Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations
2002 Characterization of acetolactate synthase resistance in common sunflower (Helianthus annuus) Anthony D. White Iowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Agricultural Science Commons, Agriculture Commons, and the Agronomy and Crop Sciences Commons
Recommended Citation White, Anthony D., "Characterization of acetolactate synthase resistance in common sunflower (Helianthus annuus) " (2002). Retrospective Theses and Dissertations. 407. https://lib.dr.iastate.edu/rtd/407
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g.. maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand corner and continuing from left to right in equal sections with small overlaps.
Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.
ProQuest Information and Learning 300 North Zeeb Road. Ann Arbor. Ml 48106-1346 USA 800-521-0600
Characterization of acetolactate synthase resistance in
common sunflower (Helianthus annum)
by
Anthony D. White
A dissertation submitted to the graduate faculty
in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
Major: Crop Production and Physiology (Weed Science)
Program of Study Committee: Micheal D. K. Owen, Co-major Professor Robert G. Hartzler, Co-major Professor Irvin C. Anderson Thomas W. Jurik Kendall R. Lamkey
Iowa State University
Ames, Iowa
2002 UMI Number 3051499
UMT
UMI Microform 3051499 Copyright 2002 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 ii
Graduate College
Iowa Stale University
This is to certify that the doctoral dissertation of
Anthony D White has met the dissertation requirements of lows State University
Signature was redacted for privacy.
Co-major Professor
Signature was redacted for privacy. - ajorProi
Signature was redacted for privacy. For the Major Program
Signature was redacted for privacy. iîi
DEDICATION
This dissertation is dedicated to my late son, Matthew David White, who taught me the value of life and the importance of family and friends. I am grateful for the time I got to spend with him and plan to keep his memory alive forever.
Matthew David White
June 7, 1997 - November 3, 1997 iv
TABLE OF CONTENTS
GENERAL INTRODUCTION 1
DISSERTATION ORGANIZATION 2
CHAPTER 1. LITERATURE REVIEW 3 Common sunflower biology 3
History of sunflowers 3
Common sunflower as a weed 4
Acetolactate synthase inhibiting herbicides 6
General 6
Mode of action and biochemical pathway 6
ALS origin 8
Physiological effects of ALS inhibitors 9
Herbicide metabolism 11
ALS genetics 12
Herbicide resistance 13
General 13 Resistance to ALS inhibiting herbicides 13
Molecular basis for ALS resistance 14
Gene transfer 16 ALS resistance in common sunflower 19 V
CHAPTER 2. COMMON SUNFLOWER (HELIANTHUS ANNUUS L.) RESISTANCE TO ACETOLACTATE SYNTHASE INHIBITING HERBICIDES
Abstract 21
Introduction 22
Materials and Methods .24
Field history 24
Seed germination 25
Herbicide dose response 25
R and S individuals 26
ALS whole plant assay 26
Herbicide penetration and translocation 27
Results and Discussion 28
Herbicide dose response .28
R and S individuals 29
ALS whole plant assay 30
Herbicide penetration and translocation 31
Sources of Materials 33
Literature Cited 33
CHAPTER 3. HERTTABILITY OF ACETOLACTATE SYNTHASE RESISTANCE IN COMMON SUNFLOWER {HELIANTHUS ANNUUS L.)
Abstract 44
Introduction 45 vi
Materials and Methods 49
Seed germination 49
Resistant and sensitive hybridization 49
DNA extraction 51
PCR and cloning procedure 52
Plasmid DNA extraction and sequencing 52
Test for dominance 53
Results and Discussion 54
DNA sequencing 54
Test for dominance 58
Sources of Materials 60
Literature Cited 61
CHAPTER 4. GENERAL CONCLUSIONS 75
APPENDIX L LOCUS IDENTIFICATION, GENBANK* ACCESSION NUMBERS, AND CORRESPONDING PLANT SPECIES FOR ALS GENES 78
APPENDIX IL AMINO ACID SEQUENCE ALIGNMENTS FROM HELL4NTHUS CLONES AND PLANT SPECIES USED IN INITIAL PCR PRIMER DESIGN 80
APPENDIX ML NUCLEOTIDE SEQUENCE ALIGNMENTS USED FOR INITIAL PCR PRIMER DESIGN 89
LITERATURE CITED 99
ACKNOWLEDGMENTS 108 1
GENERAL INTRODUCTION
The success of herbicide technology in the past half-century has helped to provide an abundant and sustained food supply (Powles and Hokum 1994). However, one consequence of widespread herbicide use is the onset of resistance. Biotypes resistant to acetolactate
synthase (ALS) inhibiting herbicides make up nearly 28% of the total number of resistant
species worldwide (Heap 2001). In the past ten years, resistance to ALS inhibiting
herbicides has been confirmed in more weeds than for any other herbicide mode of action
(Heap 2001).
Common sunflower is a major weed in crops throughout much of the western two-
thirds of the United States. Yield losses due to common sunflower competition have been
reported in soybean [Glycine max (L.) Merr.] (Geier et al. 1996; Irons and Bumside 1982),
wheat {Triticum aestivum L.) (Schweizer and Bridge 1982) and sugarbeet (Beta vulgaris L.)
(Gillespie and Miller 1984). In 1996, resistance to ALS herbicides was reported in common
sunflower (Helianthus annuus L.) (Baumgartner et al. 1996) Currently, ALS resistance in
common sunflower has been confirmed in Iowa, Kansas, Missouri, and South Dakota (Heap
2001).
In 1996, a population of common sunflower near Howard, South Dakota was
suspected to be resistant to chlorimuron and imazethapyr, both ALS inhibitors. This
population was identified in a field maintained in a corn-soybean rotation since 1988.
Chlorimuron and thifensulfuron were used as the primary herbicide treatments until 1992
when imazethapyr was substituted. This research will characterize the ALS resistance in the
Howard common sunflower population. 2
DISSERTATION ORGANIZATION
This dissertation is presented as a literature review and two papers that will be submitted to the Journal of Weed Science for publication. The first paper includes results from experiments conducted in the greenhouse and laboratory that evaluated effects of chlorimuron and imazethapyr on common sunflower growth and acetolactate synthase activity.
The second paper explores the potential for ALS genes to introgress into sensitive common sunflower populations. Also, the sequence of the DNA that codes for ALS in resistant and sensitive common sunflower was explored.
After the second manuscript a general summary is included, followed by the literature cited section of the general introduction and literature review. 3
CHAPTER 1. LITERATURE REVIEW
Common Sunflower Biology
History of sunflowers Common sunflower (Helianthus armuus L ), a member of the Compositae
(Asteraceae) plant family, is native to North America and is found in most regions of the
United States (Irons and Burnside 1982a). Common sunflower is probably the most geographically and morphologically diverse sunflower species in North America (Rogers et al 1982; Seiler and Rieseberg 1997). This species is found throughout the United States but is more common in the western two-thirds of the country. Mature plant height can range from 1 to 4.5 m and canopy diameter can exceed 1 m (Irons and Burnside 1982a; Rogers et al. 1982)
Common sunflower was cultivated in North America for several centuries before
European immigrants arrived (Rogers et al. 1982). The nutritional value of sunflower seeds was discovered in the middle 1800's, but commercial production did not occur in North
America until the early 1900's. Today many varieties of common sunflower are grown for
oil and edible seed production (Rogers et al. 1982). In a natural environment, younger plants
serve as cover and forage for many species of wildlife and birds eat mature seeds
(Stubbendieck et al. 1995).
The genus Helianthus contains between 60 and 200 different species according to
different authorities (Seiler and Rieseberg 1997). Heiser (1978) indicated that many of the
various types are not given binomial names due to the extremely variable morphology, thus
explaining the range of species in the genus Helianthus. The controversy regarding the
number of species in the genus Helianthus arises from many different factors. Natural 4 hybridization and introgression occur between many species, often resulting in morphological differences between otherwise indistinct forms. Polyploidy in perennial species contributes to the complexity of species classification in Helianthus (Rogers et al.
1982). The vast geographic range of many of the species results in the extensive phenotypic variation. Many species also are genetically variable, making rigorous identification and classification of some species difficult (Seiler and Rieseberg 1997; Rogers et al. 1982).
Common sunflower as a weed
Although common sunflower is a valuable crop and food source for wildlife, the plant is a troublesome weed throughout North America and frequents habitats disturbed by man
(Seiler and Rieseberg 1997). Common sunflower can be found in low and high rainfall areas, from sea level to 3000 m, and flowers from July through October. The weedy biotype is very similar to the cultivated sunflower but has more morphological variability. Plant height, branching, and inflorescence size can vary significantly between biotypes (Al-Khatib et al. 1998; Miller 1987).
Common sunflower is a major weed in soybean [Glycine max (L.) Merr ], wheat
(Triticum aestivum L.) and sugarbeet (Beta vulgaris L.) Irons and Burnside (1982b) reported that common sunflowers emerging with soybean had to be removed within 2 wk after soybean planting and soybean had to be kept free of sunflowers for 4 to 6 wk after planting to prevent yield loss. Soybean yield reductions ranged from 19 and 17% with 0.3 common sunflower plants m'2 to 97 and 95% with 4.6 plants m'2, in 1991 and 1992,
respectively (Geier et al. 1996). Geier et al. (1996) suggested that common sunflower
reduced soybean yield due to high interception of photosynthetically active radiation (PAR)
interception. Although other factors such as soil moisture, nutrient availability, and 5 allelopathy could play a role in reduced soybean yields, light interception has been shown to
be a primary mechanism in the interference of other weeds that grow taller than soybeans
(Geier et al 1996).
Common sunflower densities of 0.7,1.1, and 1.5 plants m"2 reduced sugarbeet (Beta
vulgaris L.) root yield 52,67, and 73%, respectively (Schweizer and Bridge 1982). In
comparison, velvetleaf (Abutilon theophrasti L.) at the same densities reduced sugarbeet root
yields 17,25, and 30%, respectively.
Cultivated sunflower is grown in rotation with spring wheat in the upper Midwestern
United States, and volunteer sunflower plants are a problem in the subsequent wheat crop
(Gillespie and Miller 1984). Wheat yields were reduced 5 to 33% from full season
competition with common sunflower at densities of 0.5 and 23 plants m 2, respectively.
