Zoologica Scripta
New taxa refresh the phylogeny and classification of pleurostomatid ciliates (Ciliophora, Litostomatea)
LEI WU,XIAOXIAO JIAO,ZHUO SHEN,ZHENZHEN YI,JIQIU LI,ALAN WARREN &XIAOFENG LIN
Submitted: 2 February 2016 Wu, L., Jiao, X., Shen, Z., Yi, Z., Li, J., Warren, A. & Lin, X. (2016). New taxa refresh the Accepted: 22 April 2016 phylogeny and classification of pleurostomatid ciliates (Ciliophora, Litostomatea). doi:10.1111/zsc.12193 —Zoologica Scripta, 00: 000–000. A high diversity of pleurostomatid ciliates has been discovered in the last decade, and their systematics needs to be improved in the light of new findings concerning their morphology and molecular phylogeny. In this work, a new genus, Protolitonotus gen. n., and two new spe- cies, Protolitonotus magnus sp. n. and Protolitonotus longus sp. n., were studied. Furthermore, 19 novel nucleotide sequences of SSU rDNA, LSU rDNA and ITS1-5.8S-ITS2 were collected to determine the phylogenetic relationships and systematic positions of the pleurostomatid ciliates in this study. Based on both molecular and morphological data, the results demon- strated that: (i) as disclosed by the sequence analysis of SSU rDNA, LSU rDNA and ITS1- 5.8S-ITS2, Protolitonotus gen. n. is sister to all other pleurostomatids and thus represents an independent lineage and a separate family, Protolitonotidae fam. n., which is defined by the presence of a semi-suture formed by the right somatic kineties near the dorsal margin of the body; (ii) the families Litonotidae and Kentrophyllidae are both monophyletic based on both SSU rDNA and LSU rDNA sequences, whereas Amphileptidae are non-monophyletic in trees inferred from SSU rDNA sequences; and (iii) the genera Loxophyllum and Kentrophyllum are both monophyletic, whereas Litonotus is non-monophyletic based on SSU rDNA analy- ses. ITS1-5.8S-ITS2 sequence data were used for the phylogenetic analyses of pleurostom- atids for the first time; however, species relationships were less well resolved than in the SSU rDNA and LSU rDNA trees. In addition, a major revision to the classification of the order Pleurostomatida is suggested and a key to its families and genera is provided. Corresponding author: Xiaofeng Lin, Laboratory of Protozoology, Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, South China Normal University, Guangzhou 510631, China. E-mail: [email protected] Lei Wu, Xiaoxiao Jiao, Zhuo Shen, Zhenzhen Yi, and Jiqiu Li, Laboratory of Protozoology, Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, South China Normal University, Guangzhou 510631, China., E-mails: [email protected], [email protected], [email protected], [email protected], [email protected] Alan Warren, Department of Life Sciences, Natural History Museum, Cromwell Rd., London SW7 5BD, UK. E-mail: [email protected] Xiaofeng Lin, Laboratory of Protozoology, Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, South China Normal University, Guangzhou 510631, China. E-mail:[email protected]
Introduction Traditionally, studies on pleurostomatids were based exclu- The Pleurostomatida, a species-rich order in the subclass sively on live observations which led to difficulties in species Haptoria, has proved to be more diverse than previously identification (Faur e-Fr emiet 1908; Kahl 1931, 1933; Dra- anticipated, and its taxonomy and molecular phylogeny have gesco 1954, 1960, 1965). With the application of the silver drawn much attention in the last decade (Lin et al. 2005a,b, staining, and the revelation of the ciliary pattern of pleu- c, 2007a,b, 2008a,b; Gao et al. 2008; Pan et al. 2010, 2013, rostomatids, the systematics of many ambiguous morpho- 2014; Vd’a cny et al. 2010, 2011a,b, 2014; Zhang et al. 2012; types have been resolved and several new genera have been Wu et al. 2013, 2014, 2015a,b; Vd’a cny et al. 2015). established (Petz et al. 1995; Lin & Song 2004; Lin et al.
ª 2016 Royal Swedish Academy of Sciences 1 Systematics of pleurostomatid ciliates L. Wu et al.
2005a, 2008a). According to Lynn (2008), the order Pleu- Semi-suture: a ciliary structure formed by the anterior rostomatida is divided into two families, Litonotidae and shortening of the right somatic kineties along full kin- Amphileptidae, based on the presence/absence of an anterior eties forming an incomplete suture – a characteristic suture formed by the right somatic kineties. Several new taxa feature of the family Protolitonotidae fam. n. have since been described, based on both morphology and small subunit ribosomal DNA (SSU rDNA) sequence data, Extraction, amplification and sequencing of DNA giving the opportunity to carry out phylogenetic and system- For each species, one or several identified cells were iso- atic analyses of pleurostomatids (Pan et al. 2010, 2013, 2014; lated and repeatedly washed in sterilized habitat water to Wu et al. 2013, 2014, 2015a,b; Vd’a cny et al. 2014; Vd’a cny remove contaminants, and transferred into 45 ll ATL buf- et al. 2015). As a result of these findings, three families are fer pending genomic DNA extraction. Their genomic recognized within the order Pleurostomatida: Litonotidae, DNA was extracted using a DNeasy Blood and Tissue Kit Amphileptidae and Kentrophyllidae (Wu et al. 2015a). In (Qiagen, Shanghai, China) according to the protocol. PCR this study, we (i) describe two new species belonging to a amplification, SSU rDNA cloning and sequencing were newly established genus and family and sequence the SSU conducted according to the method described by Wu et al. rDNA of each; (ii) investigate phylogenetic relationships (2013). Primers for partial LSU rDNA gene amplification within the order Pleurostomatida based on sequence data of were 28S-F2 (50-ACSCGCTGRAYTTAAGCAT-30) and three markers, that is SSU rDNA, LSU rDNA and ITS1- 28S-R2 (50-AACCTTGGAGACCTGAT-30). The ITS1- 5.8S-ITS2; (iii) revise the classification of the pleurostom- 5.8S-ITS2 region was amplified using the forward primer atids; and (iv) provide a key to the identification of the fami- 5.8S-F (GTAGGTGAACCTGCGGAAGGATCATTA) lies and genera of the order Pleurostomatida. and the reverse primer 5.8S-R (TACTGATATGCT TAAGTTCAGCGG), with PCR conditions as follows: 35 cycles with denaturation at 94 °C for 30 s (initial