DOCSLIB.ORG

Antibacterial Activities of Endophytic Fungi from Capsicum Annuum L. (Siling Labuyo) Leaves and Fruits

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Antibacterial Activities of Endophytic Fungi from Capsicum Annuum L. (Siling Labuyo) Leaves and Fruits BU R&D Journal 22 (1): 60-69, July 2019 | ISSN (Print): 0016-4139 journal.bicol-u.edu.ph Antibacterial Activities of Endophytic Fungi from Capsicum annuum L. (Siling labuyo) leaves and fruits Eliza Ann A. Arena, Mae Breech R. Bernal, and Jazzlyn T. Imperial* Bicol University College of Science, Legazpi City *Corresponding author: [email protected] Abstract Endophytic fungi were isolated from Capsicum annuum (siling labuyo) from three ecological zones in the province of Albay, Philippines and were identified through morpho-cultural characteristics and by molecular analysis of the internal transcribed spacer (ITS) region of the 18S ribosomal DNA. Eight fungal endophytes were isolated from the leaves and fruits. Seven were identified as Colletotrichum gloeosporioides, Lasiodiplodia pseudotheobromae, Nigrospora sphaerica, Guignardia mangiferae, Coprinopsis cinerea, Colletotrichum siamense and Colletotrichum truncatum while one remained unidentified. The extracted metabolites from the isolates were then screened for their antibacterial activities at 1,000 µg/mL. Among the fungal isolates, C. cinerea was found to be the most active against Staphylococcus aureus and Escherichia coli with zones of inhibition (ZOI) of 16.00 ± 1.00 and 17.00 ± 1.53 mm, respectively. Phytochemical screening showed that C. cinerea produced a variety of secondary metabolites such as flavonoids, alkaloids, terpenoids and quinones. The other fungal endophytes were also found to synthesize various secondary compounds that may be responsible for their antibacterial activities. Keywords: antimicrobial, Bicol, Escherichia coli, mycology, sili, Staphylococcus aureus Introduction Endophytes are highly diverse microorganisms that live within plant tissues without causing disease Antibiotic resistance is the ability of (Jia et al., 2016). They act as reservoirs of novel bioactive microorganisms to modify itself to become resistant or secondary metabolites, such as alkaloids, phenolic acids, unaffected when continually exposed to antimicrobial quinones, steroids, saponins, tannins, and terpenoids drugs. The upsurge of antibiotic resistance threatens which serve as a latent candidate for antimicrobial, public health on a global scale as it lessens the anti-insect, and anticancer agents, among others effectiveness of available treatments. This brings to the (Gouda et al., 2016). In addition to this, metabolites forefront the need to search for new antibiotics (Matjaz that are obtained from fungal endophytes from several et al., 2015). medicinal plants are identified to be good sources of pharmaceutical leads (Guerrero et al., 2019). Hence, they Traditionally, microorganisms that were are promising sources of new bioactive products that investigated for novel therapeutic agents were isolated are clinically and biotechnologically relevant (Ding et from soil. However, scientists had recently shifted their al., 2010). attention to less investigated ecological niches such as fungal endophytes which are considered as a possible The Philippines is recognized as a biodiversity source of bioactive natural products because of the hotspot with over 9,000 plant species inhabiting variety of secondary metabolites with remarkably the archipelago (Conservation International, 2007). complex molecular scaffolds they produce (Pelo et al., However, amidst the country’s floral diversity, there 2020). Moreover, they have shown to yield important are limited studies regarding the associated mycoflora compounds of pharmaceutical and commercial interest of Philippine plants. Fungal endophytes from Pandanus (Strobel, 2018). This leads to notable researches on fungi amaryllifolius (Bungihan et al., 2013), Ipomea batatas from plants as sources of bioactive metabolites with (Hipol, 2012), Musa spp. (Dagamac et al., 2010) and potential use in the health sector and in drug discovery Canarium ovatum (Torres & Dela Cruz, 2015; Guerrero (Torres & Dela Cruz, 2015). & Dalisay, 2018) were previously studied due to their BU R&D Journal, Vol. 22, July 2019 Arena et al.: Antibacterial Activities of Endophytic Fungi ISSN (Print): 0016-4139 from Capsicum annuum L. (Siling labuyo) leaves and fruits journal.bicol-u.edu.ph economic significance. One of the plants that is yet to plant samples were rinsed gently in running water to be explored for endophytic fungal communities is the remove dust and debris. After washing, a metallic one- C. annuum (siling labuyo), an important crop in the hole puncher with 6 mm diameter hole was used to Bicol Region and is often used in promoting Bicolano punch out two leaf explants under aseptic conditions, culture through