International Journal of Environmental Research and Public Health

Article Rapid and Accurate Species-Specific PCR for the Identification of Lethal Chironex Box Jellyfish in Thailand

Nuankanya Sathirapongsasuti 1,* , Kasetsin Khonchom 1, Thunyaporn Poonsawat 2,3, Mitila Pransilpa 4, Supaporn Ongsara 5, Usawadee Detsri 5,6, Suwimon Bungbai 7, Sam-ang Lawanangkoon 8, Worawut Pattanaporkrattana 8 and Satariya Trakulsrichai 9,10

1 Section of Translational Medicine, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok 10400, Thailand; [email protected] 2 Marine and Coastal Resources Research Center, Central Gulf of Thailand, Chumphon 86000, Thailand; thunya-fl[email protected] 3 Marine and Coastal Resources Research Center, Lower Gulf of Thailand, Songkhla 90100, Thailand 4 Marine and Coastal Resources Research Center, Eastern Gulf of Thailand, Rayong 21170, Thailand; [email protected] 5 Marine and Coastal Resources Research Center, Lower Andaman, Trang 92150, Thailand; [email protected] (S.O.); [email protected] (U.D.) 6 Phuket Marine Biological Center, Phuket 83000, Thailand 7 Koh Kut Hospital, Trat 23170, Thailand; [email protected] 8 Koh Phangan Hospital, Surat Thani 84280, Thailand; [email protected] (S.-a.L.); [email protected] (W.P.) 9 Ramathibodi Poison Center, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok 10400, Thailand; [email protected] 10 Department of Emergency Medicine, Faculty of Medicine, Ramathibodi Hospital, Mahidol University,


Bangkok 10400, Thailand
 * Correspondence: [email protected]; Tel.: +66-(0)2-201-2613; Fax: +66-(0)2-201-0116 Citation: Sathirapongsasuti, N.; Khonchom, K.; Poonsawat, T.; Abstract: Box jellyfish are extremely potent venom-producing marine organisms. While they have Pransilpa, M.; Ongsara, S.; Detsri, U.; been found worldwide, the highest health burden has been anticipated to be the tropical Indo-Pacific Bungbai, S.; Lawanangkoon, S.-a.; of Southeast Asia (SEA). At least 12 Cubozoan species have now been documented in Thai waters, Pattanaporkrattana, W.; Trakulsrichai, and many of them inflict acutely lethal strings, especially those under the order Chirodropida. S. Rapid and Accurate Species- Our previous study has successfully differentiated species of box jellyfish using DNA sequencing to Specific PCR for the Identification of support the morphological study. In this study, we specifically designed polymerase chain reaction Lethal Chironex Box Jellyfish in (PCR) primers for the 16S ribosomal RNA (rRNA) gene and the mitochondrial DNA cytochrome Thailand. Int. J. Environ. Res. Public oxidase subunit I (COI) gene of lethal Thai Chironex species. The SYBR green-based real-time PCR Health 2021, 18, 219. https://doi.org/ 10.3390/ijerph18010219 panel was performed for rapid species identification. The sensitivity and specificity of the panel were determined by testing samples of different species. Moreover, we applied the panel to the tentacle Received: 5 October 2020 sample from a real patient, which helped confirm the animal-of-cause of envenomation. Our results Accepted: 17 December 2020 show a success for species identification of box jellyfish using 16S rRNA and COI PCR panel, which Published: 30 December 2020 revealed congruence between molecular and morphological identification. Furthermore, the panel worked very well with the unknown samples and jellyfish tissue from the real envenomation case. Publisher’s Note: MDPI stays neu- The results demonstrated that molecular panels were able to identify three species of Chironex box tral with regard to jurisdictional claims jellyfish both rapidly and accurately, and can be performed without having a complete specimen or in published maps and institutional morphological study. affiliations.

Keywords: Chironex; box jellyfish; species identification; species-specific PCR

Copyright: © 2020 by the authors. Li- censee MDPI, Basel, Switzerland. This article is an open access article distributed 1. Introduction under the terms and conditions of the Class Cubozoa, phylum Cnidaria, often referred to as box jellyfish [1,2], are extremely Creative Commons Attribution (CC BY) potent venom-producing marine organisms. Many box jellyfish species inflict acutely lethal license (https://creativecommons.org/ stings (order Chirodropida) and represent significant marine morbidity and mortality licenses/by/4.0/).

Int. J. Environ. Res. Public Health 2021, 18, 219. https://doi.org/10.3390/ijerph18010219 https://www.mdpi.com/journal/ijerph Int. J. Environ. Res. Public Health 2021, 18, 219 2 of 12

