DOCSLIB.ORG

Identification of Genes Differentially Expressed in the Ganglia of Growing Haliotis Asinina Author(S): Patrick S

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Genes Differentially Expressed in the Ganglia of Growing Haliotis Asinina Author(S): Patrick S This may be the author’s version of a work that was submitted/accepted for publication in the following source: York, Patrick S., Cummins, Scott F., Degnan, Sandie M., Woodcroft, Ben J., & Degnan, Bernard M. (2010) Identification of genes differentially expressed in the ganglia of growing haliotis asinina. Journal of Shellfish Research, 29(3), pp. 741-752. This file was downloaded from: https://eprints.qut.edu.au/200501/ c Consult author(s) regarding copyright matters This work is covered by copyright. Unless the document is being made available under a Creative Commons Licence, you must assume that re-use is limited to personal use and that permission from the copyright owner must be obtained for all other uses. If the docu- ment is available under a Creative Commons License (or other specified license) then refer to the Licence for details of permitted re-use. It is a condition of access that users recog- nise and abide by the legal requirements associated with these rights. If you believe that this work infringes copyright please provide details by email to [email protected] Notice: Please note that this document may not be the Version of Record (i.e. published version) of the work. Author manuscript versions (as Sub- mitted for peer review or as Accepted for publication after peer review) can be identified by an absence of publisher branding and/or typeset appear- ance. If there is any doubt, please refer to the published source. https://doi.org/10.2983/035.029.0328 Identification of Genes Differentially Expressed in the Ganglia of Growing Haliotis asinina Author(s): Patrick S. York, Scott F. Cummins, Sandie M. Degnan, Ben J. Woodcroft and Bernard M. Degnan Source: Journal of Shellfish Research, 29(3):741-752. Published By: National Shellfisheries Association DOI: http://dx.doi.org/10.2983/035.029.0328 URL: http://www.bioone.org/doi/full/10.2983/035.029.0328 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Journal of Shellfish Research, Vol. 29, No. 3, 741–752, 2010. IDENTIFICATION OF GENES DIFFERENTIALLY EXPRESSED IN THE GANGLIA OF GROWING HALIOTIS ASININA PATRICK S. YORK, SCOTT F. CUMMINS, SANDIE M. DEGNAN, BEN J. WOODCROFT AND BERNARD M. DEGNAN* School of Biological Sciences, University of Queensland, Brisbane, Queensland, 4072, Australia ABSTRACT There is currently a paucity of specific genetic data regarding growth and reproduction-related processes in abalone, marine vetigastropods of commercial value. However, strong inferences about these processes can be drawn from other molluscs. For example, ganglia from the gastropods Aplysia and Lymnaea are known to produce neuropeptides related to growth, feeding behavior, and reproduction. Here, we use suppression subtractive hybridization to identify expressed genes that may be linked to the control of growth and feeding in the tropical abalone Haliotis asinina. Two pools of suppression subtractive hybridization clones were obtained from messenger RNA derived from H. asinina cerebral and pleuropedal ganglia, corresponding to genes differentially expressed in (1) well-nourished animals relative to food-deprived ones and (2) well- nourished animals relative to reproductively active ones. From these subtractions, respectively, 204 and 214 unigenes were identified in 222 and 231 sequenced clones, with 18 of these unigenes common to both subtractions. A subset of the putative differentially expressed genes was confirmed by quantitative polymerase chain reaction, validating this approach. The transcripts that are differentially expressed in the ganglia of growing H. asinina fall into a wide range of functional categories, including biological regulation, cell proliferation, and metabolic process, and include genes encoding Phe-Met-Arg-Phe-NH2 (or, FMRF- amide), myomodulin, CDC123, RAB37, and dermatopontin. KEY WORDS: abalone, growth, tropical abalone, Haliotis asinina, neuropeptide, differential expression INTRODUCTION grow in a similar manner, and have a high level