cuisine and herbal medicine. Being a from each sampling sites. For the fruit tissues, a flame- medicinal plant, it has been used to aid problems with sterilized scalpel was used to cut 2 pcs of 5x3x2 mm fruit digestion like upset stomach, intestinal gas, stomach tissue (Hipol et al., 2014). Afterwards, all explants and pain, diarrhea, and cramps. It is also used to treat tissues were subjected to surface-sterilization. Explants cardiovascular conditions that include poor circulation, and tissues were sterilized using sequential immersion excessive blood clotting and high cholesterol (Gururaj et in 95% ethanol for 1 min and NaOCl for 3 min. After al., 2004). immersing into the chemicals, both leaf explants and fruit tissues were rinsed with distilled water 3 times for There is a possibility that the medicinal properties 3 min each and were airdried under sterile conditions. of C. annuum be mirrored by its fungal endophytes. The Tissue printing was also done wherein samples were fungi, even without the plant can be used to harness touched onto uninoculated Potato Dextrose Agar (PDA) and produce the same benefits similar to its host plates for possible epiphytic growth. In addition, open (Guerrero & Dalisay, 2018). Thus, this inspired the plate method was done by opening 4 uninoculated PDA current study to isolate the endophytic fungi from C. plates while transferring surface sterilized explants annuum and screen their secondary compounds against and tissues to check for possible contaminations. Two test microorganisms. leaf explants and fruit tissues were inoculated per petri dish in triplicates thus having 6 segments per ecological zone. Materials and Methods The surface-sterilized explants and tissues were Sampling sites and collection of plant samples plated immediately with the use of flame-sterilized forceps. Chloramphenicol at 150 mg/L was added Three ecological zones were chosen as sampling to prevent the growth of bacterial contaminants. sites of C. annuum leaves and fruits: the East Washington Inoculated plates were incubated at room temperature Drive Legazpi City (13.145865° N, 123.734674° E; E: for 3-7 days, and observed for growth every after two 13.81 masl) as lowland, Bonot Legazpi City (13.158089° days. Emerging hyphae from the edge of the explants N, 123.7471° E; E: 5.63 masl) as coastland and Maslog were isolated in freshly prepared PDA slants to obtain Legazpi City (13.107071° N, 123.768533° E; E: 79.35 pure cultures. masl) as upland. The plant sample collection was carried out by randomly collecting ten pieces of mature Identification and phylogenetic analysis healthy plant leaves and fruits from each of the chosen sampling sites. The collected specimens were ensured After obtaining pure cultures, identification of the to have no visual disease symptoms such as necrosis, isolated fungal endophytes were performed by comparing chlorosis, deformities and insect foraging. Mature their cultural and morphological characteristics with leaves were those that were darker in color and had published literatures (Abass & Hussein, 2014; Badalyan bigger blade while mature fruits were those that were et al., 2011; Baldassari et al., 2008; Intan Sakinah et al., reddish and shinier in color and had plump shape. 2014; Munirah et al., 2017). Accession numbers were Complete leaf blades and fruits were collected and also assigned to each morphospecies. Species having placed in sterile polyethylene bags in preparation for distinct morphocultural characteristics from the rest of endophytic fungal isolation. The plant samples gathered the cultured endophytic fungi were sent to Macrogen were authenticated by the National Museum Botany Inc. (South Korea) for molecular identification. Division, Manila with control specimen number of 17- The genomic DNA from selected endophytes were 08-1464. amplified and sequenced using the primer pair ITS1F (5’ TCCGTAGGTGAACCTGCGG 3’) and ITS4R (5’ Isolation of endophytic fungi TCCTCCGCTTATTGATATGC 3’). DNA sequences were then compared with the National Center for Endophytic fungi were isolated from the leaves Biotechnology Information (NCBI) database with the and fruits of C. annuum following the protocol of Torres use of BLASTN algorithm. Sequences of identified and Dela Cruz (2015) with some modifications. The species were aligned using CLUSTAL W in MEGA 6. 61 BU R&D Journal, Vol. 22, July 2019 ISSN (Print): 0016-4139 Arena et al.: Antibacterial Activities of Endophytic Fungi from Capsicum annuum L. (Siling labuyo) leaves and fruits journal.bicol-u.edu.ph The evolutionary distances were computed using the 100 mL sterile Potato Dextrose Broth (PDB). After p-distance method followed by the construction of a inoculation, all flasks were incubated for 35 days at room phylogenetic tree to provide a graphical representation temperature under stationary conditions. Afterwards, of divergence among isolated fungal endophytes.