threat in tropical and subtropical waters. However, studying the box jellyfish is challenging according to their logistical difficulties: Habitat in remote locations, patchy distribution, low abundance, dangerous, and challenging sampling [3]. Moreover, in many cases, only parts of the animal, mostly tentacles, were found. Since marine biodiversity study still uses morphological analysis as a principal species identification tool that requires a complete specimen and should be done by well-trained taxonomists. Furthermore, there is increasing evidence of cryptic species within jellyfish’s clades that are indistinguishable from morphology [4–6], making traditional species identification even more difficult. To date, over 50 species have been identified [2]. While distributing globally, we be- lieve that box jellyfish have focal habitats in Southeast Asian (SEA) waters according to progressively discovered species and sting cases reports [7–12]. In Thailand, for instance, based on the Thai Department of Marine and Coastal Resources (DMCR) and the inter- national efforts, at least 12 different species of box jellyfish have been documented in Thai waters [13,14]: Three Chironex species, Chiropsoides buitendijki (van der Horst, 1907), Meteorona kishinouyei Toshino, Miyake and Shibata, 2015., three Morbakka species, Copula sivickisi (Stiasny, 1926), Tripedalia cystophora Conant, 1897, Tripedalia binata Moore, 1988, and Alatina morandinii (Straehler–Pohl and Jarms, 2011). Of these, three Chironex species are suspected to be the potential cause of life-threatening or severe envenomation in Thai- land [10–12]. Regarding to what we have learned from Thailand, highly diverse Cubozoan species are expected in SEA. SEA is one of the top tourist destinations, especially for coastal and marine activities. Thus, a rapid species-identification will help not only for proper clinical management but also for proficient marine safety and injury prevention. Molecular identification techniques: Polymerase chain reaction (PCR), real-time PCR, and DNA sequencing are more available and affordable, which have become mainstay methods in biology, especially in cryptic species identification. In this study, based on our sequencing data from previous work [15] on DNA barcoding of 16S rRNA, 18S rRNA, and cytochrome oxidase subunit I (COI) genes of nine Thai box jellyfish species, we indi- vidually designed species-specific primers for rapid and accurate PCR-based molecular identification.

2. Materials and Methods 2.1. Box Jellyfish Specimens Fifty samples from nine species of box jellyfish tentacles, listed in Table1, were col- lected from Thai waters according to the approved protocol, Mahidol University-Institute Animal Care and Use Committee, and Mahidol University Biosafety Committee. Fresh tentacles were cut and kept in absolute ethanol at 4-degree Celsius. The rest of the animals were kept in 3% formaldehyde for morphological identification.

Table 1. The box jellyfish specimens used in this study. Fifty samples from nine species of Thai box jellyfish were collected for morphological and molecular analysis.

Order Family Species Number of Animals Chironex indrasaksajiae 22 Chirodropidae Chironex Sp.A 2 Chirodropida Chironex Sp.C 7 Chiropsalmidae Chiropsoides buitendijki 2 Chiropsellidae Meteorona kishinouyei 6 Morbakka Sp.A 3 Morbakka Sp.B 4 Carybdeida Carukiidae Morbakka Sp.C 2 Tripedaliidae Copula sivickisi 2 Total 50 Int. J. Environ. Res. Public Health 2021, 18, 219 3 of 12

For panel validation, seventeen tentacle sample s from unknown Chirodropid species, no morphological study, were accumulated by Koh Phangan Hospital, five tentacle samples of Chirodropids from Phuket Marine Biological Center, four tentacle samples of Chiro- dropids from the Marine and Coastal Resources Research Center, Central Gulf of Thailand, twelve tentacle samples of Chirodropids from the Marine and Coastal Resources Research Center, Eastern Gulf of Thailand, and one tentacle sample collected from near-fatal enveno- mation patient’s skin from Koh Kut Hospital, were collected for species identification.

2.2. DNA Extraction, PCR, and Sequencing Genomic DNA was extracted from tentacle tissue by using the QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. A pair of universal 16S rRNA primers P16sf (5’AAGGGCCGCGGTAACTCTG 3’) and S16sr (5’ ACCCTGT- TATCCCCGTGGT 3’) [16] were used to amplify the 16S rRNA gene. The universal COI primers jgHCO2198 (5’-TANACYTCNGGRTGNCCRAARAAYCA-3’) and jgLCO1490 (5’- TNTCNACNAAYCAYAARGAYATTGG-3’) [17] were used for COI amplification. PCRs were performed in a final volume of 50 ul containing 50 ng of DNA as a template, 10 uM each primer, a 25 mM concentration of each deoxynucleoside triphosphate, and 5 U of Taq polymerase. The PCR protocol for 16S rRNA gene included an initial denaturing step at 95 ◦C for 5 min, followed by 30 cycles of 95 ◦C for 30 s, 64 ◦C for 30 s and 72 ◦C for 1 min with a final extension at 72 ◦C for 5 min. While, the PCR protocol for COI gene included an initial denaturing step at 94 ◦C for 2 min, followed by 30 cycles of 92 ◦C for 40 s, 45 ◦C for 40 s and 72 ◦C for 1 min 30 s with a final extension at 72 ◦C for 5 min. The reactions were performed on a MyCycler Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The PCR products were then visualized by gel electrophoresis on a 1.5% (w/v) agarose gel in 1X Tris acetate-ethylene diamine tetra-acetic acid (EDTA) buffer, stained with ethidium bromide and visualized with a UV light (The Gel Doc XR+ System, Bio-Rad Laboratories, Inc.). DNA purification was performed using PCR Purification Kit (Qiagen, Germany). The bidirectional sequencing using the same amplification primers was performed by Macrogen (Seoul, Korea) and Bioneer (Daejeon, Korea).

2.3. Sequence Analysis The three Chironex species 16S rRNA and COI gene contigs were assembled from forward and reverse reads of each 16S rRNA and COI amplicon. MAFFT software (ver- sion 7) [18,19] was used for multiple DNA alignment. Sixty-eight amplicon sequences, 62 from laboratory and 6 from Genbank, were aligned. The phylogenetic trees were constructed using Molecular Evolutionary Genetics Analysis version 7.0 (MEGA7) [20].

