Haliotis Asinina) in Coastal Waters of Thailand Determined Using Microsatellite Markers

Mar. Biotechnol. 6, 604–611, 2004 DOI: 10.1007/s10126-004-2300-5

2005 Springer Science+Business Media, Inc.

Population Structure of Tropical Abalone (Haliotis asinina) in Coastal Waters of Thailand Determined Using Microsatellite Markers

S. Tang,1 A. Tassanakajon,1 S. Klinbunga,2 P. Jarayabhand,3,4 and P. Menasveta2,4

1Department of Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand 2Marine Biotechnology Research Unit, National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Pathumthani 12120, Thailand 3Aquatic Resources Research Institute, Chulalongkorn University, Bangkok 10330, Thailand 4Department of Marine Science, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand

Abstract: Three partial genomic libraries were constructed from genomic DNA of the tropical abalone (Haliotis asinina) that was digested with AluI, vortexed/sonicated, and digested with mixed enzyme (AluI, HincII, and RsaI). The libraries yielded 0.02%, 0.42%, and 1.46% positive microsatellite-containing clones, respectively. Eleven clones each of perfect, imperfect, and compound microsatellites were isolated. Ten primer pairs (CU- Has1–CUHas10) were analyzed to evaluate their polymorphic level. The numbers of alleles per locus, observed heterozygosity (H0), and expected heterozygosity (He) ranged from 3 to 26 alleles, and varied between 0.27 and 0.85 and between 0.24 and 0.93, respectively. Three microsatellite loci (CUHas2, CUHas3, and CUHas8) were further used for examination of genetic diversity and differentiation of natural H. asinina in coastal waters of

Thailand. Genetic variabilities in terms of the effective number of alleles (ne), H0, and He were higher in 2 samples from the Gulf of Thailand (ne = 9.37, 7.66; H0 = 0.62, 0.78; and He = 0.87, 0.86) than those of one sample (ne = 6.04; H0 = 0.58; and He = 0.62) derived from the Andaman Sea. Assessment of genetic heterogeneity, including allele frequency comparison and pairwise FST analysis, indicated interpopulational differentiation, between natural H. asinina from the Gulf of Thailand and that from the Andaman Sea (P < 0.0001).

Key words: abalone, Haliotis asinina, microsatellites, genetic diversity, population differentiation.