Load more

Recommended publications
  • Hot Pepper (Capsicum Spp.) – Important Crop on Guam
    Food Plant Production June 2017 FPP-05 Hot Pepper (Capsicum spp.) – Important Crop on Guam Joe Tuquero, R. Gerard Chargualaf and Mari Marutani, Cooperative Extension & Outreach College of Natural & Applied Sciences, University of Guam Most Capsicum peppers are known for their spicy heat. Some varieties have little to no spice such as paprika, banana peppers, and bell peppers. The spice heat of Capsicum peppers are measured and reported as Scoville Heat Units (SHU). In 1912, American pharmacist, Wilbur Scoville, developed a test known as the, Scoville Organoleptic Test, which was used to measure pungency (spice heat) of Capsicum peppers. Since the 1980s, pungency has been more accurately measured by high-performance liquid chromatography Source: https://phys.org/news/2009-06-domestication- (HPLC). HPLC tests result in American Spice Trade capsicum-annuum-chile-pepper.html Association (ASTA) pungency units. ASTA pungency Introduction units can be converted to SHU. Table 2 displays Sco- Hot pepper, also known as chili, chilli, or chile pepper, ville Heat Units of various popular Capsicum peppers is a widely cultivated vegetable crop that originates (Wikipedia, 2017). from Central and South America. Hot peppers belong to the genus Capsicum. There are over 20 species under the genus Capsicum. There are five major domesticated species of peppers that are commercially cultivated (Table 1), and there are more than 50,000 varieties. Fig. 1 depicts a unqiue, citrus-flavored variety of Capsicum baccatum hot pepper, known as Lemon Drop (aji-type), popular for seasoning in Peru (Wikipedia, 2017). Table 1. The five major domesticated Capsicum species of pepper with examples of commonly known types of pepper.
    [Show full text]
  • Reimer Seeds Catalog
    LCTRONICLCTRONIC CATALOGCATALOG Drying Hot Peppers HP320‐20 ‐ Achar Hot Peppers HP321‐10 ‐ Aci Sivri Hot Peppers 85 days. Capsicum annuum. Open 85 days. Capsicum annuum. Open Pollinated. The plant produces good yields Pollinated. The plant produces good yields of 3 ¼" long by 1" wide hot peppers. Peppers of 7 ½" long by ½" wide Cayenne type hot are hot, have medium thin flesh, and turn peppers. Peppers are medium hot, have from green to deep red when mature. The medium thin flesh, and turn from light plant has green stems, green leaves, and yellowish‐green to red when mature. The white flowers. Excellent for pickling and plant has green stems, green leaves, and seasoning spice. A variety from India. United white flowers. Excellent drying, pickling, and States Department of Agriculture, PI 640826. seasoning powder. An heirloom variety from Scoville Heat Units: 27,267. Turkey. HP21‐10 ‐ Afghan Hot Peppers HP358‐10 ‐ African Fish Hot Peppers 85 days. Capsicum annuum. Open 85 days. Capsicum annuum. Open Pollinated. The plant produces good yields Pollinated. The plant produces good yields of 3" long by ½" wide Cayenne hot peppers. of 1 ½" long by ½" wide hot peppers. Peppers are very hot, have medium thin Peppers are medium‐hot, have medium thin flesh, and turn from green to red when flesh, and turn from cream white with green mature. The plant has green stems, green stripes, to orange with brown stripes, then leaves, and white flowers. Excellent for to red when mature. The plant has Oriental cuisine and for making hot pepper variegated leaves. An African‐American flakes and seasoning spice powder.
