DOCSLIB.ORG

Centrosome-Phagy Has Been Identifed

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Wu et al. Cell Biosci (2021) 11:49 https://doi.org/10.1186/s13578-021-00557-w Cell & Bioscience REVIEW Open Access Centrosome-phagy: implications for human diseases Qi Wu1†, Xin Yu1†, Le Liu2, Shengrong Sun1* and Si Sun3* Abstract Autophagy is a prominent mechanism to preserve homeostasis and the response to intracellular or extracellular stress. Autophagic degradation can be selectively targeted to dysfunctional subcellular compartments. Centrosome homeostasis is pivotal for healthy proliferating cells, but centrosome aberration is a hallmark of diverse human disor- ders. Recently, a process called centrosome-phagy has been identifed. The process involves a panel of centrosomal proteins and centrosome-related pathways that mediate the specifc degradation of centrosomal components via the autophagic machinery. Although autophagy normally mediates centrosome homeostasis, autophagy defects facili- tate ageing and multiple human diseases, such as ciliopathies and cancer, which beneft from centrosome aberration. Here, we discuss the molecular systems that trigger centrosome-phagy and its role in human disorders. Keywords: Centrosome, Autophagy, Ciliopathies, Aging, Cancer Centrosome composition and duplication distal region, so nine sets of microtubule doublets are Te centrosome is an evolutionarily conserved cylin- present there. Furthermore, in the proximal region, the drical organelle normally localized around the nuclei. A-microtubule of one triplet and the C-microtubule of It is composed of a pair of centrioles, which consist of the adjacent triplet are connected by an A–C linker [3]. fbres connecting their proximal ends and an amor- Other striking features present in mature centrioles are phous cloud of diferent proteins surrounding the cen- the subdistal and distal appendages. Te latter are essen- triole pair called pericentriolar material (Fig. 1a) (PCM) tial for docking beneath the plasma membrane upon [1]. A signature feature of the centriole is that nine sets templating the ciliary or fagellar axoneme [4]. Outside of microtubules are arranged in a radially symmetrical the centriole microtubule wall lies a cloud of proteins col- manner at the organelle periphery [2]. Te centriole is a lectively forming the PCM, which is critical for the nucle- polarized entity, with proximal and distal regions that dif- ation of cytoplasmic microtubules [5]. Another striking fer notably in the number of microtubules they harbour. nine-fold symmetrical structure is the cartwheel present Tus, nine microtubule triplets, dubbed the A-, B-, and in the proximal-most ~ 100 nm of the procentriole, which C-microtubules within each triplet, are present in the elongate and develop as the new daughter centriole prior proximal region. Te C-microtubule is absent from the to mitosis [6]. Te cartwheel can be observed before cen- triole microtubules during the assembly process in some systems and is essential for centriole biogenesis in most *Correspondence: [email protected]; [email protected] organisms [6], suggesting that it may impart the signa- † Qi Wu and Xin Yu contributed equally to this work ture nine-fold radial symmetry to the entire organelle. 1 Department of Breast and Thyroid Surgery, Renmin Hospital of Wuhan University, 238 Ziyang Road, Wuhan 430060, Hubei, People’s Republic Te PCM supplies sites for microtubule nucleation, thus of China determining the number and composition of microtu- 3 Department of Clinical Laboratory, Renmin Hospital of Wuhan bules during the cell cycle. Terefore, all microtubule- University, 238 Ziyang Road, Wuhan 430060, Hubei, People’s Republic of China related functions, including cell division, cell shape, Full list of author information is available at the end of the article © The Author(s) 2021. