Great Basin Naturalist

Volume 58 Number 1 Article 13

1-30-1998

Full Issue, Vol. 58 No. 1

Follow this and additional works at: https://scholarsarchive.byu.edu/gbn

Recommended Citation (1998) "Full Issue, Vol. 58 No. 1," Great Basin Naturalist: Vol. 58 : No. 1 , Article 13. Available at: https://scholarsarchive.byu.edu/gbn/vol58/iss1/13

This Full Issue is brought to you for free and open access by the Western North American Naturalist Publications at BYU ScholarsArchive. It has been accepted for inclusion in Great Basin Naturalist by an authorized editor of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. T H E GREAT BASIN naturalistnaturalist

moe

A

VOLUME 58 n2naN I1 JANUARY 1998

BRIGHAM YOUNG university GREAT BASIN naturalist httpwwwlibbyuedu amsnms

editor assistant editor RICHARD W BAUMANN NATHAN M SMITH 290 MLBM 190 MLBM PO box 20200 PO box 26879 brigham young university brigham young university provo UT 84602020084602 0200 provo UT 84602687984602 6879 8013785053801 378 5053 8013786688801 378 6688 FAX 8013783733801 378 3733 emailE mail nmshbllibyuedunmshbll1byuedu

associate editors BRUCE D ESHELMAN STANLEY D SMITH department of biological sciences university of department of biology wisconsin whitewater whitewater w1WIwa 53190 university of nevada las vegas las vegas NV 89154400489154 4004 JEFFREY J JOHANSEN department of biology john carroll university PAUL T TUELLER university heights OH 44118 department of environmental resource sciences university of nevada reno 1000 valley road BORIS C reno kondratieff reno NV 89512 department of entomology colorado state university fort collins CO 80523 ROBERT C WHITMORE of box PAUL C MARSH division forestry 6125 west virginia morgantown center for environmental studies arizona university Morgan town WV 26506612526506 6125 state university tempe AZ 85287

editorial board berranjerran T flinders chairman botany and range science duke S rogers zoology wilford M hess botany and range science richard R tolman zoology all are at brigham young university ex officio editorial board members include steven L taylor college of biology and agriculture H duane smith director monte L bean life science museum richard W baumann editor great basin naturalist the great basin naturalist founded in 1939 is published quarterly by brigham young university unpublished manuscripts that further our biological understanding of the great basin and surrounding areas in western north america are accepted for publication subscriptions annual subscriptions to the great basin naturalist for 1998 are 25 for individual sub- scriscribersbers 30 outside the united states and 50 for institutions the price of single issues is12is 12 all back issues are in print and available for sale all matters pertaining to subscriptions back issues or other busi- ness should be directed to the editor great basin naturalist 290 MLBM PO box 20200 brigham young university provo UT 84602020084602 0200

scholarly exchanges libraries or other ororganizations9anizationsanimations interested in obtaining thethegreatcreatgreat basin naturalist through a continuing exchange of scholarly publications should contact the exchange librarian 6385 HBLL PO box 26889 brigham young university provo UT 84602688984602 6889

editorial production staff joanne abel technical editor

copyright 0 1998 by brigham young university ISSN 001736140017 3614 official publication date 30 january 1998 1981 98 750 24893 the great basin naturalist PUBLISHED AT PROVO UTAH BY BRIGHAM YOUNG university

ISSN 001736140017 3614

VOLUME 58 31 JANUARY 1998 no I1

great basin naturalist 581 0 1998 appp 1 11

TAXONOMY OF sphaeromeria ARTEMISIA AND TANACETUM compositae anthemideae BASED ON RANDOMLY AMPLIFIED polymorphic DNA RAPD

E durant McMcArthurarthuriArthurl1 reneerenge van Buren233 stewart C SandersoSandersonsandersonlsanderson1nl1 and kimball T harper2harpere

ABSTRACT relationships within between and among the anthemideae genera sphaeromeria artemisia and tanacetum were investigated using 238 randomly amplified polymorphic DNA RAPD markers obtained from twenty lomer10 mer primers amplified on genomic DNA forty one populations from 16 taxa 15 species were studied jaccard s coefficient of similarity and UPGMA clustering analysis were used to construct phonophenogramsphonogramsgrams T tests were used to make comparisons between samples at various systematic levels DNA markers were 75 similar for conspecific populations sixteen sphaeromeriasphaeromena populations 5 species showed an average interspecific similarity of 21 interspecific similarity among 23 artemisia populations 8 species with 2 subspecies of A tntritrldentata included averaged 27 two tanacetum species 1 I1 population each were 89 similar the high similarity of the tanacetum species was in the range of observed values for conspecific populations indeed those 2 species T vulgare and T boreale have been considered conspecific by some authors the 3 subgenerasub genera of artemisia studied artemisia dracunculus and tndentataetridentataeTridentatae formed separate groups in comparisons among the genera sphaeromeriasphaeromena was 18 similar to artemisia more similar to subgenus tri- dentdentataeatae than the other artemisia subgenerasub genera interintergenericmtergenencgeneriegeneric comparisons of sphaeromeriasphaeromena and artemisia and artemisia and tanacetum each were found to be 7 similar to each other thus based on DNA markers sphaeromeriasphaeromena is more similar to artemisia than it is to tanacetum which supports previously established morphological distinctions sphaeromeriasphaeromena potentilloides may be misplaced in the genus sphaeromenasphaeromeria based on DNA marker resultsi it is likely that north american anthemideae are circumboreal derivatives of ancestral eurasian stock and that sphaeromeriasphaeromena is derived from an artemisia likeilke ancestor

key words sphaeromenaspbaeromeria artemisia tanacetum anthemideae RAPD taxonomy

two decades ago holmgren et al 1976 duceddeuced the taxon to subgeneric status section published an intriguing article sphaeromesphaeroma sphaeromeriasphaeromerid in the genus tanacetum sahaesphae ria a genus closer to artemisia than to tanace- romeria endemic to western north america tum asteraceae anthemideae in their article Hohnholmgrengren et al 1976 mcarthur et al 1989 holmgrenho1mgren et al 1976 returned sphaeromeria cronquist 1994 consists of 9 species 8 of to the generic rank first proposed by nuttall them rare several authors have noted that an 1841 torrey and gray 1843 however re understanding of relationships between and

1 shrub1shrub sciences laboratoqlaboratory rocky mountain research station forest service united states department of agricultureofagriculture 735 N 500 E provo UT 84606 department of botany and range science brigham young university provo UT 84602 spiesent3presentSpie seatsent address department of life science utah valley state college orem UT 84058

1 2 GREAT BASIN naturalist volume 58 within the genera artemisia and tanacetum were grown in our greenhouse from seed ob- would be enhanced by new information on the tained from european colleagues table 1 we distribution and phylogeny of that portion of collected samples between may and august the tribe anthemideae hall and clements 1995 inm most cases 3 populations range 1 4 1923 holmgren et al 1976 mcarthur 1979 for each taxon by combining tissue young meartmcarthurMcArthuihul et al 1989 leaves from 30 healthy but otherwise ran- artemisia is the largest genus of anthem- domly chosen individuals of each population ideae consisting of 250 or more species divided we obtained a bulked sample for each popu- into 4 subgenerasubgencrasubgenera it is distributed mostly in lation leaves were collected in nylon bags temperate portions of the northern hemisphere immersed immediately in liquid nitrogen and but also in south america and south africa transported to the laboratory where they were willis 1973 bailey HorthortonumhortoriumHortooriumorlumnum staff 1976 stored at ultra cold temperatures 80c800csoc until greger 1978 mcarthur 1979 mcarthur et al DNA was extracted herbarium voucher spec- 1981 ling 1995a tanacetum consists of some imensamens are deposited in the shrub sciences 50 species with a eurasian distribution except laboratory SSLP or the brigham young uni- for the T bipinnatumbipinnatum complex which is cir-circlr versity BRY herbaria following methods of cumcumpolarpolar willis 1973 bailey HorthortonumhortoriumHortooriumorlumnum staff mcarthur and sanderson 1985 we made a 1976 mcarthur 1979 kyhos and raven 1982 chromosome count from root tips of sahaesphae here we address relationships among the romeriaromena diversidiversifoliadzversifohafolia to extend the cytological genera sphaeromeriasphaeromena artemisia and tanace- knowledge base in sphaeromenasphaeromeria several but tum using genomic DNA markers from repre- not all sphaeromenasphaeromeria species are cytologically sentativesentative species from each genus we also re- known powell et al 1974 sanderson et al view species and generic distributions 1984 mcarthur et al 1989 randomly amplified polymorphic DNA DNA and amplification RAPD analysis has been shown to be useful extraction in studying plant population biology in pre- bulked leaf samples were thoroughly mixed paring genetic maps and in classifying plants and a sample weighing 030.30 3 050.50 5 g from each williams et al 1990 1993 dawson et al 1993 population was used for DNA extractioneftiexti action russell et al 1993 williams and st clairglair extraction procedures generally followed bult 1993 santos et al 1994 van buren et al 1994 et al 1992 this protocol resulted in high bradshaw et al 1995 gang and weber 1995 yields of genomic DNA ranging from approxi- yeh et al 1995 bonnmborminbarmin et al 1996 karp et al mately 100 galgml to nearly 400 DNA 1996 lanner et al 1996 linlm and ritland 1996 concentration was estimated using a beckman mudge et al 1996 smith et al 1996 stock- DU 640 mass spectrophotometer beckman in- inger et al 1996 whereas this paper examines strumentsst inc fullerton CA the extracted similarity among related anthemideae genera DNA was diluted with TE 1 I1 M tris and 050.50 5 a companion paper mcarthur et al 1998 uses M EDTA ph 80 to achieve a final concen- RAPD technology to examine hybridization tration of approximately 252.52bs85 5 nejungjunglalnglam and polyploidy within the subgenus indentridentylden amplification of genomic DNA was accom- tataehatae of 1 of those genera artemisia our use plished following procedures reported by of RAPD data to compare genera is novel but williams et al 1990 amplification reactions is we believe a natural extension of the many with a final volume of 15 10luijul contained the fol- studies that have made population and species lowing 5 10 ng DNA 151 5 ajlIJLd lox buffer 100 comparisons tmM each of 4 deoxynucleoside tntritrlphosphates datedate detrdctrdctp dgtp and dttadttp 353.53 5 mm mgclgmgc12 MATERIALS AND METHODS 040.40 4 limfimjm primer operon technologies inc CA and 1.2121 2 U stoffel per- plant alameda 12 fragment materials kin elmer cetus norwalk CT amplification we identified and selected for study species was earnedcarried out using a perkin elmer cetus representing morphological variation and geo- DNA 48 well thermal cycler with the follow- graphical spread of the 3 genera of concern ing cycling regime 1 3 minmm initiation step at collecting sites for representative populations 92c 2 92c for I1 minmm 35c for 1 minmm 45 seesec were determined for sphaeromenasphaeromeria and artemi- 72c for 2 minmm repeated for 45 cycles and 3 sia table 1 and representatives for tanacetum 72c for 7 minmm control reactions consisted of 199811998 RAPD contribution TO anthemideae TAXONOMY 3

TABLE 1 location of sample collections and sample reference numbers collection location and sample reference number

01 sphaeromenasphaeromeria potentilloides A gray AAA A heller hot springs hill eureka co NV mas 2428 02 sphaeromenasphaeromeria potentilloides A gray AAA A heller 4 kmkin S of hill city camas co ID masM as&s 2425 03 sphaeromenasphaeromeria potentilloides A gray AAA A heller I1 kmkin E of reese river USU S highway 50 lander co NV msm&s 2427 04 sphaeromenasphaeromeria argentea nutt point of rocks sweetwater co WY Mmsm&sas&s 2422 05 sphaeromenasphaeromeria argentea nutt 10 km SE of mountain view uinta co WY mas 2424 06 sphaeromenasphaeromeria argentea nutt near opal lincoln co WY havh&v s n 13 july 1995 07 sphaeromenasphaeromeria capitatecapitatacapitata nutt E sevier road bryce canyon sevier co UT havh&vh&vssnn 18 july 1995 08 sphaeromenasphaeromeria capitatecapitatacap itata nutt N of lookout mountain moffat co CO msm&sM as&s 2419 09 sphaeromenasphaeromeria capitatecapitatacap itata nutt muddy creek budgebridge carbon co WY msm&s 2420 10 sphaeromenasphaeronteria capitatecapitatacap itata nutt 1801 80 exit 184 sweetwater co WY msm&s 2421 11 sphaeromenasphaeromeria diversifoliadiversifolia DDCC eat redbrydb rock canyon utah co UT hav sns n 10 july 1995 12 sphaeromenasphaeromeria diversfoliadiversdiversifoliadiversifoliaaolia DCD C eat redbrydb american fork canyon utah co UT havh&v sns n 10 july 1995 13 sphaeromenasphaeromeria diversifoliadiversifolia DCD C eat redbrydb santalumsantaquinsantaqumSantaquin canyon utah co UT havh&vh&vssnn 10 july 1995 also msm&s 2041 14 sphaeromenasphaeromeria ruthianruthiae holmgren refrigerator canyon zion national park washington co UT shultz & lowrey msv&mu sns n 9 may 1995 also mas 1775 15 sphaeromeriasphaeromena ruthianruthiae holmgren the barracks E fork virgin river kane co UT ms&mu sns n shultz & lowrey 10 may 1995 also msm&s 1769 16 sphaeromenasphaeromeria ruthianruthiae holmgren pine creek zion national park washington co UT ms&mu sns n shultz & lowrey 10 may 1995 also msm&s 1774 17 artemisia ludovicianaludoviciana nutt the barracks E fork virgin river kane co UT ms&mu 2393 18 artemisia ludovicianaludoviciana nutt salt cave hollow salt creek canyon juab co UT mas 2437 19 artemisia ludovicianaludoviciana nutt daniels canyon wasatch co UT msm&s 2431 20 artemisia spinescentspinescensspinescens DDCC eaton middlegateMiddlegate churchill co NV msm&s sns n 6 june 1995 21 artemisia spinescentspinescensspinescens DCD C eaton desert experimental range millard co UT havh&v sns n 8 june 1995 22 artemisia spinescentspinescensspines cens DCD C eaton S pony express trailhead faust toodletooeletoocle co UT hav sns n 5 june 1995 23 artemisia spinescentspinescensspinescens DDCC eaton secret valley mono co CA mas sns n 10 june 1995 24 artemisia tntridentata nutt sspasp vastyanavaseyanavaseyana redbrydb beetle hobble creek canyon utah co UT gwm&l 21492 25 artemisia tntrltrityldentata nutt sspasp vastyanavasevaseyanayana redbrydb beetle red creek salmasalinasaima canyon sevier co UT msm&s 2149 26 artemisia tntritrldentatodentata nutt sspasp vastyanavaseyanavaseyana redbrydb beetle pine valley washington co UT msm&s 2177 27 artemisia tntritrldentata nutt sspasp 5 kmkin W ofofjunctionjunction of faust road and utah highway 73 thoeletooele co UT wyomingensis beetle & young havh&v sn 16 august 1995 28 artemisia A nova nelson 3 kmkin E of faust tooelethoele co UT havh&v 5 n 16 august 1995 29 artemisia pygmaeapygmaean A gray 3 km E of faust tooelethoele co UT hav s n 16 august 1995 30 artemisia pygmaeapygmaean A gray E sevier road bryce canyon sevier co UT hav sns n 18 july 1995 31 artemisia cana pursh sspasp viscivisciduladula osterhout beetle daniels summit wasatch co utah mas 2430 32 artemisia cana pursh sspasp viscivisciduladula osterhout beetle warner pass lake co OR msm&s 2436 33 artemisia michauxianamichauxiana besser snowbird little cottonwood canyon salt lake co UT h&vsHav&v s n 11 august 1995 34 artemisia michauxianamichauxiana besser above kingston lander co NV msm&s 2429 35 artemisia michauxianamichauxiana besser lamoille canyon ruby range elko co NV msm&s 2426 36 Arteranterartemisianisianisla michauxianamichauxiana besser snowbird little cottonwood canyon salt lake co UT havh&v sns n 11 august 1995 15151.51 5 km from 33 37 artemisia bigelobigeloviibtgeloviivilvii A gray utah highway 12 milepost 36 garfield co UT havh&v sns n 18 july 1995 38 artemisia bigeloviibigelovii A gray utah highway 12 milepost 51 garfield co UT havh&v sns n 18 july 1995 39 artemisia bigeloynbigelovnbigeloviibigelo ullviivn A gray north creek road garfield co UT havh&vh&vss n 18 july 1995 40 tanacetum vulgare L greenhouse grown from bonn botanical garden native population from nordrhein westfalen eifel blankenheimerdorf germany 0613 41 tanacetum boreale fisch ex DC greenhouse grown from brunn czech republic hortus centraliscentralesCentralis cultura Herherbarumherbariumbarum mediicarum facultadfacultas medica Univeruniversitasumver&itassitas masarykianaMasaryk iana 770 native population site unknown

initialsainitials for the collectorscollectoiscollectoisors are G ss sherel Goodgoodrichnch L mont E lewis H kimball T harper M E durant mcarthur mu joanne mudge S stewart C sanderson V reneerenge van buren and W alma H winward 4 GREAT BASIN naturalist volume 58 all reagents except DNA to identify ambigu- 111 S potentilloides ous markers amplified products were sepa- 2 S potentilloides rated and visualized using metaphorsmetametaphorephore adaroseagarose 3 S potentilloides gel electrophoresis DNA was stained with 4 S arorgentea ethidium bromide and bands were pho- 5 S argentea 6 S arargenorgenongengenteateo tographedto under UV light amplified bands puc 19 marker were scored from photographs and recorded 7 S capicapitotocapitatocopicoplcapitonofotofatotatototofajofojo as presence or absence of bands of the same 8 S capicapilatocopitatocapitatocopicopl tatototo molecular weight fig 1 the DNA size marker 9 S caocoocapicapitalacapitatacapitatocopicoplcap talotatoitata puc 19 207 biosynthesis inc lewisvilleLewisville 10 S copitatacopitata TX was added every ath7th lane for reference 11 S diversidiversifoliafolia 12 S diversidiversifoliafolia and ease in scoring gels A control lane puc 19 barkermorkermurkermarkermankerbarqer included all reagents but DNA was also 133 S diversifoliodiversifolio included fig 1 144 S ruthianruthiae 155 S ruthianruthiae analysis of amplified 166 S ruthineruthioe DNA products 31 177 A ludovicianaludoviciana 188 A ludoludovicionaludovicianaludovicvicianalonaionalono we used the NTSYS pc version 1801.801 80 sta- puc 19 marker tististicaltical software package to analyze amplified 199 A ludovicludovicioneludovicianaludovicianaloneionelono DNA products rohlf 1993 presence or ab- 20 A spinescentspinescensspines cens sence of specific DNA bands markers was 21 A spinescentspinescensspines cens analyzed for percent similarity to produce a 22 A spinescentspinescensspines cens similarity coefficient matrix for all samples in 23 A spinescentspinescensspines cens the analysis we used jaccard s coefficient of 24 A triirninn dentatadentato sspasp vastyanavaseyanavaseyana similarity jaccard 1912 UPGMA clustering 25 A lritrltridentatodentata sspasp vaseyonovaseyono 26 A tridenfridentritrldentatototajatojafa aspssp vosevoseyonayonayanayono analysis NTSYS pc SAHN was used to gra- 27 A tritrldentatodentata gsg wyomingensis phiphicallycally show similarity among samples A puc 19 marker phenepheneticphrenetictic tree NTSYS pc TREE was gener- 28 A nova ated to display percent similarity relationships 29 A pygmoeapygmaeapygmaean among samples mean similarity values with 300 A pygmaeapygmoeapygmaean the standard deviations for each were calcu- 311 A canaconacono sppapp visciviscidufoviscidulodulcdutodufoduloduio 32 A cona srp viscidulovisci dulo for lated populations of each species each 333 A michauxionomichauxianamichauxianaianolanoionolono genus and among the 3 genera for making i puc 19 marker comparisons of means within and between OW 344 A michauxianomichauxianamichauxianaianolonclonalono genera species and subspecies population 35 A michauxianomichauxionamichaux ianoionalanolonalono means were used many of these means were 366 A rnichouxionamichauxianamichaux lanaiana 377 A bigelobigeloviivii compared using t tests woolf 1968 percent- 383 A bigelobigeloviivii age values were arcsm transformed for arismarcsin statisti- tiltik U 399 A bigelobigeloviivii cal analyses but weiewere converted back to per- 400 T vulgare cent values for reporting 411 1 boreale puc 19 marker RESULTS control

twenty primers table 2 produced 238 fig 1 photograph offelofgelofgelgei OPAW 19 populations and taxa informative storablescoscorablerable markers that were used are identified to the right ofeachof each lane the numbers refer to populations of table 1 molecular marker lanes puc to determine similarity among the selected 19 207 and a blank control lane are also labeled to the sphaeromenasphaeromeria artemisia and tanacetum taxa right presence and absence data were used to com- pute percent similarity and to generate a phenograsphenphenogramphenograinograinogram fig 2 the phenphenograsphenogramphenogiamogram clearly phenograsphenogramphenogram fig 2 also strongly groups the distinguishes among the 3 genera of interest populations of each taxon percent similarity with the exception of a group at the top of the among populations of a single taxon among figure in which sphaeromeriasphaeromena potentilloides species within a genus and among the 3 gen- and artemisia spinescentspinescensspinescens are grouped the era of interest is reported in tables 3 and 4 199811998 RAPD contribution TO anthemideae TAXONOMY 5

TABLE 2 primerpi imer name sequence and number of markers populations of white stemmed rubber rabbit generated from each primer used for amplification of sam- brush chrysothamnus nauseosus sspasp hololeu ple DNA cus and we found about 55 similarity in number sagebrush artemisia subgenus tndentataetridentataeTrident atae primerpi imer namenamelnamet primer sequence 5 3 of markers populations in a companion study mcarthur OPAT 03 gactgggagg 13 et al 1998 using similar analytical techniques OPAT 04 ttgcctcgcc 11 to those employed in this study the patterns OPAT 06 ccgtccctga 13 OPAT 08 tcctcgtggg 10 were similar for both genera sphaeromeriasphaeromena OPAT 11 ccacatctccccagatctcc 11 populations ranged from 53 to 85 similar- OPAT 12 ctgcctagcc 15 ity artemisia populations from 58 to 87 OPAT 13 ctggtggaag 10 similarity OPAT 14 gtgccgcact 13 OPAT 15 tgacgcacgg 14 similarity WITHIN GENERA similarity of OPAT 17 agcgactgct 10 species within geneiagenelagenera provided some instruc- OPAT 18 ccagctgtga 13 tive and interesting information table 4 the accaaggcac OPAT 19 9 5 species of sphaeromenasphaeromeria were 20720.720 7 similar OPAU 03 acgaaacggg 10 and except for S potentilloides clustered on the OPAU 04 ggcttctgtc 9 OPAU 07 agacccttcgagacccttgg 9 same stem of the phenograsphenphenogramogram fig 2 when S OPAU 09 acggccaatc 15 potentilloides is removed from the analysis OPAU 11 cttctcggtc 12 the mean congeneric percent similarity for OPAU 15 tgctgaccactgctgacgac 16 sphaeromeriasphaeromerw is 24.724247 7 6 s 6.5665 OPAW 19 ggacacagag 14 is 247 n 655 sphaero OPAX 09 ggaagtcctg 11 merlameriamerza potentilloides has been recognized as TOTAL NUMBER OF MARKERS 238 somewhat distinct from other sphaeromenasphaeromeria iopopeionoperono Thnologislechnoloyei inc1 almeda CA species by earlier workers holmgrenHohn gren et al 1976 cronquist 1994 rydberg 1916 included S potentilloides in the genus vesicarpaVesicarpa and 5 similarities tables and 6 respectively report asa gray included it in artemisia but placed among the of sphaeromenasphaeromeria and species arte- other currently recognized species of sphaero values in tables 3 and 4 are the percent misia in metlameriametiamena in tanacetum torrey and gray 1843 similarity to be expected for groups of planpianplantss holmgren et al 1976 we compared the RAPD at levels of classification m the tribe various in tube markers of the sampled S potentilloides popu- anthemideae A full data matrix is available lations with all other sphaeromenasphaeromeria populations upon request from the senior autholauthor semoidemoi by subjecting those values to a t test results the chromosome number for S diversidwersifohadiversifoliafolia indicate that S potentilloides is no more simi- from santaquinSantaquin canyon utah mcarthur & lar to its convenerscongenerscongeners af5fx 14914.914 9 similarity than sandersonSandeison 2041 is 2nan 18 the same number it is to the other populations Y 15415.415 4 simisimlsimi- as n 9 or 2nan 18 for all other portedreportedle f larity included in our study t 0270.270 27 p sphaeromenasphaeromeria S cana as tanacetum species 0800.800 80 data not shown but see table 5 for com- canum S nuttalhinuttafflihi as T nuttalhinuttalliinuttalliahiliiill S potentilpotential nuttal nuttal of means it might be well to resur- loides as T potentilloides and S argentea as T parison rect rydberg s vesicarpaVesicarpa for S potentilloides argentea powell et al 1974 and S argentea the relatively high RAPD marker similarity sanderson et al 1984 and S ruthianruthiae mcarthurMcAithur between S diversi and S ruthiaeruthian 5 etalet al 1989 diversifoliafolia table is consistent with their morphological and discussion habitat preference similarities and with appar- ent volatile oil content holmgren et al 1976 inferences from RAPD data mcarthur et al 1989 unpublished interpopulationINTER POPULATION similarity within the the subgeneric taxonomy of artemisia fol- genera sphaeromenasphaeromeria and artemisia interpolinterpopmterpop lows a tradition begun by besser 1829 where- ulationalation similarity is 7247272.44 232.32 3 s table 3 in he separated sections based on various com- this is a reasonable value for populations of binationsbinations of disc and ray flower occurrences the same species using our system of analysis and fertility besser s 4 sections abrotanum van buren et al 1994 reported about 80 absinthium drancunculus senphidiumseriphidium have similarity among populations of butterbuttercupscups in the main been retained however rydberg ranunculus sppapp gang and weber 1995 1916 elevated them to subgenerasubgenera and created reported approximately 70 similarity among subordinate sections and poljakov 1961 6 GREAT BASIN naturalist volume 58

0000.00ooo 0250.25 0500.50 0750.75025375 1001.00loo

S potentilloides 1 01

1 03ni S potentilloides 02 S potentilloides 20 A spinescentspinescensspinescens 21 A spinescentspinescensspinescens 22 A spinescentspinescensspinescens 23 A spinescentspinescensspinescens 04 sphaeromeria argentea 05 sphaeromeria argentea r1 06 sphaeromeria argentea 07 S capitatacapitatecaptcapcapttatatataitata J n11 S diversifoliadiversifolia 12 S diversifoliadiversifolia 13 S diversifoliadiversifolia 14 S ruthiaeruthian

1 15 S ruthiaeruthian 16 S ruthruthiaeruthianae 08 S capitatecapitatacap itata 09 S capitatacapitatecapitata 10 S capitatecapitatacap itata 24 A tntritrldentata sspasp vastyanavasevaseyanayana 25 A tntritrldentata sspasp vastyanavaseyanavase yana 1 1 26 A tntritrldentata sspasp vastyanavaseyanavase yana 27 A tntritrldentata sspasp wyorningensiswyomingensis 28 A nova 31 A cana sspasp viscivisciduladula 32 A cana sspasp viscivisciduladula 29 A pygmaeapygmaean 30 A pygmaeapygmaean J 37 Arterartemisianisianisla bigelobigelovnbigeloynbigeloviiviivilvn nj 38 Arterartemisianisianisla bigeloblgelovnbigeloviiviivil 1 39 artenArterartemisianisianisla bigelobigelovnbigeloynbigeloviiviivilvn 17 A ludoludovicianaviciana

1 18 A ludoludovicianaviciana 19 A ludoludovicianaviciana 33 A michauxianamichaux iana 34 A michauxianamichaux iana 35 A michauxianamichaux iana 36 A michauxianamichaux iana 40 T vulgare

1 41 T boreale

fig 2 Phenphonogramogram produced using jaccard s coefficient of similarity and UPGMA clustering analysis NTSYS pc for all 41 samples included in this study numbers preceding the species identify individual populations listed in table 1

united abrotanum and absinthium into the and plummer 1978 and mcarthur 1979 for a subgenus artemisia mcarthur et al 1981 more thorough review and references weber separated rydberg s section tridentataeTridentatae from 1984 and ling 1995b consider tridentataeTridentatae a the eurasian subgenus seriphidium based on portion of seriphidium seaman 1982 and karyotypic chemotaxonomicchemotaxonomic and distributional jeffrey 1995 support as we do the indepen- differences and recognized the section at the dence of ridentataetridentataeRidentTridentatahatae from seiiphidiumseriphidium we rec- subgeneric level see persson 1974 mcarthur ognize 4 subgenerasubgenera artemisia drancunculus 199811998 RAPD contribution TO anthemideae TAXONOMY 7

TABLE 3 mean percent similarity among populationpopulationspopulations1sa1 TABLE 4 mean percent similarity within and between genera Interinterpopulationpopulation similarity abnbN mean s altnitna mean s sphaeromeria potentilloides 3 767 116 similarity within a single genus sphaeromeria argentea 3 84884.8 76 sphaeromeria 10 207 71ti7.1 sphaeromeria capitatecapitatacap itata 6 52852.8 212.1 artemisia 36 267 16316.3 sphaeromeria diversifoliadiversifolia 3 760 54 tanacetum I1 88988.9 sphaeromeria ruthiaeruthian 3 82382.3 484.8 mean 2 240 424.2 artemisia ludovicianaludoviciana 3 803 888.8ss similarity between genera artemisia michauxianamichaux iana 6 731 39 sphaeromeriaartemisiasphaeromerialartemisia 45 18018.0 35 artemisia spinescentspinescensspines cens 6 635 128 sphaeromeriatanacetumsphaerometialtanacetum 10 707.0 22 artemisia dentatatritridentatatridentate sspasp artemisiatanacetumartemisialtanacetumArtemisia Tanacetum 18 70 252.5 vastyanavasevaseyanayana 3 80880.8 16 NW foifor sicilaisimilaisimilarityitytty within a single genus isis thetlletile number ofspeciesof species and subspecies artemisia cana sspasp x number of species and subspecies minus I1 divided by 2 N toitolforfol similarity viscivisciduladula 1 580 between geneiagenera is the product of the number of species and subspecies inin artemisia pygmaeapygmaean 1 870 each genus ithisathisthis mean includes only sphaeromeria and Artenartemisiatisia because rinacetuntdnacetuin artemisia bigeloviibigelovii 3 83.5835 835 34 species behaved as itif they weiewere populations of a single species and thentheir sam- mean populationalinterinterpopulational plepie number 2 was low similarity 41 724 23 mean within species 12 74974.9 111 sampie includes all species with more than I1 population sampled see table 1 11nW foiforborbbrpor each species isis that of all comparisons ege g number of populations peipelper chromosomal and chemical criteria hall and species x number of populations peiper species minus I1 divided by 2 N totoifottot clements 1923 moss 1940 ward 1953 mean interpopulationalinterpopulationalinteipopuldtional similaritysimisiml lanty isis the sum of species populations N for mean within species is number of species beetle 1960 hanks et al 1973 mcarthur et al 1981 shultzshuitz 1986 and cronquist 1994 included A pygmaeapygmaean in tridentataeTridentatae seriphidium tridentataeTridentatae greger 1978 held north american seriphidium of some treat- a similar if less formal view representative ments whereas holbo and mozingo 1965 species from the 3 subgenerasubgenera that occur in and geissman and irwin 1974 excluded it north america artemisia drancunculus tri likewise moss 1940 beetle 1960 hanks dentataedentatae were included in this study et al 1973 geissman and irwin 1974 and the 8 species 9 taxa including I1 subspecies mcarthur et al 1981 included A bigeloviibigelovii in of artemisia included in this study are 26726.7 tridentataeTrident atae hall and clements 1923 ward similar table 3 artemisia species cluster in 3 1953 holbo and mozingo 1965 shultz main stems in the phenograsphenogramphenogram fig 2 those 1986 and cronquist 1994 excluded it both stems correspond to the 3 subsubgeneragenera to which A pygmaeapygmaean and A bigeloviibigelovii can be included the species belong the only representative of within tridentataeTridentatae based on RAPD data fig subgenus drancunculus included is A spine 2 table 6 each taxon has more DNA marker scenssaens in our phenograsphenphenogramogram fig 2 it clusters similarity to some sister tridentataeTridentatae species with S potentilloides but at a relatively low than others eg A bigeloviibigelovii with A pygmaeapygmaean coefficient of similarity nuttall 1841 origi- and A cana sspasp viscivisciduladula A pygmaeapygmaean with A nally placed A spinescentspinescensspinescens in the monotypic cana sspasp viscivisciduladula and A dentatatritridentatatridentate sspasp vasey genus picrothamnuspicrothaninus the distant placement of ana our data do not support beetle s 1960 A spinescentspinescensspinescens from other artemisia in the phen suggestion that A nova is most closely allied ogram fig 2 is in line with bremer s 1994 to A pygmaeapygmaean statement that artemisia is knownknowirwiY to be a we subjected all tridentataeTridentatae taxa to t tests polyphyletic genus two subgenus artemisia in which each was compared with other mem- species were included A ludoludovicianaviciana and A bers of the group and with all non tridentatae michauxianamichaux iana and they form a rather tight artemisia taxa in this study with respect to group fig 2 table 6 percentage similarity based on DNA markers six taxa 5 species of the subgenus triden results data not shown gave a mean percent- tataehatae were included in this study A dentatatritridentatatridentate age similarity of 40540.5 16016.0igo among species of sspasp vastyanavaseyanavaseyana A t sspasp wyomingensis A nova tridentataeTridentatae in contrast species of the triden A cana sspasp viscivisciduladula A pygmaeapygmaean and A tataehatae were only 16116.1 171.7 similar to non tntritrl bigeloviibigelovii the latter 2 species have been con- dentataedentatae taxa t 676.7 p ooiool0010.01 A comparison sidered questionable members of tridentataeTridentatae of A spinescentspinescensspinescens with other artemisia species using various morphological anatomical gave an average percent similarity of 15615.6 303.0 8 GREAT BASIN naturalist volume 58

TABLE 5 interspecificintel specific similarity in the genus sphaeromenasphaeromeria each value in the table is an average based on 9 12 inde- pendent comparisons similarity is based on rapioraploRAPDRAPID markers species 1 SPPO SPAR SPCA SPDI SPRU nilN 3 3 4 3 3

S potentilloides S arargengenteateateu 158 S capitatecapitatacapitata 16416 4 24524.524 5 S diversidiversifoliadiverstfoliafolia 137 221 279 S ruthiaeruthian 133 223 159 353 speciesaspecies desdesignationsignitions SPPO sphaeroineriahphacromena potentilloidespotenhlloidef SPAR S argentargentiaergenargenargenteuargentcatetteuca SPCA S& capitatecapitatacap itata SPDI S diversidicersifohadiversifoliafolia SPRUSPKU S ruthiaeruthian 1nan N nuninunlgunlnumber ofot populations

A similar comparison between the 2 subgenus our research was to compare sphaeromeria artemisia species A ludovicianaludoviciana and A with tanacetum and all known sphaeromeria michauxianamichauxiana and other artemisia species gave chromosome counts are diploid n 9 powell a mean percent similarity of 15015.015iso 0 2322.33 the 2 et al 1974 mcarthur et al 1989 we think that subgenus artemisia species were 4434444.33 simisimlsimi- comparisons made here among the sphaero lar to each other table 6 these results and meria and tanacetum populations are appro- inspection of the values presented in table 6 priate and that lack of a comparison of the T support the integrity of the subgenerasubgenera as rec- bipinnatumbipinnatum complex with sphaeromeria is not ognized herein especially for subgenus tri- a critical omission dentdentataeatae which was more thoroughly repre- similarity BETWEEN GENERA the per- sented in the study than were the other sub cent similarity of DNA markers between the genera genera of interest is given in table 4 and fig- two tanacetum species were sampled T ure 2 these data support the established sep- vulgare and T boreale table 1 by DNA aration of the 3 genera when the genera are marker analysis they were 8898888.99 similar fig compared table 4 the percent similarity 2 table 4 which is as similar as populations between sphaeromeria and artemisia iso18018.0 of the same species for the other taxa sampled is greater than for other comparisons among in this study fig 2 table 3 and as similar as these genera 70707.0 similarity for both the sahaesphae conspecific populations in a similar study of romeria tanacetum and the artemisia tanace- portions of the genus ranunculus van buren tum comparisons these data are in full sup- et al 1994 both tanacetum species are widely port of the holmgren et al 1976 conclusion distributed in eurasia and T vulgare is natu- that sphaeromeria is more closely affiliated ralized in temperate north america hulten with artemisia than with tanacetum and fries 1986 some but not all authors con- in the phenograsphenphenogramogram fig 2 the top group sider T boreale mainly an asian geographical consists of both sphaeromeria and artemisia variety of T vulgare hultenhulienhult6n and fries 1986 samples however they share relatively little and references in goldblatt 1981 1984 1985 similarity with each other 20 in contrast 1988 and goldblatt and johnson 1990 1994 the major group of sphaeromeria the and2nd our 2 study populations contrasted dramati- major stem of figure 2 and the balance of the cally in leaf morphology T vulgare had much artemisia samples the ard3rd and ath4th major finer pinnately dissected leaves unfortunately stems of figure 2 cluster well above the 20 we were unable to sample native north amer- similarity level that S potentilloides and A icanlean tanacetum material however all native spinescentspinescensspinescens are on the same stem fig 2 may north american species of tanacetum are mem- reflect their uniqueness in regard to species bers of the hexaploid n 27 T bipinnatumbipinnatum within their own genera as we have discussed complex powell et al 1974 kyhos and raven in the previous section rather than common 1982 whereas numerous chromosome counts phylogeny for those 2 taxa the ard3rd major stem for T vulgare and T boreale have shown these of figure 2 consists of samples of subgenus taxa to be exclusively n 9 diploidsdiplodiploidyids federov tridentataeTridentatae this group is slightly more similar 1969 goldblatt 1981 1984 1985 1988 gold- to the main sphaeromeria stem than to other blatt and johnson 1990 1994 As one goal of artemisia and may therefore be an appropriate 199819981 RAPD contribution TO anthemideae TAXONOMY 9

TABLE 6 interspecific similarity in the genus artemisia each value in the table is an average based on 9 16 indepen- dent comparisons similarity is based on RAPD markers

SpeSpeciesciesaclesaelesa1 ARSP ARLU ARMI ARTRV ARTRW ARCAV ARNO ARPY ARBI abnilnbn11 4 3 4 3 1 2 1 2 3 ARSP ARLU 119 ARMI 104 443 ARTRV 180 174 183 ARTRW 154 156 144 707 ARCAV 182 157 177 509 400 ARNO 164 165 171 604 684 489 ARPY 161 125 141 354 341 373 339 ARBI 184 145 141 236 221 276 236 303

species designations ARSP artharternisiaartemistaartemishaArteArtermistanisianisla spinescensspinescentspinesspmescenscens ARLU A ludovicianaludovtcianaludoviciana ARMI A michamianamichauxtanamichauxmichmichauyamianalanatana ARTRARTRV A dentatatntritrltridentatatridentate sspasp vastyanavasevaseyanayana ARTRWARTR A t sspasp wyommgenstiwyo ingensis ARCAARCAV A cana sspasp cisctdulaviscivisciduladula ARNO A nova ARPY A bygpygpygmeaea ARBI A biglovbigloviibiglovuii 11nN number of populationspopulkopul irionsitions

place to look for the closest relatives of sahaesphae 1979 of the principal anthemideae genera romeria although our expectation was that only artemisia achillea matricaria and tana- sphaeromeria should be closer to the less cetum have a natural north american distribu- woody A ludovicianaludoviciana complex tion willis 1973 bailey hortoriumHortorium staff 1976 mcarthur 1979 of these 4 genera artemisia anthemideae distribution is by far the most common and diversified in AND PHYLOGENY north america each of these generalgeneragenerao includ- ing artemisia has circumpolar distributions anthemideae is one of the more morpho- with much stronger diversification in eurasia logically and chemically specialized and phylo- than in north america this information is genetically advanced compositae tribes cron- consistent with our DNA marker data in sug- quist 1955 greger 1978 mcarthur 1979 zdero gesting that sphaeromeria is a distinct genus and bohlmann 1990 although the compositae aligned more closely with artemisia than with is one of the largest families of flowering plants other taxa it became an important part of the earth s flora relatively late in the mid tertiary raven and acknowledgments axelrod 1974 walenitzwagenitzWagenitz 1976 raven and axel- rod 1974 postulate an origin for the family in we thank ralph andersen paul evans northern south america because the primitive harald greger ralph moore joann mudge generalized tribes heliantheaeHeliantheae and mutisieae jeff ott ken redshaw darla sidles and john are concentrated there devore and stuessy twibell for assistance with various parts of this 1995 recently reviewed macromolecular data work zion national park personnel kindly cpdnacydna restriction site analysis rbcl sequence permitted and assisted our collection of plant data that support a south american and south- materials clyde blauer GK brown carl free- ern hemisphere ancestry for the family regard- man joann mudge leila shultz and an anon- less of its place of origin however the family ymous reviewer provided helpful reviews of rapidly in geological terms became estab- an earlier draft of the manuscript the work lished worldwide walenitzwagenitzWagenitz 1976 suggested was partially funded by US department of that the principal evolution and diversification agriculture CSREES competitive grant 91 in the family took place in xeric environments 98300615798300 6157 and by cooperative agreement and in tropical mountains in general the fam- INT 95013 RJVA between the intermountain ily s migrations were achieved when the conti- research station now rocky mountain re- nents were close to their present positions search station and brigham young university raven and axelrod 1974 the great eurasian the use of trade or firm names in this paper is and north african landmass is the center of for reader information and does not imply diversity for several tribes including anthemi- endorsement by the US department of agri- deae bailey hortoriumHortorium staff 1976 mcarthur culture of any product or service 10 GREAT BASIN naturalist volume 58

literature CITED 1985 index to plant chromosome numbers 1982 1983 monographs in systematic botany from the balleyBAILEYBAILLY HORIORIUMHORTORIUM stafestarrstareSTAFF 1976 hortus third macmillan missouri botanical garden volume 13 missouri publishing co inc new york 1270 appp botanical garden st louis 224 appp beelieBLLIICBEETLE AAA A 1960 A study of sagebrush the section tri 1988 index to plant chromosome numbers 1984 dentdentataeatae ofArofArtemisiatemma university of wyoming agricul- 1985 monographs in systematic botany from the tural station bulletin 368 university of wyoming missouri botanical garden volume 23 missouri laramie 83 appp botanical garden st louis 264 appp GOLDBLATT AND BESSEBLSSLRWS11 W S 1829 synopsis absinthiorum bulletin of the P DED E JOHNSON EDITORS 1990 index society imperial moscow 12191 219 265 cited in hall to plant chromosome numbers 1986 1987 mono- and clement below graphs in systematic botany from the missouri garden BONNIN I1 T HUGUET M GHERARDIGl IERARDI J M PROSPERI botanical volume 30 missouri botanical garden AND I1 OLIVERI 1996 high levels of polymorphism st louis 243 appp 1994 index to plant chromosome and spatial structure in a seifing plant species med- numbers 1990 icago truncatulatruncatula leguminosae shown RAPD 1991 monographs in systematic botany from the using garden markersmarkeismarkels amerleanamerican journal of botany 8384383 843 855 missouri botanical volume 51 missouri botanical garden st 267 appp branshawBRADSIIAWBRADSHAW HDH D JR SMS M WILBERT KGK G OTTO AND DWD W louis GREGER H 1978 anthemideae chemical pages SCHEMSKES IILMSKL 1995 genetic mapping of floral traits review 889 941 in B harborne and B L turner editors associated with productivereproductivele isolation in monkey in JB BL biology and chemistry of flowers mimulus nature 376762376 762 765 the compositae academic press new york BREMERBRLMCR K 1994 asteraceae cladistics and classification london and HALL H M timbeltimber press portland OR 452 appp HM AND FE CLEMENTS 1923 the phylogenetic method in taxonomy the american BULT C M KALLERSJOKALLLRSJO AND Y sunSUH 1992 amplification in north species of artemisia chrysothamnus and atriplex publication and sequencing of 16s18s from gel purified rdnaadna 326 carnegie washington washington total plant DNA plant molecular biology reporter institution of DC 355 1727217 272 284 appp HANKS D L E D MCARTHUR R STEVENSSTLVENS A CRONQUISI A 1955 phylogeny and taxonomy of the com- DL ED AND APP PLUMMER 1973 chromatographic characterization positae american midland naturalist 5347853 478 511 and phylogenetic relationships of artemisia 1994 asterales in A cronquist A H hohngrenholmgrenbohngrenHohn gren section tndentataetridentataeTridentatae research paper INT 141 USDA forest NHN H holmgren J L reveal and PK holmgren JL service intermountain forest and range experi- editorsediedltoistols intermountain flora volume 5 new york ment station ogden UT 24 appp botanical garden bronx 496 appp HOLBO HRH R AND HNH N MOZINGO 1965 the chromato- DAWSON IKI1 K K J cilClICHALMERSALMERS R WAUCIIWAUGH AND W POW- KJ graphic characterization Artemisiaofartemisiaof Artemisw section triden LLLELL 1993 detection and analysis of genetic varia- tataehatae american journal of botany 5297052 970 978 tion in horteumhorreum spontaneum populations from israel HOLMGREN AHA H LML M SHULTZ AND TK LOWREY 1976 using RAPD markers molecular ecology 21512 151 159 lsiisi sphaeromeriasphaeromena a genus closer to artemisia than to DEVOREDLVORE MLM L AND TFTE STEUSSEY 1995 place and the tanacetum asteraceae anthemideae Britbnttomabrittoniabrittaniatonia 28 birne of of the timetirne origin asteraceae with additional 255 262 comments on the calyceraceae and goodeniaceae HULTEN E AND M FRIES 1986 atlas of north european pages 23 40 in D J N hind C jeffrey and GXG V in DJN vascular plants north of the tropic of cancer 3 vol- pope ediedleditors toistols advances in compositae systematics umes koeltz scientific books germany gardens k6nigsteinkomgstemkenigsteinKomg stem royal botanic calcardensGaigal dens kew 1172 appp FLDEROV AAA A 1969 chromosome numbers of flowering federov JACCARD P 1912 the distribution of the flora of the alpine plants izdatelyvu naukbauk st petersburg reprint by zone new phytologist 113711 37 50 otto koeltz science publishers ger- koenigsteinKoenig stem JEFFREY CJC J 1995 compositae systematics 1975 1993 many 1974 928 appp developments and desideratadesideiatarata pages 3 21 in DJN GANG DRD R AND WEBER 1995 genetic variability DJ hind C jeffrey and GXG V pope editors advances in and relationships among ten populations of rubber compositae systematics royal botanic gardens rabbitbrushrabbitbrush ghrysothatnnuschrysothumntis nauseosus sspasp hololeucushololeucus kew determined by analysis RAPD of bulked genomic KARP A 0 SEBERG AND M BUIATTI 1996 molecular samples DNA botanical bulletin of Academia sinica techniques in the assessment of botanical diversity 361 8 annals of botany 7814378 143 149 GEISSMAN IRWIN gl ISSMAN TA AND MAM A 1974 chemical constitu- KYHOS DW AND PH RAVEN 1982 miscellaneous chro- and pages tion botanic affinity in artemisia 135 143 mosome counts in asteraceae Madromadronofio660 296229 62 in G benz and J santesson editors chemistry in LANNERR C T bryngelsson AND M gustafsson 1996 botanical classification proceedings of the twenty genetic validity of RAPD markers at the intra and fifth press nobel symposium academic newnewyoikyork interinterspecificspecific level in wild brassica species with n GOLDBLAIT P EDITOR 1981 index to plant chromosome 9 theoretical and applied genetics 93993 9 14 numbers 1975 1978 monographs in systematic LINLINJZANDKLINJJ ZZANDKAND K RITLAND 1996 construction of a genetic botany fromhiom the missouri botanical garden volume linkage map in the wild plant mimulus using RAPD 5 missouri botanical garden st louis 553 appp and isozyme markers genome 396339 63 70 1984 index to plant chromosome numbers 1979 LING YRY R 1995a the new world artemisia pages 255 1981 monographs in systematic botany from the 281 in DJNDJ N hind C jeffrey and GVG V pope editors missouri botanical garden volume 8 missouri advances in compositae systematics royal botanic botanical garden st louis 427 appp gardens kew 199811998 RAPD contribution TO anthemideae TAXONOMY 11

