Novel Exopolysaccharides Produced by Lactococcus Lactis Subsp

Biosci. Biotechnol. Biochem., 77 (10), 2013–2018, 2013

Novel Exopolysaccharides Produced by Lactococcus lactis subsp. lactis, and the Diversity of epsE Genes in the Exopolysaccharide Biosynthesis Gene Clusters

y Chise SUZUKI, Miho KOBAYASHI, and Hiromi KIMOTO-NIRA

NARO Institute of Livestock and Grassland Science, 2 Ikenodai, Tsukuba, Ibaraki 305-0901, Japan

Received April 19, 2013; Accepted June 26, 2013; Online Publication, October 7, 2013 [doi:10.1271/bbb.130322]

To characterize novel variations of exopolysacchar- ovalbumin-sensitized mice.12) Strain C59 also showed ides (EPSs) produced by dairy strains of Lactococcus significant activity as a plasminogen activator.13) This lactis subsp. lactis and subsp. cremoris, the EPSs of five activity was extracted from bacterial cells by 0.1 M dairy strains of L. lactis were purified. Sugar composi- sodium carbonate buffer (pH 10.0), suggesting that tion analysis showed two novel EPSs produced by cell-surface materials of strain C59 are involved in it. strains of L. lactis subsp. lactis. One strain produced EPS and CPS synthesis is usually controlled by eps EPS lacking galactose, and the other produced EPS operons located on a chromosome or plasmid, and by containing fucose. Among the eps gene clusters of these genes outside the operon.6,14–16) Clusters can differ strains, the highly conserved epsD and its neighboring greatly among strains belonging to the same species, but epsE were sequenced. Sequence and PCR analysis the first six genes, epsRXABCD, in lactococcal eps revealed that epsE genes were strain-specific. By South- operons are highly conserved among strains.6,15,17,18) A ern blot analysis using epsD, the eps gene cluster in each tyrosine (Tyr) phosphorylation regulatory system is strain was found to locate to the chromosome or a very involved in the modulation of polysaccharide synthesis. large plasmid. This is the first report on the identifica- Lactococcal EpsA, EpsB, and EpsC are the predicted tion of two novel EPSs in L. lactis subsp. lactis. The homologs of CpsC (Chain-length determinant protein), strains can be detected among other strains by using CpsD (the Tyr kinase) and CpsB (phospho-Tyr-protein epsE genes specific to them. phosphatase) of streptococcal capsule biosynthesis systems, suggesting that the lactococcal homologs function Key words: exopolysaccharide; sugar composition; in the regulation of CPS/EPS biosynthesis.17,19) EpsD of fucose; Lactococcus lactis; dairy strains lactococci is an undecaprenylphosphate glucosephosphotransferase, and a homolog of CpsE/WchA of Certain strains of Lactococcus lactis produce extrac- Streptococcus pneumoniae. It is essential for CPS/EPS ellular polysaccharides (EPSs) that are associated with biosynthesis,20) and deletion mutants of epsD do not the cell surface in the form of capsular polysaccharides produce EPSs.18,19) Except for such conserved regions, (CPSs), or are secreted into the extracellular environ- the genes following epsD vary among strains. In ment.1) EPS of L. lactis subsp. cremoris, but not of S. pneumonia, 90 individual serotypes are recognized subsp. lactis, have been well characterized. These EPS at present, and the sequences of the capsular biosyn- are heteropolysaccharides composed of repeating units thetic genes of all 90 serotypes have been analyzed.21) In of sugars, among which galactose, glucose, and rham- L. lactis subsp. cremoris, several polysaccharide struc- nose are the most common monosaccharides. The tures of repeated units have been described: pentasac- structures and compositions of several EPSs from charide with galactose,3) pentasaccharide with glucose, L. lactis subsp. cremoris, as well as the sequences and galactose, and rhamnose (ratio 2:2:1),2,22) pentasacchar- organization of the eps genes, have also been re- ide with glucose and galactose (ratio 3:2),4,16) and solved.2–5) The eps gene cluster of L. lactis subsp. lactis heptasaccharide with glucose, galactose, and rhamnose strain KF147, isolated from plants, has been character- (ratio 2:3:2),5) and others,18) but those of L. lactis subsp. ized by complete genome sequence analysis,6) but lactis have not yet been understood. Here, to explore the neither EPS structure nor sugar composition has been variety of Lactococcus EPSs, the sugar compositions of investigated. CPSs/EPSs are thought to protect bacteria EPSs from five dairy strains of L. lactis subsp. lactis and against both environmental and host factors that may be of subsp. cremoris and the DNA sequences of epsD and detrimental to survival. As food materials, EPSs are its flanking epsE genes from these strains were analyzed. useful for increasing viscosity and improving the texture 7,8) of fermented dairy products. CPSs/EPSs have been Materials and Methods found to have properties beneficial to human health, both immunostimulatory9,10) and immunomodulatory.11) Strains, media, and culture preparation. The strains of L. lactis Our group found, for example, that oral administration used in this study are listed in Table 1. L. lactis strains were grown at of live CPS-producing L. lactis subsp. lactis C59 30 C for 18 h in M17 broth (Difco, Detroit, MI, USA) containing 0.5% significantly reduced total IgE antibody levels in (wt/vol) glucose (GM17) or in chemically defined medium23)

y To whom correspondence should be addressed. Fax: +81-29-838-8606; E-mail: csuzuki@affrc.go.jp Abbreviations: EPS, exopolysaccharide; CPS, capsular polysaccharide; CDMG, chemically defined medium containing glucose; GM17, M17 broth containing glucose; DSMG, digested skim milk medium containing glucose; ABEE, p-aminobenzoic acid ethyl ester; TCA, trichloroacetic acid; PFGE, pulsed-field gel electrophoresis 2014 C. SUZUKI et al.