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creat iveco mmons .org/licen ses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creat iveco mmons .org/publi cdoma in/ zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Wu et al. Cell Biosci (2021) 11:49 Page 2 of 13 centrioles, which are linked through a fexible structure connecting their proximal ends [9]. Towards the G1-to- S transition, a procentriole starts to assemble ~ 100 nm away from the microtubule wall of the proximal region of each parental centriole, almost orthogonally to the wall. During the S and G2 phases, each procentriole remains engaged in this confguration with its parental centriole and elongates to ~ 400 nm. Towards the end of G2, the fexible link between the two parental centrioles is sev- ered, allowing the two centrosomes, each with a procen- triole/centriole pair, to separate and govern assembly of the bipolar mitotic spindle [10]. During mitosis, each procentriole disengages from its parental centriole and loses the cartwheel, which is likely targeted for degra- dation. Te two resulting centriolar cylinders in each daughter cell are then linked through their proximal ends via a fexible structure, thus completing the duplication cycle [9]. Together, these observations suggest that, in proliferating cells, the parental centriole provides a pref- erential scafold that somehow favours the local assembly of a single and correct procentriole, thus ensuring faithful centriole duplication [10]. Centrosome‑phagy contributes to centrosome homeostasis Centrosome homeostasis not only ensures the normality Fig. 1 Centrosome composition and duplication. a The centrosome of centrosome number and structure, but also maintains is composed of a pair of centrioles, which consist of fbres connecting the normal assembly process and function of centro- their proximal ends and PCM surrounding the centriole pair. Nine some, which is an essential factor for preserving cellu- microtubule triplets, dubbed the A-, B-, and C-microtubules within lar homeostasis and preventing disease onset [11]. And each triplet, are present in the proximal region of centrioles. The C-microtubule is absent from the distal region. In the proximal region, the deregulation of centrosome homeostasis is a hall- the A-microtubule and the C-microtubule are connected by an A–C mark feature of many human diseases [12]. Centrosome linker. Other striking features present in mature centrioles are the homeostasis is afected by many factors. For example, subdistal and distal appendages; b Cells in the G1 phase contain two nuclear pore complex (NPC)-associated proteins Nup133 centrioles termed the mother and daughter centrioles. Towards the and Nup358 (also known as RanBP2) are involved in the G1-to-S transition, a procentriole starts to assemble. During the S and G2 phases, each procentriole remains engaged in this confguration control of centrosome position, and their absence lead to with its parental centriole and elongates. Towards the end of G2, the the failure of centrosome tethering to the nucleus at the fexible link between the two parental centrioles is severed, allowing G2/M transition, which is required for timely establish- the two centrosomes to separate and govern assembly of the bipolar ment of a properly positioned mitotic spindle [13, 14]. mitotic spindle Overexpression or underexpression of some centrosome proteins like Polo-like kinase 4 (PLK4) and centrosomal P4.1 associated protein (CPAP, also known as Cenp- J) contribute to changes in the structure and quantity polarity, motility and adhesion, are coordinated by cen- of centrosomes [15, 16]. And electron transport chain trosomes [7]. dysfunction (mitochondrial DNA depletion or elec As with deoxyribonucleic acid (DNA) replication, the - duplication of the centrosome is semi-conservative and tron transport chain inhibition) [17], failure of cytoki- is coupled with cell cycle progression in most cases, thus nesis, mitotic slippage, cell–cell fusion and excessive ensuring that each cell is endowed with the accurate com- centrosome duplication can lead to centrosome amplif- plement of chromosomes and the correct number of two cation [18]. In addition, recent studies have shown that centrioles (Fig. 1b) [8]. During this process, the size of the autophagy is involved in regulating centrosome homeo- centrosome is strictly regulated. Cells in the G1 phase stasis [19–21]. contain two centrioles termed the mother and daughter Macroautophagy (hereafter referred to as autophagy) is a catabolic process. Te formation of a double membrane Wu et al. Cell Biosci (2021) 11:49 Page 3 of 13 phagophore (also known as an isolation membrane) is the maintaining the stability of centrosome [19]. Similarly, key to the process of autophagy. Tis membrane forms an centrosome amplifcation disorganized autophagosome autophagosome after it elongates and closes, engulfs cel- trafcking to lysosomes, resulting in an accumulation of lular
Recommended publications
  • Mutations in CDK5RAP2 Cause Seckel Syndrome Go¨ Khan Yigit1,2,3,A, Karen E