denatura- Materials and methods tion for 5 min), primer annealing at 56 °C for 1 min and Collection and identification primer extension at 72 °C for 2 min (final extension for All the species for this study were collected from coastal 10 min). regions of southern China between December 2007 and December 2012 (sampling locations are listed in Table S1 Phylogenetic analyses in Supporting Information), and investigated in life and Apart from the newly sequenced species, the sequences stained with protargol following the method of Wilbert of the SSU rDNA, LSU rDNA and ITS1-5.8S-ITS2 (1975). Description of Protolitonotus magnus sp. n. and Pro- region used in phylogenetic analyses were obtained from tolitonotus longus sp. n. is in Supporting Information. the GenBank database. The three molecular markers of Amphileptus spiculatus, A. bellus, A. aeschtae and A. salignus litostomatean ciliates were unambiguously identified and were identified according to Wu et al. (2015b), Lin et al. aligned using CLUSTALW implemented in BIOEDIT (2007a) and Chen et al. (2011). Identification of Loxophyl- 7.0 (Hall 1999). The alignment was then modified by lum meridionale and L. chinense is according to Wu et al. removing highly variable regions, and refined manually (2013) and Pan et al. (2013). Kentrophyllum sp. 1 and sp. 2 by eye. The data sets used for phylogenetic inferences are as described in Wu et al. (2015a,b). Terminology is comprised 1568 characters for SSU rDNA, 1733 charac- according to Lynn (2008) and the present study. ters for LSU rDNA and 444 characters for ITS1-5.8S- The following specialized terms are used in the descrip- ITS2. The program MrModeltest v.2 (Nylander 2004) tion and remarks/comparison: selected the GTR + G + I evolutionary model under the Full-kinety: the rightmost kinety or kineties of the cell Akaike information criterion. Bayesian inference (BI) running the entire body length in protolitonotids. analysis was conducted with MrBayes 3.1.2 (Ronquist & Single-suture: a ciliary structure formed by the pro- Huelsenbeck 2003) using the aforementioned evolution gressive shortening of the medial somatic kineties on model, with a run of 1 300 000 generations at a sam- the right side forming a suture in the anterior part of pling frequency of 100 and a burn-in of 3250 (25%). body – a characteristic feature of the family Amphilep- Maximum likelihood (ML) analysis was carried out online tidae. on the CIPRES Portal V 1.15 (http://www.phylo.org), Double-suture: a ciliary structure formed by the pro- using RAxML with the parameters as described in Sta- gressive shortening of the right-medial somatic kin- matakis et al. (2008). The reliability of internal branches eties forming two sutures, one in the anterior body was assessed using the nonparametric bootstrap method, half and one in the posterior body half – a characteris- with 1000 replicates. Maximum parsimony (MP) analysis tic feature of the family Kentrophyllidae. was performed with PAUP 4.0b10 (Swofford 2002) using
2 ª 2016 Royal Swedish Academy of Sciences L. Wu et al. Systematics of pleurostomatid ciliates the tree-bisection–reconnection algorithm and bootstrap- studies (Wu et al. 2013, 2014, 2015a,b; Vd’a cny et al. ping with 1000 replicates. 2015). Within this family, only the genus Loxophyllum is monophyletic in all three analyses (92% ML, 1.00 BI, 67% Results and discussion MP). The genera Acineria and Siroloxophyllum cluster Molecular data together to form a group that is sister to Loxophyllum with All new sequences have been deposited in the GenBank variable support (1.00 BI, 68% ML, 63% MP). The genus (for accession numbers, see Table S1). Protolitonotus longus Litonotus is paraphyletic when L. pictus is included. (ii) differs from P. magnus pop. 1 by 76 nt, and from P. magnus Clade 2 comprises the genera Amphileptus and Pseudoam- pop. 2 by 78 nt. The two populations of P. magnus differ phileptus which are members of the family Amphileptidae. from each other by 5 nucleotides and have a sequence sim- All species of Amphileptus form a poorly supported clade ilarity of 99.6%. (17% ML, 20% MP) that is sister to Pseudoamphileptus. Amphileptus is shown monophyletic, but it is statistically Phylogenetic analyses unsupported, which is consistent with previous studies (Pan Phylogenetic analyses of SSU rDNA sequences. The ML, BI et al. 2014; Wu et al. 2015b). (iii) Clade 3 includes only and MP trees based on the data set of SSU rDNA species of the genus Kentrophyllum, family Kentrophyllidae, sequences of 48 taxa show essentially identical topologies; and is maximally supported in all analyses. (iv) Clade 4 therefore, only the ML tree topology is shown (Fig. 1). All comprises Protolitonotus longus sp. n. and both populations the phylogenetic analyses recover the pleurostomatids as a of P. magnus sp. n. only. This clade is strongly supported monophyletic group with maximum posterior probability (99% ML, 1.00 BI, 99% MP) and is sister to all the other (1.00 BI) and bootstrap values of 96% and 77% for ML groups of pleurostomatids. Therefore, we classify this and MP analyses, respectively. There are four clades within molecular clade as a new family Protolitonotidae fam. n. the pleurostomatid assemblage: (i) Clade 1 consists of Loxo- phyllum, Siroloxophyllum, Acineria and Litonotus, all of which Phylogenetic analyses of LSU rDNA sequences. Taxon sam- are members of the family Litonotidae. The monophyly of pling in the LSU rDNA data set is very limited, but overall the family Litonotidae is recovered with strong support val- the topology recovered is consistent with the SSU rDNA ues (99% ML, 1.00 BI, 94% MP) as also shown in previous tree (Fig. 2). The monophyly of the order Pleurostomatida
Fig. 1 Maximum likelihood tree based on 46 SSU rDNA sequences of litostomatean ciliates. Numbers at nodes indicate bootstrap values of maximum likelihood (ML), posterior probabilities from Bayesian analysis (BI) and bootstrap values from maximum parsimony (MP), respectively. The species whose SSU rDNA was newly sequenced in this study are in bold. Arrow indicates the clade of Pleurostomatida. GenBank accession numbers are given after names of species. The scale bar corresponds to five substitutions per 100 nucleotide positions.