Table 1. L. lactis Strains Used in This Study a 50-mL reaction volume containing 1 LA PCR buffer II, 1.5 mM MgCl2, 200 mM dNTPs, 2.5 units of LA Taq DNA polymerase (Takara Strain Species Source Bio, Otsu), 0.5 mM 50- and 30-primers, and 30 ng of template DNA 0 C59a L. lactis subsp. lactis bv. Laboratory collection48) where not otherwise specified. To detect epsB genes, primers 5 B83 diacetylactis and 30B1074 were used. Amplifications were performed in a DNA C60a L. lactis subsp. cremoris Laboratory collection48) thermal cycler (2400, Perkin-Elmer, Waltham, MA) under the DRC2a L. lactis subsp. lactis bv. NIRDa following cycling conditions: initial 94 C for 5 min; 35 cycles at diacetylactis 94 C for 30 s, 62 C for 30 s, and 72 C for 4 min; and final 72 C for a a Hc-1 L. lactis subsp. cremoris NIRD 8 min. For vectorette PCR, DNA fragments digested with an a 48) O22 L. lactis subsp. cremoris Laboratory collection appropriate restriction enzyme (Dra I, Alu I) were ligated to a 49) H61 L. lactis subsp. cremoris Laboratory collection synthetic oligonucleotide duplex (annealed anchor bubble-1 and -2). H-17 L. lactis subsp. cremoris Laboratory collection49) Three mL of the ligation mixture was used as template, along with one 341 L. lactis subsp. cremoris Laboratory collection48) of the epsD primers and a universal vectorette primer. For inverse Q14 L. lactis subsp. lactis Laboratory collection48) Q20 L. lactis subsp. lactis Laboratory collection48) PCR, DNA fragments digested by means of an appropriate restriction G50 L. lactis subsp. lactis Laboratory collection48) enzyme were self-ligated and used as PCR templates. The PCR J50 L. lactis subsp. cremoris Laboratory collection48) products were separated by 1.0% (wt/vol) agarose gel electrophoresis, O7 L. lactis subsp. lactis bv. Laboratory collection48) purified, and sequenced with an ABI Prism 3700 Genetic Analyzer diacetylactis (Applied Biosystems, Foster City, CA). Sequence data were assembled Ho-6 L. lactis subsp. cremoris Laboratory collection49) and analyzed with an AutoAssembler 2.1 (Applied Biosystems). H41-21 L. lactis subsp. cremoris Laboratory collection49) Databases were searched by BLASTN and BLASTP algorithms.28) H41-61 L. lactis subsp. cremoris Laboratory collection49) 49) F-16 L. lactis subsp. cremoris Laboratory collection Phylogenetic tree analysis. Multiple sequence alignments were b 924 L. lactis subsp. cremoris NIRD done using the program CLUSTAL W.29,30) The evolutionary history ATCC19257 L. lactis subsp. cremoris ATCCc was inferred by the neighbor-joining method31) with 1,000 bootstrap aStrains used in the preparation of EPS and the sequence of epsE are trials. Evolutionary distances were computed by the p-distance underlined. method.32) Evolutionary analyses were conducted in MEGA5.33) bNIRD, National Institute for Research in Dairying (UK) Pulsed-field gel electrophoresis (PFGE) of the lactococcal genome. containing 2% glucose (CDMG). For comparison, digested skim milk The genomic DNAs of the lactococcal strains were purified and 34) medium containing 2% glucose (DSMG)24) was also used in EPS digested with Sma I in agarose plugs. PFGE was done by a CHEF preparation. DRIII system (Bio-Rad). Agarose gels (1%) were prepared from Pulsed-field Certified agarose (Bio-Rad) and then run in 1 TAE at Preparation of EPS. L. lactis cells were grown in CDMG. EPS in 14 C at an initial switch time of 3.0 s, and a final switch time of 21.8 s the CDMG culture filtrates was precipitated by the addition of 2 (run time 18 h, angle 120 , voltage 6.0 V/cm). volumes of ethanol, and was dissolved in water. After deproteinization by the addition of trichloroacetic acid (TCA, final concentration, 12%), Southern blot analysis. The DNA fragments, separated by PFGE EPS was re-precipitated with 2 volumes of ethanol and dissolved in were transferred onto nylon membrane (Hybond N, Amersham water, followed by dialysis and lyophilization. A Shimadzu LC10AD Biosciences, Buckinghamshire, England) by means of a vacuum blot HPLC system (Shimadzu, Kyoto) was used for all HPLC analyses. apparatus (Vacugene, Amersham Biosciences). An epsD fragment High molecular weight EPSs