ABCC11 Antibody (F48871)

Total Page:16

File Type:pdf, Size:1020Kb

ABCC11 Antibody (F48871) ABCC11 Antibody (F48871) Catalog No. Formulation Size F48871-0.4ML In 1X PBS, pH 7.4, with 0.09% sodium azide 0.4 ml F48871-0.08ML In 1X PBS, pH 7.4, with 0.09% sodium azide 0.08 ml Bulk quote request Availability 1-3 business days Species Reactivity Human Format Antigen affinity purified Clonality Polyclonal (rabbit origin) Isotype Rabbit Ig Purity Antigen affinity UniProt Q96J66 Localization Cytoplasmic, membranous Applications Western blot : 1:1000 IHC (Paraffin) : 1:50-1:100 Limitations This ABCC11 antibody is available for research use only. ABCC11 antibody IHC analysis in formalin fixed and paraffin embedded breast carcinoma. Western blot analysis of ABCC11 antibody and WiDr lysate. Predicted molecular weight: ~154/150kDa (isoforms 1/2). Description ATP-binding cassette sub-family C member 11 is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Application Notes Titration of the ABCC11 antibody may be required due to differences in protocols and secondary/substrate sensitivity. Immunogen A portion of amino acids 343-372 from the human protein was used as the immunogen for this ABCC11 antibody. Storage Aliquot the ABCC11 antibody and store frozen at -20oC or colder. Avoid repeated freeze-thaw cycles. Ordering: Phone:858.663.9055 | Fax:1.267.821.0800 | Email:[email protected] Copyright © NSJ Bioreagents. All rights reserved.
Recommended publications
  • ABCC12 Monoclonal Antibody, Clone M9II-3
    ABCC12 monoclonal antibody, Gene Symbol: ABCC12 clone M9II-3 Gene Alias: MGC27071, MRP9 Catalog Number: MAB6675 Gene Summary: This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters Regulatory Status: For research use only (RUO) and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins Product Description: Rat monoclonal antibody raised transport various molecules across extra- and against partial recombinant ABCC12. intracellular membranes. ABC genes are divided into Clone Name: M9II-3 seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of Immunogen: Recombinant protein corresponding to the MRP subfamily which is involved in multi-drug amino acids 690-734 of human ABCC12. resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Host: Rat Increased expression of this gene is associated with breast cancer. [provided by RefSeq] Reactivity: Human References: Applications: ICC, IHC-Fr, WB 1. Multidrug resistance-associated protein 9 (ABCC12) is (See our web site product page for detailed applications present in mouse and boar sperm. Ono N, Van der information) Heijden I, Scheffer GL, Van de Wetering K, Van Deemter E, De Haas M, Boerke A, Gadella BM, De Rooij Protocols: See our web site at DG, Neefjes JJ, Groothuis TA, Oomen L, Brocks L, http://www.abnova.com/support/protocols.asp or product Ishikawa T, Borst P. Ono N, Van der Heijden I, Scheffer page for detailed protocols GL, Van de Wetering K, Van Deemter E, De Haas M, Boerke A, Gadella BM, De Rooij DG, Neefjes JJ, Specificity: M9II-3 reacts with an internal epitope of Groothuis TA, Oomen L, Brocks L, Ishikawa T, Borst P.
    [Show full text]
  • Transcriptional and Post-Transcriptional Regulation of ATP-Binding Cassette Transporter Expression
    Transcriptional and Post-transcriptional Regulation of ATP-binding Cassette Transporter Expression by Aparna Chhibber DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Pharmaceutical Sciences and Pbarmacogenomies in the Copyright 2014 by Aparna Chhibber ii Acknowledgements First and foremost, I would like to thank my advisor, Dr. Deanna Kroetz. More than just a research advisor, Deanna has clearly made it a priority to guide her students to become better scientists, and I am grateful for the countless hours she has spent editing papers, developing presentations, discussing research, and so much more. I would not have made it this far without her support and guidance. My thesis committee has provided valuable advice through the years. Dr. Nadav Ahituv in particular has been a source of support from my first year in the graduate program as my academic advisor, qualifying exam committee chair, and finally thesis committee member. Dr. Kathy Giacomini graciously stepped in as a member of my thesis committee in my 3rd year, and Dr. Steven Brenner provided valuable input as thesis committee member in my 2nd year. My labmates over the past five years have been incredible colleagues and friends. Dr. Svetlana Markova first welcomed me into the lab and taught me numerous laboratory techniques, and has always been willing to act as a sounding board. Michael Martin has been my partner-in-crime in the lab from the beginning, and has made my days in lab fly by. Dr. Yingmei Lui has made the lab run smoothly, and has always been willing to jump in to help me at a moment’s notice.