ª 2016 Royal Swedish Academy of Sciences 3 Systematics of pleurostomatid ciliates L. Wu et al. is almost maximally supported in all analyses (100% ML, BI, 85% MP). Protolitonotus magnus sp. n. pop. 2 (i.e. Pro- 1.00 BI, 99% MP). Inside the Pleurostomatida clade, the tolitonotidae fam. n.) was basal within the Pleurostomatida Loxophyllum spp. (belonging to the family Litonotidae) clade, which is broadly consistent phylogenetic pattern with clade groups with Amphileptus spp. (belonging to the family SSU rDNA and LSU rDNA trees. Amphileptidae) with weak support (66% ML, 0.51 BI, 69% MP), and together forms a sister group to the family Ken- Summary of three gene markers analyses. In total, 19 new trophyllidae, represented by Kentrophyllum, with near-maxi- sequences (i.e. 5 SSU rDNA sequences, 7 LSU rDNA mum support (100% ML, 1.00 BI, 99% MP). These taxa sequences and 7 ITS1-5.8S-ITS2 sequences) were group with the new family Protolitonotidae fam. n. with obtained from 11 species, representing 5 genera and all strong support (96% ML, 1.00 BI, 85% MP). Thus, this 4 families of the order Pleurostomatida. For the three family is again depicted as a sister taxon of all other pleu- molecular markers, to our knowledge, the ITS1-5.8S- rostomatids. Within the Protolitonotidae clade, Protolitono- ITS2 region was used for the first phylogenetic analyses tus magnus sp. n. clusters with P. longus sp. n. with high in the order Pleurostomatida. Compared with trees based support (97% ML, 1.00 BI, 77% MP). on the SSU rRNA and LSU rRNA genes, relationships in ITS1-5.8S-ITS2 region trees are generally less well Phylogenetic analyses of ITS1-5.8S-ITS2 gene. The ITS1- resolved, probably due to the limited sampling, the high 5.8S-ITS2 region was used for the first time to conduct divergence and/or possibly unalignable sequences among the phylogenetic analyses of pleurostomatids. However, the distantly related species. Phylogenetic analyses of each of ITS1-5.8S-ITS2 trees (Fig. 3) have a more limited taxon the three gene markers recovered Protolitonotidae fam. sampling than the SSU rDNA and LSU rDNA trees, and n., as an independent lineage within the order Pleu- are generally less well resolved owing to the high variability rostomatida that is sister to all other pleurostomatids. between species as demonstrated in other groups of ciliates Trees based on SSU rDNA and LSU rDNA sequences (Vd’a cny et al. 2012; Sun et al. 2013). The monophyly of had generally consistent topologies and support the exis- the order Pleurostomatida was supported with low poste- tence of four families within the order Pleurostomatida. rior probabilities (0.90 BI) and moderate and weak boot- strap values in ML (58%) and MP (33%) analyses. Systematic treatment Nonetheless, we found that within the Pleurostomatida In the present work, a new family Protolitonotidae fam. n., clade, the Loxophyllum spp. cluster with Kentrophyllum sp. a new genus Protolitonotus gen. n. and two new species, Pro- forming a sister clade of Amphileptus spp. (95% ML, 1.00 tolitonotus magnus sp. n. (Fig 4A–G; and Fig. S1 in
Fig. 2 Maximum likelihood tree for the 21-taxon LSU rDNA sequences of ciliate taxa, with myzozoan alveolates as outgroup. New sequences are shown in bold text. Numbers at nodes are the follows: ML bootstrap values followed by BI posterior probability and MP bootstrap. Nodes not present in the estimated MP tree are designated by dash (–). The scale bar corresponds to 0.05 expected substitutions per site.
4 ª 2016 Royal Swedish Academy of Sciences L. Wu et al. Systematics of pleurostomatid ciliates
Fig. 3 Maximum likelihood tree constructed based on 34 ITS1-5.8S-ITS2 sequences of ciliates. Newly sequenced species are shown in bold. Numbers at nodes are ML bootstrap values followed by BI posterior probability and MP. Nodes not recovered are designated by dash (–). The scale bar corresponds to five substitutions per 100 nucleotide positions.
Supporting Information) and Protolitonotus longus sp. n. kineties, which was assigned to Litonotina. Lynn (2008) (Fig 4L–R; and Fig. S2 in Supporting Information), were did not accept this arrangement, however, and assigned the established. All these new taxa are characterized by the pleurostomatids into two families (Amphileptidae and unique semi-suture formed by somatic kineties on the right Litonotidae). Recently, Vd’a cny et al. (2015) recognized side. The diagnosis, description and comparison of these that the genera Kentrophyllum and Epiphyllum represent a new taxa are provided in the Appendix S1 of Supporting distinct lineage within the order Pleurostomatida and spilt Information. this order into three families, Amphileptidae, Litonotidae and Epiphyllidae. The third family embraced genera Ken- Revised classification of the order Pleurostomatida trophyllum and Epiphyllum, and Epiphyllum was chosen as The order Pleurostomatida was established by Schewiakoff the type genus. However, based on a comprehensive analy- (1896). Kahl (1931) divided the pleurostomatids into three sis of morphological and molecular data, Wu et al. (2015a, families, that is Amphileptidae Butschli,€ 1889, Tracheliidae b) considered Epiphyllum to be a junior synonym of Kentro- Ehrenberg, 1838 and Loxodidae Butschli,€ 1889. The latter phyllum and transferred Kentrophyllum-like species (includ- two families were transferred to Haptorida and Karyorelic- ing Kentrophyllum spp. and former Epiphyllum spp.) from tida, respectively, by Corliss (1979), which was accepted by Amphileptidae into a new family Kentrophyllidae Wu Small & Lynn (1985). For current classification of the et al., 2015. In this light, the family Epiphyllidae becomes a Tracheliidae and Loxodidae, see Vd’a cny & Foissner synonym of Kentrophyllidae. Here, a revised classification (2012) and Lynn (2008). Foissner & Foissner (1988) of the pleurostomatids is suggested based on both new data divided Pleurostomatida into two suborders Amphileptina presented here and previously published information. (including Amphileptidae) and Litonotina (including Order Pleurostomatida Schewiakoff, 1896 Litonotidae). Subsequently, Foissner & Leipe (1995) Family Litonotidae Kent, 1882 erected a new family Loxophyllidae, comprising two genera Acineria Dujardin, 1841 (i.e. Loxophyllum and Siroloxophyllum) that have dorsolateral Loxophyllum Dujardin, 1841
ª 2016 Royal Swedish Academy of Sciences 5 Systematics of pleurostomatid ciliates L. Wu et al.