    Mutations in CDK5RAP2 Cause Seckel Syndrome Go¨ Khan Yigit1,2,3,A, Karen E

    ORIGINAL ARTICLE Mutations in CDK5RAP2 cause Seckel syndrome Go¨ khan Yigit1,2,3,a, Karen E. Brown4,a,Hu¨ lya Kayserili5, Esther Pohl1,2,3, Almuth Caliebe6, Diana Zahnleiter7, Elisabeth Rosser8, Nina Bo¨ gershausen1,2,3, Zehra Oya Uyguner5, Umut Altunoglu5, Gudrun Nu¨ rnberg2,3,9, Peter Nu¨ rnberg2,3,9, Anita Rauch10, Yun Li1,2,3, Christian Thomas Thiel7 & Bernd Wollnik1,2,3 1Institute of Human Genetics, University of Cologne, Cologne, Germany 2Center for Molecular Medicine Cologne (CMMC), University of Cologne, Cologne, Germany 3Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), University of Cologne, Cologne, Germany 4Chromosome Biology Group, MRC Clinical Sciences Centre, Imperial College School of Medicine, Hammersmith Hospital, London, W12 0NN, UK 5Department of Medical Genetics, Istanbul Medical Faculty, Istanbul University, Istanbul, Turkey 6Institute of Human Genetics, Christian-Albrechts-University of Kiel, Kiel, Germany 7Institute of Human Genetics, Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, Germany 8Department of Clinical Genetics, Great Ormond Street Hospital for Children, London, WC1N 3EH, UK 9Cologne Center for Genomics, University of Cologne, Cologne, Germany 10Institute of Medical Genetics, University of Zurich, Schwerzenbach-Zurich, Switzerland Keywords Abstract CDK5RAP2, CEP215, microcephaly, primordial dwarfism, Seckel syndrome Seckel syndrome is a heterogeneous, autosomal recessive disorder marked by pre- natal proportionate short stature, severe microcephaly, intellectual disability, and Correspondence characteristic facial features. Here, we describe the novel homozygous splice-site Bernd Wollnik, Center for Molecular mutations c.383+1G>C and c.4005-9A>GinCDK5RAP2 in two consanguineous Medicine Cologne (CMMC) and Institute of families with Seckel syndrome. CDK5RAP2 (CEP215) encodes a centrosomal pro- Human Genetics, University of Cologne, tein which is known to be essential for centrosomal cohesion and proper spindle Kerpener Str.
  • Par6c Is at the Mother Centriole and Controls Centrosomal Protein

    Par6c Is at the Mother Centriole and Controls Centrosomal Protein

    860 Research Article Par6c is at the mother centriole and controls centrosomal protein composition through a Par6a-dependent pathway Vale´rian Dormoy, Kati Tormanen and Christine Su¨ tterlin* Department of Developmental and Cell Biology, University of California, Irvine, Irvine, CA 92697-2300, USA *Author for correspondence ([email protected]) Accepted 3 December 2012 Journal of Cell Science 126, 860–870 ß 2013. Published by The Company of Biologists Ltd doi: 10.1242/jcs.121186 Summary The centrosome contains two centrioles that differ in age, protein composition and function. This non-membrane bound organelle is known to regulate microtubule organization in dividing cells and ciliogenesis in quiescent cells. These specific roles depend on protein appendages at the older, or mother, centriole. In this study, we identified the polarity protein partitioning defective 6 homolog gamma (Par6c) as a novel component of the mother centriole. This specific localization required the Par6c C-terminus, but was independent of intact microtubules, the dynein/dynactin complex and the components of the PAR polarity complex. Par6c depletion resulted in altered centrosomal protein composition, with the loss of a large number of proteins, including Par6a and p150Glued, from the centrosome. As a consequence, there were defects in ciliogenesis, microtubule organization and centrosome reorientation during migration. Par6c interacted with Par3 and aPKC, but these proteins were not required for the regulation of centrosomal protein composition. Par6c also associated with Par6a, which controls protein recruitment to the centrosome through p150Glued. Our study is the first to identify Par6c as a component of the mother centriole and to report a role of a mother centriole protein in the regulation of centrosomal protein composition.
  • Supplemental Information Proximity Interactions Among Centrosome