1995b the new world seriphidiumsenphidium besser fourr SHULTZ LML M 1986 taxonomic and geographic limits pages 283 291 in DJNDJ N hind C J jeffrey and GVG V artemisia subgenus tridentataeTridentatae beetle mcarthur pope editors advances in compositae systematics asteraceae anthemideae pages 20 29 in FDE D royal botanic gardens kew mcarthur and BLB L welch compilers proceedings MCARTHUR EDE D 1979 sagebrush systematics and evolu- symposium on the biology of artemisia and chryso- tion pages 14 22 in the sagebrush ecosystem a thamnus USDA forest service general technical symposium college of natural resources utah report INT 200 intermountain research station state university logan ogden UT MCARTHUR ED JE MUDGE R VAN BUREN WR SMITH JEjeggJFCCCC BURKE AND WL WAGNER 1996 inter- ANDERSEN SCS C SANDERSON AND DGD G BABBEL 1998 specific hybridization in natural populations of cyr randomly amplified polymorphic DNA analysis tandra gesneriaceae on the hawaiian islands evievlevi- RAPD of artemisia subgenus tridentataeTridentatae species dence from RAPD markers plant systematics and and hybrids great basin naturalist 581258 12 27 evolution 20061200 61 77 MCARTHUR EDE D AND APA P PLUMMER 1978 biogeography stockinger EJE J CAC A MULINIX CMC M LONG TS BRLT-BRET- and management of native western shrubs a case TIN AND AFA F IEZZONI 1996 A linkage map of sweet study of great section tridentataeTridentatae artemisia basin cherry based on RAPD analysis of a microspore naturalist memoirs 21192 119 243 derived callus culture population journal of hered- MCARTHUR EDE D CLC L POPE AND DCD C FREEMAN 1981 ity 8721487 214914 128 chromosomal studies of subgenus Trident of tridentataeatae TORREY J AND A GRAY 1843 artemisia and tanacetum evidence for autoautopolyploidy artemisia polyploidy american pages 393 504 in flora of north america volume 2 of journal botany 6858968 589 605 part 3 wiley and putman new york MCARTHUR E D AND SCS C SANDERSON 1985 A cytotaxo ED VAN BUREN R KT HARPER WR ANDERSEN D STAN- nomic contribution to the western north amerleanamerican nomic TON S SEYOUM AND J L ENGLANDENGEAND 1994 evaluat- rosaceous flora madronoMadrofioflo 322432 24 28 JL ing the relationship of autumn buttercup ranuncul- MCARTHUR E D SCS C SANDERSON AND KTK T HARPER ED us acnfonmsacrifonnis var aestaestivalisivalis to some close convenerscongenerscong eners 1989 expansion of the known distribution of the random amplified polymorphic DNA ameri- rare zion tansy sphaeromeriasphaeromena ruthiaeruthian asteraceae using can journal of botany 8151481 514 519 southwestern naturalist 3444134 441 443 WAGENITZ T 1976 systematics and phylogeny of the com- MOSS EHE H 1940 interxylerary cork in artemisia with ref- positae asteraceae plant systematics and evolution erence to its taxonomic significance american jour- 12529125 29 46 nal of botany 2776227 762 768 WARD GHG H 1953 artemisia section serphidium in north MUDGEMUDCE J WR ANDERSEN RLR L KEHRER AND DJ FAIR- america a cytotaxonomic study contributions of the BANKS 1996 A RAPD genetic map of saccharum dudley herbarium 4 155 205 officinaofficinarumofficmarumofficmarumrum crop science 36136236 1362 1366 4155 WEBER WA 1984 woody NuNUTTALLTrALL T 1841 artemisia and picrothamnus transactions the western north american sagesagebrushessagebrusherbrushes phytologiaphytologicPhytol 55 7 8 of the american philosophical society II11 73987 398 417 ogia 557 WILLIAMS C E AND D A ST CLAIR 1993 pheneticphrenetic rela- PERSSON K 1974 biosystematic studies in the artemisia CE DA Phenetic tionshipsships and levels of variability mantimamaktimamaritimamarimarltima complex in europe opera botanica 35 tion detected by 1 188 restriction fragment length polymorphism and ran- dom amplified polymorphic DNA analysis of culti- POLJAKOV PP 1961 artemisia pages 425 631 in VL komarov editor flora USSR volume 26 academy vated and wild accessions of lycopersicon esculenesculean of science moscow and st petersburg tum genome 3661936 619gig 630 POWELL AMA M DW KYHOS AND PH RAVEN 1974 chro- WILLIAMS JGKJjckG K MKM K HANAFEY JAJ A RAFALSKI AND SVS V mosome numbers in compositae X american jour- TINGEY 1993 genetic analysis using random ampli- nal of botany 6190961 909gog 913 fied polymorphic DNA markers methods in enzy- RAVEN PH AND DID I1 AXELROD 1974 angiosperm bio- mology 218704218 704 740 geography and past continental movements annals WILLIAMS JGKJ G K ARA R KUBELIK KJK J LIVAK JAJ A RAFAL- of the missouri botanical garden 6153961 539 673 SKI AND SVS V TINGEY 1990 DNA morphismspolypolymorphisms ROHLF ejFJ 1993 NTSY pc numerical taxonomy and mul amplified by arbitraryarbitiarylary primers are useful as genetic variatetivariatebivariatetitivanate analysis system version 1801 80 applied bio- markers nucleic acids research 18653118 6531 6535 statistics inc setaudetSetaudet NY WILLISJCWILLIS JC 1973 A dictionary of the flowering plants and RUSSELL JRJ R R HOSEIN E JOHNSON R WAUGH AND ferns ath8th edition revised by HKH K airy shaw cam- W POWELL 1993 genetic differentiation of cocoa bridge university press cambridge UK 1245 appp theobroma cacao L populations revealed by WOOLF C M 1968 principles of biometry D van nos- RAPD analysis molecular ecology 2892 89 97 trand co inc princeton NJ 359 appp RYDBERG PA 1916 artemisia and artemisiastrumArtemisiastrum north YEH ECDEC D KXK X CHONG AND CYANGRCYANGR C YANG 1995 RAPD american flora 3424434 244 285 variation within and among natural populations of SANDERSON SCS C S GOODRICH AND EDE D MCARTHUR trembling aspen populus tremultremuloidesoides michamichx from 1984 in A love IOPB chromosome number reports alberta journal of heredity 864544608645486 454 460 LXXXV taxon 3375733 757 758 ZDERO C AND R BOHLMANN 1990 systematics and evo- SANTOS JBJ B DOS J NIENHUIS P SKROCH J TIVANG AND lution within the compositae seen with the eyes of a MKM K SLOCUM 1994 comparison of RAPD and chemist plant systematics and evolution 1711171 1 14 RFLP genetic markers in determining genetic simisimlsimi- larity among brassica oleraceaoleroleraceaeacea L genotypes theor- received 19 march 1997 etical and applied genetics 8790987 909gog 915 accepted 28 august 1997 SEAMAN FCEC 1982 sesquiterpene lactoneslactones as taxonomic characters in the asteraceae botanical review 48 121 595 great basin naturalist 581 0 1998 appp 12 27

RANDOMLY AMPLIFIED polymorphic DNA ANALYSIS RAPD OF ARTEMISIA SUBGENUS tridentataeTRIDENTATAE SPECIES AND HYBRIDS

E durant McArthurMcarthuriArthurl1 joann mudge12mudgel23 3 reneerenge van Buren244 W ralph Andersenandersen2andersenn2 stewart C SandersoSandersonsandersonlsanderson1nl1 and david G Babbelbabbel12babbell2512 5

abstractABSIRACIARSTRACT species of artemisia subgenus tridentataeTridentatae dominate much of western north america the genetic variavarlavaria- tion that allows this broad ecological adaptation is facilitated by hybridization and polyploidization three separate studies were performed in this group using randomly amplified polymorphic DNA RAPD fifty seven lomer10 mer primers generated nearlyneailyneally 400 markeismarkelsmarkers from genomic DNA obtained from leaf tissue these studies were 1 a measure of the variability of plants within and between populations and between subspecies using 5 A ttltntrltridentata sspasp wyomingensiswyommgensis populations 2 A cana sspasp camcana populations and I1 A cana sspasp viscivisciduladula population 2 an examination of the hypothesis that tetraploid ax4x artemisia tntritrldentata sspasp vastyanavaseyanavaseyana derives de novo from diploid ax2x populations viavla polyploidyautoautopolyploidy and 3 an examination of the validity of the status of putative hybrids that have been produced by controlled pollination these latter hybrid com- binationsbinations A tntridentata sspasp tntritrldentata xaX A t sspasp vastyanavaseyanavaseyana A t sspasp wyomingensiswyommgensis x A tnpartitatripartitatripartitetripartita and A cana sspasp cana x A tntritrldentata sspasp wyomingensiswyommgensis were made to combine traits of parental taxa in unique combinations with possible man- agement application RAPD marker data were subjected to similarity and UPGMA clustering analyses RAPD markers weiewelewere effective in measuring genetic diversity at different systematic levels individual plants within a population were approximately 55 to 80 similar to one another populations within subspecies gave corresponding values of similarity pioploprobablybablybabiy a result of the combined effects of large population sizes and wind pollination the 2 subspecies of A cana were approximately 45 similar at least some 4xax populations of A tntritrldentata sspasp vastyanavaseyanavaseyana apparently derive de novo from 2xax plants based on thentheir being embedded in 2xax phenograsphenphenogramphenograrnogram groups thus reinforcing evidence that polyploidyautoautopolyploidy plays an important role in tndentataetridentataeTridentatae population biology two A ttltntrltridentata sspasp tntritrldentata x A t sspasp vastyanavaseyanavaseyana and A cana sspasp cana x A tntritrldentata sspasp wyomingensiswyommgensis of the 3 putative hybrid combinations were confirmed to include hybrids these hybrids may have potential in management applications additional use of RAPD technology combined with other tech- niques may be useful in delimiting genetic characteristics and in guiding artificial selection in the tndentataetridentataeTridentatae

key words artemisia Tridenttridentataetndentataeatae RAPD hybridization diploid tetraploid polyploid polyploidyautoautopolyploidy

subgenus tndentataetridentataeTridentatae artemisiaofartemiszaof is a group 1988 freeman et al 1991 1995 graham et al of plants centered on the landscapelandscape dominant 1995 messina et al 1996 wang et al 1997 A tntritrldentata complex there have been several an area of current interest among evolutionary treatments of this group ege g rydberg 1916 biologists hall and clements 1923 ward 1953 beetle randomly amplified polymorphic DNA anal- 1960 shultz 1986 cronquist 1994 we recog- ysis RAPD is yielding useful information nize 11 species and 13 subspecies mcarthur about the population biology classification and plummer 1978 mcarthur 1979 1983 1994 and genetic structure of plants williams et al goodrich et al 1985 rosentreter and kelsey 1990 1993 fritsch et al 1993 levi et al 1993 1991 winward and mcarthur 1995 the tri- santos et al 1994 van buren et al 1994 brad- dentdentataeatae are built upon polyploidization and shaw et al 1995 gang and weber 1995 yeh hybridization ward 1953 beetle 1960 hanks et al 1995 karp et al 1996 including the et al 1973 mcarthur et al 1979 1981 1988 nature and extent of natural and controlled winward and mcarthur 1995 hybrid zones hybridization huen and helentjaris 1993 see harnsonbarnsonhairlsonharrisonharrlson 1993 for summary and refer- bradshaw et al 1994 kennard et al 1994 ences between subspecies of A tntritrldentata are dean and arnold 1996 lin and ritland 1996 yielding information about the nature stability mudge et al 1996 smith et al 1996 daehler and dynamics of these zones mcarthur et al and strong 1997 this paper reports the use

ishrubshmlsaml sciences laboratory rocky mountain researchRe searchseaich station forestfoiest service united states department of agricultureAgricolture 735 N 500 E provoprove UT 84606 delaidepal20epartincritdepai tmcnt ofbotanyof botany and range science Brigbrigharnbi ighambighamhainharn ydungyoomyoumyoungnoung universityuniver sitsslissity provo UT 84602 lecent3presentlehent address department Agronomyofagronomyof atiatoAgi onomy and plant GenetgeneticsleilesiCi univeisityuniversity of minnesota st paul MN 55108 piePicpicsentplesentpinsent4presentsent address department ofot litelilelife science utah valley state college orem UT 8405884038 5prewntaddressleantregnilewnt addless college ofot osteopathic medicine westeinwestern university of health sciences pomona CA 91766

12 199811998 RAPD ANALYSIS OF ARTEMISIA SPECIES AND HYBRIDS 13 of genomic RAPD markers in better under- the 1991 92 growing season we extracted standing the nature of population variation DNA either from fresh material immediately polyploidy and hybridization in the triden after collection 3 h or from material that tataehatae by reporting on the results of 3 studies had been immediately frozen in liquid nitro- 1 DNA marker variation among populations gen and stored at ultra cold temperatures ofA dentatatritmentatatridentatatridentatethi sspasp wyomingensis and between 80c until the tissue was extracted DNA subspecies of A cana 2 DNA marker varia- analysis was performed on individual plants tion among diploid ax2x and tetraploid ax4x and on bulked population samples 5 8 plants populations of A dentatatritridentatatridentate sspasp vastyanavaseyanavaseyana in chromosome counts were made to assist in addressing the possible de novo origin of 4xax hybrid confirmation using the techniques de- populations and 3 DNA marker determina- scribed by mcarthur and sanderson in review tion of the status of putative artificial hybrids STUDY L1 we examined DNA marker vari- A tridentata sspasp dentatatritridentatatridentate x A t sspasp vasey ability in populations at 2 different taxonomic ana A tridentata sspasp wyomingensis x A tri levels table 1 first was the population level martitapartitapartita and A cana sspasp cana x A tridentata wherein we examined 5 different populations sspasp wyomingensis we have previously exam- of A dentatatritridentatatridentate sspasp wyomingensis the ind ined these problems using morphological char- level was between 2 subspecies of A cana 2 acteristicsacteristics mcarthur and welch 1982 free- populations of A cana sspasp cana and 1 popula- man et al 1991 1995 chemistry hanks et al tion of A c sspasp viscivisciduladula we used both indi- 1973 welch and mcarthur 1981 weber et al vidual plants and bulked samples for DNA 1994 and analyses integrating chemical and marker analysis morphological approaches mcarthur et al STUDY 2 we examined DNA markers from 1988 1992 graham et al 1995 messina et al 7 A dentatatritridentatatridentate sspasp vastyanavasevaseyanayana populations table 1996 wang et al 1997 A companion paper 1 fig 1 several locations where diploid ax2x addresses the use of RAPD analysis in the sys- and tetraploid ax4x populations of this taxon tematicste of artemisia and 2 sister genera grow parapatrically or sympatricsympatricallyally have been sphaeromeria and tanacetum mcarthur et al discovered mcarthur and sanderson in review 1998 some of those populations are included in this study table 1 fig 1 initially we thought the MATERIALS AND METHODS hobble creek location which includes plants from both the mesic canyon bottom habitat plant materials and the more xeric south facing slope habitat plant populations sampled and used in the included 2xax and 4xax populations however 3 studies together with their taxonomic affilia- additional cytological study mcarthur and tion are listed in table 1 we obtained these sanderson in review unpublished has shown plant materials from the following natural that the hobble creek location is essentially populations samples of natural populations 2xax with only an occasional 4xax plant present that had been propagated from seed in our we kept the hobble creek population in the greenhouse plantingsoutoutplantings of progeny from nat- study for additional comparison of A triden ural populations in experimental plots and tata sspasp vastyanavasevaseyanayana DNA markers common gardens and putative artificial hybrids STUDY 3 we examined DNA markers from grown in the greenhouse and at plantingoutoutplanting 3 artificial hybridization experiments table 1 sites the putative hybrid seed was obtained us- the ist hybrid is A dentatatritridentatatridentate sspasp dentatatritridentatatridentate x ing methods described previously mcarthur et A t sspasp vastyanavaseyanavaseyana including F and fg hybrid al 197919881979 1988 noller and mcarthur 1986 ie generations that have been studied and con- placing inflorescences with dehiscing anthers firmed as hybrids in morphological chemical in doubled pollination white bakery bags just and insect host contexts noller and mcarthur before anthesis of the maternal parent we re- 1986 mcarthur et al 1988 1992 weber et al moved pollination bags 3 wk later and collected 1994 messina et al 1996 richards messina seed before the heads shattered representative and mcarthur unpublished this hybrid com- voucher samples for all 3 studies are deposited bination was made in an attempt to better in the shrub sciences laboratory herbarium understand hybridization dynamics and com- SSLP leaves for DNA extraction and analysis bine traits palatability nutrient content growth were collected from individual plants during rates that might be favorable for large herbivore 14 GREAT BASIN naturalist volume 58

ta13leTABLE 1 location of sample collections outplanting sites and sample reference numbers taxon location and propagation information and sample reference number 1

STUDY 1 artemisia tntritrldentata nutt sspasp arco butte co ID W sns n october 1986 grown at Springspnngvillespringvilleville and wiomingensiswyomingensis beetle & young browns park outplanting sites 3 km S of dinosaur rio blanco co CO Mmsm&sas&s 1438 grown at Springspnngvillespringvilleville and browns park outplanting sites gordon creek 7 km W of spring glenn carbon co UT W U 019 grown at Springspnngvillespringvilleville and browns park outplanting sites 6 km N of kemmerer lincoln co WY Mmajm&jaj&j 1738 U 028 grown at Springspnngvillespringvilleville and browns park plantingoutoutplanting sites I1 km E ofwarrenof warren carbon co MT majm&j 1743 grown at Springspnngvillespringvilleville and browns paikpalkpark outplanting sites artemisia cana purshpuipul sh sspasp cana maybell moffat co CO msm&s 2120 grown in shrub sciences laboratory greenhouse sheridan sheridan co WY mo sns n 1972 msm&s 2128 grown at the snow field station artemisiaArtemisiasiu cana pursh sspasp viscivisciduladula cart creek daggett co UT mabm&b 2204 osterhout beetle s1udy2STU dy 2 artemisia tntritrldentata nutt sspasp right fork of hobble creek utah UT msm&sM as&s 2184 2185 grown at vastyanavaseyanavaseyana redbrydb beetle hobble creek and great basin experimental range outplanting sites 2xax 4 km E salinaofsalmaof canyon summit red creek sevier co UT msm&s 2149 grown at hobble creek and great basin experimental range outplanting sites 2xax 7 km E of salina canyon summit red creek sevier co UT msm&s 2148 grown at hobble creek and great basin experimental range outplanting sites 4xax pine valley washington co UT msm&s 2177 grown at hobble creek and great basin experimental range plantingoutoutplanting sites 2xax 8 km N ofstoastof st george E of snows canyon washington co UT msm&sM as&s 2189 grown at hobble creek and great basin experimental range outplanting sites 4xax tabernacle dome kolobdolob terrace zion national park washington co UT msm&s 1821a grown at hobble creek and great basin experimental range outplanting sites 2xax 4 km N ofvirginof virgin washington co UT msm&s 2191 grown at hobble creek and great basin experimental range plantingoutoutplanting sites 4xax STUDYS rudy 3 artemisia tntritrldentata nutt sspasp 12 km E of dove creek delores co CO Mm&pmapap&p U 076 vabav&ba 22 grown at tntritrldentata snow field station and hobble creek outplanting sites artemisia tntrltrityldentata nutt sspasp hobble creek canyon utah co UT m&pmap U 001 msm&s 1476214423631476 2144 23639363 vastyanavaseyanavaseyana redbrydb beetle gwimlGWi ML 21492 grown at hobble creek outplanting sites artemisia cana purshpuipul sh sspasp cana sheridan sheridan co WY mo sns n 1972 mas 2128 grown at the snow field station artemisia tnpartitatripartitatripartitetripartita redbrydb west entrance USU S sheep station dubois clark co ID mas 2082 paddock 31a USU S sheep station dubois clark co ID msm&s sns n august 1994 artemisia ttltntridentata nutt sspasp arco butte co ID W sns n october 1986 grown at Springspnngvillespringvilleville and wyorningensistuyomingensis beetle & young browns park outplanting sites 6 km N of kemmerer lincoln co WY majm&j 1738 U 028 grown at Springspnngvillespringvilleville and browns park plantingoutoutplanting sites initials toifortorfior lolleltoiscollectors aiealeare 13 david G babbel ba jerry R barkerbarkei G sherel goodrichcoddGood nch I1 gary L jorgensen L mont E lewis M E durant mcarthur Mmo stephen BU monsen P A peiryperry Plumplummeiplummetmei S stewart C sanderson V gordon A van epps W bruce L welch and wi alma H winward T1 lielleile U collection numbesrcferniimbei s leterlefer to seedandseebandseed and plant culture accession numbers maintained at the great basin experimental range ephraim UT for locations of tilctilethe outplanting sites see finnicfigure 1 199819981 RAPD ANALYSIS OF ARTEMISIA SPECIES AND HYBRIDS 15

WA 0 SH A

DU V

KE 0

MA A PG mdiSDI P adl UC

GC N

SCO

DC

patpvt

fig 1 locations of plant population native sites and of outplanting sites see table 1 for more detail outplanting sites BP browns park bureau of land management GB great basin experimental range rocky mountain research station and manti la sal national forest HC hobble creek utah division of wildlifeofwildlife resources PG pleasant grove uinta national forest SF snow field station rocky mountain research station division of wildlife resources snow college and utah state university agricultural experiment station SP Springsprmgvillespringvilleville utah division of wildlife resources UC upper colorado environmental plant center natural resources conservation service and douglas and white river soil conservation districts 0 2xax artemisia tntritrlfridentata sspasp vastyanavaseyanavaseyana HC hobble creek mapMm&pap&p U 000011 gwim&lgwi M al&l 21492 Mmasas&s 2184 2185 KT kolobdolob terrace msMm&sas&s 1821821a1aaa PV pine val- ley msm&s 2177 SC salmasalinasaima canyon msm&s 2149 0 4xax A t sspasp vastyanavaseyanavaseyana KT kolobdolob terrace msm&s 2191 PV pine valley msm&s 2189 SC salina canyon msm&s 2148 N artemisia tntritrldentata sspasp wyomingensis AR arco W sns n oct 1986 DI dinosaur msm&s 1438 GC gordon creek W U 019 KE kemmerer majm&j 1738 WA warren majm&j 1743 artemisia tntritrlfridentatodentata sspasp ttltntrltridentata DC dove creek mapm&p U 076 A artemisia cana sspasp cana MA maybell msmasm&s 2120 SH sheridan mo sns n 1972 msm&s 2128 A artemisia cana sspasp viscivisciduladula CC cart creek mabm&b 2204 V artemisia tripartitetnpartitatripartitatripartita DU USU S sheep station dubois msm&s 2082 sns n aug 1994 consumption mcarthur et al 1988 1992 31a of the US sheep station dubois idaho weber et al 1994 the and2nd putative hybrid as pollen donors the ard3rd combination is A combination is A t sspasp wyomingensis x A tri cana sspasp cana x A tridentata sspasp wyomingen martitapartita 4 different combinations involving the sis 3 combinations with A c sspasp cana from warren montana and gordon creek utah sheridan wyoming as the female parent and populations of A dentatatritridentatatridentate sspasp wyomingensis A t sspasp wyomingensis from arco idaho and as female parents and 2 A tripartitatripartitetrip artita popula- kemmerer wyoming as pollen donors these tions from the entry snow fence and paddock latter 2 putative hybrid combinations were 16 GREAT BASIN naturalist volume 58

designed to attempt to combine the drought DNA markers were amplified with either tolerance of A t sspasp wyomingensis with the amplitaq DNA polymerase or amplitaqampiitaq DNA root sprouting fire tolerant adaptation of A c polymerase stoffel fragment perkin elmer sspasp cana and A tripartitetripartitatrip artita mcarthur et al cetus norwalk CT both enzymes were used 1992 mcarthur 1994 artemisia dentatatritridentatatridentate to obtain different DNA bands with the same sspasp wyomingensis is not fire tolerant and primer because amplitaq tended to amplify much of its range has been usurped by alien higher molecular weight markers than did fire adapted weed species such as bromus tec stoffel fragment sobral and honeycutt 1993 torum mcarthur et al 1990 monsen and amplifications were performed according to kitchen 1994 williams et al 1990 as modified by mudge et al 1996 reagents for RAPD amplification DNA extraction and amplification were obtained from perkin elmer cetus and we extracted DNA from individual plants promega corp madison WI primers from or bulked samples using a method adapted operon technologies inc alameda CA and from delaporta et al 1983 after the tissue the university of british columbia biotechnol was ground to a powder in liquid nitrogen agyogy laboratory vancouver BQBC the reaction using a mortar and pestle about 1 151.5isls ml preparation was automated by means of a bio extraction buffer 10 mm EDTA ph 8008.00 50 mek 1000 work station beckman instruments mm nacl 100 alALzl 20 SDS and 5 AA 2 P mer inc fullerton CA each sample for amplifi- captocaptoethanolethanol per gram of plant tissue was cation had a total volume of 15 luljolAL amplifica- added and the mixture ground further one tions were carried out on 3 MJ research PTC miml portions of the homogenate were trans- 100 96 well thermocyclers MJ research inc ferred to 15 ml centrifuge tubes and incu- watertown MA with different programs for bated for 20 min at 68c in a water bath fol- amplitaq and stoffel fragment the ampil lowing incubation 500 filAL of 1 M potassium taqhaq program consisted of an initial denatura- acetate was added to each tube and the tubes tion step at 92c for 3 min followed by 48 mixed thoroughly we then incubated the sam- cycles of denaturation step at 86c for 1 min ples at 4cac for 20 min following incubation 36c for 1 min 45 sec and 72c for 2 min the samples were centrifuged at 14000 rpm once the 48 cycles were complete samples for 5 min the supernatant was transferred were held at 72c for 7 min and then stored at through micracloth to a clean micromicrocentrifugecentrifuge 4cac until electrophoresis minimum ramp times tube containing 500 julALju L of isopropanol the were used between each step the stoffel frag- tubes were mixed by gently inverting and the ment program consisted of an initial denatura- samples incubated overnight at 4cac to help tion step at 94c for 3 min followed by 40 precipitate the DNA fairbanks et al 1993 cycles of 96c for I1 sec a 05c s 1 ramp to because of the high amount of carbohy- 35c350c which was held for I1 sec a 03c030c s 1 drate obtained after the above extraction we ramp to 72c which was held for 1 sec and a performed a carbohydrate wash sederlofsederhofSederhof 02c s 1 ramp to 96c once the 40 cycles north carolina state university chapel hill were complete samples were held at 72c for personal communication all tubes containing 7 min and then stored at 4cac until electro- DNA from a particular plant or bulked sample phoresis were combined to form single pellets each DNA amplification products were sepa- pellet was resuspended in 700 julALju L of I1 M rated by electrophoresis in 20 X 25 or 20 X nacl and vortexvortexedvortexesed gently DNA dissolves in 40 cm 20 g L 1 14 low 2 EEO adaroseagaroseagarose the salt but carbohydrates do not the sam- FMC metaphor FMC productsbioproductsBio rock- ples were incubated at 4c40cac for 20 min and land ME gels with up to 28 lanes the entire then centrifuged at 14000 rpm for ca 5 min istlisol15 jultl sample plus 2 3 alALxl of bromophenol the resulting supernatant was added 11 to blue dye in glycerol was added to each lane propanolisoisopropanol and incubated overnight at 4cac to DNA size markers puc 19 207 biosynthesis aid DNA precipitation the DNA was pel- inc lewisvilleLewisville TX were added to at least 2 leted and washed with 70 ethanol dissolved lanes in each gel for reference and ease in in TE 10 mm tris ph 8008.00 1 mm EDTA scoring gels samples were electrophoresced ph 808.0 and stored at 20c200c until use at 150 V for 3 to 4 h at room temperature 199811998 RAPD ANALYSIS OF ARTEMISIA SPECIES AND HYBRIDS 17

gels were stained with 050.5os tgg ethidium always more similar to other plants in their bromide per ml in both gel and gel buffer own population than plants of the same taxon they were not staineddestainedde gels were visualized in other populations on a UV transilluminator and photographed the gordon creek utah and warren mon- with a camera system or they were viewed on tana populations of A tridentata sspasp byominwyomin a video imaging system that had greater resolu- gensis are less homogeneous than the other 3 tion and storage capabilities than photographic populations of A t sspasp wyomingensis arco methods have mudge et al 1996 amplified idaho kemmerer wyoming dinosaur col- bands were scored and recorded as presence orado bulked samples show that the 3 geo- or absence of bands of the same molecular graphically clustered populations dinosaur weight fig 2 bands of the same mobility colorado gordon creek utah and kemmerer were presumed to be homologous wyoming are slightly more similar to each another than to the more geographically iso- analysis of amplified DNA products lated populations arco idaho and especially warren 1 the NTSYS pc statistical software package montana figs 3 under the con- was used to analyze coded DNA markers rohlf ditions of our study individual plants within 1993 presence or absence of specific DNA populations were approximately 55 to 80 bands markers was analyzed for estimating similar in DNA markers all populations are at least 50 similar to each other for 1 percent similarity with jaccard s coefficient of except I outlying plant from warren montana 3 similarity jaccard 1912 using NTSYS pc ver- fig 2 populations ofA sspasp sion 1801.80 UPGMA clustering analysis NTSYS the cana cana were about 54 similar to each other whereas pc SAHN and a pheneticphrenetictic tree NTSYS pc phene those populations were only 45 similar to the TREE were generated to graphically show population of A cana sspasp viscivisciduladula included in the percent similarity among appropriate sam- the study fig 4 sheridan wyoming ples pheneticphrenetictic trees were constructed from the Phene population ofA c sspasp cana and the cart creek individual plant data except for the artemisia utah population of A c sspasp viscidulaviscidula are tridentata sspasp wyomingensis population study more homogeneous than is the MaybemaybellII col- in that study both individual plant and bulked orado population of A c sspasp cana the simi- data were used bulked data were not the larity between A cana subspecies is support- weighted they ie were treated analogously to ive of their conspecific affinity and placement a single plant samples 5 8 bulked included within the subgenus tridentataeTridentatae mcarthur et individual plants alal19981998 STUDY 2 comparisons of the 2xax and 4xax RESULTS populations of A tridentata sspasp vastyanavaseyanavaseyana are presented in the figure 4 phenograsphenogramphenogram as indi- fifty seven primers 3 24 study per pro- vidual plants in general as in study 1 indi- nearly duced 400 6 216 per study storablescorablescorable vidual plants for each population clustered on markers that were used to construct similarity the same stem all plants and populations for phenograms tables 2 3 figs 3 6 the primer this subspecies were 50 similar as was the and marker totals of table 2 are not additive case for plants and populations within sub- because 21 of the primers and as many as 150 species in study I1 results reveal 4 groups of the DNA markers were shared between or with 55 similarity fig 5 the top one com- among the separate studies prises the 11 salina canyon utah 2xax plants STUDY I1 figures 3 and 4 show individual 16 of the 21 hobble creek utah 2xax plants plant similarity within populations of A tri and I1 of the 11 kolobdolob terrace utah 4xax plants dentata sspasp wyomingensis A cana sspasp cana the and2nd group is composed of all 8 pine valley and A c sspasp viscivisciduladula among population utah 2xax plants all 12 pine valley 4xax plants similarity within each taxon and similarity and I111 I1 of the 12 kolobdolob terrace 2xax plants the between subspecies of A cana these results ard3rd one is composed of the 9 salina canyon 4xax are within expected ranges at those systematic plants 5 of the 21 hobble creek 2xax plants and levels van buren et al 1994 gang and weber 1 kolobdolob terrace 4xax plant the bottom group 1995 mcarthur et al 1998 individual plants comprises 9 of the 11 kolobdolob terrace 4xax plants within each population are generally but not and a single kolobdolob terrace 2xax plant these 18 GREAT BASIN naturalist volume 58

W CN CY IT LO E c c T C c C C E 0 c3ca c3ca c3ca c3ca 0 Q 0 0 0 D D 01 U U U U U C 0 0 0 0 0 u 4 c c C C a 0 0 a 0 a 0 a CL v L v L U CL U U U U U

owk4wk zouwop

artemisia cana

CN CN CNC ro 00oo M0 Tr IT r CN CN CN ro CO CO 1Ir 1 I-t CD D ft 00 0 OOC 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0C 0 X X X X X X X X X X X X X X X X X X X X X X X X CN N c4ca N c14 C 4 CN CN c14 chiche c4ca CN ir r T q 14 T r 14- 1 t T c c c c c c c c c C C c c 0 0 gg 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 c r c c c c c c a c c c c c c E a 0 0 0 0 0 0 0 a 0 0 0 E 0 0 a a 0 0 0 0 0 0 0 a E ouuuuuuuuuuuuouuuuuuuuuuuuo0 0 a 0 a a a 0 0 a a a U U 0 0 0 a 0 a 0 a D a 0 0 D 0 0 0 0 a a 0 a a D 0 0 CL V ln V V L U V cn LO V ln U 0 ln V V v n ln V ln ln V V tn

artemisia denatadentatatridenatatridentatetridentatatridenotadenoto sspasp vastyanavasevaseyanayana fig 2 photographs of gels top photograph of artemisia cana subspecies gel UBC 285 bottom photograph of artemisia tridentata sspasp vastyanavaseyanavaseyana 2xax and 4xax populations from salina canyon gel 598 triplicate plant samples are in lanes labeled 01 02 etc molecular marker lanes puc 19 207 are labeled results are consistent with geographic separa- the ist and and2nd groups 55 similar are 2xax tion fig 1 except for 2 kolobdolob terrace 4xax with the exception of the 4xax pine valley plants plants that are in the ist and third groups and a single 4xax kolobdolob terrace plant whereas the respectively rather than the fth4th4tb group fig 5 ard3rd and ath4th groups 54 similar are primarily 199811998 RAPD ANALYSIS OF ARTEMISIA SPECIES AND HYBRIDS 19

TABLE 2 number of primers and DNA marker bands used in separate studies no of no of study primers bands primer sourceslsoursourcesourcesacesaeesasl

STUDY I1 artemisia tntritrldentata sspasp wyomingensis populations 22b 149 operon UBC artemisiaartermsia cana subspecies 24 216 operon UBC STUDY 2 artemisia tridentata sspasp vastyanavaseyanavaseyana 2xax and 4xax 14d 133 UBC STUDY 3 artemisia tiitiltndentatadentato sspasp tntritrldentata X A t sspasp vastyanavaseyanavaseyana 11 19 operon artemisia tntritrldentata sspasp wyomingensis x A tnpartitatripartitatripartitetripartita af4f4 15 operon UBC artemisia cana sspasp cana X A tntritrldentata sspasp wyomingensis 3839 6 operon UBC

30peron operon technologies inc UBC university of british columbia Bio technology laboratory bochboph 12 opaf06 opap01 opap03 APOR 03 apaw04 UBC 208 UBC 275 UBC 285 UBC 302 UBC 345 UBC 356 UBC 358 UBC 361 UBC 409 UBC 413 UBC 421 UBC 425 UBC 456 UBC 769 UBC 770 UBC 772 opap07 opaw04 UBC 208 UBC 270 UBC 285 UBC 302 UBC 341 UBC 356 UBC 358 UBC 361 UBC 413 UBC 421 UBC 534 UBC 536 UBC 542 UBC 571 UBC 584 UBC 585 UBC 595 UBC 598 UBC 769 UBC 770 UBC 772 dseeaseeee table 3 OPFOFFopp 19 opj04 opu03 OPUOFU 17 opw07 opw08 OPW 17 OPXOFX 12 opy01 opy02 OPY 10 fuscfubcBC 208 UBC 285 UBC 358 UBC 425 90pap 01 UBC 241 UBC 245

major groups are the A tridentata sspasp vase TABLE 3 primer name sequence and number of markers yana parent top the F and fg hybrids cen- generated from each used for amplification of sam- primer A ple DNA for study 2 ax2x and 4xax artemisia dentatatritridentatatridentate sspasp ter and the t sspasp tridentata parent near vastyanavaseyanavaseyana populations bottom the outliers are some A t sspasp tri dentata parent plants and especially F plants number faf2 primer jameanameaname primer sequence 5 3 of markers near bottom of top group and near bottom these results of a parent through f2F hybrid UBC 157 cgtgggcagg 11 fa generations give evidence of hybridization UBC 180 gggccacgct 12 UBC 199 gctcccccac 12 the parent plants are well separated in the UBC 457 cgacgccctg 5 phenograsphenphenogramogram fig 6 the faf1F and fg plants are UBC 459 gcgtcgaggg 8 closer to the maternal parent than expected UBC 515 gggggcctca 10 F hybrids do however show additional seg- UBC 540 cggaccgcgt 9 faf2 UBC 542 cccatggccc 9 regationre over the F plants as expected fig UBC 563 cgccgctcct 7 6 similarity values of figure 6 are less than UBC 584 gcgggcagga 16 others presented herein and in mcarthur et UBC 592 gggcgagtcc 5 al 1998 because we worked with taxon spe UBC 598 acgggcgctc 10 cificcefic markers to the that find UBC 601 ccgcccactg 10 extent we could UBC 615 cgtcgagcgg 9 them therefore the values should be consid- ered relative and not absolute 2 university of british columbia Biotechnology laboratory vancouver BC the other putative hybrid combinations A denatatritridenata sspasp wyomingensis x A tripartitatripartitetripartita and A cana sspasp cana x A dentatatritridentatatridentate sspasp wyomingensis 4xax with the exception of 5 hobble creek and 1 gave contrasting results data not shown the kolobdolob terrace 2xax plants A dentatatritridentatatridentate sspasp wyomingensis x A tripartitetripartitatripartita STUDY 3 DNA marker similarities among combination was not successful all female the putative hybrid plants and their parents parent plants N 10 progeny of self polli are illustrated in figure 6 the ist hybrid com- natedbated control plants N 7 and putative bination A tridentata sspasp tridentata x A t hybrid plants N 15 clustered in I1 stem sspasp vastyanavaseyanavaseyana which had been confirmed by above 50 similarity whereas pollen parents previous studies mcarthur et al 1988 weber 2 different A tripartitatripartitetripartita populations each N et al 1994 messina et al 1996 yielded 3 6 clustered in a separate group above 40 major groups plus several outliers fig 6 the similarity the 2 groups are only about 22 20 GREAT BASIN naturalist volume 58

0500.50 0700.70 090ogo

arco individual plant 019 arcoaccoanco individual plant 060 arco individual plant 091 arco individual plant 072 arco bulk sample

arco individual plant 131 gordon creek individual plant 059 gordon creek individual plant 070 gordon creek individual plant 093 dinosaur individual plant 001 dinosaur individual plant 004 dinosaur individual plant 002

dinosaurr individual plant 003

dino au r bulkbuik samplesampie dinosaur individual plant 005 kemmerer individual plant 005

gordon creek individual plant 00ool0017011 gordon creek bulk sample gordon crekcreek individual plant 002007OOZ gordon crecreekk individual plant 003 kemmerer individual plant 119 L L kemmerer individual plant 160 kemmerer bulk sample kemmererre r individual plant 071 ammekmme Kkemmereramemme r e r individual plant 144 warren individual plant 141 warren individual plant 199 warren individual plant 047

warrenrren individual plant 109 wr Wwarrenren bulk sample gordon creek individual plant 079 gordon creek individual plant 139 warren individual plant 057

fig 3 Phenphenograsphenograrnphenogramogram produced using UPGMA clustering analysis NTSYS pc rohlf 1993 for 5 artemisia tridentata sspasp wyomingensis populations individual plants and bulked samples are included similar the A cana sspasp cana x A ttltntrifridentata discussion sspasp wyomingensiswyommgensis combination on the other hand yielded results that had several putative USE OF RAPD MARKERS the set of stud- hybrid plants intermediate in similarity to the ies reported herein adds weight to the evi- 2 parental stocks these results are corrobo- dence that RAPD markers are useful in sys- rated in part by cytological studies the A tematic problems at various hierarchical levels cana sspasp cana x A dentatattltntrltritndentatatridentatatridentate sspasp wyorningenwyormngen from individual plants to genera eg levi et sis combination yielded 6xax plants which would al 1993 santos et al 1994 van buren et al be expected in an 8xax A cana sspasp cana x 4xax 1994 gang and weber 1995 mcarthur et al A ttltntrltridentata sspasp wyomingensis combination 1998 and in hybridization problems including because both A ttltntrltridentata sspasp wyomingensiswyormngensis hybrid zones and natural and artificial hybrid and A tripartitetripartita are 4xax cytological results are izatizationsions eg huen and helentjaris 1993 brad- not instructive in that combination meiotic shaw et al 1994 kennard et al 1994 dean and figures of this combination display numerous arnold 1996 lin and ritland 1996 mudge et multimultivalentsvalents especially quadriquadnvalentsquadrivalentsvalents as did al 1996 A tntritrldentata sspasp wyomingensis plants and GENETIC differentiation AT VARIOUS sy- other polyploid taxa in an earlier cytological stematic LEVELS the amount of genetic dif- study mcarthur et al 1981 ferentiation among individual plants within 199819981 RAPD ANALYSIS OF ARTEMISIA SPECIES AND HYBRIDS 21

040 050 060ogo 070 080 L franklin 1981 mcarthur 1989 further evievlevi- dence of the spread of tndentataetridentataeTrident atae pollen is sheridan I1 that during its fall pollination season triden sheridan 2 tataehatae sagebrush pollen counts are given sheridan 3 out by weather reporters to the public in areas

sheridan 5 removed from stands of plants for the benefit of those allergic to tndentataetridentataeTridentatahatae pollen sheridan 4 subspecies range from 25 A tntritrldentata mybellamybell 2 see fig 6 to 45 A cana see fig 4 similar- maybell 3 ity among populations which is generally

maybell 4 more similar than the between species simisimlsimi- laritieslarities reported in the genera ranunculus maybell 1 artemisia and sphaeromenasphaeromeria except for closely mabllmybll 5 related usually within same subgenus species cart creek I1 van buren et al 1994 mcarthur et al 1998

cart creek 5 the 25 value may be low because DNA markers were selected to contrast the sub- cart creek 3 species between genera similarity values in a cart creek 4 companion study mcarthur et al 1998 were cart creek 2 also lower 7 18 DE NOVO ORIGIN OF 4xax A TRIDENTATA ssrSSPSSE fig 4 phenograsphenogramPhen ogram produced UPGMA clustering using VASEYANA cytological evidence karyotypic analysis NTSYS pc rohlf 1993 for artemisia cana sub- species and populations individual plants are as follows structure and high multivalent frequencies in A cana sspasp cana sheridan individual plants 1 5 may- polyploidspolyploidy suggests that the tndentataetiidentatae include bell individual plants 1 5 A cana sspasp viscivisciduladula cart a high frequencey of polyploidyautoautopolyploidy mcarthur creek individual plants 1 5 et al 1981 DNA marker data fig 5 are use- ful inm addressing the hypothesis that 4xax popu- lations and plants that are adjacent or inter- populations as revealed by genomic DNA mixed with 2xax populations may be of de novo markers in this set of studies figs 3 6 is sim- in situ origin data suggest that the hypothesis ilar to that of populations determined by is at least partially correct the 4xax plants from bulked samples fig 3 van buren et al 1994 near pine valley fall within the same grouping gang and weber 1995 mcarthur et al in as the nearby 2xax plants from pine valley and review similarity between individual plants kolobdolob terrace fig 5 we suggest that these within populations is usually in the range of 4xax plants are of de novo origin from the local 50 85 an exception is in the A tridentata 2xax populations cytological evidence gives sspasp tridentata x A t sspasp vastyanavasevaseyanayana hybridiza- additional credence to this hypothesis as we tion study fig 6 where fewer subspecies have located 3 populations inm the pine valley contrasting markers were used and similarity area that are indistinguishable morphologically in hybrid and parental plants ranges from 20 and chemically boumanncoumarinumanncoumannco compound content to 100 most plants within populations of that but contain individual 2xax and 4xax plants study are above 50 in similarity but several mcarthur and sanderson in review since outliers are only about 20 25 similar to the other 4xax populations salina canyon and other plants in their populations kolobdolob terrace did not cluster tightly with we suspect that individual plants are as dif- adjacent 2xax populations they may not be recent ferent from one another within closely spaced autoploids however our studies show that all populations as populations within taxa are sampled A tntritrldentata sspasp vastyanavaseyanavaseyana plants are from one another because of the wind polli quite similar above 50 see fig 5 suggest- natedbated nature of the tridentataeTridentatae mcarthur et ing earlier or more distant polyploidyautopolyploidyauto as al 1979 1988 mcarthur 1989 in a wind pol the source of 4xax populations these 4xax popula- lination system pollen of landscape dominant tions have apparently dispersed given the plants is dispersed not only within populations evident intertwining DNA marker fig 5 but also between populations grant 1975 and geographic patterns fig 1 recently 22 GREAT BASIN naturalist volume 58

0500.50 0600.60ogo 0700.70 0800.80 0900.90ogo 1 WC 2xsc 1 2xsc 2xsc 1 2xsc r WC 2xsc 2xsc WC H 2xsc WC 4xkt 2xhc 2xhc I1 2xhc n 2xhc 2xhc j1 2xhc r 2xhc 2xhc 2xhc 2xhc 2xhc 4xhc 4xhc 1 4xhc 4xhc 4xhc 2xpv 2xpv 2xpv 2xpv 2xpv 2xpv H 2xpv 2xpv 4xpv 4xpv 4xpv L 4xpv 4xpv 4xpv 2xkt 4xpv i 2xkt 1 2xkt i 2xktKT 2xkt 2xkt H 2xkt 1 2xkt 2xkt 2xkt 2xkt 4xpv4 PV 4xpv 4xpv