    [Show full text]
  • Pepper Anthracnose in the Philippines: Knowledge Review and Molecular Detection of Colletotrichum Acutatum Sensu Lato
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 16 July 2020 doi:10.20944/preprints202007.0355.v1 Pepper anthracnose in the Philippines: knowledge review and molecular detection of Colletotrichum acutatum sensu lato Mark Angelo Balendres* and Fe Dela Cueva Institute of Plant Breeding, College of Agriculture and Food Science, University of the Philippines Los Baños, Laguna, Philippines 4031 * Corresponding Author: M. A. Balendres ([email protected]) Abstract This paper reviews the current knowledge of pepper anthracnose in the Philippines. We present research outputs on pepper anthracnose from the last three years. Then, we present evidence of the widespread occurrence of C. acutatum sensu lato in the Philippines. Finally, we highlight some research prospects that would contribute towards developing an integrated anthracnose management program. Keywords: Colletotrichum truncatum, Colletotrichum gloeosporioides, chilli anthracnose, polymerase chain reaction assay, disease distribution I. Knowledge review of pepper anthracnose in the Philippines Pepper in the Philippines Pepper (Capsicum sp.) is an important vegetable crop in the family Solanaceae. It is mainly added as a spice or condiment in various dishes. In the Philippines, there is a demand for pepper in both the fresh and processing markets. However, it is a relatively small industry compared to other vegetable crops, e.g., tomato. The Cordillera and Northern Mindanao regions produce the most but, other areas, e.g., in the CALABARZON and Central Luzon, also steadily produce pepper. The price of pepper can reach to as high as Php1,000 per Kg (USD 20), making pepper cultivation attractive to small-scale growers as a source of income. Within three months, depending on the pepper variety, growers can start harvesting the fruits, that could last to several priming’s (harvests).
    [Show full text]
  • Hodnocení a Změny Různých Odrůd Chilli Papriček a Výrobků Z Nich V Průběhu Úchovy
    Hodnocení a změny různých odrůd chilli papriček a výrobků z nich v průběhu úchovy Bc. Gabriela Gaubová Diplomová práce 2020 PROHLÁŠENÍ AUTORA DIPLOMOVÉ PRÁCE Beru na vědomí, ţe: diplomová práce bude uloţena v elektronické podobě v univerzitním informačním systému a dostupná k nahlédnutí; na moji diplomovou práci se plně vztahuje zákon č. 121/2000 Sb. o právu autorském, o právech souvisejících s právem autorským a o změně některých zákonů (autorský zákon) ve znění pozdějších právních předpisů, zejm. § 35 odst. 3; podle § 60 odst. 1 autorského zákona má Univerzita Tomáše Bati ve Zlíně právo na uzavření licenční smlouvy o uţití školního díla v rozsahu § 12 odst. 4 autorského zákona; podle § 60 odst. 2 a 3 autorského zákona mohu uţít své dílo – diplomovou práci nebo poskytnout licenci k jejímu vyuţití jen s předchozím písemným souhlasem Univerzity Tomáše Bati ve Zlíně, která je oprávněna v takovém případě ode mne poţadovat přiměřený příspěvek na úhradu nákladů, které byly Univerzitou Tomáše Bati ve Zlíně na vytvoření díla vynaloţeny (aţ do jejich skutečné výše); pokud bylo k vypracování diplomové práce vyuţito softwaru poskytnutého Univerzitou Tomáše Bati ve Zlíně nebo jinými subjekty pouze ke studijním a výzkumným účelům (tj. k nekomerčnímu vyuţití), nelze výsledky diplomové práce vyuţít ke komerčním účelům; pokud je výstupem diplomové práce jakýkoliv softwarový produkt, povaţují se za součást práce rovněţ i zdrojové kódy, popř. soubory, ze kterých se projekt skládá. Neodevzdání této součásti můţe být důvodem k neobhájení práce. Prohlašuji, ţe jsem diplomové práci pracoval samostatně a pouţitou literaturu jsem citoval. V případě publikace výsledků budu uveden jako spoluautor. ţe odevzdaná verze diplomové práce a verze elektronická nahraná do IS/STAG jsou obsahově totoţné.
