DOCSLIB.ORG

Ciliophora, Litostomatea)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ciliophora, Litostomatea) Zoologica Scripta New taxa refresh the phylogeny and classification of pleurostomatid ciliates (Ciliophora, Litostomatea) LEI WU,XIAOXIAO JIAO,ZHUO SHEN,ZHENZHEN YI,JIQIU LI,ALAN WARREN &XIAOFENG LIN Submitted: 2 February 2016 Wu, L., Jiao, X., Shen, Z., Yi, Z., Li, J., Warren, A. & Lin, X. (2016). New taxa refresh the Accepted: 22 April 2016 phylogeny and classification of pleurostomatid ciliates (Ciliophora, Litostomatea). doi:10.1111/zsc.12193 —Zoologica Scripta, 00: 000–000. A high diversity of pleurostomatid ciliates has been discovered in the last decade, and their systematics needs to be improved in the light of new findings concerning their morphology and molecular phylogeny. In this work, a new genus, Protolitonotus gen. n., and two new spe- cies, Protolitonotus magnus sp. n. and Protolitonotus longus sp. n., were studied. Furthermore, 19 novel nucleotide sequences of SSU rDNA, LSU rDNA and ITS1-5.8S-ITS2 were collected to determine the phylogenetic relationships and systematic positions of the pleurostomatid ciliates in this study. Based on both molecular and morphological data, the results demon- strated that: (i) as disclosed by the sequence analysis of SSU rDNA, LSU rDNA and ITS1- 5.8S-ITS2, Protolitonotus gen. n. is sister to all other pleurostomatids and thus represents an independent lineage and a separate family, Protolitonotidae fam. n., which is defined by the presence of a semi-suture formed by the right somatic kineties near the dorsal margin of the body; (ii) the families Litonotidae and Kentrophyllidae are both monophyletic based on both SSU rDNA and LSU rDNA sequences, whereas Amphileptidae are non-monophyletic in trees inferred from SSU rDNA sequences; and (iii) the genera Loxophyllum and Kentrophyllum are both monophyletic, whereas Litonotus is non-monophyletic based on SSU rDNA analy- ses. ITS1-5.8S-ITS2 sequence data were used for the phylogenetic analyses of pleurostom- atids for the first time; however, species relationships were less well resolved than in the SSU rDNA and LSU rDNA trees. In addition, a major revision to the classification of the order Pleurostomatida is suggested and a key to its families and genera is provided. Corresponding author: Xiaofeng Lin, Laboratory of Protozoology, Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, South China Normal University, Guangzhou 510631, China. E-mail: [email protected] Lei Wu, Xiaoxiao Jiao, Zhuo Shen, Zhenzhen Yi, and Jiqiu Li, Laboratory of Protozoology, Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, South China Normal University, Guangzhou 510631, China., E-mails: [email protected], [email protected], [email protected], [email protected], [email protected] Alan Warren, Department of Life Sciences, Natural History Museum, Cromwell Rd., London SW7 5BD, UK. E-mail: [email protected] Xiaofeng Lin, Laboratory of Protozoology, Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, South China Normal University, Guangzhou 510631, China. E-mail:[email protected] Introduction Traditionally, studies on pleurostomatids were based exclu- The Pleurostomatida, a species-rich order in the subclass sively on live observations which led to difficulties in species Haptoria, has proved to be more diverse than previously identification (Faure-Fremiet 1908; Kahl 1931, 1933; Dra- anticipated, and its taxonomy and molecular phylogeny have gesco 1954, 1960, 1965). With the application of the silver drawn much attention in the last decade (Lin et al. 2005a,b, staining, and the revelation of the ciliary pattern of pleu- c, 2007a,b, 2008a,b; Gao et al. 2008; Pan et al. 2010, 2013, rostomatids, the systematics of many ambiguous morpho- 2014; Vd’acny et al. 2010, 2011a,b, 2014; Zhang et al. 2012; types have been resolved and several new genera have been Wu et al. 2013, 2014, 2015a,b; Vd’acny et al. 2015). established (Petz et al. 1995; Lin & Song 2004; Lin et al. ª 