Common sunflower has an allelopathic effect on soybean, sorghum [Sorghum bicolor
(L.) Moench] and other crops (Irons and Burnside 1982b; Wilson and Rice 1968). Irons and
Burnside (1982b) demonstrated that ground, mature sunflower leaves mixed into the soil
reduced emergence and growth of soybean, sorghum, and sunflower. They also reported that
sunflower competition in soybean reduced soybean growth and development by a
combination of allelopathic effects and competition for water, nutrients, light and space. 6
Acetolactate Synthase Inhibiting Herbicides
General Herbicides that inhibit acetolactate synthase (ALS; EC 4.1.3.18), also called acetohydroxyacid synthase (AHAS), have been important tools to manage weeds in a number of crops since being introduced in 1982. ALS herbicides demonstrate wide crop selectivity,
high efficacy, low dosages, and low mammalian toxicity (Saari et al. 1994). Currently, ALS
inhibitor herbicides comprise nearly 40 active ingredients for selective use in at least 10
different crops (Saari et al. 1994; Simpson 1998). Several of the ALS inhibitor herbicides, including chlorimuron (ethyl {2-[[[[(4-chloro-6-methoxypyrimidine-2-yl)amino]
carbonyl]amino] sulfonyl] benzoic acid, ethyl ester}) and imazethapyr {(>2-[4,5-dihydro-4-
methyl-4-(l-methylethyl)-5-oxo-l/f-imidazol-2-yl]5-thyl-3-pyridinecarboxylic acid), are
labeled for control of common sunflower (Anonymous 2001).
Mode of action and biochemical pathway
ALS is a plant enzyme involved in the biosynthesis of the branched-chain amino
acids, valine, leucine and isoleucine (Shaner et al. 1984; Saari et al. 1994). These amino
acids are essential for plant growth and development, and their absence results in rapid
inhibition of root and shoot growth, eventually leading to plant death (Devine et al. 1993).
In general, enzymes catalyze very specific reactions and can speed up a reaction rate
by a factor of a million or more (Simpson 1998). ALS is involved in the catalysis of two
reactions located in the chloroplast (Bryan 1990; Dumas et al 1992; Schloss 1990; Stidham
and Singh 1991). The first reaction (Figure 1) couples two pyruvate molecules Threonine Pyruvate Reaction 1 Reaction 2 I
Pyruvate 2-Ketobutyrate
Acetolactate synthase I - (ALS; AHAS) I 2-Acetolactate 2-Acetohydroxybutyrate I 2,3-Dihydroxyisovalerate 2,3-Dihydroxy-3-methy[valerate I I 2-Oxoisovalerate 2-Oxo-3-methylvalerate I Valine 2-Isopropylvalate I I Isoleucine 3-Isopropylmalate I 2-Ketoisocaproate -• Leucine
Figure 1 Biosynthetic pathway of branched chain amino acids (adapted from Cobb 1992;
Saari et al. 1994). 8 and forms 2-acetolactate, which is further synthesized to either valine or leucine. The second
reaction involves the condensation of pyruvate and 2-ketobutyrate to yield 2-
acetohydroxybutyrate in the synthesis of isoleucine. This reaction is found in algae, fungi,
bacteria and higher plants but not in mammals (Chipman et al. 1998).
ALS is categorized as a flavoprotein and requires flavin adenine dinucleotide (FAD)
for complete activation (Chipman et al. 1998; Mousdale and Coggins 1991). Thiamine
pyrophosphate (TPP) and a metal co-factor, manganese (H) or magnesium (H), are also
involved with ALS fonction. TPP serves as a co-enzyme producing hydroxyethyl-TPP as an
intermediate. The metal co-factor appears to aid in binding of TPP to ALS. Flavin likely
serves to prevent protonation of the hydroxyethyl-TPP intermediate. However, the specific
requirements of FAD remain unclear since no oxidation or reduction reactions are involved
with ALS (Chipman et al. 1998; Schloss et al. 1985).
The ALS reaction occurs in a biphasic manner. First, a pyruvate molecule binds to
TPP at the active site and is decarboxylated to form an enzyme-substrate complex plus CO%
A second pyruvate then reacts with this complex to form acetolactate (Cobb 1992; Larossa
and Schloss 1984) ALS inhibiting herbicides bind slowly but tightly to the enzyme-
substrate complex to prevent the continued reaction with the second pyruvate molecule
(Larossa and Schloss 1984).
ALS origin A possible explanation for the unusual requirement of FAD for ALS activation may
be its similarity to pyruvate oxidase (Schloss et al. 1988). Pyruvate oxidase, a flavoenzyme
that catalyzes the conversion of pyruvate to acetate and CO?, has similar DNA sequence
homology to ALS (Grabau and Cronan 1986). The two proteins also use the same substrates 9
(a-kcto acids, TPP, and Mg (H)) and are similar in size (pyruvate oxidase is approximately
10 amino acids larger) (Grabau an Cronan 1986; Schloss et al. 1988). In addition, Schloss et al (1988) hypothesized that the herbicide binding domain in ALS was similar to the quinone binding site of pyruvate oxidase.
Pyruvate oxidase binding to ubiquinone-40 is tightest in the presence of pyruvate
(Cobb 1992). Schloss et al. (1988) suggested that since herbicide binding in ALS is also tightest in the presence of pyruvate, the herbicide binding site in ALS is derived from a quinone binding cofactor no longer found in ALS. ALS probably evolved from pyruvate oxidase by losing the ability to bind quinones in order to facilitate the production of acetolactate or acetohydroxybutyrate instead of acetate, a product of pyruvate oxidase (Cobb
1992; Saari et al. 1994)
Physiological effects of ALS inhibitors Visual symptoms of ALS herbicides include vein reddening, leaf chlorosis, terminal bud death, and necrosis developing only after a few days after treatment (Brown 1990).
Quantitative experiments using corn (Zea mays L.) seedlings demonstrated that plant growth inhibition was detectable in less than two hours after treatment with chlorsulfuron, 2-chloro-
N-[[(4-methoxy-6-methyl-l,3,5-triazin-2-yl)amino]carbonyl]benzenesulfbnamide, well before visual symptoms became apparent (Ray 1980).
Fitness studies in flax (Linum usitatissimum L.) (McHughen and Holm 1991), corn
(Newhouse et al. 1991), and canola (Brassica napus L.) (Swanson et al. 1989) indicated that agronomic traits, including seed yield and quality, for the ALS resistant cultivars were not different compared to the sensitive biotype. Saari et al. (1994) reported there is little change 10 in the specific activity of ALS when comparing resistant and sensitive biotypes. Thus, plants typically have no detrimental side effects of having an altered (resistant) ALS enzyme.
ALS inhibitors have little direct effect on respiration, photosynthesis, or lipid and protein synthesis (Shaner 1991). However, Shaner and Reider (1986) showed that imazapyr,
(±)-2-[4,5-dihydro-4-methyl-4-(l-methylethyl)-5-oxo-lH-imidazol-2-yl]-3- pyridinecarboxylic acid, inhibited the rate of DNA synthesis in corn root tips by 63% within
24 h after treatment. The authors also demonstrated that adding exogenous valine, leucine and isoleucine reversed the inhibition of thymidine incorporation into DNA by imazethapyr.
These results indicated a close relationship between inhibiting branched-chain amino acid synthesis and DNA synthesis, cell division, and plant growth (Shaner 1991).
Growth inhibition due to an ALS inhibitor herbicide appeared to be specific to cell division (Brown 1990). However, additional research indicated growth inhibition may also include effects on free amino acid pools, carbohydrate levels, photosynthate transport, and transpiration (Shaner 1991). Explaining and understanding the sequence of events leading to plant death after applying an ALS-inhibiting herbicide is difficult because of the involvement of several different pathways and metabolic processes.
Typical enzyme inhibitors bind either at the active site or feedback regulatory sites of the enzyme ALS is sensitive to feedback inhibition, which is characteristic of most flavoproteins, by one or more of the final products of the biosynthetic pathway, valine, leucine or isoleucine (Stidham and Singh 1991). Feedback inhibition occurs when the end product of a biosynthetic pathway binds at a regulatory site, resulting in enzyme inhibition.
This provides a rapid and sensitive mechanism to prevent over-synthesis of end products
(Simpson 1998). Bekkaoui et al (1993) reported that two subunits of ALS from canola have 11 different properties with respect to structure, sensitivity to chlorsulfuron, and thus feedback inhibition by valine, leucine or isoleucine. Therefore, differences in ALS subunits alone can alter the enzyme reaction to different conditions, including feedback inhibition.
Experiments using excised pea (Pisum sativa L.) root tips showed that growth inhibition by chlorsulfuron (sulfonylurea) or imazapyr (imidazolinone) could be reversed by adding all three branched-chain amino acids (Ray 1984; Rost et al. 1990). Supplementing
the plant with valine, leucine or isoleucine can also reverse growth inhibition by other ALS
inhibiting herbicides (Anderson and Hibberd 1985; Brown 1990).
Herbicide metabolism Natural tolerance to ALS inhibitor herbicides has been demonstrated in several plant
species (Beroasconi et al. 1995, Brown 1990, Hinz and Owen 1996, Hinz and Owen 1997).
Nonselected tolerance to sulfonylurea herbicides is primarily by metabolism (Bader et al.
1994). Sweetser et al. (1982) demonstrated that chlorsulfuron-tolerant wheat metabolized
97% of the chlorsulfuron to a pheny1-O-glyocy lated metabolite in 24h. This metabolite had
no herbicidal activity. Sugarbeet, a chlorsulfuron-sensitive species, metabolized only 5% of
the chlorsulfuron in 24h.
Brown and Neighbors (1987) found the ALS from soybean was marginally less
sensitive to thifensulfuron methyl [methyl 3-[[[[(4-methoxy-6-methyl-l,3,5-triazin-2-
yl)amino]carbonyl]amino]sulfonyI]-2-thiophenecarboxylate] and chlorimuron ethyl when
compared to several weed species. However, the 1.5 fold difference in ALS sensitivity did
not explain the 10 to 100-fold difference in whole plant tolerance to the herbicide of
soybeans and the weed species. Data indicated that the herbicide half-life in the weed
species was in excess of 24 h compared to soybeans where the half-life of thifensulfuron 12 methyl and chlorimuron ethyl was 4 to 6 h and 1 to 3 h, respectively. The thifensulfuron methyl and chlorimuron ethyl were rapidly de-esterified in soybean to the respective herbicidally-inactive free acids. In addition, chlorimuron ethyl was conjugated with homoglutathione that facilitated the more rapid metabolism of chlorimuron ethyl by soybeans. The sensitive weed species are unable to metabolize the herbicides.
ALS genetics
A small number of genes encoding amino acid biosynthetic enzymes has been isolated and characterized. Although DNA sequencing for ALS has been done, DNA coding for ALS has not been studied in common sunflower or any other Helianthus species. On the basis of Southern blot analysis, Bekkaoui et al. (1991) reported that canola probably contains a more complex genomic structure of four or more ALS genes than either thale cress
(Arabidopsis thaliana L.) (one copy) or tobacco (Nicotiana tobacum L.) (two copies).
Currently, the number of ALS genes in common sunflower is unknown.
ALS is encoded in the nucleus and is active in the chloroplast (Guttieri et al. 1996).
The in vitro oligomeric structure of ALS in higher plants has not been determined.