    [Show full text]
  • Hot Chili Chili Tool Oa., Styrke & Scoville – 3 – Rev
    Hot Chili Chili tool oa., Styrke & Scoville – 3 – rev. 1.2 Stor liste med relativ styrke og Scoville værdi (..eller den lille gruppe oversigt med kendte chili) Styrke Navne Scoville Noter ▪ Ren Capsaicin 16,000,000 12 ▪ Carolina Reaper 2,200,000 ▪ Trinidad Moruga Scorpion 2,009,231 ▪ ▪ 7 Pot Douglah 1,853,396 10++++ til 12 ▪ Trinidad Scorpion Butch T 1,463,700 ▪ Naga Viper Pepper 1,382,118 ▪ 7 Pot Barrackpore 1,300,000 ▪ 7 Pot Jonah 1,200,000 ▪ 7 Pot Primo 1,200,000 ▪ New Mexico Scorpion 1,191,595 ▪ Infinity Chili 1,176,182 ▪ Bedfordshire Super Naga 1,120,000 ▪ ▪ Dorset Naga chili 1,100,000 ▪ Naga Jolokia 1,100,000 ▪ Naga Morich 1,100,000 ▪ Spanish Naga Chili 1,086,844 ▪ 7 Pot Madballz 1,066,882 ▪ Bhut Jolokia chili 1,041,427 ▪ Chocolate Bhut Jolokia 1,001,304 ▪ 7 Pot Brain Strain 1,000,000 ▪ Bhut Jolokia Indian Carbon 1,000,000 ▪ Trinidad Scorpion 1,000,000 ▪ Raja Mirch 900,000 ▪ Habanaga chili 800,000 ▪ Nagabon Jolokia 800,000 ▪ Red Savina Habanero 580,000 10++++ Chili Home Side 1/12 Hot Chili Chili tool oa., Styrke & Scoville – 3 – rev. 1.2 10+++ og 10++++ ▪ Fatalii 500,000 10++++ ▪ Aji Chombo 500,000 ▪ Pingo de Ouro 500,000 ▪ Aribibi Gusano 470,000 ▪ Caribbean Red Habanero 400,000 ▪ Chocolate Habanero 350,000 10++++ ▪ Datil chili 350,000 10++++ ▪ Habanero 350,000 ▪ Jamaican Hot chili 350,000 ▪ Madame Jeanette chili 350,000 ▪ Rocoto chili 350,000 ▪ Scotch Bonnet 350,000 10+++ ▪ Zimbabwe Bird Chili 350,000 ▪ Adjuma 350,000 ▪ Guyana Wiri Wiri 350,000 10+++ ▪ Tiger Paw 348,634 ▪ Big Sun Habanero 325,000 ▪ Orange Habanero 325,000 9 og 10+++ ▪ Mustard Habanero 300,000 ▪ Devil’s Tongue 300,000 10++++ ▪ Orange Rocoto chili 300,000 10++ ▪ Paper Lantern Habanero 300,000 ▪ Piri Piri 300,000 8-10 ▪ Red Cheese 300,000 ▪ Red Rocoto 300,000 10++ ▪ Tepin chili 300,000 ▪ Thai Burapa 300,000 ▪ White Habanero 300,000 9-10 ▪ Yellow Habanero 300,000 ▪ Texas Chiltepin 265,000 ▪ Pimenta de Neyde 250,000 ▪ Maori 240,000 ▪ Quintisho 240,000 Chili Home Side 2/12 Hot Chili Chili tool oa., Styrke & Scoville – 3 – rev.