were fractionated with a TSKgel (460 bp) was amplified with primers 50D1318 and 30D104, purified G5000PW column (600 7:5 mm i.d., Tosoh, Tokyo) equilibrated with a PCR purification kit (QIAGEN), and labeled with a Digoxigenin with 0.1 M ammonium hydrogen carbonate (pH 8.0) at 0.8 mL min1. (DIG) High Prime kit (Roche Diagnostics, Mannheim, Germany) Standard pullulan samples (8:1 105 to 9:2 103 Da; Showa Denko, following the manufacturers’ instructions. Hybridization was carried Kanagawa, Japan) were used for calibration. They were detected with a out at 42 C. The membrane was washed under conditions of refractive index detector. The EPS fractions (from 1:0 104 to high stringency at 68 C. Detection was done with an anti-DIG 8:0 105 Da) were lyophilized and used for sugar composition antibody alkaline phosphatase conjugate and CSPD. The membrane analysis. was activated at 37 C for 10 min and developed to an X-ray film (Roche). Sugar composition analysis. After hydrolysis with 4 M trifluoro- acetic acid at 100 C for 2 h, the hydrolyzed products of EPS were N- Transcription analysis of the epsE gene. The reverse transcriptase acetylated.25) The resulting monosaccharides and a standard mono- (RT) reaction was run using 1 mg of RNA with primers derived from saccharide mixture (Seikagaku, Tokyo) containing glucuronic acid, epsE from each strain (Table 2), followed by PCR, as described above. galactose, mannose, glucose, arabinose, ribose, N-acetylmannosamine, xylose, N-acetylglucosamine, fucose, rhamnose, and N-acetylgalactosamine were labeled with p-aminobenzoic acid ethyl ester (ABEE) with Results an ABEE labeling kit25) (Seikagaku). Monosaccharides converted were analyzed by reverse-phase HPLC with a Honenpak C18 column (i.d. Diversity of sugar compositions of EPSs produced by 75 4:5 mm, Seikagaku) and 0.2 M potassium borate buffer (pH 8.9) L. lactis containing 7% acetonitrile as solvent. The eluent from the column was Previously, we found that 20 of 27 L. lactis strains detected at 305 nm. produced CPS microscopically by India-ink negative staining.35) By PCR analysis, two strains of L. lactis DNA and RNA isolation and manipulation. Molecular manipulation was done by standard methods.26) Total bacterial DNA was isolated subsp. lactis, C59 and DRC2, and three strains of with DNeasy Blood and Tissue kit (QIAGEN, Germantown, MD). L. lactis subsp cremoris C60, Hc-1 and O22, that Total RNA from the lactococcal strains was isolated from logarithmi- possessed epsB gene were selected (Table 1). 27) cally grown cells (OD620 0.3). The cells were partially frozen in We used CDMG for culture of L. lactis to isolate liquid N2, collected by centrifugation, and broken by means of glass EPSs to exclude polysaccharides from the media. In beads in the presence of phenol with FastPrep (Qbiogene, BIO101 preliminary experiments, we confirmed that polysaccha- Systems, Carlsbad, CA). Total RNA was purified with an RNeasy Mini kit (QIAGEN). ride fractions prepared from uncultured GM17 contained mannose, which can be derived from yeast extracts.22) PCR and DNA sequencing analysis. All the primers used in PCR in Similary, polysaccharide fractions prepared from DSMG this study are listed in Table 2. PCR amplifications were carried out in contained galactose and glucose. The purification steps Novel Exopolysaccharides Produced by L. lactis subsp. lactis 2015 Table 2. Oligonucleotide Primers Used in This Study

Primer Sequence (50 ! 30) Target and PCR method used Anchor bubble-1 CTTCCTCTCCTGCGACAGACAGCTTCCATTCCTTGCCTGCTCTCTTCCCTCTC Vectorette PCR Anchor bubble-2 GACTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC Vectorette PCR Vectorette primer CGAATCGTAACCGTTCGTACGAGAATCGCT Vectorette PCR 50D418G ATCAATGTTCTTAAAGGGGATATGGC Vectorette PCR 50D2 AGGGGATATGGCATTGGTTGGCCCAAGAC Vectorette PCR 50B83 GGCACGTACAACAAGAACCACTCCTCC epsB, RT-PCR 30B1074 GGCACGTACAACAAGAACCACTCCTCC epsB, RT-PCR 50D1318 TGATATCCTAGGAGGATTATCGGG epsD 30D104 CTTTACTTCGACCATGTGTCGTCC epsD, inverse PCR, RT-PCR 50D3590 ACAAACTATTTACGGATGGGACGC epsD, inverse PCR, RT-PCR 50D3098 AGATCAAGGGCCAATGTTCT epsD, RT-PCR 50C59E3651 GAACAACTCATGATGTTAAGGCCC epsC59E, RT-PCR 