This may be the author’s version of a work that was submitted/accepted for publication in the following source: York, Patrick S., Cummins, Scott F., Degnan, Sandie M., Woodcroft, Ben J., & Degnan, Bernard M. (2010) Identification of genes differentially expressed in the ganglia of growing haliotis asinina. Journal of Shellfish Research, 29(3), pp. 741-752. This file was downloaded from: https://eprints.qut.edu.au/200501/ c Consult author(s) regarding copyright matters This work is covered by copyright. Unless the document is being made available under a Creative Commons Licence, you must assume that re-use is limited to personal use and that permission from the copyright owner must be obtained for all other uses. If the docu- ment is available under a Creative Commons License (or other specified license) then refer to the Licence for details of permitted re-use. It is a condition of access that users recog- nise and abide by the legal requirements associated with these rights. If you believe that this work infringes copyright please provide details by email to [email protected] Notice: Please note that this document may not be the Version of Record (i.e. published version) of the work. Author manuscript versions (as Sub- mitted for peer review or as Accepted for publication after peer review) can be identified by an absence of publisher branding and/or typeset appear- ance. If there is any doubt, please refer to the published source. https://doi.org/10.2983/035.029.0328 Identification of Genes Differentially Expressed in the Ganglia of Growing Haliotis asinina Author(s): Patrick S. York, Scott F. Cummins, Sandie M. Degnan, Ben J. Woodcroft and Bernard M. Degnan Source: Journal of Shellfish Research, 29(3):741-752. Published By: National Shellfisheries Association DOI: http://dx.doi.org/10.2983/035.029.0328 URL: http://www.bioone.org/doi/full/10.2983/035.029.0328 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Journal of Shellfish Research, Vol. 29, No. 3, 741–752, 2010. IDENTIFICATION OF GENES DIFFERENTIALLY EXPRESSED IN THE GANGLIA OF GROWING HALIOTIS ASININA PATRICK S. YORK, SCOTT F. CUMMINS, SANDIE M. DEGNAN, BEN J. WOODCROFT AND BERNARD M. DEGNAN* School of Biological Sciences, University of Queensland, Brisbane, Queensland, 4072, Australia ABSTRACT There is currently a paucity of specific genetic data regarding growth and reproduction-related processes in abalone, marine vetigastropods of commercial value. However, strong inferences about these processes can be drawn from other molluscs. For example, ganglia from the gastropods Aplysia and Lymnaea are known to produce neuropeptides related to growth, feeding behavior, and reproduction. Here, we use suppression subtractive hybridization to identify expressed genes that may be linked to the control of growth and feeding in the tropical abalone Haliotis asinina. Two pools of suppression subtractive hybridization clones were obtained from messenger RNA derived from H. asinina cerebral and pleuropedal ganglia, corresponding to genes differentially expressed in (1) well-nourished animals relative to food-deprived ones and (2) well- nourished animals relative to reproductively active ones. From these subtractions, respectively, 204 and 214 unigenes were identified in 222 and 231 sequenced clones, with 18 of these unigenes common to both subtractions. A subset of the putative differentially expressed genes was confirmed by quantitative polymerase chain reaction, validating this approach. The transcripts that are differentially expressed in the ganglia of growing H. asinina fall into a wide range of functional categories, including biological regulation, cell proliferation, and metabolic process, and include genes encoding Phe-Met-Arg-Phe-NH2 (or, FMRF- amide), myomodulin, CDC123, RAB37, and dermatopontin. KEY WORDS: abalone, growth, tropical abalone, Haliotis asinina, neuropeptide, differential expression INTRODUCTION grow in a similar manner, and have a high level of genomic conservation (Giusti et al. 2000, Coleman & Vacquier 2002, Despite the established importance of abalone (Haliotidae; Degnan et al. 2006), the roles of H. asinina genes in growth and Vetigastropoda) as a significant aquaculture species (Gordon & reproduction are likely to be shared by other commercially Cook 2004), relatively few genes of potential commercial