2.4. Species-Specific Primers Design, Selection, and Validation Suitable areas for designing species-specific primers were identified with Multiple alignment program for amino acid or nucleotide sequences (MAFFT) version 7 [18,19], and species-specific primers for Chironex identification were designed with Aliview soft- ware (version 1.26) [21], OligoAnalyzer software (Integrated Device Technology, Inc., San Jose, CA, USA), and Primer-BLAST software (NCBI National Center for Biotechnology Information, U.S.). Primer pairs were evaluated according to 7 factors: (1) length between 18 bp to 33 bp; (2) 30-end contains one or more specific bases; (3) Delta G for hairpin less than 1 kcal/mole; (4) GC% from 35% to 60%; (5) primers for distinguishing different species; (6) false priming less than 100%; and (7) optimal annealing temperatures. All of the primers were synthesized by Integrated Device Technology, Inc. Specificity testing with each primer pair in the SYBR green-based real-time PCR assays was performed using 50 samples of 9 species of box jellyfish found in Thai waters (Table1 ). PCR amplification in a final reaction volume of 10 µL consisted of 5 µL SYBR Green master mix, 3 µL ddH2O, 0.5 µL specific forward primer, 0.5 µL specific reverse primer, and 1 µL template DNA. The PCR cycler conditions for 16S rRNA gene used were an initial denaturation at 95 ◦C for 120 s, followed by 30 cycles of 95 ◦C for 15 s, and 64 ◦C Int. J. Environ. Res. Public Health 2021, 18, x FOR PEER REVIEW 4 of 12

Green master mix, 3 μL ddH2O, 0.5 μL specific forward primer, 0.5 μL specific reverse Int. J. Environ. Res. Public Health 2021primer,, 18, 219 and 1 μL template DNA. The PCR cycler conditions for 16S rRNA gene used4 ofwere 12 an initial denaturation at 95 °C for 120 s, followed by 30 cycles of 95 °C for 15 s, and 64 °C for 60 s. The PCR cycler conditions for COI gene were an initial denaturation at 95 °C for 120for s, 60 followed s. The PCR by cycler30 cycles conditions of 95 °C for for COI 15 s, gene 55 °C were for an30 initials, anddenaturation a final extension at 95 at◦C 72 for °C for120 1 s,min. followed The PCR by 30 products cycles of were 95 ◦ Cthen for 15visu s,alized 55 ◦C forby 30gel s, electrophoresis and a final extension on a 1.5% at 72 (w◦C/v) agarosefor 1 min. gel Thein 1X PCR Tris products acetate-EDTA were then buffer, visualized stained bywith gel ethidium electrophoresis bromide on and a 1.5% visualized (w/v) withagarose a UV gel light in 1X (The Tris Gel acetate-EDTA Doc XR+ System, buffer, stainedBio-Rad with Laboratories, ethidium bromideInc.). and visualized withSensitivity a UV light testing (The Gel was Doc determined XR+ System, in Bio-RadPCR runs Laboratories, with a series Inc.). of decreasing sample DNA Sensitivityconcentrations testing of was100, determined 10, 1, 0.1, 0.01, in PCR and runs 0.001 with ng aμ seriesL−1. Two of decreasing replicates sampleof each treatmentDNA concentrations were tested.of 100, 10, 1, 0.1, 0.01, and 0.001 ng µL−1. Two replicates of each treatment were tested. 3. Results 3. Results 3.1.3.1. Three Three Chironex Chironex Box Box Jellyfish Jellyfish Foun Foundd in Various LocationsLocations inin ThailandThailand Thirty-oneThirty-one complete complete samples of three Chironex species;species;Chironex Chironex indrasaksajiae indrasaksajiae( n(n = = 22 22);); ChironexChironex Sp.Sp.A A (n = 2); 2); ChironexChironex Sp.CSp.C (n (n = =7), 7), were were collected collected from from various various locations, locations, as shownas shown in Figure in Figure 1. The1. Thespecies species of each of each sample sample was wasdetermined determined based based on morphological on morpho- anatomylogical anatomy [13]. [13].

FigureFigure 1. 1. MapMap of ofThailand, Thailand, showing showing the the species species and and locations locations where where ChironexChironex samplessamples used used in this in this study study were were found. found. The numbersThe numbers in the in bracket the bracket are animal are animal numb numbersers collected collected from from each each location. location.