Depending on the species, localization of DNA coding for ALS in the chloroplast is thought to be directed by an N-terminal chloroplast transit peptide (CTP) of approximately 59 to 92 amino acids (Mazur et al. 1987). The mature ALS protein consists of a 68 kDa subunit containing approximately 575 amino acids and is highly conserved across species (Bekkaoui et al. 1991; Guttieri et al 1996). 13
Herbicide Resistance
General The success of herbicide technology in the past half-century has helped to provide an abundant and sustained food supply (Powles and Holtum 1994). However, the widespread and frequent use of herbicides has brought on biological repercussions, including herbicide resistance. The consequences of herbicide resistance can include serious crop yield reductions due to weed-crop competition, loss of highly effective herbicides soon after introduction, and abandonment of certain crops in areas where weeds have become uncontrollable using available chemical control (Gressel 1991). The continued use of herbicide rotations, cultural practices, and mechanical cultivation will aid in reducing the problem of herbicide resistance. In order for these methods to be successful, additional information is required to understand how weeds acquire and express resistance to ALS inhibftor herbicides.
Resistance to ALS inhibiting herbicides The terms 'tolerance' and 'resistance* are often used interchangeably and thus must be defined. Tolerance reflects the normal variability in response to herbicides that exists within a plant species. Resistance is the inherited ability to survive a herbicide treatment by a formerly susceptible weed species (Lebaron and Gressel 1982).
The occurrence of herbicide resistance in weeds has accelerated in recent years. Heap
(2001) reported that 249 weed biotypes in 45 countries resistant to specific herbicides had been discovered. He also stated that since 1978, an average of nine new cases of herbicide resistance was reported each year. ALS inhibiting herbicides played a major role in these statistics by contributing 69 species to the total reported cases of herbicide resistance. In 14
Iowa, resistance to ALS inhibitors has been discovered in common cocklebur (Xanthhm strumarium L.) (Lee and Owen 2001), common waterhemp (Amaranthus rudis Sauer) (Hinz and Owen 1997), and common sunflower (Heap 2001).
In the last ten years, resistance to ALS inhibitor herbicides has been confirmed in more weeds than for any other herbicide mode of action (Heap 2001). The rapid increase in
ALS resistant weeds can be attributed to a high frequency of ALS resistant individuals in weed populations prior to herbicide use, the persistence of many ALS inhibitor compounds, and the multiple applications of ALS inhibitor herbicides made on a large number of hectares. However, few weeds in Europe have evolved ALS resistance when ALS inhibitor herbicides are used in rotation with other modes of action (Heap 1999).
Molecular basis for ALS resistance Although an altered ALS enzyme is the primary means of ALS herbicide resistance in weeds (Saari et al. 1994, Subramanian et al. 1990, Hinz and Owen 1997), other factors such as increased enzyme activity and metabolism could be involved. For example, Harms et al.
(1992) selected a tobacco cell line (SU-27D5) for high resistance to sulfonylurea and imidazolinone herbicides by using high concentrations of sulfonylurea herbicides. Mutated cells with resistance were clustered into two independently segregated regions and were, therefore, represented by at least two distinct genetic loci labeled SivRA and SuRB (Chaleff and Bascomb 1987). The specific activity of ALS in the resistant tobacco cell lysate was 6 to
7 times greater than that in wild-type cells (Harms et al. 1992) The higher specific activity
resulted in an ALS enzyme that was up to 780-fold less sensitive to ALS inhibitor herbicides
than the wild-type cells. Southern blot analysis of the resistant tobacco cell line showed a
20-fold amplification of the SmRB ALS gene and a normal diploid amount of SuKA AHAS 15 gene (Harms et al. 1992). Although gene amplification of a mutant ALS has been shown m vitro (Harms et al. 1992), this phenomenon has not yet been demonstrated as a resistance mechanism in ALS resistant weeds.
Resistance to ALS inhibitor herbicides in annual ryegrass (Lolium rigidum Gaudin) was attributable to enhanced herbicide metabolism (Christopher et al. 1992). Two resistant
annual ryegrass biotypes were evaluated for chlorsulfuron metabolism and compared to a
known sensitive biotype. Metabolism of 50% of the chlorsulfuron required an average of 4.4
h in the resistant biotypes and 7.1 h in the sensitive biotype (Christopher et al. 1992).
However, the resistant annual ryegrass biotypes demonstrated not only increased herbicide
metabolism but also an insensitive ALS enzyme, thus containing two mechanisms for ALS
resistance (Christopher et al. 1992).
One or more amino acid changes in the DNA that codes for ALS can result in ALS
inhibitor herbicide resistance (Subramanian et al. 1996). Several mutations of genes coding
for ALS have been discovered (Harms et al. 1992; Subramanian et al. 1996; Woodworth et
al. 1996; Wright et al. 1998). Two of these mutations confer broad-based resistance to all
ALS inhibitor herbicide families. Subramanian et al. (1996) found that a tryptophan»: to
leucine or an alanine^ to valine mutation carried resistance to chlorsulfuron of greater than
200-fold and 3 to 10-fold for I$o and GRso, respectively. All mutations do not necessarily
express cross-resistance to different ALS inhibitor families, as indicated by Subramanian et
al. (1996).
Wright et al. (1998) listed examples of resistant plants and the known molecular
changes resulting in resistance. The amino acid changes were divided into Region A and
Region B (Wright et al. 1998) and further subdivided into Domain A and Domain B 16
(Wiersma et al. 1989). Domain A corresponded to a 13 amino acid segment surrounding the proline site in Region A, and Domain B corresponded to four amino acids at the tryptophan site in Region B.
Molecular characterization of resistance to sulfonylurea herbicides in kochia [Kochia scoparia (L.) Schrad.] indicated that the mutations affected Domain A at position 173 for ten different resistant biotypes (Saari et al. 1994). Eberlein et al. (1997) examined several different mutations in different domains of the ALS genes for the patterns and levels of
resistance to the various herbicides that inhibit at this site. Mutations in certain regions
conferred cross-resistance to both sulfonylureas and imidazolinones, whereas other mutations
varied in specificity for a given group of ALS herbicides. The levels of cross-resistance, and
even the level of resistance to various sulfonylureas, varied tremendously between the
biotypes. Guttieri et al. (1992) reported that mutations conferring ALS resistance in kochia
were at the same codon as reported for B. napus. However, the mutation conferring
resistance in Russian thistle (Salsola iberica Senn. & Pau) could not be identified. They
concluded that multiple copies of ALS sequences in Russian thistle and other species may
complicate further efforts to characterize the basis of ALS resistance.
Gene transfer Common sunflower has the ability to hybridize with 17 other Helianthus species,
making it a very diverse and persistent weed (Rogers et al. 1982). Iowa contains 12 different
Helianthus species including common sunflower and Jerusalem artichoke (Helianthus
tuberasus L ), a perennial. Common sunflower has a haploid chromosome number of n=17
and can hybridize with Helianthus species in both the Annul and Divaricati Sections (Rogers
et al 1982), including all of those found in Iowa 17
The potential for gene exchange between wild and cultivated common sunflower depends on successful gene flow mediated by pollen (Arias and Rieseberg 1994). Pollen- mediated gene flow of herbicide resistance depends on the movement of pollen from resistant to susceptible populations and the subsequent production of viable hybrid seed (Stallings et al. 1995). Thus, gene flow is dependent on distance, breeding and pollination characteristics, plant design, and environmental conditions (Levin and Kerster 1974).
Common sunflower represents an appropriate experimental system for studying the potential for resistant genes to escape and for documenting possible consequences due to its breeding mechanism and compatibility with other Helianthus species. Herbicide resistant and sensitive sunflowers likely grow side by side in many locations. They overlap in flowering time (late May through early October) and are visited by several types of bees, primarily honeybees (Apis mellifera L.) (Arias and Rieseberg 1994). During dehiscence in
Helianthus species, pollen is scattered over the inflorescence of self-fertile hybrids, or exposed so bees can transfer it to self-sterile hybrids (Robinson 1984; Robinson 1978).
Common sunflower has a self-incompatible system of reproduction. Self- incompatibility is one of the principal and most effective mechanisms for preventing self- fertilization in flowering plants (Barrett 1988). The self-incompatibility system may fail due to direct laboratory manipulation (e.g., bud pollination, stylar irradiation, chemical inhibition of enzymes and RNA synthesis, and in vitro fertilization) (Barrett 1988). In a natural environment, self-incompatibility systems may fail due to delayed pollination, high temperatures and mixed loads of self- and hetero-specific pollen (Desrochers and Rieseberg 1998). 18
Nilsson et al. (1992) repotted that pollen transfer in an isolated population of orchids
(Aerangis ellisii) was infrequent, involved single pollen parents and occurred within five
meters of each orchid plant In comparison, sunflower would likely involve multiple pollen
parents found over a large area due to bee pollination. Arias and Rieseberg (1994) reported
that foraging bees could carry pollen up to 1000 m from the source common sunflower
plants. In addition, Kushnir (1977) reported that common sunflower plots arranged 2000 m
from an apiary obtained more than a five-fold increase in yield compared to self-pollinated
plots. Pollen movement is very difficult to evaluate in insect-pollinated species and, to date,
has not been studied extensively with respect to herbicide resistance in common sunflower.
Although Marshall et al. (2001) evaluated resistance transfer in common sunflower, they
attributed most of the movement to be caused by wind and not insects.
Herbicide resistance can be transferred through pollen. Brown and Brown (1996)
examined the effects of cross-pollinating glufosinate-resistant canola (Brassica napits L. and
B. campestris L.) and field mustard (Brassica rapa). The result was a high frequency of
hybrids that exhibited glufosinate resistance and a small portion of hybrids that produced
self-fertile seeds. The fertile plants were found to backcross to either canola or weedy
parent. Gene flow in kochia, an open pollinated species, influenced the occurrence of ALS
resistance within the species (Stallings et al. 1995). ALS resistance in kochia was inherited
as a dominant, single-gene trait. Gene flow in common sunflower is also likely to influence
the onset and spread of resistance; however, the heritibility characteristics of resistance are
currently unclear. 19
Gene flow was often assumed to correlate with pollen flow distributions. Most gene flow studies have reported either mean distances that pollen traveled or have described the relationship between distances from the source and frequency of the genetic marker
(Stallings et al. 1995). Gene flow studies between resistant and susceptible biotypes need to be conducted using a pure pollen source with an identifiable resistance marker gene, such as
ALS resistance. A receptive array of susceptible plants must be used for cross-pollination and the resulting seed scored for the presence or absence of the marker gene (Stallings et al.
1995). Marshall et al. (2001) conducted a study to ascertain movement potential of imazethapyr resistance in common sunflower. Gene flow from the resistant to sensitive common sunflower occurred with movement only 15.5 m from the parent plant. Aries and
Rieseberg (1994) reported that foraging bees could carry crop-specific genetic markers as far as 1000 m. Currently, data are not available on the effects of ALS cross-resistance moving from resistant common sunflower to other sensitive Helianthus populations.
ALS resistance in common sunflower Baumgartner et al. (1997) confirmed imazethapyr resistance in a Kansas common sunflower population. Al-Khatib et al (1998) concluded that the differences in herbicide absorption, translocation, and metabolism in the Kansas resistant population compared to a known sensitive population did not explain the high levels of resistance to imazethapyr.