30C59E3892 CATAGGTATCATAGCTAGAGCACCC epsC59E, RT-PCR 50DRC2E651 GCAGTACCTGTAGCATTTGG epsDRC2E 50DRC2E GCATTAGTAGGTTCCAGCG epsDRC2E,RT 30DRC2E651 CCAAATGCTACAGGTACTGC epsDRC2E,RT 50C60E GAAGTAAATGGGTATGAGGG epsC60E, inverse PCR, RT-PCR 30C60E ATTAAGTTTGCACCATAGGC epsC60E, RT-PCR 30C60E730 TAAATGGCGTTTGCTGGTCC epsC60E, inverse PCR 50C60E 2 CTATCTTCATGGTCATGAGG epsC60E 50Hc1E 2 TTATTTCGAGTGGTGCTGCG epsHc-1E 50Hc1E ATGAAGAGTATACGCAGAGG epsHc-1E 30epsB891E CTCTTCCCATTGAACTATAAAC epsHc-1E, epsO22E, RT-PCR 30epsB891F GTTGTTCGTGAGTTCCAACC epsHc-1F, epsO22F to isolate EPS included ethanol precipitation, TCA Table 3. Sugar Compositions of EPSs (%) of L. lactis Strains precipitation, dialysis, and ultrafiltration (>3 104 Da), Retention Strain which cannot exclude polysaccharides from these Sugar time (min) media. Hence we used CDMG for culture and high- C59 C60 DRC2 Hc-1 O22 molecular-weight EPSs (from 1:0 104 to 8:0 105 Glucuronic acid 8.5 —a 1.7 — — — Da) were fractionated by gel filtration chromatography Galactose 12.4 — 21.4 39.2 35.3 36.1 Mannose 15.3 — 3.6 — 10.2 10.5 to estimate the sugar composition. Glucose 18.2 54.4 36.8 20.2 20.2 21.4 The sugar compositions of EPSs of the five strains N-Acetylglucosamine 27.2 37.3 8.7 — 10.9 11.0 were shown in Table 3. The EPS of strain C59 consisted Fucose 29.4 — — 14.5 — — of glucose, N-acetylglucosamine, and rhamnose. It was Rhamnose 33.6 8.3 22.2 26.1 18.6 16.3 N-Acetylgalactosamine 48.7 — — — 4.9 4.6 unique in that galactose was absent, in that all the EPSs of L. lactis subsp. cremoris reported to date contain aNone galactose.2–5,22) On the other hand, the sugar composi- The values represent % of the total EPS. Data are presented as means for two independent experiments. tion of the EPS of strain DRC2 was unique in that fucose was present. Fucose has not previously been reported to occur in EPSs from Lactococcus. The EPS of strain C60 strain of Enterococcus faecium, and one strain of consisted mainly of galactose, glucose, N-acetylglucos- Streptococcus agalactiae. The nucleotide sequences of amine, and rhamnose, with small amounts of glucuronic the epsDs were well conserved among Lactococcus, but acid and mannose. Because CDMG does not contain any were significantly different from other genera. Differ- source of mannose, mannose is a component of these entiation of Lactococcus species and subspecies by the EPSs. The EPSs from Hc-1 and O22 exhibited almost sequences of epsD proved impossible. identical sugar compositions. To determine the locus of the eps gene cluster, Sma I digested genomic DNA fragments from the five strains Conserved epsD genes and their localization on the were analyzed by PFGE followed by Southern blot chromosome analysis using epsD as probe (Fig. 2). A single Sma I To characterize the eps gene cluster, the conserved fragment (100–280 kb) was hybridized with epsD in epsD of each strain and its downstream neighboring each strain, suggesting that each of the eps gene clusters gene, labeled epsE, were amplified by vectorette PCR36) is located on the chromosome or a very large plasmid. and inverse PCR. The nucleotide sequences of the Strains Hc-1 and O22 showed similar patterns of Sma I epsDE regions of strains O22, C59, DRC2, Hc-1, and fragments in PFGE and in the size of fragments C60 have been submitted to the DDBJ under accession hybridized with epsD. nos. AB373091, AB373092, AB373093, AB373094, and AB373095 respectively. Strain-specific epsE genes The putative product of epsD is an undecaprenyl- A comparison of the epsE regions of the five strains phosphate glucosephosphotransferase, a key enzyme in with their homologs indicates that the epsE genes varied EPS synthesis. Figure 1 shows a phylogenetic tree among the strains. Here, the gene was designated constructed using the nucleotide sequences of the epsD eps[strain name]E, as for example epsC59E, and the of eight strains of L. lactis subsp. cremoris, three strains product was designed Eps[strain name]E, as for example of L. lactis subsp. lactis, one strain of Lactococcus EpsC59E. Since the nucleotide sequences of epsHc-1E garvieae, two strains of Streptococcus pneumoniae, one and epsO22E were identical, the primary gene products 2016 C. SUZUKI et al. AB