    [Show full text]
  • Interindividual Differences in the Expression of ATP-Binding
    Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2018/02/02/dmd.117.079061.DC1 1521-009X/46/5/628–635$35.00 https://doi.org/10.1124/dmd.117.079061 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 46:628–635, May 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Special Section on Transporters in Drug Disposition and Pharmacokinetic Prediction Interindividual Differences in the Expression of ATP-Binding Cassette and Solute Carrier Family Transporters in Human Skin: DNA Methylation Regulates Transcriptional Activity of the Human ABCC3 Gene s Tomoki Takechi, Takeshi Hirota, Tatsuya Sakai, Natsumi Maeda, Daisuke Kobayashi, and Ichiro Ieiri Downloaded from Department of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka, Japan (T.T., T.H., T.S., N.M., I.I.); Drug Development Research Laboratories, Kyoto R&D Center, Maruho Co., Ltd., Kyoto, Japan (T.T.); and Department of Clinical Pharmacy and Pharmaceutical Care, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka, Japan (D.K.) Received October 19, 2017; accepted January 30, 2018 dmd.aspetjournals.org ABSTRACT The identification of drug transporters expressed in human skin and levels. ABCC3 expression levels negatively correlated with the methylation interindividual differences in gene expression is important for understanding status of the CpG island (CGI) located approximately 10 kilobase pairs the role of drug transporters in human skin. In the present study, we upstream of ABCC3 (Rs: 20.323, P < 0.05). The reporter gene assay revealed evaluated the expression of ATP-binding cassette (ABC) and solute carrier a significant increase in transcriptional activity in the presence of CGI.
    [Show full text]
  • View a Copy of This Licence, Visit
    Robertson et al. BMC Biology (2020) 18:103 https://doi.org/10.1186/s12915-020-00826-z RESEARCH ARTICLE Open Access Large-scale discovery of male reproductive tract-specific genes through analysis of RNA-seq datasets Matthew J. Robertson1,2, Katarzyna Kent3,4,5, Nathan Tharp3,4,5, Kaori Nozawa3,5, Laura Dean3,4,5, Michelle Mathew3,4,5, Sandra L. Grimm2,6, Zhifeng Yu3,5, Christine Légaré7,8, Yoshitaka Fujihara3,5,9,10, Masahito Ikawa9, Robert Sullivan7,8, Cristian Coarfa1,2,6*, Martin M. Matzuk1,3,5,6 and Thomas X. Garcia3,4,5* Abstract Background: The development of a safe, effective, reversible, non-hormonal contraceptive method for men has been an ongoing effort for the past few decades. However, despite significant progress on elucidating the function of key proteins involved in reproduction, understanding male reproductive physiology is limited by incomplete information on the genes expressed in reproductive tissues, and no contraceptive targets have so far reached clinical trials. To advance product development, further identification of novel reproductive tract-specific genes leading to potentially druggable protein targets is imperative. Results: In this study, we expand on previous single tissue, single species studies by integrating analysis of publicly available human and mouse RNA-seq datasets whose initial published purpose was not focused on identifying male reproductive tract-specific targets. We also incorporate analysis of additional newly acquired human and mouse testis and epididymis samples to increase the number of targets identified. We detected a combined total of 1178 genes for which no previous evidence of male reproductive tract-specific expression was annotated, many of which are potentially druggable targets.