They suggested that decreased ALS sensitivity caused the resistance to imazethapyr at the whole plant level. A recent study by Baumgartner et al. (1999) looked at cross-resistance in common sunflower to selected ALS inhibiting herbicides; however, they did not examine the possible mutations that may be causing resistance or how resistance may spread to other
Helianthus populations. 20
Therefore, four main objectives of this research were designed to further evaluate
ALS resistance in a common sunflower biotype found near Howard, SD. The first objective was to confirm that an altered ALS enzyme was responsible for reduced common sunflower control by ALS herbicides. The second was to identify possible cross-resistance to chlorimuron and imazethapyr and evaluate the percent of resistant to sensitive plants within the population. The third objective was to compare the DNA sequences for the Howard common sunflower to a known sensitive population and evaluate possible point mutations that may be responsible for an altered ALS enzyme. The fourth objective was designed to characterize ALS gene flow from the resistant common sunflower biotype into sensitive
Helianthus populations, including a perennial species (Jerusalem artichoke). 21
CHAPTER 2. COMMON SUNFLOWER {Helianthus annuus L.)
RESISTANCE TO ACETOLACTATE SYNTHASE INHIBITING
HERBICIDES.
A paper to be submitted to Weed Science.
Anthony D. White1, Micheal D. K. Owen, Robert G. Hartzler, and John Cardina
Abstract
In 1996, a common sunflower population near Howard, South Dakota was suspected to be cross-resistant to imazethapyr and chlorimuron. Whole plant acetolactate synthase (ALS) assays confirmed ALS-inhibitor resistance in the Howard biotype. The I30 values indicated the resistant population required 39 and 9 times more imazethapyr and chlorimuron, respectively, to obtain the same level of enzyme inhibition compared with the sensitive biotype. Herbicide dose response data supported the whole plant enzyme assay data; control
(> 90%) was not achieved with less than a 4X application rate of chlorimuron. Control with imazethapyr was not achieved even with a 16X rate. Chlorimuron and imazethapyr
controlled 70% and 95% of the population, respectively, when a 4X rate of each herbicide
was applied separately. Differences in 14C-herbicide absorption were observed, suggesting
1 Graduate Research Assistant, Professor, and Professor, respectively, Department of Agronomy, Iowa State University, Ames, IA 50011, and Professor, Department of Horticulture and Crop Science, Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, OH 44691. 22 there may be physical or chemical differences in leaf surface composition between the resistant and sensitive biotypes. Although translocation of 14C-herbicide was lower in the resistant biotype than in the sensitive biotype, differences were not enough to explain chlorimuron and imazethapyr selectivity between the two biotypes. Overall results suggested that the differences in the common sunflower populations were attributed to an altered site of action on the ALS enzyme.
Nomenclature: Common sunflower, Helianthus annuus L. HELAN; imazethapyr, 2-[4,5- dihydro-4-mcthyl-4-(l-methylcthyl)-5-oxo-l//-imidazol-2-yl]-5-ethyl-3-pyridmecarboxylic acid; chlorimuron, 2-[[[[(4-chloro-6-methoxy-2- pyrimidinyl)amino]caibonyl]amino]sulfonyl]benzoicacid.
Key words: ALS resistance; whole plant ALS enzyme assay; enzyme inhibition; dose response; population dynamics; herbicide penetration and translocation.
Introduction
Herbicides that inhibit acetolactate synthase (ALS; EC 4.1.3.18) have been important weed management tools in a number of crops since 1982. ALS is an enzyme that mediates the biosynthesis of the branched chain amino acids, valine, leucine, and isoleucine (Saari et al.
1994). ALS herbicides have wide crop selectivity, high efficacy levels, low use rates, and low mammalian toxicity. Currently, ALS inhibitor herbicides comprise over SO active ingredients for selective use in many different crops. A total of five chemical families is commercially marketed as inhibitors of ALS (Boutsalis 2001). 23
Although ALS-inhibiting herbicides have excellent herbicidal and environmental properties, evolved weed resistance has become a major concern in many crops around the world. Generally, the resistant populations developed after multiple applications of the same herbicide. Therefore, evolved resistance is different from the natural resistance that many weeds have for various herbicides (Saari et al. 1994).
The evolution of herbicide resistance in weeds has been accelerating in recent years. Heap
(2001) noted that 231 different weed species in over 45 countries had been reported resistant
to specific herbicides. He also stated that since 1978, an average of nine new cases of
herbicide resistance has been reported each year. ALS-inhibiting herbicides play a major
role in these statistics by contributing 65 species to the total reported cases of herbicide
resistance. Common sunflower is a troublesome weed in much of the north central United States and is
very similar to the cultivated sunflower but with more morphological variability compared
with other Helianthus species (Miller 1987; Rogers et al. 1982). Competition studies
evaluating sunflower interference in soybean (Glycine max L. Merr) indicated competition
for light (Geier et al. 1996) and production of allelopathic substances (Irons and Burnside
1982) contributed to soybean yield reduction. Research suggests that the critical period
ranges between 2 and 8 weeks after planting (WAP) depending on initial weed densities
(Allen et al. 2000; Geier et al. 1996).
In 1996, ALS resistance was discovered in common sunflower (Baumgartner et al. 1997).
Currently, ALS resistance in common sunflower has been confirmed in Iowa, Kansas,
Missouri, and South Dakota (Heap 2001). Al-Khatib et al. (1998) reported that the resistant
Kansas sunflower population was insensitive to imazethapyr. They concluded that 24 differences in absorption, translocation, and metabolism were not great enough to explain the high level of resistance to imazethapyr. Common sunflower resistance to other ALS inhibitors, including oxasulfuron (CGA-277476) and chloransulam, has also been previously reported (Al-Khatib et al. 2000).
The objectives of these studies were to confirm an altered ALS enzyme is responsible for lack of common sunflower control, to determine possible cross-resistance to chlorimuron and imazethapyr, and to evaluate the ratio of resistant to sensitive plants within the Howard population. Herbicide uptake and translocation were also investigated as possible mechanisms of resistance.
Materials and Methods
Field History. In 1996, a common sunflower population from a field near Howard, South
Dakota was suspected to be cross-resistant to chlorimuron and imazethapyr. ALS herbicide use at this site began in 1988 on soybeans (Table I), in 1989, the field was rotated to corn with no ALS herbicide applied and in 1990 the field was planted back to soybeans and ALS
herbicides were used. That year, the field was resprayed with chlorimuron to control escaped
common sunflowers. Chlorimuron and thifensulfuron were used as the primary herbicide
treatment until 1992 when imazethapyr was substituted. After the 1992 application of
imazethapyr, a respray with chlorimuron was performed to control escaped common
sunflowers.
The soybean and corn rotation continued from 1988 until the present time and has not
reduced the resistant population. ALS herbicides were not used during years when com was 25 planted. The need for a respray in 1990 suggested that resistant common sunflowers may have been prevalent after the second application of an ALS herbicide.
Seed Gemination. Seeds from suspected resistant common sunflowers were collected from the Howard location in Fall 1996 and stored at 4 C until experiments were conducted. Seeds were placed on wet germination paper in petri dishes and incubated at 4 C for 10 to 14 d.
Seeds were then germinated in an illuminated germinator set to provide approximately 200 p. mol m'V1 photosynthetic photon flux density (PPFD) over a 14 h photoperiod with 30 and
24 C day and night temperatures, respectively. Germinated seeds were then transplanted to
10-cm pots and placed in a greenhouse. Plants were fertilized weekly with a commercial fertilizer1 and watered as needed. High-pressure sodium lamps were used to maintain a
PPFD of350 iimol m"2 s*1 at the canopy level over a 16 h photoperiod. A confirmed sensitive common sunflower population from Ames, IA was used as a comparison and was germinated using the methods previously described.
Herbicide Dose Response. Plants were grown as described above with two plants per pot
Fifteen-cm plants were sprayed with 1,2,4,8, and 16 times the typical use rate of chlorimuron and imazethapyr The typical field use rates for chlorimuron and imazethapyr are 13 and 70 g ha"1, respectively. Nonionic surfactant2 (NIS) and 28% nitrogen fertilizer were added to all herbicide mixtures at 0.25% and 4% by volume, respectively. Herbicide was applied with a laboratory sprayer delivering 187 L ha"1 at 241 kPa. A control with no herbicide was included. Visual injury ratings were estimated 7,14, and 21 days after
treatment (DAT). Plants were rated on a 0 to 100 scale, with 0 representing no injury and 100
representing plant death. Injury symptoms consisted of various degrees of chlorosis, growth
reduction, and necrosis of the treated plants compared with the untreated control. Plants 26 were harvested 21 DAT at the soil surface, dried for 72 h at 85 C, and weighed. Experiments were arranged as a randomized complete block design with four replications and were conducted twice. Data were subjected to ANOVA, and means were calculated.
R and S individuals. Initial screening indicated that the Howard common sunflower population was not homogenously resistant. Therefore, an experiment was conducted to determine the percent of resistant to sensitive individuals within the Howard common sunflower population. Plants were preconditioned and germinated as previously described and transplanted into flats at approximately 100 plants per flat. Flats containing approximately 15-cm tall common sunflower plants were sprayed with 280 g ha"1 or 52 g ha"1
(four times the typical field use rate) of imazethapyr or chlorimuron, respectively. An untreated control was also included for comparison. Live plants were counted 21 DAT and considered as resistant plants. Flats containing sensitive common sunflower biotype were also treated with the respective herbicide and used as a control. Experiments were arranged in a randomized complete block design containing four replications and were conducted twice. A ratio of resistant to sensitive plants within the Howard common sunflower population was generated for both herbicides. Transformation did not affect data interpretation; thus original data were subjected to ANOVA and means calculated.
ALS Whole Plant Assay. Plants were grown as previously described. When evaluating common cocklebur (Xanlhhtm stumarium L.) for ALS resistance, Lee and Owen (2000) used the uppermost expanded leaf of a 15-cm plant. To date, whole plant ALS assays have not been performed on common sunflower. Therefore, an ALS enzyme assay modified from
Hinz and Owen (1997) and Lee and Owen (2000) was used to confirm ALS inhibitor resistance in the Howard common sunflower population. The uppermost expanded leaf of a 27 confirmed resistant common sunflower was excised at the base of the petiole and immersed in a solution containing HOE 704 (2-methyl-phosphinoyl-2-hydroxyacetic acid) and a given concentration of imazethapyr or chlorimuron. Herbicide concentrations ranged from 0.1 to
1000 j»M or 0.1 to 1000 nM for imazethapyr and chlorimuron, respectively. Plant tissue was allowed to absorb the herbicide for 4 h. Tissue samples were removed from the solution, weighed, and frozen at -10 C for 24 h.