of genomic conservation (Giusti et al. 2000, Coleman & Vacquier 2002, Despite the established importance of abalone (Haliotidae; Degnan et al. 2006), the roles of H. asinina genes in growth and Vetigastropoda) as a significant aquaculture species (Gordon & reproduction are likely to be shared by other commercially Cook 2004), relatively few genes of potential commercial value important abalone species. have been identified from this group of molluscs. For example, a neuropeptide related to feeding and reproduction, myomo- MATERIALS AND METHODS dulin, has not been reported in haliotids, despite its character- ization in other gastropods (Miller et al. 1993, Kellett et al. Animals 1996). In terms of abalone production, there is interest both in improving growth rates and controlling reproduction. In other Broodstock were obtained from Heron Island Reef (Great gastropods, there appears to be an antagonism between growth Barrier Reef, Queensland, Australia) under permit, transported and reproduction that is manifested, at least in part, by the to Bribie Island Research Center (Department of Employment, differential expression of certain genes in the ganglia. These Economic Development and Innovation) and were spawned. genes encode neuropeptides that are known to regulate growth, Spat were settled 96 h after spawning and grown out in flow- feeding behavior, hormonal processes, neurotransmission, and through tanks in partial sunlight. These juvenile animals were reproduction (Geraerts et al. 1991, Geraerts et al. 1992, Miller fed to satiety on the abundant, naturally growing algae and et al. 1993, Kellett et al. 1996, Smit et al. 1996, Perry et al. 1998, diatoms from the sides of their tanks, with occasional supple- Vilim et al. 2000, Proekt et al. 2005). The expression of these mentary feed purchased from Adam & Amos Abalone Foods neuropeptide genes is controlled by transcriptional regulators Pty. Ltd. (Mount Barker, Australia) (www.adamamos.com). whose own expression is contingent on the developmental and Adult reproductively active animals were fed artificial food as physiological state of the animal (O’Brien & Degnan 2000). described, with occasional supplements of Gracillaria edulis. Given this background, we hypothesize that ganglia from satiated, fast-growing abalone will express genes controlling Treatments growth and feeding at different levels compared with animals that are either in an unfed state or a reproductively active state. Individual juvenile animals age 385 days postfertilization To identify genes that are differentially expressed in the ganglia (DPF) were tagged for identification, and growth was tracked of nonreproductive, actively growing abalone, we used sup- by measuring animal weight and shell length at periodic in- pression subtractive hybridization (SSH). SSH identifies tran- tervals (Fig. 1). At 426 DPF, juveniles were split into 2 cohorts scripts with abundance that differs from one tissue to another. based on growth rate. The faster growing cohort was sacrificed In this study, we focused on the abalone Haliotis asinina, a fast- at that time (5 animals, designated fed ganglia or FG), and the growing species (McNamara & Johnson 1995) that is currently slower growing cohort (5 animals, designated hungry ganglia or of commercial importance in Southeast Asia (SEAFDEC/AQD HG) was transferred to an inside isolation tank with flow- Highlights 2006). Because all haliotids appear to develop and through seawater and no food. HG animals were kept in the isolation tank for 3 wk. Two further weight measurements were *Corresponding author. E-mail: [email protected] taken during this period (at 440 DPF and 447 DPF), and the 741 742 YORK ET AL. Suppression Subtractive Hybridization The PCR-Select cDNA Subtraction Kit (Clontech) was used to create 2 pools of SSH clones. The first used FG cDNA as the tester and HG as the driver. The second used FG as the tester and RAG as the driver. cDNA from each finalized subtraction were ligated into the pGEM-T Easy plasmid vector (Promega, Madison, WI) and cloned into XLI-Blue Escherichia coli. Insert-containing clones were screened by PCR using vector-specific oligonucleotide primers (5#GTTTTCCCAGTCACGACGTT, 5#-GACCATG- ATTACGCCAAGCTA). Amplicons containing a cDNA insert Figure 1. Growth rates of fed and starved abalone used in suppression were purified using Millipore’s (Millipore, Billerica, MA) Multi- subtractive hybridization. Cerebral and pleuropedal ganglia were removed Screen PCRm96 Plates, and were checked for size and concentra- from satiated animals (fed ganglia, FG) and hungry animals (hungry tion by agarose gel electrophoresis with ethidium bromide stain- ganglia, HG) for use in suppression