1 4xpv 1 4xpv IASC 4xsc I 1 i 4xsc 1 4xsc 4 4xsc 4xsc 2xhc 2xhc 4xsc 30 4xsc 4xkt 2xhc 2xhc 2xhc 2xkt i 4xky 4xkt 4xkt 1 4xkt 4xkt raC4 4xkt siifsaif 4xk4xkt 4xkt hekt4xkthvkt 199819981 RAPD ANALYSIS OF ARTEMISIA SPECIES AND HYBRIDS 23 polyploidyautoautopolyploidy has been recognized as playing ful all putative hybrid progeny are similar to a more important role inm evolution in a wide their maternal parents array of plant species than has been tradition- these hybrid combinations aside from help- ally recognized ege g small 1985 bayer 1987 ing us better understand tridentataeTridentatae breeding Nesnessnessetalsetalet al 1989 lumaretlumaree et al 1989 van dijk systems were made for specific purposes et al 1992 soltis and soltis 1993 bretagnolleBretag nolle mcarthur et al 1985 1988 1992 mcarthur and thompson 1996 laushman et al 1996 1988 the A tridentata sspasp tridentata x A t we believe the data we present here give fur- sspasp vastyanavaseyanavaseyana combination has been extended ther credence to the importance of autopoloautopoly to the faf44 generation with the goal of maintain- ploidykloidy in tridentataetndentataeTridentatae ing the growth and woody biomass character- leafinessleakinessfiness RAPD contribution TO hybridization istics of the paternal parent and the lea oil STUDIES IN tridentataeTRIDENTATAE the tndentataetridentataeTridentafafatae are and palatability essential profile to large thought to have evolved through a pattern of ungulaungulatesungulatedtes of the maternal parent we are cur- geographic migration introgression and hybrid- rently evaluating those characteristics as well ization ward 1953 beetle 1960 hanks et al as the adaptation of the hybrids with respect 1973 mcarthur and plummer 1978 mcarthur to parental stock noller and mcarthur 1986 et al 1981 1988 thompson 1991 therefore mcarthur et al 1988 weber et al 1994 studies that contribute to the understanding of messina et al 1996 mcarthur unpublished hybridization processes in the group are needed the other 2 hybrids were made to combine to better understand the group s dynamic pop- the drought tolerance and widespread adapt- ulation biology and evolution our DNA marker ability of the landscape dominant A tridentatatridentate data are from 3 different hybrid combinations sspasp wyomingwyomingenisenis with the root sprouting fire these data confirm the hybrid nature of the A tolerance capabilities of A cana sspasp cana or dentatattltntritndentatatridentatatridentate sspasp tntritrldentata X A t sspasp vastyanavaseyanavaseyana A tripartitetripartitatripartita beetle 1960 mcarthur 1994 progeny previously studied by other techniques much of the natural range of A tridentata sspasp mcarthur et al 1988 1992 weber et al 1994 wyomingensis has been lost to cheatcheatgrassgrass and messina et al 1996 the segregation of RAPD other alien fire tolerant annual weeds mcarthur al 1990 monsen 1994 markers in F and fg generations is a pattern etct and kitchen the that can be explained as the consequence of successful F hybrids have been outoutplantedplanted hybrid segregation fig 6 our data also sup- and are apparently fertile we recently col- port a successful hybridization of the A cana lected filled seed additional evaluation of both successful is they sspasp cana x A dentatattltntrltritridentatetridentata sspasp wyomingensis hybrid lines necessary before combination seven of the 13 putative hybrid can be considered for wide scale planting plants examined for RAPD markers are inter- foreverMomoreverrever the use of such material should be critically evaluated by land managers and oth- mediate inm marker patterns in respect to their parents whereas 6 are similar to the maternal ers with interest in the wellbeingwell being of our land- parent these results are consistent with our scapes we have some previous results on hybridization wherein sub- discussed traits in triden stantivestantive fractions of the progeny of successful tataehatae species and hybrids that might be desir- hybrid combinations are indeed of hybrid ori-oriorl able to combine the location of such traits on gin and other substantive fractions are the re- a genetic map would be useful information sult of self pollinations mcarthur et al 1988 RAPD in concert with other molecular genetic the other hybrid combination A tndentata sspasp tools and additional hybrid stock could be to chromosomal locations as wyomingensis x A tnpartitatripartitatripartitetripartita was not success used document has been done with other plants eg penner et al 1993 bradshaw et al 1994 kennard et al 1994 santos et al 1994 1995 mudge et al fig 5 see facing page Phenphonogramogram produced using 1996 such information would also be useful UPGMA clustering analysis NTSYS pc rohlf 1993 for artemisia tntrifridentatadentato sspasp vastyanavaseyanavaseyana 2xax and 4xax populations in the ongoing work of understanding the individual plants are keyed as follows 2xax diploid 4xax dynamics of hybrid zones between the sub- tetraploid HC hobble creek KT kolobdolob terrace PV species of A tridentata mcarthur et al 1988 pine canyon see 1 valley SC salina figure I and freeman et al 1991 1995 weber et al 1994 table I1 for more detailed location information circled numbers eg D are the major groups discussed in the graham et al 1995 messina et al 1996 wang text et al 1997 24 GREAT BASIN naturalist volume 58

0250.25 0500.50 0750.75 1001.00

i HCOI hc07 hc04c04 1 hc03c03 1 hc06 1 hc10T ti1tiltia n hc15 J 1 hc05TT hc16 1 i T 11 hc08tfftotufto 1 P hc12c12 1 hc13HC 13 hc14c14 hc17 f08f208 hc02 hc09 piol flog D hc18 H 11 1 flogfog r f26figf226 1 f17f217 f20f220 1 f224p24 f19figf219 I1 fi04 f07fj07 1 f04f204 1 fi05f105 f207 1 filopilo f06f206fogpog H f234 1 1 1 f31f23 1 f27f227 pilipiilpil 1 f210 f114 1 f33f233 f23tat7 TT2 f12fz12 f228F 28

1.1 Ff1818 1 f221

1 foi i i Ff06foglog106 f03 a Ftat3 108asicsi f15f215 f25f225 f22f222 1 1 E I f23fz23 DCOI

1 dc03 J 1 FHf211 dc20 i dc07 fzlifzl3f213 1 f205p205

1 f113pily 1 f14f214 f202 f203 f12f112 1 fz30f230 1 dc04 L 3 1 dc13 1 dc06 d118Q dc05ri i 11 1 i i dfqdc08duq 1 dc16 i dc11 1 dc12

1 dc19 L E 1 f229 f216 i dc09 DCIO f02fi02 dc14 1 dc15 dc17 dc02 i f35f235 199819981 RAPD ANALYSIS OF ARTEMISIAARTEMZSIA SPECIES AND HYBRIDS 25

fig 6 see facing page phenograsphenogramPhenogram produced using BEETLE AAA A 1960 A study of sagebrush the section tri- UPGMA clustering analysis NTSYS pc rohlf 1993 for dentdentataeatae of artemisia university of wyoming agri- artemisia dentatattltntrltritndentatatridentatatridentate sspasp ttltntrltridentata x A t sspasp vastyanavaseyanavaseyana cultural station bulletin 368 university of wyoming including parental and F and fg plant populations indi- laramie 83 appp vidual plants are keyed as follows DC A t sspasp triden BRADSHAW HDH D JR M VILLAR BDB D WATSON KGK G OTTO tata parent plant dove creek HC A t sspasp vastyanavaseyanavaseyana S STEWART AND RF STETTLER 1994 molecular parent plant hobble creek F ist generation hybrid genetics of growth and development in populus III111 plant fg 2ndand generation hybrid plant circled num- A genetic linkage map of a hybrid poplar composed bers eg a are the major groups discussed in the text of RFLP STS and RAPD markers theoretical and applied genetics 8916789 167 178 BRADSHAW HDH D JR SMS M WlWILBERTLBERT KGK G OTTO AND DW SCHEMSKE 1995 genetic mapping of floral traits associated with reproductive isolation in mon keyflowerskeyflowers mimulus nature 376762376 762 765 acknowledgments bretagnolleBRETAGNOLLE FE AND JCJ C THOMPSON 1996 an experi- mental study of ecological differences in winter evaluation of plant materials was made pos- growth between sympatric diploid and autotetraploid sible by the generous cooperation of several dactylis glomerataglomerateglomerata journal of ecology 8434384 343 353511 CRONQUIST A 1994 asterales volume 5 in A cronquist landowners including the USDA ser- forest AHA H holmgrenHohngren NHN H holmgrenHohn gren JLJ L reveal and vice uinta manti la salsaisallsalosaio ashley fishlikefishlakeFishlake and PK holmgrenHohn gren editors intermountain flora new dixie national forests utah department of york botanical garden bronx 496 appp natural resources utah division of wildlife DAEHLER CCC C AND DRD R STRONG 1997 hybridization between introduced smooth cordcordgrassgrass spartina alter resources pittman robertson A recement W agreement9reement difloraniflora poaceae and native california cordcordgrassgrass S 82 R USDI bureau of land management foliosefoliosafoliosa in san francisco bay california USA amer- snow field station rocky mountain research icanlean journal of botany 8460784 607 611 station utah division of wildlife resources DEAN R AND J ARNOLD 1996 cytonuclear disequilibriadisequilibnadisequilibria snow in hybrid zones using RAPD markers evolution college and utah state university agri- 50170250 1702 1705 cultural experiment station cooperating upper DELAPORTA SLS L J WOOD AND JBJ B HICKS 1983 A plant colorado environmental plant center USDA DNA preparationminiminipreparation version II11 plant molecular natural resources conservation service and biology reporter 1191 19 21 white and douglas soil conservation FAIRBANKS DJD J ET AL 1993 efficient characterization of river biological diversity using field DNA extraction and districts cooperating and USDA agricultural random amplified polymorphic DNA markers review research service US sheep station the work brasil genetics igli161116 11 22 was partially funded by US department of FRANKLIN ECE C EDITOR 1981 pollen management hand- agriculture CSREES grant 91 book agriculture handbook 587 USU S department competitive of agriculture washington DC 98 appp 98300615798300 6157 and by cooperative agreement FREEMAN DCD C JHJ H GRAHAM DWD W BYRD EDE D mcarthur INT 95013 RJVA between the rocky moun- AND WA TURNER 1995 characterization of a nar- tain research station formerly intermountain row hybrid zone between two subspecies of big research station and brigham young univer- sagebrush artemisia tntritrldentata asteraceae iiiiliHI111 paul developmental instability american journal of botany sity we thank evans kim harper gary 82114482 1144 1152 jorgensen steve monsen dwain nelson jeff FREEMAN DCD C WA TURNER EDE D MCARTHUR AND JHJ H ott richard stevens julie tolman john GRAHAM 1991 characterization of a narrow hybrid walker and bruce welch for assistance with zone between two subspecies ofbigosbigof big sagebrush arte- misia tntritrldentata asteraceae american journal of various parts of this work clyde blauer GK botany 7880578 805 815 brown carl freeman leila shultz and an FRITSCH P MAM A HANSON CDC D SPORE PE PACK AND anonymous reviewer provided helpful reviews LHL H RIESEBERG 1993 constancy of RAPDBAPD primer of an earlier draft of the manuscript use amplification strength among distantly related taxa the of flowering plants plant molecular biology reporter of trade or firm names in this paper is for is illoilio111011 10 20 reader information and does not imply en- GANG DRD R AND DJD J WEBER 1995 genetic variability dorsementdorsement by the US department of agricul- and relationships among ten populations of rubber ture of any product or service rabbitbrushrabbitbrush chrysothamnus nauseosus sspasp hololeu cus determined by RAPD analysis of bulked ge- nomicnomie DNA samples botanical bulletin of academia literature CITED sinica 36136 1 8 GOODRICH S EDE D MCARTHUR AND AHA H WINWARD BAYER RJR J 1987 evolution and phylogenetic relationships 1985 A new combination and a new variety in arte- of the antennariaAntennana asteraceae Inuinuleaeleae polyploid misia tntritrldentata great basin naturalist 4510045 loo100 104 agamic complexes biologisches zentralblatt 106 GRAHAM JHJ H DCD C FREEMAN AND EDE D MCARTHUR 1995 683 698 narrow hybrid zone between two subspecies of big 26 GREAT BASIN naturalist volume 58

sagebrush artemiseATteArtemiattemisiaartemiswmisiamislasw tndentata asteraceae II11 selec- 351 in SSBB monsen and SGS G kitchen compilers tion gradients and hybrid fitness american journal proceedings ecology and management of annual of botany 8270982 709 716 rangelands general technical report INT GTR 313 GRANT V 1975 genetics of flowering plants columbia USDA forest service intermountain research sta- university press new york 514 appp tion ogden UT HALL HMH M AND FEEE CLEMENTS 1923 the phylogenetic MCARTHUR EDE D ACA C BLAUER APA P PLUMMER AND R method in taxonomy the north american species of STEVENS 1979 characteristics and hybridization of artemisia chrysothamnus and atriplex publication important intermountain shrubs III111 sunflower fam- 326 carnegie institution of washington washing- ily USDA forest service research paper INT 220 ton DC 355 appp intermountain forest and range experiment sta- HANKS DLD L EDE D MCARTHUR R STEVENS AND APA P tion ogden UT 82 appp PLUMMER 1973 chromatographic characterization mcarthur EDE D AND APA P PLUMMER 1978 biogeogra- and phylogenetic relationships of artemisia section phy and management of native western shrubs a tridentataeTridentatae research paper INT 141 USDA forest case study section tndentataetridentataeTridentatae of artemisia great service intermountain forest and range experi- basin naturalist memoirs 22292 229 243 ment station ogden UT 24 appp MCARTHURMGARTHUR EDE D CLC L POPE AND DCD C FREEMAN 1981 HARRISON RGR G 1993 hybrid zones and the evolutionary chromosomal studies of subgenus tndentataetridentataeTridentatae of process oxford university press new york and artemisia evidence for polyploidyautoautopolyploidy american oxford 364 appp journal of botany 6858968 589 605 HUEN M AND T 1993 ofofrapds helentjaris inheritance RAPIs MCARTHUR EDE D EME M ROMNEY SDS D SMITH AND PT geneti- in FFI hybrids of corn theoretical and applied TUELLER COMPILERS 1990 proceedings sympo- cs 8596185 961 968 sium on cheatcheatgrassgrass invasion shrub dieoffdiboff and other JACCARDJACLARD P 1912 the distribution of the flora of the aspects of shrub biology and management USDA alpine zone new phytologist 113711 37 50 forest service general technical report INT 276 KARP A 0 SEBERG AND A BUIATTI 1996 molecular intermountain research station ogden UT 351 appp techniques the assessment of botanical diversity in MCARTHUR EDE D AND SCS C SANDERSON in review catocyto annals of botany 7814378 143 149 geography and chromosome evolution of subgenus KENNARDKENNABD V WC K POETTER A DIJKdljkhuizendijkhuizenhulzenHUIZEN MEGLIC tndentataetridentataeTridentatae of Artemisia american journal of botany J E STAUB AND M J HAVEY 1994 linkages among JE MJ mcarthur EDE D SCS C SANDERSON AND WR ANDERSEN RAPD zyme disease and mor- RFLPRFLR isozymeiso resistance 1992 assay of controlled hybridization between pop- phphological markers in narrow and wide crosses of ulationsulations of sagebrush artemisia subsubgenusgerms endentriden cucumber theoretical and applied genetics 89 tataehatae using morphological chemical seed set and 42 48 DNA data american journal of botany 76 6 sup- LAUSHMAN R H A SCHNABEL AND L HAMRICK 1996 RH JLJ plement98plementplement 98 abstract 282 electrophoretic evidence for tetrasomic inheritance MCARTHUR EDE D R VAN BUREN SCS C SANDERSON AND in the dioecious tree macluramaciura pomporiferapomiferaifera ral schneid KTK T HARPER 1998 taxonomy of sphaeromenasphaeromeria arte- journal of heredity 8746987 469 473 misia and tanacetum compositae anthemideae LEVILLVI A L J ROWLAND AND J S HARTUNG 1993 produc- LJ JS based on randomly amplified polymorphic DNA tion of reliable randomly amplified polymorphic RAPD great naturalist 58 1 11 DNA RAPD markers from DNA of woody plants basin 581 MGARTHUR E D AND B L WELCH 1982 growth rate hortscienceHortScience 28118828 1188 1190 mcarthur ED BL differences among big sagebrush artemisia triden LIN J Z AND K RITLAND 1996 construction of a genetic JZ tata subspecies and journal of range linkage map in the wild plant mimulus using RAPD accessions management 3539635 396 401 and isozyme markers genome 396339 63 70 MCARTHURMGARTHUR E D B L WELCH AND D L NELSON 1985 LUMARET RCR C M BOWMAN AND TA DYER 1989 auto ED BL DL improved cultivarscult of sagebrushersagesagebrushesbrushes and polyploidy in dactylis glomerateglomerataglomerata L further evidence developing ivars pages from studies of chloroplast DNA variation theoreti- other composite shrubs 188 196 in JRJ R carl- cal and applied genetics 7839378 393 399 son and EDE D mcarthur editors proceedings sym- MCARTHUR EDE D 1979 sagebrush systematics and evolu- posium of range plant improvement selected papers tion pages 14 22 in the sagebrush ecosystem a presented at the 38th annual meeting of the society range manage- symposium college of natural resources utah state for range management society for university logan ment denver CO 1983 taxonomy origin and distribution of big MCARTHUR EDE D BLB L WELCH AND SCS C SANDERSON sagebrush artemisia tntridentata and allies subgenus 1988 natural and artificial hybridization between tridentataeTridentatae pages 3 13 in KLK L johnson editor big sagebrush artemisia dentatatntritrltridentatatndentatatridentate subspecies utah shrub ecology workshop I1 utah state univer- journal of heredity 7926879 268 276 sity college of natural resources logan MESSINA ejFJ JHJ H RICHARDS AND EDE D mcarthur 1996 1988 new plant development in range manage- vanablevariable responses of insects to hybrid versus parental ment pages 87 112 in PT tueller editor vegetation sagebrush in common garden oecologia 107513107 513 521 selencescience applications for rangeland analysis and man- MONSEN SBS B AND SGS G KITCHEN COMPILERS 1994 pro- agement kluwer academic publishers dordrechtDordrecht ceceedings ecology and management of annual range- boston london lands USDA forest service general technical 1989 breeding systems in shrubs pages 341 361 report INT GTR 313 intermountain research sta- in CMC M mckell editor the biology and utilization tion ogden UT 416 appp of shrubs academic press inc san diego CA MUDGE J WR ANDERSEN RLR L KEHRER AND DJ FAIR- 1994 ecology distribution and values of sage- BANKS 1996 A RAPD genetic map of saccharum brush within the intermountain region pages 347 officinarumofficinarum crop science 36136236 1362 1366 199811998 RAPD ANALYSIS OF ARTEMISIA SPECIES AND HYBRIDS 27

NESS BDB D DED E SOLTIS AND PS SOLTIS 1989 autopoloautopoly THOMPSON RSR S 1991 pliocene environments and cli- ploidykloidy in heuchera micrantha saxifragaceae amer- mates in the western united states quaternary sci- icanlean journal of botany 7661476 614 626 ence reviews 1011510 lis115 132 NOLLER GLG L AND EDE D MCARTHUR 1986 establishment VAN BUREN R KT HARPER WR ANDERSEN DJ STAN- and initial results from a sagebrush artemisia tntritrl TON S SEYOUM AND JLJ L ENGLAND 1994 evaluat- dentata mass selection garden pages 104 107 inm ing the relationship of autumn buttercup ranuncu- EDE D mcarthur and BLB L welch compilers proceed- lus acroacroformisacroforrmsformis var aestaestivalisaestivahsivalis to some close con ings symposium on the biology of artemisia and benersgeners using random amplified polymorphic DNA chrysothamnus USDA forest service general tech- american journal of botany 8152481 524 519 nical report INT 200 intermountain research sta- VAN DIJK P M HARTOG AND W VAN DELDEN 1992 sin- tion ogden UT gle cytotype areas in autopolyploid plantago media PENNER GAG A J CHONG M LEVESQUE LEMAY SJS J MOL- L biological journal of the linnean society 46 NAR AND G FEDAK 1993 identification of a RAPD 315 331 marker linked to the oat stem rust gene pg3 theo- WANG H EDE D MCARTHUR SCS C SANDERSON JHJ H GRA- retical and applied genetics 8570285 702 705 HAM AND DCD C FREEMAN 1997 narrow hybrid zone ROHLF ejFJ 1993 NTSYS pc numerical taxonomy and between two subspecies of big sagebrush artemisia multivariate analysis system version 1801 80 applied ttltntrltridentata asteraceae IV reciprocal transplant biostatistics inc setaudetSetaudet NY experiments evolution sigs519551 95 102 rosentreter R AND RGR G KELSEY 1991 xeric big sage- WARD GHG H 1953 artemisia section serphidium in north brush a new subspecies in the artemisia ttltntrltridentata america a cytotaxonomic study contributions of the complex journal of range management 4433044 330 335 dudley herbarium 41554 155 205 RYDBERG PA 1916 artemisia and atemisiastrum north WEBER DJ DR GANG SC HALLS BN SMITH AND american flora 3424434 244 285 ED MCARTHUR 1994 inheritance of hydrocarbons SANTOS JBJ B DOS J NIENHUIS P SKROCH J TIVANG AND in subspecific big sagebrush artemisia tntritrldentata MK SLOCUM 1994 compansonofrapdandrflpcomparison of RAPD and RFLP hybrids biochemical systematics and ecology genetic markers in determining genetic similarity 2268922 689 697 among brassica oleraceaoleroleraceaeacea L genotypes theoretical WELCH BLB L AND EDE D MCARTHUR 1981 variation of and applied genetics 8790987 909gog 915 monoterpenoid content among subspecies and acces- SHULTZ LML M 1986 taxonomic and geographic limits of sions of artemisiaofartemisia dentatatntritrltridentatatridentate grown in a uniform gar- artemisia subgenus tndentataetridentataeTridentatae beetle mcarthur den journal of range management 3440934 409 411 asteraceae anthemideae pages 20 29 in EDE D WILLIAMS JGKJ G K MKM K HANAFEY JAJ A RAFALSKI AND SVS V mcarthur and BLB L welch compilers proceedings TINGEY 1993 genetic analysis using random ampli- symposium on the biology of artemisiaofartemisia and chryso- fied polymorphic DNA markers methods in enzy- thamnus USDA forest service general technical mology 218704218918 704 740 report INT 200 intermountain research station WILLIAMS JGKJ G K ARA R KUBELIK KJK J LIVAK JAJ A RAFALSKI ogden UT AND SVS V TINGEY 1990 DNA morphismspolymorphismspoly ampli- SMALL E 1985 morphological differentiation in med- fied by arbitrary primers are useful as genetic mark- icago sattva s1ssa 1 in relation to ploidykloidy canadian jour- ers nucleic acids research 18653118 6531 6535 nal of botany 63174763 1747 1752 WINWARD AHA H AND EDE D MCARTHURMGARTHUR 1995 lahontan SMITH JEJFCCCC BURKE AND WL WAGNER 1996 inter- sagebrush artemisia arbuscula sspasp longilongicauliscaulis a specific hybridization in natural populations of cyr new taxon great basin naturalist 5515155 151 157 tandra gesneriaceae on the hawaiian islands evi-evievl YEH FC daxDXXD K X ghongCHONGCHONC AND R C YANG 1995 RAPD dence from RAPDBAPD markers plant systematics and variation within and among natural populations of evolution 20061200 61 77 trembling aspen populus tremultremuloidesoides michamichx from SOBRAL BWS AND RJ HONEYCUTT 1993 high output alberta journal of heredity 8645486 454 460 mapping of polyploidspolyploidy using PCR generated mark- ers theoretical and applied genetics 8610586 ioslos105 112 received 19 march 1997 soulssowisSOLTIS DED E AND PS SOLTIS 1993 molecular data and accepted 28 august 1997 the dynamic nature of polyploidy critical reviews min plant sciences 1224312 243 273 great basin naturalist 581 D 1998 appp 282837983737 bitterbrushBITTERBRUSH PURSHIA tridentatatridentateDENTATATRI PURSH GROWTH IN RELATION TO BROWSING

carl L WarnWamboltboltI1 W wyatt fraaslfraasafraas1 and michael R Frisina 2

ABSIRACIABSTRACT the objectives of this study were to compare vegetative and reproductive growth characters of bitter brush purshia tntritrldentatedentata pursh stands as they relate to browsing levels growth characters were measured on 10 eco- logically diverse stands in southwestern montana on which browsing ranged from 0 to 60 of all current annual long shoot LS gigrowthowthhowth Bitterbitterbrushbrush plants exhibited both twig level and plant level responses to browsing total bud density per plant was similar for browsed and unbrowsed sites but differed P ooi0010.010 01 between browsed and browsedununbrowsedunbrowned twigs browsed twigs produced one half the leaf cluster density produced by unbrowsed twigs no significant P 0050.050 05 rela- tiontionshipship between browsing levels on browsed plants and bud densities was found length of oldoid growth twigs per plant was shortershortel P 00010.0010 ooi001 on browsed sites than on unbrowsed sites burning at 2 environmentally paired sites reduced flower bud density P 00010 oolooi001 9 and 10 growing seasons later although LS length was not affected growth of LS showed a site by yeaiyear interaction P 0050 05 our data suggest that longtermlong term browsedununbrowsedunbrowned plants should not be used as a standard foiroirolfor comparison with normally browsed plants

key words purshia tntritrldentata bitterbitterbrushbrush browsing shoot growth bud development montana

antelope bitterbitterbrushbrush purshia dentatatritridentatatridentate guenther 1989 studied the environmental pursh well documented as a valuable food relationships ofbitterbrushofbitterbrushbitterbrush stands on montana source for big game animals kufeld 1973 fish wildlife and parks mount haggin wild- kufeld et al 1973 is highly palatable moder- life management area MHWMA in south- ately nutritious and common on many big western montana and noted the wide range of game winter ranges giunta et al 1978 al- habitats and stand growth guenther 1989 though it seems to be declining in some areas also found a high level of browsing on bitter winward and findley 1983 bitterbrushBitterbrush is brush plants and little successful reproduction found in a wide range of habitats franklin and during the previous decade wambolt et al dyrness 1973 and is useful as a ground stabi- 1996 compared some of the same MHWMA lizer on exposed soils nord 1959 therefore sites with 5 other southwestern montana loca- land managers are interested in its propaga- tions and found differences in crude protein tion growth and management to improve de- content by site graded wildlife habitat the specific objectives of this study were to known for its variability in habitat mor- compare vegetative and reproductive growth phologyphology and physiology bitterbrushbitterbrush ranges characters of 10 bitterbrushbitterbrush stands on and from prostrate forms only 10 cm high to colum- near the MHWMA and to relate them to nar forms over 3 in tall winward and findley browsing levels we hypothesized that plants 1983 color shape and size of leaves stems from nearby bitterbrushbitterbrush stands are not uniuni- and seeds vary between and within popula- form in their growth characteristics tions alderfer 1977 mowing and burning result in responses that range from death to METHODS vigorous sprouting clark et al 1982 while study sites these adaptations enable bitterbrushbitterbrush to inhabit widely divergent habitats in western north we chose 10 study sites primarily to repre- america they can also make management of sent bitterbitterbrushbrush stands from a range of enviedvienvi- the species more difficult unless the response ronronmentalmental conditions table 1 included were a of local populations is known burned site and sites protected from browsing

departmentdepaitment of animal and range sciences montana state university bozeman mt59717MT 59717 sontana2montana2mcomcmontana department offisliof fish wildlife and parks butte MT 59701

28 199819981 bitterbrushbltterbrushBITTER BRUSH GROWTH 29 all sites are located within a radius of 14514.5 km TABLE 1 topographic characteristics oftheodtheof the 10 study sites near and anaconda in southwestern data from the last 4 sites were obtained from guenther butte 1989 montana longtermlong term climatic records were available for the general study area from the elevation slope aspect 1 anaconda weather station at 1700 m elevation site m annual precipitation at anaconda averages butte 1730 26 234 340 mm with 47 received between april deeldeer exclosure 1830 12 225 exclosure 1830 16 and july NOAA 1991 cattle 188 cattle deer 1820 10 190 vegetation types at all but 3 sites burn burn 2010 22 200 unburn and high rye are seraiseral stages of the unburn 2010 22 200 bitterbitterbrushbrush bluebunchbluebunch wheatwheatgrassgrass agropyron Powerline 1640 16 85 spicatumspicatum pursh habitat type mueggler and willow creek 1780 31 110 railroad gulch 1650 32 115 stewart 1980 the dominant shrub is bitter high rye 1940 38 120 brush but understory vegetation is regressed primarily from grazing fraas et al 1992 on the other 7 sites from the described potential climax composition youtie et al 1988 we selected the butte site at maude S can- stock use on both sites resumed 15 september yon near butte montana because it receives 1982 no ungulate browsing the plant community four sites were located on the MHWMA consists of bitterbitterbrushbrush centaurea macumaculosamaculoselosa owned and managed by montana fish wildlife lam spotted knapweed ribes cereuecereum dougl and parks the werlinePopowerline site is on a slope 50 squaw currant and rosa woodsiiwoodsie lindl m above a perennial stream on the northeast woods rose edge of the MHWMA big game winter range at dry cottonwood creek in the Deerdeerlodgelodge the plant community consists of bitterbrushbitterbrush district of the Deerdeerlodgelodge national forest we and spotted knapweed the willow creek site studied a 2 part exclosure one portion known near the top of a grassy ridge 150 m above as the deer exclosure was game proof the willow creek supports a relatively large other half allowed deer use but served as a amount of elymus cinereuscicinereousnereus scribn & merr livestock exclosure and thus was known as the basin wild rye along with other perennial cattle exclosure near the exclosure we studied grasses and bitterbrushbitterbrush this area was used as a bitterbitterbrushbrush stand known as the cattle deer winter range by mule deer elk and moose site because it sustained both cattle and mule the railroad gulch site is also on the deer deer browsing these 3 sites have a scattered and elk winter range this site occupies a mid overstory of pseudotsuga menziemenziesiimenziesiasii mirbamirbj slope position 30 m above an intermittent franco douglas fir A large number of native stream where the plant community consists of perennial forbs occur in the understory on bitterbrushbitterbrush and spotted knapweed the high these sites rye site 1500 m higher in elevation than the to gauge the impacts of burning bitterbrushbitterbrush other MHWMA sites appears to receive the in southwestern montana we selected 2 sites greatest snowsnowpackpack the plant community on these sites burn unburn were environmen- the high rye site is typical of the bitter tally paired on both sides of a burn line on the brush rough fescue festuca scabrella torrey south flank of steep mountain 8 km northwest ex hook habitat type mueggler and stewart of butte in the butte district of the Deerdeerlodgelodge 1980 with those species currently dominant national forest the plant community on these guenther 1989 found the least amount of 2 sites is a bitterbrushbitterbrush mountain big sagebrush big game use at this location among the 4 artemisia dentatatritrltridentatetridentatattidentata nutt sspasp vastyanavaseyanavaseyana redbrydb MHWMA sites the MHWMA study sites re- beetle bluebunehbluebunchbluebunch wheatgrasswheatgrass association inter- ceived insignificant levels of livestock grazing mediate to the big sagebrush bluebunchbluebunch wheat sampling and analyses grass and bitterbitterbrushbrush bluebunchbluebunch wheatwheatgrassgrass habitat types of mueggler and stewart 1980 study sites typical of their communities were the prescribed burn was conducted 3 novem- delineated by five 15ism m transect lines placed ber 1981 after a year s rest from livestock graz- perpendicular to the slope at 3 m intervals ing on both sites to increase fuel loads live thus comprising a study plot of 15 X 12 m we 30 GREAT BASIN naturalist volume 58

recorded topographic information at each site ered regardless of availability to browsers to determining aspect by taking a compass bear- determine plant response to removal of a per- ing from the major slope measuring slope centage of total annual growth to relate to pre- with a clinometer and ascertaining elevation viously recommended use levels hormay 1943 from USGS topographic maps the informa- garrison 1953 martinsen 1960 lay 1965 tion from MHWMA sites was taken from urness and jensen 1983 browsing level analy- guenther 1989 ses were conducted by comparing the number we used the following definitions during of browsed and unbrowsed live LS on each the study bitterbitterbrushbrush plant a single stem or plant in the manner detailed by wambolt group of stems with a single point of origin 1996 browsed and unbrowsed twigs on a leaf cluster a bud which had produced a plant were each pooled across branches for group of leaves and which had not elongated comparison of browsing response on a plant 7 mm in length long shoot LS a bud level by combining plant averages we then structure that had elongated 7 mm in length created averages for the 10 sites in the current growing season and consisted of occurrence of unequal variances for com- a stem and attached leaf clusters flower a parisonsparisons as experienced by bilbrough 1990 bud which had produced a flower flowers with similar data required use of nonparamet grew only on 1 yr old or older stems ric statistical tests sokal and rohlf 1981 a two bitterbrushbitterbrush plants rooted within 1 m of wilcoxon signed rank test snedecor and each transect line were randomly selected for cochran 1989 for comparison of paired mea- measurements 10 plants per site we ran- sures such as the same plants between years domly chose 4 branches on each plant using a and a mann whitney rank sum test snedecor frame with 10 cm grids placed on top of the and cochran 1989 for comparison of group plant random numbers identified grid inter- means both at P 0050.05oos interactions between sections the closest live branch to a plumb years sites and treatments were analyzed with line dropped through the grid was sampled a multi factor analysis of variance snedecor on each sampled branch we recorded the fol- and cochran 1989 correlation was used to lowing age and length of each stem segment measure the relationship between some vari- length of LS number of flowers leaf clusters ables without a dependence relationship and LS apical bud status of each terminal LS snedecor and cochran 1989 comparisons segment was recorded as browsed within the between sites were based on least significant past year unbrowsed or dead flowers were difference LSD snedecor and cochran 1989 counted in early july and leaf clusters and LS at FP 0050.05oos least significant differences were were counted and measured in early septem- calculated as part of the analysis of variance ber we compared measurements only from for pairs of means such as site to site or year branch LS segments 3 yr old as little bud to year comparisons all statistical tests were activity occurred on older portions of the programs of the MSUSTAT statistical program branches to determine age we examined lund 1991 annual growth scars after an initial trial of comparing growth scars with growth rings RESULTS AND discussion these measurements were summarized across browsing effects all 4 branches sampled per plant to create a plant average for each category overall aver- at the 8 browsed sites the browsing level ages resulted from averaging the 10 plant ranged from 23 to 60 removal of all cur- averages for each of the 10 study sites 100 rent annual LS table 2 this range was with- plants in previously recommended levels for long- we observed each sampled branch for term health and maintenance of stands horhor- browsing use during the previous winter may 1943 garrison 1953 steinhoff 1959 mar- guenther 1989 found a high correlation r tinsen 1960 lay 1965 shepherd 1971 only 0940.940 94 FP 0 0001000010.0001 in measuring percent bitter 2 sites had less browsing the and2nd winter FP brush utilization by determining either per- 0050.05oos while the other 6 were browsed at centage of LS browsed or length of LS re- nearly the same level both years during 1990 moved thus we determined the percentage of the 8 sites were equally browsed but in 1991 total LS browsed all branches were consid some variation in browsing levels occurred 199811998 bltterbrushbitterbrushBITTER BRUSH GROWTH 31

TABLE 2 browsing level percent for 1990 and 1991 at total bud density per plant expressed as the study sites based on number of total long shoots LS the sum of the number of flowers leaf clus- removed ters and LS per unit length of stem was simi- site 1990 1991 lar for browsed and unbrowsed sites P butte oaix2qalx2 baz0azqaz 0100.10 fig 1 however total bud density did deer exclosure bax0axax orz differ at the twig level FP ooi0010.01 between cattle exclosure 45aw 39awxy browsed and browsedununbrowsedunbrowned twigs fig 1 browsed 55aw 54axyY cattle deer 54 plants had a lower flower bud density FP burn 484gawngaw 50soyY unburn 51aw 6161ay 00010.001 and higher LS bud density P ooi0010.01 Powerline siaw 4awxy40awxy than browsedununbrowsedunbrowned plants figlFigfigi 1 however at willow creek 5252aw 23bw the twig level fig 1 flower or LS densities gulch 53aw 37awxy railroad 53 similar between browsed and ununbrowsedunbrowned high rye 60awjoawqoaw 3bwx30bwx were browsed twigs pooled for all browsed sites browsedUnunbrowsedunbrowned irowow entries with similar lowercase letters ab are not significantly different wilcoxon test P 005oos0 05 twigs from browsed plants had lower flower P column entries with similar lowercase letters wxyz are not significantly dif- ooi0010.01 and higher LS P 00010.001 bud densi- ferent LSD P oos0 05 005 ties than twigs from browsedunbrowsedununbrowned plants this suggests that browsing affects both browsed among sites evaluation of browsing effects and unbrowsed twigs on browsed plants which should consider that post browsing LS length is a plant level response further density of represents the sum of each year s growth minus any of the 3 types of buds did not appear to the cumulative reduction by browsing in depend on actual level of browsing per plant addition to the direct effect of removing twig as 0 to 100 of terminal twigs were browsed material browsing might also affect length by on sampled branches on plants exposed to changing the potential for growth growth herbherbivoresivores with r 0070.07 P 0220.22 between potential might be affected by the ability of bud density and percentage browsed this the whole plant to grow or by the number or suggests that any degree of browsing affects type of buds available either for the whole flower and LS production on the whole branch plant or for individual twigs and probably on the whole plant

016olg b 0 browsed 014 N browsedunbrowsedunbrownedUn a 0120.12 a

C 010.1oi a b a E 0080.08 E a 4 M 0060.06 a im a a a 0040.04 b a 0020.02 b a

i 0 i I1 flowers leaf LS all buds flowers leaf LS all buds clusters clusters twigs plants

fig 1 average number of buds per mm of branch density by type of bud structure flowers leaves long shoots comparisons are between browsed and unbrowsed twigs on browsed plants n 8 and between plant averages from browsed n 7 and unbrowsed n 2 sites pairs ofsarsofbarsof bars with similar letters are not different mann whitney test P 005 32 GREAT BASIN naturalist volume 58

several researchers have attributed low although browsing levels table 2 were growth rates to whole plant effects on vigor statistically the same for the burned and hormay 1943 garrison 1953 or carbohy- unburned sites flower bud density was lower drate reserves menke and trlica 1983 and on the burned site table 3 than on the have recommended moderate browse levels or unburned site P 00010.001 leaf cluster and specific seasons of use tueller and tower LS densities were similar between the two 1979 reported a lower growth rate in rested sites P 0100.10 apparently unaffected 9 and or lightly used plants than in those that were 10 growing seasons after the fire fraas et al heavily browsed terming this a stagnation 1992 had earlier reported that bitterbrushbitterbrush on effect bilbrough 1990 found that clipped the burned site was significantly lower in bitterbrushbitterbrush was able to mobilize inactive buds canopy cover P ooi0010.01 flower production P for elongation and hypothesized that this 010.1oi and seed production P 010.1oi than on would eventually alter flower and LS ratios the unburned site because these 2 sites were although we could detect differences in bud adjacent and environmentally the same table density buds per unit length of stem between 1 including their management before and sites and treatments and could construct bud after the burn treatment it is logical to assume frequencies from this information we could that flower bud density was lowered by the not determine whether changes in frequency fire just as were the characteristics reported of flowers leaf clusters or LS were due to by fraas et al 1992 we could not find addi- variable densities before browsing or to bud tional burned sites to include in our investiga- differentiation after browsing tion therefore we are uncertain whether leaf cluster bud density was 49 lower on similar results would be the rule but our find- browsed twigs P 0050.05 than on unbrowsed ings indicate that a reduction in flower buds twigs fig 1 this decrease did not appear should be anticipated between browsed and browsedununbrowsedunbrowned plants or the dry cottonwood cattle exclosure site between browsedununbrowsedunbrowned twigs from browsed plants had lower total bud densities than the un and twigs from unbrowsed plants suggesting browsed deer exclosure site P ooi0010.01 where- that this leaf bud response occurred only on as flower bud densities table 3 were lower browsed twigs possible mechanisms for this P 00010.001 and LS bud densities were higher decline include increased mortality of leaf buds P 00010.001 in 1990 as were most other browsed either by physiological effects or by higher to unbrowsed comparisons although browse leaf bud density at the distal browsed end of levels table 2 were not significantly different the twig physiological effects could include P 0100.10olo between the dry cottonwood cat- physical or chemical damage due to browsing tle exclosure and cattle deer sites in 1990 or a change in resource allocation patterns with- the cattle deer site had twice as many LS in the plant to maintain flower and LS bud buds per unit length of stem table 3 other numbers at the expense of leaf bud numbers bud densities did not differ P 0050.05 between

TABLE 3 bud density buds per 100 mm stem for flowers leaf clusters and long shoots LS on all study sites in 1990 and 1991 the 2 unbrowsed study sites are at left bud deer cattle cattle power willow RR high type year butte exclexal exel deer bum unburn line creek gulch rye flower 1990 75117.511 696.969efygg 0404ayy oraby07abyoyaby 010.1oiol01ay 29bcdy l6abcy16abey 35edy353.5 22abcy22abey soysodeysos 1991 27cz 252.5 coayooay 07aby 01aby0 iyay 1ll11211112iazibz olyols 03abq3abz 04abz0 labz4abz 0olabzolabelabz leaves 1990 107107cyy 73ay737.3 81ahcy8 ly 779aby9 losy 97abcy9 7dbcy 89abeygqabcy 95aby95abcy looylooby losy 1991 663abevS 111 8989cy 6 7abyaaby67abey 5625.6256abz 41djaz4jaz qbcz62abc 8821cy21lcy 3535az 86bcy86bey 45a45az LS 1990 17abyltitsity y liay sy 6gieyley 464.646dy 32cdy 34cdy 33lbcyibey 221abcylabey 3obcy3 obey 1991 loloyloayy loay10 24ay24aby 35bedz35bcdz 23abz 26abcy2gabcy 47dey 37cdy 33bcz 606.0go irowrow entries with similar letters abeabcdefabcabcdeodeidef are not significantly different LSD P 0050 OS 2sitcsite entries with similar letters yz forfoihbl year pairspans aieare not significantly different wilcoxon test P 005oos0 05 199811998 bitterbrushBITTER BRUSH GROWTH 33 the 2 sites few differences for any type of buds ever because these differences were not always were found among browsed unburned sites or at the same sites the correlation between between the 2 unbrowsed sites table 3 number and average LS length was not signif- ogo growth icant r 12 P 0600.600 60 As discussed ear- lier fig 1 LS bud density was highest on we measured old growth branch length 3 browsed plants P ooi0010.010 01 however LS bud 2 and 1 yr old segments LS growth annual numbers fig 3 generally did not differ P growth and leaf weights leaf clusters total 0100.10olo0 10 between browsed and unbrowsed plants branch length of old growth twigs per plant largely because of longer branches on un fig 2 was considerably shorter on the 8 browsed plants fig 2 browsed sites than on the unbrowsed butte total LS length annual growth fig 5 was and deer exclosure sites P 00010.001 reflect- not significantly correlated to total branch ing the influence of browsing in modifying length r 0450.450 45 P 0130.130 13 across all sites branch length accordingly at the dry cotton- although the unbrowsed butte and deer ex- wood location the unbrowsed site had longer closure sites that had the longest branches branches than the cattle exclosure site P also had high total LS growth this total length ooi0010.01 with only deer browsing whereas the was not significantly P 0100.10olo0 10 longer than on cattle deer site had the shortest branches most browsed sites fig 5 FP 0050.05 total branch length per plant fig long shoot length per unit length of branch 2 at the burned and unburned steep moun- varied between several sites and sometimes tain sites did not differ P 0100.10olo which indi- between years fig 6 this growth rate gen- cates that the combination of growth and erally increased on the MHWMA sites power browsing table 2 was similar between these line willow creek railroad gulch and high sites for the previous 3 yr rye inm 1991 although all other sites decreased the number and length of LS produced neither total LS length fig 5 nor LS length varied by site and year with 3 sites having per unit of branch fig 6 differed between fewer LS fig 3 and 3 sites having longer P the burned and unburned sites although the 0050.05 LS in 1991 than in 1990 fig 4 how unburned site had significantly P 001 more

3000 w el 1990 N iggi1991 2500

2000 x a a 1500

b b Y b b b c c c b Y 1000 d d c z c d d Z 1 d 500 Z j i I z I1 0 butte deer cattle cattle & burn unburn parlinepwrlinepwriine willow RR high rye exclexal exclexal deer creek gulch

fig 2 average total branch length mm of 1 2 and 3 yr old twig segments for plants n 10 at all study sites the 2 unbrowsed sites are at left site to site within year differences LSD P 005Q 05 are denoted by columns with unlike letters abedabed 1990 wxyz 1991 the astenkasterikastena denotes a site that hadbad a year to year difference wilcoxon test P 005 34 GREAT BASIN naturalist volume 58

40 0199001991 35

a a 30 a z b z a 25 Y x b a a z y Y Y b z 20 x j Y 0 x z 6 am 15 b E z 10

5

0 butte deerdoer cattle cattlecattie & burn unburn parlinepwrline willow RR high rye exclexal exclexal deer creek gulchguich

fig 3 average number of long shoots LS per branch for plants n 10 at all study sites the 2 unbrowsed sites are atit left site to site within year differences LSD P 0050.05oos0 05 aieare denoted by columns with unlike letters ab 1990 cyzxyz 1991 only those sites denoted by an astenkasterikastena showed a year to year within site difference wilcoxon test P 005

ou80 eld19901990 M 1991 Y 70 X Y Z z Y z x z Y z 60S w w E d x x E a w v rc Yv b x 50 b a d 550- c c d b 0 d d c 1 W w J 40 1 1 a a CO b b sj a 40 a 030930 1 20

10

0 butte deer cattle cattle & burn unburn parlinepwrline willow RR high rye exclexal exclexal deer creek gulch

fig 4 average n 10 long shoot LS length total long shoot length divided by number of long shoots per branch foifolfor all study sites the 2 unbrowsed sites are at left site to site within year differences LSD P 0050.050 05 are denoted by columns with unlike letters abed 1990 wxyz 1991 only those sites denoted by an astenkasterikastena showed a year to year within site difference wilcoxon test P 0050.050 05 199819981 bitterbrushbltterbrushBITTER BRUSH GROWTH 35

2000uuu

1800 01991iggi1991 a 01990 a

1600 xK E x a xK x 1400 a x x Y 4 xK tm Y 0 y r 1200 a I1 iy j b a 0 a b 0 1000 b a c b OT 0tm 800 C 0 Y 3j 600 i 0 b h 400 200 I1 0 butte deer cattle cattle & bumburn unburn parlinepwrline willow RR high rye exclexal exclexal deer creek gulch

fig 5 total long shoot length mm per branch n 10 for 1990 and 1991 for all study sites the 2 browsedununbrowsedunbrowned sites are at left site to site within year differences LSD P 0050.05oos0 OS are denoted by columns with unlike letters ab 1990 cyzxyz 1991 only those sites denoted by an astenkasterikastena showed a year to year within site difference wilcoxon test P 005

