. & K. J. Burns. 2006. Intraspecific phylogeography and adaptive divergence in the white-headed woodpecker. The Condor 108: 489-508.
Amadon, D., E. Mayr, D. W. Snow, M. A. Traylor & J. T. Zimmer. 1979. Check-list of birds of the world: a continuation of the work of James L. Peters. Cambridge: Harvard University Press. 1-365.
Amaral, F. R., Albers, P. K., Edwards, S. V. & C. Y. Miyaki. 2013. Multilocus tests of Pleistocene refugia and ancient divergence in a pair of Atlantic Forest antbirds (Myrmeciza). Molecular Ecology 22: 3996-4013.
Ames, P. L. 1971. The morphology of the syrinx in passerine birds. Peabody Museum of Natural History Yale University Bulletin 37: 194 pp.
Angelis, K. & M. Reis. 2015. The impact of ancestral population size and incomplete lineage sorting on Bayesian estimation of species divergence times. Current Zoology 61: 874–885.
Antonelli, A., J. A. A. Nylander, C. Persson & I. Sanmartín. 2009. Tracing the impact of the Andean uplift on Neotropical plant evolution. Proceedings of the National Academy of Sciences of the USA 106: 9749-9754.
Avise, J. C. 2000. Phylogeography: the history and formation of species. Harvard University Press, Cambridge, MA. 115
Avise, J. C. 2009. Phylogeography: retrospect and prospect. Journal of Biogeography 36: 3-15.
Ayres, J. C. & T. H. Clutton-Brock. 1992. River boundaries and species range size in Amazonian primates. The American Naturalist 140: 531–537.
Bacon, C. D., D. Silvestro, C. Jaramillo, B. T. Smith, P. Chakrabarty & A. Antonelli. 2015. Biological evidence supports an early and complex emergence of the Isthmus of Panama. Proceedings of Natural Academy of Science 112: 6110–6115.
Batalha-Filho, H., J. Fjeldså, P. H. Fabre & C. Y. Miyaki. 2012. Connections between the Atlantic and the Amazonian forest avifaunas represent distinct historical events. Journal of Ornithology 154: 41-50.
Batalha-Filho, H. & C. Y. Miyaki. 2016. Late Pleistocene divergence and postglacial expansion in the Brazilian Atlantic Forest: multilocus phylogeography of (Aves: Passeriformes). Journal of Zoological Systematics and Evolutionary Research 54: 137-147.
Beckman, E. J. & C. C. Witt. 2015. Phylogeny and biogeography of the New World siskins and goldfinches: rapid, recent diversification in the Central Andes. Molecular Phylogenetics and Evolution 87: 28–45.
Behling H, M. Bush & H. Hooghiemstra. 2010. Biotic development of Quaternary Amazonia: a palynological perspective. In: C. Hoorn, F. P. Wesselingh, eds. Amazonia: Landscape and species evolution. Black-Willey Publisher Ltd, 335-348.
Berlepsch, H. G. 1907. Studien über Tyranniden. Ornis 14: 463-493.
Birdsley, J. S. 2002. Phylogeny of the tyrant flycatchers (Tyrannidae) based on morphology and behavior. The Auk 119: 715–734.
Bonaccorso, E. & J. M. Guayasamin. 2013. On the Origin of Pantepui montane biotas: A Perspective Based on the Phylogeny of Aulacorhynchus toucanets. PLoS ONE 8: 1-10.
Borges, S. H. & J. M. C. Silva. 2012. A new area of endemism for amazonian birds in the rio Negro basin. The Wilson Journal of Ornithology 124:15-23.
Brumfield, R. T. 2012. Inferring the origins of lowland neotropical birds. The Auk 129: 367-376.
Brumfield, R. T. & S. V. Edwards. 2007. Evolution into and out of the Andes: a Bayesian analysis of historical diversification in Thamnophilus antshrikes. Evolution 61: 346-367.
Bulgin, N. L., Gibbs, H. L., P. Vickery & A. J. Baker. 2003. Ancestral polymorphisms in genetic markers obscure detection of evolutionarily distinct populations in the endangered Florida grasshopper sparrow (Ammodramus savannarum floridanus). Molecular Ecology 12: 831-44. 116
Burney, C. W & R. T. Brumfield. 2009. Ecology Predicts Levels of Genetic Differentiation in Neotropical Birds. The American Naturalist 174: 358–368.
Burns, S. J. L., C. Kanner, H. Cheng & R. L. Edwards. 2015. A tropical speleothem record of glacial inception, the South American Summer Monsoon from 125 to 115 ka. Climate of the Past 11: 931–938.
Bush, M. B. 1994. Amazonian speciation: a necessarily complex model. Journal of Biogeography 21: 5–17.
Bush, M. B. & P. E. Oliveira. 2006. The rise and fall of the Refugial Hypothesis of Amazonian Speciation: a paleoecological perspective. Biota Neotropica 6: 1-17.
Cabanne, G. S., Calderon, L., Arias, N. T., Flores, P., Pessoa, R., D’Horta, F. M. & C. Y. Miyaky. 2016. Effects of Pleistocene climate changes on species ranges and evolutionary processes in the Neotropical Atlantic Forest. Biological Journal of the Linnean Society 119: 856–872.