    Supplemental Information Proximity Interactions Among Centrosome

    Current Biology, Volume 24 Supplemental Information Proximity Interactions among Centrosome Components Identify Regulators of Centriole Duplication Elif Nur Firat-Karalar, Navin Rauniyar, John R. Yates III, and Tim Stearns Figure S1 A Myc Streptavidin -tubulin Merge Myc Streptavidin -tubulin Merge BirA*-PLK4 BirA*-CEP63 BirA*- CEP192 BirA*- CEP152 - BirA*-CCDC67 BirA* CEP152 CPAP BirA*- B C Streptavidin PCM1 Merge Myc-BirA* -CEP63 PCM1 -tubulin Merge BirA*- CEP63 DMSO - BirA* CEP63 nocodazole BirA*- CCDC67 Figure S2 A GFP – + – + GFP-CEP152 + – + – Myc-CDK5RAP2 + + + + (225 kDa) Myc-CDK5RAP2 (216 kDa) GFP-CEP152 (27 kDa) GFP Input (5%) IP: GFP B GFP-CEP152 truncation proteins Inputs (5%) IP: GFP kDa 1-7481-10441-1290218-1654749-16541045-16541-7481-10441-1290218-1654749-16541045-1654 250- Myc-CDK5RAP2 150- 150- 100- 75- GFP-CEP152 Figure S3 A B CEP63 – – + – – + GFP CCDC14 KIAA0753 Centrosome + – – + – – GFP-CCDC14 CEP152 binding binding binding targeting – + – – + – GFP-KIAA0753 GFP-KIAA0753 (140 kDa) 1-496 N M C 150- 100- GFP-CCDC14 (115 kDa) 1-424 N M – 136-496 M C – 50- CEP63 (63 kDa) 1-135 N – 37- GFP (27 kDa) 136-424 M – kDa 425-496 C – – Inputs (2%) IP: GFP C GFP-CEP63 truncation proteins D GFP-CEP63 truncation proteins Inputs (5%) IP: GFP Inputs (5%) IP: GFP kDa kDa 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl Myc- 150- Myc- 100- CCDC14 KIAA0753 100- 100- 75- 75- GFP- GFP- 50- CEP63 50- CEP63 37- 37- Figure S4 A siCtl
  • Supplementary Data

    Supplementary Data

    SUPPLEMENTARY DATA A cyclin D1-dependent transcriptional program predicts clinical outcome in mantle cell lymphoma Santiago Demajo et al. 1 SUPPLEMENTARY DATA INDEX Supplementary Methods p. 3 Supplementary References p. 8 Supplementary Tables (S1 to S5) p. 9 Supplementary Figures (S1 to S15) p. 17 2 SUPPLEMENTARY METHODS Western blot, immunoprecipitation, and qRT-PCR Western blot (WB) analysis was performed as previously described (1), using cyclin D1 (Santa Cruz Biotechnology, sc-753, RRID:AB_2070433) and tubulin (Sigma-Aldrich, T5168, RRID:AB_477579) antibodies. Co-immunoprecipitation assays were performed as described before (2), using cyclin D1 antibody (Santa Cruz Biotechnology, sc-8396, RRID:AB_627344) or control IgG (Santa Cruz Biotechnology, sc-2025, RRID:AB_737182) followed by protein G- magnetic beads (Invitrogen) incubation and elution with Glycine 100mM pH=2.5. Co-IP experiments were performed within five weeks after cell thawing. Cyclin D1 (Santa Cruz Biotechnology, sc-753), E2F4 (Bethyl, A302-134A, RRID:AB_1720353), FOXM1 (Santa Cruz Biotechnology, sc-502, RRID:AB_631523), and CBP (Santa Cruz Biotechnology, sc-7300, RRID:AB_626817) antibodies were used for WB detection. In figure 1A and supplementary figure S2A, the same blot was probed with cyclin D1 and tubulin antibodies by cutting the membrane. In figure 2H, cyclin D1 and CBP blots correspond to the same membrane while E2F4 and FOXM1 blots correspond to an independent membrane. Image acquisition was performed with ImageQuant LAS 4000 mini (GE Healthcare). Image processing and quantification were performed with Multi Gauge software (Fujifilm). For qRT-PCR analysis, cDNA was generated from 1 µg RNA with qScript cDNA Synthesis kit (Quantabio). qRT–PCR reaction was performed using SYBR green (Roche).
  • Supplementary Table S1. Correlation Between the Mutant P53-Interacting Partners and PTTG3P, PTTG1 and PTTG2, Based on Data from Starbase V3.0 Database

    Supplementary Table S1. Correlation Between the Mutant P53-Interacting Partners and PTTG3P, PTTG1 and PTTG2, Based on Data from Starbase V3.0 Database