4- 0 1990 N iggi1991 Y 35 z z

3 c x e25 Y E w w x 2 E b E b V 15 w a b b v a b b

a v a a

05

0 butte deer cattle cattle & burn unburn parlinepwrline willow RR high rye exclexal exclexal deer creek gulch

fig 6 long shoot LS length per length of branch mimmmmmm n 10 in 1990 and 1991 for all study sites the 2 unbrowsed sites are at left site to site within year differences LSD P 0050.050oos05 are denoted by columns with unlike let- ters abeabcabcabe 1990 vwxyz 1991 only those sites denoted by an astenkasterikastena showed a year to year within site difference wilcoxon test P 0050.05oos0 05 36 GREAT BASIN naturalist volume 58 bitterbitterbrushbrush fraas et al 1992 the fact that FRAAS WW CLC L WAMBOLT AND MRM R FRISNA 1992 pre- both the growth rate and the browsing level scribed fire effects on a bitterbrushbitterbrush mountain big sagebrush bluebunchbluebunch wheatwheatgrassgrass pages table 2 were the same at the 2 sites suggests community 212 216 in WP clary EDE D mcarthur D bedunah that browsers removed approximately the same and CLC L wambolt compilers proceedings of the amount of LS material from each branch at symposium on ecology and management of riparian each site shrub communities USDA forest service general at the dry cottonwood exclosure site LS technical report INT 289 ogden UT FRANKLIN JFJ F AND CTC T DYRNESS 1973 natural vegeta- length per unit of branch fig 6 was greater tion of oregon and washington USDA forest service on the cattle deer site than the cattle pacific northwest forest and range experiment exclosure site in 1990 as was the cattle exclo- station general technical report PNW 8 portland sure greater than the totally browsedununbrowsedunbrowned deer OR GARRISON GAG A 1953 effects of clipping exclosure that year P 0.010 01 tendency on some range ooi001 this shrubs journal of range management 63096 309 317 supports tuellertheller and tower s 1979 stagnation GIUNTA BCB C R STEVENS KRK R JORGENSEN AND AYA P theory which predicts relatively higher growth PLUMMER 1978 antelope bitterbrushbitterbrusbbitterbrush an important rates at higher browsing levels reinerrelnerremer and wildlandwildwindlandland shrub utah division of wildlife research publication urness 1982 also reported that livestock graz- 781278 12 GUENTHER GEG E 1989 ecological relationships of bitter ing increased bitterbrushbitterbrush growth by reducing brush communities on the mount haggin wildlife herbaceous competition during the growing management area unpublished master s thesis season montana state university bozeman overall we found only relatively minor vari- HORMAY ALA L 1943 bitterbrushBitterbrush in california USDA for- range the characteristics est service california forest and experiment ations in measured among station research note 34 berkeley CA browsed unburned sites or between the 2 un KUFELD RCR C 1973 foods eaten by the rocky mountain browsed sites however our data indicate a elk journal of range management 2610626 106log 113 fundamental difference in bud allocation pat- KUFELD RCR C 0OCC WALLMO AND C FEDDEMA 1973 terns between browsed and ununbrowsedunbrowned bitter foods of the rocky mountain mule deer USDA for- browsed est service rocky mountain forest and range brush plants and suggest that plants protected experiment station research paper RM 111 ft from browsing for many years should not be collins CO used as a standard for comparison with plants LAY DWD W 1965 effects of periodic clipping on yield of exposed to normal browsing pressures our re- some common browse species journal of range man- sults knowledge how agement 1818118 181 184 should increase of bitter LUND R 1991 MSUSTAT statistical analysis package brush responds to browsing an understand- microcomputer version 5005.00soo5 00 montana state univer- ing of the relationships between bitterbrushbitterbrush sity bozeman growth characters and management strategies MARTINSEN CFC F 1960 the effects of summer utilization should improve management for bitterbitterbrushbrush of bitterbitterbrushbrush in northnorthcentralcentral washington unpub- lished master s thesis university of idaho moscow stands and big game the winter ranges they MENKE JWJ W AND MJM J TRLICA 1983 effects of single and often occupy sequential defoliations on the carbohydrate reserves of four range species journal of range management acknowledgments 367036 70 74 MUEGGLER W AND WL STEWART 1980 grassland and shrubland habitat types ofwesternof western montana USDA we thank dr richard E lund of the depart- forest service intermountain forest and range ment of mathematical sciences montana state experiment station general technical report intaINTINTL university for assistance in conducting the 66 ogden UT statistical analyses NOAA 1991 climatological data montana 84 94 1 13 national climatic data center asheville NC NORD ECE C 1959 bitterbrushBitterbrush ecology some recent find- literature CITED ings USDA forest service pacific southwest forest and range experiment station research note 148 ALDLRIALDERFER LR JMJ M 1977 A taxonomic study of bitterbitterbrushbrush berkeley CA purshia dentatattltntrltritridentatetridentata pursh DC in oregon unpub- REINER RJR J AND PJ URNESS 1982 effect of grazing lished master s thesis oregon state university cor- horses managed as manipulators of big game winter vallis range journal of range management 3556735 567 571 BILBROUGH CJC J 1990 crowthgrowth responses of sagebrush SHEPHERD HRH R 1971 effects of clipping on key browse and bitterbrushbitterbrush to simulated winter browsing unpub- species in southwestern colorado colorado game lished master s thesis utah state university logan fish and parks division GFP R T 28 denver CLARK RGR G CMC M BRITTONBRIT TON AND FAEA SNEVA 1982 mor- SNEDECOR GW AND WG COCHRAN 1989 statistical tality of bitterbrushbitterbittelbrush afterabterarnelannelabher burning and clipping in methods iowa state university press ames eastern oregon journal of range management SOKAL RRR R AND ejFJ ROHLF 1981 biometry WH free- 3571135 711 714 man and co new york 1998 bitterbrushBITTERBRUSH GROWTH 37

STEINHOFF HWH W 1959 some effects of clipping bitter WAMBOLT CLL WW FRAAS AND MRM R FRISINA 1996 brush at different intensities pages 23 24 in trans- variation in bitterbrushbitter brush purshia dentatattltntrltritndentatatridentatetridentata pursh actions of the fourth annual summer conference of crude protein in southwestern montana great basin the centralgentral mountains and plains section of the naturalist 5620556 205 210 wildlife society WINWARD AHA H AND JAJ A FINDLEY 1983 taxonomic vari- TUELLER PJ AND JDJ D TOWER 1979 vegetation stagnation ations of bitterbrushbitterbrush pushiapurshia tridentata in oregon in 3 phase big game exclosures journal of range pages 25 31 in ARA R tiedemann and KLL johnson management 3225832 258 263 compilers pioceedingsproceedings of the research and manage- URNESS PJ AND CH JENSEN 1983 goat use in fall ment of bitterbitterbrushbitterbrusbbrush and clifcliffrosefrose in western north increasesinciincl eases bitterbitteibrushbitterbrushbrush biowsebrowse and reduces sagebrush america USDAUS DA forest selvleeserviceSeivice general technical density pages 186 194 in ARA R tiedemann and KLL report INT 152 johnson compilers proceedings of the research and YOUTIE BAA B GRIFFITH AND JMJ M PEEK 1988 succes- management of bitterbrushbitterbrush and clifcliffrosefrose in western sional patterns in bitterbrushbitterbrush habitat types in north north americaamenea USDA forest service general tech- central washington journal of range management nical report INT 152 4112241 122 126 WAMBOLT CLL 1996 mule deer and elk foraging prefer- ence for 4 sagebrush taxa journal of range manage- received 25 november 1996 ment 4949949 499 503 accepted 20 may 1997 great basin naturalist ssisst581 0 1998 appp 38 44 IDENTITY OF MERTENSIA oblongifolia NUTT G DON boraginaceae AND ITS ALLIES IN WESTERN NORTH AMERICA

ahmed M marfalwarfalwarfa1

ABSTRACTABS fraoFRAG r the current status of mertensia oblongifolia nutt G don and its allied taxa is surveyed on the bases of continuously coherent morphological characters andor regionally correlated variations more than 30 taxa including species subspecies varietiesvaneties and I1 forma previously considered different from M oblongifolia are now placed under synonymy of this species those taxa currently known as M fusiformis greene M bakenbakeri greene and M bakenbakeri var osterhouosterhoutiitii williams are among the new synonyms typification taxonomy and morphological problems ofmof M oblongifo lia are discussed

key words mertensia oblongifolia typification taxonomy morphology allied taxa

nuttall 1834 described and depicted pul represents an important additional morpholog- bonariajonanamonariamonana oblongifolia from a collection of plants ical feature in the taxon made by NBN B wyeth in 1834 chiefly inm the macbride 1916 also argued that M oblon valleys of the rocky mountains toward the bifoliagifolia had been misinterpreted he examined sources oftheodtheof the columbia river corresponding fragments of a specimen in the gray herbar- to present day states of idaho and wyoming ium GH which were labeled in dr craygray s As the linnaean species of pulmonaria hand M oblongifolia nutt ex sp wyeth 1753 in north america were placed within fisitmisit durand 1861 he noted that pedicelspedicels of mertensia roth 1797 FP oblongifolia nutt these fragments were very sparsely hispid calyx was transferred by don 1838 into mertensia divided nearly to the base the lobes 5 mm except for a few additions don maintained long linear lanceolate corolla tube glabrous nuttall s description of P oblongifohaoblongifolia for his within 10 minmm long limb 5 mm long filaments species and was followed by de candolleCancandolleadolle as broad and as long as the anthers style 1846 gray 1875 and coulter 1885 slightly exceeds he concluded that the mor- M oblongifolia was later treated as cerin phphologicalological characters of the fragments and thodeschodes oblongifolium nutt kuntze 1891 nuttall s description agreed perfectly williams kuntze s contemporary botanists such as nel- 1937124 also reported the abovementionedabove mentioned son 1899 1900 rydberg 1899 1900 and fragments in his monograph a fragment piper 1906 and subsequent workers on the marked in dr gray s hand is probably genus mertensia macbndemacbride 1916 johnston from the type specimen wyeth G the word 1932 williams 1937 higgins 1993 have rec- probably indicates doubt as to the identity of ognized M oblongifohaoblongifolia nutt G don as the the fragment and actually williams doubt correct name in fact cennthodescerinthodes oblongifol leads to lectotypification of the fragment lumtum has remained inadequately known since however the key problems in this study kuntze s time and seems never to have been concern the typification taxonomy and mor- mentioned again in the literature under mer- phology of the species questions that I1 have tensia species in north america examined in connection with a proposed revi- de candolleCancandolleadolle 1846911846 91 pointed out that M sion of the genus mertensia in north america oblongifolia was one of the least known species warfa in preparation of the genus mertensia but added no further pulmonaria oblongifolia was described by discussion however de candolleCancandolleadolle s report that nuttall 183443 as follows glabriuscula caule the leaves were more or less pubescent beneath simplici brectoerecto foliisfoldis lanceolatolanceolate oblongisoblongish

I1 monte L banbean lifsciemelillifeLif scienceselenceScieme museum Brigbnghainbrigharnharn young university provo UT 84602 USA present address 558 north redwood road 313 1 salt lake city UT 84116 USA permanent addressaddlessaddiess

38 199819981 IDENTITY OF MERTENSIA oblongifolia 39 obtusiusculis superiorsuperioribusibus acutis florflorinusfloribusibus tubudubu apparently rejected by rydberg 1922732 loso campanulatis paniculitispaniculatis pedicelpedicellatislatis caly who kept M longifloralongiflora a separate species cibusbibus abbreviatisabbreviates laciniis linearlinearibusibus acutis cili rydberg s position was later supported by atis nuttall s description implies that he had jepson 1925842 williams 1937136 davis seen a collection or a specimen with simple 1952592 and john 1956348 both williams erect and subglabrous stem etc in his foot- and john not only recognized M longifloralongiflora as note nuttall reported stem six to eight a species but also recognized a number of inches lower leaves commencing some dis- synonyms under this species however the tance above the base of the stem and all status ofofmM longifloralongiflora has remained at the spe- more or less pubescent above panicle formed cific level since then of axillary approximating clusters of flowers M foliosafoliose nelson 1899243 erected from corolla bright blue style somewhat exserted a collection made by evanston and again ten- nuttall thus explicitly stated that he studied a tattativelyively identified and distributed as M oblongi collection or at least a specimen with a com- folia was also placed in synonymy of M ob plete habit six to eight inches his careful longifolialongifolia by macbride 191618 19 macbride examination of the position of the lower leaves placed M hutansnutans howell M nevadensis A above the base of the stem and other nels M pubescentpubescenspubes cens piper and M hutansnutans subsp described features further confirms his posses- subcalvasubcalva piper together with M foliosafoliose in syn- sion of an entire specimen don 1838372 also onymy of M oblongifolia making 3 new com- mentioned a plant of 12 to 34 feet unlike bibinationsnations M foliosefoliosa var subcalvasubcalva howell both nuttall and don gray 187553 mac- macbrmacar M foliosefoliosa var nevadensis A nels bride 191617 and williams 1937123 appear macbrmacar and M foliosefoliosa var pubescenspubescentpubescens piper to have seen only the fragments of nuttall s macbrmacar except for a few modifications mac- specimen at the gray herbarium GH bride s synonyms under M oblongifolia were I1 have seen nuttall s plant collection at later supported by williams 1937123 125 british museum BM and the fragmentary 130 contrary to macbride rydberg 1922 specimen preserved at GH the same scraps 732 733 treated M foliosefoliosa and M hutansnutans as seen by gray 1875 macbride 1916 and different species from M oblongifolia simi- williams 1937 the fragmentary specimen is larly tidestromTidwidestromestrom 1925467 considered M very poor consisting mostly of dissected flow- nevadensis M folfoliosefoliosaiosa and M hutansnutans subsp ers and a single small leaf As correctly pointed subsubcalvacalva entities of their own and recognized out by macbride 1916 this fragmentary mater- pulmonaria oblongifolia as the only synonym ial is in accordance with nuttall s description under M oblongifolia and the type specimen besides macbride s observation on the rela- on the same sheet of the type specimen at tiontionshipship between M oblongifolia and M foli BM are 2 other non type specimens although osa nelson 1909 studied the affinities be- these 2 latter specimens were collected much tween M fusiformis greene and M congettacongestacongesta later and originate from different localities greene on the one hand and M bakeri greene they agree with M oblongifolia however as M laterifolialaterifolia greene and M amoena A nels duplicates of the type collection may possibly on the other based on these affinities nelson exist at the herbarium of kew gardens K established 3 new combinations M papipapillosapapillomallosa andor elsewhere I1 choose to designate the fusiformis greene A nels M lakenbakehbakenbakeri amoena specimen deposited at BM as a lectotype and A nels A nels and M bakeri laterifolialaterifolia the fragmentary specimen preserved at GH as greene A nels nelson then placed M capilpapil an isolectotype losa fusiformis under M papipapillosapapillomallosa greene the synonymy ofmof M oblongifolia has a long while M bakeri amoena and M bakeri laterifo complicated history mertensia longifloralongiflora lia were both placed under M bakeri he also greene 1898261 was based on a collection placed M congettacongestacongesta under M papipapillosapapillomallosa and M made by sandberg and leiberg in 1893 tenta- canescentcanescenscanescens redbrydb under M bakeri neiNelnelsonneisonsonss com- tively identified and distributed as M oblongi binationsbinations and synonymy arrangements were folia it was placed in synonymy ofmof M oblongi apparently rejected by both rydberg 1922 folia by piper 1906479 who was followed 734 1932 and tidestromTidwidestromestrom 1925467 who by macbride 191618 this synonymy was treated M bakeri M fusiformis M amoena 40 GREAT BASIN naturalist volume 58

and M laterifolialatenfolialatenlateritoliafolia as species while rydberg in this study As a result of this review I1 pres- placed M congettacongestacongesta under M fusiformis M ently treat the species M oblongifolia M bak- secundorumsecundorum cockerell under M laterifolialaterifohalaterifoliafoila eteri M fusiformis M folfoliosefoliosaiosa and M amoena as and made nomenclatural transfer of M well as most of their current synonyms as a canescentcanescenscanes cens into M cana redbrydb tidestromTidwidestromestrom placed single morphologically variable but allied group M panipaniculatepaniculataculata var aivalisnivalis S wats under M see taxonomic remarks and variations there- bakenbakeri As did both rydberg and tidestromTidwidestromestrom fore M oblongifolia is the only species recog- williams 19371001937 loo100 118 considered M lakeribakeri nized in this study while M fusiformis M and M fusiformis separate species each with a bakeri and M bakeri var osterhouosterhoutiitii williams number of synonyms contrary to rydberg are among its new synonyms williams placed M secundorumsecundorum under M although I1 have not yet examined the M lanceolatelanceolatalance olata pursh A DC and M latenfolialaterifolialatenlaterifolia longilongifloraflora type specimen sandberg & leiberg under M bakenbakeri s n at the herbarium of notre dame ND johnston 1932841932 84 85 aware of the strict its current synonyms such as M pulpulchellachella piper ecological relationship between M foliosefoliosa and 1906 M pulpulchellachella subsp glancaglauca piper 1906 its environments studied this relationship M comerihomeri piper 1906 M longifloralongiflora var homhorn carefully and affirmed that in response to the eri macbride 1916 and M longifloralongiflora var pul environment this species exhibited 3 phases chella macbride 1916 have been examined of morphological variation that correspond to and found to be closely allied to M oblongifo 1 M folfoliosefoliosaiosa 2 M foliosefoliosa var subcalvasubcalva and lia however as I1 have not consulted the type 3 M foliosefoliosa var amoena A nels johnston material of M longifloralongiflora these taxa are not respectively furthermore he provided a more included in this study both M longilongifloraflora and complete set of synonyms under each of these its synonyms will be placed either in syn- taxa and suggested that M foliosefoliosa var sub onymy to M oblongifolia or as infrainfraspecificintraspecificspecific calva was better named M foliosefoliosa var sub taxa to it calva f macbndeimacmacbrideibridei and M cusiccusickiicusicknkiikilkli piper and M praecox smiley currently placed under M eplicataeplicata macbride as M foliosefoliosa var amoena M oblongifolia is now considered different f cusickiicusickncusickii piper johnston M oblonobionoblongifoliafolia was from this species but rather close to M arizon A greene greene not mentioned in johnstonjohnstoisjohnstons s ica also M stenostenolobaloba 1901 in Johnstoisstots paper greene in his monumental work A monograph and M symphytoides 1901 both cur- of the genus mertensia in north america rently synonyms to M oblongifolia were not williams 1937 published the following new treated in this study because I1 was unable to combinations under M oblongifolia M oblon examine the type specimens of these taxa bifoliagifolia var nevadensis A nels williams and which are probably at the herbarium of ND as by M oblongifolia var amoena A nels williams indicated williams 1937126 130 andor elsewhere M M he recognized 26 synonyms under M oblon however praecox stenostenolobaloba and M symphytoides will be bifoliagifolia and its varieties williams 19371231937 123 treated together with the remaining taxa of the genus merten- 125 130 as did davis 1952592 higggshigginshiggms sia in north 1993881993 88 later found williams varieties of M america oblongifolia identical to the and placed species MATERIALS METHODS these infraintraspecificinfraspecificspecific taxa into synonymy AND the literature available despite extensive this paper is based on a study of herbarium on the genus mertensia in north america the type material obtained on loan from BM BRY identity ofmof M oblongifolia and its relationship CASGAS F GH ORE RM US and WILLU with M baken M fusiformis etc have received herbaria abbreviations according to holm- little attention lack of information exchange gren et al 1990 as well as all literature avail- andor discordant opinions among early con- able on the subject in addition I1 consulted a tributorstributors may have overshadowed the signifi- large set ofmof M oblongifolia collections deposited cance of this relationship among the taxa in at BRY and representing the states and coun- question ties in which the species occurs the purpose of this paper is to review all only well developed flowers nutnutletscutletslets and literature available on the abovementionedabove mentioned vegetative parts were used for measurements taxa and examine all type specimens of all taxa floral parts when small were measured 199811998 IDENTITY OF MERTENSIA oblongifoliaoblongifol1a 41 under a bausch & lomb tereostereomicroscopestereostereomicrosmicrosmicroscopecope ston contr arnold arb no 3853 85 1932 syn nov williams after softening in ethanol alcohol a ruler ann mo bot cardgard 2413024 130 1937 M oblongifolia var A L williams ann mo gard scaled in mm was used for measuring larger amoena nels LO0 bot in 2413024 130 1937 syn nov type locality montana madison plant parts county monida glen creek yellowstone park in this study I1 have generally followed tax- 16vi189916 VI 1899 nelson & nelson 5413 RM holotype BRY onomic concepts commonly used in taxonomic GH usisotypesUS isotopesisotypesiso types revisions based mainly on herbarium material M interintermediaintermedialmedia rydberg mem NYN Y bot cardgard 13351 335 1900 syn nov williams ann mo bot cardgard 24125 1937 I1 consider morphologically coherent to units type locality montana bridger mountains 17 18v1189718 VI 1897 be species if considerable intraspecific variavarlavaria- rydberg & bessey 4873 NY holotype not seen GH isoiso- tion is evident I1 generally discuss it under type taxonomic remarks and variations all syn- M congettacongestacongesta greene pipl baker 3173 17 1901 article not onyms are listed in chronological order under seen syn nov williams ann mo bot gard 2410024 loo100 1937 type locality poverty the species colorado ridge above cimarronCimanon 13vi190113 VI 1901 baker 129 ND holotype not seen GH RM usisotypesUS isotopesisotypesiso types gen M oblongifolia nutt G don hist 4372 M latenfloralaterifloralateriflorallatenlateriflora greene pipl baker 3183 18 1901 article not 1838 de candolleCancandolleadolle prodrproda 109210 92 1846 S watson USU S seen syn nov williams ann mo bot gard 24118 par geol eiplexpl 40th bot king s expedexpede 52385 238 1871 1937 M baken latenfloralate7lfloralatenfloraglora greene nelson coult & nels proc gray am acad 1053 1875 coulter man bot man ry mt bot 432 1909 syn nov williams 19371181937 118 rocky mt 262 1885 rydberg mem NY bot gard type locality colorado carson western colorado 1 336 gray N S 17 133619001336.19001900 macbride contr herb no 481748 21vii190121 vilVII igol1901 baker 334 GH hololotype RM US iso 1916 tidestromwidestromTid estrom contr USU S nat herb 2546725 467 1925 types williams ann mo bot cardgard 2412324 123 1937 davis fl M hutansnutans howell fl N W am 491 1901 article not idaho 592 1952 higgins utah fl 88 1993 pulmonaria seen syn nov williams ann mo bot gard 2412524 125 oblongifoliaoblongifoha nuttall jour acad nat sci phila 7437 43 1834 1937 M foliosefoliosa var subsubcalvacalva piper macbride contr G don gen hist 43724 372 1838 de candolleCancandolleadolle prodrproda 10 2 gray herb N S no 481848 18 1916 type locality oregon gen 1846 cerinthodescennthodes oblongifoliumoblongifohum nutt kuntze rev on high hills near Goldengoldendaledale IV 1878 20 IV 1882 how- pi pt 24362 436 1891 type locality idahowyomingIdaho Wyoming north- ell s n OREoreholotypeholotype ern andes towards sources of columbia river wyeth s n M coronata A nelson bull torr bot club 2940329 403 BM lectotype GHghi iso lectotype designated here 1902 syn nov williams ann mo bot cardgard 24125 1937 M panipanlpampaniculatapamculatapaniculateculata ait G don var aivalismvalisnivalis S watson USU S type locality wyoming sweetwater county 9v119009 VI 1900 par geol eiplexpl 40th bot king s expedexpede 52395 239 1871 nelson 7071 RM holotype GH ORE isotype syn nov M aivalismvalisnivalis wats rydberg mem NYN Y bot gard M cusiccusickiikii piper bull torr bot club 2964329 643 1902 13361 336 1900 syn nov type locality utah bear river syn nov williams ann mo bot gard 2413024 130 1937 M canyon villVIIIv11118691869 watson 844 ghiGH holotype fohosafoliosafoliose var amoena f cusiccusickiicusicknkiikil piper johnston contr M bakenbakeri greene Pitpittoniapitroniatonia 4904 90 1899 syn nov arnold arb no 385 1932 syn nov williams ann mo mo gard williams ann bot 24118 1937 type locality bot gard 2413024 130 1937 type locality oregon steinsteinss colorado southern colorado summit of mt hayden mts eastern oregon 18v1190118 VI 1901 cusick 2582 article 14v11189814 vilVII 1898 baker earle & tracy 576 ND holotype not specimen US holotype GH ORE RM isotopesisotypesisotypes seen GH RM US isoisotopesisotypestypes M nevadensis A nelson proc biolabiol soc wash 179617 96 M foliosefoliosa A nelson bull torr bot club 2624326 243 1899 1904 syn nov williams ann mo bot gard 24125193724125 1937 syn nov williams ann mo bot gard 24125193724 125 1937 type M foliosefoliosa var nevadensis A nels A nelson macbride locality wyoming southwest wyoming on the sagebrush contr gray herb N S no 481948 19 1916 syn nov slopes in the foothills 28v28v18971897 evanston 2951 RM williams ann mo bot gard 2412524 125 1937 M oblongifo holotype GH isotype haliailaiia var nevadensis A nels LOL 0 williams ann mo bot M fusiformis greene Pitpittoniapitroniatonia 4894 89 1899 syn nov cardgard 2412524 125 1937 syn nov davis 19525921952 592 higgins williams ann mo bot cardgard 2410024 loo100 1937 M papipapillosapapillomallosa 1993881993 88 type locality nevada hunter creek canyon 5 fusifonnisfusiformis greene A nelson coult and A nelson man miles west ofofrenoofredoreno 16v16 v19031903 kennedy & true 711 RM ry mt bot 421 1909 syn nov williams ann mo bot holotype gard 2410024 100 1937 type locality colorado bob creek M myosotifohamyosotifolia heller colo agr eapexp sta bull fl west la plata mountains 28v1189828 VI 1898 baker earle & colo 100292100 292 1906 article not seen syn nov williams tracy 206 ND holotype not seen F GH RM US iso ann mo bot gard 24118 1937 M lanceolatalanceolatelanceolata var types myosotifohamyosotifolia heller macbride contr gray herb N S M tubifloratubiflora rydberg bull torr bot club 2654426 544 no 481548 15 1916 syn nov type locality colorado eagle 1899 syn nov williams ann mo bot cardgaidgaldgard 24125 county red cliff 26v1190026 VI 1900 osterhout 2164 MO lecto- 1937 type locality wyoming big horn mountains head- type selected by williams not seen GH isolectotype waters of the tongue river vii1898vilVII 1898 tweedy 119 NY M hutansnutans subsp subsubcalvacalva piper contr USU S nat holotype not seen GH US isoisotopesisotypestypes herb fl wash 11479 1906 williams ann mo bot M amoena A nelson bot gaz 3019530 195 1900 syn cardgard 24123 1937 M foliosefoliosa var subsubcalvacalva piper nov williams ann mo bot gard 2413024 130 1937 M bak- macbride contr gray herb N S no 481848 18 1916 erien amoena A nels A nelson coult & A nelson man williams ann mo bot cardgard 2412324 123 1937 M foliosefoliosa ry mt bot 422 1909 syn nov williams ann mo bot var subsubcalvacalva f macmacbndeimacbrideibrideibridel macbrmacar johnston contr arnold gard 243024 30 1937 M foliosefoliosa var amoena A nels john arb 3843 84 1932 syn nov williams ann mo bot cardgard 42 GREAT BASIN naturalist volume 58

2412324 123 1937 type locality washington yakima region 050.5os 2545254.5 cm attenuated or tapering rarely rattlesnake mts 29iv190129 IV 1901 cotton 328 US holotype rounded at the base acuminate to obtuse GH RM isoisotopesisotypestypes rarely rounded at the apex entire scabrous or M pubescentpubescenspubescens piper contr USU S nat herb fl wash gla- 1147911 479 1906 non de candolleCancandolleadolle 1846 syn nov williams sparsely to densely ciliate at the margins ann mo bot gaidgaldgard 2413024 130 1937 M foliosefoliosa var pubes brous to minutely scabrous on both sides or cens piper macbrideMaemacbride conticontr glaycraygray herb N S no 481948 19 sparsely to densely pubescent above glabrous 1916 williams ann mo bot cardgard 2413024 130 1937 type to scabrous beneath or densely pubescent on county Waterville locality washington douglas waterville both sides midrib prominent petiole winged 23iv190023 IV 1900 whited 1214 US holotype ORE isotype M refracta nelson bot gaz 5669 1913 syn nov 6 12 cm long glabrous or pubescent all over williams ann mo bot caidgaidgaldgard 2411824 ilslis118 1937 type locality inflorescence congested becoming panicled Coloiacoloradodo wagon wheel gap 28vii28 vilVII 1912 griffin 139 with age with few branches to rather crowded RM holotype GH isotype formed of axillary approximating clusters of M epeplicataephcatalicata macbride contr gray herb N S no flowers pedpedunclespeduncleduncles up to 6 cm long pedipedicelscels 481648 16 1916 syn nov type locality idaho boise county dry buck 10v191110 vigli macbridemacbnde 856 RM holotype very slender and often drooping 1 10 mm long M nelsoniinelsonelsonianii macbride contr gray herb N S no glabrous or pubescent calyx divided nearly to 481948 19 1916 williams ann mo bot cardgard 2412324 123 1937 the base 3 8 mm long enlarging in fruit gla- type locality nevada elko county Jarjarbidgeharbidgebidge 9vii19129 vilVII 1912 brous or pubescent lobes 5 2 5 mm long nelson & macbride 1995 RM holotype GH isotype narrowly to lanceolate triangular acumi- M bakeri var subglabra macbndemacbride & payson contr linear craygraygiayherbherb N S no 496619174966 1917 williams ann mo bot nate to acute sparsely to densely ciliate or cardgaidgaldgard 2412324 123 1937 type locality idaho custer county hispid at the margins plant hermaphrodite josephus lakes 3viii19163 VIII 1916 macbride & payson 3544 flowers bright blue occasionally subtended by GH holotype CAS RM isoisotopesisotypestypes lanceolate foliar braatsbracts corolla tubular cam M oblongifolia vaivar nimbatammbata macbride contr gray panpanulateplanulateulate up to 15 mm long tube 5 12 X 3 mm heibhelbherb N S no 5318 1918 article not seen syn nov williams ann mo bot cardgard 2413024 130 1937 type locality lobes 4 5 mm long obtuse stamens attached montana bozeman 18v1893 Gottgottschalckgottschalchschalch s n GH at the throat of corolla free part of filaments holotype 2 4 mm long usually dilated crests or append- peck M cooperae torreya 3215132 lsiisi151 1932 article not ages in the throat between the bases of the fil- seen syn nov williams ann mo bot gard 2413024 130 10 at 1937 type locality oregon harney county 6 miles west aments conspicuous with a toothed ring ofofrileyriley VI 1922 cooper 11127 WILLU holotype GH the base of the tube anthers 121.2 2 mm long isotype oblong and straight style 10 mm long usually M bakenbakeri vaivar osterhouosterhoutnosterhoutiitiitiltn williams ann mo bot enclosed or somewhat exserted cutletsnutlets 3 mm gaidgaldgard 2412024 120 1937 syn nov type locality colorado long alveolar and white spotted strongly muri- giandglandgrand county sulphur springs 8vi19068 VI 1906 osterhout 3225 RM holotype GH isotype cate rugose distribution mertensia oblongifolia is perennial 10 50 cm tall with fairly woody widespread throughout the mountain and thick short erect or vertical rootrootstocksstocks usu- pacific states of north america ally branched at the summit roots numerous HABITAT M oblongifolia is known in slender fibrous intermingled with few large clumps and moist open slopes it is also found woody ones and the 1 several crowns closely on plains hillsideshillsides andor mountains with covered or clothed with dead brown leaf bases pine woods it has an altitudinal range from and dead petpetiolespetiolusioles stems I1 or more from each 7800 to 13000 feet 2377 3962 m elongated crown straight and simple ascend- TAXONOMIC REMARKS AND variations ing to erect slightly to fairly conspicuously mertensia oblongifolia is one of the most mor- striate or angled smooth or rough glabrous or phophologicallylogically variable species of the genus the densely pubescent with fine relatively long variation is probably correlated with geologi- spreading or closely appressed or crisped cal andor ecological responses the subconi- retroflexed hairs leaves alternate green thick cal to conical or shortly fascicled to cushion occasionally ample radical or lower leaves shaped or rarely tapering rootstock caudex commencing some distance above the base of of most type specimens of synonyms examined the stem few scattered petiolate the upper- supports such variation basal and upper leaves most numerous or crowded at the summit often monomorphic in shape size and pubes- sessile to subsessile with lamina linear lance cence for most synonyms ofm oblongifolia or olate to lanceolate oblong or spatulate to nar- rarely dimorphic in some type specimens such rowly oblong ovate rarely elliptic 3 12 X as M cusiccusickiikii cusick 2582 and M epeplicatalicata 199811998 IDENTITY OF MERTENSIA obloncifoliaoblongifolia 43 macbride 856 both at RM further confirm literature CITED this variation regarding the indumentum M oblongifolia varies from entirely glabrous to DE CANDOLLE APA P 1846 Borragineborragineaeae in APA P de can dolle prodromus systematissystematicSystematis natuialisnaturalisNatnaturalesuralis regni veg completely pubescent etastabilisetabilisbilis 10 parispans vernacular NAMES bluebell bluebelbluebellbluebluebellsbluebellebellsbelisbeilsIS cocCOCKERELLgerellKERELL TDA 1907 A new mertensia from colorado spindle bluebell western bluebell muhlenbergia 3683 68 1918 notes on the flora of boulder county colo- acknowledgments rado torreya 873177873 177 183 COULTER JMJ M 1885 manual of the botany of the rocky mountains ivison blakeman taylor and company this study has been performed entirely at new york and chicago the herbarium of the monte L bean life sci- DAVIS RJ 1952 flora of idaho brigham young univer- ence museum of brigham young university sity press provo UT DON G 1838 A general history of the dichlamydeous BRY I1 am deeply grateful to stanley L dr plants 4 longman and co london welsh curator of the herbarium for invalu- GRAY A 1875 contributions to the botany of north able advice instructive suggestions and con- america notes on boraginaceae pi oceoceedingsproceedingsedings of the structivestruc tive criticism of the manuscript I1 also american academy ofartsobartsof arts and sciences new series thank dr duane atwood assistant curator 104810 48 62 1886 synoptical flora of north america 2l21al 2ndand and staff of the herbarium for arranging all edition ivison blakeman taylor and company new loans to BRY york I1 express thanks to elder alexander morrimom- greene ELE L 1898 new or noteworthy species XXI pit son and dr ron gerrison both of the corpo- toniatoma 32573 257 263 president 1899 west american asperifoliae IV Pitpittoniapitroniatonia ration of the the church of jesus 4864 86 97 christ of latter day saints for constant inter- 1901 plantae bakerianaebakenanaeBakeBakeri anaenanae 3 washington est and encouragement and for first approach- HIGGINS LCL C 1993 boragmaceaeboraginaceae pages 66 92 in SLS L ing BYU concerning my research activities welsh et al editors A utah flora and2nd edition revised brigham young print provo similar thanks go to the dean of the college university services UT HOLMGREN PK NH HOLMGREN AND LC BARNEITBARNETT of biology and agriculture chairman of the 1990 index herbanorumherbariorumherbanorum part 1 the herbaria of the department of botany and range science world ath8th edition rignumregnum vegetable 120 and director of the life science museum all JEPSON WL 1925 A manual of the flowering plants of press of BYU for hosting my research and placing california university of california berkeley and los angeles all disposal necessary facilities at my JOHN HSH S 1956 flora of southeastern washington and of I1 am much obliged to directors and cura- adjacent idaho revised edition students book coigoigolcorgor tors of the herbaria mentioned under materi- horationporationporation pullman WA als and methods for loan of specimens JOHNSTON I1 M 1932 notes on various boralesborages of the west- united states contributions from the arnold references for the ern all literature or needed arboretum of harvard university 3833 83 98 work have been obtained through painstaking KUNTZE 0 1891 revisitrevisio generuagenerum Planpianplantarumplantariumplantaium2tarum 2 leipzig work by dr nathan M smith science librar- LINNAEUS C 1753 species Planplantarumplantariumtarum 1 edition 1 ian of the life science museum as well as the holmiae MACBRIDE F of staff of the harold B library of BYU JEJ 1916 the true mertensiasMertensias western lee north america I1 contributions from the clayglaycraygray herb- also many thanks are due my friends and arlumarium of harvard university new series 48148 1 20 colleagues at the monte L bean life science MACBRIDE JFJ F AND EBE B PAYSON 1917 new or otherwise museum for support and encouragement par- interesting plants from idaho IV contributions from ticularlyticularly douglas cox assistant director the gray herbarium of harvard university new dr series 496049 60 72 of the museum and Ms terry simmons mu- NELSON A 1899 new plants from wyoming VII bul- seum secretary for introducing me to comput- letin of the torrey botanical club 2623626 236 250 ers and related facilities 1900 contributions from the rocky mountain comments and suggestions on the final draft herbarium I1 botanical gazette 303189303 189 203 1902 new from bulletin of of the by C higgins of plants wyoming XIV manuscript dr larry the torrey botanical club 2940029 400 406 st george utah Ms joanne abel of the 1904 new plants from nevada proceedings of great basin naturalist and dr mats thulin of the biological society of washington 179117 91 98 uppsala university are appreciated 1909 in JMM coulter and A nelson editorsediedltois new financial support has been given by the manual of botany of the central rocky mountains vascular plants cincinnati and new york corporation of the president the church of 1913 contributions from the rocky mountain jesus christ of latter day saints herbarium XIII botanical gazette 56l6356156163 63 71 44 GREAT BASIN naturalist volume 58

NELSON A AND TDA COCKERELL 1903 three new 1904 studies on the rocky mountain flora XIIIXHL plants from new mexico proceedings oftheodtheof the biolog- bulletin of the torrey botanical club 3163131 631 655 ical society of washington 164516 45 46 1922 flora of the rocky mountains and adjacent NUHALLNUTTALL T 1834 A catalogue of a collection of plants plains hafner publishing co new york made chiefly min the valleys of the rocky mountains 1932 flora of the prairies and plants of central 01or northern andes towards the source of the colum- north america new york botanical garden new bia river Boragineboragineaeae journal of the academy of york natural science of philadelphia 7437 43 45 TIDESTROM I1 1925 flora of utah and nevada contribu- OSTERHOUT GEG E 1917 A new mertensia torreya 17 tions from the united states national herbarium 175 176 25725 7 635 PIPER CXC V 1902 new and noteworthy northwestern plants WATSON S ET AL 1871 botany in C king editor united VII bulletin of the torrey botanical club 2964229 642 646 states geological exploration of the fortieth parallel 1906 flora of the state of washington boragina- government printing office washington DC ceae contributions from the united states national WILLIAMS LOL 0 1937 A monograph of the genus merten- herbariumheiher bariumbarlum 1147211 472 486 siasla min north america annals of the missouri botani- ROTH AWA W 1797 catalecta botanica 1 leipzig cal garden 2417941724 17 159 RYDBERG PA 1899 new species from the western united states bulletin of the torrey botanical club received 7 may 1997 2654126 541 546 accepted 11 august 1997 1900 catalogue of the flora of montana and the yellowstone national park boraginaceae memoirs of the new york botanical garden 13261 326 337 great basin naturalist 581 0 1998 appp 45 53 astragalus leguminosae nomenclatural PROPOSALS AND NEW TAXA

stanley L welshlwelsh1welshel

ABSTRACT As part of an ongoing summary revision of astragalus for the flora north america project several nomenclatural changes are indicated nomenclatural proposals include A molybdenusmolybdenum var shultziorum barneby welsh comb nov A strahsauaustralis var aboriginorumabonginorum richardson welsh comb nov A australisaustrohsstrahs var cottonicottom MEM E jones welsh comb nov A strahsaustralisau var lepagei hulten welsh comb nov A australis var muneimurielmunet hulten welsh comb nov A subcinereussubcznereus var sileranussileranus MEM E jones welsh comb nov A tegetarioidestegetanoides var anciusanxius meinke & kaye welsh comb nov A ampullarioidesampullanoidesampullanoides welsh welsh comb nov A catlencutlencutleri barneby welsh comb nov and A laccoliticlaccoliticuslaccohticusus MEM E jones welsh comb nov proposals of new taxa include astragalus sect scytocarpi subsect microcymbi welsh subsect nov and A sabulosus var vesiculusvehiculus welsh var nov A lectotype is selected for phaca australis L

key words astragalus nomenclature new taxa

astragalus with more than 350 species and appearance of the entire manuscript within the a great many intraspecificinfraspecificinfraspecific taxa is perhaps the FNA publication schedule format is as under- largest genus of north american plants its stood for the FNA publication order of treat- complexity has long been recognized as evi- ment is phylogenetic as per barneby or as per denced by its tangled nomenclatural history present modification experts and others interested in this vast genus have encountered enormous problems in deal- astragalus molybdenusmolybdenum barneby leanleah W bot ing with it especially prior to 1964 in that 670 1950 leadville milkmilkvetchvetch year rupert barneby in his classic account in low loosely matted shortly caulescent my opinion the most impressive taxonomic perennials 050.5os 6 14 cm long from extensive- work of the century untied the gordian knot ly branching subterranean caudex branches of nomenclature typification and classifica- pubescence strigulose pilosulous basifixed tion of astragalus for north america regard- stems largely subterranean the aerial tips less of when a taxonomic work is attempted prostrate or ascending stipulesStistipuledpules 2 5 mm long there will be shortfalls in information avail- all connate sheathing leaves 151.5isls 7 cm long ability in adequacy of specimens in confluence leaflets 9 17 25 2 10 mm long ovate ovate of data from disparate regions and in overall oblong or elliptic obtuse mostly crowded understanding through time despite those folded or involute Pedpedunclespeduncleduncles 1 3 65656.5 cm problems the atlas of north american astra- long racelesracemes loosely 3 to 6 flowered the axis galus barneby 1964 will stand for all time as scarcely elongating 3 10 15 mm long in a remarkable attempt to understand this huge fruit bractsbraats 252.5 5 mm long pedipedicelscels 050.5os 2 genus and as a tribute to barneby s genius mm long bractbracteoleseoles 0 2 calyx 525.2 7 mm it is hoped that the proposals discussed here- long the tube campanulate 3 424.2 mm long in represent some helpful minor additions to the teeth subulate 2 3 mm long flowers the work by barneby whose treatment is re- 10710.7 12512.5 mm long pink purple lilac or flected in a large manuscript now in prepara- whitish the banner veined and suffused with tion for the flora north america FNA project lilac recurved through ca 45045 the keel tip by SL welsh and R spellenberg included maculate pods ascending sessile or nearly so below are sufficient portions of that treatment 7 11 12 mm long 3 353.5 mm thick obliquely to allow the current proposals to be put into ovoid or ovoid ellipsoid somewhat incurved perspective and to be used by workers prior to 1 loculed strigulose ovules 6

department of botany and range science and M L bean life science museum brigham young university provo UT 84602