Cadena, C. D., J. Klicka & R. E. Ricklefs. 2007. Evolutionary differentiation in the Neotropical montane region: Molecular phylogenetics and phylogeography of Buarremon brush-finches (Aves, Emberizidae). Molecular Phylogenetics and Evolution 44: 993–1016.
Capurucho, J. M. G., C. Cornelius, S. H. Borges, M. Cohn-Haft, A. Aleixo, J. P. Metzger & C. C. Ribas. 2013. Combining phylogeography and landscape genetics of Xenopipo atronitens (Aves: Pipridae), a white sand campinas specialist, to understand Pleistocene landscape evolution in Amazonia. Biological Journal of the Linnean Society 110: 60-76.
Caro, L. M., P. C. Caycedo-Rosales, R. C. K. Bowie, H. Slabbekoorn & C. D. Cadena. 2013. Ecological speciation along an elevational gradient in a tropical passerine bird? Journal of Evolutionary Biology 26: 357–374.
Chapman, F. M. 1926. The distribution of bird life in Ecuador. Bulletin of American Museum of Natural History 55: 1–784.
Chaves, A. V., C . L. Clozato, D. R. Lacerda, E. H. R. Sari & F. R. Santos. 2008. Molecular taxonomy of Brazilian tyrant-flycatchers (Passeriformes: Tyrannidae). Molecular Ecology Resources 8: 1169–1177.
Chaves, J. A., J. T. Weir & T. B. Smith. 2011. Diversification in Adelomyia hummingbirds follows Andean uplift. Molecular Ecology 20: 4564-4576.
Cheng, H., A. Sinha, W. Cruz, X. Wang, R. L. Edwards, F. M. d’Horta, C. C. Ribas, M. Vuille, L. D. Stott & A. S. Auler. 2013. Climate change patterns in Amazonia and biodiversity. Nature Communications 4: 1-6. 117
Cicero C, N. K. Johnson. 2001. Higher level phylogeny of New World vireos (Aves: Vireonidae) based on sequences of multiple mitochondrial DNA genes. Molecular Phylogenetics and Evolution 20: 27–40.
Cohn-Haft, M. 1996. Why the Yungas Tody-Tyrant (Hemitriccus spodiops) is a Snethlagea, and why it matters. The Auk 133: 709-714.
Cohn-Haft, M. 2000. A case study Amazonian biogeography: vocal and DNA-sequence variation in Hemitriccus flycatchers. PhD Thesis, Louisiana State University, Baton Rouge, EUA, 136p.
Colinvaux, P. A. 1993. Pleistocene biogeography and diversity in tropical forests of South America. In: Goldblatt, P. ed. Biological relationships between Africa and South America. Yale University Press, New Haven pp 473–499.
Corander J., P. Marttinen, J. Sirén & J. Tang. 2008. Enhanced Bayesian modelling in BAPS software for learning genetic structures of populations. BMC Bioinformatics 9: 539.
Corander, J. & J. Tang. 2007. Bayesian analysis of population structure based on linked molecular information. Mathematical Biosciences 205: 19-31.
Corander, J., P. Marttinen. 2006. Bayesian identification of admixture events using multi-locus molecular markers. Molecular Ecology 15: 2833-2843.
Cracraft J. 1985. Historical biogeography and patterns of differentiation within the southamerican avifauna: areas of endemism. Ornithology Monographs 36: 49–84. d’Horta, F. M., A. M. Cuervo, C. C. Ribas, R. T. Brumfield & C. Y. Miyaki. 2012. Phylogeny and comparative phylogeography of Sclerurus (Aves: Furnariidae) reveal constant and cryptic diversification in an old radiation of rain forest understorey specialists. Journal of Biogeography doi:10.1111/j.1365-2699.2012.02760.x
Derryberry, E. P., S. Claramunt, G. Derryberry, R. T. Chesser, J. Cracraft, A. Aleixo, J. Pérez-Emán, J. V. Remsen Jr & R. T. Brumfield. 2011. Lineage diversification and morphological evolution in a large-scale continental radiation: the neotropical ovenbirds and woodcreepers (Aves: Furnariidae). Evolution 65: 2973–2986.
Descimon H. 1986. Origins of Lepidopteran faunas in the high tropical Andes. In: F. Vuilleumier, M. Monasterio, eds. High altitude tropical biogeography. New York: Oxford University Press. 500–532.
Drummond A. J., A. Rambaut. 2012. BEAST. Ver. 1.8.2 Available at http://beast.bio.ed.ac.uk
DuBay, S. G. & C. C. Witt. 2012. An improved phylogeny of the Andean tit-tyrants (Aves, Tyrannidae): More characters trump sophisticated analyses. Molecular Phylogenetics and Evolution 64: 285-296. 118
Duellman, W. E. 1982. Quaternary climatic-ecological fluctuations in the lowland tropics: Frogs and forests. Pages 389–402 In: G. T. Prance, ed. Biological Diversification in the Tropics. Columbia University Press, New York.