value important abalone species. have been identified from this group of molluscs. For example, a neuropeptide related to feeding and reproduction, myomo- MATERIALS AND METHODS dulin, has not been reported in haliotids, despite its character- ization in other gastropods (Miller et al. 1993, Kellett et al. Animals 1996). In terms of abalone production, there is interest both in improving growth rates and controlling reproduction. In other Broodstock were obtained from Heron Island Reef (Great gastropods, there appears to be an antagonism between growth Barrier Reef, Queensland, Australia) under permit, transported and reproduction that is manifested, at least in part, by the to Bribie Island Research Center (Department of Employment, differential expression of certain genes in the ganglia. These Economic Development and Innovation) and were spawned. genes encode neuropeptides that are known to regulate growth, Spat were settled 96 h after spawning and grown out in flow- feeding behavior, hormonal processes, neurotransmission, and through tanks in partial sunlight. These juvenile animals were reproduction (Geraerts et al. 1991, Geraerts et al. 1992, Miller fed to satiety on the abundant, naturally growing algae and et al. 1993, Kellett et al. 1996, Smit et al. 1996, Perry et al. 1998, diatoms from the sides of their tanks, with occasional supple- Vilim et al. 2000, Proekt et al. 2005). The expression of these mentary feed purchased from Adam & Amos Abalone Foods neuropeptide genes is controlled by transcriptional regulators Pty. Ltd. (Mount Barker, Australia) (www.adamamos.com). whose own expression is contingent on the developmental and Adult reproductively active animals were fed artificial food as physiological state of the animal (O’Brien & Degnan 2000). described, with occasional supplements of Gracillaria edulis. Given this background, we hypothesize that ganglia from satiated, fast-growing abalone will express genes controlling Treatments growth and feeding at different levels compared with animals that are either in an unfed state or a reproductively active state. Individual juvenile animals age 385 days postfertilization To identify genes that are differentially expressed in the ganglia (DPF) were tagged for identification, and growth was tracked of nonreproductive, actively growing abalone, we used sup- by measuring animal weight and shell length at periodic in- pression subtractive hybridization (SSH). SSH identifies tran- tervals (Fig. 1). At 426 DPF, juveniles were split into 2 cohorts scripts with abundance that differs from one tissue to another. based on growth rate. The faster growing cohort was sacrificed In this study, we focused on the abalone Haliotis asinina, a fast- at that time (5 animals, designated fed ganglia or FG), and the growing species (McNamara & Johnson 1995) that is currently slower growing cohort (5 animals, designated hungry ganglia or of commercial importance in Southeast Asia (SEAFDEC/AQD HG) was transferred to an inside isolation tank with flow- Highlights 2006). Because all haliotids appear to develop and through seawater and no food. HG animals were kept in the isolation tank for 3 wk. Two further weight measurements were *Corresponding author. E-mail: [email protected] taken during this period (at 440 DPF and 447 DPF), and the 741 742 YORK ET AL. Suppression Subtractive Hybridization The PCR-Select cDNA Subtraction Kit (Clontech) was used to create 2 pools of SSH clones. The first used FG cDNA as the tester and HG as the driver. The second used FG as the tester and RAG as the driver. cDNA from each finalized subtraction were ligated into the pGEM-T Easy plasmid vector (Promega, Madison, WI) and cloned into XLI-Blue Escherichia coli. Insert-containing clones were screened by PCR using vector-specific oligonucleotide primers (5#GTTTTCCCAGTCACGACGTT, 5#-GACCATG- ATTACGCCAAGCTA). Amplicons containing a cDNA insert Figure 1. Growth rates of fed and starved abalone used in suppression were purified using Millipore’s (Millipore, Billerica, MA) Multi- subtractive hybridization. Cerebral and pleuropedal ganglia were removed Screen PCRm96 Plates, and were checked for size and concentra- from satiated animals (fed ganglia, FG) and hungry animals (hungry tion by agarose gel electrophoresis with ethidium bromide stain- ganglia, HG) for use in suppression