Role of ITGAE in the Development of Autoimmune Diabetes in Non-Obese Diabetic Mice
Total Page：16
File Type：pdf, Size：1020Kb
E S BARRIE and others Role of ITGAE in autoimmune 224:3 235–243 Research diabetes Role of ITGAE in the development of autoimmune diabetes in non-obese diabetic mice Elizabeth S Barrie, Mels Lodder, Paul H Weinreb1, Jill Buss, Amer Rajab, Christopher Adin2, Qing-Sheng Mi3 and Gregg A Hadley The Ohio State University Wexner Medical Center, Room 216 Tzagournis Medical Research Facility, Correspondence 420 W 12th Avenue, Columbus, Ohio 43201, USA should be addressed 1Biogen Idec, Cambridge, Massachusetts 02142, USA to G A Hadley 2College of Veterinary Medicine, Columbus, Ohio 43201 USA Email 3Henry Ford Hospital, Detroit, Michigan 48202, USA [email protected] Abstract C There is compelling evidence that autoreactive CD8 Tcells play a central role in precipitating Key Words the development of autoimmune diabetes in non-obese diabetic (NOD) mice, but the " diabetes underlying mechanisms remain unclear. Given that ITGAE (CD103) recognizes an islet- " autoimmune restricted ligand (E-cadherin), we postulated that its expression is required for initiation of " immune system disease. We herein use a mouse model of autoimmune diabetes (NOD/ShiLt mice) to test this " mouse C hypothesis. We demonstrate that ITGAE is expressed by a discrete subset of CD8 T cells that infiltrate pancreatic islets before the development of diabetes. Moreover, we demonstrate that development of diabetes in Itgae-deficient NOD mice is significantly delayed at early Journal of Endocrinology but not late time points, indicating that ITGAE is preferentially involved in early diabetes development. To rule out a potential contribution by closely linked loci to this delay, we treated WT NOD mice beginning at 2 weeks of age through 5 weeks of age with a depleting anti-ITGAE mAb and found a decreased incidence of diabetes following anti-ITGAE mAb treatment compared with mice that received isotype control mAbs or non-depleting mAbs to ITGAE. Moreover, a histological examination of the pancreas of treated mice revealed that NOD mice treated with a depleting mAb were resistant to immune destruction. These results indicate that ITGAEC cells play a key role in the development of autoimmune diabetes and are C C consistent with the hypothesis that ITGAE CD8 T effectors initiate the disease process. Journal of Endocrinology (2015) 224, 235–243 Introduction Type 1 diabetes is a T cell-mediated autoimmune disease role in the development of diabetes, in direct destruction caused by the destruction of insulin-producing b cells of islets and/or in providing help for B and T cell responses of the islets of Langerhans in the pancreas, resulting in a to islet autoantigens (Shizuru et al. 1988, Haskins & Cooke hyperglycemic state. Non-obese diabetic (NOD) mice 2011). However, there is compelling evidence that C C (NOD/ShiLt) represent an experimental model of type 1 recognition of autoantigens by CD8ab TCRab cells C diabetes (Delovitch & Singh 1997), which mimics key (CD8 T cells) plays a pivotal role in the initiation of aspects of human disease. Studies of both NOD mice and diabetes. In both diabetic NOD mice and humans, there is humans indicate that autoreactive CD4 T cells play a key evidence that MHC I alleles (the target of CD8 T cells) http://joe.endocrinology-journals.org Ñ 2015 Society for Endocrinology Published by Bioscientifica Ltd. DOI: 10.1530/JOE-14-0396 Printed in Great Britain Downloaded from Bioscientifica.com at 09/28/2021 02:09:51AM via free access Research E S BARRIE and others Role of ITGAE in autoimmune 224:3 236 diabetes contribute to development of diabetes (Katz et al. 1993, might have the capacity to slow the development of Serreze et al. 1994, Wicker et al. 1994, Serreze et al. 1997, autoimmune diabetes. The goal of this study was to test Jarchum et al. 2007, Nejentsev et al. 2007,Tsai et al. 2008). this hypothesis. Experiments in which spleen cells from prediabetic Itgae deficient mice were originally developed in 1999 NOD mice are transferred into immunodeficient NOD– (Schon et al. 1999) on the Balb/c background. In these SCID recipients document an absolute requirement for mice, exon 10 of the integrin alpha E (Itgae) locus was CD8 cells in the initial phases of development of diabetes replaced with a neomycin resistance gene. The deficiency (DiLorenzo et al. 1998). This requirement for CD8 cells was detected via PCR, fluorescence-activated cell sorting is a robust finding reproduced in a variety of experi- (FACS) analysis, and immunoprecipitation as an mental models including transfers into non-irradiated insertion of approximately 200 bp. Results from previous young mice (Bendelac et al.1987), adult irradiated studies have indicated that Itgae deficiency does not mice (Miller et al. 1988), athymic nude mice (Kano et al. have a significant effect on host weight, reproduction, 1992, Matsumoto et al. 1993), and NOD–SCID mice survival (Schon et al. 1999), or defense against pathogens K K (Christianson et al. 1993, Rohane et al. 1995). Indeed, (Fousteri et al. 2009). In the present