Ebel, E. R., J. M. DaCosta, M. D. Sorenson, R. I. Hill, A. D. Briscoe, K. R. Willmott & S. P. Mullen. 2015. Rapid diversification associated with ecological specialization in Neotropical Adelpha butterflies. Molecular Ecology 24: 2392–2405.
Elias, M., M. Joron, K. Willmott, K. L. Silva-Brandão, V. Kaiser, C. F. Arias, L. M. Gomez Piñerez, S. Uribe, A. V. Brower, A. V. Freitas & C. D. Jiggins. 2009. Out of the Andes: patterns of diversification in clearwing butterflies. Molecular Ecology 18:1716-1729.
Endler J. A. 1977. Geographic variation, speciation, and clines. Princeton: Princeton Univ. Press. 262 p.
Fernandes, A. M., M. Wink, C. H. Sardelli & A. Aleixo. 2014. Multiple speciation across the Andes and throughout Amazonia: the case of the spot-backed antbird species complex (Hylohylax naevius/Hylophylax naevioides). Journal of Biogeography 41: 1094-1104.
Ferreira, M., Aleixo, A., Ribas, C. C. & M. P. D. Santos. 2016. Biogeography of the Neotropical genus Malacoptila (Aves: Bucconidae): the influence of the Andean orogeny, Amazonian drainage evolution and palaeoclimate. Journal of Biogeography, doi:10.1111/jbi.12888.
Fitzpatrick, J. W. 1976. Systematics and biogeography of the tyrannid genus Todirostrum and related genera (Aves). Bulletin of the Museum of Comparative Zoology 147: 435-463.
Fitzpatrick, J. W., J. P. O’Neill. 1979. A new Tody-tyrant from northern Peru. The Auk 96: 443-447.
Fitzpatrick, J. W., J. M. Bates, K. S. Bostwick, I. C. Caballero, B. M. Clock, A. Farnsworth, P. A. Hosner, L. Joseph, G. M. Langham, D. J. Lebbin, J. A. Mobley, M. B. Robbins, E. Scholes, J. G. Tello, B. A. Walther & K. J. Zimmer. 2004. Family Tyrannidae (Tyrant-flycatchers). In: del Hoyo, J., A. Elliot, D. A. Christie eds. Handbook of the Birds of the World. Vol. 9. Cotingas to Pipits and Wagtails. Barcelona: Lynx Ediciones, pp. 170–463.
Fjeldså J. 1995. Geographical patterns of neoendemic and older relict species of Andean forest birds: the significance of ecologically stable areas. In: Churchill, S. P. H. Balslev, E. Forero, J. L. Luteyn, eds. Biodiversity and Conservation of Neotropical Montane Forests. New York: The New York Botanical Garden, 89–102.
Fjeldså, J., M. Irestedt. 2009. Diversification of the South American avifauna: patterns and implications for conservation in the Andes. Annals of the Missouri Botanical Garden 96: 398-409. 119
Fjeldså, J., D. Zuccon, M. Irestedt, U. S. Johansson & P.G.P. Ericson. 2003. Sapayoa aenigma: a New World representative of 'Old World suboscines'. Proceedings of the Royal Society B. doi: 10.1098/rsbl.2003.0075
Flórez-Rodríguez, A., M. D. Carling, C. D. Cadena. 2011. Reconstructing the phylogeny of "Buarremon" brush-finches and near relatives (Aves, Emberizidae) from individual gene trees. Molecular Phylogenetics and Evolution 58: 297-303.
Flot, J.F. 2010. Seqphase: a web tool for interconverting phase input/output files and fasta sequence alignments. Molecular Ecology Resources 10: 162-6.
Françoso, E., Zuntini, A. R., Carnaval, A. C., M. C. Arias. 2016. Comparative phylogeography in the Atlantic forest and Brazilian savannas: pleistocene fluctuations and dispersal shape spatial patterns in two bumblebees. BMC Evolutionary Biology, doi: 10.1186/s12862-016-0803-0.
García-R, J. C., A. J. Crawford, A.M. Mendoza, O. Ospina, H. Cardenas & F. Castro. 2012. Comparative Phylogeography of Direct-Developing Frogs (Anura: Craugastoridae: Pristimantis) in the Southern Andes of Colombia. PLoS ONE, doi:10.1371/journal.pone.0046077.
Garzione, C. N., Hoke, G. D., Libarkin, J. C., Withers, S., MacFadden, B., Eiler, J., Ghosh, P., Mulch, A. 2008. Rise of the Andes. Science 320: 1304–1307.
Gernhard T. 2008. The conditioned reconstructed process. Journal of Theoretical Biology 253: 769-778.
Gregory-Wodzicki, K. M. 2000. Uplift history of the central and northern Andes: a review. GSA Bulletin 112: 1091–1105.
Haffer, J. 1969. Speciation in Amazonian forest birds. Science 165:131–137.
Haffer, J. 1978. Distribution of Amazon birds. Bonner Zoologischen Beiträge 29: 38–78.