2016 Royal Swedish Academy of Sciences 1 Systematics of pleurostomatid ciliates L. Wu et al. 2005a, 2008a). According to Lynn (2008), the order Pleu- Semi-suture: a ciliary structure formed by the anterior rostomatida is divided into two families, Litonotidae and shortening of the right somatic kineties along full kin- Amphileptidae, based on the presence/absence of an anterior eties forming an incomplete suture – a characteristic suture formed by the right somatic kineties. Several new taxa feature of the family Protolitonotidae fam. n. have since been described, based on both morphology and small subunit ribosomal DNA (SSU rDNA) sequence data, Extraction, amplification and sequencing of DNA giving the opportunity to carry out phylogenetic and system- For each species, one or several identified cells were iso- atic analyses of pleurostomatids (Pan et al. 2010, 2013, 2014; lated and repeatedly washed in sterilized habitat water to Wu et al. 2013, 2014, 2015a,b; Vd’acny et al. 2014; Vd’acny remove contaminants, and transferred into 45 ll ATL buf- et al. 2015). As a result of these findings, three families are fer pending genomic DNA extraction. Their genomic recognized within the order Pleurostomatida: Litonotidae, DNA was extracted using a DNeasy Blood and Tissue Kit Amphileptidae and Kentrophyllidae (Wu et al. 2015a). In (Qiagen, Shanghai, China) according to the protocol. PCR this study, we (i) describe two new species belonging to a amplification, SSU rDNA cloning and sequencing were newly established genus and family and sequence the SSU conducted according to the method described by Wu et al. rDNA of each; (ii) investigate phylogenetic relationships (2013). Primers for partial LSU rDNA gene amplification within the order Pleurostomatida based on sequence data of were 28S-F2 (50-ACSCGCTGRAYTTAAGCAT-30) and three markers, that is SSU rDNA, LSU rDNA and ITS1- 28S-R2 (50-AACCTTGGAGACCTGAT-30). The ITS1- 5.8S-ITS2; (iii) revise the classification of the pleurostom- 5.8S-ITS2 region was amplified using the forward primer atids; and (iv) provide a key to the identification of the fami- 5.8S-F (GTAGGTGAACCTGCGGAAGGATCATTA) lies and genera of the order Pleurostomatida. and the reverse primer 5.8S-R (TACTGATATGCT TAAGTTCAGCGG), with PCR conditions as follows: 35 cycles with denaturation at 94 °C for 30 s (initial denatura- Materials and methods tion for 5 min), primer annealing at 56 °C for 1 min and Collection and identification primer extension at 72 °C for 2 min (final extension for All the species for this study were collected from coastal 10 min). regions of southern China between December 2007 and December 2012 (sampling locations are listed in Table S1 Phylogenetic analyses in Supporting Information), and investigated in life and Apart from the newly sequenced species, the sequences stained with protargol following the method of Wilbert of the SSU rDNA, LSU rDNA and ITS1-5.8S-ITS2 (1975). Description of Protolitonotus magnus sp. n. and Pro- region used in phylogenetic analyses were obtained from tolitonotus longus sp. n. is in Supporting Information. the GenBank database. The three molecular markers of Amphileptus spiculatus, A. bellus, A. aeschtae and A. salignus litostomatean ciliates were unambiguously identified and were identified according to Wu et al. (2015b), Lin et al. aligned using CLUSTALW implemented in BIOEDIT (2007a) and Chen et al. (2011). Identification of Loxophyl- 7.0 (Hall 1999). The alignment was then modified by lum meridionale and L. chinense is according to Wu et al. removing highly variable regions, and refined manually (2013) and Pan et al. (2013). Kentrophyllum sp. 1 and sp. 2 by eye. The data sets used for phylogenetic inferences are as described in Wu et al. (2015a,b). Terminology is comprised 1568 characters for SSU rDNA, 1733 charac- according to Lynn (2008) and the present study. ters for LSU rDNA and 444 characters for ITS1-5.8S- The following specialized terms are used in the descrip- ITS2. The program MrModeltest