Samples were thawed, and 5 mL of water per g fresh weight was added. After 1 h a 0.5 mL aliquot was removed to which 50 iiL of 6N sulfuric acid was added and heated at 60 C for 15 min to stop the reaction and facilitate the decarboxylation of acetolactate to acetoin. Acetoin concentration was quantified using napthol and creatine and the mixture was incubated at 60
C for 15 min. Hinz and Owen (1997) performed this portion of the experiment in the dark due to the possible photodegradation of napthol. However, data (not shown) indicated that light had no effect. Therefore, in this study, the assay procedure was performed in the light and absorbance was measured at 525 nm. Data were converted to relative enzyme activity
(percentage of control) and I50 values (inhibition of 50% of the enzyme activity) were calculated. Experiments were arranged as a randomized complete block design with four replications and were conducted twice.
Herbicide Penetration and Translocation. Plants were grown as previously described with one plant per pot. Fifteen-cm plants were sprayed with 13 and 70 g ha"1 of chlorimuron and imazethapyr, respectively. NIS and 28% nitrogen were added to both herbicides at 0.25% and 4% by volume, respectively. Immediately thereafter, five 2 pL droplets of l4C-labelled herbicide were applied to the abaxial side of the fourth common sunflower leaf. Each 10 pL application contained approximately 2.5 kBq of 14C-labeled imazethapyr (pyridine-6-l4C- 28 imazethapyr; 766 kBq mg"1) or 2.6 kBq of 14C-labeled chlorimuron (pyrimidine-2-l4C- chlorimuron ethyl; 112 kBq mg*1). No radiolabeled herbicide was applied to the main leaf veins.
Plants were harvested at 4,12,24, and 72 hours after treatment. At harvest, each plant was divided into treated lea£ plant material above the treated leaf and below the treated leafj and roots. The treated leaf was excised at the base of the petiole and washed for 30 s with 10 mL of chloroform to remove unabsoibed radioactive herbicide. One milliliter of the leaf wash was added to 10 ml of scintillation cocktail3 for 14C quantification. The plant sections were placed in separate paper bags and dried at 85 C for 48 h. Plant tissue was ground with a
Wiley mill4 and a 100 mg subsample was oxidized in a sample oxidizer5. The resultant
,4COj was captured in a COj trapping cocktail6. The entire tissue sample was oxidized if the weight was under 100 mg. All radioactivity was quantified using a liquid scintillation spectrophotometer (LSS)7.
The experiment contained six replications and was conducted twice. Tests for homogeneity of variance indicated that data from replicated experiments could be combined.
Data were subjected to ANOVA, separated using Fisher's Protected LSD (P £ 0.05), and are presented as a percentage of the 14C applied
Results and Discussion
Herbicide Dose Response. Dose response (Figure 1A) and biomass data (Figure IB) indicated different responses between the Howard common sunflower population and the sensitive population when treated with either chlorimuron or imazethapyr. The sensitive biotype was completely controlled when treated with the normal use rate of imazethapyr or 29 chlorimuron and thus is not shown in Figures 1A or IB. Adequate control (>90% visual control) was not achieved with less than 8 times the typical field application rate (13 g ha"1) of chlorimuron, whereas control with imazethapyr was poor even at 16 times the typical application rate (70 g ha"1). Similar results were seen when a chlorimuron and imazethapyr were applied to a resistant Kansas common sunflower biotype (Al-Khatib 1998; Baumgartner etal. 1999).
Based on the lack of a respray treatment in the early history of ALS herbicide use on the
Howard common sunflower population (Table 1), it is likely that this population was initially sensitive to both imazethapyr and chlorimuron. However, through ALS herbicide selection, this population is now functionally resistant to imazethapyr and chlorimuron.
R and S individuals. The application of imazethapyr or chlorimuron resulted in complete death of sensitive plants at 21 DAT. The Howard population was not homogeneously resistant to either chlorimuron or imazethapyr. Imazethapyr and chlorimuron controlled
95% and 70% of the individuals screened at a 4X rate, respectively. Therefore, at least 25% of the plants within the population were more sensitive to chlorimuron compared to imazethapyr. Differences in susceptibility to the two herbicides may be caused by several factors. One factor may be that the criteria used for evaluating the resistant and sensitive individuals
(symptoms at a 4X rate) were too stringent. If this is true, some of the sensitive plants may survive a IX herbicide application and be functionally resistant in the field. Since common sunflowers are predominately insect pollinated, another factor may involve the possible influx of pollen from sensitive plants outside of the field. Arias and Rieseberg (1994) reported that foraging bees could carry crop-specific genetic markers in common sunflower 30 as far as 1000 m. Therefore, heterogeneity in the Howard population is likely due to pollen contamination coming from sensitive plants outside of the field. Whole plant ALS enzyme assays and herbicide penetration and translocation studies were conducted using confirmed
resistant plants due to the heterogeneity of resistance in the Howard common sunflower
population.
Whole Plant ALS Assay. ALS-inhibitor resistance was confirmed with the whole plant
ALS assay. The 1% values for imazethapyr were 200.0 and 5.2 iiM for the resistant and
sensitive biotypes, respectively (Table 2). Chlorimuron Iso values were 10.5 and 1.2 nM for
the resistant and sensitive biotypes, respectively. The Iso values indicated the resistant
population required 39 and 9 times more imazethapyr and chlorimuron, respectively, to
obtain the same level of enzyme inhibition compared with the sensitive biotype
A resistant Kansas common sunflower biotype exhibited an lis of 4.23 (210-fold increase)
and 24.2 nM (18.6-fold increase) for imazethapyr and chlorimuron, respectively (Al-Khatib
et al. 1998; Baumgartner et al. 1999). Differences in resistance between the Kansas and
Howard common sunflower may be attributed to the different enzyme assay technique used
to evaluate resistance, and are not comparable. However, the most essential observation is
that the level of imazethapyr resistance is much greater than chlorimuron resistance for both
the Howard and Kansas common sunflower populations.
Differences at the enzyme level between the two herbicides suggest that resistance may be
caused by a mutation on the ALS gene that confers differential cross-resistance to
sulfonylureas and imidazolinones. Amino acid substitutions at positions 205, 574, or 653 on
the ALS gene in other plant species have expressed the same resistance characteristics seen
in the Howard and Kansas common sunflowers (Gressel 2002). Gene sequencing is 31 necessary to determine if any of these mutations are present in the resistant common sunflower biotypes.
Herbicide penetration and translocation. Recovery of applied l4C was more than 85% at each harvest interval for each biotype by herbicide combination. Since statistical differences were observed among treatments (Tables 3 and 4), the means are presented separately.
The rate of uptake was similar for both common sunflower populations; however, the amount of 14C absorbed was significantly different (Figure 2). Compared to the resistant population after 4 h, the sensitive population absorbed 44% and 36% more l4C-chlorimuron and 14C-imazethapyr, respectively. Foliar absorption of both herbicides remained higher at all sampling times for the sensitive population compared to the resistant. The sensitive
common sunflower plants absorbed approximately 85% of the total absorbed l4C- chlorimuron by 24 h, whereas the resistant population did not achieve this level of absorption
until 48 h. Healthy and thriving plants were used for the experiment. Therefore, differences
in herbicide absorption are not caused by sick compared to healthy plants.
The data suggested that very little of the absorbed 14C-chlorimuron was translocated out of
the treated leaf of the sensitive biotype before the 24 h harvest period (Table 3). The level of
translocation to all plant sections was low for the resistant biotype. Even after 72 h, the
distribution of all radioactivity translocated out of the treated leaf in the resistant biotype
remained low (7%) compared with the sensitive biotype (33%).
Translocation into different plant sections in sensitive plants was not different from resistant
plants when treated with 14C-imazethapyr at 24 or 72 h (Table 4). A difference was seen in
l4C accumulation below the treated leaf at 48 h. 32
Differences in total l4C absorbed were seen between the resistant and sensitive common sunflower populations for both chlorimuron and imazethapyr. The distribution of l4C within the plant showed that the resistant population had reduced translocation compared with the sensitive population. Resistance to chlorimuron and imazethapyr in the Howard common sunflower likely involved differential uptake and translocation. These differences suggested that biochemical or physical differences between the two populations may exist. Additional research evaluating leaf wax characteristics or other barriers of herbicide movement in these common sunflower populations may help explain these differences.
In summary, differential absorption and translocation alone did not adequately explain chlorimuron and imazethapyr selectivity between the resistant and sensitive sunflower populations. The results of the ALS enzyme assays support the conclusions from studies in other weeds (Al-Khatib et al. 1998; Baumgartner et al 1999; Hinz and Owen 1997; Saari et al. 1994) that the mechanism of resistance in the Howard sunflower population is related to an altered site of action and involves differential sensitivity to ALS inhibition.
ALS resistance in common sunflower is a problem that continues to spread. Preventative measures should be taken to slow the onset or expansion of resistant populations. These measures involve using herbicides with different modes of action, rotating crops, and using more mechanical practices in crop production.
Sources of Materials
1 Miracle Gro Excell, Scotts-Sierra Horticultural Co., 14111 Scottslawn Rd Marysville, OH
43041. 33
2 X-77 (a mixture of alkylarylpolyoxyethylene glycols, free fatty acids, and isopropanol),
Loveland Industries, Inc., P.O. Box 1289, Greeley, CO 80632.
3 Ultima Gold F. Packard Bioscience B. V., P.O. Box 9403,9703 LP Groningen, The
Netherlands.
4 Thomas Scientific, P.O. Box 99, Swedesboro, NJ 08085.
5 Model 0X500. R. J. Harvey Instrument Corp., 123 Patterson St., Hillsdale, NJ 07642.
6 Carbon-14 Cocktail for Biological Oxidizers. Harvey Instrument Corp., 123 Patterson, St,
Hillsdale, NJ 07642.
7 Model 3801. Beckman Coulter, Inc., 4300 N. Harbor Blvd., P.O. Box 3100, Fullerton, CA
92834-3100.
Literature Cited
Al-Khatib, K., D. E. Peterson, D. L. Regehr. 2000. Control of imazethapyr -resistant
common sunflower (Helianthus annum) in soybean (Glycine max) and com (Zea mays).
Weed Technol. 14:133-139.
Al-Khatib, K., J R. Baumgartner, D. E. Peterson, R. S. Currie. 1998. Imazethapyr
resistance in common sunflower (Helianthus annuus). Weed Sci. 46:403-407.
Allen, J. R., W. G. Johnson, R. J. Smeda, and R. J. Kremer. 2000. ALS-resistant
Helianthus annuus interference in Glycine max. Weed Sci. 48:461-466.
Arias, D. M and L. H. Rieseberg. 1994. Gene flow between cultivated and wild
sunflowers. Theor. AppL Genet. 89:655-660. 34
Baumgartner, J R., K. Al-Khatib, R_ S. Currie. 1999. Cross-resistance of imazethapyr- resistant common sunflower (Helianthus annuus) to selected imidazolinoae, sulfonylurea, and triazolopyrimidine herbicides. Weed Technol. 13:489-493.
Baumgartner, J. R., K. Al-Khatib, R_ S. Currie. 1997. Imazethapyr resistance in common sunflower. Proc. North Cent. Weed Sci. Soc. 52:162.
Boutsalis, P. 2001. Herbicide Resistance Action Committee (HRAC). Internet location:
http://plantprotection.orp/HRAC. November, 2001.