3.2. Amplification and Sequencing Analysis of the 16S rRNA and COI Genes

Int. J. Environ. Res. Public Health 2021, 18, x FOR PEER REVIEW 5 of 12

Int. J. Environ. Res. Public Health 2021, 18The, 219 414 bp and 709 bp long 16S rRNA and mtDNA COI genes were5 of 12successfully amplified from 31 Chironex samples using Cubozoa universal primers. Direct sequencing of the amplicons was performed by Sanger sequencing. Unrooted phylogenetic trees, based3.2. on Amplification 62 sequences, and Sequencing 6 Chironex Analysis sequences of the 16S rRNAfrom andGeneBank, COI Genes and one outgroup species PhysaliaThe physalis 414 bp and(Table 709 bp2), long showed 16S rRNA three and mtDNAdistinct COI, well-supported genes were successfully morphological identificationamplified from (Figures 31 Chironex 2 andsamples 3). The using phylogenet Cubozoa universalic trees primers.obtained Direct for sequencing16S and COI of segments showedthe amplicons that Chironex was performed SpA byclustered Sanger sequencing. with Chironex Unrooted indrasaksajiae phylogenetic trees, and based Chironex SpC on 62 sequences, 6 Chironex sequences from GeneBank, and one outgroup species Physalia clusteredphysalis with(Table 2Chironex), showed yamaguchii three distinct,, well-supportedwhich congruence morphological with the identification morphology. (Fig- However, Chironexures2 andindrasaksajiae3). The phylogenetic and Chironex trees obtainedSpA share for 16Ssequence and COI similarity segments showedof 92.03% that in 16S rRNA andChironex 86.33%Sp.A in COI, clustered while with ChironexChironex yamaguchii indrasaksajiae andand ChironexChironex Sp.C SpC clustered share sequence with Chi- similarity of 88.14%ronex yamaguchii in 16S rRNA, which and congruence 85.43% with in theCOI morphology. gene. However, Chironex indrasaksajiae and Chironex Sp.A share sequence similarity of 92.03% in 16S rRNA and 86.33% in COI, while Chironex yamaguchii and Chironex Sp.C share sequence similarity of 88.14% in 16S TablerRNA 2. The and information 85.43% in COI of gene.16S rRNA and cytochrome oxidase subunit I (COI) gene sequences from GenBank. Table 2. The information of 16S rRNA and cytochrome oxidase subunit I (COI) gene sequences from Accession No. GenBank.Species 16S COI Accession No. ChironexSpecies fleckeri GQ849103 FJ665181 16S COI Chironex yamaguchii AGC0592 FJ665180 Chironex fleckeri GQ849103 FJ665181 ChironexChironex indrasaksajiae yamaguchii KX090147AGC0592 KT223648 FJ665180 PhysaliaChironex indrasaksajiaephysalis AY935284KX090147 AY937374 KT223648 Physalia physalis AY935284 AY937374

FigureFigure 2. Phylogenetic 2. Phylogenetic tree tree of of ChironexChironex species species based based on theon 16Sthe rRNA 16S rRNA gene sequences. gene sequences.

Int. J. Environ. Res. Public Health 2021, 18, 219 6 of 12

Int.Int. J. Environ.J. Environ. Res. Res. Public Public Health Health 2021 2021, 18, 18, x, FORx FOR PEER PEER REVIEW REVIEW 6 6of of 12 12

FigureFigureFigure 3. 3. 3.PhylogeneticPhylogenetic Phylogenetic tree tree tree of of of ChironexChironex Chironex speciesspecies species based based based on on on the the the COI COI COI gene gene gene sequences. sequences. sequences.

3.3.3.3.3.3. Species-Specific Species-SpecificSpecies-Specific Primer PrimerPrimer Design DesignDesign for for for Three Three Three Thai Thai Thai Chironex Chironex Chironex Species Species Species MultipleMultipleMultiple alignments alignments ofof 34of 34 16S34 16S 16S rRNA rRNA rRNA and and 34and COI34 34 COI sequences COI sequences sequences were performedwere were performed performed by MAFFT by by MAFFTversionMAFFT 7version programversion 7 7program to program identify to suitableto identify identify regions suitable suitable for regions primer regions design for for primer primer (Figures design design4 and (Figures5 ).(Figures The univer- 4 4and and 5).sal5). The forwardThe universal universal primer forward forward was taken primer primer from was was Sucharitakul taken taken from fromet Sucharitakul Sucharitakul al. [16] and threeet et al. al. [16] species-specific [16] and and three three species- reversespecies- specificprimersspecific reverse werereverse newly primers primers designed were were newly fornewly 16S designed designed rRNA (Table for for 16S 316S). rRNA On rRNA the (Table other(Table 3). hand, 3). On On the species-specific the other other hand, hand, species-specificforwardspecies-specific primers forward andforward universal primers primers reverse and and primeruniver universal weresal reverse reverse designed primer primer for COI were were (Table designed designed4). for for COI COI (Table(Table 4). 4).

FigureFigure 4. 4.16S 16S rRNA rRNA sequence sequence alignment alignment from from five five Chironex Chironex species. species. The The forward forward arrows arrows ar are forwarde forward primers; primers; the the reverse reverse Figure 4. 16S rRNA sequence alignment from five Chironex species. The forward arrows are forward primers; the reverse arrowsarrows are are reverse reverse primers. primers. arrows are reverse primers.

Int. J. Environ. Res. Public Health 2021, 18, 219 7 of 12 Int. J. Environ. Res. Public Health 2021, 18, x FOR PEER REVIEW 7 of 12

FigureFigure 5.5. COICOI sequencesequence alignmentalignment fromfrom fivefive ChironexChironex species.species. TheThe forwardforward arrowsarrows areare forwardforward primers;primers; thethe reversereverse arrowsarrows areare reversereverse primers.primers.