v.2 (Nylander 2004) tion and remarks/comparison: selected the GTR + G + I evolutionary model under the Full-kinety: the rightmost kinety or kineties of the cell Akaike information criterion. Bayesian inference (BI) running the entire body length in protolitonotids. analysis was conducted with MrBayes 3.1.2 (Ronquist & Single-suture: a ciliary structure formed by the pro- Huelsenbeck 2003) using the aforementioned evolution gressive shortening of the medial somatic kineties on model, with a run of 1 300 000 generations at a sam- the right side forming a suture in the anterior part of pling frequency of 100 and a burn-in of 3250 (25%). body – a characteristic feature of the family Amphilep- Maximum likelihood (ML) analysis was carried out online tidae. on the CIPRES Portal V 1.15 (http://www.phylo.org), Double-suture: a ciliary structure formed by the pro- using RAxML with the parameters as described in Sta- gressive shortening of the right-medial somatic kin- matakis et al. (2008). The reliability of internal branches eties forming two sutures, one in the anterior body was assessed using the nonparametric bootstrap method, half and one in the posterior body half – a characteris- with 1000 replicates. Maximum parsimony (MP) analysis tic feature of the family Kentrophyllidae. was performed with PAUP 4.0b10 (Swofford 2002) using 2 ª 2016 Royal Swedish Academy of Sciences L. Wu et al. Systematics of pleurostomatid ciliates the tree-bisection–reconnection algorithm and bootstrap- studies (Wu et al. 2013, 2014, 2015a,b; Vd’acny et al. ping with 1000 replicates. 2015). Within this family, only the genus Loxophyllum is monophyletic in all three analyses (92% ML, 1.00 BI, 67% Results and discussion MP). The genera Acineria and Siroloxophyllum cluster Molecular data together to form a group that is sister to Loxophyllum with All new sequences have been deposited in the GenBank variable support (1.00 BI, 68% ML, 63% MP). The genus (for accession numbers, see Table S1). Protolitonotus longus Litonotus is paraphyletic when L. pictus is included. (ii) differs from P.
Load more

Recommended publications
  • Protocols for Monitoring Harmful Algal Blooms for Sustainable Aquaculture and Coastal Fisheries in Chile (Supplement Data)
    Protocols for monitoring Harmful Algal Blooms for sustainable aquaculture and coastal fisheries in Chile (Supplement data) Provided by Kyoko Yarimizu, et al. Table S1. Phytoplankton Naming Dictionary: This dictionary was constructed from the species observed in Chilean coast water in the past combined with the IOC list. Each name was verified with the list provided by IFOP and online dictionaries, AlgaeBase (https://www.algaebase.org/) and WoRMS (http://www.marinespecies.org/). The list is subjected to be updated. Phylum Class Order Family Genus Species Ochrophyta Bacillariophyceae Achnanthales Achnanthaceae Achnanthes Achnanthes longipes Bacillariophyta Coscinodiscophyceae Coscinodiscales Heliopeltaceae Actinoptychus Actinoptychus spp. Dinoflagellata Dinophyceae Gymnodiniales Gymnodiniaceae Akashiwo Akashiwo sanguinea Dinoflagellata Dinophyceae Gymnodiniales Gymnodiniaceae Amphidinium Amphidinium spp. Ochrophyta Bacillariophyceae Naviculales Amphipleuraceae Amphiprora Amphiprora spp. Bacillariophyta Bacillariophyceae Thalassiophysales Catenulaceae Amphora Amphora spp. Cyanobacteria Cyanophyceae Nostocales Aphanizomenonaceae Anabaenopsis Anabaenopsis milleri Cyanobacteria Cyanophyceae Oscillatoriales Coleofasciculaceae Anagnostidinema Anagnostidinema amphibium Anagnostidinema Cyanobacteria Cyanophyceae Oscillatoriales Coleofasciculaceae Anagnostidinema lemmermannii Cyanobacteria Cyanophyceae Oscillatoriales Microcoleaceae Annamia Annamia toxica Cyanobacteria Cyanophyceae Nostocales Aphanizomenonaceae Aphanizomenon Aphanizomenon flos-aquae
    [Show full text]
  • Phylogenomic Analysis of Balantidium Ctenopharyngodoni (Ciliophora, Litostomatea) Based on Single-Cell Transcriptome Sequencing