    [Show full text]
  • Hot Pepper (Capsicum Spp.) – Important Crop on Guam
    Food Plant Production June 2017 FPP-05 Hot Pepper (Capsicum spp.) – Important Crop on Guam Joe Tuquero, R. Gerard Chargualaf and Mari Marutani, Cooperative Extension & Outreach College of Natural & Applied Sciences, University of Guam Most Capsicum peppers are known for their spicy heat. Some varieties have little to no spice such as paprika, banana peppers, and bell peppers. The spice heat of Capsicum peppers are measured and reported as Scoville Heat Units (SHU). In 1912, American pharmacist, Wilbur Scoville, developed a test known as the, Scoville Organoleptic Test, which was used to measure pungency (spice heat) of Capsicum peppers. Since the 1980s, pungency has been more accurately measured by high-performance liquid chromatography Source: https://phys.org/news/2009-06-domestication- (HPLC). HPLC tests result in American Spice Trade capsicum-annuum-chile-pepper.html Association (ASTA) pungency units. ASTA pungency Introduction units can be converted to SHU. Table 2 displays Sco- Hot pepper, also known as chili, chilli, or chile pepper, ville Heat Units of various popular Capsicum peppers is a widely cultivated vegetable crop that originates (Wikipedia, 2017). from Central and South America. Hot peppers belong to the genus Capsicum. There are over 20 species under the genus Capsicum. There are five major domesticated species of peppers that are commercially cultivated (Table 1), and there are more than 50,000 varieties. Fig. 1 depicts a unqiue, citrus-flavored variety of Capsicum baccatum hot pepper, known as Lemon Drop (aji-type), popular for seasoning in Peru (Wikipedia, 2017). Table 1. The five major domesticated Capsicum species of pepper with examples of commonly known types of pepper.
    [Show full text]
  • Identification of Resistance to Powdery Mildew in Chile Pepper
    HORTSCIENCE 54(1):4–7. 2019. https://doi.org/10.21273/HORTSCI13596-18 day/18 °C night ± 3 °C. Plants were trans- planted from the greenhouse to the CPI Teaching Garden location, a Glendale loam Identification of Resistance to Powdery soil. The plants were spaced 30 cm apart within row in 1-m–wide rows, and furrow Mildew in Chile Pepper irrigated and fertilized as needed. 1 Disease scoring. Plants were grown under Jack E. McCoy and Paul W. Bosland natural infection conditions and were evalu- Department of Plant and Environmental Sciences, New Mexico State ated once when disease had reached its high- University, Las Cruces, NM 88003 est level throughout the field. Plants were scored based on a modified DI developed by Additional index words. Capsicum, disease resistance, Leveillula taurica, powdery mildew Zheng et al. (2013). The DI is a scale of 0 to 5, Abstract. Powdery mildew [Leveillula taurica (Lev.) Arn] is a fungus causing epidemics on where 0 = no visible sporulation, 1 = re- chile peppers (Capsicum sp.) worldwide. It was first observed in New Mexico in the late stricted chlorotic spots on the adaxial leaf 1990s and has been a reoccurring issue. During the 2017 growing season, environmental surface, with weak or no sporulation on the conditions were highly favorable for powdery mildew development and severe infection abaxial leaf area; 2 = several isolated sporu- was observed. This provided a unique opportunity to identify novel sources of resistance lation spots on the abaxial leaf area; 3 = in Capsicum to powdery mildew. In the present study, the incidence and severity of numerous sporulation spots covering up to powdery mildew was evaluated for 152 chile pepper accessions comprising different 40% to 50% of the abaxial leaf area; 4 = cultivars and species.