INTRODUCTION 1996). Abalone aquaculture has been established in several countries, but approximately 75% of the world production Abalones are marine gastropods distributed worldwide annually is in China (mainly Haliotis discus hannai) and along the coastal waters of tropical and temperate areas Taiwan (mainly H. diversicolor supertexta) (Gordon, 2000). (Geiger, 2000). Approximately 20 species of abalone are Three species of tropical abalone, H. asinina, H. ovina, commercially important (Jarayabhand and Paphavasit, and H. varia, are locally found in Thai waters (Jarayabhand and Paphavasit, 1996). Among these species H. asinina is Received June 5, 2003; accepted February 18, 2004; online publication March 9, 2005. the most promising for aquaculture. Artificially propagated Corresponding author: A. Tassanakajon; e-mail: [email protected] breeding programs and culture techniques for H. asinina Microsatellite polymorphism in H. asinina 605 are well developed; however, basic information on genetic population differentiation and levels of genetic diversity of H. asinina is necessary to improve the stock selection program and conserve the existing natural gene pool (Klinbunga et al., 2003). An initial step toward natural stock management of H. asinina is to develop molecular genetic markers that can be applied to its genetic management, including determination of stock structure, evaluation of the levels of gene flow, and reconstruction of intraspecific phylogeny. In addition, the ability to determine individuality and parentage of H. asinina will provide the means to establish efficient selective breeding programs and to construct genetic linkage maps of H. asinina more effectively. Microsatellites are short, tandemly repeated DNA loci (1–6 nucleotides) arrayed for approximately 10 to 50 copies and abundantly dispersed in eukaryotic genomes. Micro- satellite loci exhibiting large numbers of alleles are ideally suited for gene mapping and pedigree analysis (Pepin et al., 1995), whereas loci with lower polymorphic levels can be used for population genetic studies (Wright and Bentzen, 1994). Microsatellite markers have been successfully developed in several abalone species including H. rufescens (Kirby and Powers, 1998), H. rubra (Huang and Hana, 1998; Evans et al., 2001), H. asinina (Selvamani et al., 2000), H. discus discus (Sekino and Hara, 2001), and H. discus hannai and H. kamtschatkara (Miller et al., 2001). Genetic diversity and population differentiation of abalone in Thai waters based on microsatellite polymor- Figure 1. Map of Thailand indicating sampling sites of H. asinina phism have not been reported. The objective of this study used in this study. Dots represent sample locations (except the was to develop informative microsatellites in H. asinina and Philippines sample) from which H. asinina was collected. CAM to assess the genetic structure of this species in coastal indicates Cambodia; SAM, Samet Island; TRA, Trang. waters of Thailand. We isolated H. asinina microsatellites from 3 partial genomic libraries that were constructed bodia (HACAME, N = 23) located in the Gulf of Thailand. using different approaches. Genetic heterogeneity among Samples of hatcheries were offspring of wild broodstock H. asinina populations derived from different areas was initially established from approximately 100 founders orig- investigated using the 3 microsatellite loci. inating in Cambodia (HACAMHE, N = 15) and Samet Is- land (HASAMHE, N = 10) and the second generation of H. asinina (HAPHIHE, N = 20) initially established from approximately 200 founders and maintained at the Aqua- MATERIALS AND METHODS culture Department, SEAFDEC, Philippines. Samples DNA Extraction Specimens of H. asinina were collected from 6 samples (Figure 1). Natural abalone include samples from Talibong Genomic DNA extracted from a single individual of H. Island (HATRAW, N = 28) located in the west of peninsular asinina (Gulf of Thailand origin) by a proteinase K phenol- Thailand, and Samet Island (HASAME, N = 12) and Cam- chloroform extraction method (Davis et al., 1986) was used 606 S. Tang et al. for construction of each partial genomic library. For Primer Design and Amplification of Microsatellites genotyping of abalone a Chelex-based extraction method (Walsh et al., 1991; Altschmied et al., 1997) was utilized Primer pairs to amplify microsatellite regions were de- (N = 108). signed using OLIGO 4.0 (National Biosciences; Table 1). Polymerase chain reaction (PCR) was carried out as Construction of H. asinina Partial Genomic described by Supungul et al. (2000). PCR products were Libraries analyzed on a 6% denaturing polyacrylamide gel at 50 W for 2.5 to 6 hours. After autoradiography allele sizes of Three partial genomic libraries were constructed: an AluI- each locus were determined by comparison with the M13 digested library (5 lgofH. asinina genomic DNA digested sequencing marker (Yanisch-Perron et al., 1985). Cross- with 25 U of AluIat37C for 2 hours); a vortexed/sonicated species amplification for all loci was tested in H. ovina genomic library (1 lgofH. asinina genomic DNA vortexed (N = 5) and H. varia (N = 5) under different PCR for 15 minutes and subsequently sonicated in an Ultrasonic amplification conditions (annealing temperatures,