    Parasite 24, 43 (2017) © Z. Sun et al., published by EDP Sciences, 2017 https://doi.org/10.1051/parasite/2017043 Available online at: www.parasite-journal.org RESEARCH ARTICLE Phylogenomic analysis of Balantidium ctenopharyngodoni (Ciliophora, Litostomatea) based on single-cell transcriptome sequencing Zongyi Sun1, Chuanqi Jiang2, Jinmei Feng3, Wentao Yang2, Ming Li1,2,*, and Wei Miao2,* 1 Hubei Key Laboratory of Animal Nutrition and Feed Science, Wuhan Polytechnic University, Wuhan 430023, PR China 2 Institute of Hydrobiology, Chinese Academy of Sciences, No. 7 Donghu South Road, Wuchang District, Wuhan 430072, Hubei Province, PR China 3 Department of Pathogenic Biology, School of Medicine, Jianghan University, Wuhan 430056, PR China Received 22 April 2017, Accepted 12 October 2017, Published online 14 November 2017 Abstract- - In this paper, we present transcriptome data for Balantidium ctenopharyngodoni Chen, 1955 collected from the hindgut of grass carp (Ctenopharyngodon idella). We evaluated sequence quality and de novo assembled a preliminary transcriptome, including 43.3 megabits and 119,141 transcripts. Then we obtained a final transcriptome, including 17.7 megabits and 35,560 transcripts, by removing contaminative and redundant sequences. Phylogenomic analysis based on a supermatrix with 132 genes comprising 53,873 amino acid residues and phylogenetic analysis based on SSU rDNA of 27 species were carried out herein to reveal the evolutionary relationships among six ciliate groups: Colpodea, Oligohymenophorea, Litostomatea, Spirotrichea, Hetero- trichea and Protocruziida. The topologies of both phylogenomic and phylogenetic trees are discussed in this paper. In addition, our results suggest that single-cell sequencing is a sound method of obtaining sufficient omics data for phylogenomic analysis, which is a good choice for uncultivable ciliates.
    [Show full text]
  • Biovolumes and Size-Classes of Phytoplankton in the Baltic Sea
    Baltic Sea Environment Proceedings No.106 Biovolumes and Size-Classes of Phytoplankton in the Baltic Sea Helsinki Commission Baltic Marine Environment Protection Commission Baltic Sea Environment Proceedings No. 106 Biovolumes and size-classes of phytoplankton in the Baltic Sea Helsinki Commission Baltic Marine Environment Protection Commission Authors: Irina Olenina, Centre of Marine Research, Taikos str 26, LT-91149, Klaipeda, Lithuania Susanna Hajdu, Dept. of Systems Ecology, Stockholm University, SE-106 91 Stockholm, Sweden Lars Edler, SMHI, Ocean. Services, Nya Varvet 31, SE-426 71 V. Frölunda, Sweden Agneta Andersson, Dept of Ecology and Environmental Science, Umeå University, SE-901 87 Umeå, Sweden, Umeå Marine Sciences Centre, Umeå University, SE-910 20 Hörnefors, Sweden Norbert Wasmund, Baltic Sea Research Institute, Seestr. 15, D-18119 Warnemünde, Germany Susanne Busch, Baltic Sea Research Institute, Seestr. 15, D-18119 Warnemünde, Germany Jeanette Göbel, Environmental Protection Agency (LANU), Hamburger Chaussee 25, D-24220 Flintbek, Germany Slawomira Gromisz, Sea Fisheries Institute, Kollataja 1, 81-332, Gdynia, Poland Siv Huseby, Umeå Marine Sciences Centre, Umeå University, SE-910 20 Hörnefors, Sweden Maija Huttunen, Finnish Institute of Marine Research, Lyypekinkuja 3A, P.O. Box 33, FIN-00931 Helsinki, Finland Andres Jaanus, Estonian Marine Institute, Mäealuse 10 a, 12618 Tallinn, Estonia Pirkko Kokkonen, Finnish Environment Institute, P.O. Box 140, FIN-00251 Helsinki, Finland Iveta Ledaine, Inst. of Aquatic Ecology, Marine Monitoring Center, University of Latvia, Daugavgrivas str. 8, Latvia Elzbieta Niemkiewicz, Maritime Institute in Gdansk, Laboratory of Ecology, Dlugi Targ 41/42, 80-830, Gdansk, Poland All photographs by Finnish Institute of Marine Research (FIMR) Cover photo: Aphanizomenon flos-aquae For bibliographic purposes this document should be cited to as: Olenina, I., Hajdu, S., Edler, L., Andersson, A., Wasmund, N., Busch, S., Göbel, J., Gromisz, S., Huseby, S., Huttunen, M., Jaanus, A., Kokkonen, P., Ledaine, I.