Fig. 1. Phylogenetic Tree of epsD of L. lactis and Related Species. The nucleotide sequences of the genes encoding the undecaprenylphosphate glucosephosphotransferase of 12 Lactococcus strains and four strains of other genera were compared by MEGA5. The five Fig. 2. PFGE of Sma I Digests of Genomic DNA of L. lactis Strains strains used in this study are underlined. epsD homologs used (A) and Southern Blot Analysis Using epsD Probe (B). (GenBank accession no.): epsD of O22 (AB373091), Hc-1 Lane 1, C59; lane 2, C60; lane 3, DRC2; lane 4, Hc-1; lane 5, (AB373094), L. lactis subsp. cremoris SMQ-461 (AY741550), O22. Lactococcus garvieae Lg2 (AP009333), DRC2 (AB373093), L. lactis subsp. cremoris B891 (AF100298), L. lactis subsp. cremoris Ropy352 (EF192213), L. lactis subsp. lactis KF147 (CP001834), EpsDRC2E (331 AAs) has a structure with an N- L. lactis subsp. cremoris B40 (AF036485), C60 (AB373095), terminal hydrophilic region followed by six transmem- L. lactis subsp. cremoris HO2 (AF142639), and C59 (AB373092), brane domains (TMDs). The function of the hydrophilic wcjG of Streptococcus pneumoniae strain 10061/38 (serotype 10a) (CR931649), cpsE of Enterococcus faecium E980 N-terminal region (1–137 AAs) of EpsDRC2E is (ABQA01000044), Streptococcus agalactiae NEM316 unknown. The six TMDs (138–307 AAs) were similar (AL766849), and wchA of S. pneumoniae strain 34357 (serotype to the C-terminal TMDs of EpsM from SMQ461 (282– 13) (CR931661). An optimal tree with sum of branch length ¼ 463 AAs in 482 AAs), the uncharacterized protein LAF- 0.3014 is shown. 1415 (284–453 AAs in 476 AAs) of Lactobacillus fermentum, and an O-antigen transporter from MG1363 were predicted to be identical. Here, epsHc-1E is (283–446 AAs in 472 AAs) (Fig. 2D). described as representative of two genes. To confirm the expression of these eps genes, total The amino acid sequence of EpsHc-1E was identical RNA was prepared and the expression of epsD and epsE to those of EpsE of Lactococcus strains Ropy352,16) and to each strain was examined by reverse transcriptase- B891,18) whereas five base substitutions were found at PCR. The PCR products corresponding to epsD and the nucleotide sequence level. On the basis of predicted epsE were detected, indicating that all the gene were amino acid similarity, EpsC59E and EpsHc-1E were functional (data not shown). found to be homologs of UDP-GlcNAc transferase To determine whether each of the epsE genes is subunit Alg14, with 22% and 31% identity to the human present among L. lactis subsp. lactis and subsp. cremo- Alg14 homolog (UniProt, Q96F25.1) respectively. ris strains, PCR was performed with 19 L. lactis strains Figure 3A shows a phylogenetic tree constructed using (Table 1) as templates and primer sets from each epsE the nucleotide sequences of the alg14 homologs of gene from strains C59, C60, DRC2, and Hc-1. Each Lactococcus strains and those of several species, epsE fragment was amplified from the corresponding including human alg14. Alg14 and Alg13 form a strain among the 19 strains, except for strains Hc-1 and complex in which Alg14 functions as a membrane O22 (data not shown), suggesting that each various epsE anchor and Alg13 as a catalytic subunit of a UDP- genes is strain-specific. Although the whole eps clusters GlcNAc transferase.37,38) As shown in Fig. 3B, epsHc- of these strains have not yet determined, the strain- 1E and the following epsHc-1F were homologous to specific epsE regions can serve as probes for detecting pneumococcal cps14F (P72514) and cps14G (P72515) distinct eps clusters. respectively.39) EpsHc-1F, EpsFs of Ropy352 and B891, and Cps14G are homologs of the catalytic subunit of Discussion UDP-GlcNAc transferase Alg13. EpsHc-1F had 32% identity to a human Alg13 homolog (NP 001161857). In this study, we analyzed sugar composition of EPS The amino acid sequence of EpsC60E (385 amino and strain-specific epsE genes of three strains of acids, AAs) showed similarity to rhamnosyltransferases, L. lactis subsp. cremoris and two strains of L. lactis categorized as most closely related to the GT1 family of subsp. lactis. Strain