Haffer, J. 1985. Avian zoogeography of the Neotropical lowlands. Neotropical Ornithology 36:113–146.
Haffer, J. 1987. Biogeography of Neotropical birds. pgs 105–150 In: Whitmore, T. C., G. T. Prance, eds. Biogeography and Quaternary history in tropical America. Clarendon Press, Oxford, United Kingdom.
Haffer, J. 1993. Time’s cycle and time’s arrow in the history of Amazonia. Biogeographica 69: 15–45.
Haffer, J. 2008. Hypotheses to explain the origin of species in Amazonia. Brazilian Journal of Biology 4: 917–947.
Haffer, J. & G.T. Prance. 2001. Climatic forcing of evolution in Amazonia during the Cenozoic: On the refuge theory of biotic differentiation. Amazoniana 16: 579-608. 120
Harris, S. E. & Mix, A. C. 2010. Climate and tectonic influences on continental erosion of tropical South America, 0-13 Ma. Geology 30: 447-450.
Harvey, M. G. & R. T. Brumfield. 2015. Genomic variation in a widespread Neotropical bird (Xenops minutus) reveals divergence, population expansion and gene flow. Molecular Phylogenetics and Evolution 83: 305–316.
Hawkins, B. A., J. A. F. Diniz-Filho, C. A. Jaramillo & S. A. Soeller. 2007. Climate, Niche Conservatism, and the Global Bird Diversity Gradient. The American Naturalist 170: S16-S27.
Hayakawa E. H. & D. F. Rossetti. 2015. Late quaternary dynamics in the Madeira river basin, southern Amazonia (Brazil), as revealed by paleomorphological analysis. Anais da Academia Brasileira de Ciências 87: 29-49.
Heled, J. & A. J. Drummond. 2010. Bayesian inference of species trees from multilocus data. Molecular Biology and Evolution 27: 570-80.
Hellmayr C.E. 1927. Catalogue of birds of the Americas and the adjacent islands, part 5. Publication. Field Museum of Natural History Zoological series 13: 517 p.
Hoorn, C., F. P. Wesselingh, H. ter Steege, M. A. Bermudez, A. Mora, J. Sevink, I. Sanmartín, A. Sanchez-Meseguer, C. L. Anderson, J. P. Figueiredo, C. Jaramillo, D. Riff, F. R. Negri, H. Hooghiemstra, J. Lundberg, T. Stadler, T. Särkinen & A. Antonelli. 2010. Amazonia through time: Andean uplift, climate change, landscape evolution, and biodiversity. Science 330: 927–931.
Hoorn, C., J. Guerrero, G.A. Sarmiento & M.A. Lorente. 1995. Andean tectonics as a cause for changing drainage patterns in Miocene northern South America. Geology 23: 237-240.
Ihering, H. 1904. The biology of the Tyrannidae with respect to their systematic arrangement. The Auk 21: 313-322.
Irion, G. 1976. Quaternary sediments of the upper Amazon lowlands of Brasil. Biogeographica 7: 163–167.
Kattan, G. H., P. Franco, V. Rojas & G. Morales. 2004. Biological diversification in a complex region: a spatial analysis of faunistic diversity and biogeography of the Andes of Colombia. Journal of Biogeography 31: 1829–1839.
Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A. Cooper, S. Markowitz, C. Duran, T. Thierer, B. Ashton, P. Mentjies & A. Drummond. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649.
Kimball, R. T., Braun, E. L., Barker, F. K., Bowie, R. C., Braun, M. J., Chojnowski, J. L., Hackett, S. J., Han, K. L., Harshman, J., Heimer-Torres, V., Holznagel, W., Huddleston, 121
C. J., Marks, B. D., Miglia, K. J., Moore, W. S., Reddy, S., Sheldon, F. H., Smith, J. V., Witt C. C. & T. Yuri. 2009. A well-tested set of primers to amplify regions spread across the avian genome. Molecular Phylogenetics and Evolution 50: 654-60.
Lagomarsino, L. P., F. L. Condamine, A. Antonelli, A. Mulch & C. C. Davis. 2016. The abiotic and biotic drivers of rapid diversification in Andean bellflowers (Campanulaceae). New Phytologist, doi:10.1111/nph.13920.
Landis, M., N. J. Matzke, B. R. Moore & J. P. Huelsenbeck. 2013. Bayesian analysis of biogeography when the number of areas is large. Systematic Biology 62: 789–804.
Lanfear, R., B. Calcott, S.Y. Ho & S. Guindon. 2012. Partitionfinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution 29: 1695-701.
Lanyon, W. E. 1984. A phylogeny of the kingbirds and their allies. American Museum Novitates 2797.
Lanyon, W. E. 1985a. Molecular perspective on higher-level relationships in the Tyrannoidea (Aves). Systematic Zoology 34: 404–418.
Lanyon, W. E. 1985b. A phylogeny of the myiarchine flycatchers. Ornithological Monographs 36: 361–380.
Lanyon, W. E. 1986. A phylogeny of the thirty-three genera in the Empidonax assemblage of tyrant flycatchers. American Museum Novitates 2846.