BCGR 5139 bath for 1 hour); and a mixed-enzyme-digested MgCl2 concentrations, and thermal profiles) library (6 lgofH. asinina genomic DNA digested with 20 U each of AluI, HincII, and RsaI for 2 hours at 37C). After Data Analysis agarose gel electrophoresis the resulting 300-bp to 800-bp DNA fragments were excised, eluted out from the gels, and The number of alleles per locus and observed, and expected further treated with T4 polynucleotide kinase and Klenow heterozygosity were calculated (Nei, 1987). The effective fragment according to conditions recommended by the number of alleles (Crow and Kimura, 1965) and allele fre- manufacturer (New England Biolabs). Approximately quencies at each locus in each sample were calculated. 150 ng of manipulated genomic DNA of H. asinina was Hardy-Weinberg equilibrium for each locus was examined ligated to 50 ng of dephosphorylated SmaI-digested pUC18 using the exact test (Rousset and Raymond, 1995). Linkage (Amersham Bioscience) overnight at 16C. The ligation disequilibrium between loci in each sample and allele fre- mixture was electrotransformed into Escherichia coli XL1- quency distribution between possible sample combinations Blue (Dower et al., 1988). Recombinant clones were se- were compared using the Markov chain approach (Guo and lected on ampicillin agar plates according to standard Thompson, 1992). Significance of pairwise FST values (Weir protocol (Maniatis et al., 1982). and Cockerham, 1984) was evaluated. All the calculations described above were conducted using GENEPOP 2.0 Screening of Microsatellite-Containing Clones (Raymond and Rousset, 1995). The significance levels for multiple tests were adjusted following a sequential Bonfer- Transformed clones were transferred onto a piece of roni approach (Rice, 1989). Cavalli-Sforza and Edwards Whatman filter paper (#45). The filter paper was hybrid- chord genetic distance (Cavalli-Sforza and Edwards, 1967) 32 ized with the c- P labeled (GT)15 and (CT)15 probe and was estimated for all possible combinations of samples using subjected to autoradiography at )80C for 2 to 4 hours the Gendist routine in PHYLIP 3.56c (Felsenstein, 1993). (Grunstein and Hogness, 1975). Positive clones were picked up and cultured individually. Plasmid DNAs were extracted RESULTS AND DISCUSSION using a boiling method (Holmes and Quigley, 1981). Isolation and Characterization of Microsatellites in DNA Sequencing H. asinina

32 Plasmid DNAs (500 ng) were sequenced manually using a With the c- P-end-labeled GT15 probe, the mixed-en- T7 sequencing kit (Amersham) with universal or reverse zyme-digested library yielded 1.46% positive clones (51 in primers. The products were analyzed on 8% denaturing 3487), While the vortexed/sonicated and AluI-digested li- polyacrylamide gels at 50 W for 2.5 hours. The sequencing braries gave 0.42% (19 in 4564) and 0.20% (5 in 2510), gel was transferred onto a piece of ﬁlter paper, dried in respectively. Further screening of the vortexed/sonicated vacuo, and subjected to autoradiography overnight at room library with the (CT)15 probe provided another 0.07% of temperature. positive microsatellite-containing clones (3 in 4464 clones). Microsatellite polymorphism in H. asinina 607

Table 1. Characteristics of Ten Novel Microsatellites in H. asinina

Sample Size range No. of a Locus Motif Primer sequence (5¢–3¢) Ta (C) size (N) in (bp) alleles H0 He

CUHas1 (GT)17N36(GT)10 TCATCTGAGTTAATAAGGGAC 53 72 258–360 26 0.85 0.93 TCAGTCATTATCTTAGCGGAG

CUHas2 (AT)7(GT)37 ATGGAAGTCAACAATAGACAGG 57 65 286–340 21 0.68 0.93 CCCAGATCAGTTCCACAATAC

CUHas3 (GT)24(GA)18 TCCAGACTGCACGTTATTATTCC 57 71 134–178 13 0.62 0.82 GCACCCTGTCTCCCTTGAAC

CUHas4 (GT)6(TGCA)4N15(GT)7 GTTCCGTTCTACCAATGATCG 57 67 222–250 5 0.40 0.59 ACTCGCCGTCGTATACCTAG

CUHas5 (GT)17 ATGAACCTCTAATCTAAAGC 49 72 104–173 19 0.35 0.91 AGTGCTCTTTACCAATCC

CUHas6 (GT)19 CGATGGTGATACGATGATGC 57 48 232–240 6 0.75 0.71 ACGGTATGAACATATCGTGAC

CUHas7 (ACGC)6 CTACACCAACATTATCCTG 49 48 112–126 3 0.27 0.24 AATCAATAAGTGACTGTCTG

CUHas8 (AGTG)16 GTATTACTTGACTTTGAGCC 49 72 148–238 19 0.71 0.88 TGTATGTCCTATCACAGCAT

CUHas9 (GT)34 TGTCGTAACTCCCATAGCG 53 48 148–240 26 0.81 0.92 GGTGTCCATTTATGAATTGAG

CUHas10 (CA)16CG(CA)4 CCACTCACAACAACGCACG 53 48 118–160 9 0.42 0.63 AAGGCAGCGAAACCTCACC aGenBank accession numbers are BV096864 to BV096873.