Geier, P. W , L. D. Madux, L. J. Moshier, and P. W. Stahlman. 1996. Common
sunflower (Helianthus annuus) interference in soybean {Glycine max). Weed Technol.
10:317-321.
Gressel, J. 2002. Molecular Biology of Weed Control. Taylor and Francis, London. In
Press.
Heap, I. M. 2001. International Survey of Herbicide Resistant Weeds. Internet location:
http://www.weedscience.com. November, 2001.
Hinz, J. R.R. and M D. K. Owen. 1997. Acetolactate synthase resistance in a common
waterhemp (Amaranthus rudis) population. Weed Technol. 11:13-18. Irons, S. M. and O. C. Bumside. 1982. Competitive and allelopathic effects of sunflower
{Helianthus annuus). Weed Sci. 30:372-377.
Lee, J. M. and M. D. K. Owen. 2000. Comparison of acetolactate synthase enzyme
inhibition among resistant and susceptible Xanthium strumarium biotypes. Weed Sci.
48:286-290.
Miller, J. 1987. Sunflower. Pages 626-668 in W. R. Fehr, E. L. Fehr, and H. J. /essen,
eds. Principle of Cultivar Development. Vol. 2., New York, NY: Macmillan Publishing. 35
Rogers, C E , T E. Thompson, and G. J. Setter. 1982. Sunflower species of the United
States. Fargo, ND: National Sunflower Assoc. 75p.
Saari, L. L., J. C. Cotterman, and D. C. Thill. 1994. Resistance to acetolactate synthase inhibiting herbicides. Pages 83-139 in S. B. Powles and J. A. M Hokum, eds. Herbicide
Resistance in Plants: Biology and Biochemistry, Boca Raton, FL: CRC Press, Inc. Table 1. Field history in Howard, South Dakota from 1988 to 1996. Primary Herbicide Program Respray Treatment 4IIM Application Rate Application Rate Practice Year Crop Herbicide Timing* (kg/ha) Heibicide (8/1*) 1988 soybean conventional trifluralin PPI 0.1 none thifcnsulfinon POST 0.004 chlorimuron POST 0.006 1989 corn no-till cyanazine PRE 2.2 None cyanazine POST 1.3 atrazine POST 0.4 dkamba POST 0.6 1990 soybean conventional trifluralin PPI 0.1 chlorimuron 88 thifcnslu/uron POST 0.004 chlorimuron POST 0.006 1991 corn no-till cyanazine PRE 2.2 none atrazine POST 1.3 cyanazine POST 0.4 1992 soybean conventional imazethapyr POST 0.007 chlorimuron 5.8 1993b com no-till metolacMor PRE 2.2 none acetachlor PRE 2.0 dimethenamid PRE 1.6 atrazine POST 0.6 dicamba POST 0.6 1994 soybean no-till glyphosate PRE 1.1 chlorimuron 13.1 imazethapyr POST 0.007 1995 com no-till cyanazine PRE 2.2 none atrazine POST 1.3 cyanazine POST 0.4 dicamba POST 0.6 1996 soybean no-till glyphosate PRE 1.1 imazaquin 36.8 metribuzin PRE 0.4 imazethapyr POST 0.007 imazaquin POST 0.007 * Abbreviations: PPI, pre-piant incorporated; PRE, preemergence; POST, postemergence. bThe field was divided into thirds for demonstration plots The POST treatment was applied to the entire field. 37
Table 2. Inhibition of resistant and sensitive common sunflower acetolactate synthase to imazethapyr and chlorimuron.
Iso values' Herbicide Resistant Sensitive R/S imazethapyr (nM) 200 (194 to 205 )" 5.2 (2.5 to 7.7) 39 chlorimuron (nM) 10.5 (8.9 to 12.1) 1.2 (0.4 to 2.2) 9 * I»: Inhibition of 50% of the enzyme activity.
6 Values in parentheses are 95% confidence intervals. Table 3, Effect of time on 14C distribution in resistant and sensitive common sunflower populations treated with l4C-chlorimuron.
14C Distribution
Time after p , . Treated Above Below Application (h) °^u Leaf Treated Leaf Treated Leaf Roots • % of absorbed
sensitive 84 3 8* 5 resistant 91 1 3 5
24 sensitive 70* 4* 13* 13 * resistant 92 1 3 4
48 sensitive 59* 6* 20* 15* resistant 91 2 3 4
72 sensitive 67 * 10 * 15 * 8 * resistant 94 1 2 3 * Asterisk corresponds to significant differences between the two populations for each given time after application (a = 0.05). Table 4, Effect of time on l4C distribution in resistant and sensitive common sunflower populations treated with l4C-imazethapyr.
I4C Distribution Time After Treated Above Below Application (h) Population Leaf Treated Leaf Treated Leaf Roots % of absorbed 4 sensitive 92 1 3 4 resistant 91 1 2 6
24 sensitive 62 10 14 14 resistant 66 11 9 14
48 sensitive 56 16 15 * 13 resistant 58 16 9 17
72 sensitive 57 16 15 12 resistant 54 21 10 15 * Asterisk corresponds to significant differences between the two populations for each given time after application (a == 0.05). 1 Figure 1. A. Response of resistant common sunflower treated with imazethapyr or
2 chlorimuron. Visual ratings shown were taken at 21 DAT. The x-axis values are expressed
3 as X times the typical use rate for each herbicide. The IX rates for imazethapyr and
4 chlorimuron were 70 and 13 g ha"1, respectively. Regression equations: imazethapyr, y = 1.3
5 + [64.5/(1+ exp (-(x-8.4)/l .8))] (i* = 0.99); chlorimuron, y = "29349.3 + [294734.5/(1+ exp (-
6 (x-"7.3)/1.2))l (r* = 0.95). B Effect of chlorimuron or imazethapyr on biomass
7 accumulation in the Howard common sunflower population. Regression equations: 8 imazethapyr, y = 1.72/[l+(x/10.53)1-721 (r3 = 0.52); chlorimuron, y = 1,89/[l+(x/l .28)0-63 ] (r2 9 =0.95). 41
100
B • Chlorimuron o Imazethapyr
18 Figure 2. Effect of time on l4C-chlorimuron and l4C-imazethapyr absorption in resistant and sensitive common sunflower. Regression equations: chlorimuron-sensitive, y = (15.17x)/(3.14+x) (R3 = 0.99); chlorimuron-resistant, y = (10.83x)/(5.65+x) (R2 = 0.97); imazethapyr-sensitive, y = (23.54x)/(l ,25+x) (R2 = 0.99); imazethapyr-resistant, y = (15.94x)/(l ,62+x) (R2 = 0.98). 43
Chlorimuron
14 -
12 -
10 -
• Sensitive o Resistant I £
Imazetfaapyr o x>
20
0 4 24 48 72 Time (h) 44
CHAPTER 3. HERITABILITY OF ACETOLACTATE SYNTHASE
RESISTANCE IN COMMON SUNFLOWER (Helianthus annuus).
A paper to be submitted to Weed Science.
Anthony D. White, Michelle A. Graham, and Micheal D K. Owen1
Abstract
A common sunflower population from Howard, South Dakota was previously determined to be cross-resistant to imazethapyr and chlorimuron. Experiments were designed to determine the genetic characteristics of acetolactate synthase (ALS) resistance in the Howard common sunflower and to evaluate the potential of introgression into other Helianthus populations.
Approximately 529 amino acids were sequenced from the ALS gene in common sunflower and Jerusalem artichoke. An alanine substitution to valine was observed at amino acid position 204. Previously documented mutations at this locus indicated it played a pivotal role in conferring resistance to one or more ALS inhibitor herbicide. The existence of an amino acid sequence frame shift between positions 436 and 441 also suggests that at least two copies of the ALS gene exist in common sunflower. The shift was not seen in Jerusalem artichoke, indicating that either additional gene copies were not polymerase chain reaction
(PCR) amplified or only one copy of ALS was present in the genome. The existence of upstream and downstream amino acid polymorphisms from the sequenced regions remains 45 unknown. Progeny from resistant-sensitive (R.-S) hybrids indicated that ALS resistance in the Howard common sunflower population was likely due to a semi-dominant gene.
Nomenclature: Common sunflower, Helianthus annuus L., HELAN; Jerusalem artichoke,
Helianthus tuberosus L, HELTU; imazethapyr, 2-[4,5-dihydro-4-methyl-4-(l-methylethyl>-
5-oxo-l/f-imidazoI-2-yl]-5-ethyl-3-pyridinecarboxylic acid; chlorimuron, 2-[[[[(4-chloro-6- methoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]benzoic acid.
Key words: common sunflower, Jerusalem artichoke, acetolactate synthase, gene flow, herbicide resistance, gene sequencing.
Introduction
Herbicides that inhibit acetolactate synthase (ALS; EC 4.1.3.18) are important tools used to manage weeds in a number of crops since being introduced in 1982 (Saari et al.
1994). ALS catalyzes the first step involved in the biosynthesis of the branched-chain amino acids, valine, leucine, and isoleucine. These amino acids are essential for plant growth and development, and their absence results in rapid inhibition of root and shoot growth, eventually leading to plant death (Devine et al. 1993). ALS inhibiting herbicides exhibit high efficacy at low rates and are used in various crops (Saari et al. 1994). The ALS reaction is found in algae, fungi, bacteria, and higher plants, but not in mammals, which helps to explain why ALS herbicides exhibit low mammalian toxicity (Chipman et al. 1998).
1 Graduate Research Assistant, Post Doctoral Geneticist and Professor, Department of Agronomy, Iowa State University, Ames, IA 50011. 46
The primary mechanism of ALS-inhibitor resistance in weeds is an altered ALS enzyme (Hinz & Owen 1997; Saari et al 1994; Subramanian et al 1990). One or more amino acid changes in the DNA that codes for ALS can result in resistance to ALS inhibiting herbicides (Subramanian et al. 1996; Wright et al. 1998). In addition, these changes in the protein structure appear to have few adverse effects on productivity at the enzyme or whole plant level.
Wright et al. (1998) listed several examples of ALS inhibitor resistance in plants and the known genetic mutations resulting in resistance. The amino acid changes were divided into those that occurred in Regions A or B and were further subdivided into changes that occurred in Domains A and B (Wiersma et al. 1989). Domain A corresponded to a 13 amino acid segment surrounding the proline site in Region A, and Domain B corresponded to four amino acids at the tryptophane site in Region B
Common sunflower is known to hybridize with 17 other Helianthus species, including Jerusalem artichoke (Helianthus tuberosus L.) (Rogers et al. 1982). Gene flow among these species can occur through pollen movement, seed dispersal, and the spread of
vegetative propagules (Maxwell and Mortimer 1994; Saari et al. 1994). Gene flow in
common sunflower is likely mediated primarily by pollen transfer since cultivated and wild
biotypes have large achenes with no adaptations for long-distance dispersal (Linder et al.
1998). Common sunflower has a self-incompatible system of reproduction and is primarily bee pollinated (Arias and Rieseberg 1994).