TableTable 3.3. ListList ofof thethe 16S16S rRNArRNA primersprimers ofof threethree ThaiThaiChironex Chironexspecies. species. Product SampleSample NameName Seq. (5’ Seq.→ 3’)(5’  3’) Length Length (bp) (bp) Tm ( Tm◦C) (°C) Product (bp) (bp) Universal primer P16sf AAGGGCCGCGGTAACTCTG 19 61.7 Universal primer P16sf AAGGGCCGCGGTAACTCTG 19 61.7 414 S16sr ACCCTGTTATCCCCGTGGT 19 59.5 414 S16sr ACCCTGTTATCCCCGTGGT 19 59.5 Chironex Sp.A P16sf AAGGGCCGCGGTAACTCTG 19 61.7 226 Chironex Sp.A CA16srP16sf ACCTGCTACTCCCTAAGGTTTAAATTTAGTGAAGGGCCGCGGTAACTCTG 31 19 58 61.7 Chironex indrasaksajiae P16sfACCTGCTACTCCCTAAGGTTTAAATTT AAGGGCCGCGGTAACTCTG 19 61.7 226 CA16sr 31 58 226 CI16sr ACCTACTGTTCCCTAGAGTTTAAGTTTAAAGGAGTG 32 57.6 ChironexChironex Sp.C indrasaksajiae P16sfP16sf AAGGGCCGCGGTAACTCTGAAGGGCCGCGGTAACTCTG 19 19 61.7 61.7 CC16sr CCTCTAAAGTATCTAATCTAAAGTGGAGGGTAGACCTACTGTTCCCTAGAGTTTAAGTTT 33 57 217226 CI16sr 32 57.6 AAAGG Chironex Sp.C P16sf AAGGGCCGCGGTAACTCTG 19 61.7 Table 4. List of the COI primers of three Thai Chironex species. CCTCTAAAGTATCTAATCTAAAGTGG 217 CC16sr 33 57 Sample Name Seq. (5’AGGGTAG→ 3’) Length (bp) Tm (◦C) Product (bp) Universal primer jgLCO1490 TNTCNACNAAYCAYAARGAYATTGG 25 56 709 jgHCO2198Table 4. List TANACYTCNGGRTGNCCRAARAAYCAof the 16S rRNA primers of three Thai Chironex species. 26 60 Chironex Sp. A CAcof CACCGCTTTTTCCATGTTGATTAGATTAGAAT 32 57.7 Sample Name Seq. (5’ 3’) Length (bp) Tm (°C) Product535 (bp) Universal primer Chironex_cor jgLCO1490 CATCGTTATAGCRCCTGCTARCACAGGYART TNTCNACNAAYCAYAARGAYATTGG 25 31 5662.8 709 Chironex indrasaksajiae jgHCO2198CIcof CTGTGTACCCTCCCCTATCAGCCATTCAATCTANACYTCNGGRTGNCCRAARAAYCA 26 3160 62.8 245 Chironex Sp. A Chironex_cor CAcof CACCGCTTTTTCCATGTTGATTAGATTAGAAT CATCGTTATAGCRCCTGCTARCACAGGYART 32 31 57.7 62.8 535 Chironex Sp.CChironex_cor CCcof CATCGTTATAGCRCCTGCTARCACAGGYART GGCATTCCCAAGACTAAACAACATATCCTTC 31 3162.8 59.1 349 Chironex indrasaksajiae Chironex_corCIcof CTGTGTACCCTCCCCTATCA CATCGTTATAGCRCCTGCTARCACAGGYARTGCCATTCAATC 31 31 62.8 62.8 245 Chironex_cor CATCGTTATAGCRCCTGCTARCACAGGYART 31 62.8 Chironex Sp.C CCcof GGCATTCCCAAGACTAAACAACATATCCTTC 31 59.1 The specificity tests were performed by uniplex SYBR green-based real-time349 PCR. Chironex_cor CATCGTTATAGCRCCTGCTARCACAGGYART 31 62.8 The primer specificity was confirmed by the presence of a clear band on gel electrophore- sis (FigureThe specificity6). For possible tests were cross-reactivity performed by with uniplex other SYBR Cubozoan green-based species, real-time we addition- PCR. allyThe checkedprimer thespecificity designed was primers confirmed with 19by samples the presence from six of species a clear of Thaiband box on jelly- gel fish:electrophoresisChiropsoides (Figure buitendijki 6). ,ForMeterona possiblespp., cross-reactivityMorbakka Sp.A, withMorbakka other CubozoanSp.B, Morbakka species,Sp.C, we andadditionallyCopula sivickisi checked. The the results designed clearly primers indicate with that 19 each samples pair of from primers six species identified of ThaiChironex box speciesjellyfish specifically: Chiropsoides and buitendijki showed, no Meterona cross-reactivity spp., Morbakka with other SpA, Thai Morbakka Cubozoan SpB, species. Morbakka SpC, and Copula sivickisi. The results clearly indicate that each pair of primers identified

Int. J. Environ. Res. Public Health 2021, 18, x FOR PEER REVIEW 8 of 12

Int. J. Environ. Res. Public Health 2021, 18, 219 8 of 12 Chironex species specifically and showed no cross-reactivity with other Thai Cubozoan species.