    [Show full text]
  • Protozoologica
    Acta Protozool. (2014) 53: 207–213 http://www.eko.uj.edu.pl/ap ACTA doi:10.4467/16890027AP.14.017.1598 PROTOZOOLOGICA Broad Taxon Sampling of Ciliates Using Mitochondrial Small Subunit Ribosomal DNA Micah DUNTHORN1, Meaghan HALL2, Wilhelm FOISSNER3, Thorsten STOECK1 and Laura A. KATZ2,4 1Department of Ecology, University of Kaiserslautern, 67663 Kaiserslautern, Germany; 2Department of Biological Sciences, Smith College, Northampton, MA 01063, USA; 3FB Organismische Biologie, Universität Salzburg, A-5020 Salzburg, Austria; 4Program in Organismic and Evolutionary Biology, University of Massachusetts, Amherst, MA 01003, USA Abstract. Mitochondrial SSU-rDNA has been used recently to infer phylogenetic relationships among a few ciliates. Here, this locus is compared with nuclear SSU-rDNA for uncovering the deepest nodes in the ciliate tree of life using broad taxon sampling. Nuclear and mitochondrial SSU-rDNA reveal the same relationships for nodes well-supported in previously-published nuclear SSU-rDNA studies, al- though support for many nodes in the mitochondrial SSU-rDNA tree are low. Mitochondrial SSU-rDNA infers a monophyletic Colpodea with high node support only from Bayesian inference, and in the concatenated tree (nuclear plus mitochondrial SSU-rDNA) monophyly of the Colpodea is supported with moderate to high node support from maximum likelihood and Bayesian inference. In the monophyletic Phyllopharyngea, the Suctoria is inferred to be sister to the Cyrtophora in the mitochondrial, nuclear, and concatenated SSU-rDNA trees with moderate to high node support from maximum likelihood and Bayesian inference. Together these data point to the power of adding mitochondrial SSU-rDNA as a standard locus for ciliate molecular phylogenetic inferences.
    [Show full text]
  • Controlled Sampling of Ribosomally Active Protistan Diversity in Sediment-Surface Layers Identifies Putative Players in the Marine Carbon Sink
    The ISME Journal (2020) 14:984–998 https://doi.org/10.1038/s41396-019-0581-y ARTICLE Controlled sampling of ribosomally active protistan diversity in sediment-surface layers identifies putative players in the marine carbon sink 1,2 1 1 3 3 Raquel Rodríguez-Martínez ● Guy Leonard ● David S. Milner ● Sebastian Sudek ● Mike Conway ● 1 1 4,5 6 7 Karen Moore ● Theresa Hudson ● Frédéric Mahé ● Patrick J. Keeling ● Alyson E. Santoro ● 3,8 1,9 Alexandra Z. Worden ● Thomas A. Richards Received: 6 October 2019 / Revised: 4 December 2019 / Accepted: 17 December 2019 / Published online: 9 January 2020 © The Author(s) 2020. This article is published with open access Abstract Marine sediments are one of the largest carbon reservoir on Earth, yet the microbial communities, especially the eukaryotes, that drive these ecosystems are poorly characterised. Here, we report implementation of a sampling system that enables injection of reagents into sediments at depth, allowing for preservation of RNA in situ. Using the RNA templates recovered, we investigate the ‘ribosomally active’ eukaryotic diversity present in sediments close to the water/sediment interface. We 1234567890();,: 1234567890();,: demonstrate that in situ preservation leads to recovery of a significantly altered community profile. Using SSU rRNA amplicon sequencing, we investigated the community structure in these environments, demonstrating a wide diversity and high relative abundance of stramenopiles and alveolates, specifically: Bacillariophyta (diatoms), labyrinthulomycetes and ciliates. The identification of abundant diatom rRNA molecules is consistent with microscopy-based studies, but demonstrates that these algae can also be exported to the sediment as active cells as opposed to dead forms.