    [Show full text]
  • Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Harvard University - DASH Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Varas, Florencio, Matthias Stadtfeld, Luisa de Andres-Aguayo, Nimet Maherali, Alessandro di Tullio, Lorena Pantano, Cedric Notredame, et al. 2009. Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions. Stem Cells 27(2): 300-306. Published Version doi:10.1634/stemcells.2008-0696 Accessed February 18, 2015 8:46:59 PM EST Citable Link http://nrs.harvard.edu/urn-3:HUL.InstRepos:4459933 Terms of Use This article was downloaded from Harvard University's DASH repository, and is made available under the terms and conditions applicable to Open Access Policy Articles, as set forth at http://nrs.harvard.edu/urn- 3:HUL.InstRepos:dash.current.terms-of-use#OAP (Article begins on next page) EMBRYONIC STEM CELLS/INDUCED PLURIPOTENT STEM CELLS Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions FLORENCIO VARAS,a MATTHIAS STADTFELD,b LUISA DE ANDRES-AGUAYO,a NIMET MAHERALI,b ALESSANDRO DI TULLIO,a LORENA PANTANO,c CEDRIC NOTREDAME,c KONRAD HOCHEDLINGER,b THOMAS GRAFa,d aDifferentiation and Cancer and cBioinformatics Program, Center for Genomic Regulation and Pompeu Fabra University, Barcelona, Spain; bCancer Center and Center for Regenerative Medicine, Massachusetts General Hospital, Harvard Stem Cell Institute, Boston, Massachusetts, USA; dInstitucio´ Catalana de Recerca i Estudis Avanc¸ats Key Words.
    [Show full text]
  • View See Ref
    Finelli et al. Molecular Cytogenetics 2012, 5:16 http://www.molecularcytogenetics.org/content/5/1/16 RESEARCH Open Access Juxtaposition of heterochromatic and euchromatic regions by chromosomal translocation mediates a heterochromatic long- range position effect associated with a severe neurological phenotype Palma Finelli1,2*, Silvia Maria Sirchia3,4, Maura Masciadri1, Milena Crippa1, Maria Paola Recalcati1, Daniela Rusconi1, Daniela Giardino1, Laura Monti3, Francesca Cogliati1, Francesca Faravelli5, Federica Natacci6, Leonardo Zoccante7, Bernardo Dalla Bernardina7, Silvia Russo1 and Lidia Larizza1,3 Abstract Background: The term “position effect” is used when the expression of a gene is deleteriously affected by an alteration in its chromosomal environment even though the integrity of the protein coding sequences is maintained. We describe a patient affected by epilepsy and severe neurodevelopment delay carrying a balanced translocation t(15;16)(p11.2;q12.1)dn that we assume caused a position effect as a result of the accidental juxtaposition of heterochromatin in the euchromatic region. Results: FISH mapped the translocation breakpoints (bkps) to 15p11.2 within satellite III and the 16q12.1 euchromatic band within the ITFG1 gene. The expression of the genes located on both sides of the translocation were tested by means of real-time PCR and three, all located on der(16), were found to be variously perturbed: the euchromatic gene NETO2/BTCL2 was silenced, whereas VPS35 and SHCBP1, located within the major heterochromatic block of chromosome 16q11.2, were over-expressed. Pyrosequencing and chromatin immunoprecipitation of NETO2/BTCL2 and VPS35 confirmed the expression findings. Interphase FISH analysis showed that der(16) localised to regions occupied by the beta satellite heterochromatic blocks more frequently than der(15).