    Supplementary Table S1. Correlation between the mutant p53-interacting partners and PTTG3P, PTTG1 and PTTG2, based on data from StarBase v3.0 database. PTTG3P PTTG1 PTTG2 Gene ID Coefficient-R p-value Coefficient-R p-value Coefficient-R p-value NF-YA ENSG00000001167 −0.077 8.59e-2 −0.210 2.09e-6 −0.122 6.23e-3 NF-YB ENSG00000120837 0.176 7.12e-5 0.227 2.82e-7 0.094 3.59e-2 NF-YC ENSG00000066136 0.124 5.45e-3 0.124 5.40e-3 0.051 2.51e-1 Sp1 ENSG00000185591 −0.014 7.50e-1 −0.201 5.82e-6 −0.072 1.07e-1 Ets-1 ENSG00000134954 −0.096 3.14e-2 −0.257 4.83e-9 0.034 4.46e-1 VDR ENSG00000111424 −0.091 4.10e-2 −0.216 1.03e-6 0.014 7.48e-1 SREBP-2 ENSG00000198911 −0.064 1.53e-1 −0.147 9.27e-4 −0.073 1.01e-1 TopBP1 ENSG00000163781 0.067 1.36e-1 0.051 2.57e-1 −0.020 6.57e-1 Pin1 ENSG00000127445 0.250 1.40e-8 0.571 9.56e-45 0.187 2.52e-5 MRE11 ENSG00000020922 0.063 1.56e-1 −0.007 8.81e-1 −0.024 5.93e-1 PML ENSG00000140464 0.072 1.05e-1 0.217 9.36e-7 0.166 1.85e-4 p63 ENSG00000073282 −0.120 7.04e-3 −0.283 1.08e-10 −0.198 7.71e-6 p73 ENSG00000078900 0.104 2.03e-2 0.258 4.67e-9 0.097 3.02e-2 Supplementary Table S2.
  • Centrosome Impairment Causes DNA Replication Stress Through MLK3

    Centrosome Impairment Causes DNA Replication Stress Through MLK3

    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Centrosome impairment causes DNA replication stress through MLK3/MK2 signaling and R-loop formation Zainab Tayeh 1, Kim Stegmann 1, Antonia Kleeberg 1, Mascha Friedrich 1, Josephine Ann Mun Yee Choo 1, Bernd Wollnik 2, and Matthias Dobbelstein 1* 1) Institute of Molecular Oncology, Göttingen Center of Molecular Biosciences (GZMB), University Medical Center Göttingen, Göttingen, Germany 2) Institute of Human Genetics, University Medical Center Göttingen, Göttingen, Germany *Lead Contact. Correspondence and requests for materials should be addressed to M. D. (e-mail: [email protected]; ORCID 0000-0001-5052-3967) Running title: Centrosome integrity supports DNA replication Key words: Centrosome, CEP152, CCP110, SASS6, CEP152, Polo-like kinase 4 (PLK4), DNA replication, DNA fiber assays, R-loops, MLK3, MK2 alias MAPKAPK2, Seckel syndrome, microcephaly. Highlights: • Centrosome defects cause replication stress independent of mitosis. • MLK3, p38 and MK2 (alias MAPKAPK2) are signalling between centrosome defects and DNA replication stress through R-loop formation. • Patient-derived cells with defective centrosomes display replication stress, whereas inhibition of MK2 restores their DNA replication fork progression and proliferation. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
  • Suppl. Table 1

    Suppl. Table 1

    Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
  • Pdf Breuss No 3

    Pdf Breuss No 3

    © 2016. Published by The Company of Biologists Ltd | Development (2016) 143, 1126-1133 doi:10.1242/dev.131516 RESEARCH ARTICLE Mutations in the murine homologue of TUBB5 cause microcephaly by perturbing cell cycle progression and inducing p53-associated apoptosis Martin Breuss1, Tanja Fritz1, Thomas Gstrein1, Kelvin Chan1,2, Lyubov Ushakova1, Nuo Yu1, Frederick W. Vonberg1,3, Barbara Werner1, Ulrich Elling4 and David A. Keays1,* ABSTRACT abnormalities (Breuss et al., 2012; Ngo et al., 2014). Tubb5 is Microtubules play a crucial role in the generation, migration and widely expressed throughout embryonic development, and is differentiation of nascent neurons in the developing vertebrate brain. enriched in the developing cortex, where it is found in radial glial Mutations in the constituents of microtubules, the tubulins, are known to progenitors, intermediate progenitors and postmitotic neurons. As is cause an array of neurological disorders, including lissencephaly, true for the vast majority of tubulin mutations that cause human TUBB5 de novo polymicrogyria and microcephaly. In this study we explore the disease, those in are heterozygous and . The genetic and cellular mechanisms that cause TUBB5-associated preponderance of such mutations and absence of disease-causing microcephaly by exploiting two new mouse models: a conditional null alleles has led to the assertion that tubulin mutations act by a E401K knock-in, and a conditional knockout animal. These mice gain-of-function mechanism rather than haploinsufficiency (Hu present with profound microcephaly due to a loss of upper-layer et al., 2014; Kumar et al., 2010). neurons that correlates with massive apoptosis and upregulation of Here, we investigate this contention by generating an E401K p53.
  • Cep57 and Cep57l1 Function Redundantly to Recruit the Cep63