Lanyon, W. E. 1988a. A phylogeny of the thirty-two genera in the Elaenia assemblage of tyrant flycatchers. American Museum Novitates 2914.
Lanyon, W. E. 1988b. The phylogenetic affinities of the flycatcher genera Myiobius Darwin and Terenotriccus Ridgeway. American Museum Novitates 2915.
Lanyon, W. E. 1988c. A phylogeny of the flatbill and tody-tyrant assemblage of tyrant flycatchers. American Museum Novitates 2923: 1-41.
Larsson, A. 2014. AliView: a fast and lightweight alignment viewer and editor for large data sets. Bioinformatics 30: 3276-3278.
Latrubesse, E. M. 2002. Evidence of Quaternary palaeohydrological changes in middle Amazonia: the Aripuanã-Roosevelt and Jiparaná ‘fans’. Zeitschrift für Geomorphologie 129: 61–72.
Latrubesse, E. M., M. Cozzuol, S. A. F. Silva-Caminha, C. A. Rigsby, M. A. Absy & C. Jaramillo. 2010. The late Miocene paleogeography of the Amazon Basin and the evolution of the Amazon River system. Earth Science Reviews 99: 99–124. 122
López-Alvarado, J., L. Sáez, R. Filigheddu, N. Garcia-Jacas & A. Susanna. 2014. The limitations of molecular markers in phylogenetic reconstruction: The case of Centaurea sect. Phrygia (Compositae). Taxon 63: 1079-1091.
Marchant, R., H. Behling, J. C. Berrio, A. Cleef, J. Duivenvoorden, H. Hooghiemstra, P. Kuhry, B. Melief, E. Schreve-Brinkman, B. Van Geel, T. Van Der Hammen, Van G. Reenen & M. Wille. 2002. Pollen-based biome reconstructions for Colombia at 3000, 6000, 9000, 12 000, 15 000 and 18 000 14C yr ago: Late Quaternary tropical vegetation dynamics. Journal of Quaternary Science 17: 113-129.
Marroig, G. & R. Cerqueira. 1997. Plio-Pleistocene South American history and the Amazon lagoon hypothesis: a piece of the puzzle of Amazonian diversification. Journal of Comparative Biology 2: 103–119.
Mata, H., Fontana, C. S., Maurício, G. N., Bornschein, M. R., Vasconcelos, M. F. & S. L. Bonatto. 2009. Molecular phylogeny and biogeography of the eastern Tapaculos (Aves: Rhinocryptidae: Scytalopus, Eleoscytalopus): Cryptic diversification in Brazilian Atlantic Forest. Molecular Phylogenetics and Evolution 53: 450-462.
Matzke, N. J. 2014. Model selection in historical biogeography reveals that founder-event speciation is a crucial process in Island Clades. Systematic Biology 63: 951-70.
Mauck, W. M., K. J. Burns. 2009. Phylogeny, biogeography, and recurrent evolution of divergent bill types in the nectar-stealing flowerpiercers (Thraupini: Diglossa and Diglossopis). Biological Journal of the Linnean Society 98: 14–28.
Maurício, G. N., Mata, H., Bornschein, M. R., Cadena, C. D., Alvarenga, H. & S. L. Bonatto. (2008). Hidden generic diversity in Neotropical birds: Molecular and anatomical data support a new genus for the Scytalopus indigoticus species-group (Aves: Rhinocryptidae). Molecular Phylogenetics and Evolution 49: 125-135.
Mckay, B. D., H. L. Mays Jr, Y. Wu, H. Li, C. Yao, I. Nishiumi & F. Zou. 2013. An empirical comparison of character-based and coalescent-based approaches to species delimitation in a young avian complex. Molecular Ecology 22: 4943–4957.
Meyer de Schauensee, R. 1966. The species of birds of South America and their distribution. Philadelphia: Publications of Academy of Natural Sciences: 577 pp.
Michelangeli, F. A., P. J. F. Guimarães, D. S. Penneys, F. Almeda & R. Kriebel. 2013. Phylogenetic relationships and distribution of New World Melastomeae (Melastomataceae). Botanical Journal of the Linnean Society 171: 38–60.
Miller, M. J., E. Bermingham, J. Klicka, P. Escalante, F. S. R. Amaral, J. T. Weir, K. Winker. 2008. Out of Amazonia again and again: episodic crossing of the Andes promotes diversification in a lowland forest flycatcher. Proceedings of the Royal Society B 275: 1133–1142. 123
Monasterio, M., F. Vuilleumier. 1986. Introduction: high tropical mountain biota of the world. In: Monasterio M, F. Vuilleumier, eds. High altitude tropical biogeography. New York: Oxford University Press. 3–10.
Moritz, C., J. L. Patton, C. J. Schneider & T. B. Smith. 2000. Diversification of rainforest faunas: an integrated molecular approach. Annual Review of Ecology Systematic 31: 533–563.
Muñoz, M. M., N. G. Crawford, T. J. McGreevy-Jr, N. J. Messana, R. D. Tarvin, L. J. Revell, R. M. Zandvliet, J. M. Hopwood, E. Mock, A. L. Schneider & C. J. Schneider. 2013. Divergence in coloration and ecological speciation in the Anolis marmoratus species complex. Molecular Ecology 22: 2668-2682.
