Identification of Genes Differentially Expressed in the Ganglia of Growing Haliotis Asinina Author(S): Patrick S

This may be the author’s version of a work that was submitted/accepted for publication in the following source:

York, Patrick S., Cummins, Scott F., Degnan, Sandie M., Woodcroft, Ben J., & Degnan, Bernard M. (2010) Identiﬁcation of genes differentially expressed in the ganglia of growing haliotis asinina. Journal of Shellﬁsh Research, 29(3), pp. 741-752.

This ﬁle was downloaded from: https://eprints.qut.edu.au/200501/

c Consult author(s) regarding copyright matters

This work is covered by copyright. Unless the document is being made available under a Creative Commons Licence, you must assume that re-use is limited to personal use and that permission from the copyright owner must be obtained for all other uses. If the document is available under a Creative Commons License (or other speciﬁed license) then refer to the Licence for details of permitted re-use. It is a condition of access that users recog- nise and abide by the legal requirements associated with these rights. If you believe that this work infringes copyright please provide details by email to [email protected]

Notice: Please note that this document may not be the Version of Record (i.e. published version) of the work. Author manuscript versions (as Sub- mitted for peer review or as Accepted for publication after peer review) can be identiﬁed by an absence of publisher branding and/or typeset appear- ance. If there is any doubt, please refer to the published source. https://doi.org/10.2983/035.029.0328 Identification of Genes Differentially Expressed in the Ganglia of Growing Haliotis asinina Author(s): Patrick S. York, Scott F. Cummins, Sandie M. Degnan, Ben J. Woodcroft and Bernard M. Degnan Source: Journal of Shellfish Research, 29(3):741-752. Published By: National Shellfisheries Association DOI: http://dx.doi.org/10.2983/035.029.0328 URL: http://www.bioone.org/doi/full/10.2983/035.029.0328

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Journal of Shellﬁsh Research, Vol. 29, No. 3, 741–752, 2010.

IDENTIFICATION OF GENES DIFFERENTIALLY EXPRESSED IN THE GANGLIA OF GROWING HALIOTIS ASININA

PATRICK S. YORK, SCOTT F. CUMMINS, SANDIE M. DEGNAN, BEN J. WOODCROFT AND BERNARD M. DEGNAN* School of Biological Sciences, University of Queensland, Brisbane, Queensland, 4072, Australia

ABSTRACT There is currently a paucity of specific genetic data regarding growth and reproduction-related processes in abalone, marine vetigastropods of commercial value. However, strong inferences about these processes can be drawn from other molluscs. For example, ganglia from the gastropods Aplysia and Lymnaea are known to produce neuropeptides related to growth, feeding behavior, and reproduction. Here, we use suppression subtractive hybridization to identify expressed genes that may be linked to the control of growth and feeding in the tropical abalone Haliotis asinina. Two pools of suppression subtractive hybridization clones were obtained from messenger RNA derived from H. asinina cerebral and pleuropedal ganglia, corresponding to genes differentially expressed in (1) well-nourished animals relative to food-deprived ones and (2) well- nourished animals relative to reproductively active ones. From these subtractions, respectively, 204 and 214 unigenes were identified in 222 and 231 sequenced clones, with 18 of these unigenes common to both subtractions. A subset of the putative differentially expressed genes was confirmed by quantitative polymerase chain reaction, validating this approach. The transcripts that are differentially expressed in the ganglia of growing H. asinina fall into a wide range of functional categories, including

biological regulation, cell proliferation, and metabolic process, and include genes encoding Phe-Met-Arg-Phe-NH2 (or, FMRF- amide), myomodulin, CDC123, RAB37, and dermatopontin.

KEY WORDS: abalone, growth, tropical abalone, Haliotis asinina, neuropeptide, differential expression

INTRODUCTION grow in a similar manner, and have a high level of genomic conservation (Giusti et al. 2000, Coleman & Vacquier 2002, Despite the established importance of abalone (Haliotidae; Degnan et al. 2006), the roles of H. asinina genes in growth and Vetigastropoda) as a significant aquaculture species (Gordon & reproduction are likely to be shared by other commercially Cook 2004), relatively few genes of potential commercial value important abalone species. have been identified from this group of molluscs. For example, a neuropeptide related to feeding and reproduction, myomo- MATERIALS AND METHODS dulin, has not been reported in haliotids, despite its characterization in other gastropods (Miller et al. 1993, Kellett et al. Animals 1996). In terms of abalone production, there is interest both in improving growth rates and controlling reproduction. In other Broodstock were obtained from Heron Island Reef (Great gastropods, there appears to be an antagonism between growth Barrier Reef, Queensland, Australia) under permit, transported and reproduction that is manifested, at least in part, by the to Bribie Island Research Center (Department of Employment, differential expression of certain genes in the ganglia. These Economic Development and Innovation) and were spawned. genes encode neuropeptides that are known to regulate growth, Spat were settled 96 h after spawning and grown out in flow- feeding behavior, hormonal processes, neurotransmission, and through tanks in partial sunlight. These juvenile animals were reproduction (Geraerts et al. 1991, Geraerts et al. 1992, Miller fed to satiety on the abundant, naturally growing algae and et al. 1993, Kellett et al. 1996, Smit et al. 1996, Perry et al. 1998, diatoms from the sides of their tanks, with occasional supple- Vilim et al. 2000, Proekt et al. 2005). The expression of these mentary feed purchased from Adam & Amos Abalone Foods neuropeptide genes is controlled by transcriptional regulators Pty. Ltd. (Mount Barker, Australia) (www.adamamos.com). whose own expression is contingent on the developmental and Adult reproductively active animals were fed artificial food as physiological state of the animal (O’Brien & Degnan 2000). described, with occasional supplements of Gracillaria edulis. Given this background, we hypothesize that ganglia from satiated, fast-growing abalone will express genes controlling Treatments growth and feeding at different levels compared with animals that are either in an unfed state or a reproductively active state. Individual juvenile animals age 385 days postfertilization To identify genes that are differentially expressed in the ganglia (DPF) were tagged for identification, and growth was tracked of nonreproductive, actively growing abalone, we used sup- by measuring animal weight and shell length at periodic in- pression subtractive hybridization (SSH). SSH identifies tran- tervals (Fig. 1). At 426 DPF, juveniles were split into 2 cohorts scripts with abundance that differs from one tissue to another. based on growth rate. The faster growing cohort was sacrificed In this study, we focused on the abalone Haliotis asinina, a fast- at that time (5 animals, designated fed ganglia or FG), and the growing species (McNamara & Johnson 1995) that is currently slower growing cohort (5 animals, designated hungry ganglia or of commercial importance in Southeast Asia (SEAFDEC/AQD HG) was transferred to an inside isolation tank with flow- Highlights 2006). Because all haliotids appear to develop and through seawater and no food. HG animals were kept in the isolation tank for 3 wk. Two further weight measurements were *Corresponding author. E-mail: [email protected] taken during this period (at 440 DPF and 447 DPF), and the

741 742 YORK ET AL.