Pollen dispersal from one plant to another is only one requirement for successful gene
transfer. Requirements for gene transfer to occur include proper overlap in space and time of 47 the parents, successful fertilization, and viable progeny to develop and pass the genes on to future generations (Jorgensen et al. 1996; Levin and Kerster 1974; Stallings et al 1995).
Many crop species including beets (Beta vulgaris) (Boudry et al. 1993), rice (Oryza sativa) (Langevin et al. 1990), and oil seedrape (Brassica napus) (Jorgensen and Anderson
1994; Brown and Brown 1996) are grown where sexually compatible relatives exist. Gene flow between a crop and a weedy relative may alter the adaptability of the weed by allowing
traits, such as self-compatibility and dormancy, to introgress from the crop into the wild
species (Snow et al. 1998). Klinger and Ell strand (1994) reported that F; hybrid radishes, a
cross between cultivated (Raphanus sativus) and wild (Raphanus sativus) biotypes, exhibited
up to 15% greater lifetime fecundity compared to purely wild genotypes. In comparison,
common sunflower wild/crop hybrids inherited resistance to rust (Puccinia helianthi Schw.)
and produced 24% more flower heads compared to infected plants (Snow et al. 1998). If
common sunflower inherits fitness-related genes, including herbicide resistance, these
beneficial traits could contribute to increased weediness of the hybrid genotypes
Seefeldt et al. (1998) described a herbicide resistance model resulting from a nuclear-
encoded semi-dominant gene. The model established segregation patterns for a single
nuclear gene conferring resistance (R) or sensitivity (S) depending on the herbicide dose.
Segregation ratios of 3:1 (R:S or S:R) follow the hypothesis that resistance is monogenically
controlled with R being dominant at low doses and conversion to S being dominant at higher
doses. Semi-dominance occurs when the segregation ratio does not follow a 3:1 or 1:3 (R:S)
ratio regardless of herbicide rate. Semi-dominant genes produce a 1:2:1 (R; Segregating :S)
ratio at an intermediate dose. The segregating genotypes will have a varying level of
lethality at the herbicide dose response indicated. This is thought to occur because the semi- 48 dominant gene allows the expression of both sensitive and resistant ALS resulting in an intermediate response to a given herbicide dose (Saari et al. 1994).
Prickly lettuce (Lactuca serriola L.) (Mallory-Smith et al. 1990) and tobacco (Chaleff and Bascomb 1987), derived from homozygous S and R crosses, segregated in a 1:2:1 manner and were thought to contain a semi-dominant ALS resistance gene. In contrast, Lee
(1999) concluded that ALS resistance in common cocklebur was likely due to a single dominant nuclear gene. When a discriminatory dose of imazethapyr was used to detect an intermediate dose response, no resistance was detected in the heterozygous resistant common cocklebur. Although this pattern of resistance has been shown in Palmer pigweed
(Amarcmthuspalmeri S. Wats.) (Currie et al. 1996), neither prickly lettuce or Palmer pigweed exhibited cross-resistance to two families of ALS inhibitors like the Howard common sunflower.
Although wild-crop hybridization has been studied in common sunflower (Arias and
Rieseberg; Snow et al. 1996), data on gene flow of herbicide resistance, particularly for ALS- inhibiting herbicides, are limited. Marshall et al. (2001) evaluated movement of imazethapyr
resistance to a sensitive common sunflower biotype. However, movement of the resistance gene occurred only up to 15.5 m, which is much less than reported for other genetic markers.
Arias and Rieseberg (1994) reported that foraging bees could carry crop-specific genetic
markers as far as 1000 m. Currently, data is not available on the effects of ALS cross- resistance moving from resistant common sunflower to other sensitive Helianthus
populations.
Further investigation of the heritability characteristics of ALS cross-resistance is
necessary to understand the introgression of resistance genes into sensitive populations. 49
Therefore, the objectives of these studies were to evaluate the genetics of ALS-inhibitor herbicide resistance in a confirmed resistant biotype of common sunflower and examine the possibility of introgression into both a sensitive common sunflower and Jerusalem artichoke population.
Materials and Methods
Seed germination. In 1996, a common sunflower population from a field near Howard,
South Dakota was determined to be cross-resistant to chlorimuron and imazethapyr, both
ALS inhibiting herbicides (White et al. 2001). Seeds from resistant common sunflowers were collected from the Howard location in the fall 1996 and stored at 4 C until experiments were conducted. Seeds were placed on wet germination paper in petri dishes and incubated at 4 C for 10 to 14 d. Seeds were then germinated in an illuminated germinator set to provide approximately 200 |imol m'V1 of photosynthetic photon flux density (PPFD) over a 14 h photoperiod with 30 and 24 C day and night temperatures, respectively. Germinated seeds were then transplanted to 10-cm pots and placed in a greenhouse. Plants were fertilized weekly with a commercial fertilizer1 and watered as needed. High-pressure sodium lamps
were used to maintain a PPFD of350 nmol m"2 s'1 at the canopy level over a 16 h
photoperiod. Resistant and sensitive hybridization. The ALS resistant common sunflower population
(Howard, SD) was not homogeneously resistant. Therefore, 15 cm plants were treated with a
combination of chlorimuron and imazethapyr at 52 g ha"1 and 280 g ha"1 (four times the
normal use rate), respectively, to confirm cross-resistance. Non-ionic surfactant (NIS)2 and
ammonium sulfate (AMS)3 were added to each herbicide at 0.25% by volume and 4.5 kg 50 ha*1, respectively. The surviving Fi generation ALS cross-resistant plants were used for further evaluations and are referred to as 'HSD\
ALS resistant and sensitive common sunflower and sensitive Jerusalem artichoke
(Helianthus tuberosus L.) were grown to flowering. The sensitive parents consisted of two common sunflower populations from Ames, IA and one from Ankeny, IA and are referred to as 'AMI', 'AM2, and 'ANK', respectively. Populations of Jerusalem artichoke (JA) from
Johnston, IA and Ames were included in the cross-pollination procedure. The JA-HSD and
AM2-HSD hybrids did not produce seed and were not used for further evaluation.
Cross-pollination was conducted when the flowers were completely open and pollen availability appeared to be at the maximum. Although common sunflower is predominately pollinated by the honey bee (Apis mellifera L), successful cross-pollination in a greenhouse can be accomplished by hand (G. J. Seiler, Northern Crop Sci. Lab , USDA-ARS, Fargo, ND
58105, personal communication). When pollen shed began, flowers from a resistant and sensitive plant were physically rubbed together to facilitate pollen exchange. The sensitive
common sunflower served as the pistillate receptor and all flowers received pollen from
confirmed resistant plants. Debet4 mesh bags were immediately placed over each pollinated
flower and the plant was allowed to mature. A HSD by HSD cross was also performed to
evaluate possible changes in the ALS resistance gene within the population.
Dormancy in common sunflower seeds is high in comparison to other weeds (G. J.
Seiler, personal communication). However, seeds that are removed from the plant as the
flower petals begin to dry up tend to have lower levels of dormancy compared to seeds that
complete maturity on the plant (Seiler, G , personal communication). Therefore, R/S hybrid
seed heads were removed when petals showed signs of desiccation. The seed heads were 51 allowed to air dry for several weeks and then were shelled; seeds were cleaned and stored at
4 C until further use. Approximately 50 crosses were made for each sensitive biotype. Seeds were combined among each resistant/sensitive cross resulting in hybrid lines described as
'AM1-HSD', 'AM2-HSD', 'ANK-HSD', and 'HSD-HSD'
DNA extraction. DNA was extracted from six different Helianthus biotypes including:
AM I, BAO ALS sensitive Helianthus annuus, HSD, ANK-HSD, SUNSPOT (commercial variety: H. annuus var. sunspot), and JA (Johnston, IA). ANK was not included because plant material was not available at the time of sequencing. Other hybrids were not included since germination was poor and heterogeneity for the ALS resistance gene would likely exist within the hybrid population since only Fi progeny was available. DNA sequence analysis of an Fi may produce results unreliable for evaluating movement of ALS resistance genes.
A standard extraction and purification method was used to extract genomic DNA
(Doyle and Doyle 1990). Up to 1 g of fresh plant material was removed from the respective plants and ground using a sterile, preheated mortar and pestle (approximately 60 C) with 2 mL of pre-warmed CTAB buffer (100 mM Tris-HCL, pH 7.5; 27 mM hexadecyltrimethyl- ammonium bromide (CTAB); 0.7 M sodium chloride; lOmM EDTA) containing 2- mercaptoethanol to a final concentration of 1%. The ground tissue was poured into a centrifuge tube and the mortar and pestle rinsed with an additional 8 mL CTAB buffer
solution. The samples were incubated at 60 C for 1 h, an equal amount of 24:1
chloroform:octanol was added, and each sample centrifuged9 for 10 min at 3500 rpm. The
supernatant was removed and cold isopropanol was added at two-thirds the supernatant
volume. Samples were rocked gently to promote DNA precipitation and stored overnight at
-20 C The samples were then centrifuged for 10 min at 3500 rpm to pellet the DNA. The 52 supernatant was decanted and the pellet dried in a fume hood. The pellet, containing DNA, was re-dissolved in 400 gl TE (10 mM Tris HCl, 1 mM EDTA, pH 8.0) and stored at -20 C until further analysis. Gel electrophoresis was used to ensure presence of genomic DNA.
PGR and cloning procedure. Genomic DNA was first amplified by PCR using primers6 that flanked two distinct regions (A and B) of the ALS gene (Figure 1). However, these primers did not amplify the respective regions in all of the Helianthus samples. PCR products generated from primers derived from the sequences from various plant species
(Table 1) for Regions A and B were cloned and sequenced. The resulting nucleotide sequences were aligned and specific primers for Regions A and B of the ALS gene in
Helianthus were designed and used to generate final sequence data (Table 2).
Separate PCR reactions were set up to amplify each region from each biotype. PCR was optimized using 1 pLof diluted DNA template (1:100 dilution of total extracted DNA),
0.5 pM of each of two primers, 0.2 units jiL"1 Taq DNA polymerase7,1.5 mM MgCI%, IX
PCR buffer and 0.15 nNTPs in a final volume of 40 nL. The reactions were subjected to a 2
min incubation at 94 C; 40 cycles of 1 min at 94 C, 30 s at 54 C, and 1 min at 72 C; 5 min at
72 C and stored at 4 C. PCR products were fractionated by electrophoresis on a 1.2% low melt agarose gel and cloned8.
Plasmid DNA «traction and sequencing. Selected white colonies from cloning were used for sequence analysis. The clones were screened using PCR to insure the presence of the
DNA fragment. Plasmid DNA was extracted using a modified alkali lysis miniprep
(Sambrook et al. 1989). Cultured cells (4 mL) were spun on a single speed centrifuge9 for 30
s and the supernatant decanted. The pellet was resuspended in GTE solution (40% sterile
glucose, lOmM EDTA, pH 8.0,25mM Tris/HCl, pH 8.0, and sterile water). The sample was 53 mixed gently with a cell lysis solution (0.2 M NaOH, 10% SDS, and sterile water), inverted several times, and incubated for no more than 5 min. Potassium acetate solution (3 M potassium acetate, 1M glacial acetic acid, and sterile water) was gently mixed into the sample and incubated on ice for 5 min. Samples were centrifuged at 4 C for 5 min and the supernatant transferred to a sterile tube RNA was removed by adding 1 pL of RNAase (10 mg nL"1) and incubating at 37 C for 30 to 60 min. Phenol-chloroform (1:1) was added, the preparation centrifuged for 3 min, and the upper aqueous phase was then transferred to a sterile tube. Chlorofbrm-isoamyl alcohol (24:1) was added and the preparation was again centrifuged for 3 min. Supernatant was transferred to a sterile tube and isopropanol was added.