Fig. 4 Morphology and ciliary pattern of Protolitonotus magnus sp. n. (A–G) and Protolitonotus longus sp. n. (L-R). —A. Right lateral view of a representative individual of Protolitonotus magnus sp. n. —B. Cortical granules. —C. Extrusomes. —D–G. Ciliary pattern of right (D, G) and left (E, F) side, indicating the semi-suture (arrowheads) and the full kineties (arrows). —H. To show the macronuclear nodules and distribution of extrusomes. —I–K. To show typical cell contortions. —L. Right lateral view of representative individual of Protolitonotus longus sp. n. —M. Extrusomes. —N–P, Q. Ciliary pattern of right (O, Q) and left (N, P) side, indicating the semi-suture (arrowheads) and the full kineties (arrows). —R. To show the macronuclear nodules and distribution of extrusomes. DB – dorsal brush; PK1-2 – perioral kinety 1, 2. Scales bars = 400 lm (A, H, L); 10 lm (C, M); 100 lm (N, O).
6 ª 2016 Royal Swedish Academy of Sciences L. Wu et al. Systematics of pleurostomatid ciliates
Litonotus Wrzesniowski, 1870 References Siroloxophyllum Foissner & Leipe, 1995 Chen, R., Lin, X. & Warren, A. (2011). A new pleurostomatid cili- Family Amphileptidae Butschli,€ 1889 ate, Amphileptus salignus n. sp. (Protozoa, Ciliophora), from – Amphileptus Ehrenberg, 1830 mangrove wetlands in southern China. Zootaxa, 3048,62 68. Corliss, J. (1979). The Ciliated Protozoa: Characterization, Classification Opisthodon Stein, 1859 and Guide to the Literature. 2nd ed. New York: Pergamon Press. Pseudoamphileptus Foissner, 1983 Dragesco, J. (1954). Diagnoses pr eliminaries de quelques cili es Amphileptiscus Song & Bradbury, 1998 nouveaux des sables. Bulletin De La Societe Zoologique De France- Apoamphileptus Lin & Song, 2004 evolution et Zoologie, 79,62–70. Family Kentrophyllidae Wu et al., 2015 Dragesco, J. (1960). Cili es m esopsammiques littoraux, syst ema- Kentrophyllum Petz et al., 1995 tique, morphologie, ecologie. Traveaux de la Station Biologique de – Family Protolitonotidae fam. n. Roscoff, 12,1 356. Dragesco, J. (1965). Cili es m esopsammiques d’Afrique noire. Cah- Protolitonotus gen. n. iers de Biologie Marine, 6, 357–399. Faur e-Fr emiet, E. (1908). Sur deux infusoires nouveaux de la fami- lie des Trachelidae. Bulletin De La Societe Zoologique De France- Key to the families and genera of the order evolution et Zoologie, 33,13–16. Pleurostomatida Foissner, W. & Foissner, I. (1988). The fine structure of Fuscheria The following key is based on data both from the present terricola Berger, Foissner & Adam, 1983 and a proposed new fi study and from the published literature (Foissner & Leipe classi cation of the Subclass Haptoria Corliss, 1974 (Ciliophora, Litostomatea). Archiv Fur€ Protistenkunde, 135, 213–235. 1995; Lin & Song 2004; Lin et al. 2005a; Wu et al. 2015a, Foissner, W. & Leipe, D. (1995). Morphology and ecology of b). Siroloxophyllum utriculariae (Penard, 1922) n. g., n. comb. A: Right somatic kineties anteriorly terminating along perioral Litonotidae (Ciliophora, Pleurostomatida) and an improved classification of kineties Pleurostomatid ciliates. Journal of Eukaryotic Microbiology, 42, B: Extrusomes absent along dorsal margin 476–490. C: Spoonlike excavation present Acinera Gao, S., Song, W., Ma, H., Clamp, J. C., Yi, Z., Al-Rasheid, K. CC: Spoonlike excavation absent Litonotus A., Chen, Z. & Lin, X. (2008). Phylogeny of six genera of the BB: Extrusomes present along dorsal margin D: Without stringlike oral bulge Loxophyllum subclass Haptoria (Ciliophora, Litostomatea) inferred from DD: With stringlike oral bulge Siroloxophyllum sequences of the gene coding for small subunit ribosomal RNA. – AA: Right somatic kineties not terminating along perioral Journal of Eukaryotic Microbiology, 55, 562 566. kineties Hall, T. A. (1999). BioEdit: a user-friendly biological sequence B: Right somatic kineties anteriorly terminating along the Protolitonotidae alignment editor and analysis program for Windows 95/98/NT. rightmost full kineties Nucleic Acids Symposium Series, 41,95–98. C: Extrusomes present along ventral margin Protolitonotus Kahl, A. (1931). Urtiere oder Protozoa I: Wimpertiere oder Ciliata BB: Middle right somatic kineties anteriorly shortened to (Infusoria) 2. Holotricha außer den im 1. Teil behandelten Pros- form a suture tomata. Tierwelt Dtl, 21, 181–398. C: Middle right somatic kineties posteriorly shortened to form Kentrophyllidae Kahl, A. (1933). Ciliata libera et ectocommensalia. In G. Grimpe a suture & E. Wagler (Eds) Die Tierwelt der Nord- und Ostsee Lief 23 (Teil D: One peripheral kinety forming a circle on the right side Kentrophyllum P, c3). (pp. 29–146). Leipzig: Geest & Portig. CC: Middle right somatic kineties not shortened posteriorly to Amphileptidae Lin, X. & Song, W. (2004). Establishment of a new amphileptid form a suture genus, Apoamphileptus nov. gen. (Ciliophora, Litostomatea, Pleu- E: Spoonlike excavation present anteriorly Amphileptiscus rostomatida), with description of a new marine species, Apoam- EE: Spoonlike excavation absent phileptus robertsi nov. spec. from Qingdao, China. Journal of F: Left perioral kinety forming a circle Opisthodon Eukaryotic Microbiology, 51, 618–625. FF: Left perioral kinety not forming a circle Lin, X., Song, W. & Warren, A. (2005a). Taxonomic studies on G: Right and left perioral kineties cross and not reaching at Apoamphileptus three marine pleurostomatid ciliates: Kentrophyllum verrucosum posterior end of cell (Stokes, 1893) Petz, Song et Wilbert, 1995, Epiphyllum soli- GG: Perioral kineties reaching posterior of cell H: Oral slit extending to near the posterior end of cell Pseudoamphileptus forme (Faure-Fremiet, 1908) gen. n., comb. n. and Amphileptus HH: Oral slit not extending to near the posterior end of cell Amphileptus sikorai sp. n., with the establishment of a new genus Epiphyllum (Ciliophora: Pleurostomatida). Acta Protozoologica, 44, 129–145. Lin, X., Song, W. & Warren, A. (2005b). Two new marine pleu- rostomatid ciliates from China, Amphileptus gui nov. spec. and Acknowledgements Amphileptus yuianus nov. spec. (Ciliophora, Pleurostomatida). – This work was supported by the National Natural Science European Journal of Protistology, 41, 163 173. Foundation of China (project numbers: 41576148, Lin, X., Song, W., Wilbert, N. & Warren, A. (2005c). Two new marine pleurostomatid ciliates from China, Loxophyllum jini sp. 41476128 and 31222050).