studies, the Itgae / depletion of CD8 cells in young NOD mice prevents genotype was backcrossed onto the NOD background. the development of diabetes (Wang et al. 1996). These We herein describe the development of Itgae-deficient data are consistent with a model in which autoreactive mice on the NOD background and demonstrate that C CD8 T cells initiate the disease process leading to such mice exhibit delayed development of diabetes. diversification of the CD4 T cell response and eventual We further document that depleting monoclonal development of a pathogenic CD4 T cell response (Serreze antibodies (mAbs) to ITGAE have a blocking effect in WT et al. 1997). NOD mice indicating that the decrease in diabetes aE(ITGAE)/b7 (herein referred to as ITGAE) is a T-cell development is not due to genes closely linked to Itgae. integrin that confers specificity for the epithelial-cell- The interpretation of these results and their therapeutic specific ligand, E-cadherin (Cepek et al. 1994, Karecla et al. implications are discussed. 1995). Results from studies using transplant models indicate that ITGAE promotes destruction of epithelial C compartments by alloreactive CD8 T cells (Feng et al. Materials and methods 2002, El-Asady et al. 2005, Yuan et al. 2005). These findings Journal of Endocrinology PCR potentially provide insights into mechanisms of diabeto- genesis because the ITGAE ligand, E-cadherin, is highly DNA was isolated from a tail clip using the DNeasy Blood expressed by pancreatic b-cells (Cirulli et al. 1994, Meda & Tissue Kit (Qiagen), as per the manufacturer’s instruc- 2013), the critical targets in diabetes. Several lines of tions. The concentration of DNA was measured using a C C evidence indicate that autoreactive ITGAE CD8 cells Nanodrop 2000 Spectrophotometer (Thermo Scientific, play a key role in initiation of diabetes. For instance, Waltham, MA, USA). PCR was performed with HotStar Taq C ITGAE is preferentially expressed by CD8 T cells (Hadley Polymerase (Qiagen) on a Veriti Thermocycler (Applied et al. 1997), a subset thought to play a central role in Biosystems). Primers for the detection of Itgae deficiency C triggering the development of diabetes. Moreover, CD8 T were as follows: F: GCAACAACGCATCGTTCATATGGA cells unable to express ITGAE (i.e., from mice with targeted and R: GTGCTCTGTCTATTGTTCCCCTCCTT. The PCR disruption of ITGAE) are deficient in the capacity to reject product of the disrupted allele is expected to be 1100 bp, pancreatic islet allografts (Feng et al. 2002). Histological while the product for the WT allele is 900 bp (Schon et al. C analyses have revealed that CD8 T effectors in Itgae- 1999). Primers for the detection of D11Mit320 were as deficient hosts successfully traffic to the general graft follows: F: CCCATATAGTGAAGCAAGAAACG and R: site but completely fail to accumulate within the islet TTATAGTGTATGCATCCAGGTGTG. Amplification of allograft itself (Feng et al. 2002). This histological picture DNA from NOD mice yields a 124 bp product, whereas is strikingly similar to the peri-insulitis stage in the mice on a Balb/c background will produce a 140 bp development of diabetes. Thus, these results raise the product. Primers for the detection of D11Mit325 were as possibility that acquisition of expression of ITGAE by follows: F: CCTCCACCTGAAAATTCATACT and R: diabetogenic CD8 effector/memory cells may be a key GGTTAGAGGATGATGATGATGATG. Amplification of checkpoint in progression from peri-insulitis to frank DNA from NOD mice yields a 110 bp product and a diabetes. Therefore, we postulated that blockade of ITGAE 124 bp product from Balb/c mice. http://joe.endocrinology-journals.org Ñ 2015 Society for Endocrinology Published by Bioscientifica Ltd. DOI: 10.1530/JOE-14-0396 Printed in Great Britain Downloaded from Bioscientifica.com at 09/28/2021 02:09:51AM via free access Research E S BARRIE and others Role of ITGAE in autoimmune 224:3 237 diabetes Mice mAb, M290 (Kilshaw & Baker 1988). To produce the mAbs, standard recombinant DNA technology was used NOD/ShiLtJ and Balb/cJ mice were purchased from the to render M290 effector competent in mice by replacing Jackson Laboratory (Bar Harboe, ME, USA). To develop the rat IgG1 Fc domain with a murine IgG2a domain Itgae-deficient mice on a diabetic background, we K K (herein referred to as ChM290-IgG2a), which is anti- interbred WT NOD mice with Itgae / mice on the cipated to bind Fc receptors with a high affinity and be Balb/c background (C.129S2-Itgaetm1Cmp/J), and then an effector competent in mice. To further promote its backcrossed the resulting offspring to NOD mice for 12 depleting capacity, ChM290-IgG2a was grown in CHO generations. Diabetes in NOD/ShiLtJ mice is characterized cells with targeted disruption of a 1,2 fucosyltransferase by insulitis, a leukocytic infiltration of the pancreatic islets (Potelligent, Kyowa Hakko Kirin, Tokyo, Japan) that with marked decreases in pancreatic insulin content produces a low-fucose antibody, which has been shown occurring in females at approximately 12 weeks of age to improve Fc receptor binding and enhance effector and several weeks later in males (Makino et al.