    Cep57 and Cep57l1 Function Redundantly to Recruit the Cep63

    © 2020. Published by The Company of Biologists Ltd | Journal of Cell Science (2020) 133, jcs241836. doi:10.1242/jcs.241836 SHORT REPORT Cep57 and Cep57l1 function redundantly to recruit the Cep63–Cep152 complex for centriole biogenesis Huijie Zhao1,*, Sen Yang1,2,*, Qingxia Chen1,2,3, Xiaomeng Duan1, Guoqing Li1, Qiongping Huang1, Xueliang Zhu1,2,3,‡ and Xiumin Yan1,‡ ABSTRACT SAS-5 in Caenorhabditis elegans) to load Sas-6 for cartwheel The Cep63–Cep152 complex located at the mother centriole recruits formation (Arquint et al., 2015, 2012; Cizmecioglu et al., 2010; Plk4 to initiate centriole biogenesis. How the complex is targeted to Dzhindzhev et al., 2010; Moyer et al., 2015; Ohta et al., 2014, 2018). mother centrioles, however, is unclear. In this study, we show that Several proteins, including Cep135, Cpap (also known as CENPJ), Cep57 and its paralog, Cep57l1, colocalize with Cep63 and Cep152 Cp110 (CCP110) and Cep120, contribute to building the centriolar at the proximal end of mother centrioles in both cycling cells and microtubule (MT) wall and mediate centriole elongation (Azimzadeh multiciliated cells undergoing centriole amplification. Both Cep57 and and Marshall, 2010; Brito et al., 2012; Carvalho-Santos et al., 2012; Cep57l1 bind to the centrosomal targeting region of Cep63. The Comartin et al., 2013; Hung et al., 2004; Kohlmaier et al., 2009; Lin depletion of both proteins, but not either one, blocks loading of the et al., 2013a,b; Loncarek and Bettencourt-Dias, 2018; Schmidt et al., Cep63–Cep152 complex to mother centrioles and consequently 2009). It is known that Cep152 is recruited by Cep63 to act as the cradle prevents centriole duplication.
  • Multicilin Drives Centriole Biogenesis Via E2f Proteins

    Multicilin Drives Centriole Biogenesis Via E2f Proteins

    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Multicilin drives centriole biogenesis via E2f proteins Lina Ma,1 Ian Quigley,1 Heymut Omran,2 and Chris Kintner1,3 1The Salk Institute for Biological Studies, La Jolla 92037, California, USA; 2Department of Pediatrics, University Hospital Muenster, 48149 Muenster; Germany Multiciliate cells employ hundreds of motile cilia to produce fluid flow, which they nucleate and extend by first assembling hundreds of centrioles. In most cells, entry into the cell cycle allows centrioles to undergo a single round of duplication, but in differentiating multiciliate cells, massive centriole assembly occurs in G0 by a process initiated by a small coiled-coil protein, Multicilin. Here we show that Multicilin acts by forming a ternary complex with E2f4 or E2f5 and Dp1 that binds and activates most of the genes required for centriole biogenesis, while other cell cycle genes remain off. This complex also promotes the deuterosome pathway of centriole biogenesis by activating the expression of deup1 but not its paralog, cep63. Finally, we show that this complex is disabled by mutations in human Multicilin that cause a severe congenital mucociliary clearance disorder due to reduced generation of multiple cilia. By coopting the E2f regulation of cell cycle genes, Multicilin drives massive centriole assembly in epithelial progenitors in a manner required for multiciliate cell differentiation. [Keywords: centrioles; e2f4; multiciliate cells] Supplemental material is available for this article. Received April 17, 2014; revised version accepted May 27, 2014. The centriole, a cylindrical organelle made up of triplet cently have come into focus molecularly (Tang 2013).
  • Hierarchical Recruitment of Plk4 and Regulation of Centriole Biogenesis by Two Centrosomal Scaffolds, Cep192 and Cep152