ª 2016 Royal Swedish Academy of Sciences 7 Systematics of pleurostomatid ciliates L. Wu et al.
n. and L. qiuianum sp. n. (Ciliophora: Pleurostomatida). Acta Vd’a cny, P. & Foissner, W. (2012). Monograph of the dileptids Protozoologica, 44, 147–157. (Protista, Ciliophora, Rhynchostomatia). Denisia, 31,1–529. Lin, X., Song, W. & Li, J. (2007a). Amphileptus aeschtae nov. spec. Vd’a cny, P., Rajter, L’., Shazib, S. U., Jang, S. W., Kim, J. H. & and Amphileptus eigneri nov. spec. (Ciliophora, Pleurostomatida), Shin, M. K. (2015). Reconstruction of evolutionary history of two new marine pleurostomatid ciliates from China. European pleurostomatid ciliates (Ciliophora, Litostomatea, Haptoria): Journal of Protistology, 43,77–86. interplay of morphology and molecules. Acta Protozoologica, 54, Lin, X., Song, W. & Li, J. (2007b). Description of two new marine 9–29. pleurostomatid ciliates, Loxophyllum choii nov. spec. and L. shini Vd’a cny, P., Orsi, W. & Foissner, W. (2010). Molecular and mor- nov. spec. (Ciliophora, Pleurostomatida) from China. European phological evidence for a sister group relationship of the classes Journal of Protistology, 43, 131–139. Armophorea and Litostomatea (Ciliophora, Intramacronucleata, Lin, X., Al-Rasheid, K. A., Al-Quraishy, S. A., Al-Farraj, S. A. & Lamellicorticata infraphyl. nov.), with an account on basal Song, W. (2008a). Identification of three highly confused marine litostomateans. European Journal of Protistology, 46, 298–309. Loxophyllum (Ciliophora: Pleurostomatida) with a key to seven Vd’a cny,P.,Bourland,W.A.,Orsi,W.,Epstein,S.S.&Foissner,W. congeners from the China Sea. Journal of Eukaryotic Microbiology, (2011a). Phylogeny and classification of the Litostomatea (Protista, 55, 331–342. Ciliophora), with emphasis on free-living taxa and the 18S rRNA Lin, X., Li, J., Gong, J., Warren, A. & Song, W. (2008b). Taxo- gene. Molecular Phylogenetics and Evolution, 59,510–522. nomic studies on three marine pleurostomatid ciliates, Litonotus Vd’a cny, P., Orsi, W., Bourland, W. A., Shimano, S., Epstein, S. bergeri nov. spec., L. blattereri nov. spec. and L. petzi nov. spec. S. & Foissner, W. (2011b). Morphological and molecular phy- (Ciliophora, Pleurostomatida) from North China Sea. European logeny of dileptid and tracheliid ciliates: Resolution at the base Journal of Protistology, 44,91–102. of the class Litostomatea (Ciliophora, Rhynchostomatia). Euro- Lynn, D. H. (2008). The Ciliated Protozoa, Characterization, Classifi- pean Journal of Protistology, 47, 295–313. cation, and Guide to the Literature. Dordrecht: Springer. Vd’a cny, P., Bourland, W. A., Orsi, W., Epstein, S. S. & Foissner, Nylander, J. A. A. (2004). MrModeltest. 2. Evolutionary Biology Cen- W. (2012). Genealogical analyses of multiple loci of litostom- tre. Uppsala, Sweden: Uppsala University. atean ciliates (Protista, Ciliophora, Litostomatea). Molecular Phy- Pan, H., Gao, F., Li, J., Lin, X., Al-Farraj, S. A. & Al-Rasheid, K. logenetics and Evolution, 65, 397–411. A. (2010). Morphology and phylogeny of two new pleurostom- Vd’a cny, P., Breiner, H. W., Yashchenko, V., Dunthorn, M., atid ciliates, Epiphyllum shenzhenense n. sp. and Loxophyllum spirel- Stoeck, T. & Foissner, W. (2014). The chaos prevails: molecular lum n. sp. (Protozoa, Ciliophora) from a mangrove wetland, phylogeny of the Haptoria (Ciliophora, Litostomatea). Protist, South China. Journal of Eukaryotic Microbiology, 57, 421–428. 165,93–111. Pan, H., Gao, F., Lin, X., Warren, A. & Song, W. (2013). Three Wilbert, N. (1975). Eine verbesserte Technik der Protar- new Loxophyllum species (Ciliophora: Pleurostomatida) from golimpr€agnation fur€ Ciliaten. Mikrokosmos, 64, 171–179. China with a brief review of the marine and brackish Loxophyl- Wu, L., Chen, R., Yi, Z., Li, J., Warren, A. & Lin, X. (2013). lum species. Journal of Eukaryotic Microbiology, 60,44–56. Morphology and phylogeny of three new Loxophyllum species Pan, H., Li, L., Lin, X., Li, J., Al-Farraj, S. A. & Al-Rasheid, K. (Ciliophora, Pleurostomatida) from mangrove wetlands of A. S. (2014). Morphology of three species of Amphileptus (Proto- southern China. Journal of Eukaryotic Microbiology, 60, 267– zoa, Ciliophora, Pleurostomatida) from the South China Sea, 281. with note on phylogeny of A. dragescoi sp. n. Journal of Eukary- Wu, L., Chen, R., Yi, Z., Li, J., Warren, A. & Lin, X. (2014). The otic Microbiology, 61, 644–654. morphology of three Loxophyllum species (Ciliophora, Pleu- Petz, W., Song, W. & Wilbert, N. (1995). Taxonomy and ecology rostomatida) from southern China, L. lembum sp. n., L. vesiculo- of the ciliate fauna (Protozoa, Ciliophora) in the endopagial and sum sp. n. and L. perihoplophorum Buddenbrock, 1920, with notes pelagial of the Weddell Sea, Antarctica. Stapfia, 40,1–223. on the molecular phylogeny of Loxophyllum. Journal of Eukaryotic Ronquist, F. & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylo- Microbiology, 61, 115–125. genetic inference under mixed models. Bioinformatics, 19, 1572–1574. Wu, L., Clamp, J. C., Yi, Z., Li, J. & Lin, X. (2015a). Phyloge- Small, E. B. & Lynn, D. H. (1985). Phylum Ciliophora Doflein, netic and taxonomic revision of an enigmatic group of haptorian 1901. In J. J. Lee, S. H. Hunter & E. C. Bovee (Eds), An Illus- ciliates, with establishment of the Kentrophyllidae fam. n. (Pro- trated Guide to the Protozoa (pp. 393–575). Lawrence, Kansas: tozoa, Ciliophora, Litostomatea, Pleurostomatida). PLoS One, Society of Protozoologists. 