45 46 GREAT BASIN naturalist volume 58

1 leaflets of upper leaves 17 25 racelesracemes 3 to 6 & GMG M armstrong 3651 holotype POM iso flowered plants of central colorado and teton types MO NY WYO co montana molybdenusmolybdenum var flowering july august alpine tundra and leaflets of lippertipper leaves 9 17 racelesracemes mostly I1 oior 2 exceptionally 3 flowered plants of the salt krummholz or on talus at 2865 3150 m in rivelriver range lincoln co wyoming salt river range lincoln co wyoming I1 var shultziorum plants of the 2 varieties are essentially iden- tical in aspect but the features noted in the astragalus molybdenusmolybdenum var molybdenusmolybdenum key appear to be substantial diagnostic ones based on A plumplumbeusplumbeousbeus barneby leaf W bot 51955 195 gontscharow 1949 non A plumplumbeusplumbeousbeus astragalus australis L 263796372 637 alpine plants the caudex deeply sub- lam fl fr dwarf 1778 subarctic milkmilkvetchvetch terranean the branches rhizomatous stipulesStistipuledpules phaca australis L mant pi 1 103 176711767 2 15 7 long 5 mm long leaves 151.5 mm the moderate caulescent perennial 10 20 30 uppermost with 17 25 leaflets 2 10 mm long cm tall from a superficial caudex pubescence pedunclespeduncled 1 65gs Peduncles 3 656.5 cm long the racelesracemes 3 to silky strigose villous or villous tomentose 6 flowered calyx 525.2 7 mm long the tube basifixed stems erect or ascending few to 42 campanulate 3 424.2 mm long the teeth subu- several stipulesStistipuledpules 1 2 7 11 mm long often late 2 3 mm long flowers 107 12512.5 mm veined semicoriaceous at least the lowermost long pink lilac purple or whitish the banner connate sheathing leaves 1 2 7 10 cm pods recurved through ca 45 rather abruptly long leaflets 5 7 15 3 28 35 mm long 1 7 contracted into a short beak ovules 6 type 8 mm wide oblong linear elliptic elliptic or colorado about 4 miles east of leadville linear oblong acute villous to glabrate on both lake county ripley & barneby no 9994 sides Pedpedunclespeduncleduncles 2 10 14 cm long racemes pass raceles west slope of mosquito east of lead- 2 to 40 flowered rather compact and ascend- ville no 10045 synsyntypestypes CAS isosyntypes ing at anthesis the axis 1 15 cm long in fruit GH K NY POMPOW RM RSA US WTU bractsbraats 121.2lbib1 2 5 mm long pedipedicelscels 080.80 8 353.53 5 mm flowering july august alpine tundra com- long bracteolesbracteoles 0 calyx 373.73 7 646.46 4 mm long the munity at 3780 3965 m along the continental tube 2122.11 5 mm long campanulate villous the divide along the boundaries between gunni teeth 1 3 mm long subulate flowers 757.57 5 son pitkin lake park and park summit coun- 14514.514 5 mm long ochroleucous or suffused with ties in central colorado and disjunct in teton pink the wing petals bilobed apically the ban- co montana ner recurved through 40 50 pods pendu- lous stipitate the stipe 252.52 5 8 10 mm long astragalus molybdenusmolybdenum varvan shultziorum the body obliquely and narrowly elliptic in barneby welsh comb nov outline 13 27 mm long 3 9 11 mm wide based on A shultziorum barneby bnttoniabrittaniabrittoniaBrittonia 3315633 156 semisemibilocularbilocular the septum 0 060.6og0 6 mm wide 1958 glabrous or pubescent ovules 8 16 2nan 16 dwarf alpine plants the caudex deeply 32 48 type habitat in alphisalpmisalpinis helvetiaehelvetian subterranean the branches rhizomatous stip Itaitaliaeitalianliae gallo provinciaeprovmciaeprovinciate lectotype here des- ules 2 3 mm long leaves 151.5lsis 7 8 cm long ignaignatedted illustration of astragaloidesAstragal oides alpina the uppermost with 9 15 17 leaflets 2 7 mm supina glabragladra molus auctionauctionbusauctioribusbus inm tilli cat long lance or ovate elliptic obtuse to acute PIpl hort pisani 19 5 14 f 1 172v1723 mostly distant flat or loosely folded dedunpedun american materials ofaof A australis are por- cles 05os050.5 1 4 cm long the racelesracemes usually 2 tions of a vast circumboreal species complex i- to 3 flowered calyx 5 575.7 676.7 mm long the demonstrating great variability beginning tube campanulate 3 343.4 4 mm long the teeth with the typical material inm southern europe subulate 181.8lsis 333.3 mm long flowers 11 12 and extending eastward asiatic plants passing mm long whitish lavender tinged the banner under the names A tugaranoviitugaranomi basilevskaja veined and suffused with lilac recurved A gorodkogorodkovngorodkoviivilviivn Jurtjurtsevjurtsensev A tolmaczeviitolmaczemz Jurtjurtsevjurtsensev through ca 50 the keel tip maculate pods and A kolymensis jurtsevjurtsen korobkov et al tapering to an elongate beak ovules 8 or 9 1986 belong to this complex with the entities type wyoming lincoln county stony hill- having the same degree of morphological top 9500 ft mountains near cottonwood integrity or lack thereof as the american lake E ofofsmootsmoot 31 jul 1923 fl EB payson materials varietal segregation within the north 199819981 astragalus nomenclature 47 american variants has been based on differ- long whitish to purplish pod stipe 4 6 mm ences in pubescence leaflet shape and pod long the body obliquely ellipsoid to narrowly size and shape several varieties have been oblong 11 24 mm long 4 7 mm wide the proposed with the best summary that of valves glabrous to occasionally strigose type barneby 19641371964.137 often great variation alaska central yukon R distrdietr porcupine R occurs within a single population but some of 45 miles from its mouth OJ murie 2162 the proposed taxa have apparent geographical june 26 1926 holotype S correlation others are haphazard or represent flowering june july mountain slopes ridge a mere continuum many of the variants can crests meadows and less commonly on gravel be determined mechanically on a 2nan basis bars at ca 200 860 m east central alaska and essentially as summarized by barneby it will british and barn mountains of northern yukon be possible by using the following key to iden- and in the yukon river valley and vicinity of tify the most conspicuous morphological but kluane national park southwest yukon admittedly transitional variants variability is diagnostic criteria that would separate speci- the rule within the species and a more detailed mens from northern yukon those with petio- segregation though possible might separate late leaves from plants at the type locality of morphologically similar individuals not taxa A australis sens str in the alps of southern perhaps even the following proposals do not europe are not resolved herein they appear represent taxa per se but there are hints of to be essentially identical petiolate specimens correlation of some features with geographical occur throughout the range of var murieimoriei as and ecological distributions here interpreted the type of this variety has strigulose pods unusual in plants from the 1 flowers 757 5 11 12 mm long calyx 353.53 5 595 9 mm arctic but pubescence does not seem to have long plants ofbroadof broad distribution diagnostic value within the group many of 2 leaves petiolate plants from eastern alaska the morieimuriei specimens were from ridge and yukon var muncimuneimunct tops 2 leaves sessile the lower pair of leaflets aris-aris especially in northern yukon with a smaller ing from the stistipulesstipuledpules appearing as if foliose number from stream gravels the apparent yukon stistipulesstipuledpules plants from southern south- preferred habitat of most of var lepalepageigei qvav ward rocky mts and olympics plants from southwestern yukon are more 3 pods 3 7 9 mm broad seldom much if at nearly uniform and belong to the lifi all bladdery pedunclespedpeduncleduncles 656.56 5 15 cm long neatisnearis plants widely distributed phase whose type is from the famous lake var aboriginorumabonginorum labarge now laberge collected by JB 3 pods 7 9 11 mm broad bladdery tarlton in 1899 holotype NY isotype US inflated pedpedunclespeduncleduncles 3 656 5 cm long plants known only from the olympic mts wash- astragalus australis varvan lepagei hulten ington var cottoni welsh comb nov 1 flowers 11511.5ilslis11 5 13813 8 14514514.514 5 mm long calyx 575.75 7 656 5 based A lepagei yukon mm long plants from west central to northern on hulten fl alaska & 1761 1950 A basilevskaja alaska east to northern yukon and northwest tugarinov ii A tolmaczeviitolmaczevn jurt sev territories var lepagei stems 8 24 40 cm long sprawling to astragalus australis var murieimoriei rydberg ascending leaves 3 9 cm long sessile or def- welsh comb nov initely petiolate leaflets 5 9 15 6 33 mm based on A abonginorumaboriginorum var muneimurielmunet hulten fl long elliptic to lanceolate lance oblong lin alaska & yukon 1080 1947 atelophragma linearelineage ear lanceolate or linear acute to apiculate rydberg bull torrey bot club 405040 50 1913 glabrous to strigulose pilosulouspilosulous or villous 7 stems 35 cm long ascending leaves 2 Pedpedunclespeduncleduncles 4 454.5 10 cm long typically longer gs 3 656.5 cm long leaflets 7 9 15 6 15 mm than the leaf racelesracemes rather densely to long linear to narrowly elliptical acute to loosely 8 to 29 32 flowered the axis 3 14 obtuse glabrous to strigulose pilosulous or cm long in fruit calyx 47474.7 484.8 656.5gs cm long villous Pedpedunclespeduncleduncles 25 11 cm long typically the tube 282.8 5 mm long campanulate to longer than the leaf racelesracemes rather densely deeply so black strigulose to villous the teeth to somewhat loosely 6 8 to 21 flowered the 1 141.4 242.4 narrowly subulate flowers 95gs959.5 axis 151.5isls 959.5gs cm long in fruit calyx 424.2 555.5ss ils11511.5 13813.8 mm long whitish to purplish pod mm long the tube 242.4 272.7 mm long campanu- stipe 3 5 7 mm long the body obliquely late strigulose to villous the teeth 11iili1.1 252.5 mm ellipsoid to narrowly oblong 10 15 30 mm long narrowly subulate flowers 858.5 959.5gs mm long 3 6 858.5ss mm wide the valves typically 48 GREAT BASIN naturalist volume 58 glabrous type arctic coast distrdietr umiatomiat through its huge geographical range at ca july 29 1948 lepage 23601 holotype S 20 3630 m yukon east to gaspe and south to flowering june july often on gravel bars oregon nevada central and northern utah but also on spits beaches and less commonly colorado and western south dakota on ridge crests in mixed tundra from near sea the var abonginorumaboriginorum consists of the aggre- level to 350 m from coastal western alaska gation of variants distributed in the mountains along the northern and southern slopes of the and valleys from northern british columbia brooks range south to near the 65th parallel southward exclusive of the isolated var cot- and east to the ranges of northern yukon and toni separation of the fineatisnearis phase in the continental and insular northwest territories yukon from the northernmost outliers of var canada abonginorumaboriginorum is rather tenuous however most plants from northern alaska yukon and of var muneimurielmunet including the hneanslinearislineatisnearis phase northwest territories are variable also but have petiolate leaves at least at the lower seem to revolve about a group of plants from nodes and the great body of specimens south sand bars spits and beaches with overall along the cordillera have sessile leaves but larger flowers and broader pods well devel include a great many variable specimens apedoped large flowered collections from the cov- often growing intermixed within the same ille river at umiatomiat were sufficiently distinc- populations further segregation seems futile tive that hulten 195017611950.1761 compared them at present with A harringtoniiharringtonii rydberg hulten of the it is unfortunate that the synonymy already robbinrobbinsiisii complex even those large flowered overcrowded should have yet another name specimens are part of a continuum with small insistence on priority of autonautonymsyms in recent flowered plants forming the other extreme codes of botanical nomenclature has led to especially in coastal western alaska in north- such clutter in this case the earliest autonym ern yukon the large flowered material is tran- available for the geographically most extensive sitsitionalional with smaller flowered plants assigned american variety is aboriginorumabonginorum barneby herein to var muriel 1964 et subsequent cited the name as abo nginumriginum but later used the suffix orum for astragalus australis varvan aboriginorum taxa named by him richardson welsh comb nov based on autonym of A aboriginorumabonginorum varvan fastigiorumvarfastigiorum astragalus australis var cottoni ME jones MEM E jones rev astrabastraga&trag 135 1923 iei e A abonginorumaboriginorum welsh comb nov cotton s milkmilkvetchvetch richardson in franklin jour append 746 1822 phaca A cottoni MEM E jones rev astrabastrag 135 1923 nom glabriuscula hooker fl bor amer 11441 144 1831 A nov pro A olympicusolympicus cotton bull torrey bot club proc glabriusculusglabnusculus var major A gray acad nat sci 2957329 573 1902 non A olympicusolympicus pallas 1800 A aus philadelphia 1863601863 60 1863 A australis var glabriusglabnusglabrous tralistrails var olympicusolympicus cotton isely systcyst bot 84218 421 culus hooker isely systcyst bot 84218 421 1983 A for 1983 nom illegalleg atelophragma cottoni MEM E jones woodiiwoodnwoodfi S watson A richardsonchardsomirichardsoniirichardsonianiinil sheldon atelophrag rydberg ma wallowensewallowense rydberg atelophragma herriotiihernotii ryd- hernoherriotii stems 1 171.71 7 dmdra long decumbent to berg astragalus scrupulicolascrupulicola fernald & Weathweatherbyerbyl ascending 1.51 5 2 5.55ss55 5 cm long leaflets stems 10 50 cm long ascending leaves leaves isls15 55 9 15 17 4 16 mm long linear elliptic to sessile 1 7 10 cm long leaflets 5 15 3 27 elliptic villo 35 nunmm long linear to oblong lanceolate or oblanceolate acute to subacute pedunclespeduncled 65gs elliptical acute to obtuse glabrous to strigose sulousbulous or glabrate above Peduncles 3 656.56 5 cm gs long typically equaling or somewhat longer or villous Pedpedunclespeduncleduncles 656.56 5 15 cm long typically longer than the leaf racelesracemes rather densely than the leaf racelesracemes rather densely 11 to 6 to 40 flowered the axis 151.5 15 cm long in 21 flowered the axis 2 6 cm long in fruit fruit flowers 7 12512.5 mm long whitish to pur- flowers 10 12212.212 2 mm long creamy white pod plish pod stipe 252.5 8 mm long the body ob- stipe 3 5 mm long the body semi ellipsoid liquely ellipsoid to narrowly oblong 10 30 mm bladdery inflated 20 25 mm long 7 9 11 long 3 7 mm wide the valves glabrous to mm thick the valves glabrous ovules 10 15 occasionally strigose ovules 8 16 type nainalmalmaival- type olympic mts clallam county july lies of the rocky mountains drummond 1900 ADEA D E elmer holotype WS isoisotopesisotypestypes holotype K NY ORE P US flowering may to july gravel bars stony flowering june july ridge tops and talus shores talus ridge crests and meadows grow- on granite at 1380 1680 m in the olympic ing with an immense array of plant species mts clallam co washington 199819981 astragalus nomenclature 49

this is the most distinctive of the variants prostrate radiating hornbornfrom the lootroot cicrownown plants within the australis complex in north amer- of garfield kane iron and eastern washing- ton counties utah and lincoln co nevada ica hence its recognition previously at specific var sileranussileranus level it is isolated by many kilometers from 2 pods ovoid or ovoid ellipsoid bladdery inflated other taxa in the complex less than twice as long as broad stems ascending or less commonly prostrate plants astragalus subcinereus A gray proc amer of coconino and mohave counties arizona and lincoln co northern nevada acad 13366 1878 siler s milkvetchmilkvetch vaivalvar subcinereus low caulescent perennial 14 90 cm long 1 mature pods elliptic oblong to oblong 353 5 6 7 radiating from a subterranean branching mm wide flowers 85 11 mm long stems 40 90 caudex pubescence villosulous or hirsutulous cm long plants of igneous gravels in eastern sevier and western emery counties utah basifixed stems few to several prostrate to I1 vaivar basalticusbasalticus weakly ascending buried for a space of 1 2 10 15 cm Stistipulesstipuledpules 151.5 656.5 minmm long at astragalus subcinereus var subcinereus least some connate sheathing leaves 151.5 858.5 plants with stems to 5 dindmdiu long or less with cm long leaflets 9 23 2 16 mm long 1 858.5 mature pods relatively broad mainly 6 13 mm 10 wide oblanceolate obo- mm oblong to or wide and otherwise differing as in the key vate obtuse emarginate or refuseretuse villosulous typewypeType mociakmokiakmoklak pass in the northwestern part on both surfaces or glabrate above Pedpedunclespeduncleduncles of arizona near the utah boundary dr E 151.5 10 cm long racelesracemes 5 to 37 flowered palmer 1877 holotypebolotype GH isoisotopesisotypestypes K MO the flowers ascending to declined at anthesis NY PH US the axis 1 7 cm long in fruit braatsbracts 1 3 mm ponderosa pine pinyon juniper and sage- long 05os 25 eoles pedipedicelscels 050.5 252.5 mm long bractbracteoles brush communities at 1670 2410 in in 0 1 calyx 343.4 636.3 minmm long the tube 232.3 363.6 garfield iron kane and washington coun- mm long campanulate villosulous the teeth ties utah lincoln co nevada and mohave 090.9og 292.9 minmm long subulate flowers 6 11 mm and coconino counties arizona long ochroleucous and commonly suffused with purple pods spreading to declined sub- astragalus subcinereus var silsileranuseranus ME sessile inflated ovoid ellipsoid to ellipsoid jones welsh comb nov siler s milkvetchmilkvetch 12 27 mm long 35353.5 6 13 mm wide when based on the antonym ofaof A sileranussileranus var cariacus pressed subteretesubterete to dorsoventrally com- MMEE jones proc calif acad sci II11 56425 642 1895 A pressed thinly villosulous mottled ovules sileranussileranus MEM E jones zozoe 22422 242 1891 phaca sileranasilerana MEM E jones rydberg 10 20 plants prostrate radiating from a root much of the material from kane garfield crown with stems to 6 dindmdiu long often and washington counties utah differs from conspic- uously flexuous pods ellipsoid mostly more the typical plants in mohave co arizona in than longer than broad or if shorter less being more leafy the leaflets 4 10 mm broad twice than 7 mm wide and the texture leathery in having longer stems 3 7 dm long and in type collected by me M E jones on june having more firmly walled pods 15 28 mm ME 23 1890 inm sink valley southern utah at long and 6 10 13 mm thick these utah about 7000 feet altitude holotype POM iso plants belong sens str to var caraicus ME POW iso types CASGAS GH MO NY US the autonym silsiislisileranussileranurseranus jones ie var flowering may ponderosa although the features are weak and overlap- june pine aspen oak pmyon and mixed moun- they form a syndrome of characteristics pinyonpryon juniper ping blushbrush at 1700 2750 in indicative of an evolutionary trend and are tain communities in in garfield western kane eastern washington herein treated at varietal level bringing to 3 and iron utah and lincoln co the number of taxa within the counties species nevada

1 mature pods ovoid ellipsoid 5 6 13 mm wide flowers 5 9 mm long stems mostly 14 70 cmem astragalus subcinereus vaivarvan basalticusbasalticus welsh long plants commonly of sedimentary gravels great basin naturalist 3830238 302 1978 basalt sometimes from igneous substrates southern milkvetchmilkvetch utah and northern arizona plants with stems to 8 dm long with mature 2 pods ellipsoid turgid but not bladdery inflated more than twice as long as broad or pods narrow mainly 353.53 5 6 7 mm wide and if shortershoitelitei then differing otherwise stems otherwise differing as in the key type utah 50 GREAT BASIN naturalist volume 58

sevier co 16 km S of fremont junction SLS L lousIOUs obscurely stipitate the stipe ca 040.4 mm welsh D isely & G moore 6447 23 july long concealed by the calyx the body ellip- 1967 holotype BRY isotype ISC soid or lancelanee ellipsoid 6 9 mm long 25252.5 flowering may june pinyon juniper and 3 333.3 mm thick obcompressed the valves ponderosa pine communities at 1380 2430 m white villosulous almost or quite 2 loculed in western emery and eastern sevier coun- the septum 080.8os 131.3 mm wide ovules 4 6 ties utah type colorado four miles west of gun- specimens of var basalticusbasalticus grow sympatrisympatnsympatry nison gunnison co 20 july 1945 fl & fl cally with A flexuosus var diehlii MEM E jones ripley & barneby no 7179 holotype CAS barneby when material of the latter variety is isotopesisotypesisotypes COLO GH RSA robust it approaches var basalticusbasalticus in habit flowering july august dry sandy and but not inm pod and flower size indicated how- gravelly sites in sagebrush at 2310 2640 m in ever is a close alignment between the 2 taxa hills west and southwest of gunnison col- and var basalticusbas alticus might possibly be treated orado within an expanded A flexuosus var diehlii or despite conjecture that the skiff milkvetchmilkvetch within A subcinereus the more robust nature might represent a recent introduction from of var basalticusbasalticus precludes alignment with A unknown source its ecological placement is flexuosus however not unlike that of numerous other species of astragalus there is no reason to believe that astragalus sect scytocarpi subsect it is other than indigenous and endemic it has microcymbi welsh subsect nov been relocated numerous times since its initial based on A microcymbus barneby amer midi nat discovery previous placement within section urahst41499uralistmuralist 41499 1949 strigulosistrigulose is however open to question more perennial caulescent with a shortly sub- apparently it belongs within the scytocarpi terranean caudex pubescence basifixed stip near A gracilis ules dimorphic at least the lowermost con nate sheathing leaves with 9 15 oblong obo astragalus tegetarioides jones contr vate or obovate cuneate emarginate folded ME W 1066logg10.66 1902 kentrophyta leaflets racemes loosely 3 7 to 14 flowered bot bastard raceles prostrate caulescent perennial forming mats calyx 222.22 2 262.62 6 mm long the tube 141.41 4 191.91iglg 9 mm or cushions 1 3 4 dm wide radiating from a long the teeth 050.50os 5 070.70 7 mm long flowers branching caudex pubescence strigose or thin- 565.65sg 6 5855.8ss 8 cm long pods 6 9 mm long obscurely ly villosulous basifixed stems 5 15 cm long stipitate almost or quite bilocular ovules 4 6 or more stipulesStistipuledpules 080.8os 3 5 mm long at least the subsection is monotypic the lower ones connate sheathing leaves 1 4 ss55 astragalus microcymbus barneby amer midi 6 cm long leaflets 5 7 11 151.5isls 555.5 7 mm nat 41499 1949 skiff milkvetchmilkvetch long obovate cuneate obtuse truncate or pedun slender diffuse caulescent perennial 25 60 emarginate pubescent on both sides dedun cles 03 2.595gs long cm tall from a shallowly buried caudex 030.3 25 cm racelesracemes compactly or pubescence strigulose to subvillosulous basi- loosely 2 3 to 6 8 flowered the flowers fixed stems prostrate or weakly ascending ultimately declined at anthesis the axis 3 15 long 1.212 2.727 long subterranean for a space of 1 3 cm stipulesstipuledStipules mm in fruit bractsbraats 12 27 mm cels 0.404 1.313 15isls1.51 5 3 mm long at least the lower ones connate pedipedicels 04 13 mm long bractbracteoleseoles 0 calyx 222.2 2.626 3.737 long 1.11 1 2 leaves 15151.51 5 2 4 cm long shortly petioled or 22 26 37 mm the tube 11illi mm the uppermost subsessile leaflets 9 15 ob long obconic campanulate the teeth 1 191.9ig long ovate or oblong cuneate 3 9 mm long nunmm long subulate flowers 444.4 6 7 mm long whitish the faintly lilac emarginate Pedpedunclespeduncleduncles 08080.80 8 151.51 5 353.53 5 cm long banner veined pods 35 45 variously hairy racelesracemes loosely 3 7 to 14 spreading sessile the body 353.5 454.5 mm long 1.515 42 flowered the axis 1 2 656.56 5 cm long min fruit 15 424.2 mm wide ovoid lenticular ob- flowers 565.65 6 585.85 8 mm long whitish tinged with scurely trigonous minutely strigulose to silky lilac the banner recurved through ca 45450 villous ovules 2 3 4 calyx 222.22 2 262.62 6 mm long the tube 141.41 4 191.9iglg1 9 mm 1 racemes loosely 2 8 long campanulate or obconicobcomc campanulate raceles to 6 flowered flowers whitish the banner with pale lilac veins 444 4 7 strigulose with white and fuscous hairs the mm long pods 151.5isls1 5 282.82 8 mulmuimm wide plants of harney teeth 050.50os 5 070.70 7 mm long subulate pods lendupendu co oregon var tegetarioides 199819981 astragalus nomenclature 51

1 racelesracemes compactly 7 9 to 15 flowered flowers 3 17 mm wide ovate to obovate lanceolate rose purple the banner with a pale basal eye or elliptic obtuse to refuseretuse strigose along 6.5665 10 12 long pods 32423 2 wide plants 655 mm 3242324.23224424 2 mm beneath ciliate glabrous above dedunpedun of lassen co california var anxiusanxtusangius veins cles 4 9 23 cm long racelesracemes 15 20 to 40 astragalus tegetarioides var tegetarioides flowered the flowers ascending anthesis the 4 10 16 long 1 5 pubescence strigose strigulose leaflets axis cm in fruit braatsbracts 151.5isls 4 mm long pedipedicelscels 070.70 7 353.53 5 mm long bractebracete 7 11 151.5lsis 555.5 mm long racelesracemes 131.3 181.8 cm oles 0 2 calyx 5 6 minmm long the tube 4 5 long loosely 2 to 6 8 flowered calyx 22222.2 nunmm long short cylindric strigose the teeth 262.696gg 373.7 mm long the teeth 1 191.9ig minmm long 050.50 5 0900.9og 9 12121.21 2 mm long triangular to subulate flowers 444.4 6 7 mm long the banner re- flowers 11 14 18 mm long ochroleucous flexed 70 100 pods 333.3 4.545 mm long 151.5lsis 282.8 45 minmiu the keel immaculate the banner recurved mm wide type no 2619 cusick southern through ca 25 pods erect slenderly blue mts oregon in sandy soil in the buck stipitate the stipe 7 15 mm long the body ovoid to range june 28 190f1901 holotype POM iso ellipsoid inflated papery 12 18 mm long types G GH K MO ND NY ORE P RM min 8 10 12 mm thick obcompressed glabrous US essentially unilocular the septum to ca 020.20 2 dry pine forests and sagebrush communi- minmm wide type washington co utah ties at ca 1350 1550 in in the little jumperjuniper ca I1 mi N hwybwy 91 at shivwitsShivwits 3450 ft elev mountain and silvies in west upper river welsh atwood 21049 21 co oregon SL ND april central and north harney 1982 holotype BRY flowering april may gypsiferous sub- astragalus tegetarioides var anciusanxius meinke strates in boils on the chiclechinle formation sur- & kaye welsh comb nov rounded by creosote bush other warm desert A anciusanxius meinke & kaye madronoMadrofioflo 39 194 199211992 shrubs and juniper communities at ca 1050 pubescence loosely villous to pilosulouspilosulous 1150 in from the petrified forest section of 9 15 4 9 long racemes 0.808os 2.222 leaflets mm raceles 08 22 zion national park west in several disjunct cm long compactly 7 to 13 15 flowered populations to the type locality washington calyx 323.2 474.7 5 minmm long the teeth 17itlt1.7 272.7 co utah long 65gs 12 minmm flowers 656.5 10 minmm long the the shivwitsShivwits milkvetchmilkvetch was dismissed as banner reflexed 60 80 pods 353.5 454.5 mm long taxonomically inconsequential by barneby 323.2 424.2 minmm wide type california lassen 1989 and by isely 1996 however the com- co ash valley ca 25 km west of madeline bination of subterranean caudices fistulose and US hwybwy 395 immediately south of ash stems very large number of flowers on an valley rd in loose gravel overlying volcanic attenuated raceme and papery inflated pods bedrock on the boundary of t38n rileRIIE seems to be a rather consequential grouping sect 32 and t37n rileRIIE sect 5 ca 1550 in of taxonomic features especially in a plant 16 jul 1991 meinke and lantz 6108 holo- with a preference for harsh ecological sub- type OSC isotopesisotypesisotypes CAS ISC MO NY RM strates diagnostic criteria are of the order of UC US magnitude of those utilized elsewhere to dis- arid flats in or near juniper sagebrush tinguish the closely related A ensiensiformisformis MMEE steppe or pinus jeffrejeffreyyi woods at 1540 1660 jones from A minminthorniaeminthormaethormae rydberg jepson in in ash valley extreme north central lassen the nature of the root crown and of the pods co california but not of the remainder of the plant is remiremlremi- niscent of the only slightly allopatncallopatric A astragalus ampullarioides welsh welsh ampullanusampullariusampulianuslanuslatiuslarius S watson plants of the shivwitsShivwits comb nov shivwitsShivwits milkmilkvetchvetch milkvetchmilkvetch are routinely hedged back by deer great A eremieremiticusererruttcusticus var ampullarioides welsh basin often the entire inflorescence is consumed naturalist 4626246 862262 1986 moderate caulescent perennial 20 63 cm astragalus cutlericutlery barneby welsh comb tall from a branching subterranean caudex nov cutler s milkmilkvetchvetch pubescence thinly strigulose basifixed stems A preusspreusshpreussett var cutlericutlery barneby great basin naturalist decumbent to erect buried for a space of 2 10 46256 1986 cm stipulesstipuledStipules 3 9 mm long all distinct leaves moderate caulescent short lived peren- 5 22 cm long leaflets 13 21 4 24 mm long nial often flowering as an annual 10 30 35 52 GREAT BASIN naturalist volume 58 cm tall from a superficial caudex pubescence to glabrous on both sides Pedpedunclespeduncleduncles 353.5 7 cm sparingly strigulose to subglabrous basifixed long racelesracemes 4 to 10 flowered the flowers stems few to several ascending to erect ascending spreading at anthesis the axis 050.5os 2 forming bushy clumps Stistipulesstipuledpules 2 656.56 5 mm cm long in fruit braatsbracts 2 6 mm long pedicelspedicels long all distinct leaves 3 13 cm long leaflets 2 5 mm long bractbracteoleseoles 0 2 calyx 15 17517.517 5 5 17 19 3 17 20 mm long 3 5 12 mm minmm long the tube ils11511.5 14 minmm long cylin- broad elliptic to lanceolate oblanceolate or dric strigulose the teeth 3 4 mm long subu- obovate acute to obtuse or mucronulate late flowers 23 27 34 mm long ochroleu- strigulose to glabrous below glabrous above cous fading yellowish or white fading off Pedpedunclespeduncleduncles 252.52 5 10 cm long bractsbraats 151.5isls1 5 252.52 5 mm white pods spreading to declined subsessile long racelesracemes 5 to 9 flowered pedipedicelscels inflated cylindroid 20 48 mm long 10 15 151.5isls1 5 252.52 5 minmm long bractbracteoleseoles 2 calyx 73737.37 3 mm thick stiffly papery to leathery strigose 757.57 5 858.58 5 9 mm long the tube 595.95 9 676.76 7 long unilocular ovules 55 59 2nan 26 cylindric pale purple or whitish sparsely black 1 flowers 27 34 mm long ochroleucous fading strigose the teeth 131.31 3 171.71 7 23232.32 3 mm long sub- yellowish plants of the cisco thompson vicinity ulate flowers 15 16 mm long white or tinged var sabulosus or drying purplish the banner recurved 1 flowers 23 27 mm long white fading off white through ca 40 45 pods ascending to erect plants from northwest of moab vesiculusvehiculus stipitate the stipe 3 353.53 5 mm long the inflated var body oblong ellipsoid 14 18 mm long 9 11 astragalus sabulosus van sabulosus minmm thick the valves thinly cartilaginous var Jonejonesiellasiella sabulosasabulosesabulosa MEM E jones rydberg greenish suffused sometimes with purple calyx 15 17517.5 mm long the tube 11511.5 14 unilocular glabrous ovules 20 38 type ils mm long cylindric strigulose the teeth 3 4 cutler 2283 copper canyon 1 mi from I mi mm long subulate flowers 27 34 mm long mouth san juan co holotype NY utah ochroleucous fading yellowish pods spread- types CAS WIS isoisotopesisotypes ing to declined subsessile inflated cylin- flowering april may saltbush and black droid 20 48 mm long 10 15 mm thick leath- brush communities on permian formations at ery type collected by ME jones may 2 1155 copper canyon ca 1250 inm at south of 1890 at cisco utah on gravelly soil san arm powell san near juan aimalm of lake juan co grand river holotype POM utah flowering late march to may mat atriplex taxon when first characterized was this shadscaleshadscale communities at 1300 1600 inm on known only from plants flowering as annuals mancos shale and morrison formation in later collections demonstrate that the plant is the grand river valley vicinity of thompson at least a short lived perennial the other and cisco grand co utah characters hold however even if there is more the very large pale ochroleucous flowers overlap in leaflet number than previously are borne in late march through april and by known also the pods are of thin texture mid may the plants bear large sausagelike approaching A eastwoodiae more so than A fruits the cisco milkmilkvetchvetch is a primary sele- preuspreussiipreussepreussnsiisllsilsn with which it shares features of nium indicator with close affinities to both var ascending erect pods cutler s milkvetchmilkvetch dif- vesiculusvehiculus and A iselyi welsh avqv from both fers from A preussiipreussepreussnpreussiislisll in about the same order of which it can be distinguished by its ochro- of magnitude as does A eastwoodiae leucous flowers that fade yellow welsh 1994 the flowers ofaof A sabulosus var sabulosus are astragalus sabulosus ME jones zoezog 2 239 the largest within astragalus in utah and pos- 1891 cisco milkmilkvetchvetch sibly elsewhere though they are not the robust ill scented caulescent perennial longest understanding of diversity within 13 38 cm tall from a woody superficial caudex the sabulosus complex was long held in abey- pubescence strigulose basifixed stems decum- ance because of paucity of flowering speci- bent to ascending or erect several to numerous mens in herbaria those that were collected forming clumps stipulesStistipuledpules 4 9 mm long all were taken in fruiting condition floral fea- distinct leaves 3 10510.510ioslos 5 cm long leaflets 5 11 tures readily allow segregation of the known 6 35 50 mm long 3 17 mm wide rhombic populations into 3 taxa A isely A sabulosus oval to obovate or elliptic mucronate strigose var sabulosus and A sabulosus var vesiculusvehiculus 199819981 astragalus nomenclature 53 astragalus sabulosus var vesiculusvehiculus welsh spreading ascending the axis 3 15 cm long in var nov fruit bractsbraats 2 5 mm long pedipedicelscels 1 252.5 mm similis var sabusabulosisabulostsabuloselosilostiositost sed in florflonbusflorinusfloribusibus minor long calyx 10 11511.5 mm long the tube 858.5ss 10 ibus 2 27 neenec 27 34 mm et albidisalbinis neeneenec mmrum long cylindric strigulose the teeth 1 2 ochroleucis dedechloredecolorecolore albidisalbinis necneenecnee flavis et mm long flowers 19 27 mm long pink pur legummibuslegurninibuslegummibus substipitatis incipientmcipientibusincipientibusibus type pie fading or drying ochroleucous pods utah grand co t24s r20e seesec 7 ca 16 mi ascending humistratehumistrate sessile the body due NW of moab ca 4500 ft elev morrisonmornson 15 25 27 mm long 7 15 mm thick when formation mixed salt desert shrub comm 28 pressed turgidly lance ovoid contracted dis- aarapr 1984 SLS L welsh 22709 holotype BRY 3 tally into an incurved laterally compressed isoisotopesisotypestypes distributed previously as astragalus beak 5 8 mm long fleshy the valves ca 2 minmm sabulosus additional specimens all BRY thick shrinking in ripening green or purplish utah grand co ca I1 km SSE of historic state but not mottled strigulose unilocular ovules station and 20 km NW of moab at ca 1464 m ca 38 type ME jones no 56581 july 21 elev 30 april 1984 SLS L welsh & D trotter 1894 at cottrellcottrelfss ranch henry mountains 22723 fl do 20 may 1985 SLS L welsh 23432 utah 6000 alt holotype POM fr do 21 may 1984 atwood Goodgoodrichnch and salt desert shrub bigelow sagebrush and thompson 9700 do t24s r20e sig SESW juniper communities at 1460 1890 m in ca 181.81 8 miles N of courthouse rock 16 june western wayne and western garfield counties 1995 D atwood 20276 henry mts and vicinity utah calyx 12 16 mm long the tube 11 13 mm the laccolitelaccolithlaccolite milkvetchmilkvetch is easily distin- long cylindric black strigulose the teeth 2 353.53 5 guished from A chamaeleuce A gray by its mm long subulate flowers 23 27 mm long lance ovoid not ellipsoid purple mottled white fading whitish pods spreading to de- pods the taxon has been confused with the clined subsessile to incipiently substipitatesubstipitate nearby A consobrinus barneby welsh with inflated cylindroid 28 45 mm long 9 13 mm which it shares structurally similar but much thick stiffly leathery larger pods and flowers and has been treated shadscaleShadscale woody aster galleta community previously as a variety of A chamaeleuce on the morrisonmornson formation at 1370 1465 rn whose distribution is adjacent to but not con- near the head of courthouse wash grand fluent with that of this plant its morphological co utah differences are similar to those regarded as plants of var vesiculusvehiculus the stage station diagnostic in other taxa within the argophylli milkvetchmilkvetch approach A iselyi in flower color but have much larger flowers they are geo- literature CITED graphically disjunct by more than 35 km from A iselyi and about that distance from the BARNEBY RCR C 1964 atlas of north american astragalus nearest known population of var sabulosus memoirs of the new york botanical garden 13 1 1188 sabulosus complex also with A the is allied 1989 fabalesbabales pages 1 279 min A cronquist et al praelongus sheldon which has much smaller intermountainintermountain flora ab3b new york botanical garden flowers and pods bronx NY huetHULTHULTENN E 1950 flora of alaska and yukon X dicotyledicotyles astragalus laccoliticusus doleacdoneaedoneac lundsbunds univ arssk NEN F avd 2 461 laccolitic ME jones welsh 1485 1992 comb nov laccolitelaccolithLaccolite milkvetchmilkvetch ISELY D 1996 native and naturalized leguminosae A cicadascicadae var laccoliticlaccoliticusus MEM E jones proc calif fabaceae of the united states unpublished manu- acad sci II11 56725 672 1895 script iowa state university ames 1000 appp perennial acaulescent 4 8 cm tall from a KOROBKOV AAA A MXM V SOKOLLOVA NNN N TARASKINA AND taproot and superficial caudex pubescence BA JURTSEVJUETSEV 1986 leguminosae flora aicticaarcticaarctisca dolabriform stems obsolete or essentially so URSS 92192 1 187 WELSH SLS L 1994 leguminosae in SLS L welsh et al A the intermternodesinternodesnodes obscured by stipules stipulesstipuledStipules utah flora and2nd edition brigham young university 2 5 mm long all distinct leaves 2 9 cm long provo UT leaflets 5 9 11 454544.55 5 11 mm long 353.53 5 656.56gs 5 mm wide oblanceolate to obovate obtuse received 17 april 1997 accepted 29 may 1997 strigose on both sides Pedpedunclespeduncleduncles 131.31 3 6 cm long racelesracemes 3 to 8 flowered the flowers great basin naturalist 581 0 1998 appp 54 65

REGIONAL assessment OF WADABLE STREAMS IN IDAHO USA

christopher T Robinsonrobinsonl2robinson1212 and G wayne Minsminshalllmmshall1halll

ABSTRACT there has been a resurgence in applying bioassessmentbioassessment techniques for evaluating and monitoring the biological integrity of stream ecosystems in all cases biological metrics have been refined to account for regional variation in aquatic habitats and fauna this study evaluated environmental and maeromacromacromvertebratemacroinvertebrateinvertebrate properties for fadablewadable streams in 3 major ecoregionsecoregions of idaho northern basin and range snake river plain and northern rocky mountain these 3 ecoregionsecoregions constitute 80 of the land area in idaho reference streams were delineated from test streams in each ecoregioneco region using standard habitat assessment protocols plafkin et al 1989 multiple discriminant analysis effectively determined habitat quantified measures and macromaeromacroinvertebratemacromvertebrateinvertebrate differences between reference and test streams within ecoregionsecoregions although the results suggested that quantifiable habitat measures ege g water chemistry and nutrients and biotic metricsmetnes based on taxonomic groups ege g elmidaeElmelmidgeidae improved the discriminatory power of evaluation procedures our results support the contention of a multi metric approach for assessing differences among streams within an ecoregionecoregion lastly individual metrics differed in their importance for evaluating stream condition among ecoregionsecoregions further empha- sizing the importance of regionally stratifying metliemetric selection or scoring procedures

key words bioassessmentbioassessment ecoregionecoregion habitat idaho macromacroinvertebratesinvertebrates phosphorus

although the clean water act directs the et al 1989 hughes et al 1990 matthews et al US environmental protection agency to 1992 develop programs to evaluate restore and rapid bioassessmentbioassessment protocols have become maintain the integrity of its waters freshwater an important tool in the biological evaluation lakes and streams continue to be seriously of stream ecosystems karr et al 1986 plafkin degraded by nonpointnonpoint source pollutants and et al 1989 karr 1991 these protocols are habitat alterations associated with various based on a strong theoretical framework in land use practices benke 1990 hughes et al community and ecosystem ecology although 1990 karr 1991 hughes and noss 1992 allan specific metrics usually are modified to adjust and flecker 1993 richards et al 1993 1996 nationally derived or general criteria to meet historically water quality assessment focused regional conditions steedman 1988 barbour primarily on chemical criteria and single factor et al 1992 resh and mcelravy 1993 barbour laboratory toxicity tests the nature of non et al 1996 rapid bioassessmentbioassessment protocols were point source pollution eg sedimentation and developed originally for the time and cost related changes in physical habitat however effective collection of biological data although requires alternative methods for assessing the compromising data completeness eg qualita- biotic hehealthalff of freshwater systems minshall tive sampling techniques and reliability eg 1996 presently many states have implemented no measure of data variability resulting in a an ecoregionecoregion approach in their bioassessmentbioassessment loss of statistical power and potential for type II11 programs eg fausch et al 1984 gallant et al errors resh and jackson 1993 more specifi- 1989 southerland and stribling 1995 barbour cally rapid bioassessmentbioassessment attempts to use et al 1996 an ecoregionecoregion areas of similar geog- regional biota to determine water and habitat raphy hydrology climate chemistry terrestrial quality and thus evaluate stream ecosystem vegetation and biota approach was adopted to integrity and health rosenberg and resh 1993 account for geographical differences variabil- barbour et al 1996 for example protocols have ity in freshwater habitats and fauna and the been developed using fish macromacroinvertebratesinvertebrates differential response of respective regions to and algae to provide a more integrative ecosys anthropogenic impacts bailey 1989 gallant tem level assessment of biological integrity

stream ecology centergenter department ofot biological sciences idahoidabo state university pocatello ID 83209 21resentaddressniesentpresentprePiepiesentsent iddressdiessdrevs department ofot limnology swiss federal institute of environmental science and technology EAWAG ueberlandstrasse 133 CH 8600 duebendorf switzerland address allailali respondencecorrespondencecoicor and reprint requests to this author

54 199819981 bloassessmentbioassessmentBlOBIOASSESSMENT OF IDAHO STREAMS 55

bramblett and fausch 1991 barbour et al NBR r 14 t 18 SPR r 16 t 12 1992 reice and wohlenberg 1993 idaho NRM r 16 t 9 test sites in the NBR and recently issued a number of monitoring proto- SRP ecoregionsecoregions are usually lowland areas per- cols that use fish chandler and maret 1993 or turbed primarily by livestock grazing and other macromacroinvertebratesinvertebrates clark and maret 1993 in nonpointnonpoint source agricultural inputs mining is conjunction with habitat evaluation guidelines the major land use in the NRM A complete burton 1991 burton et al 1991 for assessing list of study streams and specific locations can the biological integrity of its streams be found in robinson and minshall 19951995aa the present study incorporated rapid bio collection procedures for physical assessment protocols for assessing the biologi- and chemical measures cal conditions of fadablewadable streams in the north- ern basin and range NBR snake river plain initially we evaluated habitats using quali- SRP and northern rocky mountain NRM tative habitat assessment procedures as ecoregionsecoregions within idaho we examined a vari- defined in plafkin et al 1989 streams with ety of habitat and biotic measures used for summed habitat assessment values 80180yso of the assessing the biological integrity of lotic sys- possible maximum score were used as refer- tems and evaluated their respective applicabil- ence streams those with lower scores were con- ity to conditions found in these 3 ecoregionsecoregions sidered test streams in addition other habitat we focused our work on the NBR and SRP measures were quantified at each site specifi- ecoregionsecoregions in the southern part of the state in cally we calculated average bankfullbank full widths at 1990 and 1991 and included the NRM eco each study site from 5 transects 50 in equidis- region in 1993 robinson and minshall 1995a tant we estimated canopy cover for the entire these 3 ecoregionsecoregions constitute 80 of the reach ca 250 in and presented it as quartile land area in idaho we examined the respon- percent ie 0 25 50 75 or 100 coverage sivenesssiveness of measures among streams that dif- substratum size x axis embeddedembeddednessness quar- fered in the degree of impact by land uses ter system as for canopy cover values and characteristic of the particular region undis- water depth were measured from 100 randomly turbed or least impacted streams which serve chosen stones locations for depth within a as the reference condition for determining 100loom m section of each study reach using an degree of degradation of test streams thus pro- orion model 126 conductivity meter stan- vide the foundation for developing predictive dardizeddardized to 20c20 C we measured specific con- models generalizations regarding stream integ- ductanceductance in the field field ph was measured rity in a particular area or ecoecoregionregion in idaho with either an orion model sa250 or schott model CG 837 ph meter alkalinity and hard- METHODS ness were quantified in the laboratory using standard methods APHA 1992 and selection of study sites nitrate phosphorus concentrations were measured we selected study sites from candidate using a HACH meter model dr2000 and streams by reviewing existing literature con- HACH reagents water velocities for calcula- cerning site conditions by discussing options tions of discharge were determined using an with various agency personnel bureau of land ott clC l1 meter management idaho division of environmen- we collected periperiphytonphyton by scraping all tal quality idaho department of fish and material from a known area on the surface of game and united states forest service and 5 stones and transferring the material onto sep- private landowners and by field reconnais- arate whatman GFF glass fiber filters n 5 sance where possible we made special effort site after robinson and minshall 1986 upon to select designated stream segments of con- filtering the material was kept frozen at 25c25 C cern clark 1990 dunn 1990 site locations until analysis in the laboratory for chlorophyll a range from the idahowyomingIdaho Wyoming border to the and AFDM initially we ground samples in idahooregonIdaho Oregon border many sites are accessi- reagent grade acetone using a brinkmann tis- ble only via a dirt track or by foot eighty five sue homogenizer model PT 1035 chloro- and2nd to ath4th order streams after strahler 1957 phyll a was extracted in reagent grade acetone were selected for analysis and included refer- and quantified using a gilford model 2600 ence r and test t sites in each ecoregionecoregion spectrophotometer APHA 1992 samples from 56 GREAT BASIN naturalist volume 58