Suppression Subtractive Hybridization

The PCR-Select cDNA Subtraction Kit (Clontech) was used to create 2 pools of SSH clones. The first used FG cDNA as the tester and HG as the driver. The second used FG as the tester and RAG as the driver. cDNA from each finalized subtraction were ligated into the pGEM-T Easy plasmid vector (Promega, Madison, WI) and cloned into XLI-Blue Escherichia coli. Insert-containing clones were screened by PCR using vector-specific oligonucleotide primers (5#GTTTTCCCAGTCACGACGTT, 5#-GACCATG- ATTACGCCAAGCTA). Amplicons containing a cDNA insert Figure 1. Growth rates of fed and starved abalone used in suppression were purified using Millipore’s (Millipore, Billerica, MA) Multi- subtractive hybridization. Cerebral and pleuropedal ganglia were removed Screen PCRm96 Plates, and were checked for size and concentra- from satiated animals (fed ganglia, FG) and hungry animals (hungry tion by agarose gel electrophoresis with ethidium bromide stain- ganglia, HG) for use in suppression subtractive hybridization. Time points ing. Unidirectional sequencing was performed by the Australian are the ages of the animals in days postfertilization (DPF). HG animals Genome Research Facility (Brisbane, Queensland, Australia). were deprived of food at 426 DPF. Growth curves shown are broadly Resulting sequences were vector trimmed and adaptor se- typical of the remaining animals of their respective cohorts. quences were removed using the CodonCode Aligner, Version 2.0.6 (CodonCode Corp, Dedham, MA) (www.codoncode.com), and were checked by manual inspection. Sequence assembly was HG animals were sacrificed at 447 DPF. Adult reproductively performed with the CAP3 program (Huang & Madan 1999), active animals (ex-broodstock) were sacrificed during the using sequences generated in this study, unpublished H. asinina breeding season (designated reproductively active ganglia, or sequences, and previous published sequences (O’Brien & Degnan RAG). 2000, O’Brien & Degnan 2002a, O’Brien & Degnan 2002b, RNA Isolation Hinman & Degnan 2002, Hinman et al. 2003, O’Brien & Degnan 2003, Jackson et al. 2005, Streit et al. 2005, Jackson & Degnan Animals were anesthetized at –80°C for 10–12 min and then 2006, Jackson et al. 2006, Gunter & Degnan 2007, Koop et al. decapitated. Cerebral and pleuropedal ganglia were removed, 2007, Williams et al. 2009) from an in-house database. All put immediately into RNALater (Ambion, Austin, TX), and resulting discrete sequences, contigs and singlets, were used to stored at 20°C. search the NCBI database (www.ncbi.nlm.nih.gov), using RNA was isolated with the Oligotex Direct messenger RNA BLASTx with default settings and a cutoff E value of 10–6. (mRNA) Mini Kit (QIAGEN, Hilden, Mettmann, Germany) Functional groupings were assigned when possible using the per the manufacturer’s protocol, and stored at –80°C. Cerebral Gene Ontology database (www.geneontology.org). and pleuropedal ganglia (CG and PPG) were combined to make each of 3 samples of SSH-destined RNA sample: FG (ganglia Differential Expression Analysis of Selected Genes by qPCR from 2 FG males), HG (2 HG males), and RAG (1 RAG male Four sequences were arbitrarily selected from each SSH clone and 1 RAG female). RNA for quantitative polymerase chain pool to confirm differential expression levels between abalone reaction (qPCR) was isolated from the 3 remaining members of ganglia cohorts by qPCR using a Corbett Rotor-Gene 6000 each cohort using TRI Reagent (Sigma-Aldrich, St. Louis, MO) thermocycler (QIAGEN). Primers were designed using the per the manufacturer’s instructions, and was quantitated at 280 Primer3 (Vers. 0.4.0) program (http://frodo.wi.mit.edu/) (Rozen nm with a NanoDrop ND-1000 spectrophotometer (NanoDrop & Skaletsky 2000), and are detailed in Table 1. Technical and Products, Wilmington, DE). biological replicates were used in all cases. Resulting values were normalized against the 3 reference genes Has-ubiquitin, Has- Complementary DNA Synthesis and Amplification NACA, and Has-DAu1506, chosen using the geNorm (Vers. 3.5) Complementary DNA (cDNA) for SSH was made and program (Vandesompele et al. 2002) from the pool of potential amplified with the Clontech Super SMARTPCR cDNA Syn- reference genes described by Williams et al. (2009) (see Table 1 thesis Kit (Clontech, Mountain View, CA) per the kit manual for oligonucleotide primer sequences). Nontemplate controls and instructions, except the optimal PCR cycle number was de- also 1:10 dilution calibrator samples made with pooled ganglia termined by subtracting 2 cycles instead of the recommended 1 cDNA were used in all cases. Results were normalized and cycle to increase stringency of proportionate amplification. A compared using the Relative Expression Software Tool for CHROMA-SPIN + TE-400 column (Clontech) with buffer Rotor-Gene 3000 and 6000, version 3 (Pfaffl et al. 2001). A 2- exchange protocol to distilled water was used to target smaller tailed, unpaired Student’s t-test was used to validate differences transcripts. in expression, with P values of 0.05 or better deemed significant. For qPCR analysis, cDNA was reverse transcribed from RESULTS DNaseI-treated RNA using SuperScript III Reverse Transcrip- tase (Invitrogen, Carlsbad, CA) as described by Williams et al. Animal Growth Rates (2009). For each RNA sample, a control was prepared in which the reverse transcriptase (RT) was not added to the reaction. Animals in the combined FG and HG cohorts grew ex- Samples and no-RT controls were tested by PCR, using Has tremely well to 426 DPF, with some individuals from the FG ubiquitin primers (Williams et al. 2009). cohort almost doubling in size over 41 days. Average weight GROWTH-RELATED GENES IN HALIOTIS ASININA 743

TABLE 1. Oligonucleotide primers for qPCR.

Target Gene Primer Sequences Temperature (°C) Has-Myomodulin F: ACGGTCGGACGAGAAAGTTGATGG 67 R: TGATGGGTTTGTTGGGAGGGATG Has-FMRF-amide F: GGTGGATGTGAAACAGCGAACAGTC 68 R: TTCGGGAAGCGAGATTCTGGTG Has-RAB37 F: GTCACACAGGGCTGAAAGACACATC 70 R: CTTCCACGTCAACGACTTTGTTCC Has-SPATA1 F: TGACAGTCCCAAGGGAAACAACC 70 R: CGGCCGCACTGTTGTATTTGTC Has-CDC123 F: ACAAGGGACATCTGACGCTGGTTG 70 R: GGGTTTGGCTGAACTCCATCCTTG Has-Dermatopontin F: TCATTAGCGGCGTCATCAGTTTCC 71 R: TGTGCCACAGTGCACCAAATGTC Has-Stearoyl CoA desaturase F: GGTGGTCACGACTCCACTCAAATAC 68 R: GGCATCACAGCAGGAACACATC Has-CHRNA7 F: GGACGCTCAAGACTGTTGTAGTTGG 69 R: CGACGTGAATGTTGACGAGTGG Has-ubiquitin F: TGGCAAGCAGTTGGAAGATGGT 57 R: CAGTTGTACTTGGAGGCCAGGAT Has-NACA F: TGTCGCAAGCCAACGTTTCA 57 R: GACAGCATGTTCAGCACTGGT Has-DAu1506 F: AGATGCGTGTATGCTGGAGT 57 R: TGGGTACATGCCAATGCT