    [Show full text]
  • South China Sea)
    Journal of Marine Science and Engineering Article Diversity and Seasonality Dynamics of Ciliate Communities in Four Estuaries of Shenzhen, China (South China Sea) Chuanqi Jiang 1,2,3,4, Bin Liu 5, Jing Zhang 1,2,3,4, Siyu Gu 2,6, Zhencheng Liu 2,6, Xueyan Wang 2,6, Kai Chen 2, Jie Xiong 2, Yishan Lu 1,3,4 and Wei Miao 2,7,8,* 1 Shenzhen Institute of Guangdong Ocean University, Shenzhen 518120, China; [email protected] (C.J.); [email protected] (J.Z.); [email protected] (Y.L.) 2 Key Laboratory of Aquatic Biodiversity and Conservation, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China; [email protected] (S.G.); [email protected] (Z.L.); xueyanfi[email protected] (X.W.); [email protected] (K.C.); [email protected] (J.X.) 3 Guangdong Provincial Engineering Research Center for Aquatic Animal Health Assessment, Shenzhen 518120, China 4 Shenzhen Public Service Platform for Evaluation of Marine Economic Animal Seedings, Shenzhen 518120, China 5 Key Laboratory of Biodiversity of Aquatic Organisms, Harbin Normal University, Harbin 150025, China; [email protected] 6 University of Chinese Academy of Sciences, Beijing 100049, China 7 State Key Laboratory of Freshwater Ecology and Biotechnology of China, Wuhan 430072, China 8 CAS Center for Excellence in Animal Evolution and Genetics, Kunming 650223, China * Correspondence: [email protected]; Tel.: +86-27-68780050 Abstract: Ciliates are fundamental components of microzooplankton, with important ecological roles. However, ciliate communities are particularly difficult to monitor using conventional morphological Citation: Jiang, C.; Liu, B.; Zhang, J.; approaches.
    [Show full text]
  • Growth Characteristics and Phylogenetic Analysis of the Marine Dinoflagellate Dinophysis Infundibulus (Dinophyceae)
    Vol. 52: 209–221, 2008 AQUATIC MICROBIAL ECOLOGY Printed September 2008 doi: 10.3354/ame01233 Aquat Microb Ecol Published online August 21, 2008 Growth characteristics and phylogenetic analysis of the marine dinoflagellate Dinophysis infundibulus (Dinophyceae) Goh Nishitani1, Satoshi Nagai1,*, Yoshihito Takano2, Sanae Sakiyama1, Katsuhisa Baba3, Takashi Kamiyama4 1Harmful Algal Bloom Division, National Research Institute of Fisheries and Environment of Inland Sea, 2-17-5 Maruishi, Hatsukaichi, Hiroshima 739-0452, Japan 2Faculty of Fisheries, Nagasaki University, 1-14 Bunkyo-machi, Nagasaki 852-8521, Japan 3Hokkaido Hakodate Fisheries Experimental Station, 1-2-66 Yunokawa, Hakodate, Hokkaido 042-0932, Japan 4Tohoku National Fisheries Research Institute, Fisheries Research Agency, 3-27-5 Shinhama, Shiogama, Miyagi 985-0001, Japan ABSTRACT: We report the successful growth of the toxic dinoflagellate Dinophysis infundibulus under laboratory conditions, when fed the marine ciliate Myrionecta rubra grown with the crypto- phyte Teleaulax amphioxeia; this study follows previous studies on D. acuminata, D. caudata, and D. fortii, showing the mixotrophy. We succeeded in maintaining several clonal strains of D. infundibulus for a relatively long period of time (>8 mo). Growth rates in D. infundibulus ranged from 0.40 to 0.94 divisions d–1, reaching a maximum concentration of 1.2 to 2.3 × 103 cells ml–1. The rate was 0.36 divisions d–1 when apparently fully expanded cells, resulting from the active ingestion of Myrionecta rubra, were cultivated without the ciliate prey. In contrast, the culture of D. infundibulus was not established in the absence of the ciliate or when provided only with the cryptophyte T. amphioxeia, suggesting that D.