Load more

Recommended publications
  • Haliotis Asinina) in Coastal Waters of Thailand Determined Using Microsatellite Markers
    Mar. Biotechnol. 6, 604–611, 2004 DOI: 10.1007/s10126-004-2300-5 Ó 2005 Springer Science+Business Media, Inc. Population Structure of Tropical Abalone (Haliotis asinina) in Coastal Waters of Thailand Determined Using Microsatellite Markers S. Tang,1 A. Tassanakajon,1 S. Klinbunga,2 P. Jarayabhand,3,4 and P. Menasveta2,4 1Department of Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand 2Marine Biotechnology Research Unit, National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Pathumthani 12120, Thailand 3Aquatic Resources Research Institute, Chulalongkorn University, Bangkok 10330, Thailand 4Department of Marine Science, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand Abstract: Three partial genomic libraries were constructed from genomic DNA of the tropical abalone (Haliotis asinina) that was digested with AluI, vortexed/sonicated, and digested with mixed enzyme (AluI, HincII, and RsaI). The libraries yielded 0.02%, 0.42%, and 1.46% positive microsatellite-containing clones, respectively. Eleven clones each of perfect, imperfect, and compound microsatellites were isolated. Ten primer pairs (CU- Has1–CUHas10) were analyzed to evaluate their polymorphic level. The numbers of alleles per locus, observed heterozygosity (H0), and expected heterozygosity (He) ranged from 3 to 26 alleles, and varied between 0.27 and 0.85 and between 0.24 and 0.93, respectively. Three microsatellite loci (CUHas2, CUHas3, and CUHas8) were further used for examination of genetic diversity and differentiation of natural H. asinina in coastal waters of Thailand. Genetic variabilities in terms of the effective number of alleles (ne), H0, and He were higher in 2 samples from the Gulf of Thailand (ne = 9.37, 7.66; H0 = 0.62, 0.78; and He = 0.87, 0.86) than those of one sample (ne = 6.04; H0 = 0.58; and He = 0.62) derived from the Andaman Sea.
    [Show full text]
  • Evolution of Large Body Size in Abalones (Haliotis): Patterns and Implications
    Paleobiology, 31(4), 2005, pp. 591±606 Evolution of large body size in abalones (Haliotis): patterns and implications James A. Estes, David R. Lindberg, and Charlie Wray Abstract.ÐKelps and other ¯eshy macroalgaeÐdominant reef-inhabiting organisms in cool seasÐ may have radiated extensively following late Cenozoic polar cooling, thus triggering a chain of evolutionary change in the trophic ecology of nearshore temperate ecosystems. We explore this hypothesis through an analysis of body size in the abalones (Gastropoda; Haliotidae), a widely distributed group in modern oceans that displays a broad range of body sizes and contains fossil representatives from the late Cretaceous (60±75 Ma). Geographic analysis of maximum shell length in living abalones showed that small-bodied species, while most common in the Tropics, have a cosmopolitan distribution, whereas large-bodied species occur exclusively in cold-water ecosys- tems dominated by kelps and other macroalgae. The phylogeography of body size evolution in extant abalones was assessed by constructing a molecular phylogeny in a mix of large and small species obtained from different regions of the world. This analysis demonstrates that small body size is the plesiomorphic state and largeness has likely arisen at least twice. Finally, we compiled data on shell length from the fossil record to determine how (slowly or suddenly) and when large body size arose in the abalones. These data indicate that large body size appears suddenly at the Miocene/Pliocene boundary. Our ®ndings support the view that ¯eshy-algal dominated ecosys- tems radiated rapidly in the coastal oceans with the onset of the most recent glacial age.