F, forward; R, reverse. increase for both cohorts over a 20-day period was approxi- unigenes remain unidentified. The FG/HG and the FG/RAG mately 53%, with individual weight increases during that time library had 29 and 43 unigenes with significant matches, ranging from approximately 36–74%. The two fastest growing respectively. An additional 6 unigenes with significant matches males (Fig. 1) were selected for use in SSH. After segregation to occurred in both libraries. Identified unigenes were assigned the isolation tank, the HG cohort initially increased slightly in function using the Gene Ontology database (Table 2, Fig. 3). weight, although visible muscle wasting was apparent. Shell lengths increased, as indicated by a bright-blue band of new Differential Expression Analysis of Selected Genes shell evident at the leading edge of the shell in all cases. A further week in isolation showed further visually evident muscle To confirm that specific genes are differentially expressed in wasting and a general drop in overall body weights. Ganglia FG, HG, and RAG ganglia, qPCR was undertaken on ganglia from the 2 males with body weights that were reduced by the cDNA pooled from 3 individuals from each cohort. Eight genes greatest amount (9–10%) between the final 2 time points of 440 were surveyed (Fig. 4). Phe-Met-Arg-Phe-NH2 (FMRF-amide), DPF and 447 DPF were used for SSH. RAB37, and myomodulin transcripts, which were identified in the FG-versus-HG comparison, were significantly higher in Identification of Differentially Expressed Genes in the Ganglia abundance in the FG cohort than in the HG cohort (Fig. 4), with Student’s t-test P values of 1.64 E–6, 1.19 E–5, and 0.026, In total, 570 clones were sequenced (285 per pool of SSH clones). After vector and quality trimming, 222 and 231 high- quality sequences were obtained from the FG/HG and FG/ RAG SSH libraries, respectively. Average, unassembled, quality-trimmed sequence length for each pool was 394 bp for the FG/HG pool and 390 bp for the FG/RAG pool. Sequences shorter than 45 bp after quality trimming were discarded. After assembly by the CAP3 program (Huang & Madan 1999), 186 and 196 unique sequences were obtained from the FG/HG (34 contigs and 152 singlets) and FG/RAG (41 contigs and 155 singlets) pools, respectively. Eighteen additional contigs were shared between the two pools (Fig. 2). Sixty-four of the 400 unigenes matched with previously published and unpublished H. asinina sequences. All usable sequences were submitted to Genbank under accession numbers (GT067284–GT067736). Identification of unigenes by BLASTx of the NCBI database Figure 2. Unigene sequence distributions between FGHG and FGRAG resulted in 78 significant matches (Tables 2 and 3). A total of 322 clone pools. TABLE 2. 744 FGHG subtraction-characterized unigenes.

Ontology Gene Name bp Species NCBI Identifier Probability Biological Process Cellular Component Molecular Function Genbank Has-Myomodulin 1,526 Aplysia californica AAB27697 9e-46 Biological regulation Extracellular space Receptor binding GT067304 GT067419 Has-FMRF 1,438 Haliotis asinina ACD65487 1e-157 Biological regulation Extracellular space Receptor binding GT067373 Has-RAB37 231 Strongylocentrotus XP_793152 6e-17 Biological regulation Cytoplasm Nucleotide binding GT067503 purpuratus Has-Nephronophthisis 4 392 Nematostella vectensis XP_001633863 1e-32 Biological regulation Membrane Protein binding GT067461 Has-SH3KBP1 405 Branchiostoma floridae XP_002227915 7e-18 Biological regulation Cytoplasm Protein binding GT067473 Has-CD63 antigenlike 1,593 Haliotis diversicolor ABY87409 2e-44 Biological regulation Membrane Unlisted GT067440 Has-Sorbitol dehydrogenase 408 Branchiostoma floridae XP_002243265 2e-35 Metabolic process Extracellular space Oxidoreductase activity GT067332 GT067403 Has-DHRS4 649 Branchiostoma floridae XP_002239319 3e-57 Metabolic process Mitochondrion Oxidoreductase activity GT067482 Has-Hydroxyacyl-CoA 236 Ixodes scapularis EEC08919 2e-29 Metabolic process Mitochondrion Oxidoreductase activity GT067404 dehydrogenase Has-Peptidase S9 612 Branchiostoma floridae XP_002214795 5e-66 Metabolic process Unlisted Hydolase activity GT067484 Has-Enolase 1 alpha 727 Loligo pealei O02654 2e-94 Metabolic process Nucleus Lyase activity GT067363

Has-EHMT1 451 Wolbachia sp. ZP_01314472 4e-15 Metabolic process Nucleus Transferase activity GT067299 Y Has-PCMT1 319 Branchiostoma floridae XP_002245733 4e-28 Metabolic process Cytoplasm Transferase activity GT067362 AL ET ORK Has-ATP5A1 729 Branchiostoma floridae XP_002223559 9e-100 Metabolic process Mitochondrion Transporter activity GT067477 Has-MoCo sulfurase 376 Branchiostoma floridae XP_002210682 4e-18 Metabolic process Unlisted Mo-molybdopterin GT067315 cofactor sulfurase Has-Cytochrome P450 1,021 Strongylocentrotus XP_783905 6e-47 Metabolic process Endoplasmic Oxygen binding GT067290 . purpuratus reticulum Has-NADH dehydrogenase 1,066 Haliotis rubra YP_026073 5e-166 Electron transport Mitochondrion Oxidoreductase activity GT067347 subunit 5 chain Has-Cytochrome c oxidase 1,579 Haliotis discus ACB73222 0.0 Electron transport Mitochondrion Oxidoreductase activity GT067399 subunit I chain Has-Cytochrome c oxidase 1,831 Haliotis rubra YP_026070 8e-92 Electron transport Mitochondrion Oxidoreductase activity GT067469 subunit II chain Has-KCTD1 491 Branchiostoma floridae XP_002208935 2e-08 Ion transport Membrane Transporter activity GT067472 Has-KCTD7 412 Branchiostoma floridae XP_002201046 4e-14 Ion transport Membrane Transporter activity GT067328 Has-MED18 879 Ixodes scapularis EEC04612 2e-36 Regulation of Nucleus Protein binding GT067359 transcription Has-Ribosomal protein S3 803 Homo sapiens AAX28980 4e-115 Translation Ribosome RNA binding GT067337 Has-60S acidic 610 Ricinus communis EEF33307 1e-11 Translation Ribosome RNA binding GT067423 ribosomal protein P2 Has-Ribosomal protein 136 Ixodes scapularis EEC20271 4e-08 Translation Ribosome Structural molecule GT067366 mRpS25 activity Has-NIP7 443 Ixodes scapularis EEC05410 4e-57 Ribosome biogenesis Nucleus Protein binding GT067351 Has-NOP16 519 Branchiostoma floridae XP_002235781 3e-14 Ribosome biogenesis Nucleus Unlisted GT067326 Has-SPATA1 579 Nematostella vectensis XP_001638255 1e-10 Spermatogenesis Unlisted Unlisted GT067449 GT067452

continued on next page GROWTH-RELATED GENES IN HALIOTIS ASININA 745

respectively. From the FG-versus-RAG SSH analysis, CDC123 and dermatopontin genes were found to be upregulated. qPCR analysis conﬁrms these transcripts are more abundant in the FG

Genbank – GT067433 GT067454 cohort relative to the RAG cohort, with P values of 7.64 E 5 and 2.29 E–7, respectively. SPATA1, from the FG-versus-HG comparison, showed slight, nonsigniﬁcant downregulation in the FG cohort. Stearoyl CoA desaturase and CHRNA7, both from the FG-versus-RAG comparison, also did not show statistically signiﬁcant differences in expression, although expression levels were slightly higher in the RAG cohort for CHRNA7. activity DISCUSSION