    [Show full text]
  • Classification of the Phylum Ciliophora (Eukaryota, Alveolata)
    1! The All-Data-Based Evolutionary Hypothesis of Ciliated Protists with a Revised 2! Classification of the Phylum Ciliophora (Eukaryota, Alveolata) 3! 4! Feng Gao a, Alan Warren b, Qianqian Zhang c, Jun Gong c, Miao Miao d, Ping Sun e, 5! Dapeng Xu f, Jie Huang g, Zhenzhen Yi h,* & Weibo Song a,* 6! 7! a Institute of Evolution & Marine Biodiversity, Ocean University of China, Qingdao, 8! China; b Department of Life Sciences, Natural History Museum, London, UK; c Yantai 9! Institute of Coastal Zone Research, Chinese Academy of Sciences, Yantai, China; d 10! College of Life Sciences, University of Chinese Academy of Sciences, Beijing, China; 11! e Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, 12! Xiamen University, Xiamen, China; f State Key Laboratory of Marine Environmental 13! Science, Institute of Marine Microbes and Ecospheres, Xiamen University, Xiamen, 14! China; g Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China; h 15! School of Life Science, South China Normal University, Guangzhou, China. 16! 17! Running Head: Phylogeny and evolution of Ciliophora 18! *!Address correspondence to Zhenzhen Yi, [email protected]; or Weibo Song, 19! [email protected] 20! ! ! 1! Table S1. List of species for which SSU rDNA, 5.8S rDNA, LSU rDNA, and alpha-tubulin were newly sequenced in the present work. ! ITS1-5.8S- Class Subclass Order Family Speicies Sample sites SSU rDNA LSU rDNA a-tubulin ITS2 A freshwater pond within the campus of 1 COLPODEA Colpodida Colpodidae Colpoda inflata the South China Normal University, KM222106 KM222071 KM222160 Guangzhou (23° 09′N, 113° 22′ E) Climacostomum No.
    [Show full text]
  • Structure, Function and Evolution Of
    University of Rhode Island DigitalCommons@URI Open Access Master's Theses 2014 STRUCTURE, FUNCTION AND EVOLUTION OF PHOSPHOPROTEIN P0 AND ITS UNIQUE INSERT IN TETRAHYMENA THERMOPHILA Giovanni Pagano University of Rhode Island, [email protected] Follow this and additional works at: http://digitalcommons.uri.edu/theses Terms of Use All rights reserved under copyright. Recommended Citation Pagano, Giovanni, "STRUCTURE, FUNCTION AND EVOLUTION OF PHOSPHOPROTEIN P0 AND ITS UNIQUE INSERT IN TETRAHYMENA THERMOPHILA" (2014). Open Access Master's Theses. Paper 358. http://digitalcommons.uri.edu/theses/358 This Thesis is brought to you for free and open access by DigitalCommons@URI. It has been accepted for inclusion in Open Access Master's Theses by an authorized administrator of DigitalCommons@URI. For more information, please contact [email protected]. STRUCTURE, FUNCTION AND EVOLUTION OF PHOSPHOPROTEIN P0 AND ITS UNIQUE INSERT IN TETRAHYMENA THERMOPHILA BY GIOVANNI PAGANO A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN BIOLOGICAL AND ENVIRONMENTAL SCIENCES UNIVERSITY OF RHODE ISLAND 2014 MASTER OF SCIENCE OF GIOVANNI PAGANO APPROVED: Thesis Committee: Major Professor Linda A. Hufnagel Lenore M. Martin Roberta King Nasser H. Zawia DEAN OF THE GRADUATE SCHOOL UNIVERSITY OF RHODE ISLAND 2014 ABSTRACT Phosphoprotein P0 is a highly conserved ribosomal protein that forms the central scaffold of the large ribosomal subunit’s “stalk complex”, which is necessary for recruiting protein elongation factors to the ribosome. Evidence in the literature suggests that P0 may be involved in diseases such as malaria and systemic lupus erythematosus. We are interested in the possibility that the P0 of the “ciliated protozoa” Tetrahymena thermophila may be useful as a model system for vaccine research and drug development.