1993 were extracted min 100 methanol metha- pie for metric analysis in 1990 all macroinver nol extraction eliminates the need to grind tebrates were removed from each quantitative samples holmhansenholm hansen and riemann 1978 sample in 1991 and 1993 the 5 quantitative although both extraction media result in simi- samples from a site were combined and fol- lar extraction efficiencies we conducted a test lowing the initial removal of large and rare to compare chlorophyll a concentrations from taxa a minimum of 300 organisms were sys- samples using both media chlorophyll a was tematically handpickedhand picked from the combined eftiextiextractedacted from samples in acetone or methanol sample analogous to the 2 phase sample pro- and quantified as above the results indicated cessing described by cuffney et al 1993 also no difference between the methanol and ace- see courtemanch 1996 we identified all tone methods p 0760.760 76 independent samples picked macromacroinvertebratesinvertebrates to lowest feasible t test n 20 PenpenphytonPeriperiphytonperlphyton AFDM of each sam- taxonomic unit usually genus and enumer- ple was determined as described above for ated them BOM see below using the remaining material biotic metrics were calculated from the from chlorophyll a analysis macromacroinvertebrateinvertebrate data from each site as depending on the year of study we used described in winget and magnum 1979 quantitativesemiquantitativesemi and quantitative collection platts et al 1983 fisher 1989 plafkin et al techniques for sampling macroinvertebratesmacroinvertebrates to 1989 chandler and maret 1993 and clark meet specific study objectives for that year in and maret 1993 seventeen metrics were cal- 1990 semiquantitative sampling was conducted culated for benthic macromacroinvertebratesinvertebrates ratio of at all selected sites and an additional 5 quanti- ephemeroptera plecoptera and trichoptera tative samples were collected at 5 of these EPT abundance to chironomidae CH and sites in 1991 and 1993 we completed quanti- oligochaeta 0 abundance EPTCHO tative sampling at all selected sites with addi- species richness EPT richness hilsenhoff tional semiquantitative samples collected at 10 biotic index HBI biotic condition index of these sites in 1991 benthic macroinverte BCI ratio of EPTCH dominant taxon brates were semiquantitatively collected from shannonShannorsnoiss diversity index 1 HI T simpsinssimpsorssimpsonsSimpsorssonssois dom- riffrimmlerun habitats using a metal framed net 1 i- inance index C ratio of shredders to total mm mesh in 1990 and 500soo amlomjom mesh in 1991 macromacroinvertebrateinvertebrate abundance macroinverte and 1993 30 cm high X 60 m wide X 100 cm brate density scrapers filterersfilterers shred- long affixed to a D style shovel handle A 3 ders EPT taxa CHO and chirono- minmm sample was proportioned among riffle and midae the HBI used an assigned scale of run habitats along a 150isom m length of stream 0 10 hilsenhoff 1988 and regional tolerance and preserved min the field with 10 formalin values from clark and maret 1993 plafkin et al 1989 also see resh and jackson for the 25 sites evaluated in 1993 in the 1993 using a modified hess net 250 lumjompom NRM we calculated macromacroinvertebrateinvertebrate met- mesh we collected quantitative benthic sam- rics from fisher s 1989 data due to budget ples at 5 riffrimmlerun habitats at each site although limitations fisher 1989 assessed 137 sites in different mesh sizes were used between years the NRM data which the state of idaho no statistical differences were found between wanted to incorporate into their monitoringbiomonitoringbio respective biotic metrics at a particular site program for quality assurance we collected robinson and minshall 1995a macromacroinvertebratesinvertebrates from 4 of these sites and benthic organic matter was estimated from compared biotic metrics for macroinverte material obtained in the quantitative macro brates with respective data from fisher 1989 invertebrate samples following removal of although some discrepancy existed in identifi- macroinvertebratesmacromvertebiatesmaeromacroinvertebrates organic matter was deter- cation of taxa fisher consistently had higher mined by drying the sample at 60cgoc60 C for at species richness and EPT richness values most least 48 h weighing ashing at 550c550 C for 2 h other biotic metrics appeared robust enough to rehydrating redrying for at least 24 h and mitigate the differences for example highly rereweighweighingmg the difference in dry weights was similar values were found for EPT and the quantity of organic matter as AFDM for CHO based on these results we felt confi- that sample in the laboratory we systemati- dent that metrics could be calculated for all 25 cally handpickedhand picked a 300 count sample of macro streams using fisher s data in concert with our invertebrates from each semiquantitative sam habitat measures to eliminate discrepancies in 199819981 bloassessmentbioassessmentBlOBIOASSESSMENT OF IDAHO STREAMS 57 richness values we combined some obvious 180 T splitspilt taxonomic groups eg baetisbabtis species 4a 160 jaj3 specimens of all macromacroinvertebrateinvertebrate taxa col- 00 140 T lected during the study were retained for C 120 voucher collections and housed at the stream r too100 poca- W ecology center of idaho state university 4 80 tello idaho department of health and wel- 0 fare bureau of laboratories boise and orma 60 J smith museum of natural history albertson 40 college of idaho caldwell X 20

we completed separate multiple discrimi- 0 nant analyses MDA using quantitative habitat R T R T R T measures biotic metrics and relative abun- northern snake northern basin and river rocky dances of the most common taxa or taxonomic range plain mountain groups to determine variables that best differ- entiaentiatedted reference and test streams in each fig 1 average lsIs habitat assessment values after ecoregionecoregion tabachnick and fidell 1989 some plafkin et al 1989 for reference and test streams within taxa were combined at the generic eg ephe each ecoecoregionregion merelmereimerellamereliamerelldmerealdld or family eg elmidaeElmelmidgeidae level to pro- vide enough data for statistical comparisons all combined taxa had equal tolerance values after NRM however NBR and SRP test streams clark and maret 1993 these taxonomic groups displayed a wide variation in habitat assess- generally comprised over 80 of the macro ment values that ranged from 30 to 143 144 invertebrate assemblage at any one site one was the separation value for reference and test way ANOVA was used to determine differ- streams because of design constraints see ences in quantified habitat variables of refer- methods test streams in the NRM showed ence streams among ecoregionsecoregions variables were much less variation and had higher average transformed prior to analysis to improve data habitat scores than test streams in NBR and homoscedasticity zar 1984 following MDA SRP ecoregionsecoregions we scored selected biotic metrics for each multiple discriminant analysis using quanti- ecoregionecoregion similarly to methods described in fied habitat measures clearly separated refer- barbour et al 1996 briefly metrics that had ence streams in each ecoregionecoregion fig 2 refer- values greater or lesser ie dependent on par- ence streams in the NRM were distinguished ticular metric than the median value of refer- from other reference streams by lower eleva- ence streams scored 5 those between the tions and lower water temperatures root 1 25ile or 75ile and the median scored 3 whereas reference streams in the NBR and and those higher than the 75ile or lower than SRP had similar elevations and temperatures the 25ile scored 1 we then summed individ- but differed significantly in water chemistry ual metric scores for each site to provide an and widthdepthwidth depth ratio root 2 here refer- overall score for that stream separate t tests ence streams in the NBR had higher ionic were performed to test for differences between measures eg specific conductance alkalinity average reference and test site scores within and hardness and greater depths ie differ- each ecoregionecoregion zar 1984 ences in widthdepthwidthdeptbwidth depth ratios due to differences in depth not width than streams in the SRP RESULTS table 1 there were some major differences in habi- assessment and habitat tat characteristics between reference and test conditions environmental streams within each ecoregionecoregion these differ- As designed reference streams had higher ences were especially evident in the NBR and average habitat assessment values after plafkin SRP physically test streams typically had lower et al 1989 than test streams in each ecoregionecoregion gradients more open canopiescanopies smaller sub fig 1 indeed reference sites had average strata higher substratasubsubstratalstrata embeddedembeddednessness and values 60 points greater than test sites in the higher water temperatures than reference NBR and SRPSRE and 30 points more in the streams table 1 chemical differences among 58 GREAT BASIN naturalist volume 58

metrics found important for distinguishing 4 stream types in the NBR included EPT rich- NBR ness ChironomidaeEPTeptchironomidae ratio hydropsy aanAIA ain A chidaechidam scrapers EPT taxa and 2 AA A CHO AA A chironomidae important metrics for the cm SRP included taxa richness EPT richness HBI OE 0 Eeptch0PTC H 0 ratio dominant taxon filter ers and EPT taxa thirteen of 17 metrics were deemed important in the NRM table 2 but this high number probably reflected the less degraded conditions of test sites in this f501 p0000 ecoregionecoregion MDA results root scores for 4 2 0 2 4 6 ie 0 individual sites within each ecoregionecoregion are root 1 elevation temperature shown in figure 3 this type of presentation simply demonstrates that 1 most reference fig 2 multiple discriminantdisei imitantiminant analysis scatterscatterplotplot ofrootoffootof root sites were biologically different from test sites scores foiformor individual reference streams within each ecoreacore outliers also were evident and 2 variation in gion based on quantitative habitat measures circles inde- pendently drawn to illustrate differences among ecoreacore biotic metrimetricsc s occurred among streams gions MDA based on individual taxa indicated that different taxonomic groups except the elmidaeElmelmidgeidae were important for distinguishing stream types were most evident inm the NBR among stream types in each ecoregionecoregion four with test streams showing 2xax higher ion con- taxa differentiated reference and test sites in centrationscentrations than reference streams in addition the NBR elmidaeElmelmidgeidae heptageniidae capadazapada phosphorus concentrations were ca 2xax greater and ephemerellidae table 2 for the SRP in test streams than in reference streams al- these taxa included the Elmelmidaeelmidgeidae rhyacophili though they were more pronounced in the SRP dae brachycentrus capniidae drunella ecoregionecoregion again few differences were observed turbellaria and simuliidae whereas babtisbaetis in habitat conditions between test and refer- elmidaeElmelmidgeidae capadazapada brachycentrus drunella and ence streams of the NRMN RM although test streams simuliidae were important discriminatorsdiscriminatory in did display higher water temperatures than the NRM ecoregionecoregion the graphical presenta- reference streams table 1 differences in tion of site MDA root scores shows clear sepa- biotic resources were less evident among test ration between reference and test streams but and reference streams due to high variability as with the biotic metrics a high variation in ege g all CVs 100 however there were taxonomic properties among study sites within some trends of enhanced periperlpenpenphytonperiphytonphyton standing each ecoregionecoregion fig 4 crops in test streams relative to reference correlation analysis was used to reveal streams for example average chlorophyll a redundant metrics or taxonomic groups from levels were 4xax greater in test streams than inm the MDA results of these metrics and taxa reference streams in the NBR and periperlpenpenphytonperiphytonphyton those having the least amount of overlap AFDM values were 3xax greater in test streams between reference and test sites were retained than in reference streams in the SRP these for development of a biotic assessment score patterns are contrary to those min the NRM and two metrics and no taxa were eliminated from may reflect a reduction in bryophytes not the NRB ChironomidaeEPTeptchironomidae ratio and quantified in this study in test streams inm this CHO table 2 only taxa richness and ecoregionecoregion CTC T robinson personal observation drunella were omitted in the SRP whereas taxa richness EPTCHO ratio dominant macioMacromaeromacroinvertebratemacroemacromvertebrateinvertebrate assessment taxon shannonsshannonaShannons index ch0ghoCHO and chi- multiple discriminant analysis MDA re- ronomidae were removed fromchascore develop- vealed important but different metrics for dis- ment in the NRM no taxa were eliminated in tinguishing between reference and test streams the NRM lower albeit nonsignificant biotic within each ecoregionecoregion table 2 for example metric and taxonomic scores were found for only EPT richness was an important discrimi- test sites relative to reference sites in the NBR nator between stream types in all ecoregionsecoregions metric p 0150.15 taxa p lsis15.15 and SRP 199811998 bloassessmentbioassessmentBlOBIOASSESSMENT OF IDAHO STREAMS 59

TABLE 1 physical chemical and resource characteristics for reference R and test T streams evaluated in each ecoregioneco region characteristics expressed as means standard deviations itdstd and coefficients of variation CV blank cells were sites in which that variable was not recorded variables that are underlined showed significant differences between reference and test streams in the NBR or SRP

northern basin and 1 range snake river plaipiaipialplain n northern rockyI1 mountainsMOU ntciins mean itdstd CV mean itdstd CV mean itdstd CV

PHYSICAL

elevation m R 1756 135 8 1630 612 38 1131 298 26 T 1769 228 13 1586 355 22 1329 409 31 slope 21 R 41 33 80 37 35 94 33 14 43 T 16 10 65 18 12 71 23 14 63 discharge msnfsarsnrsm3s R 045 064 141 012 008 67 023 017 75 T 030 033 illiiilii111 023 025 illiiilil111 029 020 71 temperature CO R 112 33 29 126 40 32 75 26 35 T 151 33 22 157 42 27 97 26 27 width m R 38 12 32 34 14 43 60 24 39 T 35 20 56 51 24 48 63 30 47 widthdepthWidth depth ratio R 186 81 44 211 75 36 339 142 42 T 163 71 43 256 85 33 257 139 54 canodycanopy cover R 46 26 56 67 20 30 40 31 76 T 16 22 137 28 33 118 39 32 82 substratasubstratalSub strata size cmm R 150 72 48 158 49 31 316 139 44 T 73 65 88 94 52 55 312 117 37 Embeddedembeddednessness R 34 6 19 27 12 45 25 11 43 T 51 14 28 42 21 51 22 6 29

CHEMICAL

specific conductance limbos R 131 112 85 114 56 49 70 40 58 T 288 146 50 117 66 57 58 22 38 alkalinity eglmglm&lal cac03caboycacoy R 62 53 86 45 27 60 41 19 46 T 138 59 43 59 25 43 36 16 45 hardness eglmgl cac03caboycacoy R 88 57 65 48 30 63 T 190 61 32 66 32 49 ph R 82 04 5 82 04 5 80 04 5 T 84 02 3 78 06 8 77 01 1 nitrate eglmgl n03 R 009 006 69 007 003 48 T 007 003 49 008 006 75 phosphorus eglmglM p04PO R 006 004 57 013 013 101 T 010 011 106 026 023 86

BIOTIC RESOURCES

benthic organic matter gmegm2 R 1272 2401 189 229 194 85 T 768 951 124 465 828 178 ferlferiPenPeripenphytonperiphytonphyton chlorophyll a R TI71 85 120 156 177 113 453 473 104 mgcm2 T 283 647 229 181 238 131 228 138 61 Penpenphytonperipbytonphyton AFDM mgcm2 R 241 435 181 126 278 221 669 412 62 T 101 109 108 391 861 220 724 245 34

metric p 0100.10olo taxa p 0130.13 ecoregionsecoregions gesting this biotic scoring technique is robust whereas respective metric scores were essen- for assessing stream condition tially identical in the NRM metric p osl0510.51 taxa p 79tg79.79 fig 5 however combining discussion scores from metrics and taxa caused reference sites to have significantly greater average the primary goal of the study was to exam- scores than test sites in the NBR p 0020.02 ine a series of abiotic and biotic metrics for with 2 outliers removed and the SRP p assessing biological integrity in and2nd to ath4th ooi0010.01 indicating inclusion ofoftaxonomictaxonomic metrics order streams within the NBR SRP and NRM provided additional important biotic informa- ecoregionsecoregions of idaho collecting these baseline tion on stream condition the 2 outliers in the data from reference or best case streams and NBR actually had habitat assessment scores of degraded systems allows the development of 142 and 143 very close to the arbitrary separa- biological criteria for each ecoregionecoregion for use tion score of 144 for reference streams sug by resource managers in general the same 60 GREAT BASIN naturalist volume 58

IABLLTABLE 2 MDA factor coefficients foiroirolfor metrics and taxa found significant for discriminating between reference and test sites within each ecoecoregionecoiegionrexionregion separate analyses were completed foiformoimol metrics and specific taxa within each ecoregioneco region val- ues in bold indicate redundant metrics omitted from score development for that ecoregionecoregion see methods noinorthernthem snake northern metricmetriemetiicvaiiablevariable basin and range river plain rocky mountains taxa i icinessichnessrichness 1131.13 0450.45 EPTeptnchnessrichness 139 241 237 HBI 037 359 BCI EPTChironomidaeeptchironomidaeeptchnonomidae 1471471.47 231 ChironomidaeEPTeptchironomidaeeptchn onomidae 137 1071.07 oligochaeteoligochaetdoligoebaeta dominant taxa 078 086 Hydroiiydropsychidaehydropsychidaepsychidae 082 224 Shshannonannonss 4784.78 simpsinssimpsonsSimpsons 556 seiasciaserascraperspeispers 177 111 filterersfilterers 127 shreddersshredshieddeisdels 078 EPT taxa 246 278 chironomidae 0360.36 1561.56 oligochaeta chnahnchironomidaeonomidae 090 0870.87 taxon variable baetisbabtis 242 elmidaeelmidge 061ogi0.610 61 loi1011 01 0490.490 49 heptagenndaeheptageniidae ogi0910 91 capadazapada 0580 58 186 rhyacophilidae 128 brachycentrus 0480 48 0250.250 25 ephemeiephemerellidaeelhdae 0490.490 49 hexatomaHexhepatomaatoma capniidaecapnndae 030 drunella 0810.81 123 turbellaria 085 sialissiahssiehsstabs simuhdaesirnulidae 0750 75 1431.431 43

qualitative habitat assessment measures can be tionseions among streams within an ecoregionecoregion that used for evaluating habitat quality in each also are indicative of dominant land uses or ecoregionecoregion however additional research is nonpointnonpoint source pollution further although needed to test whether these differences in ionic concentrations tend to be higher in de- qualitative measures are associated with land graded streams this finding is more evident scape scale changes and nonpointnonpoint source pol- for streams in the NBR than in the SRP the lution in idaho see eg richards et al 1996 range in habitat assessment values is similar in in contrast some quantitative variables for both ecoregionsecoregions mean chlorophyll a values assessing aquatic habitats are important for also are 2 4xax higher in degraded sites than in distinguishing among stream types within and reference sites in the NBR and SRP acoreecore among ecoregionsecoregions these measures may better gions but the high variability among sites low- reflect gross changes in landscape properties ers the importance of this factor for assessing that are not evident in qualitative habitat assess- aquatic habitats our results suggest the impor- ments but more relevant to aquatic biota for tance of including additional quantitative mea- example measures of maximum water temper- sures water chemistry in particular in habitat ature substratasubsubstratalstrata size specific conductance and assessment protocols to more fully describe nutrients provide important additional infor- environmental conditions of a stream resh et mation to explain differences in habitat condi al 1995 current technology allows rapid and 199819981 bloassessmentbioassessmentBlOBIOASSESSMENT OF IDAHO STREAMS 61

3 1 NBR 2

0-

1

2

3

0 3 0a cn0 0 2 SRP 0 cc 1 L g 0 M

1

2

3

20.2 4 caCQ 6

4 NRM 2

0

2

4 test 6 reference

fig 3 histogram of multiple discriminant analysis root scores foiforgoigor individual streams within each ecoregionecoregion based on biotic metrics dotted line separates reference from test streams note the variation among streams within each ecoreacore gion accurate field determination of general chemi- metrics also differs between ecoregionsecoregions for cal characteristics and temperature regimes for example chironomidae and oligochaeta are aquatic systems which at times can override predominant in the NBR suggesting that met- the importance of other habitat measures in rics based on these organisms are important constraining benthic populations for discriminating among stream types in this Macromacroinvertebrateinvertebrate metrics derived from EPT ecoecoregionregion whereas filterersfilterers is important in taxa measures of dominance abundances of the SRESRP these findings further demonstrate chironomids and HBI are important for distin- the necessity of a multi metric approach to guiguishingshing among stream types in each ecoregionecoregion develop and refine biological metrics for spe- however the relative importance of some biotic cific regions of the country or a state to account 62 GREAT BASIN naturalist volume 58

3 NBR 2

0 limEIM M

1

2

0 0 2 3 80 4 cn 2 3 0 SRP 0 2 CC 1 Q im M dilJIL 0 EM AE

7 1

JS 2 3 E 0 4 C 1 X0 6 0

4 NRM 2 J

0

2.2 reference test 4

fig 4 histogram of multiple discriminant analysis root scores for individual streams within each ecoregionecoregion based on taxonomic groups see methods dotted line separates reference from test streams note the variation among streams within each ecoregionecoregion

for the natural regional variation observed for stream types by including measures based on lotic systems hughes et al 1990 however the most abundant taxa excluding chironomids readers are directed to barbour et al 1996 for and oligochaetes results indicate some taxa an alternative approach that applies a differen- as grouped by family low abundances pre- tial scoring regime for using the same biotic cluded use of some individual taxa in multi- metrics among regions variate statistics to be especially sensitive for we examined the potential of additional characterizing stream types also see resh and macromacroinvertebrateinvertebrate metrics to differentiate unzicker 1975 minshall 1996 for example 199819981 bloassessmentbioassessmentBlOBIOASSESSMENT OF IDAHO STREAMS 63

50ou NBR 40 0

30 A 0 Q 20 T iiiiiyn r 0 0 tsaggl 0r 10 L L 0 0 L- 0 1 R T R T R T D uu60fingin T 0 SRP 50 0 0 V 40 B Y

0 1 l MCQ 30 0 0 40 Q 0 Z 20 i rfeiorfei 0 W I1 CLS 10 0 Uy 4u 0 0u R T R T R T 60cr NRM 0 50ju ii 40 0 30 0 r E 20 LH 0 0 0 10

0 R T R T R T metric taxa both

fig 5 box plots for summed metric scores of reference and test streams within each ecoregionecoregion for biotic metrics and taxonomic groups separately and combined metric and taxa scores each box plot represents the median standard devia- tion and 90 confidence limits open circles are outliers that some family groups are more abundant in onomicgnomic metrics whether at the family genera reference eg elmidaeElmelmidgeidae heptageniidae and or species level greatly improves the informa- rhyacophilidae than in degraded streams tion content and biological relevance of proto- affirms that certain taxa may be especially good cols designed to assess lotic integrity eg indicators of habitat or water quality other robinson and minshall 1995b taxa are abundant enough at the genus level to in summary different metrics prove impor- compare among stream types hexatomaHexhepatomaatoma dru- tant for assessing ecological conditions in nella and brachycentrus the inclusion of tax streams from different ecoregionsecoregions in idaho 64 GREAT BASIN naturalist volume 58

the use of individual metrics also provides BAILEY RGR G 1989 ecoregionsEcoregions of the continents map important information concerning the kinds of USDA forest service intermountain region ogden UT pollution or changes in the types of pollution in BARBOUR MTM T J GERRITSEN GE GRIFFITH R fryden- affecting a or land use particular water body borg E mccaltonmccattonMcCATTON JSJ S WHITE AND MLM L BASTIAN for example similar types of land use may 1996 A framework for biological criteria for florida show different effects on streams among acoreecore streams using benthic macromaeromacroinvertebratesmacromvertebratesinvertebrates journal of gions because of regional differences in abiotic the north american benthologicalBenth ological society 15 185 211 and biotic properties lastly assessing the bio- BENKE AGA G 1990 A perspective on america s vanishing logical integrity of streams is complex and streams journal of the north american benthologi requires multiple measures that can elucidate cal society 9779 77 88 the diverse causes of ecological impairment BRAMBLETT RGR G AND KDD FAUSCH 1991 variable fish communities and the index of biotic integrity in a acknowledgments western great plains river transactions of the ameri- can fisheries society 120752120igo 752 769 BURTON TA 1991 monitoring stream substrate stability A number of individuals assisted in the suc- pool volumes and habitat diversity water quality cessful completion of this project D M ander- monitoring protocols report 3 idaho department son J check T curzon PD dey R gill P of health and welfare division of environmental koetsier DED E lawrence J mann J mihuc quality boise 8 appp TB mihuc SC minshallMmshallshailshali mladenkaMiadenka BURTON TA E COWLEY GWG W HARVEY AND B WICHERSKI GC 1991 protocols for evaluation and monitoring of moser A S M over- DCD CA nelson JSJ nelson streamriparianstream riparian habitats associated with aquatic com- field SES E relyea TV royer K sant S A munimunitiesties in rangeland streams water quality moni- thomas and JT varricchione we thank T toring protocolprotocolss report 4 idaho department of koch S langensteinLangen stem MJM J mclntyremcintyremeintyre M ing- health and welfare division of environmental quality 31 ham P olmstead C corsey S grunder B boise appp CHANDLER GL AND TR MARET 1993 protocols for smith and A van vooren for information on assessment of biotic integrity fish in idaho streams prospective field sites we appreciate the help water quality monitoring protocols report 6 idaho of J mende D parnshparashparrish and FE partridge of the division of health and welfare division of environ- idaho department of fish and game for assis- mental quality boise 25 appp tance at various times during the project and CLARK WH 1990 coordinated nonpointnonpoint source water quality monitoring program for idaho idaho depart- the of s 1989 data from use fisher benthic ment of health and welfare division of environ- streams in the northern rocky mountain eco mental quality boise 139 appp region B smith USFS salmon NF made pos- CLARK WH AND TR MARET 1993 protocols for assess- sible the selection and sampling of streams in ment ofbioticof biotic integrity maeromaceoinmacromacroinmacroinvertebratesmacroin vertebratesinvertebrates in idaho the panther cleekcreekgleekgreek catchment special thanks streams water quality monitoring protocols report 5 idaho department of health and welfare divi- go to WH clark RXR litke M mcintyremclntyremeintyre M J MJ sion of environmental quality boise 18 appp mcmasters and D zaroban of idaho depart- courtemanch DLD L 1996 commentary on the subsamsubram ment of health and welfare division of envi- pling procedures used for rapid bioassessmentsbio assessments ronronmentalmental quality and TRTR maret of the united journal of the north american Benthbenthologicalological society states geologic survey for advice and assistance 1538115 381 385 throughout the project study was funded CUFFNEY TFTE MEM E GURTZ AND MRM R MEADOR 1993 the methods for collecting benthic invertebrate samples through a grant from the idaho department of as part of the national water quality assessment health and welfare division of environmental program open file report 9340693 406 USU S geological quality we appreciate the constructive com- survey raleigh NC ments from TV royer and 2 anonymous re- DUNN AK 1990 water quality advisory working commit- tee designated stream segments of concern idaho viewers this paper is dedicated to the memory department of health and welfare division of envi- of dr timothy litke ronronmentalmental quality boise 52 appp FAUSCH KDD JRJ R KARR AND PR YANT 1984 regional literature CITED application of an index of biotic integrity based on stream fish communities transactions of the ameri- ALLAN JDJ D AND ASA S FLECKER 1993 diversitybiodiversityBio conser can fisheries society 11339113 39 55 vation in running watelwaters s bioscience 433243 32 43 FISHEKTRFISHER TR 1989 application and testing ofbioticof biotic integrity amerioamericanAMERIC AN PUBLIC HEALTH association 1992 standard in northern and central idaho headwater streams methods for the examination of water and waste- unpublished master s thesis university of idaho water american public health association ameri- moscow 180 appp can water works association and water pollution GALLANT ALA L TR WHITTIER DPD P LARSEN JMJ M OMERNIK control federation washington DC AND RBR HUGHESHUCHES 1989 regionalization as a tool for 199819981 bloassessmentbioassessmentBlOBIOASSESSMENT OF IDAHO STREAMS 65

managing environmental resources epa6003 89060 invertebrates australian journal of ecology 20 USEPA environmental research laboratory corval- 108 121 lis OR RESH VH AND JDJ D UNZICKER 1975 water quality monimoni- hilsenhoff WL 1988 rapid field assessment of organic toring and aquatic organisms the importance of pollution with a family level biotic index journal of species identifications journal oftheodtheof the water pollution the north american Benthbenthologicalological society 7657 65 68 control federation 47947 9 19 holmhansenHOLM HANSEN 0 AND B RIEMAN 1978 chlorophyll a RICHARDS C GEG E HOST AND JWJ W ARTHUR 1993 identi- determination improvement in methodology oikosbikos ficationfication of predominant environmental factors struc- 3043830 438447438 447 turing stream macromacroinvertebrateinvertebrate communities within HUGHES RMR M AND RER F NOSS 1992 biological diversity a large agricultural catchment freshwater biology and biological integrity current concerns for lakes 2920529 205 214 and rivers fisheries 171117 11 19 RICHARDS C LBL B JOHNSON AND GEG E HOST 1996 land HUGHES RM TR WHITTIERWHIT TIER CM ROHM AND DP scape scale influences on stream habitats and biota LARSEN 1990 A regional framework for establishing canadian journal of fisheries and aquatic sciences recovery criteria environmental management 14 53295 311 673 683 ROBINSON CTC T AND GW MINSHALL 1986 effects of dis- KARR JRJ R 1991 biological integrity a long neglected turturbancebance frequency on stream benthic community aspect of water resource management ecological structure in relation to canopy covelcover and season applications 1661 66 84 journal of the north american benthologicalBenthological society KARR JRJ R KDK D FAUSCH PL angermeier PR YANT AND 52375 237 248 IJI1 J SCHLOSSER 1986 assessing biological integrity 1995a biological metrics for regional biomomtorbiomonitor in running waters a method and its rationale special ingmg and assessment of small streamssti earnsearms in idaho final publication 5 illinois natural history survey report state of idaho division of environmental MATTHEWS WJ DJD J HOUGH AND HWH W ROBISON 1992 quality boise 94 appp similarities in fish distribution and water quality pat- 1995b effects of open range livestock grazing on terns in streams of arkansas congruence of multi- stream communities pages 39 48 in KEK F steele edi- variate analyses copeiacopela 19922961992 296 305 tor animal waste and the land water interface lewis MINSHALL GWG W 1996 bringing biology back into water publishers boca raton FL quality assessments pages 289 324 in freshwater ROSENBERG DMD M AND VH RESH 1993 introduction to ecosystems revitalizing educational programs in lim- freshwater bioblomonitoring and benthic macroinvertemacromverte nology water science and technology board com- brates pages 1 9 in DMD M rosenberg and VH resh mission on Geogeosciencessciences environment and resources editors freshwater biomonitonngbioblobiomonitoringmonitoring and benthic national research council USA maeromacromacroinvertebratesmacromvertebratesinvertebrates chapman hall new york PLAFKIN JLJ L MTM T BARBOUR KDK D PORTER SKS K GROSS southerland MTM T AND JB STRIBLING 1995 status of AND RMR M HUGHES 1989 rapid bioassessmentbioassessment pro- biological criteria development and implementation tocols for use in streams and rivers benthicbentbic macroinmaceoinmacroemacrom pages 81 96 in WS davis and TP simon editors vertebrates and fish USEPA epa4444 89 001 biological assessment and criteria tools for water PLATTS WS WE MEGAHAN AND GW MINSHALL 1983 resource planning and decision making lewis pub- methods for evaluating stream riparian and biotic lishers boca raton FL conditions general technical report INT 138 STRAHLER ANA N 1957 quantitative analysis of watershed USDA forest service intermountamintermountain forest and geomorphology american geophysical union trans- range experiment station ogden UT 70 appp actions 3891338 913 920 REICE SRS R AND M wohlenbergWOHLEN bergBERC 1993 monitoring STEEDMAN RJR J 1988 modification and assessment of an freshwater benthic macromacroinvertebratesinvertebrates and benthic index of biotic integrity to quantify stream quality in processes measures for assessment of ecosystem southern ontario canadian journal of fisheries ardand health pages 287 305 in DMD M rosenberg and VH aquatic sciences 4549245 492 501 resh editors freshwater bioblomonitoring and benthic tabachnick BGB G AND LSL S FIDELL 1989 using multi macromaeromacroinvertebratesmacromvertebratesinvertebrates chapman hall new york banatevariatevanate statistics 2ndand edition harper collins pub- RESH VH AND JKJX JACKSON 1993 rapid assessment lishers inc new york approaches to bioblobiomonitonngbiomonitoringmonitoring using benthic macroinmaceoinmacroemacrom WINGET RNR N AND FA MAGNUM 1979 biotic condition vertebrates pages 195 233 in DM rosenberg and index integrated biological physical and chemical VH resh editors freshwater biomonitoringbioblomonitoring and ben- stream parameters for management in aquatic thic macromaeromacroinvertebratesmacromvertebratesinvertebrates chapman hall new york ecosystem inventory macroinvertebratemacro invertebrate analysis RESH VH AND EPE P mcelravy 1993 contemporary USU S forest service intermountain region contract quantitative approaches to bioblobiomonitonngbiomonitoringmonitoring using ben- no 40 84 m8ma 8 524 brigham young university thic macromvertebratesmacroinvertcbrates pages 159 194 in DMD M provoprovostprovoutProvoUTUT rosenberg and VH resh editors freshwater bio ZAR JHJ H 1984 Bio statistical analysis 2ndand edition pren monitoring and benthic macromaeromacroinvertebratesmacromvertebratesinvertebrates chap tice hall inc englewood cliffs NJ man hall new york RESH VH RHR H NORRIS AND MTM T BARBOUR 1995 design received 18 december 1996 and implementation of rapid assessment approaches accepted 2 september 1997 for water resource monitoring using benthic macro great basin naturalist 581 C 1998 appp 66 75

BATS OF THE WHITE AND INYO MOUNTAINS OF california NEVADA

joseph M Szewczakszewczakl2szewczak1212 susan M Szewczakszewczak11 michael L MornsonMorrison 3 and linnea S hallahall3hai13

ABSABSTRACTRAur1 we surveyed bats thithl oughoutthroughout the white and inyo mountains of california and nevada from december 1990 to november 1996 we surveyed hibernating bats and foraging bats from june 1992 to september 1996 the white inyo range rests in a unique biogeographical junction between the sierra nevada mojave desert and great basin regions elevational gradients of 305 4340 in combined with limited human development furtherfulfui ther enhance the interest of natural history and faunal distributions in this range we found 13 bat species in the course of 2668 observa- tions thieethree of these species the spotted bat eddennaeudennaeudermaEudennadehnadermaberma maculatummaculatum silver haired bat lasionycteris noctivagantnoctivagans and hoary bat Lasilasiuruslasiumsufusurus cinereus have no previous records from the white inyo range we found bats in all vegetation zones except the alpine 3500 4342 in despite an abundance of mines in this range only townsend s big eared bat corynorhinus townsendii and the western small footed myotismayotis myotismayotis ciliolabrumciholabrumciliolabrum used them routinely our data also indicated the importance of surface water to bat populations in and regions

key words bats chiroptera great basin vegetation zones habitat desert and regions water source hibernation

the white inyo range rests in the junction characterize how each bat species uses avail- of 3 faunal regions the sierra province to the able mine resources we report observations west mojave to the south and great basin to from both foraging and hibernating bats the east because this range rises abruptly on its because the white inyo range remains rela- east and west sides animals can readily access tively undisturbed habitat this baseline may a variety of vegetation types over short linear prove useful for tracking longtermlong term alterations distances in addition to altitudinal differences in environment since many researchers con- vegetation communities are enhanced by a vari- sider bats to be sensitive indicators of environ- ety of edaphic sites resulting from the range s mental change kunz 1982 mccracken 1986 high lithographic diversity elliot fisk 1986 thomas 1988 these data also provide useful despite this interesting biogeographical setting comparisons for other ranges in the region faunal distributions of the range have received thousands of abandoned mines lie on public little attention morrison et al 1993 provided and private lands shields et al 1995 the the first thorough study of bird distributions importance of these mines as reservoirs for and habitat use in the white inyo range wildlife displaced from natural habitats has however no systematic survey of bats and gained increasing recognition tuttle and tay- their habitat associations in these mountains lor 1994 and documenting patterns of mine has been undertaken hock 1963 summarized use by bats in the white inyo range may results of a handful of general collecting trips prove useful for present and future manage- from 1917 to 1958 that yielded some bat speci- ment efforts mens this summary plus an unpublished manuscript from a field course at university of STUDY AREA california at davis brosius et al ca 1974 con- stitute all prior records the white and inyo mountains extend for our objectives were to provide a detailed approximately 175 km forming a contiguous account of bat distributions throughout the range trending north south and lying just east white inyo range assess how each species of and parallel to the sierra nevada the white utilizes the different vegetation zones available mountains comprise the northern half located to it along the range s elevational gradient and within inyo and mono counties california

snivelI1 universitysity ofot california white mountain research station 3000 east line st bishop CA 93514 uthaiuthoi to whom oiiespondencecorrespondence should hebe addressed 3departmentdelaidepaldepai tmentament of biological sciensselensscienselensciencess california state university saciamentoSaciasacrarnentosacramentomento CA 95819

66 199811998 BATS OF THE WHITE INYO RANGE 67 and extending into esmeralda county nevada could observe bats foraging over open vegeta- on their northern reach the inyo mountains tion away from water we could seldom capture extend to the south and lie entirely within inyo such individuals therefore most of our cap- county california elevational gradients span tures occurred at sources of water that from 300 in at the eastern base of the inyo attracted bats springs pools troughs and mountains in saline valley california to the stream corridors we assume these records 4342 m summit of white mountain peak cali- represent bats observed foraging in the vicinity fornia annual precipitation varies from less of those water sources than 10 cm at the base of the range to approxi- foraging bats were captured over approxi- mately 50 cm along the northern crest of the mately 200 person days in the field from may white mountains oglesby 1985 peterson through october 1990 1996 we used mist 1986 the owens and chalfant valleys cali- nets or a harp trap set across open flyways near fornia form a continuous valley separating the water sources four bats recorded in this study range from the sierra on the west while the were hand captured from buildings at deep east side of the range descends into a series of springs college inyo county california we valleys from north to south they are fish lake keyed each specimen to species ingles 1965 valley located within california and nevada barbour and davis 1969 hall 1981 deter- and deep springs valley eureka valley and mined gender and reproductive status if saline valley all within california although female and then released it we typically we centered this survey on the white inyo maintained the nets from dusk to local 2330 h range to fulfill our goal of assessing eleva- depending upon activity which normally trailed tional range we elected to extend our survey of off around 2230 h occasionally we maintained foraging bats into the valley floors at the base nets throughout the night but made few addi- of these mountains bats foraging in these tional captures areas may depend upon rocky outcrops and although troublesome to differentiate in other features of the mountains for boostsroosts and other regions M ciliolabrumciliolabrum and M californi hibernacularhibernaculae cus were readily distinguished in the white five primary vegetation zones occur in the inyo range the white inyo M ciliolabrumciliolabrum white inyo range along elevational gradients has a distinctive straw colored pelage with a 1 mojave mixed desert scrub characterized highly contrasting dark facial mask and ears by the presence of creosote bush larrea tri the M califomicus we encountered has a chest- dentadentatatd 300 1200 in 2 great basin desert nut brown pelage with much less contrast to scrub where shadscaleshadscale atriplex confertifoliaconfertifolia the facial mask and ears barbour and davis is the most common species 1200 2000 in 3 1969 hall 1981 pinyon juniper forest predominantly single we also recorded bats we could identify leaf pinyon pinus monophylldmonophyllamonophyliaphylla interspersed without capture in 2 instances with the aid of with utah juniper Junijuniperasjuniperusperas osteosperma binoculars we identified roosting brazilian 2000 2900 in 4 bristlecone limber pine for- free tailed bats daridatadaridatadatidaTaTadaTida brasiliensis we then est or subalpine a mixture of these 2 trees counted individuals as they emerged in the pinus longaevalongaeva and pinus flexflexilisilis 2900 3500 evening we similarly assessed a colony of pal- m and 5 alpine characterized by the absence lid bats anttoantiozousAntioAntroantrozouszous pallpallidusidus the audible calls of trees 3500 4342 in of the spotted bat eudermaeudeemaEuderma nwulatummaculatummaculatumtom enabled species recognition without specialized equip- METHODS ment and supplemented capture records for this species foraging bats hibernating bats we considered bats on the wing from may to october to be foraging although active bats we considered inactive bats between the are occasionally seen during fair winter weather months of november and march to be hiber- barbour and davis 1969 these flights may nating from december 1990 to november not necessarily be for foraging whitaker and 1996 we surveyed 2 natural caves and approxi- rissler 1989 we surveyed throughout the mately 260 mines for hibernating bats working range in all vegetation zones between june approximately 125 person days in the field we 1992 and september 1996 although we often entered the mine or cave and visually inspected 68 GREAT BASIN naturalist volume 58 all accessible reaches paying particular atten- TABLE 1 compiled observations of bats in the white inyo range 1990 1997 with records shown in tion to crevices in the walls and ceilings we previous in parentheses previous specimen number for myotismayotis volans took care to minimize disturbance to bats and is inexact as it was described as many from 3 locations other inhabitants by limiting direct light con- museum of vertebrateofvertebrate zoology tact and moving quietly through the mine or number number cave species determinations weiewelewere made by observed observed noncontact inspection to avoid disturbance species foraging hibernating all were identified easily fortunately species Tadarida brasiliensis liss118551185 5 in this way M ciliolabrumcilio labrum was often found eudmaeudamaeuderma maculatummaculatum 91 5 10 cm deep in crevices but was recognizable corynorhinus townsendii 452 47913479 13 by its size pointed tragus straw colored fur Antroantrozouszous pallpallidusidus 854 2 2 and almost black facial mask barbour and lasionycterislasionyctens noctivagantnoctivagans lasiurusLasiurus cicinereuscinereousnereus 27 davis 1969 hall 1981 using a mercury field pipistrellus hesperus 41018410 18 4 thermometer ac1c accuracy we recorded air eptesicusjuscuseptesicus fuscuspuscus 1004loo100 4 1 temperature in the immediate vicinity of roost myotismayotis elotisevotis 123 volans 103 14 1 bats myotismayotis 10314 ing myotismayotis califorcalifornicuscaliformcusnicus 152 previous capture records myotismayotis ciliolabrumciliolabrum 334 49 myotismayotis luciflucialucifugusf1aaa gust 1 we searched for previous capture records of myotismayotis yumanensisyumanensist 243 white inyo bats at the los angeles county TOTALS 2132602132 60 53613536 13 museum of LACM museum natural history threethicethiee captured in mist nets other records from acoustic detection see text of vertebrateofvertebrate zoology at berkeley MVZ west- tweTOe have not listed M lucifuustucilucilucifugvsfuus described by harris 1974 see text ern foundation of vertebrate zoology WFVZ and among the holdings of the university of california white mountain research station we found bats in all vegetation zones except we included these records in our tabulation of alpine fig 1 the great basin desert scrub observed species and range distributions zone had the highest species richness with 13 species including the LACM M lucifuguslucifugous RESULTS record pinyon juniper was the next richest zone wherein we recorded 10 species we re- we encountered a total of 13 bat species corded 9 species in the mojave mixed desert from 2668 observations during our survey scrub zone we found only 3 species in the table 1 three species E maculamaculatumtum silver bristlecone limber pine zone of those 3 only haired bat lasionyctenslasionycteris noctivagantnoctivagans and E fuscus and M volans were observed forag- hoary bat lasiurusLasiurus cinereus were not previ- ing in the zone whereas C townsendii was ously recorded in the white inyo range the recorded hibernating little brown bat myotismayotis lucifuguslucifugous had I1 previ- the single richest site surveyed was the ous record from this range LACM we did not lower portion of cottonwood creek where it encounter it in our survey see myotismayotis yuma enters fish lake valley above the oasis ranch bensisnensis comments in discussion although it is on the east side of the white mountains tst5s known in the nearby sierra hall 1981 T rneRKE seesec 33 1600 in elevation at this site brasiliensis E maculatummaculatum townsend s big we captured 12 species on separate occasions eared bat corynorhinus townsendtownsendiitownsendiaii A pal T brasiliensis E maculamaculatumtum C townsendtownsendiitownsendiaii A lidusaidus western pipistrelle pipistrellus hespe- pallpallidusidus L noctivagantnoctivagans L cinereus P hespehesperusTw rus big brown bat eptesicus fuscus long E fuscus M volans M califomicus M cilio legged myotismayotis myotismayotis volans and western labrum and M elotisevotis the most productive small footed myotismayotis myotismayotis ciliolabrumciliolabrum were night at this site was 15 august 1995 during all found in both the white and inyo moun- which 20 T brasiliensisbrasifiensis I1 E maculatummaculatum 4 A tains portions of the range L noctivagantnoctivagans L pallpallidusidus 4 L cinereus 13 P hesperus 9 E fus- cinereus long eared myotismayotis myotismayotis elotisevotisevotis cus 2 M volans and I1 M ciliolabrumciliolabrum were and california myotismayotis myotismayotis californicuscaliforcaliformnicuscascus mist netted during a 2 h period however were found only in the white moun- despite an abundance of carbonate rocks tains portion of the combined range M yuma throughout the white inyo range only I1 cav- bensisnensis was found only in the inyo mountains ern is known 2090 inm located near westgard 199819981 BATS OF THE WHITE INYO RANGE 69

elevation in feet foraging fangerange 2000 4000 6000 8000 10000 12000 14000 hibernating range great plnyonpanyon bristeconebnstleconebristleconebristecone mojave mixed basin sniperuniperiuniper alpine desert scrub desert scrub forest limber pine forest Todarida brasitiensisbrasiliensis

eudermaeudeema maculamaculatumtum

corynorhlnuscorynorhinus townsendtownsendlltownsendlillli senNEW

antrozousAntro zous palliduspallidus lasionycteris noctivagantnoctivagans 6mmmi

lasiurusLasi urus cinereus pipistrellus hesperus eptesicus fuscus

myotismayotis elotisevotis

myotismayotis volans

myotismayotis californicuscehfornicuscalifornicus

myotismayotis ciliolabrumcitiolabrumcilio labrum EMEM

myotismayotis lucifuguslucifugous

myotismayotis yumanensis

1 isoiao1000 20002 00 30300000 40004 00 elevation in meters

fig 1 elevational distribution of foraging and hibernating bats in the white inyo range showing vegetation zones

pass california this cavern extends approxi- species within a mine we never observed M mately 50 m inward with ceiling heights up to ciliolabrumcikolabrumcikociliolabrum hibernating together but C town about 25 m this cavern remains undisturbed sendil were observed in clusters as large as because it is protected by a locked gate and approximately 50 individuals we observed only remote location and is relatively inaccessible I1 individual each of E fuscus L noctivagantnoctivagans because of its vertical entrance however fol- and M volans hibernating in mines in mines lowing 4 visits over separate years we observed below 1500 m we encountered bats in approx- only a single C townsendii hibernating within imately 25 of mines 3 m in length above it A single C townsendii was observed hiber- 1500 m elevation approximately 50 of mines nating in a 2 m deep natural pocket in a dolo- 3 m in length contained at least 1 bat these mite formation in the southern end of the white estimates of mine use are based upon our gen- mountains 1890 m on 2 occasions 5 decem- eral impressions only because it was not possi- ber 1991 and 18 february 1995 an active L ble or deemed safe to enter every mine or to noctivagantnoctivagans was found in a dormitory hallway survey every part of the mines we did enter at deep springs college because of their con- dition and the dates we assumed they had species accounts been hibernating on the premises all other Thdarida brasiliensisbraszliensis hibernation observations were from mines we found C townsendtownsendiitownsendiaii and M ciliolabrumciliolabrum T brasiliensisbrasihensis was found at the lower eleva- hibernating in mines throughout the range tions of the inyo mountains and southernmost these species were observed hibernating with- portion of the white mountains lower cotton- in about 40 cm of each other however we wood creek above oasis ranch mono co often encountered lone individuals of either california tst5s r37e seesec 33 1600 m we 70 GREAT BASIN naturalist volume 58 observed a dispersed colony of 1028 at the RKE sec 5 1600 inm and I1 female on 25 july base of mcelvoy canyon on the east side of the 1992 at a concrete water trough at the north- inyo mountains inyo co california 640 in west end of saline valley lake at 305 in inyo we describe this colony as dispersed because co california t14s r38e sec 27 we ob- they roost in a series of overhanging ledges served 36 individuals exiting a maternity roost along the narrow canyon wall rather than a at the base of the white mountains in deep single site A perennial stream flows through springs valley inyo co california 1705 in the canyon below the boostsroosts we counted these and a single male carcass was found in a build- bats on 26 july 1992 as they flew overhead ing at oasis ranch in fish lake valley on the after emerging heading in the direction of east side of the white mountains mono co saline valley this site appears vacant during california tst5s rneRKE sec 28 1530 in A winter A crevice in a large boulder above the maternity colony of several hundred is known deep springs dairy inyo co california tst7s on the west side of the white mountains inyo r36e sec 1 1590 m hosts more than 100 T co california 1710 in patricia brownbrownberryberry brasiliensis for several weeks during the spring personal communication this bat is also known perhaps a stopover during migration on 19 to roost in lava tube caves on the western slope august 1996 we found a small colony at the of the inyo mountains at approximately 1380 entrance of a dolomite mine at the western base in denyse racine california department of of the inyo mountains near the shoreline of fish and game personal communication the owens dry lake inyo co california we remaining C townsendtownsendiitownsendiaii observations were of could not determine the number of bats in this hibernating individuals six bats were observed colony but from the limited guano deposit and hibernating in a white mountain mine at 3188 apparent configuration of the crevice perhaps in on 28 november 1992 the highest observa- no more than several dozen were present tion of this survey the majority of mines we entered during the winter months above 1500 eudennaeddennaeuderma maculatummaculatum in harbored at least 1 C townsendii this bat three E maculatummaculatum were captured along distributed itself well among the available lower cottonwood creek on the east side of hibernaculaehibemaculaehibernacular rather than concentrating within the white mountains mono co california a few selected sites the 7 largest concentra- tst5s rner37eRKE sec 33 1600 in 2 males on 17 tions observed per mine were 80 51 40 25 august 1993 and I1 female on 14 august 1995 25 20 and 19 bats the group of 80 was found based upon audible calls of this species we in the inyo mountains at 2140 in elevation found it to be a common forager among mid with an air temperature near the bats oficof5cof YC on elevation riparian corridors of the range down 12 february 1995 the group of 51 was found to the owens dry lake bed inyo co califor- in the white mountains at 2400 in elevation nia west side of inyo mountains 1080 in we and an air temperature near the bats of 4cac on would typically hear E maculatummaculatum from 12 february 1994 inyo co california seven shortly after twilight until the early morning individuals were found in a mine complex on hours from april through october we rou- the west side of the white mountains on 25 tinely heard E maculatummaculatum foraging over the february 1993 mono co california we fields and buildings of deep springs college observed these bats in a lower adit with an air inyo co california tst7s r36e sec 1 1600 temperature near them of 3cac in latest in the year this bat was heard at the Antroantrozouszous pallpallidusidus deep springs college was 9 november 1996 we found A pallpallidusidus at scattered locations corynorhinus townsendtownsendiitownsendiaii throughout the inyo mountains below 1710 in three foraging C townsendtownsendiitownsendiaii were captured and as low as 430 in at saline valley hot springs during this survey I1 male in queen canyon at inyo co california t13s r39e sec 18 our the northern end of the white mountains on 9 only observations of this bat in the white july 1992 esmeralda co nevada TIN r33e mountains occurred at lower cottonwood creek sec 32 2410 in 1 male at lower cottonwood mono co california tst5s r37e sec 33 1600 creek on the east side of the white mountains inm there is a maternity roost in a side entrance- on 27 august 1992 mono co california tst6s way of the deep springs college boarding 199819981 BATS OF THE WHITE INYO RANGE 71 house inyo co california 1600 m from which nia t14s r37e seesec 1 790 m we often ob- we counted 39 bats exiting on 5 august 1994 served this species emerging well before dark bats presumably from this colony can often our highest elevation capture was a male on be seen night roosting at various sites around 22 july 1992 at 2740 ra in the inyo mountains the college during the summer this roost re- at mexican spring inyo co california tiss mains vacant during the winter we captured I1 r38e seesec 34 P hesperus is known to be spo- male and 1 female on 18 june 1996 and radically active throughout the winter bar- another female on 9 july 1996 on the eastern bour and davis 1969 and we observed it in shore of owens dry lake north of the town of the late afternoon and early evening flying over keeler inyo co california tigs r38e seesec and coming down to sip from the hot spring 313110801080 m pools in saline valley east of the inyo moun- tains in february and march 1994 inyo co lasionyderislasionycteris noctivagantnoctivagans california t13s r39e seesec 18 over the we captured a male L noctivagantnoctivagans in the course of 7 nights between 6 april 1996 and 18 white mountains at the lower cottonwood september 1996 we captured 30 P hesperus creek site mono co california tst5s r37e over small ponds on the eastern shore of secsee 33 1600 m on 11 june 1996 A female L owens dry lake near the town of keeler inyo noctivagantnoctivagans was captured in a dormitory room co california tigs r38e secsee 31 t17s at deep springs college inyo co california r38e seesec 5 t17s r38e seesec 22 all at 1080 our 4 hibernation observations of this bat tst7s r36e secsee 1 1600 m on 8 october 1991 m on 5 december 1991 we observed an individ- occurred at the lowest mines we surveyed ual hibernating in a drill hole in a mine devel- 1340 1400 m inyo co california air tem- oped in dolomitic marble on the southern peratureperature near the bats in these mines was slope of the white mountains inyo co cali- warmer 15c than temperatures we encoun- fornia 2050 m another individual was cap- tered at higher elevations a situation not ideal tor- tured in the dormitory wing of deep springs for minimizing energy expenditure during to foraging during college on 18 february 1995 from the condi- por but perhaps conducive and tion of this bat and the time of year it had occasional winter mild spells barbour probably aroused from hibernating on site davis 1969 ofarrell and bradley 1970 eptesicusfuscuseptesicus lasiurusLasiurus cinereuscicinereousnereus fuscus we captured E fuscus along the lower sec- we captured 1 female and 3 males at 2090 tions of perennial streamstreamflowsflows of the white m along chiatovich creek esmeralda co mountains all drainages in which we cap- nevada TIS secsee 29 on 6 july 1992 r34e tured this bat were upstream from ranches and 17 females and 7 males at 1590 ra along with established agricultural fields hock 1963 cottonwood creek mono co california tst5s listed this bat as occurring up to 3090 m in the secsee 33 the side of the r37e both on east white mountains unfortunately we do not white mountains another male was captured know whether this referred to a hibernating or wyman on 26 june 1992 along creek at 1920 foraging individual on 26 june 1993 we found the moun- m on the southern reach of white E fuscus foraging along lone tree creek on tains inyo co california tst6s r36e secsee 22 the west side of the white mountains at 2070 these drainages all have stands of cottonwood m mono co california tst3s r33e seesec 33 populus fremonfremontiifremontiatii a large leafed tree consid- we found a single hibernating bat in a mine ered desirable to this tree roostingboosting species tunnel in the white mountains on 12 february barbour and davis 1969 1994 at 2500 m inyo co california A stor- pipistrellus hesperus age shed at deep springs college inyo co california tst7s r36e secsee 1 1600 m serves as P hesperus is the most common bat we cap- a night roost for about 3 dozen of these bats tured in mist nets most captures occurred however the day roost location for this group within the ist hour after sunset on 26 july remains unknown on 16 august 1996 we cap- 1992 we netted 51 females and 37 males at a tured a post lactating female over a small pond pool in mcelvoy canyon on the east side of on the eastern shore of owens dry lake inyo the inyo mountains in 151.5isls h inyo co califor co california tigs r38e secsee 31 1080 m 72 GREAT BASIN naturalist volume 58