FigureFigure 6. Gels 6. Gels from from six PCR six PCR reactions reactions validating validating the thespecie speciess specificity specificity of the of thedesigned designed primers primers for three for three ChironexChironex species.species. (a) (16Sa) 16S rRNA rRNA gene gene specific specific primers primers for for ChironexChironex SpA.Sp.A. (b ()b 16S) 16S rRNA rRNA gene gene Specific Specific primers primers for Chironex indrasaksajiaeindrasaksajiae.(. (cc)) 16S 16SrRNA rRNA gene gene specific specific primers primers for forChironex ChironexSp.C. SpC. (d )(d COI) COI gene gene specific specific primers primers for Chironexfor ChironexSp.A. SpA. (e) COI (e) COI gene gene specific specific primers primers for Chironex indrasaksajiae. (f) COI gene specific primers for Chironex SpC. M: VC 100bp Plus DNA Ladder for Chironex indrasaksajiae.(f) COI gene specific primers for Chironex Sp.C. M: VC 100 bp Plus DNA Ladder (Vivantis, (Vivantis, Malaysia); 1 Chironex SpA; 2 Chironex indrasaksajiae; 3 Chironex SpC; 4 Morbakka SpA; 5 Morbakka SpB; 6 Morbakka Malaysia); 1 Chironex Sp.A; 2 Chironex indrasaksajiae; 3 Chironex Sp.C; 4 Morbakka Sp.A; 5 Morbakka Sp.B; 6 Morbakka Sp.C; SpC; 7 Meteorona spp.; 8 Chiropsoide buitendijki; 9 Copula sivickisi.; and N no template. 7 Meteorona spp.; 8 Chiropsoide buitendijki; 9 Copula sivickisi.; and N no template. Sensitivity of the PCR panels was determined by varying the starting DNA materials Sensitivity of the PCR panels was determined by varying the starting DNA materials of 10,of 10,1, 0.1, 1, 0.1, and and 0.01 0.01 ng. ng. For For all allthree three ChironexChironex species,species, the the lower lower limit limit of detection of detection was was 0.010.01 ng ngfor forCOI COI gene gene (Figure (Figure 7).7 On). On the the other other hand, hand, for for 16S 16S rRNA, rRNA, even even a low a low amount amount of of DNADNA template template resulted resulted in strong in strong positive positive signals signals (Figure (Figure 7).7 ).

Int.Int. J. J. Environ. Environ. Res. Res. Public Public Health Health2021 2021, 18, 18, 219, x FOR PEER REVIEW 99 of of 12 12

Figure 7. Sensitivity of the designed primers for three Chironex species (amplification curves). (a) 16S rRNA gene for ChironexFigure Sp.A.7. Sensitivity (b) 16S rRNA of the gene designed for Chironex primers indrasaksajiae for three .(Chironexc) 16S rRNA species gene (amplification for Chironex Sp.C.curves). (d) ( COIa) 16S gene rRNA for Chironex gene for Sp.A.Chironex (e) COI SpA. gene (b) for16SChironex rRNA gene indrasaksajiae for Chironex.(f) COIindrasaksajiae gene for.Chironex (c) 16S rRNASp.C. gene 1: 10 ng;for Chironex 2: 1 ng; 3: SpC 0.1 ng;(d) COI 4: and gene 0.01 for ng Chironex (DNA templateSpA. (e) concentrations). COI gene for Chironex indrasaksajiae. (f) COI gene for Chironex SpC. 1: 10 ng; 2: 1 ng; 3: 0.1 ng; 4: and 0.01 ng (DNA template concentrations).

3.4.3.4. Panel Panel Validation Validation with with Unknown Unknown Species Species and and Real Real Clinical Clinical Samples Samples SeventeenSeventeen tentacle tentacle samples samples from unknownfrom unknown Chirodropid Chirodropid species with species no morpholog- with no icalmorphological study were accumulatedstudy were accumulated by Koh Phangan by Koh Hospital; Phangan blind Hospital; samples blind of samples five tentacle of five samplestentacle ofsamples Chirodropids of Chirodropids from Phuket from Marine Phuket Biological Marine Biological Center, four Center, tentacle four samples tentacle ofsamples Chirodropids of Chirodropids from the from Marine the and Marine Coastal and Coastal Resources Resources Research Research Center, Center, Central Central Gulf ofGulf Thailand, of Thailand, and twelve and tentacletwelve tentacle samples samples of Chirodropids of Chirodropids from the from Marine the and Marine Coastal and ResourcesCoastal Resources Research Research Center, Eastern Center, Gulf Eastern of Thailand; Gulf of andThailand; one tentacle and one sample tentacle collected sample fromcollected near-fatal from envenomationnear-fatal envenomation patient’s skin patient’s from Kohskin from Kut Hospital Koh Kut were Hospital used were for PCR used panelfor PCR validation. panel validation. The species The of allspecies samples of all were samples successfully were successfully identified: Allidentified: seventeen All samplesseventeen from samples Koh Phangan from Koh hospital Phangan were hospital positive were for Chironex positive indrasaksajiae for Chironex; fiveindrasaksajiae samples ; fromfive Phuketsamples Marine from Phuket Biological Marine Center Biological were positive Center for wereChironex positiveSp.A, forthree Chironex samples SpA, from three thesamples Marine from and Coastalthe Marine Resources and Coastal Research Resources Center, Central Research Gulf Center, of Thailand Central were Gulf posi- of tiveThailand for Chironex were indrasaksajiae,positive for Chironexand one sampleindrasaksajiae, was positive and one for Chironexsample Sp.C;was positive all twelve for samplesChironex from SpC; the all Marine twelve andsamples Coastal from Resources the Marine Research and Coastal Center, Resources Eastern Gulf Research of Thailand Center, wereEastern positive Gulf forof ChironexThailandSp.C; were and positive the jellyfish for Chironex sample SpC; on patient and the skin jellyfish was positive sample for on Chironexpatient indrasaksajiae.skin was positive for Chironex indrasaksajiae.