    Hierarchical Recruitment of Plk4 and Regulation of Centriole Biogenesis by Two Centrosomal Scaffolds, Cep192 and Cep152

    Hierarchical recruitment of Plk4 and regulation of PNAS PLUS centriole biogenesis by two centrosomal scaffolds, Cep192 and Cep152 Tae-Sung Kima,1, Jung-Eun Parka,1, Anil Shuklab, Sunho Choia,c, Ravichandran N. Murugand, Jin H. Leea, Mija Ahnd, Kunsoo Rheee, Jeong K. Bangd, Bo Y. Kimf, Jadranka Loncarekb, Raymond L. Eriksong,2, and Kyung S. Leea,2 aLaboratory of Metabolism, Center for Cancer Research, National Cancer Institute, Bethesda, MD 20892; bLaboratory of Protein Dynamics and Signaling, Center for Cancer Research, National Cancer Institute, Frederick, MD 21702; cResearch Laboratories, Dong-A ST, Yongin, Gyeonggi-Do 449-905, Republic of Korea; dDivision of Magnetic Resonance, Korean Basic Science Institute, Ochang, Chungbuk-Do 363-883, Republic of Korea; eDepartment of Biological Sciences, Seoul National University, Seoul 151-742, Republic of Korea; fWorld Class Institute, Korea Research Institute of Bioscience and Biotechnology, Ochang, Chungbuk-Do 363-883, Republic of Korea; and gBiological Laboratories, Harvard University, Cambridge, MA 02138 Contributed by Raymond L. Erikson, October 21, 2013 (sent for review August 8, 2013) Centrosomes play an important role in various cellular processes, overexpressed, Plk4 can induce multiple centriole precursors including spindle formation and chromosome segregation. They surrounding a single parental centriole, and centrosomally lo- are composed of two orthogonally arranged centrioles, whose calized Plk4 appears to be required for this event (16). The duplication occurs only once per cell cycle. Accurate control of cryptic polo box (CPB) present at the upstream of the C-terminal centriole numbers is essential for the maintenance of genomic polo box (PB) (18) is necessary and sufficient for targeting Plk4 integrity.
  • The Centriolar Satellite Proteins Cep72 and Cep290 Interact and Are Required for Recruitment of BBS Proteins to the Cilium

    The Centriolar Satellite Proteins Cep72 and Cep290 Interact and Are Required for Recruitment of BBS Proteins to the Cilium

    M BoC | ARTICLE The centriolar satellite proteins Cep72 and Cep290 interact and are required for recruitment of BBS proteins to the cilium Timothy R. Stowea, Christopher J. Wilkinsonb, Anila Iqbalb, and Tim Stearnsa,c aDepartment of Biology and cDepartment of Genetics, Stanford School of Medicine, Stanford, CA 94305-5020; bCentre for Biomedical Sciences, School of Biological Sciences, Royal Holloway and Bedford New College, University of London, TW20 0EX Egham, United Kingdom ABSTRACT Defects in centrosome and cilium function are associated with phenotypically Monitoring Editor related syndromes called ciliopathies. Centriolar satellites are centrosome-associated struc- Yixian Zheng tures, defined by the protein PCM1, that are implicated in centrosomal protein trafficking. Carnegie Institution We identify Cep72 as a PCM1-interacting protein required for recruitment of the ciliopathy- Received: Mar 23, 2012 associated protein Cep290 to centriolar satellites. Loss of centriolar satellites by depletion of Revised: Jun 4, 2012 PCM1 causes relocalization of Cep72 and Cep290 from satellites to the centrosome, suggest- Accepted: Jun 29, 2012 ing that their association with centriolar satellites normally restricts their centrosomal local- ization. We identify interactions between PCM1, Cep72, and Cep290 and find that disruption of centriolar satellites by overexpression of Cep72 results in specific aggregation of these proteins and the BBSome component BBS4. During ciliogenesis, BBS4 relocalizes from cen- triolar satellites to the primary cilium. This relocalization occurs normally in the absence of centriolar satellites (PCM1 depletion) but is impaired by depletion of Cep290 or Cep72, re- sulting in defective ciliary recruitment of the BBSome subunit BBS8. We propose that Cep290 and Cep72 in centriolar satellites regulate the ciliary localization of BBS4, which in turn affects assembly and recruitment of the BBSome.