Although a number of genes related to the control of growth, reproduction, and feeding have been found in molluscs (Geraerts et al. 1991, Geraerts et al. 1992, Lopez et al. 1993, Kellett et al. 1996, Smit et al. 1996), there is currently a paucity of such se-

Ontology quences in abalone. In this study we focused on genes expressed in anterior cerebral and pleuropedal ganglia of the tropical abalone H. asinina, because evidence to date from other molluscs suggests that these ganglia are central to the control of growth and reproduction (Geraerts et al. 1991, Geraerts et al. 1992, Lopez et al. 1993, Kellett et al. 1996, Smit et al. 1996). Using an SSH approach (Diatchenko et al. 1996, Hillmann et al. 2009) we identified genes differentially expressed in these ganglia in tropical abalone in different physiological states that were either induced through differential feeding regimes (i.e., fed to Biological Process Cellular Component Molecular Function satiation vs. starved) or in different natural reproductive states (i.e., fast-growing juvenile vs. reproductively active adult). After subtracting transcripts that are common to starved and reproductively active abalone, we identified a diversity of expressed sequence tag (EST) differentially expressed in the continued TABLE 2. ganglia of well-fed juvenile abalone. In this survey, 400 unigenes were identified, of which 4.5% (18 unigenes) were shared between the 2 SSH analyses. We classified 19.5% of the unigenes into a functional or structural category based on significant sequence similarity to genes in other species currently lodged in GenBank; they fall XP_002195276 3e-15 Unlisted Unlisted Unlisted GT067321 EEE27073XP_783470 3e-06 3e-07 Unlisted Unlisted Membrane Unlisted Calcium ion binding GT067331 DNA binding GT067375 XP_002241826 9e-11 Unlisted Unlisted Oxidoreductase activity GT067487 CAP20021 5e-12 Transposition Nucleus Transposase activity GT067480 BAC00784 3e-44 Muscle contraction Cytoplasm Structural molecule AAP85231 4e-70 Muscle contraction Cytoplasm Protein bindinginto a GT067394 broad range of categories. The remaining 80.5% of unigenes do not significantly match with any known sequences, suggesting they are either lineage-specific genes, some of which may be unique to haliotids, or are partial cDNA sequences that correspond to nonconserved regions of the mRNA (e.g., the 3# untranslated region). The low redundancy of our SSH clone pools suggests that further sequencing of these libraries will yield additional putative abalone growth-related genes. Analysis of a subset of genes by qPCR confirmed that most purpuratus Strongylocentrotus Taeniopygia guttata Toxoplasma gondii Branchiostoma floridae Eriphia verrucosa Mytilus galloprovincialis Haliotis asinina of the genes identified by SSH in this study are likely to be differentially expressed, supporting the use of this method to identify rapidly ESTs of potential interest. Five of 8 genes tested 471 412 900 221 491 368

3,413 by qPCR had higher expression in the ganglia of fed juvenile abalone than unfed juvenile and fully grown, reproductively active adult abalone, respectively. Such evidence of successful subtraction compares favorably with subtraction validation efforts used in other studies (de la Vega et al. 2007, Wang et al. 2008, Green et al. 2009). Taken together, our results suggest a successful subtraction, and thereby imply that a large proportion of the remaining transcripts in both SSH clone Gene Name bp Species NCBI Identifier Probability pools are also upregulated during conditions of fast growth. More important, from a biological perspective, these results calcium-binding protein monooxygenase Has-Unichrom Has-TTC39C Has-Membrane Has-Dimethylanaline Has-Mariner transposase Has-Titin Has-Tropomyosin 1 confirm that there are significant differences in the ganglionic TABLE 3. 746 FGRAG subtraction-characterized unigenes.

Ontology Gene Name bp Species NCBI Identifier Probability Biological Process Cellular Component Molecular Function Genbank Has-FMRF 1,438 Haliotis asinina ACD65487 1e-157 Biological regulation Extracellular space Receptor binding GT067559 GT067570 Has-Angiopoietinlike 7 313 Branchiostoma floridae XP_002205872 1e-18 Biological regulation Extracellular space Receptor binding GT067709 Has-ADF/cofilin 937 Haliotis diversicolor ABV08873 4e-55 Biological regulation Cytoplasm Protein binding GT067539 Has-Thioredoxin 626 Nasonia vitripennis XP_001600982 7e-33 Biological regulation Membrane Oxidoreductase GT067713 domain-containing 15 activity Has-Homolog of Drosophila 758 Aplysia californica Q16981 4e-44 Biological regulation Membrane Calcium ion GT067565 Frequenin binding Has-CDC123 361 Gallus gallus XP_424021 5e-18 Cell proliferation Cytoplasm Unlisted GT067718 Has-Dermatopontin 583 Haliotis discus ABO26644 9e-53 Cell adhesion Extracellular Protein binding GT067590 discus matrix Has-Beta-actin 2 490 Haliotis diversicolor ABY87412 3e-31 Cell motion Cytoplasm Structural molecule GT067626 Has-DID4 892 Ixodes scapularis EEC09331 9e-35 Cellular localization Cytoplasm Protein binding GT067723 Has-PIKFYVE 379 Branchiostoma floridae XP_002235991 2e-33 Cellular localization Endosome Transferase activity GT067731 Has-Ephrin receptor B2 383 Ixodes scapularis EEC18904 7e-44 Developmental process Membrane Receptor activity GT067506 Has-Reductase-related 289 Trichoplax adhaerens XP_002108834 4e-19 Metabolic process Unlisted Oxidoreductase GT067720 Y R TAL ET ORK protein activity Has-Alpha-L-fucosidase 269 Halocynthia roretzi BAB85519 1e-29 Metabolic process Cytoplasm Hydrolase activity GT067734 Has-Hydroxyacylglutathione 551 Nematostella vectensis XP_001639978 1e-21 Metabolic process Unlisted Hydrolase activity GT067544 hydrolase . Has-Phosphatase 378 Branchiostoma floridae XP_002220771 4e-30 Metabolic process Unlisted Hydrolase activity GT067640 methylesterase 1 Has-Alpha-L-fucosidase 308 Branchiostoma floridae XP_002248325 2e-11 Metabolic process Cytoplasm Hydrolase activity GT067689 Has-Acid trehalaselike 255 Branchiostoma floridae XP_002214284 1e-15 Metabolic process Membrane Hydrolase activity GT067700 protein 1 Has-Ubiquitin specific 732 Xenopus laevis NP_001121282 3e-17 Metabolic process Nucleus Hydrolase activity GT067703 protease 7 Has-Hexokinase II 515 Ixodes scapularis EEC16047 1e-11 Metabolic process Mitochondrion Transferase activity GT067549 Has-Cubulin 330 Ciona intestinalis XP_002129050 1e-08 Metabolic process Membrane Receptor activity GT067553 Has-TRAPPC6B 287 Strongylocentrotus XP_001201457 4e-28 Transport Endoplasmic Unlisted GT067599 purpuratus reticulum Has-NADH 1,066 Haliotis rubra YP_026073 5e-166 Electron transport Mitochondrion Oxidoreductase GT067676 dehydrogenase chain activity subunit 5 Has-NADH:Ubiquinone 454 Drosophila erecta XP_001975591 2e-12 Electron transport Mitochondrion Oxidoreductase GT067543 dehydrogenase chain activity Has-Cytochrome c 1,579 Haliotis discus ACB73222 0.0 Electron transport Mitochondrion Oxidoreductase GT067579 oxidase subunit I chain activity Has-Cytochrome c 567 Haliotis discus ACB73222 4e-31 Electron transport Mitochondrion Oxidoreductase GT067619 oxidase subunit I chain activity