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Gene Section Review ABCC11 (ATP-binding cassette, sub-family C (CFTR/MRP), member 11) Akimitsu Yamada, Kazuaki Takabe, Krista P Terracina, Takashi Ishikawa, Itaru Endo Department of Breast and Oncological Surgery, Yokohama City University School of Medicine, Kanagawa, Japan (AY, IE), Department of Surgery, Virginia Commonwealth University, Richmond, Virginia, USA (AY, KT, KPT), Department of Breast and Thyroid Surgery, Yokohama City University Medical Center, Yokohama, Kanagawa, Japan (TI) Published in Atlas Database: December 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/ABCC11ID538ch16q12.html DOI: 10.4267/2042/54005 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology genes were classified into the multidrug resistant- Abstract associated protein (MRP) family. Review on ABCC11, with data on DNA/RNA, on Description the protein encoded and where the gene is implicated. The ABCC11 gene is encoded by a 68 kb gene consisting of 30 exons (Yabuuchi et al., 2001). According to the August 2013, NCBI database, Identity there are three ABCC11 variants. Variant 1 consists Other names: EWWD, MRP8, WW of 4576 bp (NM_032583.3) while variant 2 consists of 4862 bp (NM_033151.3). Both variant 1 and 2 HGNC (Hugo): ABCC11 genes encode an ABCC11 protein (isoform a) Location: 16q12.1 consisting of 1382 amino acids. Variant 3 (isoform b) consists of 4462 bp (NM_145186.2) and encodes DNA/RNA a protein consisting of 1344 amino acids. This variant 3 lacks an alternate in-frame exon compared Note to variant 1, resulting in a shorter protein (isoform In 2001, three research groups independently b), compared to isoform a.
    [Show full text]
  • Repositioning of Tyrosine Kinase Inhibitors As Antagonists of ATP-Binding Cassette Transporters in Anticancer Drug Resistance
    Cancers 2014, 6, 1925-1952; doi:10.3390/cancers6041925 OPEN ACCESS cancers ISSN 2072-6694 www.mdpi.com/journal/cancers Review Repositioning of Tyrosine Kinase Inhibitors as Antagonists of ATP-Binding Cassette Transporters in Anticancer Drug Resistance Yi-Jun Wang, Yun-Kai Zhang, Rishil J. Kathawala and Zhe-Sheng Chen * Department of Pharmaceutical Sciences, College of Pharmacy and Health Sciences, St. John’s University, Queens, NY 11439, USA; E-Mails: [email protected] (Y.-J.W.); [email protected] (Y.-K.Z.); [email protected] (R.J.K.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-718-990-1432; Fax: +1-718-990-1877. Received: 31 July 2014; in revised form: 4 September 2014 / Accepted: 11 September 2014 / Published: 29 September 2014 Abstract: The phenomenon of multidrug resistance (MDR) has attenuated the efficacy of anticancer drugs and the possibility of successful cancer chemotherapy. ATP-binding cassette (ABC) transporters play an essential role in mediating MDR in cancer cells by increasing efflux of drugs from cancer cells, hence reducing the intracellular accumulation of chemotherapeutic drugs. Interestingly, small-molecule tyrosine kinase inhibitors (TKIs), such as AST1306, lapatinib, linsitinib, masitinib, motesanib, nilotinib, telatinib and WHI-P154, have been found to have the capability to overcome anticancer drug resistance by inhibiting ABC transporters in recent years. This review will focus on some of the latest and clinical developments with ABC transporters, TKIs and anticancer drug resistance. Keywords: multidrug resistance; ABC transporters; tyrosine kinase inhibitor; clinical relevance; pharmacogenomics 1. Introduction Cancer, also known as malignant neoplasm or tumor, is the second most leading cause of death after cardiovascular diseases in United States and developing countries.