A total of 78 positive clones were sequenced, and 33 mi- in H. rubra (8–41 alleles, H0 = 0.19–0.38, He = 0.81–0.96, crosatellite loci were isolated. The proportions of perfect, Huang et al., 2000; 2–16 alleles, H0 = 0.14–0.76, He = imperfect, and compound microsatellites (Weber, 1990) 0.40–0.90, Evans et al., 2001); H. discus discus (3–10 alleles, were identical (11 clones accounting for 33.33% of each H0 = 0.18–0.80, He = 0.29–0.89, Sekino and Hara, 2001); type of microsatellite). and Australian H. asinina (2–25 alleles, He = 0.29–0.96, H0 Fourteen primer pairs were designed, of which 10 was not reported; Selvamani et al., 2000), but lower than

(CUHas1–CUHas10) worked well in H. asinina samples microsatellites in H. kamtschatkana (20–63 alleles, H0 =

(HACAME, HACAMHE, HASAMHE, and HAPHIHE) 0.41–0.89, He = 0.68–0.96, Miller et al., 2001). with the allelic variations (Table 1, Figure 2). CUHas1 Nonoverlapping alleles were observed at CUHas9; that exhibited the highest variability (26 alleles, H0 = 0.85, is, the HATRAW sample possessed smaller alleles (148–

He = 0.93), while the lowest variability was observed at 162 bp) than those detected in the HACAME sample (184–

CUHas7 (3 alleles, H0 = 0.27, He = 0.24). Linkage dis- 240 bp) suggesting that this locus has potential to identify equilibrium between loci was not significant for all com- the coastal origins of Thai H. asinina. However, larger binations of loci after corrections of significance level (P > numbers of specimens from other sites of each coastal re- 0.0083). Three microsatellite loci (CUHas4, CuHas6, and gion should be genetically examined to verify our specu- CuHas7) were successfully amplified in specimens from the lations. Gulf of Thailand but not in the Andaman Sea sample Selvamani et al. (2000) also isolated and characterized (HATRAW). Cross-species amplification for H. ovina and 11 microsatellites in H. asinina, but the genetic variability H. varia was not successful at all loci even though a variety of these microsatellites was only examined in the Heron of PCR conditions were extensively tested. reef population of Australia (N =21–41 per locus). The The level of genetic variability at each microsatellite failure to genotype HATRAW sample originating from the locus in this study was as high as that previously reported Andaman Sea using CUHas4, CuHas6, and CuHas7 primer 608 S. Tang et al.

expected heterozygosity per locus across samples varied from 3.67 to 12.00, 3.58 to 9.37, 0.58 to 0.82, and 0.62 to 0.88, respectively (Table 2). The HACAME sample exhibited the largest number of

alleles and effective alleles per locus (12.00 alleles, ne = 9.37)

compared with HASAME (8.33 alleles, ne = 7.66) and

HATRAW (8.67 alleles, ne = 6.04). High genetic diversity was also observed in 2 hatchery stocks, HACAMHE (8.67

alleles, ne = 8.74) and HASAMHE (7.67 alleles, ne = 7.17. The HAPHIHE sample exhibited the lowest number of alleles

and effective alleles for all loci (3.67 alleles, ne = 3.58). Three instances (HACAME at CUHas2 and CUHas3 and HAP- HIHE at CUHas8) showed signiﬁcant deviation from Hardy- Weinberg expectations (P < 0.0001). Comparable levels of heterozygosity between hatchery stocks (HACAMHE and HSAMHE) and their natural samples (HACAME and HASAME) suggested that founders’ contributions in those hatchery stocks were relatively large.

Genetic Heterogeneity of Natural H. asinina Samples

On the basis of genetic distance values, the level of genetic differentiation between HASAME and HACAME was low (0.0578), but greater genetic distance was observed between coastal regions (0.1310 and 0.1393, respectively) (Table 3).