continued on next page TABLE 3. continued

Ontology Gene Name bp Species NCBI Identifier Probability Biological Process Cellular Component Molecular Function Genbank Has-Cytochrome c 891 Haliotis diversicolor ABY87350 2e-108 Electron transport Mitochondrion Oxidoreductase GT067538 oxidase subunit III chain activity Has-KCTD1 491 Branchiostoma floridae XP_002208935 2e-08 Ion transport Membrane Transporter activity GT067688 Has-CHRNA7 359 Lymnaea stagnalis ABA60380 1e-19 Ion transport Membrane Receptor activity GT067683 Has-Haemocyanin II 641 Haliotis tuberculata CAC20588 6e-110 Oxygen transport Extracellular space Transporter activity GT067532 GT067552 GT067561 Has-Niemann-Pick C 795 Strongylocentrotus XP_780036 2e-08 Lipid transport Lysosome Transporter activity GT067510 protein isoform 1 purpuratus G Has-Niemann Pick 1,250 Branchiostoma floridae XP_002214770 2e-15 Lipid transport Lysosome Transporter activity GT067594 ROWTH type C2 protein Has-Stearoyl-CoA 263 Macaca mulatta XP_001086993 4e-36 Lipid biosynthetic Endoplasmic Oxidoreductase GT067531 -R desaturase process reticulum activity ELATED Has-X-box binding 492 Haliotis discus ABO26643 3e-24 Regulation of Nucleus Transcription factor GT067535 protein discus transcription activity Has-Ets65A 292 Tribolium castaneum XP_972989 1e-11 Regulation of Nucleus Transcription factor GT067630 transcription activity G Has-Sp4 transcription 222 Micromonas pusilla EEH60802 6e-09 Regulation of Nucleus Transcription GT067612 IN ENES factor transcription coactivator activity

Has-Ribosomal protein S3 803 Homo sapiens AAX28980 4e-115 Translation Ribosome RNA binding GT067551 H GT067736 ASININA ALIOTIS Has-40S ribosomal 523 Novocrania anomala ACD65104 4e-65 Translation Ribosome RNA binding GT067605 protein RPS16 Has-Ribosomal protein 967 Arenicola marina ABW23163 2e-114 Translation Ribosome RNA binding GT067696 rpl7a Has-Hsp90A 2,620 Haliotis asinina ABR15463 4e-175 Protein folding Cytoplasm Protein binding GT067675 Has-Glycosyltransferase 586 Acyrthosiphon pisum XP_001952055 6e-09 Protein folding Membrane Transferase GT067671 activity Has-Titin 536 Mytilus galloprovincialis BAC00784 1e-24 Muscle contraction Cytoplasm Structural GT067525 molecule activity Has-DMBT1 290 Taeniopygia guttata XP_002189390 8e-11 Immune response Endomembrane Receptor activity GT067646 system Has-Coiled-coil domain 175 Sus scrofa XP_001926178 2e-13 Unlisted Cytoplasm Protein binding GT067571 containing 2 Has-Transmembrane 684 Salmo salar ACI69503 9e-43 Unlisted Cytoplasm Protein binding GT067608 protein 33 Has-Calumenin 150 Ciona intestinalis NP_001027627 2e-09 Unlisted Endoplasmic Calcium ion GT067623 reticulum binding

continued on next page 747 748 YORK ET AL.

transcriptomes in H. asinina fed to differing extents, and between abalone in different phases of the reproduction cycle. Genbank GT067519 GT067633 GT067715 From 400 unigenes, we obtained 78 signiﬁcant BLASTx matches, a hit rate of 19.5%. By comparison, Wang et al. (2008) and Green et al. (2009) achieved hit rates between 61% and 62%, whereas de la Vega et al. (2007) achieved approximately 33%. Our lower hit rate is most likely the result of our relatively stringent signiﬁcance threshold of 10–6 E value for BLAST results when compared with the thresholds of Wang et al. – binding (2008), Green et al. (2009), and de la Vega et al. (2007) of 10 3, 10–5, and 10–5, respectively. When comparing the sequences obtained from the 2 SSH comparisons, there were 18 sequences in common, supporting the notion that this overall strategy may uncover genes associated with rapid growth.

Conserved Genes Uncovered during This Screen That May Be Ontology Involved in Growth Regulation

Neuropeptides are one of the key agents in controlling the physiological state of molluscs (Greenberg & Price 1979, Cropper et al. 1987, Geraerts et al. 1991, Perry et al. 1998, Vilim et al. 2000, Proekt et al. 2005, Bechtold & Luckman 2007). Although this study has the potential to identify genes encoding peptides associated with growth, we identiﬁed only 3 unigenes that signiﬁcantly match known neuropeptides: FMRF-amide,

Biological Process Cellular Component Molecular Function myomodulin, and angiopoietinlike 7. We attribute this result to a relatively low overall number of clones sequenced, and to a low overall percentage of secretory proteins and neuropeptides found in neural mRNAs (Moroz et al. 2006). There are also technical reasons stemming from the nature of the sequences obtained in SSH. In particular, the enrichment of continued TABLE 3. the 3# sequence from transcripts means that open reading frames (ORFs) are either only partially sequenced or not sequenced at all (i.e., only the 3# untranslated region (UTR) sequence was obtained). Because diagnostic signal peptides are located at the 5# end of the ORF, these will be largely missed in EST sequences corresponding to genes encoding divergent or P82596XP_416390 4e-61 6e-52 Unlisted Unlisted Unlisted Mitochondrion Unlisted Carbohydrate GT067509 XP_002195276 3e-15 Unlisted Unlisted Unlisted GT067638 EEC17319 9e-108 Unlistednovel peptides. Unlisted Notably, the Unlisted percentage of GT067592 secretory proteins and neuropeptide transcripts found in our annotated sequences is approximately 5.4%, which compares favorably with the corresponding percentage of approximately 5% obtained by Moroz et al. (2006), in their excellent Aplysia neural transcriptome study. Analysis of the H. asinina mantle secretome reveals that the genome encodes a large diversity of novel, secreted proteins (Jackson et al. 2006, Jackson et al. 2010). Nonetheless this SSH screen identiﬁed a number of candidate Haliotis laevigata Gallus gallus Taeniopygia guttata Ixodes scapularis growth regulating genes, some of which encode secreted proteins described brieﬂy below. The H. asinina FMRF-amide gene encodes a precursor 572 412 836

1,546 protein that is cleaved to produce multiple neurotransmitters, including FMRF-amide and FMRF-related peptides (Genbank nos. ACD65487 and ACD65488). In other molluscs, FMRF- amide is involved in negative regulation of food intake and cardio-excitation (Greenberg & Price 1979, Bechtold & Luck- man 2007). The overall FG cohort upregulation of FMRF- amide is unsurprising, because well-fed abalone would require ongoing negative regulation of food intake, whereas the unfed Gene Name bp Species NCBI IdentiﬁerHG Probability cohort would not. RAB37 is a member of the Ras oncogene family, which is NY-SAR-95 Has-Perlucin Has-CECR5 Has-TTC39C Has-Sarcoma antigen localized to secretory granules and is established as having GROWTH-RELATED GENES IN HALIOTIS ASININA 749