myotismayotis elotisevotis at the lone tree creek headheadworksworks mono co california sec 33 2070 also we found M elotisevotis along the lower drain- tst3s r33e in on ages of the white mountains and up through the west side of the white mountains three other females were captured along the lower the pinyon juniper zone our highest capture portion of cottonwood on separate for this species occurred on 8 july 1993 at 2470 creek along chiatovich creek esmeralda co occasions mono co california t5s r37e in sec ts nevada TIS r33e sec 35 where we cap- 33 1660 in tured 1 male and I1 female however the MVZ myotismayotis ciliociliolabrumciholabrumlabrum lists a 1954 record from cottonwood creek white mountains mono co california at together with C townsendtownsentownsendntownsendiitownsendiadnii M ciliolabrumciliolabrum was only bat 2895 in A female M elotisevotis was captured the other we commonly found beside a storage building at deep springs col- hibernating in the white inyo range our highest hibernating observation of M cilio lege inyo co california tst7s r36e sec 1 1600 m on 4 september 1992 all other cap- labrum occurred on 12 february 1994 at 2500 tures were at water sites in in the white mountains inyo co califor- nia and our lowest was on 23 december 1990 myotismayotis colonsvolans at 1710 inm in a small mine on the northwest M volans was well distributed throughout slope of deep springs valley inyo co cali- the white inyo range in the great basin fornia we usually found this bat well up into a scrub and pinyon juniper zones we observed crevice and hibernating alone even among a a single hibernating M volans during this sur- group of tunnels however we found 10 dis- vey in a mine at the north end of the white tritributedbuted through a mine in marble canyon on mountains on 31 january 1993 esmeralda co the east side of the inyo mountains inyo co nevada 2770 in our highest foraging obser- california 2260 in we found M ciliolabrumciliolabrum vation ofofmM volans occurred at mexican spring foraging throughout the great basin scrub and toward the southern end of the inyo moun- pinyonpryonpmyon juniper zone of the range our highest tains at 2740 in inyo co california tiss foraging observation for this species was a r38e sec 34 however the MVZ also lists a male captured at mexican spring toward the 1954 record of many specimens of this bat southern end of the inyo mountains on 22 july from cottonwood creek white mountains 1992 at 2740 in inyo co california t15s mono co california at 2895 inm our lowest r38e sec 34 the lowest was a pregnant capture of this bat was a male netted on 25 female we captured over the runoff of a spring august 1992 at a road stream crossing in silver on the eastern shore of owens dry lake j17st17s canyon on the west side of the white moun- r38e sec 9 1080 in on 30 may 1996 tains at 1410 inyo co california in tst6s r34e myotismayotis lucifuguslucifugous sec 24 on 19 june 1996 we captured a non- reproductive female over a small pond on the we did not encounter M lucifuguslucifugous during eastern shore of owens dry lake near the town our survey but the LACM lists a specimen of of keeler inyo co california t17s r38e M lucifuguslucifugous from lower wyman canyon in the sec 5 1080 in southern white mountains from may 1972 inyo co california t6s r36e sec 23 1740 myotismayotis nicus ts califorcalifornicuscaliformcus in however we believe a discrepancy exists we captured M califorcalifornicuscaliformcusnicus at 4 sites in the regarding the myotismayotis species in the owens white mountains along its lower slopes in the dry lake area our comments in this regard great basin scrub zone and up into the begin- are in the discussion below ning of the pinyon juniper zone on 24 july myotismayotis yumanensis 1995 and 3 august 1995 a female M califormcafifomicalciform cus was found ostingroostingboostingro during the day in a we captured 24 specimens of this bat along classroomclassi oom at deep springs college inyo co the eastern shore of owens dry lake on the california tst7s r36e sec 1 1600 in on 25 southern end of the inyo mountains the most august 1992 we captured a female at a road prolific activity occurred over a small pond stream crossing in silver canyon on the west several km north of the town of keeler inyo side of the white mountains inyo co cali- co california tigs r38e sec 31 1080 in fornia tst6s r34e sec 24 1410 in and 2 males there we captured 8 lactating females and 1 199819981 BATS OF THE WHITE INYO RANGE 73 volant juvenile male on 9 july 1996 at another fers successfully utilizing such different envi- small pond closer to keeler we captured I1 lac- ronronmentsments as mojave mixed desert scrub and tating and I1 pregnant female on 19 june 1996 pinyon juniper forest suggests an ability to inyo co california t17s r38e sec 5 1080 exploit a variety of foraging strategies and prey m these records indicate the presence of a selection such adaptability may seem surpris- maternity roost in the keeler vicinity on 24 ing in view of evidence that this species re- august 1995 we netted a female at the sulfate mains threatened over much of its original range well on owens dry lake inyo co california former c2ca species and california species of t17s r38e sec 18 and a male and a female special concern however this result is consis- on 14 september 1995 near the eastern owens tent with other studies indicating that roost lake margin inyo co california tigs r37e disturbance may be a more decisive factor in sec 26 we also observed these bats flying to this bat s decline than habitat disturbance pier- foraging sites on the lake bed at dusk presum- son and rainey 1994 the remoteness and low ably heading out from roost sites east of the human population density of the white inyo lake at the base of the inyo mountains range reduce human disturbance as a factor however the remoteness of this range also discussion provides relatively undisturbed foraging habi- tat thus the relative effect of roost vs habitat 13 bat we encountered in of the species disturbance cannot be separated in fact the this survey none specialized in any of the 5 situation in the white inyo range could also vegetation zones of the white inyo range all be interpreted to suggest that C townsendtownsendiitownsendiaii species overlapped with at least I1 other zone requires undisturbed boostsroosts and foraging habi- although for L noctivagansnoctivagant L cinereuscicinereousnereus and tat to thrive interestingly the modern white M califomicus the overlap from the great basin inyo population of C townsendtownsendiitownsendiaii may exceed desert scrub into the pinyon juniper zone was prehistoric numbers humphrey and kunz limited E maculatummaculatum C townsendtownsendiitownsendiaii P hespe- 1976 concluded that this bat is a capable colo- rus E fuscus and M volans were all found which foraging over 3 zones including the hibernat- nizer it naturally boostsroosts in caverns this of this C ing observations C townsendii extended its rarely occur in range because range through all zones in which we observed townsendtownsendiitownsendiaii has only recently begun roosting in basically bats we observed only E fuscus and M volans the area within the many mines cre- foraging in the higher bristlecone limber pine ated in the last century zone compared with 9 foraging species in the we should note that our survey shows a bias pinyon juniper zone in contrast morrison et toward activity in riparian corridors and other al 1993 observed 61 bird species in the areas with water as those were the only places bristlecone limber pine zone 3 more than in in which we could effectively capture foraging the pinyon juniper zone the reduced bat for- bats with this bias the comparative richness we aging activity in the bristlecone limber pine measured in the great basin desert scrub zone zone may result from the diurnal vs nocturnal may instead depict the richness of a wetland habits of birds vs bats and these bats exclusive environment in the milder climate of this lower insect diet the higher elevation of the bristle- elevation zone compared with the others thus cone limber pine zone elicits colder nocturnal it may not accurately reflect general compara- temperatures causing impoverished nocturnal tive trends in species richness in these zones insect activity wellington 1945 graham 1983 bats typically sip water by skimming over it found a similar decrease in bat species moving kunz 1982 and thus require water sources up an elevational gradient in the peruvian with an open surface we visited point water andes sources in the inyo mountains with such con- C townsendtownsendiitownsendiaii foraged in 3 different vegeta- stant bat activity that we did not risk setting tion communities fig 1 this bat is a known mist nets too near them because such water lepidopteran specialist barbour and davis 1969 sources are the only ones available for many clark et al 1993 while some lepidopteran kilometers in any direction it seems clear that species may be found throughout these vegeta- entire populations depend upon these isolated tion communities the overall species composi- sources we recommend that wildlife manage- tion among these communities most likely dif ment planners consider the impacts of such 74 GREAT BASIN naturalist volume 58 water sources upon bats in addition to other of M yumanensis barbour and davis 1969 wildlife for example the seemingly harmless herd and fenton 1983 harris s conclusion cessation of water flow to an old trough may was based solely upon 10 museum specimens profoundly affect bat populations in a large a few study skins and specimens in alcohol surrounding area evaluation of existing and few specimens of M I1 reftehrerehictuslictus are undam- planned water sources with consideration of aged resulting in a less than ideal sample size bat needs could do much to enhance bat popu- for statistical analysis harris noting the pale lations in and regions coloration of the keeler specimens accounted ovelaOveiaoverallll C townsendtownsentownsendiitownsendntownsendiadnii and M cikolabrumciliolabrumcikocilio labrum for it by stating that selection at the lower ele- accounted for nearly 99 of all bats found in vations could easily have produced the level of mines with C townsendtownsendiitownsendiaii comprising about paleness seen at keeler lending further con- 89 because both E fuscus and M volans are fusion harris identified 3 of the 10 owens lake regarded as regular mine users tuttle and tay- museum specimens as M yumanensis what- lor 1994 the single hibernation sightings for ever the taxonomic resolution of this debate these bats contrasted with our foraging obser- all bats we recorded as M yumanensis are a vations of these species this indicated that morphologically similar population A defini- either their white inyo hibernacularhibernaculae remain tive resolution of the species designation for undiscovered or they typically leave the area to this population may await DNA analysis hibernate our observation of L noctivagantnoctivagans M thysanodesthys anodes fringed myotismayotis was also ab- hibernating in a mine is of note because this sent from this survey but has a range described species has rarely been found to use mines as to include the white inyo range hall 1981 hibernacularhibernaculae barbour and davis 1969 alten- barbour and davis 1969 described M thy bach and piersonpierson 1994 sanidessanodes as preferring pinyon juniper forests noticeably absent from this survey was M making their absence from the white inyo lucifuguslucilucifugousffuguS whose range is described as encom- range more conspicuous however hall and passing the white inyo range hall 1981 kelson 1959 mentioned that it does not seem perhaps the sparse timber of the range does to be common anywhere in its range and that it not meet the requirements of M lucifuguslucifugous seems to prefer caves which seldom occur in which is described as preferring timbered areas the range thus in contrast to C townsendtownsendiitownsendiaii hall and kelson 1959 the LACM record from which has apparently moved into the range by lower wyman canyon may be representative exploiting many available mines in place of of occasional forays this species may make into natural caves M thysanodesthysanodes may not be as the white inyo range from the sierra nevada adaptable to mines or may move more slowly to the west the thoroughness of the present into previously unused areas survey would have likely encountered this more than a dozen bat species inhabit the species if it routinely inhabited the white white inyo mountain range attracted by a inyo range variety of natural and artificial conditions our the owens lake myotiemyotid that we recorded data indicate influences in species distribution as M yumanensis is described by harris 1974 from vegetation zones availability of water and as the subspecies M lucifuguslucifugous refrerehfehictuslictus with mines further work using noncontact census keeler as the type location however consis- methods will be required to assess the impact tent with earlier descriptions but contrary to of vegetation zones away from water today the harris we prefer to maintain its designation as white inyo range serves as a refuge for bats M yumanensis based upon the dull and pale and careful management of water mines and pelage and light colored ears characteristic of other resources may continue this role indefi- M yumanensis and our field observations in nitely which its habitat and foraging behavior are more consistent with M yumanensis than with acknowledgments M lucifuguslucifugous the keelerowensKeelerOwens dry lake locale is unforested an uncharacteristic habitat we could not have completed the scope of for M lucifuguslucifugous from our observations these this survey without the invaluable support of bats foraged almost exclusively over the scat- kathy noland and the inyo national forest tered open water along the margin of owens terry russi and the bureau of land manage- dry lake flying just over it a strategy typical ment and elizabeth phillips and dave trydahl 199819981 BATS OF THE WHITE INYO RANGE 75 and the university of california white moun- HUMPHREY SR AND TH KUNZ 1976 ecology of a pleis- tain research station we thank 2 anonymous tocene relict the western big eared bat plecotus townsendtownsentownsendiitownsendntownsendiadnii in the southern great plains journal of reviewers for their insights that contributed to mammalogy 5747057 470 494 the manuscript we also acknowledge alex INGLES LGL G 1965 mammals of the pacific states stan- berger david galbraith noah hamm and ford university press stanford CA 508 appp brendan taaffe and thank them for their help KUNZTHKUNZ TH 1982 ecology ofbatsof bats plenum press new york and london 425 appp MCCRACKEN G 1986 why are we losing our mexican literature CITED free tailed bats bats 313 1 4 MORRISON MLM L LSL S HALL JJJ J KEANE AJA J KUENZI AND ALTENBACH JSJ S AND EDE D PIERSON 1994 pages 7 18 in J VERNER 1993 distribution and abundance of birds the importance of mines to bats an overview bats on the white mountains california great basin nat- and mines 1994 workshop proceedings biological uralist 5324653 246 258 resources research center university of nevada OFARRELL MJ AND WG BRADLEY 1970 activity pat- reno terns of bats over a desert spring journal of mam- BARBOUR RW AND WH DAVIS 1969 bats of america malogy 511851 18 26 press university of kentucky lexington 286 appp OGLESBYRJOGLESBY RJ 1985 analysis ofwinterof winter season precipitation BROSIUS AGA G G ERWIN A GLICKEN P KIMSEY AND totals and variations across the white mountains T NIELSEN no date ca 1974 A wildlife survey of region of california nevada unpublished research the white and inyo mountains unpublished manu- paper university of california davis geography script university of california davis unnumbered department 15 appp CLARK BSB S DMD M LESLIE JR AND TS CARTER 1993 for- PETERSON AMA M 1986 the distribution and ecology of aging activity of adult female ozark big eared bats deciduous tree species in the white mountains plecotus townsentownsenddnii ingensmgensdingens in summer journal of CA NV unpublished master s thesis university of mammalogy 7442274 422 427 california davis geography department ELLIOT FISK DLD L 1986 quaternary dynamics of the white PIERSON ED AND WE RAINEY 1994 the distribution mountains pages 47 50 in CAC A hall jr and DJ status and management of towsend s big eared bat young editors natural history of the white inyo corynorhinus townsendtownsentownsendiitownsendntownsendiadnii in california report to range eastern california and western nevada and california department of fish and game high altitude physiology white mountain research SHIELDS DJ TC BROWN AND DD BROWN 1995 dis- symposium volume 1 university of california los tributiontribution of abandoned and inactive mines on national angeles forest service lands USDA forest service general GRAHAM GLG L 1983 changes in bat species diversity along technical report RM GTR 260195260960 195 appp an elevational gradient up the peruvian andes jour- THOMAS DWD W 1988 the distribution of bats in different nal of mammalogy 6455964 559 571 ages of douglas fir forests journal of wildlife man- HALL ERE R 1981 the mammals of north america and2nd agement 5261952 619gig 626 edition wiley new york 1181 appp TUTTLE MDM D AND ARA R TAYLOR 1994 bats and mines HALL ERE R AND KRK R KELSON 1959 the mammals of bat conservation international austin TX 42 appp north america volume I1 ronald press co new wellington WG 1945 conditions governing the distri- york 625 appp bution of insects in the free atmosphere canadian HARRIS AHA H 1974 myotismayotis yumanensis in interior south- entomologist 77777 7 15 western north america with comments on myotismayotis WHITAKER jojrandljj0ja jr annAND LJ RISSLER 1989 do bats feed lucifuguslucifugous journal of mammalogy 5558955 589 607 in winter american midland naturalist 129200129 200 203 HERD RMR M AND MBM B FENTON 1983 an electrophoretic morphological and ecological investigation of a puta- received 18 march 1996 tive hybrid zone between myotismayotis lucifuguslucifugous and M accepted 14 july 19919977 yumanensis chiroptera Vespertilionidvespertilionidaeac canadian journal of zoology 61202961 2029 2050 HOCK RJR J 1963 mammals of the white mountain range california white mountain research station publi- cationscations berkeley CA 5 appp gleatgreat basin naturalist 581 0 1998 appp 76 81 HABITAT USE BY SMALL MAMMALS IN southeastern UTAH WITH REFERENCE TO MEXICAN SPOTTED OWL management

maite Suredasuredal2sureda1212 and michael L Mornsonmorrisonl3mornson1313

abstractABSIRACARSTRACT 1 we determined temporal and spatial differences in abundance and habitat use by small mammals in southeastsoutheasterneinern utah as part ofot an effort to enhance management of the mexican spotted owl strix occidentoccidentalisoccidentahsoccidentalistalisallsails lucida listed hyby the federal government as threatened woodratsWoodrats neotoma sppapp were captured only in canyons and most fre- quently in the pinyonpryonpmyon lumperjuniperjumper pinus adulisedulis juniperus osteosperma vegetation type white footed micemlee peromyscus sppapp were found in a varietyvaivar lety of vegetation types in both canyons and mesas the deer mouse P maniculatusmaruculatus was gener- ally the most frequently captured species among vegetation types we found seasonal and yearly differences in relative abundance of each small mammal species our data suggest that the pinyon jumperjuniper vegetation type within canyons is an important component of mexican spotted owl habitat

kenkeitkeltkeifkey words small mammals habitat use utah rodents mexican spotted owl

since its federal listing as a threatened forest san juan county utah the area con- species in april 1993 several authors have re- sidered part of the canyonlandsCanyonlands section of the ported on habitat requirements of the mexican colorado plateau geographic province thorn- spotted owl ganey 1994 zwank et al 1994 bury 19654171965 417 426 ranges from elevations of ward and block 1995 it has been suggested approximately 1830 to 2680 m elk ridge the that mexican spotted owls select habitats dominant topographic feature of the study area based partially on the availability of prey ward is flanked to the west and east by steep walled and block 1995 confirming this theory is canyons 3 of which texas hammond and vital for the owl s recovery however we know dark canyons contain mexican spotted owls of no published studies examining the distri- willey 1992 and are the focus of ouioulour study bution and abundance of predominant prey the study area comprises extensive sandstone species within the range of the mexican spot- canyoncanyonlandslands stairstepstair step benchlandsbenchlands alluvial val- ted owl in utah in southeastern utah these leys high plateaus and laccolithic mountains owls occur 75 of the time within canyons barnes 1978 and 25 of the time on mesa tops willey vegetation types sampled in our study area 1992 they forage primarily in the in pinyon were selected based on their predominance pinus eduhsedulis juniperusjumperusperus osteosperma juniperjumper eduis Jum within canyons and on mesas within canyons vegetation type within canyons willey 1992 the following types were sampled unpublished data vegetation 1 pmyon woodlands 2 mixed moun our objective was to determine spatial and pinyonpryon juniperjumper tain brush gambel oak quercus gamgambelngambeangambgambehilbehileinelnelu temporal differences in abundance and habitat alderleafalderleaf mountain mahogany Cercocercocarpuscarpus relationships of small mammals in canyons and serviceberry amelan- and on mesas of the manti lasal national montanus utah chier utahensisutahensisl 3 willow salix forest in southeastern utah these data can riparian grasses forbs and 4 mixed conifer then be used to aid in managing and recover- sppapp and pinus white fir ing the mexican spotted owl in utah ponderosa pine ponderosaponderosalrosai abies concoconcolorlorl and douglas fir pseudotsuga STUDY AREA menziemenziesnmenziesiflsn we sampled 3 vegetation types on mesas mature ponderosa pine aspen quak- we conducted our study on the monticello ing aspen populus fremtremtremloidestremloideslloides ponderosa ranger district of the manti lasal national pine and grassforbgras sforbshorb shrub

lwildlileikllife anami fishenesnsheriesFishenes sciences school ofot renewable natural resources university ofofanzonaarizonaAnzona tucson AZ 85721 2presentaddress2plcscllt aclchessarlariacl chess 20290 jamestownlainesJaineskaines town rd 12 sonora CA 95370 313pieplesentPicresentsent address departmentdepal tinenttenent of biologicalofbiological sciencesselenScienceices california state university sacramento CA 95819

76 199811998 SMALL MAMMAL HABITAT USE 77

METHODS ductiveeductive condition as nonreproductive abdom- inal testes or nipples small mammal trapping grids were located we estimated relative abundance of pre- randomly within activity areas of 3 owl home dominant prey species as catch per unit effort ranges in texas hammond and dark canyons defined as the number of captures per 100 activity areas were delineated following wil- trap nights trap nights were defined as the ley unpublished data trapping grids were set number of traps per night multiplied by the within each of the predominant vegetation number of nights in the field minus sprung types in canyons and on mesas surrounding but empty traps mills et al 1991 each canyon because canyon width varied we made the following comparisons of rel- from approximately 100 to 300 m to fit a grid ative abundance of each species 1 separately completely within some of the designated can- for canyons and mesas between years between yon vegetation types we used grids of various seasons between years and between seasons lengths and widths however we arranged within years 2 for canyons versus mesas them to approximate as nearly as possible a 5 within years and for each season within each x 5 trapping pattern all mesa grids were 5x55 x 5 year and 3 between vegetation types sepa- we separated all trapping stations by 15 m rately for canyons and mesas for each season we trapped during 2 seasons for 2 yr sum- within each year these analyses provide infor- mer and fall 1994 and 1995 summer trapping mation on temporal and spatial differences in was done from may through early august fall species abundance and habitat use we used a trapping from late august through october in mann whitney test zar 1984138 146 for 1994 we trapped 35 grids in each season 5 comparisons of relative abundance of predom- gridsvegetationgrids vegetation type 20 grids in canyons inant prey species between 2 groups for com- hammond and texas canyons 15 grids on pariparisonssons between more than 2 groups such as mesa tops in 1995 28 grids were trapped in between vegetation types the kruskal wallis each season 3 5 gridscanyongrids canyon vegetation types test zar 1984201 202 was used if a signifi- 4 gridsmesagrids mesa vegetation types 16 grids in can- cant difference was found between vegetation yons hammond texas and dark canyons 12 types we used dunndunns s test zar 1984200 to on mesas A grid from each vegetation type determine where the difference occurred was trapped synchronously during a sampling because of violations of assumptions we did session to lessen temporal biases in results not conduct parametric analyses and we each trapping period ran for 4 nights ofarr- avoided multivariate analyses because of low ell 1974 found that the moon had a negative sample sizes for some comparisons exploratory effect on nocturnal rodent activity therefore multivariate analyses indicated no substantial we trapped only on nights around a new moon differences in interpretations with analyses 10 nights before 10 nights after presented herein P ooi0010.01 was used for sig- we placed 2 sherman live traps at each nificancenificance because of repeated 2 way compar- trapping station alternating placement of extra isons results at 001 P 0050.05oos were discussed large 10 X 12 X 37 cm traps at each trapping as tendencies toward significance exact FsPs are station within each grid so that 13 trapping provided to aid in interpretation of results stations consisted of 1 extra large trap and 1 large 76tg767.6 X 828.2 X 229 cm trap and 12 trap- RESULTS ping stations consisted of 2 large traps all traps contained polyester batting and were baited species composition with rolled oats and peanut butter davis 1982 during 25148 trap nights we captured a extra large traps increased the probability of total of 2906 new animals white footed mice capturing woodratswoodrats peromyscus sppapp were the most frequently we set traps before sunset and checked them captured species group 81281281.2 of all captures at sunrise upon capture all mammals were of which 75075.0tso were deer mice P caniculamanicula identified to species aged sexed weighed tus 11711.7 canyon mice P crinituscrinitus 10010.0loo and individually identified by toe clipping brush mice P boyliiboylisboylii and 333.3 pinyon mice we differentiated between juveniles and adults P truel woodratsWoodrats neotoma sppapp were cap- by pelage coloration and we recorded reprocepro tured only in canyons and represented 191.9ig of 78 GREAT BASIN naturalist volume 58 all captures of which 80480.480 4 were mexican N only in canyons in fall 1994 and summer 1995 mexicanusmexicanus 14314.314 3 white throated N albigulaalbigula and only on mesas in fall 1995 table 1 the and 545.45 4 bushy tailed N cincinereaered woodratswoodrats brush mouse had a significantly higher rela- the montane vole microtus montanus least tive abundance in canyons during fall 1994 P chipmunk tamias minimus colorado chip- 000070.0007 MWM W and during summer and fall munk T quadrivittatusquadnmttatus rock squirrel sper- 1995 P 000100.0010 P 000210.0021 respectively momophilusphilus varlevarievanhvatievariegatusvanegatusvanegafusgatus silky pocket mouse per- MWM W table 1 the mexican woodratwoodral was cap- ognaognathusthus flavus western harvest mouse rei tured only in canyons table 1 throdontomys menalotismegmegalotisalotis ord kangaroo rat mesa dipodomys ordiiordia and a shrew species sorex vegetation types sppapp represented 16916.916 9 of all captures we observed a tendency for differences in relative abundance of deer mice within seasonal and yearly variation mesa vegetation types during summer and fall 1994 relative abundance see table 1 of deer FP 00170.017 P 00310.031 respectively kruskal micemlee on mesas was significantly greater in fall wallis KWK W table 2 and fall 1995 P 0050.05oos 1995 than fall 1994 P ooi0010.010 01 mann whitney KWK W table 2 due to large variances in abun- MWMWIM WWI and in fall 1995 than summer 1995 P dance numbers we could not determine where 0 0001000010.0001 MWM W relative abundance of deer the differences occurred in statistical analyses mleemice in canyons tended to be greater in sum- of multiple comparisons upon visual exami- mer 1994 than summer 1995 P 0040.040 04 MWM W nation of mean indices we determined the relative abundance of canyon mice in canyons grassforb shrub vegetation type had a higher was significantly greater in 1994 than 1995 P relative abundance of deer mice than the aspen 0 0001000010.0001 MWM W and in fall 1994 than fall 1995 or ponderosa pine vegetation types canyon P 0 0001000010.0001 MWM W and tended to be greater mice brush mice and pinyon mice were cap- in summer 1995 than summer 1994 P tured very infrequently on mesas and we cap- 0 0250002500.0250 MWM W relative abundance of brush tured no mexican woodratswoodrats on mesas mleemice in canyons was significantly greater in 1995 than 1994 P 000010.00010 0001 MWM W inm sum- canyon vegetation types mer 1995 than summer 1994 P 0 0001000010.0001 M- we observed a tendency for differences in W and in fall 1994 than summer 1994 P relative abundance of brush mice between 0 0001000010.0001 MWM W in canyons relative abundance canyon vegetation types in fall 1994 P of mexican woodratswoodrats tended to be greater in 00210.021 KWK W table 2 visual examination indi- summer 1995 than summer 1994 P 0040.040 04 cates that the pinyon pine and mixed moun MWM W and was significantly greater in fall 1994 tain brush vegetation types had a higher rela- than fall 1995 P 00050.0050 005oos MWM W and inm fall tive abundance of brush mice than did the 1994 than summer 1994 P 000130.00130 0013 MWM W other vegetation types we observed signifi- cant canyons versus mesas differences in relative abundance of pinyon mice in fall 1994 P 00050.005 KWK W and the deer mouse was significantly more summer 1995 P ooiool0010.01 KWK W statistical anal- abundant on mesas during 1995 P 0 0001000010.0001 yses of multiple comparisons could not deter- MWM W table 1 the canyon mouse and pinypinyonon mine where the difference occurred due to mouse were significantly more abundant in large variances in abundance numbers visual canyons during 1994 P 0 000000000oooo0.0000 P 00070.0070 007 examination of mean indices shows that the respectively MWM W table 1 whereas the brush pinyon juniper vegetation type had the high- mouse was significantly more abundant inm can- est relative abundance of pinyon mice in both yons the next year P 0 0000000000.0000 MWM W table 1 seasons table 2 we observed no other signif- the deer mouse had a significantly higher icant differences in relative abundance of other relative abundance on mesas during summer species within canyon vegetation types mexi- and fall 1995 P 0 0168001680.0168 P 000010.00010 0001 respec- can woodwoodratsrats were captured 48948.9 of the time tively MWM W table 1 the canyon mouse had a in pinyon juniper within canyons whereas significantly higher relative abundance min 24424.4 were captured in mixed mountain brush canyons during summer 1994 P 0 0007000070.0007 M- 22222.2282292 in the riparian type and 898.9sg in mixed W table 1 the canyon mouse was captured conifer 199819981 SMALL MAMMAL HABITAT USE 79

TABLE 1 small mammal relative abundance no animals per 100 trap nights estimates in canyons and mesas of the manti lasal national forest utah during summer and fall 1994 and 1995 19941994 1995IS195

summersumimer falleailRilluil overallov srail summersunimer fallfalifailfciliilltii overallovisrail

species xT 8 Xje s XT 8 X5cac 8 XT s X s deer mouse mesas 87 518 61 662 74 599 79 443 130 640 101 581 canyons 57 241 71 607 64 462 40 267 50 304 46 282 canyon mouse mesas 01 013 00 00 009 00 01 017 00 011 canyons 22 241 37 412 30 342 12 219 00 07 169 brush mouse mesas 01 018 01 013 01 015 05 162 03 056 04 125 canyons 01 037 14 146 04 082 34 251 26 208 27 142 pinyon mouse mesas 01 018 00 00 013 02 044 01 022 01 036 canyons 04 107 03 049 04 082 04 091 10 183 07 142 mexican woodratwoodral mesas 00 00 00 00 00 00 canyons 02 059 07 075 04 072 03 038 03 032 02 032 other species mesas 18 250 15 191 23 168 28 195 37 326 45 249 canyons 06 083 06 091 06 086 13 148 21 176 18 165

discussion johnson and armstrong 1987 fitzgerald et al 1994 thus the widespread presence of rocky the deer mouse was generally the most substrates within most vegetation types may frequently captured species in all vegetation explain the presence of this species in all veg- types surveyed which is consistent with its etation types johnson and armstrong 1987 general habitat associations burt and gros noted that vegetation in an area may have lit- senheisersensenheiderheider 1976 hofmeisterhoffmeister 1986 fitzgerald tle or no effect on local distribution of this et al 1994 fitzgerald et al 1994 noted that species but that the species is associated with where habitat specific peromyscus sppapp occur the aredsarddsarea s rocky substrate rather than with the deer mice will be locally scarce or absent this plant association was not the case in our study where in most the brush mouse was most frequently cap- vegetation types deer mice were consistently tured in the pinyon juniper vegetation type in more abundant than any other peromyscus sppapp canyons which is consistent with previous de- however armstrong 1979 noted that it is not scriptscriptionsions oftheodtheof the species habitat wilson 1968 uncommon for peromyscus species to co occur hoffmeisterhouHonmeistermelster 1986 fitzgerald et al 1994 it was in areas of heterogeneous vegetation as are also abundant in the riparian vegetation type found within canyons in our study area for where streamstreambedsbeds consist of heavy brush and example the mixed conifer vegetation type rocks the pinyon mouse was most frequently within canyons may have scattered pinyon captured in pinyon juniper once again consis- pines or patches of gambel oak within them tent with previous descriptions of the species thus the general heterogeneous distribution habitat throughout its range wilson 1968 of vegetation types in our study area may burt and Grossengrossenheiderheider 1976 armstrong 1979 explain why deer mice were consistently hoffmeister 1986 fitzgerald et al 1994 abundant in all vegetation types we captured the mexican woodratwoodral in the the canyon mouse was captured in all can- pinyon juniper vegetation type in all seasons yon vegetation types in each season of each sampled in 3 of the 4 seasons sampled it was year except in fall 1995 when they were not captured in mixed mountain brush and ripar- captured in any vegetation type the canyon ian vegetation and in 2 of the 4 seasons in mouse is generally associated with rocky mixed conifer our results are consistent with slickrockslickrock and cliff habitats hofmeisterhoffmeister 1986 literature on mexican woodratwoodral habitat it is 80 GREAT BASIN naturalist volume 58

tulleTMSLLTA ur 2 relative abundance no animals per 100 trap nights estimates of small mammals within mesa and canyon vegetation types of the manti lasal national forest utah during summer and fall 1994 and 1995 19941994 19951995

sullsulisummerSUITimer fallEeailallailali sunsummerimer Efallfalifailallaliail

species af3fx s af5fX 8 TX s TX 8

MESAS deer mouse aspen 63 433 27 281 65 347 106 142 ponderosapondeiosapineponderosapinepine 61 311 25 249 59 452 93 166 grassforbgi assfoi b shrubshishl abub 137 430 130 706 113 410 190 868

CANYONS deeldeer mouse mixed conifer 48 238 77 356 32 208 49 344 pinyon juniper 55 153 15 141 36 269 55 359 mixed mountain blushbrush 62 320 97 773 55 356 68 316 ripalriparianlanian 61 281 96 669 44 351 39 132 canyon mouse mixed conifer 18 249 16 222 11 255 00 pinyon junipeijuniper 31 300 63 576 06 097 00 mixed mountain brush 25 289 42 416 17 294 00 riparian 15 146 29 324 19 323 00 brush mouse mixed conifer 00 06 082 20 171 10 071 pinyon juniper 03 072 22 183 40 361 30 260 mixed mountain brush 01 022 23 140 18 236 24 162 ripalriparianlanian 00 04 065 40 062 34 067 pinyon mouse mixed conifer 01 022 00 00 00 pinyon juniper 13 194 09 043 12 135 30 241 mixed mountain brush 01 022 01 022 00 00 riparian 02 045 02 045 00 00 mexican woodratwoodiatwoodral mixed conifer 00 02 027 02 027 00 pinyon juniper 05 1121 12 13 098 03 049 03 050 mixed mountain brush 02 045 04 042 05 050 00 riparian 00 08 080 02 029 02 029

characteristically found on rocky slopes cliffs ward and block 1995 were captured in a and rock outcrops burt and Grossengrossenheiderheider variety of vegetation types within canyons 1976 and is associated with pinyonpryonpmyon juniper and woodratswoodrats were captured only in canyons woodlands armstrong 1979 comely and baker thus maintaining a mixture of vegetation types 1986 fitzgerald et al 1994 may provide a buffer against the effects of we found that canyon and brush mice were small mammal cycles in any particular vegeta- captured primarily within canyons and the tion type ward and block 1995 small mam- mexican woodratwoodral was captured only within can- mal populations are known to fluctuate with yons As mentioned above mexican spotted seed andor cone crop production mckeever owls studied in this area were located primar- 1961 buchanan et al 1990 if a small mam- ily 75 within canyons willey unpublished mal species is not an extreme habitat specialist data found that owls within the canyons sam- as the owl s predominant prey species are pled were foraging primarily in pinyon junijum not owls may temporarily be able to move per this corresponds with woodratwoodral distribu- into food abundant areas and maintain viable tion and abundance in our study populations our results also suggest that the our results should be useful in the devel- pinyon juniper vegetation type is an important opment of management plans for the mexican component of the mexican spotted owl s home spotted owl peromyscus sppapp the predomi- range during summer and fall based on owl nant prey species of the mexican spotted owl foraging behavior studies and owl diet willey 199811998 SMALL MAMMAL HABITAT USE 81

1992 unpublished data and the distribution fitzgerald JPJ P CAC A MEANEY AND DMD M ARMSTRONG 1994 mammals of coloradocoloichloi ado university of colorado and abundance of key species future research press should address the correlation between owl denver 467pp CANEYGANEYganen JLJ L 1994 habitat selection by mexican spotted survival and reproductive success and the owls in northern arizona auk 111 162 169 amount of pinyon juniperjumper vegetation type with- hoffmeister DED F 1986 mammals of arizona university in the home range of individual owl pairs of arizona press tucson AZ 602 appp JOHNSON DW AND DMbm ARMSTRONG 1987 peromyscus crlcricylcnnituscrinitusnitus mammalian species 2871187287 1 8 acknowledgments MCKEEVER S 1961 relative population of small mam- mals in three forest types of northeastern california we thank the US forest service and rocky ecology 4239942 399 402 mountain forest and range experiment sta- MILLS JNJ N BAB A ELLIS KTK T mckee jaj1J I1 MAIZTEGUI AND tion for funding our study tony bleuze jeff JEJ E CHILDS 1991 habitat associations and relative densities ofrodentof rodent populations in cultivated areas of dixon adam duerr sandy lehman john central argentina journal of mammalogy 7247072 47079479 keane john martin nicole brown and hillary OTARRELLOFARRELL MJM J 1974 seasonal activity patterns of rodents heard for field assistance the monticello in a sagebrush community journal of mammalogy ranger district for logistical support and 5580955 809sog 823 ganey THORNBURY WD 1965 regional geomorphology of the joseph william block phillip zwank united states john wiley and sons new york 609 and an anonymous referee for constructive PP comments WARD JP JR AND WM BLOCK 1995 pages 1 48 in USDI fish and wildlife service mexican spotted CITED owl recovery plan volume II11 USDI fish and wild- literature life service albuquerque NM WILLEY DWD W 1992 movements and habitat ecology of ARMSTRONG DMD M 1979 ecological distribution of rodents mexican spotted owls in southern utah final report in Canyoncanyonlandslands park great in national utah basin utah division of wildlifeofwildlife resources 23 appp naturalist 3919939 199 205 WILSON DED E 1968 ecological distribution of the genus BARNES FA 1978 canyon country geology wasatch pub- peromyscus southwestern naturalist 1326713 267 274 lishers inc salt lake city UT 160 appp ZAR JHJ H 1984 Biostatistical analysis and2nd edition pren- BUCHANAN B R W LUNDQUIST AND KBK B AUBRY 1990 JBJ RW tice hall englewood cliffs NJ 718 appp winter population of douglas squirrels in different in ZWANK PJ KWK W KROEL DMD M LEVIN GMG M SOUTHWARD aged douglas fir forests journal of wildlife man- AND RCR C ROMME 1994 habitat characteristics of agement 5457754 577 581 mexican spotted owls in southwestern new mex- BURT WH AND RPR P grossenheiderGROSSEN HEIDER 1976 peterson field icoieoleo journal of field ornithology 6532465 324 334 guides mammals houghton mifflin co boston MA 289 appp received I1 april 1997 CORNELY AND R BAKER 1986 neotoma JEJ E RJJ mexicansmexicanamexicana accepted 5 august 1997 mammalian species 2621262 1 7 DAVIS DED E 1982 CRC handbook of census methods for terrestrial vertebrates CRC press boca raton FL 397 appp great basin naturalist ssi581 C 1998 appp 82 86

LATE pleistocene MICROTINE RODENTS FROM SNAKE CREEK BURIAL CAVE WHITE PINE COUNTY NEVADA

christopher J bell12bei112 and jim I1 meadamead3

ABSIRACTABSTRACT A total of 395 microtine rodent specimens recovered from snake cleekcreekgleekgreek burial cave SCBC are referred to microtus sp and leminiscuslemrmscus curcurtatustatus radiocarbon and uranium series dates indicate an age for these fossils of between 9460 160 yiyr BYB P and 151000 700 yr BPB P the sample of lower first molars of lemniscuslemmiscusLemmiscus includes 4 5 and 6 closed triangle morphomorphotypestypes earlier reports of the 4 closed triangle morphomorphotypetype are from Irvingirvingtonianirvmgtomantonian deposits in Coloiacoloradodo nevada and new mexico and from early rancholabieanrancholabrean deposits in washington the morphomorphotypetype is not known in living populations of Lemmislemniscuslemmiscuscus SCBC specimens constitute the youngest record of the 4 closed triangle morphomorphotypetype and are the only specimens reported from the late rancholabrean the time of disappearance of Lemmislemniscuslemmiscuscus with this molar morphology is unknown but populations with this morphomorphotypetype possibly became extinct at or near the end of the pleistocene

ketikeifkey words Lemmislemniscuslemmiscuscus microtus pleistocene extinction

terrestrial vertebrate faunalfaunas of the rancho datum point in the cave fossils recovered labreangabrean mammal age late pleistocene from from the upper 25 cm unit I1 are secondarily the central great basin have foiforboibol the most part deposited as a result of digging activities by been discovered viavla exploration and excava- cavers A bat guano layer unit II11 level 3 tion of cave deposits grayson 1993 many of marks the beginning of undisturbed deposits these localities are from relatively high eleva- in the sequence the highly fossiliferous unit tions fewer low elevation sites have been dis- iliIII111 encompassing levels 4 10 produced the covered and consequently less is known of the majority of vertebrates and is the presumed rancholabrean faunal history at lower eleva- source of materials recovered from unit I1 tions excavations in snake creek burial cave backdirtbackdirt the top of unit lilliiIII111 is radiocarbon SCBQSCBC a natural trap cave from the southern dated at 9460 160 yr BEBY radiocarbon years snake range in white pine county nevada before 1950 dated material was bat guano resulted in the recovery of an extensive verte- and a uranium series date on an equus horse brate fauna consisting of over 30000 skeletal phalanx from near the bottom of the excava- elements mead and mead 1989 the cave is tion gave an age of 15100 700 yr BEBY mead formed in a small devonian limestone ridge and mead 1989 separated from the mountains by a broad allu- preliminary discussion of the fauna and more vial fan at 1731 m elevation and is one of the extensive treatments of reptilian and numer- few lowland sites in the great basin that has ous mammalian mustelid carnivore remains produced a late pleistocene fauna were published previously mead and mead preliminary sampling in 1984 from the pro- 1985 mead et al 1989 mead and mead 1989 file of a trench excavated by cavers produced a many additional components of the small mam- small vertebrate assemblage indicative of late mal fauna are under study now and our pur- pleistocene age mead and mead 1989 more pose here is to document microtine rodents extensive excavations were undertaken inm 1987 from the site when 4 contiguous 1 x 1 m test pits were ex- A total of 395 specimens are referred to the cavated using arbitrary 10 cm stratigraphic 2 microtine rodent genera microtus voles and levels to a depth of approximately 1 m below lemniscuslemmiscusLemmis cus sagebrush voles both of which the present surface 2 m below an established have rootless molars with a relatively complex

idepartinentepaitmont of integrative biology and museum of vertebrate zoology university of california berkeley CA 94720 resent address department of geological sciences university of texas at austin austin TX 78712 31departinentdepaldupaidcpai finonttinont of geology and the quaternary studies programPiogiamglam northern arizona university flagstaff AZ 86011