    [Show full text]
  • Full Text (PDF)
    Int. J. Dev. Biol. 53: 1081-1088 (2009) DEVELOPMENTALTHE INTERNATIONAL JOURNAL OF doi: 10.1387/ijdb.082791sc BIOLOGY www.intjdevbiol.com Expression of prohormone convertase 2 and the generation of neuropeptides in the developing nervous system of the gastropod Haliotis SCOTT F. CUMMINS1, PATRICK S. YORK1, PETER J. HANNA2, BERNARD M. DEGNAN1 and ROGER P. CROLL*,3 1School of Integrative Biology, The University of Queensland, Brisbane, Australia, 2School of Life and Environmental Sciences, Deakin University, Geelong, Australia and Department of Anatomy, Mahidol University, Bangkok, Thailand, 3Department of Physiology and Biophysics, Faculty of Medicine, Dalhousie University, Halifax, Canada ABSTRACT Prohormone convertase 2 (PC2) belongs to a family of enzymes involved in the proteolytic maturation of neuropeptide precursors into mature peptides that act as neurotrans- mitters, neuromodulators or neurohormones. Here we show that a gene encoding a PC2-like enzyme (HasPC2) is expressed during larval development and in the adult ganglia of the vetigastropod Haliotis asinina. HasPC2 exhibits high sequence identity to other gastropod PC2s and thus is likely to function in peptide processing. Analysis of HasPC2 expression indicates that it is activated early in nervous system development. During trochophore and early veliger larval stages, HasPC2 is expressed in the vicinity of the forming ganglia of the central nervous system and parts of the putative peripheral nervous system. Later in larval development, at the time the veliger becomes competent to interact with the external environment and initiate metamorpho- sis, HasPC2 expression largely restricts to cells of the major ganglia and their commissures. Profiling of veliger larvae by bioinformatic approaches suggests the expression of a variety of peptides.
    [Show full text]
  • BMC Biology Biomed Central
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by GEO-LEOe-docs BMC Biology BioMed Central Research article Open Access A rapidly evolving secretome builds and patterns a sea shell Daniel J Jackson1,2, Carmel McDougall1,4, Kathryn Green1, Fiona Simpson3, Gert Wörheide2 and Bernard M Degnan*1 Address: 1School of Integrative Biology, University of Queensland, Brisbane Qld 4072, Australia, 2Department of Geobiology, Geoscience Centre, University of Göttingen, Goldschmidtstr.3, 37077 Göttingen, Germany, 3Institute of Molecular Biosciences, University of Queensland, Brisbane Qld 4072, Australia and 4Department of Zoology, University of Oxford, Tinbergen Bldg., South Parks Road, Oxford OX1 3PS, UK Email: Daniel J Jackson - [email protected]; Carmel McDougall - [email protected]; Kathryn Green - [email protected]; Fiona Simpson - [email protected]; Gert Wörheide - [email protected] goettingen.de; Bernard M Degnan* - [email protected] * Corresponding author Published: 22 November 2006 Received: 27 July 2006 Accepted: 22 November 2006 BMC Biology 2006, 4:40 doi:10.1186/1741-7007-4-40 This article is available from: http://www.biomedcentral.com/1741-7007/4/40 © 2006 Jackson et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Instructions to fabricate mineralized structures with distinct nanoscale architectures, such as seashells and coral and vertebrate skeletons, are encoded in the genomes of a wide variety of animals.
    [Show full text]
  • Shelled Molluscs
    Encyclopedia of Life Support Systems (EOLSS) Archimer http://www.ifremer.fr/docelec/ ©UNESCO-EOLSS Archive Institutionnelle de l’Ifremer Shelled Molluscs Berthou P.1, Poutiers J.M.2, Goulletquer P.1, Dao J.C.1 1 : Institut Français de Recherche pour l'Exploitation de la Mer, Plouzané, France 2 : Muséum National d’Histoire Naturelle, Paris, France Abstract: Shelled molluscs are comprised of bivalves and gastropods. They are settled mainly on the continental shelf as benthic and sedentary animals due to their heavy protective shell. They can stand a wide range of environmental conditions. They are found in the whole trophic chain and are particle feeders, herbivorous, carnivorous, and predators. Exploited mollusc species are numerous. The main groups of gastropods are the whelks, conchs, abalones, tops, and turbans; and those of bivalve species are oysters, mussels, scallops, and clams. They are mainly used for food, but also for ornamental purposes, in shellcraft industries and jewelery. Consumed species are produced by fisheries and aquaculture, the latter representing 75% of the total 11.4 millions metric tons landed worldwide in 1996. Aquaculture, which mainly concerns bivalves (oysters, scallops, and mussels) relies on the simple techniques of producing juveniles, natural spat collection, and hatchery, and the fact that many species are planktivores. Keywords: bivalves, gastropods, fisheries, aquaculture, biology, fishing gears, management To cite this chapter Berthou P., Poutiers J.M., Goulletquer P., Dao J.C., SHELLED MOLLUSCS, in FISHERIES AND AQUACULTURE, from Encyclopedia of Life Support Systems (EOLSS), Developed under the Auspices of the UNESCO, Eolss Publishers, Oxford ,UK, [http://www.eolss.net] 1 1.