Int. J. Environ. Res. Public Health 2021, 18, 219 10 of 12

4. Discussion Cubozoan or box jellyfish is the most venomous creature on the planet. While globally, they are believed to be most prevalent in the tropical Indo-Pacific region, especially in SEA. Thus, public health and tourist safety dictate that concerted actions to effectively address this issue are now many SEA national priorities. In Thailand, at least twelve species of box jellyfish have been identified, in which Chironex species was found to have potent venom and, therefore, the capacity to kill. To date, Chironex fleckeri, the multi-tentacle box jellyfish found in Australia, has been described as “the most lethal jellyfish in the world.”. But from reviewed clinical data in Thailand, we found that Chironex indrasaksajiae, newly identified box jellyfish from Thai waters have more potent venom than Chironex fleckeri by causing the systemic signs and symptoms within 1 min and cardiac arrest or death within 2–3 min [10,16]. According to what we have learned from Thailand, highly diverse Cubozoan species are expected in SEA. Moreover, since there is no territory in the water, animals can move around freely, especially box jellyfish that have the ability to swim up to 4 knots [22]. There is a high possibility that the animals found in Thai waters are also found in neighboring countries. For example, the Chironex species that we found in our Andaman Sea might also be found and could be a cause for fatal cases in Langkawi; Chironex species found in the Eastern Gulf of Thailand might be found in Cambodian or Vietnamese waters as well. Despite increasing envenomation cases and health burden in the regions, expertise related to box jellyfish: Animal survey, species identification, distribution, predictable seasonal, and geographic hot spots, is very limited. This study was the first and perhaps the most extensive Cubozoan DNA collection in SEA. The partial sequences of 16S rRNA and COI were analyzed to identify suitable regions for species-specific primers. We successfully attained a PCR panel that could identify Chi- ronex species specifically with no cross-reactivity with other Thai Cubozoan species. Since PCR and real-time PCR have become a standard technique in the laboratory. We believe that this rapid and accurate PCR-based Chironex species identification panel would help identify the cause of envenomation for proper clinical management and facilitate the box jellyfish research and enhance better awareness and insight that would lead to proficient marine safety and injury prevention in the SEA regions. Moreover, we found two out of three Thai Chironex box jellyfish, Chironex indrasaksajiae and Chironex Sp.A, are morphologi- cally similar but genetically different. They would be the sister or cryptic species. To further scrutinize this, deep sequencing to compare the whole genome sequences would help us trace back these animals’ origin and evolution. Without the complete genome sequencing and comparative genomic analysis, this study showed a relatively simple way to identify sister or cryptic species using two molecular markers: 16S rRNA and the mitochondrial DNA COI gene. However, because the panel was designed explicitly for Thai Chironex species, it may or may not be valid for Chironex species elsewhere. We believe that our approach could be used as an exemplar for other unknown or new species.

5. Conclusions Molecular biology assays have been well implemented especially for molecular identi- fication. In this study, a series of experiments have been done with the objective to develop a PCR-based strategy for rapid and accurate species identification of Chironex box jellyfish found in Thai waters. Our results show a success for species identification of box jelly- fish using 16S rRNA and COI PCR panel, both conventional PCR and SYBR green-based real-time PCR assays. Furthermore, the panel worked very well with the unknown sam- ples and jellyfish tissue from the real envenomation case. The results demonstrated that molecular panels were able to identify three species of Chironex box jellyfish both rapidly and accurately. In addition, it could be performed without having a complete sample or morphological study.

Author Contributions: Conceptualization, N.S.; Formal analysis, N.S.; Funding acquisition, N.S.; Investigation, N.S. and K.K.; Methodology, N.S. and K.K.; Project administration, N.S.; Resources, Int. J. Environ. Res. Public Health 2021, 18, 219 11 of 12

N.S., T.P., M.P., S.O., U.D., S.B., S.-a.L. and W.P.; Visualization, N.S. and K.K.; Writing–original draft, N.T. and S.T.; Writing–review & editing, N.T. and S.T. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by Biodiversity-Based Economy Development (BEDO), grant number 71/2562. Institutional Review Board Statement: The study was conducted according to the ARRIVE guide- lines, and approved by Mahidol University-Institute Animal Care and Use Committee (protocol no F03-62-007, 9 September 2019). Informed Consent Statement: Not applicable. The study is not involving humans. Data Availability Statement: The data presented and generated during the study are publicly available. The data can be found here: [https://med.mahidol.ac.th/transmed/en/Research/NS/ Research/] Acknowledgments: We especially would like to thank Angel Anne Yanagihara, the University of Hawai’i at Manoa, and the Fulbright Specialist Program for her expertise in box jellyfish, and the onsite training support. We appreciate fishermen, resort staff, local authorities, and medical personnel for insight information, coordination, and field research support. Conflicts of Interest: The authors declare no conflict of interest.