Hc-1 and O22 had identical epsE glycosyltransferases (Fig. 3C). The streptococcal rham- genes and produced EPS with identical sugar composi- nosyltransferases showed high similarity to EpsC60E. tions, but the other three strains were unique in epsE A transmembrane protein topology prediction genes and EPS sugar composition. We found that the algorithms (TMpred program; http://www.ch.embnet. epsE sequence, a downstream gene of conserved epsD, org/software/TMPREDform.html) predicted that could be used to identify novel eps gene clusters. Novel Exopolysaccharides Produced by L. lactis subsp. lactis 2017 A EpsE of L. lactis B40, a UDP-GlcNAc transferase homolog, can transfer UDP-glucose to lipid-linked glucose,20) but the substrate specificities of other bacterial UDP-GlcNAc transferase homologs have not been determined. Ramos et al.40) examined intracellular pools of UDP-sugars in an EPS-producing strain and a non-producing strain, and found that there is competi- tion between EPS synthesis and cell growth. UDP- GlcNAc may preferentially proceed by peptidoglycan synthesis rather than EPS synthesis. On the other hand, heterologous expression of the eps gene cluster of Streptococcus thermophilus in a L. lactis strain lacking UDP-GalNAc caused the replacement of GalNAc by B Gal in recombinant EPS,41) suggesting that bacterial glycosyltransferases might have multiple specificities for the donor and the acceptor sugar molecule. Further characterization of the glycosyltransferases encoded in eps gene clusters should provide a clue to the strain- specific determinants of EPS sugar composition. Strain DRC2 produced EPS, containing galactose, glucose, rhamnose, and fucose. The EPS of strain DRC2 does not contain amino sugars. Fucose has not previously been reported to occur in EPSs from Lactococcus. We investigated fucose-containing EPS for the first time in strain DRC2. In lactic acid bacteria, EPS of C S. thermophilus MR-1C composed of galactose, rhamnose, and fucose at a ratio of 5:2:1.42) Fucosylation in prokaryotic organisms might be involved in molecular mimicry, adhesion, colonization, and modulation of the host immune response.43) Our preliminary in vitro D experiment suggested that strain C59 but not strain DRC2 evaded uptake by a macrophage-like cell line (data not shown). EPS of strain C59 contained glucose, rhamnose, and GlcNAc, and was unique in lacking Fig. 3. Phylogenetic Tree of alg14 Homologs of L. lactis and Other galactose. Macrophages can recognize the surfaces Genera (A) and Schematic Diagram of the Organization of the molecules, and the distinct characteristics of CPS may epsDE Regions (B, C, D). be involved. For example, an eps mutant of Streptococ- Nucleotid sequences of alg14 (glycosyltransferase activity en- cus iniae is susceptible to phagocytosis whereas its hancer) homologs of six Lactococcus strains and six other genera parent strain is not.44) Furthermore, the mitogenic were compared by MEGA5 (A). The strains used in this study (O22, Hc-1 and C59) are undelined. Genes used (GenBank accession no.): activity of an acidic polysaccharide from Lactobacillus epsHc-1E, epsO22E, L. lactis subsp. cremoris Ropy352 epsE delbrueckii subsp. bulgaricus was completely abolished (EF192213), L. lactis subsp. cremoris B891 epsE (AF100298), by dephosphorylation.45) In view of their susceptibility S. pneumoniae serotype 14 cps14F (X85787), S. pneumoniae to phagocytosis, the structures of repeated units of the serotype 8 wciQ (AF316641), E. faecium E980 epsG (AB- QA01000044), epsC59E, L. lactis subsp. cremoris HO2 epsG EPSs and sugar modification should be determined. (AF142639), Schizosaccharomyces pombe alg14 (CU329670), Ho- The sugar composition of the EPS of strain C60 was mo sapiens alg14 (AK289395), Sphingomonas elodea ATCC 31461 similar to that of EPSs from L. lactis subsp. cremoris gelK (AF305842). The percentages of replicate trees in which the B40,22) and L. lactis subsp. cremoris SBT0495,24) associated taxa clustered together on the bootstrap test (1,000 wheras the former contained small amounts of glucur- replicates) are shown next to the branches. An optimal tree with sum of branch