10, e0123720. Stamatakis, A., Hoover, P. & Rougemont, J. (2008). A fast boot- Wu, L., Yi, Z., Li, J., Warren, A., Xu, H. & Lin, X. (2015b). Two strap algorithm for the RAxML web-servers. Systematic Biology, new brackish ciliates, Amphileptus spiculatus sp. n. and A. bellus sp. 57, 758–771. n. from mangrove wetlands in southern China, with notes on Sun, P., Clamp, J. C., Xu, D., Huang, B., Shin, M. K. & Turner, the molecular phylogeny of the family Amphileptidae (Protozoa, F. (2013). An ITS-based phylogenetic framework for the genus Ciliophora, Pleurostomatida). Journal of Eukaryotic Microbiology, Vorticella: finding the molecular and morphological gaps in a tax- 62, 662–669. onomically difficult group. Proceedings of the Royal Society B: Bio- Zhang, Q., Simpson, A. & Song, W. (2012). Insights into the phy- logical Sciences, 280, 149–162. logeny of systematically controversial haptorian ciliates (Cilio- Swofford, D. L. (2002). PAUP*. Phylogenetic analysis using parsi- phora, Litostomatea) based on multigene analyses. Proceedings of mony (*and other methods). Version 4, MA: Sunderland. the Royal Society B: Biological Sciences, 279, 2625–2635.
8 ª 2016 Royal Swedish Academy of Sciences L. Wu et al. Systematics of pleurostomatid ciliates
Supporting Information Table S1. Names, sampling locations and GenBank Additional Supporting Information may be found in the numbers of newly sequenced taxa in the present study. online version of this article: Table S2. Morphological characteristics of Protolitonotus Fig. S1. Photomicrographs of Protolitonotus magnus sp. n. magnus sp. n. and Protolitonotus longus sp. n. from living individuals (A-I, K, L, N) and stained with pro- Appendix S1. Taxonomy section. targol (J, M, O–Q). Fig. S2. Photomicrographs of Protolitonotus longus sp. n. from living individuals (A–C) and stained with protargol (D–G).
ª 2016 Royal Swedish Academy of Sciences 9 Taxonomy Section
Collection and Identification of Protolitonotus spp.
All samples were collected by directly bailing surface water into 250-ml wide-mouth bottle.
Two populations of Protolitonotus magnus sp. n. were collected from coastal waters of the
South China Sea. Population 1 (Pop. 1) was collected on 21 June 2007 from Daya Bay (22°
42’ N; 114° 31’ E), Huizhou, Guangdong, where the water temperature was ~30°C, salinity
~28‰, and pH 7.5. Population 2 (Pop. 2) was collected on 6 April 2012 from Nansan Island
(21° 11’ N; 110° 26’ E), Zhanjiang, Guangdong, where the water temperature was ~27°C, salinity ~28‰, and pH 7.5. Protolitonotus longus sp. n. was isolated on 28 November 2008 from an oyster-culturing pond (22° 25’ N; 113° 37’ E), Zhuhai, Guangdong, where the water temperature was ~23°C, salinity ~12.9‰, and pH 7.8. Isolated specimens were cultivated for several days at room temperature (approximately 25°C) in Petri dishes containing water from the collection site with two grains of rice to enrich bacteria as food for ciliates.
Observations of living isolated cells were made using bright field and differential interference contrast microscopy. The protargol staining method according to Wilbert (1975) was used in order to reveal the ciliary pattern. Counts and measurements of stained specimens were conducted at a magnification of 1000×. Drawings of stained specimens were performed with the help of a camera lucida.
Taxonomic Summary
Order: Pleurostomatida Schewiakoff, 1896
Family: Protolitonotidae fam. n. Diagnosis: Pleurostomatids with right somatic kineties progressively shortened along the rightmost full kineties forming a semi-suture. Type genus: Protolitonotus gen. n.
Etymology: The family name is derived from the type genus Protolitonotus.
Remarks. Hitherto, the order Pleurostomatida was divided into three families, namely
Litonotidae, Amphileptidae and Kentrophyllidae, on the basis of the differences in the ciliary pattern on the right side of the cell (Wu et al. 2015a). The new family Protolitonotidae fam. n. is separated from Litonotidae by having the right somatic kineties anteriorly shortened along the rightmost full kineties (vs. anteriorly shortened along the perioral kinety in Litonotidae).
Amphileptidae differs from Protolitonotidae fam. n. by its right medial somatic kineties progressively shortened forming an anterior suture (vs. semi-suture). Kentrophyllidae is distinguished from Protolitonotidae fam. n. by having the right medial somatic kineties progressively shortened both anteriorly and posteriorly forming two sutures (vs. a single semi-suture). In our phylogenetic tree, Protolitonotidae fam. n. forms a clade that is basal to all other pleurostomatids. Therefore, both the morphological and molecular data support its validity as a separate family.