Naka, L. N. 2011. Avian distribution patterns in the Guiana Shield: implications for the delimitation of Amazonian areas of endemism. Journal of Biogeography 38: 681-696.
Naka, L. N., C. L. Bechtoldt, L. M. P. Henriques & R. T. Brumfield. 2012. The Role of Physical Barriers in the Location of Avian Suture Zones in the Guiana Shield, Northern Amazonia. The American Naturalist 179: E115-E132.
Nogueira, A. C. R., R. Silveira & J. T. F. Guimarães. 2013. Neogene-Quaternary sedimentary and paleovegetation history of the eastern Solimões Basin, central Amazon region. Journal of South American Earth Sciences 46: 89-99.
O'Dea, A., H. A. Lessios, A. G. Coates, R. I. Eytan, S. A. Restrepo-Moreno, A. L. Cione, L. S. Collins, A. Queiroz, D. W. Farris, R. D. Norris, R. F. Stallard, M. O. Woodburne, O. Aguilera, M. P. Aubry, W. A. Berggren, A. F. Budd, M. A. Cozzuol, S. E. Coppard, H. Duque-Caro, S. Finnegan, G. M. Gasparini, E. L. Grossman, K. G. Johnson, L. D. Keigwin, N. Knowlton, E. G. Leigh, J. S. Leonard-Pingel, P. B. Marko, N. D. Pyenson, P. G. Rachello-Dolmen, E. Soibelzon, L. Soibelzon, J. A. Todd, G. J. Vermeij & J. B. C. Jackson. 2016. Formation of the Isthmus of Panama. Science Advances 2: e1600883.
Ohlson, J., J. Fjeldså & P. G. P. Ericson. 2008. Tyrant flycatchers coming out in the open: phylogeny and ecological radiation of Tyrannidae (Aves, Passeriformes). Zoologica Scripta 37: 315–335.
Patterson, B. D., S. Solari & P. M. Vela. 2014. The role of the Andes in the diversification and biogeography of Neotropical mammals In: Patterson, B.D., Costa, L. P. eds. Bones, clones, and biomes: the history and geography of Recent Neotropical mammals. University of Chicago Press. 351-378.
Peizhen, Z., Molnar, P. & Downs, W. R. 2001. Increased sedimentation rates and grain sizes 2–4 Myr ago due to the influence of climate change on erosion rates. Nature 410: 891–897. 124
Pérez-Emán, J. L. 2005. Molecular phylogenetics and biogeography of the Neotropical redstarts (Myioborus; Aves, Parulinae). Molecular Phylogenetics and Evolution 37: 511–528.
Peterson, A. T. & C. M. Ammann. 2012. Global patterns of connectivity and isolation of populations of forest bird species in the late Pleistocene. Global Ecology and Biogeography doi: 10.1111/geb.12010
Platt, A., R. Woodhall & A. George. 2007. Improved DNA sequencing quality and efficiency using an optimized fast cycle sequencing protocol. BioTechniques 43: 58-62.
Podos, J., R. Dybboe & M. O. Jensen. 2013. Ecological speciation in Darwin’s finches: Parsing the effects of magic traits. Current Zoology 59: 8–19.
Porzecanski A. L. & J. Cracraft. 2005. Cladistic analysis of distributions and endemism (CADE): using raw distributions of birds to unravel the biogeography of the South American aridlands. Journal of Biogeography 32: 261–275.
Rambaut, A., M. A. Suchard, D. Xie & A. J. Drummond. 2014. Tracer v1.6. Available at: http://tree.bio.ed.ac.uk/ software/tracer/
Rheindt, F. E., Cuervo, A. M. & R. T. Brumfield. 2013. Rampant polyphyly indicates cryptic diversity in a clade of Neotropical flycatchers (Aves: Tyrannidae). Biological Journal of the Linnean Society 108: 889-900.
Rheindt, F. E., Krabbe, N., Wee, A. K. S. & L. Christidis. 2015. Cryptic speciation in the Lesser Elaenia Elaenia chiriquensis (Aves: Passeriformes: Tyrannidae). Zootaxa 4032: 251-263.
Rheindt, F.E., J.A. Norman & L. Christidis. 2008. Phylogenetic relationships of tyrant-flycatchers (Aves: Tyrannidae), with an emphasis on the elaeniine assemblage. Molecular Phylogenetics and Evolution 46: 88–101.
Ribas C. C., R. G. Moyle, C. Y. Miyaki & J. Cracraft. 2007. The assembly of montane biotas: linking Andean tectonics and climatic oscillations to independent regimes of diversification in Pionus parrots. Proceedings of Royal Society B 274: 2399–2408.
Ribas, C. C., A. C. R. Nogueira, A. Aleixo, C. Y. Miyaki, J. Cracraft. 2011. A paleobiogeographic model for biotic diversification within Amazonia over the past three million years. Proceedings of the Royal Society B 279: 681-689.