length=1.7949 is shown. Schematic diagram of the onic acid and mannose but the latter did not. EpsC60E organization of alg14 homologs presented in A (B), epsC60E (385AA) is similar to rhamnosyltransferases of strepto- homologs (C), and epsDRC2E homologs (D). The strains used in cocci and entrococci in addition of those of lactococci this study are underlined. Genes used (GenBank accession no.): (Fig. 3C). While rhamnose was detected in all the EPSs epsC60E, E. faecium 1,231,501 EFRG 00402 (GG688436), S. pneu- analyzed in this study, rhamnosyltransferase genes were moniae 554/62 wchF21) (CR931640), Lactococcus garvieae Lg2 LCGL 0438 (AP009333), epsDRC2E, L. lactis subsp. cremoris not amplified by PCR analysis using epsC60E primers in SMQ461 epsM15) (AY741550), Lactobacillus fermentum IFO3956 19 strains of L. lactis, indicating that the rhamnosyl- LAF-1415 (AP008937), L. lactis subsp. cremoris MG1363 rfbX transferase encoded in epsC60E is unique to this strain. (AM406671). The rhamnosyltransferase of Lactococcus garvieae Lg2 (UniProt, F9VC47) was most similar to EpsC60E (83% Although the gene products of epsHc-1E, epsO22E, and identity). Genomic analysis of L. garvieae Lg2 indicated epsC59E, as well as the epsEs of strains B891 and that this rhamnosyltransferase, encoded in LCGL 0438, Ropy352, are all thought to be UDP-GlcNAc transferase is absent in a non-virulent strain, ATCC 49156.46) The homologs, GlcNAc was detected in EPS of strains Hc-1, upstream region of LCGL 0438 is similar to the O22, and C59 but not in those from strains B891 and conserved epsRXABCD in L. lactis. Morita et al. found Ropy352. It has been confirmed experimentally that that the capsule or eps gene cluster may be widely 2018 C. SUZUKI et al. spread among lactococci, including those in human gut 20) van Kranenburg R, van Swam II, Marugg JD, Kleerebezem M, microbiota.46) Genomes of dairy lactococci may be and de Vos WM, J. Bacteriol., 181, 338–340 (1999). involved in the horizontal gene transfer of eps genes in 21) Bentley SD, Aanensen DM, Mavroidi A, Saunders D, Rabbinowitsch E, Collins M, Donohoe K, Harris D, Murphy the human gut via dairy product intake, contributing to L, Quail MA, Samuel G, Skovsted IC, Kaltoft MS, Barrell B, 47) the main mechanism of evolution. A metagenomic Reeves PR, Parkhill J, and Spratt BG, PLoS Genet., 2, e31 approach to dairy products or fermented foods may (2006). elucidate genetic exchange in eps gene clusters in 22) van Casteren WHM, Dijkema C, Schols HA, Beldman G, and Lactococcus. Voragen AG, Carbohydr. Polym., 37, 123–130 (1998). In this study, two novel EPSs produced by L. lactis 23) Otto R, Brink B, Veldkamp H, and Konings WN, FEMS subsp. lactis were identified. Our results indicate that Microbiol. Lett., 16, 69–74 (1983). 24) Nakajima H, Toyoda S, Toba T, Itoh T, Mukai T, Kitazawa H, epsE downstream of conserved epsD showed diversity and Adachi S, J. Dairy Sci., 73, 1472–1477 (1990). of strains and can be used as strain-specific probes. The 25) Yasuno S, Kokubo K, and Kamei M, Biosci. Biotechnol. chemical structures of these EPSs and sequence analysis Biochem., 63, 1353–1359 (1999). of complete eps clusters are under investigation. 26) Sambrook J, Fritsch EF, and Maniatis T, ‘‘Molecular Cloning, a Laboratory Manual’’ 2nd edn., Cold Spring Harbor Laboratory Acknowledgments Press, Cold Spring Harbor (1989). 27) Redon E, Loubiere P, and Cocaign-Bousquet M, J. Biol. Chem., 280, 36380–36385 (2005). This study was supported in part by a Grant-Aid for 28) Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Scientific Research (C) no. 23580124 from the Japan Miller W, and Lipman DJ, Nucleic Acids Res., 25, 3389–3402 Society for the Promotion of Science (to C. S.) and by a (1997). grant (Development of Evaluation and Management 29) Thompson JD, Higgins DG, and Gibson TJ, Nucleic Acids Res., Methods for Supply of Safe, Reliable, and Functional 22, 4673–4680 (1994). Foods and Farm Produce) from the Ministry of 30) Larkin M, Blackshields G, Brown N, Chenna R, McGettigan P, McWilliam H, Valentin F, Wallace I, Wilm A, Lopez R, Agriculture, Forestry, and Fisheries of Japan (to C. S.). Thompson J, Gibson T, and Higgins D, Bioinformatics, 23, 2947–2948 (2007). References 31) Saitou N and Nei M, Mol. Biol. Evol., 4, 406–425 (1987). 