Figure 3. Distribution of biological process ontologies of unigenes, by suppression subtractive hybridization clone pool. The ‘‘Other’’ category includes the biological processes cell adhesion, cell motion, cellular localization, developmental process, transport, oxygen transport, lipid transport, ribosome biogenesis, spermatogenesis, muscle contraction, immune response, and transposition, none of which represented more than 2 genes per clone pool. Partially characterized genes with BLASTx matches better than a 10–6 E value that currently have ‘‘unlisted biological process’’ ontology on the Gene Ontology database (www.geneontology.org) also fall under ‘‘Other.’’ a regulatory role in secretion (Fukuda 2008). A role for RAB37 and this gene’s biological role in abalone ganglia remains in insulin secretion has been suggested by Brunner et al. (2007). a matter of speculation. There is strong evidence that insulin-related peptides act as The myomodulin gene, found in our study to be significantly growth-promoting hormones in molluscs (Geraerts et al. 1991, upregulated in the FG cohort, encodes multiple neuropeptides Geraerts et al. 1992, Smit et al. 1996). Based on the unequivocal and has been found in Aplysia and Lymnaea (Lopez et al. 1993, FG cohort upregulation of RAB37 in our study, and that Kellett et al. 1996). Myomodulin peptides play roles in feeding RAB37 has a well-established role in secretion, we infer that behavior (Cropper et al. 1987, Perry et al. 1998, Proekt et al. 2005) RAB37 may influence growth in abalone by means of a regula- and reproduction (van Golen et al. 1996, De Lange et al. 1998). tory role in the secretion of insulin or another regulatory factor. CDC123 is a positive regulator of cell division (Bieganowski In addition, given its impact on tumorigenesis (e.g., Dobashi et al. 2004, Okuda & Kimura 1996) that has a potential link to et al. 2009, Wu et al. 2009), RAB37 might also directly influence insulin release (Grarup et al. 2008). CDC123 gene expression is molluscan cell division. reportedly controlled by nutrient availability (Bieganowski et al. SPATA1 appears to be involved in sperm head formation, 2004). These characteristics are all consistent with its observed and in mice is found exclusively in the testes (L’Hoˆte et al. 2007). upregulation in ganglia from fed, fast-growing juvenile abalone. Mutations are known to cause infertility; sperm are still pro- Molluscan dermatopontins are extracellular matrix proteins duced, but are infertile (L’Hoˆte et al. 2007, Giesecke et al. 2009). that are a major constituent of the proteinaceous matrix of L’Hoˆte et al. (2007) suggest a role for SPATA1 in structural abalone shell (Marxen et al. 2003) and appear to play roles in maintenance of chromosomes. The lack of significant expres- the molluscan immune system (Okamoto & Fujiwara 2006). In sion variation between FG and HG cohorts is uninformative, mammals, dermatopontin is in involved in the modulation of

Figure 4. Quantitative qPCR collective cohort results. Error bars represent SE. *Significant upregulation (P # 0.05). **Significant upregulation (P # 0.01). 750 YORK ET AL. cell proliferation (Okamoto et al. 1999, Takeuchi et al. 2006). expression will be required to characterize fully the role these Although the role of dermatopontin in the H. asinina ganglia is genes play in abalone growth. unknown, its overall upregulation in the FG cohort is consistent with a role in cell proliferation. CONCLUSIONS Stearoyl CoA desaturase is a lipogenic enzyme that catalyzes the synthesis of monounsaturated fatty acids from saturated We have successfully used SSH to identify ganglionic ESTs fatty acids (Flowers & Ntambi 2009), and has a well-established from the tropical abalone H. asinina that are differentially link to obesity (Flowers & Ntambi 2009) in organisms ranging expressed during periods of rapid growth. This is the first step in from humans to Caenorhabditis elegans (Brock et al. 2007). understanding changes in haliotid ganglia expression of genes Interestingly, there was no significant difference in the expres- known to affect growth and reproduction in other molluscs sion of this gene in FG and RAG cohorts, as both were well fed. (Geraerts et al. 1991, Smit et al. 1996, van Golen et al. 1996, De We propose this gene as an excellent candidate for future studies Lange et al. 1998). These anterior ganglia are known to be of adiposity in abalone. a primary source of regulatory neuropeptides (Cropper et al. CHRNA7 is a subunit of the nicotinic acetylcholine re- 1987, Geraerts et al. 1991, Geraerts et al. 1992, Lopez et al. ceptor, and is reported here in H. asinina for the first time. 1993, Miller et al. 1993, Kellett et al. 1996, Smit et al. 1996, CHRNA7 was chosen for qPCR because of the nicotinic Proekt et al. 2005, Moroz et al. 2006), although only a few such acetylcholine receptor’s well-established link with metabolic peptides were identified in this screen. Nonetheless, a number of rate, appetite, and satiety, and therefore body weight and genes associated with controlling growth and cell proliferation obesity (Grunberg et al. 1988, Jo et al. 2002, Guan et al. 2004). have been identified. The methodological approach we have Here we draw a distinction between genes that encode taken to isolate genes involved in growth, reproduction, and nonsecreted proteins and genes that encode either secreted feeding has been validated, and genes likely to be involved in peptides or putative regulators of neuropeptide secretion. growth via cell division have been identified. Finally, a start has Secreted neuropeptides can affect tissues remote from the site been made on the abalone neural transcriptome, and it is clear of gene expression by traveling via the hemolymph. To in- that many more genes of great scientific interest are left to be vestigate growth, examination of ganglia gene expression is identified in this fascinating creature. therefore entirely appropriate for genes encoding neuropeptides and for putative regulators of their secretion (e.g., myomodulin, ACKNOWLEDGMENTS FMRF-amide, RAB37). By comparison, nonsecreted putative regulators of cell division such as CDC123 and dermatopontin, We thank Paul Palmer and the staff of the Bribie Island and genes affecting fat metabolism such as stearoyl CoA Research Centre within the Department of Employment, desaturase are more limited to expression sites in their effects, Economic Development and Innovation for their support and their expression is known to vary between tissue types and use of the facility. This research was supported by a (Onisto et al. 1998, Heinemann & Ozols 2003, Okamoto & grantfromtheAustralianResearchCounciltoS.M.D.and Fujiwara 2006). Further examination of tissue-specific gene B. M. D.