Genus: Protolitonotus gen. n.
Diagnosis: Protolitonotids with one to several full kineties in rightmost region of cell that extend entire body length; extrusomes distributed along entire ventral margin.
Etymology: The genus name is a composite of the Latin words “proto” (original) and the genus-group name Litonotus, and refers to this genus representing the ancestral group of pleurostomatids. Masculine gender.
Type species: Protolitonotus magnus sp. n.
Species assignable: Protolitonotus magnus sp. n. and P. longus sp. n.
Remarks. This new genus is distinguished from all known pleurostomatid genera by its anterior semi-suture.
Protolitonotus mangus sp. n. (Figs 4A-G. Supplementary material, Fig. S1 and Table S2)
Diagnosis: Body 400–1350 µm × 40–85 µm in vivo; 350–1300 macronuclear nodules; single contractile vacuole subterminal with long collecting canal; 16–22 right kineties including 2 or
3 full kineties, and 12–16 left kineties; extrusomes evenly distributed along entire ventral margin.
Type slides: A protargol slide, with the holotype specimen marked with a black circle, is deposited in the Laboratory of Protozoology, Ocean University of China (OUC), China, with registration number Lin-070621-01. One protargol slide containing paratype specimens
(marked by black circles) is deposited in the Laboratory of Protozoology, Ocean University of China (OUC), China, with registration number WL20120406-01. A second paratype slide is deposited in the collection of the Natural History Museum, London, UK with registration number NHMUK 2015.7.27.1.
Type location: Coastal waters off Daya Bay (22° 42’ N; 114° 31’ E), Huizhou, Guangdong,
China.
Etymology: The Latin adjective magnus (large or great) indicates the very large body size of the type population. Masculine gender.
Description. Body size variable, about 500–1350 µm × 40–85 µm in vivo, usually ca.
850–1200 µm in length, laterally compressed about 5:1, moderately contractile, shaped like the leaf of kelp with posterior end bluntly pointed; neck region about 15% of body length, flexible and variable in shape (Figs 4I-K and S1A-I). About 450–1300 macronuclear nodules in central region of body; nodules spherical to ellipsoidal, about 3–5 µm × 3–6 µm in vivo
(Figs 4A, H and S1O). Micronucleus not observed. Single subterminal contractile vacuole
5–12 µm in diameter, located at posterior dorsal margin, with collecting canal that reaches along dorsal margin to anterior region of body (Figs 4A and S1B-D, H). Numerous bar-shaped extrusomes, about ~10 µm long, densely arranged beneath pellicle and evenly distributed over body surface, some scattered in cytoplasm (Figs 4H and S1L, O).
Pellicle thin with many, tiny (<0.5 µm across), dot-like, colourless cortical granules densely packed between ciliary rows on both sides of cell (Figs 4B and S1K, N). Right side of body flat with many conspicuous longitudinal shallow grooves and densely ciliated, cilia about ~5 µm long in vivo; left side sparsely ciliated, cilia difficult to detect in vivo.
Cytoplasm slightly grayish, often with numerous greasily shining globules and some food particles that render main body region more or less opaque. Locomotion by gliding slowly across substratum on left side of body or by swimming in a serpentine-like manner.
Ciliary pattern as shown in Figs 4D, E, F, F, G and S1J, M, P, Q. Two perioral kineties
(PK1, 2) around oral slit; PK1 on left side of cytostome, composed of closely spaced dikinetids in anterior 2/5, continuing as a row of closely spaced monokinetids (Figs 4E, F and
S1J, Q); PK2 on right of cytostome, formed of closely spaced dikinetids, slightly less closely spaced in posterior 3/5 (Figs 4D, G). Right side of body with 16–22 kineties, including PK2, of which two or three (usually two) kineties (i.e. full kineties) nearest the dorsal margin run entire body length whereas others are progressively shortened anteriorly forming a semi-suture that extends about 1/3 body length (Figs 4D, G and S1P); in some individuals there is also a posterior semi-suture (Fig. S1M). Left side with 12–16 kineties, some of which are formed of several to many of closely spaced dikinetids in anterior, arrangement of kineties somewhat irregular in anterior region (Figs 4E, F); in one individual the left kineties formed an inconspicuous anterior single-suture (Fig. S1Q). Dorsal brush (DB) extends 1/3 body length as a row of densely spaced dikinetids (Figs 4E, F and S1J, Q).
Comparison of two populations of Protolitonotus magnus sp. n. The two populations closely resemble each other in almost all characteristics except the length of extrusomes and the average of body length; in pop.1 the extrusomes are 8-12 µm long (vs. 10-15 µm long in pop.2) and the average body length is 812 µm (vs. 643 um in pop.2). In addition, the SSU rDNA sequence of pop.1 differs from that of pop.2 in five nucleotides, although they have sequence similarity of 99.6%. These differences are considered to be population-level variations so the conspecificity of the two populations is not in doubt.
Protolitonotus longus sp. n. (Figs 4L-R; Supplementary material, Fig. S2 and Table S2)
Diagnosis: Body 800–1400 µm × 45–85 µm in vivo; 600–1500 macronuclear nodules; single subterminal contractile vacuole with long collecting canal; 11–14 right kineties including 1 or
2 full kineties;7–9 left kineties; extrusomes evenly distributed along entire ventral margin.
Type slides: A protargol slide with the holotype specimen (marked with a black circle) is deposited in the Laboratory of Protozoology, Ocean University of China (OUC), China, with registration number SZ-081128-05-01. One protargol slide containing paratype specimens
(marked by black circles) is deposited in the collection of the Natural History Museum,
London, UK with registration number NHMUK 2015.7.27.2.
Type location: An oyster-pond in Zhuhai (22° 25’ N; 113° 37’ E), Guangdong, China.
Etymology: The Latin adjective longus (long) indicates that the type population has a long body.
Description. Body variable in size, about 800–1400 µm × 45–85 µm in vivo, usually about
1000–1350 µm in length, highly flexible, moderately contractile, laterally compressed about 3:1, long ribbon-shaped with posterior end bluntly pointed, and with conspicuous neck region that is about 35–45% body length (Figs 4L and S2, A-C). About 450–1300 macronuclear nodules in central body region; nodules spherical to ellipsoidal, about 3–5 µm × 3–6 µm in vivo (Figs 4R and S2F). Micronucleus not observed. Single contractile vacuole, 5–12 µm in diameter, located subterminally at posterior dorsal margin, with long collecting canal reaching anterior cell region (Figs 4L and S2A, B). Several non-contractile vacuoles, 3–6 µm in diameter, scattered in mid-body region (Figs 4L and S2A, B). Extrusomes bar-shaped, about
~10 µm long, densely arranged beneath pellicle and evenly distributed over body surface, some scattered in cytoplasm (Figs 4L, M, R and S2L, E). Cortical granules not observed.