32) Nei M and Kumar S, ‘‘Molecular Evolution and Phylogenetics,’’ 1) De Vuyst L, De Vin F, Vaningelgem F, and Degeest B, Int. Oxford University Press, New York, pp. 1–339 (2000). Dairy J., 11, 687–707 (2001). 33) Tamura K, Peterson D, Peterson N, Stecher G, Nei M, and 2) Nakajima H, Hirota T, Toba T, Itoh T, and Adachi S, Kumar S, Mol. Biol. Evol., 28, 2731–2739 (2011). Carbohydr. Res., 224, 245–253 (1992). 34) Le Bourgeois P, Lautier M, van den Berghe L, Gasson MJ, and 3) Gruter M, Leeflang BR, Kuiper J, Kamerling JP, and Vliegen- Ritzenthaler P, J. Bacteriol., 177, 2840–2850 (1995). thart JF, Carbohydr. Res., 231, 273–291 (1992). 35) Suzuki C, Kimoto-Nira H, Kobayashi M, Nomura M, Sasaki K, 4) van Casteren WHM, de Waard P, Dijkema C, Schols HA, and and Mizumachi K, Int. J. Food Microbiol., 123, 159–165 (2008). Voragen AG, Carbohydr. Res., 327, 411–422 (2000b). 36) Riley J, Butler R, Ogilvie D, Finniear R, Jenner D, Powell S, 5) van Casteren WHM, Dijkema C, Schols HA, Beldman G, and Anand R, Smith JC, and Markham AF, Nucleic Acids Res., 18, Voragen AG, Carbohydr. Res., 324, 170–181 (2000a). 2887–2890 (1990). 6) Siezen RJ, Starrenburg MJ, Boekhorst J, Renckens B, Molenaar 37) Gao XD, Tachikawa H, Sato T, Jigami Y, and Dean N, J. Biol. D, and van Hylckama Vlieg JE, Appl. Environ. Microbiol., 74, Chem., 280, 36254–36262 (2005). 424–436 (2008). 38) Chantret I, Dancourt J, Barbat A, and Moore SE, J. Biol. Chem., 7) Dabour N, Kheadr E, Benhamou N, Fliss I, and LaPointe G, 280, 9236–9242 (2005). J. Dairy Sci., 89, 95–110 (2006). 39) Kolkman MA, van der Zeijst BA, and Nuijten PJ, J. Biol. 8) Hassan AN, Awad S, and Muthukumarappan K, J. Dairy Sci., Chem., 272, 19502–19508 (1997). 88, 4221–4227 (2005). 40) Ramos A, Boels IC, de Vos WM, and Santos H, Appl. Environ. 9) Hosono A, Lee J, Ametani A, Natsume M, Hirayama M, Adachi Microbiol., 67, 33–41 (2001). T, and Kaminogawa S, Biosci. Biotechnol. Biochem., 61, 312– 41) Stingele F, Vincent SJ, Faber EJ, Newell JW, Kamerling JP, and 316 (1997). Neeser JR, Mol. Microbiol., 32, 1287–1295 (1999). 10) Kitazawa H, Itoh T, Tomioka Y, Mizugaki M, and Yamaguchi 42) Low D, Ahlgren JA, Horne D, McMahon DJ, Oberg CJ, and T, Int. J. Food Microbiol., 31, 99–106 (1996). Broadbent JR, Appl. Environ. Microbiol., 64, 2147–2151 11) Kitazawa H, Nomura M, Itoh T, and Yamaguchi T, J. Dairy (1998). Sci., 74, 2082–2088 (1991). 43) Ma B, Simala-Grant JL, and Taylor DE, Glycobiology, 16, 12) Yoshida A, Aoki R, Kimoto-Nira H, Kobayashi M, Kawasumi 158R–184R (2006). T, Mizumachi K, and Suzuki C, FEMS Immunol. Med. 44) Bolotin S, Fuller JD, Bast DJ, Beveridge TJ, and de Azavedo Microbiol., 61, 315–322 (2011). JC, FEMS Immunol. Med. Microbiol., 50, 366–374 (2007). 13) Nomura M, Biosci. Biotechnol. Biochem., 76, 1459–1462 45) Kitazawa H, Harata T, Uemura J, Saito T, Kaneko T, and Itoh T, (2012). Int. J. Food Microbiol., 40, 169–175 (1998). 14) van Kranenburg R, Kleerebezem M, and de Vos WM, Plasmid, 46) Morita H, Toh H, Oshima K, Yoshizaki M, Kawanishi M, 43, 130–136 (2000). Nakaya K, Suzuki T, Miyauchi E, Ishii Y, Tanabe S, Murakami 15) Dabour N and LaPointe G, Appl. Environ. Microbiol., 71, 7414– M, and Hattori M, PLoS ONE, 6, e23184 (2011). 7425 (2005). 47) Donati C, Hiller NL, Tettelin H, Muzzi A, Croucher NJ, 16) Knoshaug EP, Ahlgren JA, and Trempy JE, Appl. Environ. Angiuoli SV, Oggioni M, Dunning Hotopp JC, Hu FZ, Riley Microbiol., 73, 897–905 (2007). DR, Covacci A, Mitchell TJ, Bentley SD, Kilian M, Ehrlich 17) Nierop Groot MN and Kleerebezem M, J. Appl. Microbiol., 103, GD, Rappuoli R, Moxon ER, and Masignani V, Genome Biol., 2645–2656 (2007). 11, R107 (2010). 18) van Kranenburg R, Vos HR, van Swam II, Kleerebezem M, and 48) Nomura M, Kobayashi M, Narita T, Kimoto-Nira H, and de Vos WM, J. Bacteriol., 181, 6347–6353 (1999). Okamoto T, J. Appl. Microbiol., 101, 396–405 (2006). 19) Minic Z, Marie C, Delorme C, Faurie J-M, Mercier G, Ehrlich 49) Okamoto T and Morichi T, Agric. Biol. Chem., 43, 2389–2390 D, and Renault P, J. Bacteriol., 189, 1351–1357 (2007). (1979).