    [Show full text]
  • Energy Metabolism in the Tropical Abalone, Haliotis Asinina Linné: Comparisons with Temperate Abalone Species ⁎ J
    Journal of Experimental Marine Biology and Ecology 342 (2007) 213–225 www.elsevier.com/locate/jembe Energy metabolism in the tropical abalone, Haliotis asinina Linné: Comparisons with temperate abalone species ⁎ J. Baldwin a, , J.P. Elias a, R.M.G. Wells b, D.A. Donovan c a School of Biological Sciences, Monash University, Clayton, Victoria 3800, Australia b School of Biological Sciences, The University of Auckland, Private Bag 92019, Auckland, New Zealand c Department of Biology, MS 9160, Western Washington University, Bellingham, WA 98225, USA Received 15 March 2006; received in revised form 14 July 2006; accepted 12 September 2006 Abstract The abalone, Haliotis asinina, is a large, highly active tropical abalone that feeds at night on shallow coral reefs where oxygen levels of the water may be low and the animals can be exposed to air. It is capable of more prolonged and rapid exercise than has been reported for temperate abalone. These unusual behaviours raised the question of whether H. asinina possesses enhanced capacities for aerobic or anaerobic metabolism. The blood oxygen transport system of H. asinina resembles that of temperate abalone in terms of a large hemolymph volume, similar hemocyanin concentrations, and in most hemocyanin oxygen binding properties; however, absence of a Root effect appears confined to hemocyanin from H. asinina and may assist oxygen uptake when hemolymph pH falls during exercise or environmental hypoxia. During exposure to air, H. asinina reduces oxygen uptake by at least 20-fold relative to animals at rest in aerated seawater, and there is no significant ATP production from anaerobic glycolysis or phosphagen hydrolysis in the foot or adductor muscles.
    [Show full text]
  • (Greenlip Abalone) Nacre and Prismatic Organic Shell Matrix Karlheinz Mann1* , Nicolas Cerveau2, Meike Gummich3, Monika Fritz3, Matthias Mann1 and Daniel J
    Mann et al. Proteome Science (2018) 16:11 https://doi.org/10.1186/s12953-018-0139-3 RESEARCH Open Access In-depth proteomic analyses of Haliotis laevigata (greenlip abalone) nacre and prismatic organic shell matrix Karlheinz Mann1* , Nicolas Cerveau2, Meike Gummich3, Monika Fritz3, Matthias Mann1 and Daniel J. Jackson2 Abstract Background: The shells of various Haliotis species have served as models of invertebrate biomineralization and physical shell properties for more than 20 years. A focus of this research has been the nacreous inner layer of the shell with its conspicuous arrangement of aragonite platelets, resembling in cross-section a brick-and-mortar wall. In comparison, the outer, less stable, calcitic prismatic layer has received much less attention. One of the first molluscan shell proteins to be characterized at the molecular level was Lustrin A, a component of the nacreous organic matrix of Haliotis rufescens. This was soon followed by the C-type lectin perlucin and the growth factor-binding perlustrin, both isolated from H. laevigata nacre, and the crystal growth-modulating AP7 and AP24, isolated from H. rufescens nacre. Mass spectrometry-based proteomics was subsequently applied to to Haliotis biomineralization research with the analysis of the H. asinina shell matrix and yielded 14 different shell-associated proteins. That study was the most comprehensive for a Haliotis species to date. Methods: The shell proteomes of nacre and prismatic layer of the marine gastropod Haliotis laevigata were analyzed combining mass spectrometry-based proteomics and next generation sequencing. Results: We identified 297 proteins from the nacreous shell layer and 350 proteins from the prismatic shell layer from the green lip abalone H.