Ribas, C. C., C. Y. Miyaki & J. Cracraft. 2009. Phylogenetic relationships, diversification and biogeography in Neotropical Brotogeris parakeets. Journal of Biogeography 36: 1712–1729.
Ridgely, R. S. & G. Tudor. 1994. The birds of South America. vol. 2. University of Texas Press, Austin. 125
Ridgway, R. 1907. The birds of North and Middle America, part 4. Bulletin of United States National Museum 50: 973 pp.
Ronquist, F., M. Teslenko, P. van der Mark, D. L. Ayres, A. Darling, S. Höhna, B. Larget, L. Liu, M. A. Suchard & J. P. Huelsenbeck. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 1-4.
Rossetti, D. F., M. C. L. Cohen, S. H. Tatumi, A. O. Sawakuchi, E. H. Cremon, J. C. R. Mittani, T. C. Bertani, C. J. A. S. Munita, D. R. G. Tudela, M. Yee & G. Moya. 2015. Mid-Late Pleistocene OSL chronology in western Amazonia and implications for the transcontinental Amazon pathway. Sedimentary Geology 330: 1-15.
Rossetti, D. F., T. C. Bertani, H. Zani, E. H. Cremon & E. H. Hayakawa. 2012. Late Quaternary sedimentary dynamics in Western Amazonia: implications for the origin of open vegetation/forest contrasts. Geomorphology 177: 74–92.
Roy, M. S., J. M. C. Silva, P. Arctander, J. Garcıa-Moreno, J. Fjeldså. 1997. The speciation of South American and African birds in montane regions. In: Mindell, D.P., ed. Avian molecular evolution and systematics. San Diego: Academic Press. 325–343.
Rull, V. 2008. Speciation timing and neotropical biodiversity: the Tertiary–Quaternary debate in the light of molecular phylogenetic evidence. Molecular Ecology 17: 2722–2729.
Rull, V. 2011. Neotropical biodiversity: timing and potential drivers. Trends in Ecology and Evolution 26. doi:10.1016/j.tree.2011.05.011.
Sanchez-Gonzalez, L. A., A. G. Navarro-Sigüenza, N. K. Krabbe, J. Fjeldså & J. Garcıa-Moreno. 2015. Diversification in the Andes: the Atlapetes brush-finches. Zoologica Scripta 44: 135–152.
Satler, J. D., B. C. Carstens & M. Hedin. 2013. Multilocus Species Delimitation in a Complex of Morphologically Conserved Trapdoor Spiders (Mygalomorphae, Antrodiaetidae, Aliatypus). Systematic Biology 62: 805–823.
Schultz, E. D., C. W. Burney, R. T. Brumfield, E. M. Polo, J. Cracraft & C. C. Ribas. 2017. Systematics and biogeography of the Automolus infuscatus complex (Aves; Furnariidae): Cryptic diversity reveals western Amazonia as the origin of a transcontinental radiation. Molecular Phylogenetics and Evolution 107: 503–515.
Sclater, P. L. 1888. Catalogue of the birds in the British Museum, vol. 14. London: British Museum (Natural History), 494 pp.
Sedano, R. E. & K. J. Burns. 2010. Are the Northern Andes a species pump for Neotropical birds? Phylogenetics and biogeography of a clade of Neotropical tanagers (Aves: Thraupini). Journal of Biogeography 37: 325–343. 126
Shang, H. Y., Z. H. Li, M. Dong, R. M. Adams, G. Miehe, L. Opgenoorth & K. S. Maoa. 2015. Evolutionary origin and demographic history of an ancient conifer (Juniperus microsperma) in the Qinghai-Tibetan Plateau. Scientific Reports 5: 1-15.
Short, L. 1975. A zoogeographic analysis of the South American chaco avifauna. Bulletin of the American Museum of Natural History 154: 163-352.
Silva, J. M. C. 1995. Biogeographic analysis of the South American Cerrado avifauna. Steenstrupia 21: 49–67.
Šmíd, J., J. Moravec, L. Kratochvíl, A. K. Nasher, T. Mazuch, V. Gvoždík, S. Carranza. 2015. Multilocus phylogeny and taxonomic revision of the Hemidactylus robustus species group (Reptilia, Gekkonidae) with descriptions of three new species from Yemen and Ethiopia. Systematics and Biodiversity 13: 346-368.
Smith, B. T., A. Amei & J. Klicka. 2012. Evaluating the role of contracting and expanding rainforest in initiating cycles of speciation across the Isthmus of Panama. Proceedings of Royal Society B 279: 3520–3526.
Smith, B.T., J. E. McCormack, A. M. Cuervo, M. J. Hickerson, A. Aleixo, C. D. Cadena, J. Pérez-Emán, C. W. Burney, X. Xie, M. G. Harvey, B. C. Faircloth, T. C. Glenn, E. P. Derryberry, J. Prejean, S. Fields & R. T. Brumfield. 2014. The drivers of tropical speciation. Nature 515: 406–9.