    [Show full text]
  • An Application of Image Processing and Fuzzy Logic
    INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 9, ISSUE 02, FEBRUARY 2020 ISSN 2277-8616 Bell Pepper And Chili Pepper Classification: An Application Of Image Processing And Fuzzy Logic Eldrin James Olaes, Edwin R. Arboleda, Jesusimo L. Dioses Jr. and Rhowel M. Dellosa Abstract: Bell pepper is often called sweet pepper and capsicum in other countries. Peppers are well-known for their different colors and uses. Capsicum peppers contain abundant antioxidants and vitamin C. In comparison to red peppers, it has nine times the level of carotene, such as lycopene which is claimed to improved heart health and reduce cancer risk. While, chili pepper, better known as ―Siling Labuyo‖ in the Philippines, is the fruit from the Genus capsicum plant, a member of the nightshade family, Solanaceae. These two kinds of pepper are commonly used as an ingredient for a different type of foods in the Philippines. Bell pepper is typically used in Filipino recipes to enhance its flavor and makes it smell better, while chili peppers are used to enhance the spiciness of the food. In this paper, the methods to be used in classifying differences of the seeds of bell pepper and chili pepper are image processing, fuzzy logic and K nearest neighbor. The morphological features of the seeds such as area, equivalent diameter, perimeter, and roundness in the gathered data from 60 samples of bell pepper and chili pepper seeds have been analyzed to classify bell pepper and chili pepper’s seeds characteristics. The fuzzy logic has been employed to determine the degrees of truth between truth and false instead of the common that only identifies truth and false.
    [Show full text]
  • Siling Labuyo) on the Sexual Behavior of Male Rattus Norvegicus (Albino Rats)
    International Journal of Science and Research (IJSR) ISSN (Online): 2319-7064 Index Copernicus Value (2016): 79.57 | Impact Factor (2017): 7.296 Effects of Capsicum frutescens L. (Siling Labuyo) on the Sexual Behavior of Male Rattus norvegicus (Albino Rats) Michael C. Guyamin1, Marinella L. Guda2, Rikki Mae U. Palec3 1, 2, 3Biological Sciences Department, College of Science and Computer Studies, De La Salle University-Dasmariñas, Cavite, Philippines Abstract: Among the traditionally used sex enhancement natural remedies in the Philippines, C. frutescens is popular for its quick onset of action involving its chemical content, capsaicin. However, its use has not been scientifically validated. Aphrodisiac activity of the test substance was evaluated in terms of exhibited sexual behavior. In order to assess the effect of C. frutescens, Mount latency (ML), intromission latency (IL), ejaculation latency (EL), mount frequency (MF), intromission frequency (IF), ejaculation frequency (EF), and post-ejaculatory interval (PEI) were carried out as the parameters. Sixteen male albino rats were divided into the following groups: T0 being the control group and T1, T2, T3 with different concentration of the test substance at 5%, 10% and 15%, respectively. The route of administration for all the groups was oral gavage, which was done once a day for 12 days. The mating behaviour was analyzed with the help of the female rats and was observed for 30 minutes, every four days. The administration of the extract resulted in significant increase in mount frequency, intromission frequency, ejaculation frequency and ejaculation latency. However, the mount latency, intromission latency and post ejaculation interval were significantly decreased throughout the experimental period.
    [Show full text]
  • 5 Tasting Ability in Humans