    [Show full text]
  • Allele Frequencies of the ABCC11 Gene for Earwax Phenotypes Among Ancient Populations of Hokkaido, Japan
    Journal of Human Genetics (2009) 54, 409–413 & 2009 The Japan Society of Human Genetics All rights reserved 1434-5161/09 $32.00 www.nature.com/jhg ORIGINAL ARTICLE Allele frequencies of the ABCC11 gene for earwax phenotypes among ancient populations of Hokkaido, Japan Takehiro Sato1, Tetsuya Amano2, Hiroko Ono2, Hajime Ishida3, Haruto Kodera4, Hirofumi Matsumura5, Minoru Yoneda6 and Ryuichi Masuda1 Human earwax is classified into wet and dry types, which are determined by a single-nucleotide polymorphism in the adenosine triphosphate-binding cassette, sub-family C11 (ABCC11) gene locus. To investigate the allele frequencies of the ABCC11 locus within ancient populations on the Northern Japanese island of Hokkaido, amplified product-length polymorphisms were analyzed for 50 specimens of the Okhotsk people and 35 specimens of the Jomon and Epi-Jomon people excavated from various archaeological sites of Hokkaido. Of these specimens, 31 Okhotsk and 19 Jomon/Epi-Jomon samples were genotyped successfully. Frequencies of the wet-type allele in the Jomon/Epi-Jomon people, considered a major ancestor of the Ainu, were higher than those of other Northeastern Asian populations, including the modern Ainu. By contrast, in the Okhotsk people, believed to originate from East Siberia, frequencies of the dry-type allele were relatively higher than those in the Ainu and Jomon/Epi-Jomon people. These results suggest that gene flow from the Northeastern Asian Continent to descendants of the Jomon/Epi-Jomon people of Hokkaido through the Okhotsk people occurred,
    [Show full text]
  • Multidrug Resistance in Mammals and Fungi—From MDR to PDR: a Rocky Road from Atomic Structures to Transport Mechanisms
    International Journal of Molecular Sciences Review Multidrug Resistance in Mammals and Fungi—From MDR to PDR: A Rocky Road from Atomic Structures to Transport Mechanisms Narakorn Khunweeraphong and Karl Kuchler * Center for Medical Biochemistry, Max Perutz Labs Vienna, Campus Vienna Biocenter, Medical University of Vienna, Dr. Bohr-Gasse 9/2, A-1030 Vienna, Austria; [email protected] * Correspondence: [email protected]; Tel.: +43-1-4277-61807; Fax: +43-1-4277-9618 Abstract: Multidrug resistance (MDR) can be a serious complication for the treatment of cancer as well as for microbial and parasitic infections. Dysregulated overexpression of several members of the ATP-binding cassette transporter families have been intimately linked to MDR phenomena. Three paradigm ABC transporter members, ABCB1 (P-gp), ABCC1 (MRP1) and ABCG2 (BCRP) appear to act as brothers in arms in promoting or causing MDR in a variety of therapeutic cancer settings. However, their molecular mechanisms of action, the basis for their broad and overlapping substrate selectivity, remains ill-posed. The rapidly increasing numbers of high-resolution atomic structures from X-ray crystallography or cryo-EM of mammalian ABC multidrug transporters initiated a new era towards a better understanding of structure–function relationships, and for the dynamics and mechanisms driving their transport cycles. In addition, the atomic structures offered new evolutionary perspectives in cases where transport systems have been structurally conserved from bacteria to humans, including the pleiotropic drug resistance (PDR) family in fungal pathogens for which high resolution structures are as yet unavailable. In this review, we will focus the discussion Citation: Khunweeraphong, N.; Kuchler, K.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 12 Gene Symbol ABCC12 Organism Human Gene Summary This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1 MDR/TAP MRP ALD OABP GCN20 and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. Gene Aliases MGC27071, MRP9 RefSeq Accession No. NC_000016.9, NT_010498.15 UniGene ID Hs.410111 Ensembl Gene ID ENSG00000140798 Entrez Gene ID 94160 Assay Information Unique Assay ID qHsaCEP0058208 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000311303, ENST00000448542, ENST00000416054 Amplicon Context Sequence CGGTGGCTTCATCAAGGAGAATGATCTTTGAATTACGGAGAAGAGCTCGGGCCA CACAAAGCAGCTGACGTTCCCCTACTGAGAAGTTTTCTCCATTTTCTGTGACTTC TGCCTGTAATTTTTC Amplicon Length (bp) 94 Chromosome Location 16:48117960-48119602 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 101 R2 0.9986 cDNA Cq 34.53 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 82 gDNA Cq 24.32 Specificity (%) 100 Information
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]