LITERATURE CITED Bechtold, D. A. & S. M. Luckman. 2007. The role of RFamide peptides De Lange, R. P., J. Joosse & J. Van Minnen. 1998. Multi-messenger in feeding. J. Endocrinol. 192:3–15. innervation of the male sexual system of Lymnaea stagnalis. J. Bieganowski, P., K. Shilinski, P. N. Tsichlis & C. Brenner. 2004. Cdc123 Comp. Neurol. 390:564–577. and checkpoint forkhead associated with RING proteins control de la Vega, E., B. M. Degnan, M. R. Hall & K. J. Wilson. 2007. the cell cycle by controlling eIF2gamma abundance. J. Biol. Chem. Differential expression of immune-related genes and transposable 279:44656–44666. elements in black tiger shrimp (Penaeus monodon) exposed to a range Brock, T. J., J. Browse & J. L. Watts. 2007. Fatty acid desaturation and of environmental stressors. Fish Shellfish Immunol. 23:1072–1088. the regulation of adiposity in Caenorhabditis elegans. Genetics Diatchenko, L., Y. F. Lau, A. P. Campbell, A. Chenchik, F. Moqadam, 176:865–875. B. Huang, S. Lukyanov, K. Lukyanov, N. Gurskaya, E. D. Sverdlov Brunner, Y., Y. Coute´ , M. Iezzi, M. Foti, M. Fukuda, D. F. & P. D. Siebert. 1996. Suppression subtractive hybridization: Hochstrasser, C. B. Wollheim & J. C. Sanchez. 2007. Proteomics a method for generating differentially regulated or tissue-specific analysis of insulin secretory granules. Mol. Cell. Proteomics 6:1007– cDNA probes and libraries. Proc. Natl. Acad. Sci. USA 93:6025– 1017. 6030. Coleman, A. W. & V. D. Vacquier. 2002. Exploring the phylogenetic Dobashi, S., T. Katagiri, E. Hirota, S. Ashida, Y. Daigo, T. Shuin, T. utility of ITS sequences for animals: a test case for abalone Fujioka, T. Miki & Y. Nakamura. 2009. Involvement of TMEM22 (Haliotis). J. Mol. Evol. 54:246–257. overexpression in the growth of renal cell carcinoma cells. Oncol. Cropper, E. C., R. Tenenbaum, M. A. Kolks, I. Kupfermann & K. R. Rep. 21:305–312. Weiss. 1987. Myomodulin: a bioactive neuropeptide present in an Flowers, M. T. & J. M. Ntambi. 2009. Stearoyl-CoA desaturase and its identified cholinergic buccal motor neuron of Aplysia. Proc. Natl. relation to high-carbohydrate diets and obesity. Biochim. Biophys. Acad. Sci. USA 84:5483–5486. Acta 1791:85–91. Degnan S.A., Imron, D. L. Geiger & B. M. Degnan. 2006. Evolution in Fukuda, M. 2008. Regulation of secretory vesicle traffic by Rab small temperate and tropical seas: disparate patterns in southern hemi- GTPases. Cell. Mol. Life Sci. 65:2801–2813. sphere abalone (Mollusca: Vetigastropoda: Haliotidae). Mol. Phy- Geraerts, W. P. M., A. B. Smit, K. W. Li & P. L. Hordijk. 1992. The logenet. Evol. 41:249–256. light green cells of Lymnaea: a neuroendocrine model system for GROWTH-RELATED GENES IN HALIOTIS ASININA 751

stimulus-induced expression of multiple peptide genes in a single cell Jackson, D. J., C. L. McDougall, B. J. Woodcroft, P. Moase, R. Rose, type. Experientia 48:464–473. M. Kube, R. Reinhardt, D. S. Rokhsar, C. Montagnani, C. Joubert, Geraerts, W. P. M., A. B. Smit, K. W. Li, E. Vreugdenhil & H. van D. Piquemal & B. M. Degnan. 2010. Parallel evolution of nacre Heerikhuizen. 1991. Neuropeptide gene families that control re- building gene sets in molluscs. Mol. Biol. Evol. 27:591–608. productive behavior and growth in molluscs. In: M. N. Osborne, Jo, Y. H., D. A. Talmage & L. W. Role. 2002. Nicotinic receptor-mediated editor. Current aspects of the neurosciences. London: MacMillan. effects on appetite and food intake. J. Neurobiol. 53:618–632. pp. 255–285. Kellett, E., S. J. Perry, N. Santama, B. M. Worster, P. R. Benjamin & J. Giesecke, K., H. Hamann, K. F. Stock, A. Woehlke, H. Sieme & O. F. Burke. 1996. Myomodulin gene of Lymnaea: structure, expres- Distl. 2009. Evaluation of SPATA1-associated markers for stallion sion, and analysis of neuropeptides. J. Neurosci. 16:4949–4957. fertility. Anim. Genet. 40:359–365. Koop, D., G. S. Richards, A. Wanninger, H. M. Gunter & B. M. Giusti, A. F., V. F. Hinman, S. M. Degnan, B. M. Degnan & D. E. Degnan. 2007. The role of MAPK signalling in patterning and Morse. 2000. Expression of a Scr/Hox5 gene in the larval central establishing axial symmetry in the gastropod Haliotis asinina. Dev. nervous system of the gastropod Haliotis, a non-segmented spiralian Biol. 311:200–212. lophotrochozoan. Evol. Dev. 2:294–302. L’Hoˆte, D., C. Serres, P. Laissue, A. Oulmouden, C. Rogel-Gaillard, X. Gordon, H. R. & P. A. Cook. 2004. World abalone fisheries and Montagutelli & D. Vaiman. 2007. Centimorgan-range one-step aquaculture update: supply and market dynamics. J. Shellfish Res. mapping of fertility traits using interspecific recombinant congenic 23:935–939. mice. Genetics 176:1907–1921. Grarup, N., G. Andersen, N. T. Krarup, A. Albrechtsen, O. Schmitz, T. Lopez, V., L. Wickham & L. Desgroseillers. 1993. Molecular cloning of Jørgensen, K. Borch-Johnsen, T. Hansen & O. Pedersen. 2008. myomodulin cDNA, a neuropeptide precursor gene expressed in Association testing of novel type 2 diabetes risk alleles in the JAZF1, neuron L10 of Aplysia californica. DNA Cell Biol. 12:53–61. CDC123/CAMK1D, TSPAN8, THADA, ADAMTS9, and Marxen, J. C., M. Nimtz, W. Becker & K. Mann. 2003. The major NOTCH2 loci with insulin release, insulin sensitivity, and obesity soluble 19.6 kDa protein of the organic shell matrix of the freshwater in a population-based sample of 4,516 glucose-tolerant middle-aged snail Biomphalaria glabrata is an N-glycosylated dermatopontin. Danes. Diabetes 57:2534–2540. Biochim. Biophys. Acta 1650:92–98. Green, T. J., T. J. Dixon, E. Devic, R. D. Adlard & A. C. Barnes. 2009. McNamara, D. C. & C. R. Johnson. 1995. Growth of the ass’s ear Differential expression of genes encoding anti-oxidant enzymes in abalone (Haliotis asinina Linne´) on Heron Reef, tropical eastern Sydney rock oysters, Saccostrea glomerata (Gould) selected for Australia. Mar. Freshw. Res. 46:571–574. disease resistance. Fish Shellfish Immunol. 26:799–810. Miller, M. W., S. Beushausen, A. Vitek, S. Stamm, I. Kupfermann, J. Greenberg, M. J. & D. A. Price. 1979. FMRFamide, a cardioexcitatory Brosius & K. R. Weiss. 1993. The myomodulin-related neuropep- neuropeptide of mollusks: an agent in search of a mission. Am. Zool. tides: characterization of a gene encoding a family of peptide 19:163–174. cotransmitters in Aplysia. J. Neurosci. 13:3358–3367. Grunberg, N. E., K. A. Popp, D. J. Bowen, S. M. Nespor, S. E. Winders Moroz, L. L., J. R. Edwards, S. V. Puthanveettil, A. B. Kohn, T. Ha, A. & S. E. Eury. 1988. Effects of chronic nicotine administration on Heyland, B. Knudsen, A. Sahni, F. Yu, L. Liu, S. Jezzini, P. Lovell, insulin, glucose, epinephrine, and norepinephrine. Life Sci. 42:161– W. Iannucculli, M. Chen, T. Nguyen, H. Sheng, R. Shaw, S. 170. Kalachikov, Y. V. Panchin, W. Farmerie, J. J. Russo, J. Ju & E. Guan, G., S. F. Kramer, L. L. Bellinger, P. J. Wellman & P. R. Kramer. R. Kandel. 2006. Neuronal transcriptome of Aplysia: neuronal 2004. Intermittent nicotine administration modulates food intake in compartments and circuitry. Cell 127:1453–1467. rats by acting on nicotine receptors localized to the brainstem. Life O’Brien, E. K. & B. M. Degnan. 2000. Expression of POU, Sox, and Pax Sci. 74:2725–2737. genes in the brain ganglia of the tropical abalone Haliotis asinina. Gunter, H. M. & B. M. Degnan. 2007. Developmental expression of Mar. Biotechnol. (NY) 2:545–557. Hsp90, Hsp70 and HSF during morphogenesis in the vetigastropod O’Brien, E. K. & B. M. Degnan. 2002a. Developmental expression of Haliotis asinina. Dev. Genes Evol. 217:603–612. a class IV POU gene in the gastropod Haliotis asinina supports Heinemann, F. S. & J. Ozols. 2003. Stearoyl-CoA desaturase, a short- a conserved role in sensory cell development in bilaterians. Dev. lived protein of endoplasmic reticulum with multiple control Genes Evol. 212:394–398. mechanisms. Prostaglandins Leukot. Essent. Fatty Acids 68:123–133. O’Brien, E. K. & B. M. Degnan. 2002b. Pleiotropic developmental Hillmann, A., E. Dunne & D. Kenny. 2009. cDNA amplification by expression of HasPOU-III, a class III POU gene, in the gastropod SMART-PCR and suppression subtractive hybridization (SSH)- Haliotis asinina. Mech. Dev. 114:129–132. PCR. Methods Mol. Biol. 496:223–243. O’Brien, E. K. & B. M. Degnan. 2003. Expression of Pax258 in the Hinman, V. F. & B. M. Degnan. 2002. Mox homeobox expression in gastropod statocyst: insights into the antiquity of metazoan geo- muscle lineage of the gastropod Haliotis asinina: evidence for sensory organs. Evol. Dev. 5:572–578. a conserved role in bilaterian myogenesis. Dev. Genes Evol. Okamoto, O. & S. Fujiwara. 2006. Dermatopontin, a novel player in the 212:141–144. biology of the extracellular matrix. Connect. Tissue Res. 47:177–189. Hinman, V. F., E. K. O’Brien, G. S. Richards & B. M. Degnan. 2003. Okamoto, O., S. Fujiwara, M. Abe & Y. Sato. 1999. Dermatopontin Expression of anterior Hox genes during larval development of the interacts with transforming growth factor beta and enhances its gastropod Haliotis asinina. Evol. Dev. 5:508–521. biological activity. Biochem. J. 337:537–541. Huang, X. & A. Madan. 1999. CAP3: a DNA sequence assembly Okuda, A. & G. Kimura. 1996. An amino acid change in novel protein program. Genome Res. 9:868–877. D123 is responsible for temperature-sensitive G1-phase arrest in Jackson, D. J. & B. M. Degnan. 2006. Expressed sequence tag analysis a mutant of rat fibroblast line 3Y1. Exp. Cell Res. 223:242–249. of genes expressed during development of the tropical abalone Onisto, M., P. Zeilante, P. Scannapieco, D. Pellati, M. Pozza, C. Caenazzo, Haliotis asinina. J. Shellfish Res. 25:225–231. A. Negro & S. Garbisa. 1998. Expression study on D123 gene product: Jackson, D. J., N. Ellemor & B. M. Degnan. 2005. Correlating gene evidence for high positivity in testis. Exp. Cell Res. 242:451–459. expression with larval competence and the effect of age and Perry, S. J., V. A. Straub, G. Kemenes, N. Santama, B. M. Worster, J. F. parentage on metamorphosis in the tropical abalone Haliotis Burke & P. R. Benjamin. 1998. Neural modulation of gut motility by asinina. Mar. Biol. 147:681–697. myomodulin peptides and acetylcholine in the snail Lymnaea. J. Jackson, D. J., C. McDougall, K. Green, F. Simpson, G. Wo¨ rheide & B. Neurophysiol. 79:2460–2474. M. Degnan. 2006. A rapidly evolving secretome builds and patterns Pfaffl, M. W., G. W. Horgan & L. Dempfle. 2001. Relative expression a sea shell. BMC Biol. 4:40. software tool (REST) for group-wise comparison and statistical 752 YORK ET AL.