    [Show full text]
  • Developing Perspectives on Molluscan Shells, Part 1: Introduction and Molecular Biology
    CHAPTER 1 DEVELOPING PERSPECTIVES ON MOLLUSCAN SHELLS, PART 1: INTRODUCTION AND MOLECULAR BIOLOGY KEVIN M. KOCOT1, CARMEL MCDOUGALL, and BERNARD M. DEGNAN 1Present Address: Department of Biological Sciences and Alabama Museum of Natural History, The University of Alabama, Tuscaloosa, AL 35487, USA; E-mail: [email protected] School of Biological Sciences, The University of Queensland, St. Lucia, Queensland 4072, Australia CONTENTS Abstract ........................................................................................................2 1.1 Introduction .........................................................................................2 1.2 Insights From Genomics, Transcriptomics, and Proteomics ............13 1.3 Novelty in Molluscan Biomineralization ..........................................21 1.4 Conclusions and Open Questions .....................................................24 Keywords ...................................................................................................27 References ..................................................................................................27 2 Physiology of Molluscs Volume 1: A Collection of Selected Reviews ABSTRACT Molluscs (snails, slugs, clams, squid, chitons, etc.) are renowned for their highly complex and robust shells. Shell formation involves the controlled deposition of calcium carbonate within a framework of macromolecules that are secreted by the outer epithelium of a specialized organ called the mantle. Molluscan shells display remarkable morphological
    [Show full text]
  • A Survey of Stock of the Donkey's Ear Abalone, Haliotis Asinina L. in The
    A survey of stock of the donkey’s ear abalone, Haliotis asinina L. in the Sagay Marine Reserve, Philippines: evaluating the effectiveness of marine protected area enforcement Ronald J. Maliao, Edward L. Webb∗, Kathe R. Jensen School of Environment, Resources and Development, The Asian Institute of Technology, P.O. Box 4, Klong Luang, Pathum Thani 12120, Thailand Received 19 August 2002; received in revised form 7 May 2003; accepted 18 May 2003 Abstract Marine protected areas (MPA) are tools for integrated coastal management (ICM); they have gained worldwide acceptance as a strategy for resource restoration and conservation. Research must gauge the effectiveness of MPA implementation in promoting fisheries recovery. This study investigated the effectiveness of enforcement in the Sagay Marine Reserve (SMR), western Philippines, in promoting the recovery of abalone stock. Enforcement of protection in the SMR is accomplished through the bantay-dagat (sea patrol), which utilizes reef watchtowers to deter illegal activities. The abalone populations in two protected reefs (well-enforced protection) and two open access reefs (poorly enforced protection) in the SMR were surveyed using 50 m×2 m belt transects. Abalone density was significantly greater, and abalone were larger, on protected than on unprotected reefs. However, we found that recruitment appeared limited at all sites, and that abalone tended to be sexually mature at small sizes. This may indicate that the population has been near a critical threshold, that recent climatic events may have suppressed recovery rates, and/or that enforcement and rule compliance was low and with continued poaching. Nevertheless, the results of this study agree with findings of other research that a properly enforced no-take MPA can promote recovery of local stocks.
    [Show full text]
  • Aquaculture Environment Interactions 11:129
    Vol. 11: 129–142, 2019 AQUACULTURE ENVIRONMENT INTERACTIONS Published March 28 https://doi.org/10.3354/aei00300 Aquacult Environ Interact OPENPEN ACCESSCCESS Anti-predator response of Haliotis tuberculata is modified after only one generation of domestication Sabine Roussel1,*, Thomas Bisch1,2, Sébastien Lachambre1,3, Pierre Boudry4, Jean-Lou Gervois3, Christophe Lambert1, Sylvain Huchette3, Rob Day5 1Univ Brest, CNRS, IRD, Ifremer, LEMAR, 29280 Plouzané, France 2AgroParisTech, 16 rue Claude Bernard, 75231 Paris Cedex 05, France 3France Haliotis, 29880 Plouguerneau, France 4Ifremer, Univ Brest, CNRS, IRD, LEMAR, 29280 Plouzané, France 5School of Biosciences, University of Melbourne, Parkville, Victoria 3010, Australia ABSTRACT: Domestication of Haliotis tuberculata has only recently begun. During the process, we expect that behavioural and physiological traits may evolve to become more adapted to their captive environment. These modifications may result from intentional selection of production traits or unconscious and unintentional selection due to conditions experienced in the farm envi- ronment. To study this process at the earliest stage, the progeny of 3 different broodstocks obtained from wild parents, selected farmed abalone and randomly sampled farmed abalone, were studied. After rearing for 16 mo in separate tanks, offspring from the 3 progenies were placed together in sea cages at the same density. After 3 yr, behavioural traits were studied, and the immune status after a stress situation was assessed. Mortality and growth were also recorded. In spite of the fact that no significant differences were observed in survival, growth or immune sta- tus traits between the 3 progenies, less progeny from the selected broodstock performed the com- plete sequence of anti-predation behaviour, and they took more time to reach their hides com- pared to the wild progeny.