    [Show full text]
  • Article (837.7Kb)
    GBE A Phylogenomic Approach to Clarifying the Relationship of Mesodinium within the Ciliophora: A Case Study in the Complexity of Mixed-Species Transcriptome Analyses Erica Lasek-Nesselquist1,* and Matthew D. Johnson2 1New York State Department of Health (NYSDOH), Wadsworth Center, Albany, New York Downloaded from https://academic.oup.com/gbe/article-abstract/11/11/3218/5610072 by guest on 05 February 2020 2Biology, Woods Hole Oceanographic Institution, Woods Hole, Massachusetts *Corresponding author: E-mail: [email protected]. Accepted: October 29, 2019 Data deposition: This project has been deposited in the NCBI SRA database under accessions PRJNA560206 (Mesodinium rubrum and Geminigera cryophila), PRJNA560220 (Mesodinium chamaeleon), and PRJNA560227 (Mesodinium major). All phylogenies and alignments in- cluded in this study have been deposited in Dryad: 10.5061/dryad.zw3r22848. Abstract Recent high-throughput sequencing endeavors have yielded multigene/protein phylogenies that confidently resolve several inter- and intra-class relationships within the phylum Ciliophora. We leverage the massive sequencing efforts from the Marine Microbial Eukaryote Transcriptome Sequencing Project, other SRA submissions, and available genome data with our own sequencing efforts to determine the phylogenetic position of Mesodinium and to generate the most taxonomically rich phylogenomic ciliate tree to date. Regardless of the data mining strategy, the multiprotein data set, or the molecular models of evolution employed, we consistently recovered the same well-supported relationships among ciliate classes, confirming many of the higher-level relationships previously identified. Mesodinium always formed a monophyletic group with members of the Litostomatea, with mixotrophic species of Mesodinium—M. rubrum, M. major,andM. chamaeleon—being more closely related to each other than to the heterotrophic member, M.
    [Show full text]
  • Zoonotic Parasites of Dromedary Camels: So Important, So Ignored Alireza Sazmand1* , Anja Joachim2 and Domenico Otranto1,3
    Sazmand et al. Parasites Vectors (2019) 12:610 https://doi.org/10.1186/s13071-019-3863-3 Parasites & Vectors REVIEW Open Access Zoonotic parasites of dromedary camels: so important, so ignored Alireza Sazmand1* , Anja Joachim2 and Domenico Otranto1,3 Abstract With a global population of about 35 million in 47 countries, dromedary camels play a crucial role in the economy of many marginal, desert areas of the world where they survive under harsh conditions. Nonetheless, there is scarce knowledge regarding camelsʼ parasite fauna which can reduce their milk and meat productions. In addition, only scattered information is available about zoonotic parasites transmitted to humans via contamination (e.g. Crypto- sporidium spp., Giardia duodenalis, Balantidium coli, Blastocystis spp. and Enterocytozoon bieneusi), as foodborne infections (e.g. Toxoplasma gondii, Trichinella spp. and Linguatula serrata) or by arthropod vectors (Trypanosoma spp.). Herein, we draw attention of the scientifc community and health policy-making organizations to the role camels play in the epidemiology of parasitic zoonotic diseases also in the view of an increase in their farming in desert areas worldwide. Keywords: Camelus dromedarius, Zoonoses, One-Health Background disease transmission to humans, especially in resource- With a worldwide population of about 35 million, cam- poor communities with improper sanitation and medi- els are an important source of meat and milk in many cal access. Tis article reviews the current knowledge on regions of the world, mainly in Africa and Asia [1]. Te zoonotic parasites reported from camels and gaps on the one-humped camel, also known as dromedary (Came- topic that should be addressed in future research.
    [Show full text]
  • Article (Refereed) - Postprint
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by NERC Open Research Archive Article (refereed) - postprint Dupont, A.Ö.C.; Griffiths, R.I.; Bell, T.; Bass, D. 2016. Differences in soil micro-eukaryotic communities over soil pH gradients are strongly driven by parasites and saprotrophs. Environmental Microbiology, 18 (6). 10.1111/1462-2920.13220 © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd This version available http://nora.nerc.ac.uk/512817/ NERC has developed NORA to enable users to access research outputs wholly or partially funded by NERC. Copyright and other rights for material on this site are retained by the rights owners. Users should read the terms and conditions of use of this material at http://nora.nerc.ac.uk/policies.html#access This document is the author’s final manuscript version of the journal article, incorporating any revisions agreed during the peer review process. There may be differences between this and the publisher’s version. You are advised to consult the publisher’s version if you wish to cite from this article. The definitive version is available at http://onlinelibrary.wiley.com/ Contact CEH NORA team at [email protected] The NERC and CEH trademarks and logos (‘the Trademarks’) are registered trademarks of NERC in the UK and other countries, and may not be used without the prior written consent of the Trademark owner. Differences in soil micro-eukaryotic communities over soil pH gradients are strongly driven by parasites and saprotrophs. 1 Dupont
    [Show full text]