Sorenson, M. D., J. C. Ast, D. E. Dimcheff, T. Yuri & D. P. Mindell. 1999. Primers for a PCR-based approach to mitochondrial genome sequencing in birds and other vertebrates. Molecular Phylogenetics and Evolution 12:105-114.
Sousa-Neves, T., A. Aleixo & F. Sequeira. 2013. Cryptic patterns of diversification of a widespread Amazonian woodcreeper species complex (Aves: Dendrocolaptidae) inferred from multilocus phylogenetic analysis: implications for historical biogeography and taxonomy. Molecular Phylogenetics and Evolution 68: 410-424.
Stadler, T. & F. Bokma. 2012. Estimating speciation and extinction rates for phylogenies of higher taxa. Systematic Biology Advance: 1-34.
Stamatakis, A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688-2690.
Steiner, C. C., A. Mitelberg, R. Tursi & O. A. Ryder. 2012. Molecular phylogeny of extant equids and effects of ancestral polymorphism in resolving species-level phylogenies. Molecular Phylogenetics and Evolution 65: 573-581.
Stephens, M., N. J. Smith & P. Donnelly. 2001. A new statistical method for haplotype reconstruction from population data. American Journal of Human Genetics 68: 978-89. 127
Struwe, L., S. Haag, E. Heiberg & J. R. Grant. 2009. Andean speciation and vicariance in neotropical Macrocarpaea (Gentianaceae–Helieae). Annals of the Missouri Botanical Garden 96: 450-469.
Suh, A., L. Smeds & H. Ellegren. 2015. The Dynamics of Incomplete Lineage Sorting across the Ancient Adaptive Radiation of Neoavian Birds. PLOS Biology 13: 1-18.
Tello, J. G., J. M. Bates. 2007. Molecular phylogenetics of the tody-tyrant and flatbill assemblage of tyrant flycatchers (Tyrannidae). The Auk 124: 134–154.
Tello, J. G., R. G. Moyle, D. J. Marchese & J. Cracraft. 2009. Phylogeny and phylogenetic classification of the tyrant flycatchers, cotingas, manakins, and their allies (Aves: Tyrannides). Cladistics 25: 429–467.
Thom, G., A. Aleixo. 2015. Cryptic speciation in the white-shouldered antshrike (Thamnophilus aethiops, Aves – Thamnophilidae): The tale of a transcontinental radiation across rivers in lowland Amazonia and the northeastern Atlantic Forest. Molecular Phylogenetics and Evolution 82: 95–110.
Tobias, J. A., J. M. Bates, S. J. Hackett & N. Seddon. 2008. Comment on “The latitudinal gradient in recent speciation and extinction rates of birds and mammals.” Science 319: 901.
Traylor, M. A. 1977. A classification of the tyrant flycatchers (Tyrannidae). Bulletin of the Museum of Comparative Zoology 148: 129-184.
Traylor, M. A. 1979. Check-list of birds the word. Volume 8. Harvard University Press. Cambridge, Massachusetts. van der Hammen, T. & A. M. Cleef. 1986. Development of the high Andean Páramo flora and vegetation. In: Vuilleumier, F., M. Monasterio, eds. High altitude tropical biogeography. New York: Oxford University Press. 153–201.
Wallace, A. R. 1852. On the monkeys of the Amazon. Proceedings of the Zoological Society of London 20: 107–110.
Wang, X., Edwards, R. L., Auler, A. S., Cheng, H., Kong, X., Wang, Y., Cruz, F. W., Dorale, J. A. & H. W. Chiang. 2017. Hydroclimate changes across the Amazon lowlands over the past 45,000 years. Nature 541: 204-207.
Warter, S. L. 1965. The cranial osteology of the New World Tyrannoidea and its taxonomic implications. Ph.D. diss., Louisiana State Univ. Microfilms, Ann Arbor, Michigan, order no. 66-761.
Weir, J.T. & D. Schluter. 2008. Calibrating the avian molecular clock. Molecular Ecology 17: 2321-2328.
Wesselingh, F. P., C. Hoorn, S. B. Kroonenberg, A. Antonelli, J. G. Lundberg, H. B. Vonhof & H. Hooghiemstra. 2010. On the origin of Amazonian landscapes and 128 biodiversity: a synthesis. In: Hoorn C, F. P. Wesselingh, eds. Amazonia: Landscape and species evolution. Black-Willey Publisher Ltd. 421-432.
Zimmer, J. T. 1940. Studies of Peruvian birds. No. 34. The genera Todirostrum, Euscarthmornis, Snethlagea, Poecilotriccus, Lophotriccus, Myiornis, Pseudotriccus, and Hemitriccus. American Museum Novitates 1066: 1-23.
Zimmer, J. T. 1953. Notes on tyrant flycatchers (Tyrannidae). American Museum novitates 1605: 1-16.
Zimmer, K. J., A. Whittaker, C. Sardelli, E. Guilherme & A. Aleixo. 2013. A new species of Hemitriccus tody-tyrant from the state of Acre, Brazil. In: del Hoyo J, Elliott A, Christie D, eds. Handbook of the Birds of the World, Special Volume: New Species and Global Index. Barcelona: Lynx Edicions. 292-296.