Genetic heterogeneity analysis and FST statistics revealed significant genetic population differentiation in natural samples of H. asinina (P < 0.0001, Table 3) in addition to the results seen in the genetic distance data. A lack of genetic heterogeneity was observed between samples in the Figure 2. Microsatellite patterns resulting from analysis of H. Gulf of Thailand (HACAME and HASAME; P > 0.0083), asinina at loci CUHas2 (A), CUHas3 (B), and CUHas8 (C). A but significant population structures were found between sequencing ladder of M13mp18 was used as the size standard (lanes those and the Andaman Sea sample (HATRAW) (P < A, C, G, and T). 0.0001). As a result, H. asinina in coastal waters of Thailand can be differentiated from the Gulf of Thailand and the pairs designed from microsatellites of H. asinina from the Andaman Sea stocks. Gulf of Thailand implied that locus-specific primers of Klinbunga et al. (2003) determined genetic diversity Australian H. asinina reported by Selvamani et a1. (2000) and population differentiation of the same set of H. asinina should be carefully tested and characterized with Thai H. samples screened in this study by using PCR–restriction asinina before being used in genetic studies (e.g., the con- fragment length polymorphism of 16S rDNA (mitochon- struction of genetic linkage maps and breeding programs) drial DNA). A panmixia was found in natural H. asinina of natural Thai samples and hatchery stocks. populations in Thai waters. In contrast, analysis of genetic differentiation of those samples by randomly amplified Genetic Diversity of H. asinina polymorphic DNA (RAPD) revealed significant differentiation between the Gulf of Thailand samples HACAME and Three loci (CUHas2, CUHas3, and CUHas8) were prelim- HASAME and the Andaman HATRAW samples (P < inarily tested for population genetic studies of H. asinina. 0.0001; Popongviwat, 2001), as well as the results obtained The number of alleles, effective alleles, and observed and in this study. Microsatellite polymorphism in H. asinina 609

Table 2. Mean Number of Alleles, Effective Number of Alleles, and Heterozygosity per Locus of Each Sample of H. asinina Across Three Microsatellite Loci (CUHas2, CUHas3, and CUHas8)

Mean no. of Effective no. Mean heterozygosity Haplotype diversityb alleles per of allelesa

Sample locus (ne) H0 ±SD He ± SD 16S rDNA 16S+18S rDNA

Natural HACAME 12.00 ± 2.00 9.37 0.62 ± 0.16 0.87 ± 0.05 0.0000 0.3391 HASAME 8.33 ± 0.58 7.66 0.78 ± 0.13 0.86 ± 0.04 0.0000 0.0000 HATRAW 8.67 ± 7.23 6.04 0.58 ± 0.28 0.62 ± 0.27 0.1351 0.7065 Hatchery HACAMHE 8.67 ± 1.53 8.74 0.79 ± 0.13 0.88 ± 0.07 0.0000 0.7816 HASAMHE 7.67 ± 0.58 7.17 0.82 ± 0.17 0.86 ± 0.02 0.2731 0.7511 HAPHIHE 3.67 ± 1.53 3.58 0.67 ± 0.58 0.68 ± 0.01 0.0000 0.8359 a Mean ne of 3 loci. bResults from PCR-RFLP analysis assessed for the same sample sets (Klinbunga et al., 2003).

Table 3. Genetic Heterogeneity Analysis, FST Estimate, and Genetic Distance Between Pairs of Haliotis asinina Samples