Right side of body flat with many conspicuous longitudinal shallow grooves and densely ciliated, cilia about ~5 µm long; left side sparsely ciliated, cilia difficult to detect in vivo.
Cytoplasm slightly grayish, often with numerous refringent globules and some food particles that render main body region more or less opaque. Locomotion by gliding across substratum on left side of body or by swimming in a serpentine-like manner.
Ciliary pattern as shown in Figs 4N-Q and S2 D, G. Two perioral kineties (PK1, 2) along oral slit; PK1 on left side of cytostome formed of closely spaced dikinetids in anterior 1/3, continuing as a row of closely spaced monokinetids (Figs 4N, P and S2D); PK2 on right of cytostome formed of dikinetids that are more densely spaced in anterior 2/5 (Figs 4O, Q and
S2G). Right side of body with 11–14 kineties (including PK2) of which 1 or 2 kineties (i.e. full kineties) near dorsal margin extend entire body length, others shortened along them to form a semi-suture that extends about 1/2 body length (Figs 4O, Q and S2G). Left side with
7–9 kineties each comprising closely spaced dikinetids in anterior and monokinetids in posterior, arrangement of kineties somewhat irregular in anterior region (Figs 4N, P and S2D).
Dorsal brush (DB) extends 2/5 of body length as a row of densely spaced dikinetids (Figs 4N,
P and S2D). Nematodesmata well-developed, originating from kinetosomes of perioral kineties and extending into cytoplasm (Fig. S2F).
Comments on Protolitonotus longus sp. n. and P. magnus sp. n. Protolitonotus longus sp. n. and P. magnus sp. n. are similar in having a large body size, numerous macronuclear nodules and a single contractile vacuole equipped with a long collecting canal, but the former can be distinguished from the later by having fewer somatic kineties on both sides of the cell (11-14 vs. 16-22 on right side; 7-9 vs. 12-16 on left side) and in the absence (vs. presence) of cortical granules. Furthermore, although both species usually have two full kineties, P. longus sp. n. occasionally has only one whereas P. magnus sp. n. occasionally has three.
1 2 Table S1. Names, sampling locations and GenBank numbers of newly sequenced taxa in the present study. 3 Species Sampling location SSU rDNA LSU rDNA ITS1-5.8S-ITS2 4 Protolitonotus magnus pop. 1 Daya Bay (22° 42’ N; 114° 31’ E) KP870177 5 Protolitonotus magnus pop. 2 Zhanjiang (21° 11’ N; 110° 26’ E) KP870179 KU925887 KU925877 6 Protolitonotus longus Zhuhai (22° 25’ N; 113° 37’ E) KP870181 KU925890 7 Acineria incurvata Daya Bay (22° 44’ N; 114° 31’ E) KP870180 8 Kentrophyllum sp. 1 Daya Bay (22° 44’ N; 114° 31’ E) KP870178 KU925884 KU925879 9 Kentrophyllum sp. 2 Zhanjiang (21° 14’ N; 110° 23’ E) KU925889 10 Amphileptus spiculatus Shenzhen (22° 38’ N, 114° 06’ E) KU925886 KU925883 11 Amphileptus aeschtae Zhanjiang (21° 14' N, 110° 23' E) KU925888 12 Amphileptus bellus Huizhou (22° 41' N, 114° 23' E) KU925885 13 Amphileptus salignus pop. 1 Shenzhen (22° 38’ N, 114° 06’ E) KU925882 14 Amphileptus salignus pop. 2 Daya Bay (22° 44’ N; 114° 31’ E) KU925878 15 Loxophyllum meridonale Zhanjiang (21° 14' N, 110° 23' E) KU925881 16 Loxophyllum chinense Guangzhou (22° 42' N, 113° 38' E) KU925880 17 Table S2. Morphological characteristics of Protolitonotus magnus sp. n. (pop. 1, 1st line; pop. 2, 2nd line) and Protolitonotus longus sp. n. (3rd line). Characters Min Max Mean SD CV n Body length 350 1200 812.3 48.03 27.7 28 400 950 643.3 31.91 25.8 27 800 1400 1063.3 44.85 16.3 15
Body width 30 80 60.0 2.52 22.2 28 40 100 59.4 3.00 26.2 27 50 80 63.3 2.32 14.2 15
Number of right 16 22 19.1 0.30 8.4 28 somatic kinetiesa 16 21 19.6 0.24 6.6 27 11 14 13.0 0.29 8.7 15
Number of full 2 3 2.1 0.34 16.2 23 kineties 2 3 2.1 0.32 15.3 18
1 2 1.8 0.41 22.9 15
Number of left 12 16 13.9 2.20 8.6 28 somatic kinetiesb 13 15 14.3 0.15 5.4 27 7 9 8.3 0.19 8.7 15
Number of 350 1250 849.7 43.09 28.8 28 macronuclear 380 1300 836.7 41.46 25.7 27 nodules 600 1500 1066.7 55.13 20.0 15
Length of 2 5 3.1 0.20 34.3 28 macronuclear 2 5 2.7 0.17 32.9 27 nodules 1.5 3 2.1 0.12 21.6 15
Width of 2 4 2.6 0.13 26.8 28 macronuclear 2 4 2.3 0.14 23.6 27 nodules 1.5 3 1.9 0.10 21.0 15
Length of 8 12 10.3 0.21 9.6 28 extrusomes 10 15 12.8 0.32 13.0 27 7 12 9.0 0.35 14.5 15
Length of 35 65 45.9 1.96 20.1 28 nematodesmata 35 85 53.7 2.06 19.9 27 35 55 45.3 1.79 15.3 15
All measurements in μm. Data based on protargol-stained specimens. (Min, minimum; Max, maximum; Mean, arithmetic mean; CV, coefficient of variation in %; SD, standard deviation; n, sample size). aperioral kineties 2 and full kineties included. bperioral kineties 1 and dorsal brush kinety included.