analysis of relative expression results in real-time PCR. Nucl. Acids quantitative RT-PCR data by geometric averaging of multiple Res. 30:2002–2007. internal control genes. Genome Biol. 3:r0034. Proekt, A., F. S. Vilim, V. Alexeeva, V. Brezina, A. Friedman, J. Jing, L. van Golen, F. A., K. W. Li, S. Chen, C. R. Jime´ nez & W. P. Geraerts. Li, Y. Zhurov, J. V. Sweedler & K. R. Weiss. 2005. Identification of 1996. Various isoforms of myomodulin identified from the male a new neuropeptide precursor reveals a novel source of extrinsic copulatory organ of Lymnaea show overlapping yet distinct mod- modulation in the feeding system of Aplysia. J. Neurosci. 25:9637–9648. ulatory effects on the penis muscle. J. Neurochem. 66:321–329. Rozen, S. & H. Skaletsky. 2000. Primer3 on the WWW for general users Vilim, F. S., E. C. Cropper, D. A. Price, I. Kupfermann & K. R. Weiss. and for biologist programmers. Methods Mol. Biol. 132:365–386. 2000. Peptide cotransmitter release from motor neuron B16 in SEAFDEC/AQD Highlights. 2006. Tigbauan, Iloilo, Philippines: Aplysia californica: costorage, corelease, and functional implica- SEAFDEC Aquaculture Department. pp. 13–15. tions. J. Neurosci. 20:2036–2042. Smit, A. B., S. Spijker, J. van Minnen, J. F. Burke, F. de Winter, R. van Wang, K. J., H. L. Ren, D. D. Xu, L. Cai & M. Yang. 2008. Elk & W. P. M. Geraerts. 1996. Expression and characterization of Identification of the up-regulated expression genes in hemocytes of molluscan insulin-related peptide VII from the mollusc Lymnaea variously colored abalone (Haliotis diversicolor Reeve, 1846) chal- stagnalis. Neuroscience 70:589–596. lenged with bacteria. Dev. Comp. Immunol. 32:1326–1347. Streit, K., D. J. Jackson, B. M. Degnan & B. Lieb. 2005. Developmental Williams, E. A., B. M. Degnan, H. Gunter, D. J. Jackson, B. J. expression of two Haliotis asinina hemocyanin isoforms. Differen- Woodcroft & S. M. Degnan. 2009. Widespread transcriptional tiation 73:341–349. changes pre-empt the critical pelagic–benthic transition in the Takeuchi, T., M. Suzuki, J. Kumagai, T. Kamijo, S. Masato & T. vetigastropod Haliotis asinina. Mol. Ecol. 18:1006–1025. Kitamura. 2006. Extracellular matrix dermatopontin modulates Wu, C. Y., R. C. Tseng, H. S. Hsu, Y. C. Wang & M. T. Hsu. 2009. prostate cell growth in vivo. J. Endocrinol. 190:351–361. Frequent down-regulation of hRAB37 in metastatic tumor by Vandesompele J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De genetic and epigenetic mechanisms in lung cancer. Lung Cancer Paepe & F. Speleman. 2002. Accurate normalization of real-time 63:360–367.