Probability valueb

a Pairwise comparison CUHas2 CUHas3 CUHas8 FST Genetic distance

HATRAW–HASAME 0.0009 <0.0001 <0.0001 0.2111* 0.1393 HATRAW–HACAME <0.0001 <0.0001 <0.0001 0.1977* 0.1310 HATRAW–HASAMHE <0.0001 <0.0001 <0.0001 0.2456* 0.1556 HATRAW–HACAMHE <0.0001 <0.0001 <0.0001 0.2258* 0.1494 HATRAW–HAPHIHE <0.0001 <0.0001 <0.0001 0.2870* 0.1486 HAPHIHE–HASAME <0.0001 <0.0001 <0.0001 0.2004* 0.1649 HAPHIHE–HACAME <0.0001 <0.0001 <0.0001 0.1785* 0.1564 HAPHIHE–HASAMHE <0.0001 <0.0001 <0.0001 0.2178* 0.1716 HAPHIHE–HACAMHE <0.0001 <0.0001 <0.0001 0.1979* 0.1670 HASAME–HACAME 0.2709ns 0.1080ns 0.2206ns )0.0052ns 0.0578 HASAME–HASAMHE 0.0100ns 0.0258ns 0.0188ns 0.0455ns 0.0871 HASAME–HACAMHE 0.0310ns 0.0030* 0.0093ns 0.0437ns 0.0767 HACAME–HASAMHE 0.0362ns 0.2380ns 0.5050ns 0.0079ns 0.0521 HACAME–HACAMHE 0.0190ns 0.0216ns 0.1098ns 0.0189ns 0.0531 HACAMHE–HASAMHE 0.9746ns 0.9316ns 0.9273ns )0.0313ns 0.0113 aComparisons between natural H. asinina samples are in bold face. bProbability values of genetic homogeneity between samples. Genetic heterogeneity analysis was conducted based on allele frequency distributions; signiﬁcance level was further adjusted to P < 0.0083 using a sequential Bonferroni method. Superscript ns, indicates not signiﬁcant; *, P < 0.0001.

Nonsigniﬁcant genetic heterogeneity between our Microsatellite markers developed in this study can be hatchery stocks (HACAMHE and HASAMHE) and their further applied to assist genetic improvement and breeding natural samples (HACAME and HASAME) based on 16S programs of H. asinina, such as determination of correla- rDNA (Klinbunga et al., 2003), RAPD (Popongwiwat, tion between genotypes and survival rates after settlement of 2001), and microsatellites (this study) suggests the possi- larvae, and between growth rate and levels of heterozygosity. bility of using our hatchery stocks to establish stock In addition, these markers may be useful to identify the enhancement programs at the geographic origins of stock units of migration ability in natural H. asinina. Highly H. asinina. polymorphic levels of microsatellites can also be applied to 610 S. Tang et al. parentage analysis, eliminating problems accompanied by Grunstein, M., and Hogness, D.S. (1975). Colony hybridisation: a traditional selective breeding programs in which offspring method for the isolation of cloned DNAs which contain a speciﬁc of different family lines must be cultured separately. gene. Proc Natl Acad Sci U S A 72:3961. Holmes, D.S., and Quigley, M. (1981). A rapid boiling method for the preparation of bacterial plasmids. Anal Biochem 114:193– CKNOWLEDGMENTS A 197.

This research was supported by the Thailand Research Huang, B.X., and Hanna, P.J. (1998). Identiﬁcation of three Funds (TRF) Grant RDG4320015 awarded to S.K. and A.T. polymorphic microsatellite loci in blacklip abalone, Haliotis rubra (Leach), and detection in other abalone species. J Shellﬁsh Res The student grant to S.T. was supported by The Thailand 17:795–799. Graduate Institute of Science and Technology (TGIST). We also thank 2 anonymous referees for spending their Huang, B.X., Peakall, R., and Hanna, P.J. (2000). Analysis of ge- valuable time to review our manuscript. netic structure of blackip abalone (Haliotis rubra) populations using RAPD, minisatellite and microsatellite markers. Mar Biol 136:207–216.

REFERENCES Jarayabhand, P., and Paphavasit, N. (1996). A review of the culture of tropical abalone with special reference to Thailand. Altschmied, J., Hornung, U., Schlupp, I., Gadau, J., Kolb, R., and Aquaculture 140:159–168. Schartl, M. (1997). Isolation of DNA suitable for PCR for field and Kirby, V.L., and Powers, D.A. (1998). Identification of microsat- laboratory work. Bio techniques 23:228–229. ellites in the California red abalone, Haliotis rufescens. J Shellfish Cavalli-Sforza, L.L., and Edwards, A.W.F. (1967). Phylogenetic Res 17:801–804. analysis: models and estimation procedures. Evolution 21:550–570. Klinbunga, S., Pripue, P., Khamnamtong, N., Puanglarp, N., Crow, J.F., and Kimura, M. (1965). Evolution in sexual and a Tassanakajon, A., Jarayabhand, P., and Menasveta, P. (2003). sexual populations. Am Nat 99:439–450. Genetic diversity and molecular markers of the tropical abalone (Haliotis asinina) in Thailand. Mar Biotechnol 5:505–517. Davis, L.G., Dibner, M.D., and Battey, J.F. (1986). Preparation of genomic DNA. In: Basic Method in Molecular Biology, New York, Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982). Molecular N.Y: Elsevier Science, pp 42–43. Cloning: A Laboratory Manual. Cold Spring Harbor, N.Y: Cold Spring Habor Laboratory. Dower, W.J., Miller, J.F., and Ragsdale, C.W. (1988). High effi- ciency transformation of E. coli by high voltage electroporation. Miller, K.M., Laberee, K., Kaukinen, K.H., Li, S., and Withler, R.E. Nucleic Acids Res 16:612–617. (2001). Development of microsatellite loci in pinto abalone (Haliotis kamtschatkana). Mol Ecol Notes 1:315–317. Evans, B., Conod, N., and Elliott, N.G. (2001). Evaluation of microsatellite primer conservation in abalone. J Shellfish Res Nei, M. (1987). Molecular Evolutionary Genetics. New York, N.Y: 20:1065–1070. Columbia University Press.