    5 Tasting ability in humans We must recognize that our mouth is very specific to tasting and interpreting the taste of specific foods items. Our mouth is full wit sensitive nerves which react and interpret very different even within an identical range of products, such as chilies As chilies have different “heats” or punchiness measured in the so called SCOVILLE SCALE our mouth nerves react in different places to establish the spiciness of such products Lips Left side Right side On the back top On the back bottom Tongue The 5 basic tasting senses are: Sweet, Salty, Sour, Bitter and Heat / Spiciness Scoville scale From Wikipedia, the free encyclopedia The Scoville scale is a measurement of the pungency (spicy heat) of chili peppers—such as the jalapeño, the bhut jolokia, and the world's current hottest pepper, the Carolina Reaper—or other spicy foods as reported in Scoville heat units (SHU),[1] a function of capsaicin concentration. Capsaicin is one of many related chemicals, collectively called capsaicinoids. The scale is named after its creator, American pharmacist Wilbur Scoville. His method, devised in 1912, is known as the Scoville Organoleptic Test.[2] Unlike methods based on high-performance liquid chromatography, the Scoville scale is a subjective measurement dependent on the capsaicin sensitivity of testers and so is not a precise or accurate method to measure capsaicinoid concentration.[citation needed] Considerations[edit] Since Scoville ratings are defined per unit of dry mass, comparison of ratings between products
    [Show full text]
  • Pepper Name Trinidad Moruga Scorpion 7 Pot Jonah
    Pepper Name High SHU Rating 16,000,000,000 Resiniferatoxin 5,300,000,000 Tinyatoxin 16,000,000 Pure Capsaicin 15,000,000 Dihydrocapsaicin 9,200,000 Nonivamide 9,100,000 Nordihydrocapsaicin 8,600,000 Homodihydrocapsaicin 5,300,000 Police Grade Pepper Spray 2,200,000 Carolina Reaper 2,000,000 Common Pepper Spray Trinidad Moruga 2,009,231 Scorpion 1,853,396 7 Pot Douglah 1,463,700 Trinidad Scorpion Butch T 1,382,118 Naga Viper Pepper 1,300,000 7 Pot Barrackpore 7 Pot Jonah 1,200,000 1,200,000 7 Pot Primo 1,191,595 New Mexico Scorpion 1,176,182 Infinity Chili 1,120,000 Bedfordshire Super Naga Chili 1,100,000 Dorset Naga Pepper 1,100,000 Naga Jolokia 1,100,000 Naga Morich 1,086,844 Spanish Naga Chili 1,066,882 7 Pot Madballz 1,041,427 Bhut Jolokia Pepper 1,001,304 Chocolate Bhut Jolokia 1,000,000 7 Pot Brain Strain 1,000,000 Bhut Jolokia Indian Carbon 1,000,000 Trinidad Scorpion Raja Mirch 900,000 800,000 Habanaga Pepper 800,000 Nagabon Jolokia 580,000 Red Savina Habanero 500,000 Fatalii Aji Chombo 500,000 Pingo de Ouro 500,000 Aribibi Gusano 470,000 400,000 Caribbean Red Habanero 350,000 Chocolate Habanero 350,000 Datil Pepper 350,000 Habanero Jamaican Hot Pepper 350,000 350,000 Madame Jeanette chili 350,000 Rocoto Pepper 350,000 Scotch Bonnet 350,000 Zimbabwe Bird Chili 350,000 Adjuma 350,000 Guyana Wiri Wiri 348,634 Tiger Paw 325,000 Big Sun Habanero 300,000 Mustard Habanero 300,000 Devil’s Tongue 300,000 Orange Rocoto Pepper Paper Lantern 300,000 Habanero Piri Piri 300,000 Red Cheese 300,000 Red Rocoto 300,000 300,000 Tepin Pepper Thai
    [Show full text]
  • 500+ V Arieties of P Epper Plants, 200 Tomatoes & 75
    Cross Country Nurseries 199 Kingwood Locktown Road Stockton, New Jersey 08559 Celebrate Peppers for Peace! 500+ Varieties of Pepper Plants, 200 Tomatoes & 75 Eggplants. Live Plants, Seeds, Fresh Chiles, & Organic Supplies too. The World’s Largest Selection of Chile & Sweet Pepper Plants 2020 Cross Country Nurseries 199 Kingwood Locktown Road Stockton, New Jersey 08559 www.ChilePlants.com E: [email protected] 908-996-4646 fax: 908-996-4638 2 We love being growers! We raise our plants on a diet of fish emulsion and seaweed, and use beneficial insects for pest control. Our plants are grown in 2.5” x 2.5” x 3.5” deep plastic pots. This is a nice plant size that has a great root system to produce fast. The plants average 6-8” tall, and are strong, super healthy and will produce abundantly. • Most MAIL ORDER PLANTS are $4.00 each. • Extremely Hot and Super Hot MAIL ORDER PLANTS are $4.50 each. • Carolina Reaper MAIL ORDER PLANTS are $6.00. Minimum order 6 plants. Plants are sold individually. You may mix and match any peppers, tomatoes or eggplants in any quantity. No need to order 6 of one variety. Total order must be 6 or12 plants, or any other multiple of six (6). For quickest service, please order online at www.ChilePlants.com. We recommend placing your orders early, but requesting delivery at the proper plant- ing time for your area. Plants are reserved when the order arrives, not when it ships. Pepper and Eggplant Plants ship late March through early June. Tomato Plants ship late March through late May only.
    [Show full text]