82 199811998 BURIAL CAVE microtinesMICROTINES 83

occlusal surface the lower ist molar ml sible most of the lower ist molars from SCBC lower ard3rd molar mam3 upper ard3rd molar mam36m3 have 5 closed triangles fig 1aaa but 4 individ- and edentulous dentdentariesaries of these genera are uals have a closed labial secondary wing tri- usually readily identifiable and constitute the angle 6 as well upper ard3rd molars of most basis for this report species have an anterior loop and at least 3 alternating triangles with a posterior portion descriptive ACCOUNTS that varies in complexity no microtus speci- mens show an elongated posterior extension of all specimens are auratedcurated into the collec- m3ma as in Lemmislemniscuslemmiscuscus only 3 closed dentine tions of the laboratory of quaternary paleon- fields are present on the ard3rd lower molars tology quaternary studies program northern referred to microtus grayson 1983 noted arizona university NAUQSP elements that the position of the mandibular foramen listed below are followed by the specimen can be used to differentiate edentulous den number or range of numbers dental termi- tariesbaries of microtus and lemniscuslemmiscusLemmiscus in microtus nology follows repenning 1992 this foramen is on or slightly dorsal to the ridge of bone encapsulating the posterior por- microtus sp schrank 1798 tion of the lower incisor and is clearly visible MATERIAL left dentary with ml and when the dentary is laid flat on its labial sur- m3ma 7680 left dentary with I1 ml 2 7702 face in lemniscuslemmiscusLemmiscus the foramen is situated on right dentary with I1 ml 2 7691 right dentary the anterodorsal portion of this encapsulating with I1 m2ma 3 7890 isolated mlMI 7681 7690 ridge and is not distinctly visible in a direct 7692 7701 7703 7733 7872 7874 7876 iso- lingual view lated m3ma 7877 7889 7891 7894 7933 7936 7938 7939 isolated m3ma 7837 7846 7873 Lemmislemniscuslemmiscuscus curtatuscurtatus cope 1868 7937 left edentulous dentary 8045 8074 right MATERIAL left dentary with I1 ml 2 edentulous dentary 8019 8044 7755 left dentary with I1 mlMI 7794 left den- DIAGNOSIS primary wings on the lower tary fragment with mlm1ma 7828 right dentary ist molar of microtus species in the restricted with mlMI 7741 7749 7802 7830 isolated mlMI sense of repenning 1987 1992 are well 7735 774077427740 7742 774877507748 7750 775477567754 7756 7793 developed and form triangles 4 and 5 sec- 7795 780178037801 7803 7827782978317827 7829 7831 78367875 ondary wings are usually present in some isolated m3ma 7895 7932 isolated m3ma 7847 extinct early north american representatives 7871 left edentulous dentary 7940 7982 right of this genus placed in the species M haropparop edentulous dentary 7983 8018 erarius and the extant M oeconomus the lin- DIAGNOSIS in living Lemmislemniscuslemmiscuscus curcurtatustatus gual primary wing triangle 5 of the lower ist the lower ist molar has a posterior loop and 5 molar is generally open and broadly confluent closed alternating triangles similar to that in with the anterior cap on which only a single fig IB a ath6th triangle is present and may be secondary wing may be developed hibbard broadly confluent with the anterior cap nearly 1944 youngman 1975 hall 1981 in most closed fig 1cICac or completely closed gener- other north american species the lingual pri- ally only the labial secondary wing is well mary wing is closed and development of sec-see developed although a weak lingual secondary ondary wings and morphology of the anterior wing may be developed in the earliest known cap are highly variable for this reason spe- populations of Lemmislemniscuslemmiscuscus the lingual primary cific identification of isolated teeth of microtus wing triangle 5 is widely confluent with the species is problematic zakrzewski 1985 anterior cap fig ID see discussion msm3s multivariate statistical methods were shown to assigned to Lemmislemniscuslemmiscuscus curtatuscurtatus have an ante- be useful in discriminating isolated molars of rior loop 2 alternating triangles and an elon- several species from the southwestern united gate and uncomplicated posterior loop repen- states smartt 1977 but no comprehensive ning 1992 msm3s referred to lemniscuslemmiscusLemmis cus have study of this kind that includes all north 4 closed dentine fields edentulous dentdentariesaries american species has yet been published in were identified based on the position of the the absence of such a study reliable identifica- mandibular foramen see discussion under tion of many microtus species remains impsimpos microtus above 84 GREAT BASIN naturalist volume 58

in heaton 1985 but these reports appear to be based largely upon modern geographic dis- tributiontribution of taxa although 3 specimens from the tule springs site in southern nevada were identified as microtus cf M califorcahformcuscalifornicusnicus by mawby 1967 no discussion was provided to indicate how the identification was made and comparisons with other microtus species may not have been adequate A single specimen in from crystal ball cave was tentatively identi- fied as M pennsylvanicuspennsylvanicus heaton 1985 eleven msm2s NAUQSP 8075 8085 from SCBC show distinct development of a pos tefoteroterolingualterohnguallingual dentine field similar to that seen in living M pennsylvanicuspennsylvanicus although some authors consider this feature to be unique to M pennsylvanicuspennsylvanicus it is reported to occur at least occasionally in several other species of microtus zakrzewski 1985 and is almost uniuni- verversallysally present in M californicuscalifornicus personal D observation it is not known to occur in lem C biscusmiscus until a complete survey of the devel- opment of this feature in microtus species can be completed we hesitate to refer these speci- mens to any given species but note their pres- ence in the fauna so that future considerations of this problem may take them into account despite its contributing little else to our knowledge of microtus in the great basin the material from SCBC does provide further doc- umentationumentation of the presence of this genus at lower elevations during the pleistocene although lemniscuslemmiscusLemmis cus is reported from numerous pleistocene and holocene localities fig 1 occlusal view of left ml of microtine rodents outside the great basin FAUNMAPFAUN MAP working from snake creek burial cave A microtus sp NAUQSP group 1994 surprisingly few reports have 7683 B typical Lemmislemniscuslemmiscuscus curcurtainstatus morph from SCBC been published from within this region where NAUQSP 7738 C a complex morph oflemmiscus cur is today 1946 earliest tatus NAUQSP 7747 in which the ath6th triangle is nearly it is widespread hall the closed D 4 closed triangle morph of lemniscuslemmiscusLemmis cus curcurtatustatus known occurrence in the great basin is in NAUQSP 7734 scale bars 1 mm irvingtonianIrvingtonian early to middle pleistocene deposits in cathedral cave located about 40 km north of SCBC bell 1995 we identified discussion Lemmislemniscuslemmiscuscus molars recovered from excavation backdirtbackdirt in smith creek cave northern snake today only 2 species of microtus M mon- range that is presumably pleistocene in age tanus and M longicaudus are found in the possibly from the reddish brown silt unit see central great basin including the area around discussion in mead et al 1982 its occurrence SCBC hall 1946 2 other species M penn in the late pleistocene was documented at sylvanisussylvanicussylvanicus and M richardrichardsonifichardsonirichardsonbsoni presently inhabit crystal ball cave in utah heaton 1985 and regions bordering the great basin hall 1981 owl cave nevada turnmire 1987 it also is microtus is reasonably well represented in late known from pleistocene holocene deposits in pleistocene faunalfaunas of the great basin M mon- rock springs cave jefferson et al 1994 and tanus and M longicaudus are usually reported from several holocene deposits within the as questionable identifications see summary great basin FAUNMAP working group 1994 199811998 BURIAL CAVE microtinesMICROTINES 85

TABLE 1 stratigraphic distribution ofm1of m1ma of Lemmislemniscuslemmiscuscus morphomorphotypestypes from the 1987 excavations in SCBC number of specimens of each morphomorphotypetype total number of specimens and relative percent of 4 closed triangle morphomorphotypestypes are provided for each stratigraphic level only levels excavated in primary deposits are included at4t 4 closed triangle morphomorphotypetype 5tat 5 closed triangle morphomorphotypetype 6tat specimens in which a fth6th6tb triangle is well developed but not completely closed stratigraphic at4t 5tat 6tat total of at4t level Lemmislemniscuslemmiscuscus Lemmislemniscuslemmiscuscus Lemmislemniscuslemmiscuscus specimens morphomorphotypestypes 3 guano 0 3 0 3 0 4 0 1 0 1 0 45 0 4 1 5 0 5 1 7 2 10 10 6 1 13 1 15 77 7 1 15 0 16 67 8 0 5 0 5 0 9 0 2 0 2 0

most molars assigned to Lemmislemniscuslemmiscuscus from A total of 57 mlsMIs of lemniscuslemmiscusLemmis cus curtatuscurtatus SCBC are indistinguishable from those of liv- from the 1987 excavations in SCBC can be ing L curtatuscurtatus but 4 notable exceptions reliably placed in the stratigraphic sequence occur NAUQSP 7734 7788 7806 and 7833 of these 3 are 4 closed triangle forms and 4 are lower ist1stast molars in which the lingual pri- are relatively complex morphotypesmorphotypes in which mary wing is widely confluent with the ante- the ath6th triangle is nearly closed fig 1cac rior cap fig ID this relatively primitive four closed triangle specimens are evenly dis- morphology is not known to us to occur in liv- tritributed in the middle of the stratigraphic se- ing L curtatuscurtatus it is the only morphology pre- quence see table 1 but are absent from the sent in the SAM cave fauna in new mexico oldest deposits this pattern may be a result of with an estimated age of 875000 yr BPBE low sample size for each stratigraphic level repenning 1992 both 4 and 5 closed trian- the taxonomic status of the 4 closed trian- gle forms are reported from the same strati- gle Lemmislemniscuslemmiscuscus is uncertain and for the pres- graphic levels in the pit locality in porcupine ent we refer these specimens to lemniscuslemmiscusLemmis cus cave colorado a sequence dated to between curcurtatustatus specimens from SCBC represent the 365000 and 478000 yr BP wood and youngest known occurrence of this morphol- barnosky 1994 barnosky et al 1996 and ogy and demonstrate a persistence of this form cathedral cave nevada also considered to into the late rancholabrean the precise time be irvingtonianIrvingtonian in age bell 1995 in the pit of disappearance of lemniscuslemmiscusLemmis cus with this molar locality the relative abundance of the 4 closed morphology is unknown but its absence in the triangle forms decreases in successively living fauna and its presence in SCBC suggest younger stratigraphic levels with a concomi- the possibility that populations of Lemmislemniscuslemmiscuscus tant increase in relative abundance of 5 closed with this morphology went extinct at the end triangle forms wood and barnosky 1994 A of the pleistocene perhaps in response to cli- similar pattern was documented at the ken- matic changes occurring during the glacial newick roadcutroadcup in washington where both 4 holocene interglacial transition and 5 closed triangle specimens were reported rensberger et al 1984 rensberger and acknowledgments barnosky 1993 with the primitive morphol- ogy found predominantly in the lower part of financial support for the SCBC excavations the section the age of the kennewick fauna is was received from the national geographic not precisely known but a full review of data society 3627873627 87 geological society of pertaining to the age of the kennewick section america 3829873829 87 and northern arizona was provided by rensberger and barnosky university quaternary studies program we 1993 who concluded that the lowermost appreciate the assistance of the bureau of sections probably do not extend back into the land management and US forest service in irvingtonianIrvingtonian obtaining excavation permits we are especially 86 GREAT BASIN naturalist volume 58 grateful to emilee mead for helping with all and D ellis editors pleistocene studies in southern aspects of the project illustrations were nevada nevada state museum anthropological the papers 13 by mcconnaughey and helpful prepared LA MEAD EME M AND jaj1J I1 MEAD 1989 snake creek burial comments on an earlier version of this report cave and a review of the quaternary mustemustelidslids of were provided by AD moskybarnoskyBa HW greene the great basin great basin naturalist 4914349 143 154 CA repenning GE swartz and J vindum MEAD j1jaJ I1 AND EME M MEAD 1985 A natural trap for pleistocene animals snake valley eastern nevada money in support of this project was in travel in current research in the pleistocene 21052 ios105 106 provided by the department of integrative MEADJITHMEAD j1ja TH heatonandemHEATON ANDEMAND EM MEAD 1989 late biology university of california berkeley quaternary reptiles from two caves in the east cen trai great basin journal of herpetology 2318623 186 189 CITED MEAD JI RS THOMPSON AND TR VAN DEVENDER literature 1982 late wisconsinanWisconsinan and holocene fauna from smith creek canyon snake range nevada trans- BARNOSKY A D ROUSE EAE A HADLY D L WOOD FL AD TI DL actions of the san diego society of natural history KEESING AND VA SCHMIDT 1996 comparison of 20120 1 26 mammalian response to glacial interglacial transi- rensberger JMJ M AND ADA D BARNOSKY 1993 short term tions in the middle and late pleistocene pages in fluctuations in small mammals of the late pleistocene 16 33 m K M stewart and KLK L seymour editors in KM from eastern washington pages 299 342 in RA palaeoecology and palaeoenvironments of late ceno- martin and ADA D barnosky editors morphological mammals tributes to the career of CSC S rufus zoiczoiezole change in quaternary mammals of north america of toronto press toronto in churcher university cambridge university press ontario canada rensberger JMJ M ADA D BARNOSKY AND P SPENCER 1984 BELL C 1995 A pleistocene irvingtonianIrving CJJ middle tonian geology and paleontology of a pleistocene to holo microtine rodent fauna from white pine county cene loess succession benton county washington nevada and its implications for microtine rodent eastern washington university reports in archaeol- biochronologybio journal of vertebrateofvertebrate paleontology 15 chronology ogy and history loo1003910010039139139 1 105 supplement to 3 318aisa REPENNING CAC A 1987 chronologyBiobiochronology of the microtine FAUNMAP WORKING GROUP 1994 FAUNMAP a data- rodents of the united states pages 236 268 inCT MOM of 0 base documenting late quaternary distributions woodburne editor cenozoic mammals of north mammal in the united states illinois state species in america geochronology and biostratigraphy univer- museum scientific papers 25 sity of california press berkeley GRAYSON K 1983 paleontology of gatecliff shel- DKD the 1992 allophaiomys and the age of the clyorolyor suite small mammals pages 99 126 D H ter in DH thomas krestovkaKrestovka sections yakutisyakutia USU S geological survey editor archaeology of monitor valley 2 gate- the bulletin 203720371 1 98 cliff shelter anthropological papers of the american SMARTT RAR A 1977 the ecology of late pleistocene and museum 59 of natural history recent microtus from south central and southwest- 1993 desert s past a natural prehistory of the the ern new mexico southwestern naturalist 22122 ilg1191 19 great basin smithsonianSmithsoman institution press washinwashing-g TURNMIRE KLK L 1987 an analysis of the mammalian fauna ton DC 356 appp from owl cave one and two snake range eastcast HALL 1946 of cali- ERE R mammals of nevada university central nevada unpublished thesis university of press berkeley 710 fornia appp maine orono 282 appp 1981 the mammals of north america john wiley WWOODOOD DLD L AND ADA D BARNOSKY 1994 middle pleis- and sons new york 1181 appp tocene climate change in the colorado rocky moun- HEATON paleo- TH 1985 quaternary paleontology and indicated by fossil mammals from porcupine cave county utah tains ecology of crystal ball millard cave quaternary research 4136641 366 375 with emphasis on mammals and a description of a YOUNGMAN PM 1975 mammals of the yukon territory of fossil skunk great basin naturalist new species national museums of canada publications in zool- 45 337 390 45337 ogy 10110iol 1 192 HIBBARD CWC W 1944 stratigraphy and vertebrate paleon- zakrzewski RJR J 1985 the fossil record pages 1 51 in tology of pleistocene deposits of southwestern kansas RHR H tamarin editor biology of new world micro- of the geological society of 55 bulletin america tus american society of mammalogists special 754 718 publication 8 JEFFERSON GT WE MILLER MEM E NELSON AND JHJ H MADSEN quaternary JR 1994 catalogue of late ver- received 9 may 1997 from museum of tetebrates utah natural history los accepted 11 august 1997 angeles county technical report 919 1 34 MAWBY JEJ E 1967 fossil vertebrates of the tule springs site nevada pages 107 128 inOT HMH M worthington great basin naturalist 581 C 1998 appp 87 89

WESTERN TOAD BUFO BOREAS IN SOUTHERN UTAH NOTES ON A SINGLE population ALONG THE EAST FORK OF THE SEVIER RIVER

megan RobinsorobinsonlRobinsonrobinson1robinsonelnl1 michael P donovalldonovanldonovantDonovandonovan1Donovanl1 and terry D Schwanerschwanerl2schwaner1212

key words bufo boreas population size potential prey potential predator

amphibian species including the north the bottom of a long canyon with a winding american western toad bufo boreas are de- slow moving stream whose bed is an imper- clining worldwide blaustein and wake 1990 meable layer of kaiparowits clay underlain this decline may be related to a number of with claron limestone the riparian zone is factors including human interference and habi- dominated by the introduced kentucky blue- tat degradation blaustein and olson 1991 in- grass boapoapoa prapratensistensis and smooth brome bro- direct effects of stress leading to diseases mus inermis and native wire grass juncus such as redlegred leg carey 1993 mineral toxins baltitusbalbalticusticus present vegetation contrasts with the in water that kill tadpoles porter and hakan- natural cover in the early 1900s which con- son 1976 predation on juveniles and adults sisted of various types of willows E L boshell beiswenger 1981 olson 1989 and pathogenic personal communication A weir on the east fungal infections of eggs blaustein et al 1994 slope of the canyon creates a small pond about ross et al 1995 summarized the status of B 30 m in diameter native stands of engelmann boreas in utah mapped distributions of many spruce picea engelmanniiengelmanniaengelmannii mixed with blue disjunct populations and cited evidence for spruce P pungentpunpungensgens and douglas fir pseudo- possible declines in populations within the tsuga menziemenziesiamenziesumenziesiimenzieshleshiesUsiislisll rise above the riparian zone northern part of the state these authors stressed adjacent areas were clearcut in the 1930s and that surveys need to be expanded and contin- later replanted with ponderosa pine pinus ued especially in southern utah to clarify the ponderosa access to the site is by an unim- status of these toads and to identify factors proved road running parallel to the stream that might affect their populations we visited the study site on 23 june 6 and recent reports of B boreas at 3 new mon- 21 july 4 17 and 31 august and 7 september tane localities 2500 3030 m elevation in south- 1996 usually from midmorningmid morning to mid after ern utah noted adults egg strings and meta noon As we slowly walked along the main morphsmorphe ross et al 1995 although no exact stream its branches and the moist slopes on date was given for the presence of adults and either side of the road we located toads and egg strings metamorphsmetamorphy were reportedly ob- captured them by hand snout vent length served in july at 2 of the 5 ponds surveyed SVL in millimeters and weight WT in grams earlier in the year these are the only reports were measured for each toad before it was on the ecology of B boreas in southern utah released at the exact point of capture wart consequently we chose to study the natural patterns on the head and dark blotchesblotcherblotches on the history of a single population of B boreas in throat and lower left leg were sketched for this area initially focusing on questions con- each individual suspected recaptures were cerning population size and structure later identified by comparisons with these we located boreal toads at a new locality in drawings using the petersen method we esti- garfield county utah along the east fork of mated population size and we tested equal the sevier river not far from a site previously catchcatchabilityhatchabilityability using a zero truncated poisson test reported by ross et al 1995 the site is in fortran programs PETERSEN and ZERO

department of biology southernSouthein utah university cedar city UT 84720 author to whom correspondence should be addressedaddi essed

87 88 GREAT BASIN naturalist volume 58 respectively in krebs 1989 potential prey two dead adult toads were found under a types were identified from sweeps of the veg- clump of dried grass in a burrow also occupied etation using insect nets and inferences on by 4 live juvenile northern water shrews feeding were obtained from palpation of toad sorex palustnspalustrispalustris although we examined the stomachs potential competitor and predator partially dried carcasses we could not deter- species were noted mine that the toads were killed by shrews forty six toads were observed unique cap- although it is suspected that shrews were tures represented 35 adult toads 17 males and feeding on them fig 1 numerous wander- 18 females neither tadpoles in the stream its ing garter snakes thamnophis elegansdelegans vavagransmagransgrans tributatributariesries or the small pond above the weirwein were observed in the area all were too small nor newly metamorphosed toadtoadletstoadlesslets or poten- SVL 050.50 5 in to swallow any of the toads we tial young of the year were observed most measured although they could definitely prey toads were recorded in june N 11 and july on juveniles and tadpoles the only other am- N 27 with fewer observations in august phibian species observed at the study site was N 6 and september N 2 the leopard frog rana pipiensplens whose num- males N 16 were smaller than females bers appeared fewer than B boreas only 6 N 18 in both length and weight ANCOVA were observed during the study period mean SVL for males 86.886868 8 mm range 75 98 868 A population of B boreas in southern utah for males 646 6 mm mean WT 64664.664 g range studied during summer 1996 contained only 52 80 g mean SVL for females 96.3963 3 96396 mm large presumably old adults with no indica- range 81 111 mm mean WT for females tion of size age structure that would suggest 92992.992989 9 g range 52 115 g F 208720.8720 87 df 132 juvenile recruitment estimated popula- P 001 the tion size of 53 adults is based on individuals we compared the 25 non recaptured toads that were recaptured at random however observed during the first 2 visits with those 8 sample sizes were uneven for the period of recaptured and 10 non recaptured toads ob- study and this number relies on the assump- served during the last 5 visits to estimate pop- tion that grouping data into 2 samples does ulation size petersen estimate with re- the not bias the true of population placement was 53 adult toads 95 CL estimate size we also assumed no from 38 99 A goodness of fit test of observed and recruitment migra- adult toads of expected values for the zero truncated poisson tion of into or out the study area because of the widely test of equal catchabilityhatchabilitycatchability could not reject the separated populations in this area growth rates estimated from a very null hypothesis xax22 1211 21 df 3 P 080.80 8 A null hypothesis no difference between small sample of recaptures over a relatively short period of probably do accu- male N 4 and female N 6 growth in time not madaymmday was accepted mann whitney test U rately reflect annual growth rates A femur 404.04 0 Z 171.71 7 2 tailed FP value 0090.090 09 com- from 10 concentric layers of bone in each bined recaptures for males and females allowed esteonosteon may indicate an old adult toad how- an average estimate of 0170.170 17 madaymmday 95 CL ever sections of bone from toads of various 0090.090 09 0250.250 25 growth in SVL during the study sizes are needed to verify this notion toads period were not observed feeding but their stomachs we swept five 10lom m transects with a 40 cm appeared to contain large insects possibly diameter insect net in the vicinity of captured orthopterorthopteransans because grasshoppers are the toads the 169 arthropods caught in these largest but not most abundant potential prey sweeps represented 7 orders homoptera toads may be selectively feeding on them dead 27 coleoptera 25 diptera 18 orthop- toads can be eaten by shrews but whether tera 17 hymenoptera 8 hemiptera shrews kill toads is not known numerous 4 and arachnida 1 Orthopterorthopteransortbopteransans N wandering garter snakes may prey on tadpoles 29 had much larger average body lengths 2012012020.11 and small toads but are too small to swallow mm 95 CL 18718.718 7 21521.521bis815 5 than those N adult toads in this population there appear to 140 of all other taxa 28282.82 8 mm 95 CL be few if any competitors to B boreas for 242.42 4 313.13 1 all toad stomachs examined by pal- food and habitat space R pipienspipkens and B pation in july and early august contained boreas occur together along the water courses large prey 28 282.82 8 mm perhaps suggesting that critical resources for 199811998 NOTES 89

AN

4

T

4

fig 1 venter of a dead western toad bufo boreas found in the burrow of a northern water shrew sorex papalustrispalustnslustris in southern utah note the jagged apparently chewed edge near the head end of the dried carcass survival are either different for both species or BLACK JHJ H AND RBR B BRUNSON 1971 breeding behavior if similar are not limiting of the boreal toad bufo boreas boreas baird and girard in western montana great basin naturalist toads appear to be clumped along water 3110931 109log 113 courses or in wet seepage areas with abundant BLAUSTEIN ARA R AND DHD H OLSON 1991 declining am- grasses and sedges habitat similar to those phibians science 2531467253 1467 previously described for the species in other BLAUSTEIN ARA R AND DBD B WAKE 1990 declining amphib- ianlan population a global phenomenon tree 52035 203 204 1970 ian areas eg campbell from previopraviopreviousus BLAUSTEIN ARA R PD HOFFMAN DGD G HOKIT JMJ M descriptions by black and brunson 1971 the KIESECKERkieKlE SECKER SCS C WALLS AND JBJ B HAYS 1994 UV pond above the weir at this study site appears repair and resistance to solar UVBUV B in amphibian ideal for breeding aggregations of toads eggs a link to population declines P proceedings of the national academcyAcademcy of sciences 91179191 1791 1795 CAMPBELL JBJ B 1970 hibernaculahibernacular of a population of bufo acknowledgments boreas boreas in the colorado front range her petologica 2627826 278 282 we thank the following for advice and tech- CAREY C 1993 hypothesis concerning the causes of the nical assistance EL boshell JTJX boyer TC disappearance of boreal toads from the mountains of esque colorado conservation biology 73557 355 362 BW ferguson RA fridell D quin- KREBS CJC J 1989 ecological methodology harper & tana S robertson R rodriguez DA ross row publishers new york 65 appp and PE summers D robinson PE hanrion NPNE OLSON DH 1989 predation on breeding westeinwestern toads hanrion M hanrion and J barraza helped bufo boreas copela 19893911989 391 397 PORTER KRK R AND DED E HAKANSON 1976 toxicity ofmineohmineof mine locate toads in the field special thanks arearc drainage to embryonic and larval boreal toads bufo- extended to the US forest service dixie nidae bufo boreas copela 176327176 327 331 national forest for financial and logistic sup- ross DA TC ESQUE RA FRIDELL AND P HOVINGH port 1995 historical distribution current status and range extension of bufo boreas in utah herpetological review 264187264 187 189 literature CITED received I1 may 1997 beiswenger RER E 1981 predation by grey jays on aggre- accepted 9 may 1997 gating tadpoles of the boreal toad bufo boreas copela 19812741981 274 276 great basin naturalist ssi581 C 1998 appp 90 91

WESTERN WOOD PEWEES ACCEPT COWBIRD EGGS

david R cursonlcurson1cursons Christopchristopherherber B goguenigoguen1 and nancy E MathewMathewssl1

key words western wood pewee Concontopustopus sordisordidulusdulus brood parasitism brown headed cowbird molothrus ater accepter

the western wood pewee Concontopustopus sor the pinyon juniper avian community we ex- didulus is an infrequently recorded host of periperimentallymentally parasitized 10 nests during 1995 the brood parasitic brown headed cowbird and 1996 to determine the accepter status of friedmann et al 1977 friedmann and kiff western wood peweespewzes at this site A single 1985 as are the majority of tyrtyrannidtyrannoidannid flycatch- fresh brown headed cowbird egg was added ers petit in press A minority of cowbird host to each nest and no host eggs were removed species termed rejectersrejectrejectorsers rothstein 1975 eggs were added during daylight hours at the reject cowbird eggs by ejecting them from the following stages of the nest cycle nest build nest burying them in the nest bottom or ing 3 nests egg laying 4 nests or early in deserting the parasitized nest hosts that do incubation 3 nests some nests were observed not exhibit this response to parasitism are for 30 min after the egg was added to record called accepters hosts tend to either accept the adult pewee s response to the introduced or reject in a consistent manner rothstein egg we considered the egg accepted if it re- 1975 but see petit 1988 goguen and math- mained in the nest with adult peweespewzes attend- ews 1996 A species can be assumed to be an ing for 4 d accepter if parasitism is noted in more than at unmanipulated western wood pewee 20 of its nests friedmann et al 1977 stud- nests we recorded a parasitism frequency of ies may underestimate the frequency of para- 16 16 of 101 nests two nests were para sitism of rarely used hosts if these hosts are sitized multiply each with 2 cowbird eggs rejectersrejectorsrejecters because cowbird eggs may be cowbird eggs were accepted for at least 4 d in ejected before being observed the status of 13 nests hatched in 7 nests and fledged in 3 these hosts can be ascertained correctly only nests no nest fledged both a cowbird and a by experimentation pewee or more than a single cowbird at I1 relatively few tyrtyrannidtyrannoidannid flycatcher species nest peweespewzes accepted a cowbird egg after an have been tested in this regard eastern king adult had physically attacked the female cow- birds tyrannus tyrannus and western king bird when it first removed a pewee egg and birds T vertiverticalisverticalismcalis are rejectersrejectrejectorsers rothstein when it parasitized the nest 2 min later we 1975 while eastern phoebesphoebea sansayornissayomisSayomisornisonnis phoebe noted 2 cases of possible cowbird egg rejec- and least flycatchers empidonax minimus tion 1 involving ejection and the other deser- are accepters rothstein 1986 briskie and tion in the former case the cowbird egg was sealy 1987 we report experiments that demon- laid in an empty nest and disappeared before strate the western wood pewee is an accepter the ist pewee egg was laid in the latter case a species nest was deserted during incubation following the study site is in pinyon pine one seed parasitism and clutch reduction from 3 pewee juniper pinus adulisedulis juniperus monospermamonospermymonosperma eggs to 1 pewee egg and 1 cowbird egg woodlands in colfax county northeastern new peweespewzes accepted the cowbird egg at 8 of 10 mexico between 1992 and 1996 we located 80 experimentally parasitized nests eggs and monitored nests of western wood pewee accepted by peweespewzes remained in nests be- as part of a study of the nesting dynamics of tween 4 and 19 d prior to being predateddepredateddeprecatedde

idepartmentcpaitment ot wildlifeofwildlifc ecology university ofot wisconsinofwisconsin madison 1630 linden drive madison wlWI 53706

90 199811998 NOTES 91 along with the pewee s clutch being removed considering the obvious selective advantage by a human observer or hatching J1 nest at of such behavior it is surprising that cowbird the nest where the cowbird hatched the nest- egg ejection is not more widespread or even ling fledged successfully the immediate re- fixed in the pewee population sponse of a pewee returning to a freshly para sitisitizedzed nest during incubation was noted at acknowledgments I1 nest this bird perched on the nest rim looked briefly into the nest and settled down we wish to thank the many people who to incubate showing no sign of having noticed helped with nest searching and monitoring any change in its nest throughout the study tim demarco assisted cowbird eggs disappeared within 4 d at 2 with parasitism experiments and peter ziegler experimentally parasitized nests at a nest tested observed the parasitic act at a pewee nest the near the end of nest building the cowbird egg NRA whittington center and V 7 ranch pro- disappeared within 2 d and the pewee s clutch vided access to their lands and logistical sup- was initiated 4 d later at another nest tested port funding was provided by the USU S fish during egg laying we found the cowbird egg and wildlife service and national biological beneath the nest when we next visited it 4 d service as part of the national BBIRD pro- later the pewee clutch had increased from 2 gram the max mcgraw wildlife foundation to 3 eggs A and2nd cowbird egg added upon dis- contributed to the costs of publication this covery of this ejection was found under the work was supported by the department of nest after 3 d while the pewee clutch re- wildlife ecology university of wisconsin at mained intact madison the acceptance of experimentally added cowbird eggs at 8 of 10 nests demonstrates literature CITED that the western wood pewee like other small BRISKIE V AND S G SEALY 1987 responses of tyrannityrannidstyrannidesds tested so far is a cowbird egg accepter JVJ SG least flycatchers to experimental inter and intraspecific rothstein 1975 the observed desertion of brood parasitism condor 8989989 899 901 an unmanipulated nest may have resulted FRIEDMANN H AND LEL F KIFFKIFE 1985 the parasitic cow- from partial clutch reduction rather than para- birds and their hosts proceedings of the western sitism and thus probably does not represent foundation for vertebrate zoology 22262 226 304 have FRIEDMANN H LEL F kirrkireKIFF AND SIS I1 ROTHSTEIN 1977 A true cowbird egg rejection experiments further contribution to knowledge of the host rela- shown at least 2 other accepter species east- tions of the parasitic cowbirds smithsonian contri- ern phoebe rothstein 1986 and clay colored butions to zoology 23512359351 1 75 sparrow spizella hallidapalpallidalida hill and sealy 1994 GOGUEN CBC B AND NEN E MATHEWS 1996 nest desertion gnatcatchers to desert nests in response to partial clutch by blue gray Gnatcatchers in association with brown headed cowbird parasitism animal behaviour 52 reduction but not parasitism per se 613 619 the disappearance of the experimental cow- HILL DPD P AND SGS G SEALY 1994 desertion otof nests para bird egg from a nest tested during the build- sitized by cowbirds have clay coloured sparrows ing stage may have simply represented a gen- evolved an anti parasite defence animal behaviour 48 1063 1070 eralizederalized response to any object found in the 481063 PETIT LJ 1988 adaptive tolerance of cowbird parasitism nest prior to the host s egg laying rather than a by prothonotary warblerswarblers a consequence of nest site response specific to brood parasitism roth- limitation animal behaviour 4142541 425 432 stein 1975 the least flycatcher an accepter in press losthostI selection by cowbirds in north rejected cowbird eggs that were experimen- america adaption to life history traits or ecological opportunism in T cook SKS K robinson SIS I1 roth- 2 at building stage tally introduced to nests the stein SGS G sealy and JNMJ N M smith editors ecology but did so by nest desertion briskie and sealy and management of cowbirds university of texas 1987 furthermore nest predation or removal press austin TX of the egg by a cowbird cannot be ruled out ROTHSTEIN SIS I1 1975 an experimental and teleonomicteleo nomic investigation of avianavlan brood parasitism condor 77 however the experiments did elicit an inin- 250 271 stance of true cowbird egg rejection the re- 1986 A test of optimality egg recognition in the peated ejection of a cowbird egg from a nest eastern phoebe animal behaviour 34110934 1109 1119 containing a host clutch provides circumstan- tial evidence that peweespewzes possess the behav- received I1 may 1997 accepted 28 august 1997 ioral and physical traits required to reject cleatcledtcreatgiedtgreat basin naturalist 581 0 1998 appp 92 95

BOOK REVIEW few and far between moments in the north book and for using technical information with- american desert john martin campbell out documentation museum of new mexico press santa fe the author has been described as an arche NM 1997 2995 paperpaperboundbound 4000 ologist anthropologist photographer and re- clothbound naissance writer and the book reveals all of those characteristics by its title and theme few and far between perhaps only the author knows the mean- could be intended as a scholarly book of sci-sciseisel ing to the title few and far between it cer- ence after all the study of deserts is scienceselence tainly cannot refer to the animals that are dis- and archeologyarchearchaeologyology and anthropology are forms of cussed in the book because animals are com- selencescience photographs too can introduce one mon in deserts it might refer to the scarcity of to scienceselence when presented accurately and fac- trees or other perennial plants because many tually however to one who has been trained of the photographs depict these organisms academically about the deserts of north amer- but it couldrtt mean plants in general deserts icaleaiea and who has trained others to one who are covered with ephemerals and other forbs has lived in the deserts for a lifetime the book when physical conditions are optimal presents a pictorial introduction to deserts for the 14 color photographs are a part of the someone who is not trained in scienceselence there introduction to each of the 3 sections and the is little in the book of scientific worth fur- 59 black and white photographs each occupy therthermoremore it contains too many errors to be of a full page accompanied by descriptive infor- much value to a scientist but even the reader mation on a facing page this information is with limited knowledge of scienceselence should be limited to I1 or 2 paragraphs usually less than presented with accurate information half a page about half of these black and white the book consists of the author s photo- photographs are in the section entitled the graphs with captions and minimal discussions face of the desert while the book is about in addition one of the illustrations is a map of the desert not all photographs are appropriate part of western north america showing the 4 to the desert photographs not related to the different deserts of the continent or present- desert are marginally appropriate or totally ing the one desert which the author repeat- inappropriate to the book s title and main edly uses in his writing the photographs pri- theme marily studies in blacks grays and white with from a scientist s perspective there are sev- a few in color are the fundamental contribu- eral objections to the book s thesis one is the tions to the publication the written part of the repetitive reference to the north american volume is limited from tony Hillerhillermanmanss fore- desert as a single geographic area this is word and campbell s preface it presents 3 noted in the subtitle to the book and is repeated sections origins the face of the desert throughout the writing the origins section and desert people concluding with an page 2 contains a brief description of all earth s extensive though incomplete bibliography deserts the statement is made that the north the museum of new mexico press is com- american desert is fifth in size further sug- mended for the clean copy and reproduction gesting there is a single desert science recog- of photographs and campbell is compli- nizes both physiographically and biologically 4 mented for his talents as a photographer even very different geographic areas and 4 unique those pictures not directly of the desert he is deserts additionally smaller regions such as criticized for the many errors found in the eastern washington and eastern utah are desert

92 199711997 BOOK REVIEW 93 but decidedly not a part of the specific desert in geographic area references physiography claimed by campbell of western united states nevin M fenneman one common entity is found in all these mcgraw hill book company 1931 natural different deserts the lack of adequate water regions of the united states and canada throughout most of the year however this is charles B hunt WH freeman and com- only I1 reason for a region to be designated as pany 1974 exploring the great basin gloria desert other physical features include loca- griffen cline university of oklahoma press tion of mountain ranges and direction of pre- 1963 the trees and shrubs of the southwest- vailing winds some of this is explained in ern deserts lyman benson and robert A campbell s introductory statements darrow university of arizona press and uni- in his discussion of deserts on the different versity of new mexico press 1954 deserts continents campbell almost apologetically in- james A macmahon alfred A knopf 1985 cludes the arctic and antarctic regions in his this latter being one of the audubon society statement that 30 percent of the earth s land nature guides and the only reference of these surface is covered by desert the arctic and 5 included in campbell s bibliography antarctic regions are in fact extremely cold campbell s map is also incorrect for the deserts because water is not readily available mojave desert one of the important evidences to support life however the book is about the of this desert is the larreaambrosialarrealambrosiaLarrealaryea Ambrosia shrub deserts of north america and while illustra- association which extends into southwestern tions of the antarctica desert would be inap- washington county of utah into northwestern propriatepropriate photographs of the arctic region of mohave county of arizona both areas are north america would have made the book more shown on the map incorrectly as being great complete if one would read in some 19th basin desert and along the colorado river century historical writings of north america a farther south than shown by campbell s map reference would be found to the great ameri- the book contains many errors and incon- can desert of central north america extend- sistencies in writing on page 4 the caption to ing from mexico into canada this extensive the color photograph uses the binomial of the geographic region now referred to as the arrowweed as pulcheapulchean servicedserviceaservicea the correct grasslands biome of the continent is no longer scientific name of this shrub is pulcheapulchean sericea described as desert however it may be con- A statement is made on page 6 that the sidered as appropriate an example of a desert desert encompasses all of nevada which state- as some of those written about and shown by ment is in error high mountains certainly at campbell this great american desert might elevations immediately below timberline on the also have been included as a part of the north northern slopes are not desert even though american desert presented by the author they are surrounded by desert these high another objection to campbell s presenta- mountains are sometimes referred to as islands tion in photograph and dialogue is the idea in the sky but these islands are not part of that the great basin desert is found north and the desert A statement is made on page 50 east of its actual physiographic boundaries map about the various desert mountains with a on page xii admittedly these extended regions specific reference to elevations of from more are desert but they cannot be correctly defined than nine thousand feet to more than fourteen as great basin excluding the arctic the 4 pri- thousand feet above sea level this is implied mary deserts of north america are detailed in by campbell to be desert this map campbell s map shows both the great on page 16 the author states that the rain basin desert and the mojave desert incor- forests of the northwest coast are the only rectly the great basin desert for instance true jungles of any temperate zone region on does not extend northward into the state of earth this is not true of all such regions on washington nor eastward into central and earth but why is this even considered in a southern wyoming nor into eastern utah nor discussion on deserts on unnumbered page into northwestern or southwestern colorado 45 is the sentence not a single major desert it certainly does not extend into northeastern plant species of the mexican state of sonora arizona nor into new mexico the great basin for example grows in the desert of washing- desert conforms to the area covered by the ton with the great difference in latitudes basin and range province and is more restricted sonora 30n washington 45n how could 94 GREAT BASIN naturalist volume 57 anyone knowledgeable of plants expect them southwest where arroyos do produce diverse to be similar in these geographically separated species and large numbers of plants areas campbell reverts to the 19th and early the caption to the photo on unnumbered 20th century reference to the life zones ofcofaof C page 61 is storm on san rafael reef this hart merrlmerriamMerriaidard instead of using the now scien- photo shows clouds but no storm similarly tifically acceptable blomes idea that on page 62 and unnumbered page 63 is on page 50 an incorrect statement is made cloudburst on the red desert without any that the sage grouse is exclusive to the great evidence of water basin the known distribution of the sage ground temperatures are discussed on page grouse extends into southern canada and cen- 64 with the note that they have reached a tral north america far beyond the reaches of staggering 190 degrees E in the opinion of the great basin also on page 50 is a reference the writer of this review documentation of to prongpronghornhom antelope this mammal is admit- this temperature should be included another tedly a pronghorn but it is assuredly not an inconsistency is found on page 72 in reference antelope even though the once popular song to the photo of a playa the statement is made refers to where the deer and the antelope that the floor of a playa may be as flat as a play tabletop and as solid as a rock there is no on page 52 is the statement that the great objection to the statement but the playa shown basin desert grows relatively few plant species is fractured with mud cracks and is anything the plant species may be few in number com- but flat and certainly not solid because of pared to a tropical rain forest perhaps but a these cracks on page 74 a statement is made great variety of forbs and annuals are found in that quagmires are bottomless perhaps this all north american deserts is included as a form of poetic expression but reference to the creosotecreosotebushbush this should quagmires are not really bottomless be 2 words not 1 occurs on pages 53 and 54 A north country prickly pear is shown and with the statement that each parent root discussed on page 90 and unnumbered page may produce dozens of bushes over thousands 91 in reference to fruit size the expression is of square feet of desert floor the creosote used that desert prickly pears bear fruit two bush does clone to produce other plants over inches long others as with those of this little time and over limited areas but over thou- northernmost species are as big as thimbles sands of square feet is an exaggeration compared to 2 inches a thimble should be the full color illustration on page 55 is of referred to as small rather than big Is there the purple prickly pear opuntia vioviolaceaviolaceanlacea such a thing as a 2 inch thimble according to NL britton and JN rose the swallows nests are shown on unnumbered cactaceae volume I1 page 144 this scientific page 107 with the name of the cliff swallow name is questionable these authors explain given as hirundo pyrrhonpyrrhonotaota on the facing page that this plant can never be critically identi- the genus name for this bird is Petropetrochelidonchelidon fied because it was described from drawings not hirundo brought back from the southwest and not A statement is made on page 112 that the from actual specimens joshua tree nearly exclusively belongs to the it is stated on page 56 that the sonoran mojave desert the map on page xii shows desert runs right down to the sedsea and it the mojave desert scarcely in arizona where has its equally unique shore fauna including joshua trees are common and not at all in great sea turtles how can an animal such as southwestern utah where they are abundant a sea turtle that spends its entire life in the the word nearly probably justifies these ocean except for brief moments on land for inclusions oviposition be referred to as a desert animal in the narrative on page 116 the first para- the photo and narrative on page 58 and graph is about the accompanying picture of a unnumbered page 59 claim that arroyos mexican blue palm the binomial used for the result from the absence of close growing plant however is a synonym and not the vegetation this appears to be quite true about accepted scientific name the second para- the one pictured in new mexico but there are graph about the cochimi indians has no rec- countless examples throughout the american ogniognizablezable reference to the picture of the palm 199719971 BOOK REVIEW 95 the logical explanation might be that this sec- book review duchesne county utah refer- ond paragraph introduces desert people ence page 144 is not even remotely near a which is the last section of the book beginning desert on the next page despite these technical criticisms the reader the caption to the color photograph on page of few and far between should be entertained 120 is about the prickly pear cactus as a food by the writing especially such poetic expres- source the photograph however shows a tree sions as I1I got to go along page x desertic cholla not a prickly pear cactus pacific coastcoashcoasc page 16 the poisoned water to the discussion on page 121 is about rabbit boot page 20 the honest river and the drives the author then states that fifteen or exotic rivers page 68 on the other hand more species of other rodents were eatereaten em- the reader may find it monotonous with some phasis added this statement suggests that of the redundancies that occur rabbits are rodents campbell may have been more at peace according to the information on page 127 with his science readers had the draft been chaco canyon lies squarely in a great basin more carefully critiqued and edited by a com- desert environment As stated previously in petent scientist and had the author and editors this review new mexico is not in the great paid more attention to detail and documenta- basin although the environment may be some- tion of what supposedly is fact few and far what similar and certainly the area in and between is obviously not intended for the sci- around chaco canyon is suggestive of desert entist but it is a photographer s contribution the photo on unnumbered page 136 show- showing his ability to record in that medium ing a salmon fisher s roost in wasco county oregon is interesting historically but the andrew H barnum columbia river and its tributatributariesries are defi- professor emeritus nitely not in any desert like so many other dixie college references some of which are stated in this st george UT 4770

information FOR AUTHORS the great basin naturalist welcomes previously VOUCHER SPECIMENS authors are encouraged to unpublished manuscripts pertaining to the biologi- designate properly prepare label and deposit cal natural history of western north america high quality voucher specimens and cultures docu- preference will be given to concise manmanuscriptsuscripts of menting their research in an established permanent up to 12000 words simple species lists are dis- collection and to cite the repository in publication coucouragedraged references IN THE TEXT are cited by author and SUBMIT manuscripts to richard W baumann date eg martin 1989 or martin 1989 multiple editor great basinnaturalistbasin naturalist 290 MLBM PO box citations should be separated by commas and listed 20200 brigham young university provo UT in chronological order use et al after name of 84602020084602 0200 anan accompanying cover letter must first author for citations having more than two include phone numbers of the author submitting authors the manuscript and FAX number and emailE mail acknowledgments under a centered main address when applicable the letter must also pro- heading include special publication numbers when vide information describing the extent to which data appropriate text or illustrations have been used in other papers literature CITED also under a centered main or books that are published in press submitted or heading lists references alphabetically in the fol- soon to be submitted elsewhere authors should lowing formats adhere to the following guidelines manuscripts not mack GD and LD flake 1980 habitat relation- so prepared may be returned for revisionrevision ships of waterfowl broods on south dakota manuscript preparation in general the great stock ponds journal of wildlife management basin naturalist follows recommendations in 44695 700 scientific style and format the CBE manual for sousa WPWE 1985 disturbance and patch dynamics publishers authors editors and ath6th edition on rocky intertidal shores pages 101 124 in council of biology editors inc 11 south lasalle STA pickett and PS white editors the ecolo- street suite 1400 chicago IL 60603 USA PHONE gy of natural disturbance and patch dynamics 3122010101312 201 0101 FAX 3122010214312 201 0214 we do however academic press new york dinerdiffer in our treatment of entries in literature cited coulson RN and JA witter 1984 forest ento- authors may consult the most recent issue of the mology ecology and management john wiley great basin naturalist for formatting guidelines and sons inc new york 669 appp TYPE AND DOUBLE SPACE all materials including literature cited table headings and figure legends TABLES are double spaced on separate sheets and avoid hyphenated words at the righthandright hand margins designed to fit the width of either a single column use WordwordperfectwordperfecfsPerfect s italics feature for words to be 67gt676.7 cm or a page 14014014.0 cm use lowercase letters printed in italics use standard bond 2228 cm to indicate footnotes leaving 25 cm margins on Aallali sides photocopies OF FIGURES are submitted initially SUBMIT 3 COPIES of the manuscript 5 copies of with the manuscript editors may suggest changes fish manuscripts and the original on a 35 inch disk lettering on figures should be large enough to utilizing WordwordperfectPerfect 51sisl5.1 or above number all withstand reduction to one or two column width pages and assemble each copy separately title originals must be no larger than 22289228992822 X 28 cmem page abstract and key words text acknowledg- NOTES if the manuscript would be more appro- ments literature cited appendices tables figure priate as a short communication or note follow the legends figures above instructions but do not include an abstract TITLE PAGE includes an ininformativeormaormativenormativetive title no longer A CHARGE of 50 per page is made for articles than 15 words names and addresses of authors a published the rate for individual subscribers will running head of fewer than 40 letters and spaces be 35 per page however manuscripts with com- footnotes to indicate change of address and author plex tables andor numerous photographs may be to whom correspondence should be addressed if assessed an additional charge reprints may be pur- other than the first author chased at the time of publication an order form is ABSTRACT states the purpose methods results sent with the proofs and conclusions of the research it is followed by FINAL CHECK 6 12 key words listed in order of decreasing cover letter explaining any duplication of importance to be used for indexing information and providing phone numbers TEXT has centered main headings printed in all FAX number and emailE mail address capital letters second level headings are centered 3 copies of the manuscript 5 copies of fish in upper and lowercase letters third level head- papers and WordwordperfectPerfect diskette ings begin paragraphs conformity with instructions photocopies of illustrations ISSNis8n0017001736140017 3614 GREAT BASIN naturalist volvoivoiss58 no i1 january 19981993

CONTENTS articles taxonomy of sphaeromeria artemisia and tanacetum compositae anthemideae based on randomly amplified polymorphic DNA RAPD E durant mcarthur reneerenge van buren stewart C sanderson and kimball T harper 1 randomly amplified polymorphic DNA analysis RAPD of artemisia subgenus tridentataeTridentatae species and hybrids E durant mcarthur joann mudge reneerenge van buren W ralph andersen stewart C sanderson and david G babbel 12 bitterbrushbitterbrusbBitterbrush purshia tridentata pursh growth in relation to browsing carl L wambolt W wyatt fraas and michael R frisina 28 identity of mertensia oblongifolia nutt G don boraginaceae and its allies in western north america ahmed M warfa 38 astragalus leguminosae nomenclatural proposals and new taxa stanley L welsh 45 regional assessment fadablewadableofwadableof streams in idaho USA christopher T robinson and G wayne minshall 54 bats of the white and inyo mountains of cailCalicaliforniafomia nevada joseph M szewczak susan M szewczak michael L morrison and linnea S hall 66 habitat use by small mammals in southeastern utah with reference to mexican spotted owl management maite sureda and michael L morrison 76 late pleistocene microtine rodents from snake creek burial cave white pine county nevada christopher J bell and jim I1 mead 82 notes western toad bufo boreas in southern utah notes on a single population along the east fork of the sevier river megan robinson michael P donovan and terry D schwaner 87 western wood peweespewzes accept cowbird eggs david R curson christopher B goguen and nancy E mathews 90 book review few and far between moments in the north american desert john martin campbell andrew H barnum 92