Felsenstein, J. (1993). Phylip (Phylogeny Inference Package Ver- Pepin, L., Amigues, Y., Lepingel, A., Berthier, J.L., Bensaid, A., and sion 3.5c). Seattle: Distributed by the author. Department of Vaiman, D. (1995). Sequence conservation of microsatellites be- Genetics, University of Washington. tween Bos taurus (cattle), Capra hircus (goat) and related species: examples of use in parentage testing and phylogeny analysis. Geiger, D.L. (2000). Distribution and biogeography of the Heredity 74:53–61. Haliotidae (Gastropoda: Vetigastropod) world-wide. Boll Mala- cologico 35:57–120. Popongviwat, A. (2001). Genetic Diversity of Tropical Abalone in Thailand Using RAPD-PCR. Bangkok, Thailand: M.Sc. thesis, Gordon, H.R. (2000). World abalone supply, markets and pricing: Chulalongkorn University. historical, current and future prospectives. Opening Speech: 4th International Abalone Symposium, Cape Town, South Africa. Raymond, M., and Rousset, F. (1995). GENEPOP (Version 1.2): a University of Cape Town, February 6–11, 2000. population reconstructing phylogenic trees. Mol Biol Evol 4:406– 425. Guo, S.W., and Thompson, E.A. (1992). Performing the extract test of Hardy-Weinberg proportion for multiple alleles. Biometrics Rousset, F., and Raymond, M. (1995). Testing heterozygote excess 48:361–372. and deﬁciency. Genetics 140:1413–1419. Microsatellite polymorphism in H. asinina 611

Rice, W.R. (1989). Analyzing tables of statistical tests. Evolution Walsh, P.S., Metzger, D.A., and Higuchi, R. (1991). Chelex 100 as 43:223–225. medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10:506–513. Sekino, M., and Hara, M. (2001). Microsatellite DNA loci in Paciﬁc abalone Haliotis discus discus (Mollusca, Gastropoda, Weber, J.L. (1990). Informativeness of human (dC-dA)n and (dG- Haliotidae). Mol Ecol Notes 1:8–10. dT)n polymorphism. Genomics 7:524–530.

Selvamani, M.J.P., Degnan, S.M., Paetkau, D., and Degnan, B.M. Weir, B.S., and Cockerham, C.C. (1984). Estimation F-statistics (2000). Highly polymorphic microsatellite loci in the Heron Reef for the analysis of population structure. Evolution 38:1358–1370. population of the tropical abalone Haliotis asinina. Mol Ecol 9:1184–1186. Wright, J.M., and Bentzen, P. (1994). Microsatellites: genetic markers for the future. Rev Fish Biol Fish 4:384–388. Supungul, P., Sootanan, P., Klinbunga, S., Kamonrat, W., Jar- ayabhand, P., and Tassanakajon, A. (2000). Microsatellite poly- Yanisch-Perron, C., Vieira, J., and Messing, J. (1985). Improve morphism and the population structure of the black tiger shrimp M13 phage cloning vectors and host strains: nucleotide sequences (Penaeus monodon) in Thailand. Mar Biotechnol 2:339–347. of the M13 mp18 and pUC19. Gene 33:103–119.