References 1. Bentlage, B.; Cartwright, P.; Yanagihara, A.A.; Lewis, C.; Richards, G.S.; Collins, A.G. Evolution of box jellyfish (Cnidaria: Cubozoa), a group of highly toxic invertebrates. Proc. R. Soc. B Biol. Sci. 2010, 277, 493–501. [CrossRef][PubMed] 2. WoRMS—World Register of Marine Species—Cubozoa. Available online: https://www.marinespecies.org/aphia.php?p= taxdetails&id=135219 (accessed on 19 March 2018). 3. Rowley, O.C.; Courtney, R.L.; Browning, S.A.; Seymour, J.E. Bay watch: Using unmanned aerial vehicles (uav’s) to survey the box jellyfish chironex fleckeri. PLoS ONE 2020, 15, e0241410. [CrossRef][PubMed] 4. Acevedo, M.J.; Straehler-Pohl, I.; Morandini, A.C.; Stampar, S.N.; Bentlage, B.; Matsumoto, G.I.; Yanagihara, A.; Toshino, S.; Bordehore, C.; Fuentes, V.L. Revision of the genus carybdea (cnidaria: Cubozoa: Carybdeidae): Clarifying the identity of its type species carybdea marsupialis. Zootaxa 2019, 4543, 515–548. [CrossRef][PubMed] 5. Bayha, K.; Dawson, M.N. New family of allomorphic jellyfishes, drymonematidae (scyphozoa, discomedusae), emphasizes evolution in the functional morphology and trophic ecology of gelatinous zooplankton. Biol. Bull. 2010, 219, 249–267. [CrossRef] 6. Dawson, M.N.; Jacobs, D.K. Molecular evidence for cryptic species of aurelia aurita (cnidaria, scyphozoa). Biol. Bull. 2001, 200, 92–96. [CrossRef] [PubMed] 7. Lippmann, J.M.; Fenner, P.J.; Winkel, K.; Gershwin, L.A. Fatal and Severe Box Jellyfish Stings, Including Irukandji Stings, in Malaysia, 2000–2010. J. Travel Med. 2011, 18, 275–281. [CrossRef][PubMed] 8. Pirkle, C.M.; Yanagihara, A.A. Insights in Public Health: Trapped in a Sea of Uncertainty: Limitations in Unintentional Injury Research in the Philippines and Interdisciplinary Solutions to Reduce Fatal Box Jellyfish Stings. Hawaii J. Med. Public Health 2019, 78, 30–34. [PubMed] 9. Sonthichai, C.; Tikumrum, S.; Smithsuwan, P.; Bussarawit, S.; Sermgew, T.; O’Reilly, M.; Siriarayaporn, P. Jellyfish envenomation events in selected coastal provinces of Thailand 1998–2008. Outbreak Surveill. Investig. Rep. 2009, 2, 9–12. 10. Thaikruea, L.; Siriariyaporn, P. The magnitude of severe box jellyfish cases on Koh Samui and Koh Pha-ngan in the Gulf of Thailand. BMC Res. Notes 2016, 9, 108. [CrossRef][PubMed] 11. Thaikruea, L.; Siriariyaporn, P.; Wutthanarungsan, R.; Smithsuwan, P. Review of Fatal and Severe Cases of Box Jellyfish Envenomation in Thailand. Asia-Pac. J. Public Health 2015, 27, NP1639–NP1651. [CrossRef][PubMed] 12. Thaikruea, L.; Siriariyaporn, P. Situation of injuries and deaths in Thailand. In Injuries and Deaths Caused by Box Jellyfish and Portuguese Man-of-War: Treatment and Prevention; Thaikruea, L., Ed.; Faculty of Medicine of Chiang Mai University: Chiang Mai, Thailand, 2014; pp. 23–42. 13. Marine and Coastal Resources Research and Development Center of Marine and Coastal Resources. Report on Venomous Jellyfish Situation in Thailand; Marine and Coastal Resources Research and Development Center of Marine and Coastal Resources: Bangkok, Thailand, 2016. 14. Toshino, S.; Nishikawa, J.; Srinui, K.; Taleb, S.; Miyake, H. New records of two species of Cubozoa from Thailand. Plankton Ben- thos Res. 2019, 14, 143–149. [CrossRef] 15. Khonchom, K.; Poonsawat, T.; Ongsara, S.; Pransilpa, M.; Detsri, U.; Sathirapongsasuti, N. Molecular identification of box jellyfish in Thai waters. In Proceedings of the 6th Marine Science Conference, Chonburi, Thailand, 18–20 June 2018; pp. 748–759. 16. Sucharitakul, P.; Chomdej, S.; Achalawitkun, T.; Arsiranant, I. Description of Chironex indrasaksajiae Sucharitakul sp. nov. (Cnidaria, Cubozoa, Chirodropida): A new species of box jellyfish from the Gulf of Thailand. Phuket Mar. Biol. Cent. Res. Bull. 2017, 74, 33–44. Int. J. Environ. Res. Public Health 2021, 18, 219 12 of 12

17. Geller, J.; Meyer, C.P.; Parker, M.; Hawk, H. Redesign of PCR primers for mitochondrial Cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. Mol. Ecol. Resour. 2013, 13.[CrossRef] 18. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2017, 20, 1160–1166. [CrossRef][PubMed] 19. Kuraku, S.; Zmasek, C.M.; Nishimura, O.; Katoh, K. aLeaves facilitates on-demand exploration of metazoan gene family trees on MAFFT sequence alignment server with enhanced interactivity. Nucleic Acids Res. 2013, 41, W22–W28. [CrossRef][PubMed] 20. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2015, 33, 1870–1874. [CrossRef][PubMed] 21. Larsson, A. AliView: A fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 2014, 30, 3276–3278. [CrossRef][PubMed] 22. Box Jellyfish, Box Jellyfish Pictures, Box Jellyfish Facts. Available online: https://www.nationalgeographic.com/animals/ invertebrates/group/box-jellyfish/ (accessed on 27 August 2012).