    [Show full text]
  • Control of Shell Pigmentation by Secretory Tubules in the Abalone Mantle Alyssa Budd1†, Carmel Mcdougall1†, Kathryn Green2 and Bernard M Degnan1*
    Budd et al. Frontiers in Zoology 2014, 11:62 http://www.frontiersinzoology.com/content/11/1/62 RESEARCH Open Access Control of shell pigmentation by secretory tubules in the abalone mantle Alyssa Budd1†, Carmel McDougall1†, Kathryn Green2 and Bernard M Degnan1* Abstract Background: Molluscan shells exhibit a wide diversity of pigmentation patterns and are often used as models for understanding the mechanisms underlying biological pattern formation. Numerous mathematical models have been put forward to describe these patterns, but all rely on assumptions regarding the nature of the pigments and the cells from which they are secreted. We investigated pigmentation and cellular morphology of the mantle (shell-secreting organ) of the tropical abalone, Haliotis asinina, as a crucial step towards understanding the molecular mechanisms of shell patterning in this gastropod mollusc. Results: Accumulation and release of pigmented products occurs within secretory tubules in the prismatic zone of the juvenile H. asinina mantle. The colour observed within these tubules closely matches the colour deposited most recently within the shell lying directly above. The pigments are autofluorescent, and confocal microscopy reveals that multiple pigments can be present within a single tubule at any one time. Examination of mantle morphology in other gastropods reveals that mantle tubules are not restricted to abalone, but are not universal. Conclusions: The presence of a tubule-based secretory system within the abalone mantle demonstrates that pigmentation is not controlled by a simple line of cells. Instead, co-ordination of patterning events is likely to be modular, with signals received by individual cells being transmitted throughout the entire tubule to synchronise the accumulation and secretion of pigmented material.
    [Show full text]
  • Downloaded and Aligned in Clus- Conclusion Talx
    BMC Evolutionary Biology BioMed Central Research article Open Access Dynamic expression of ancient and novel molluscan shell genes during ecological transitions Daniel J Jackson1,2, Gert Wörheide2 and Bernard M Degnan*1 Address: 1School of Integrative Biology, University of Queensland, Brisbane Queensland 4072, Australia and 2Department of Geobiology, Geoscience Centre, University of Göttingen, Goldschmidtstr.3, 37077, Göttingen, Germany Email: Daniel J Jackson - [email protected]; Gert Wörheide - [email protected]; Bernard M Degnan* - [email protected] * Corresponding author Published: 10 September 2007 Received: 22 December 2006 Accepted: 10 September 2007 BMC Evolutionary Biology 2007, 7:160 doi:10.1186/1471-2148-7-160 This article is available from: http://www.biomedcentral.com/1471-2148/7/160 © 2007 Jackson et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The Mollusca constitute one of the most morphologically and ecologically diverse metazoan phyla, occupying a wide range of marine, terrestrial and freshwater habitats. The evolutionary success of the molluscs can in part be attributed to the evolvability of the external shell. Typically, the shell first forms during embryonic and larval development, changing dramatically in shape, colour and mineralogical composition as development and maturation proceeds. Major developmental transitions in shell morphology often correlate with ecological transitions (e.g. from a planktonic to benthic existence at metamorphosis). While the genes involved in molluscan biomineralisation are beginning to be identified, there is little understanding of how these are developmentally regulated, or if the same genes are operational at different stages of the mollusc's life.
    [Show full text]