After incubation overnight, samples were centrifuged for at least 20 min to pellet the
DNA and the supernatant was decanted. The pellet was rinsed with 70% ethanol, centrifuged, and the supernatant decanted. The pellet was allowed to dry and resuspended in
25nL"' sterile water. Samples were sent to the Iowa State Sequencing Facility where gel sequencing was carried out using an automated sequencer10. Clone sequences were aligned according to the respective region. Clones with identical consensus sequences are shown and referred to as a single sequence.
Test for dominance. Resultant hybrid seed was preconditioned and germinated using methods previously described. Approximately 300,300,300, and 500 seeds were subjected to germination conditions for AMI-HSD, AM2-HSD, ANK-HSD, and HSD-HSD, respectively. Limited hybrid plants were available and a single herbicide treatment was used to select for ALS cross-resistance. A herbicide mixture of imazethapyr, chlorimuron, and
NIS at 13 g ha1,70 g ha*1, and 0.25% by volume, respectively, was applied to 10 to 15 cm 54 plants to select for resistant individuals. AM1-HSD and ANK-HSD produced 3 and 13 plants, respectively, for gene dominance evaluation. One plant from each line served as an untreated control. Germination did not occur in the AM2-HSD and HSD-HSD lines even under various germination regimes including changes in temperature, light, moisture, and preconditioning periods. Chi-square analysis was conducted to evaluate the corresponding frequency distribution for the ANK-HSD hybrid.
Results and Discussion
DNA sequencing. Sequencing for Region A was successful between nucleotides 354 and
1140 of the ALS gene in all evaluated Helianthus biotypes. Sequencing of Region B successfully overlapped a portion of Region A and consisted of nucleotides 1074 to 1941.
The overlapping area of the two regions showed no significant polymorphisms that would affect sensitivity to ALS inhibitors. Therefore, the general annealing position of the RevA and ForB primers was used to distinguish Regions A and B from one another. Further discussion refers to each separate region.
Minor polymorphisms were seen at several positions in Region A (See Appendix HI for complete sequence alignment). These substitutions are easily discounted as playing a role in ALS inhibitor resistance since most are not found in biotypes expressing resistance (HSD and ANK-HSD) A glycine to glutamate substitution at amino acid position 301 was seen in an ANK-HSD clone. This substitution likely plays no part in ALS resistance since it was not seen in any of the clones for HSD.
A distinct mutation was discovered at amino acid position 204 in Region A (Figure
2). A substitution of an alanine for valine was seen in six of seven clones from resistant 55 biotypes. The seventh clone contained an alanine at this position and was not mutated, as were other species listed in the sequence alignment (Appendix HI). Two mutations that confer ALS resistance at this locus have been previously identified (Hartnett et al. 1996;
Wood worth et al. 1996). The first mutation was an alanine to asparagine substitution, which conferred resistance to imazaquin (2-[4,5-dihydro-4-methyl-4-(1 -methylethyl)-5-oxo- IH- imidazol-2-yl]-3-quinolinecarboxylie acid) and chlorimuron (Hartnett et al. 1996). This site was previously identified in yeast ALS, but not plant ALS, to confer resistance to ALS inhibiting herbicides.
Woodworth et al. (1996) showed that an alanine to valine substitution in common cocklebur (Xanthium strumarium L.) (Table 3) was responsible for resistance to imidazolinones and partial resistance to sulfonylurea herbicides. Enzyme assays concluded that ALS from the resistant biotype was approximately 10-fold less sensitive than the wild- type to inhibition from compounds from four different chemical classes of ALS-inhibiting
herbicides. The Howard common sunflower biotype has exhibited this same pattern of
resistance to imazethapyr and chlorimuron (White et al. 2001).
Region B also exhibited minor polymorphisms in genetic code among the different
clones (See Appendix m for complete sequence alignment). A substitution of lysine for
glutamate at amino acid position 405 (Figure 3) was observed in one clone of six derived
from genomic DNA from an ALS resistant biotype. This substitution has not been
previously identified as playing a role in resistance to ALS inhibitor herbicides. The
substitution is likely due to either PCR or sequencing error and thus would likely not play a
part in resistance to ALS inhibitors. No polymorphisms were identified in Region B that
conferred ALS resistance in other plant species, including the tryptophan to leucine mutation. 56
Although the copy number of the ALS gene in Helianthus is presently unknown, an event between amino acid position 436 and 441 may provide further insight on gene copy number. A frame shift was observed in 9 of 23 clones (ANK2-1, SUN2-1B, HSD2-6,
BA02-1B, BA02-1, BA02-3, BA02-4, HSD2-3, SUN2-3) sequenced for Region B. The frame shift consisted of either a deletion or insertion of four amino acids from the ALS gene.
The shift occurred in multiple clones within multiple biotypes, indicating that a true change exists and was not an error due to PCR or sequencing. To verify the change was not due to sequencing error, the seven clones were sequenced a second time. The frame shift provides firm evidence that at least two copies of ALS exist in common sunflower. The shift was not detected in clones from Jerusalem artichoke, indicating that either multiple gene copies of
ALS do not exist in this species or that PCR amplification did not amplify more than one copy. A southern blot analysis of genomic DNA from both species is necessary to determine the exact number of genes in these two species.
The ALS gene in H. tuberasus was evaluated to identify how conserved it was compared to H. annuus. The sequences from Regions A and B indicated few differences between the two species. However, H. tuberasus did not express the frame shift exhibited in
Region B. Although multiple copies of the ALS gene may exist in H. tuberasus, the sequencing data indicated that the gene is highly conserved with that of H. annuus. In addition, DNA coding for ALS was highly conserved in both the wild (AM-1 and BAO) and cultivated (SUN) H. annuus.
Primers were designed and synthesized to flank the entire ALS gene in all of the
Helianthus biotypes. Initial efforts were to sequence the entire ALS gene in Helianthus sp.
Unfortunately, the forward primer at the 5' end (nucleotide position 220) and the reverse 57 primer al the 3' end (nucleotide position 1980) did not amplify any of the biotypes, due to degeneracy in the primer sequence (primer sequences not shown). Therefore, approximately
100 bases at each the 5' and 3* end of the ALS gene in the Helianthus sp. evaluated were not amplified.
A polymorphism in genetic code upstream from amino acid position 220 has been previously reported in common cocklebur (Bernasconi et al. 1995). However, the mutation was discounted as playing a role in resistance since it lies in the coding region for the chloroplast transit peptide and is cleaved from the mature ALS protein. To date, no other mutations between nucleotide positions 220 and 354 have been reported to play a role in
ALS resistance.
Three mutations have been reported in other plant species to occur downstream from nucleotide 1941 at the 3' end of the ALS gene. A serine to asparagine (Sathasivan et al.
1990), threonine or phenylalanine (Lee et al. 1999) substitution at amino acid position 653
(nucleotide 1959) in Arabidopsis thaliana (L.) Heyhn all conferred resistance to various ALS inhibitors. Sequence alignments (Appendix HI) indicated that this region of the ALS gene is not highly conserved among various plant species, including the sequences generated from
Helianthus sp. Complete sequence analysis of the ALS gene in Arabidopsis and N. tabacum indicated that they code for proteins of670 and 667 amino acids, respectively (Hartnett et al
1996). However, Saari et al. (1994) reported that the mature protein contained approximately
575 amino acids. The location of the stop codon for the ALS gene in sunflower is unclear and, therefore, may be present before nucleotide position 1959. Since the existence of a substitution at amino acid position 653 remains unreported in species other than Arabidopsis, its role in ALS resistance in Helianthus sp. remains unclear. 58
Test for dominance. The common sunflower lines AMI, AM2, and ANK produced minimal seed when pollinated by the HSD line. Low seed production was not surprising since the plants were pollinated by hand and not insects. The small quantity of seed compounded with poor germination resulted in few plants being available for gene dominance screening. However, different flowering times between the resistant and sensitive
lines or unfavorable environmental conditions during flowering may have influenced seed
production from the resistant/sensitive crosses.
Investigation of the seeds from AM2-HSD and HSD-HSD indicated most of the
achenes lacked an embryo. Inadequate pollination and incompatibility between the resistant
and sensitive lines are likely causes of barren achenes. Unfortunately, little information is
available regarding optimum timing or environmental conditions necessary for successful
common sunflower pollination.
The ALS cross resistance observed in the Howard common sunflower was likely due
to a semi-dominant nuclear-encoded gene. The F, progeny of ANK-HSD segregated in a
2:9:1 (sensitiveintermediateresistant) manner and produced heterozygous intermediates
(Figure 4A). Although 10 of 12 plants survived an application of chlorimuron and
imazethapyr, only one plant showed no signs of injury compared to the untreated control. A
calculated chi-square value of 5.33 did not exceed the critical value (5.99; 2 df; a=0.05).
Therefore, the distribution frequency of the ANK-HSD hybrid followed the model of a 1:2:1
segregation ratio with respect to movement of the ALS resistance gene.
The AMI-HSD line did not provide enough plants to evaluate gene dominance (two
plants). Therefore, a segregation ratio and chi-square value are not reported. However, 59 compared to the control, the single surviving plant responded similar to the intermediate plants from the ANK-HSD line when treated with chlorimuron and imazethapyr (Figure 4B.
Inheritance studies of ACCase resistance in wild oat (Avenafatua L.) and Italian ryegrass (Lolium multiflorum Lam.) indicated that resistance was due to monogenic inheritance with resistance dominant at low doses switching to susceptibility as the dominant phenotype at high doses (Seefeldt et al. 1998). The segregation ratio of wild oat was reported to be 1:2:1 (R:I:S). Although the segregation ratio of the ANK-HSD line did not follow all three segregation patterns described by Seefeldt et al. (1998), evaluating more genotypes at various herbicide concentrations would likely confirm that a semi-dominant resistance gene is responsible for ALS resistance in this population of common sunflower and provide a better understanding of resistance segregation within the Howard common sunflower population.
Evaluating additional Fi plants at various herbicide concentrations may clarify the segregation ratio of resistance and confirm the existence of a semi-dominant resistance gene.
Additional research focusing on the genetics and gene flow of ALS resistance in Helianthus will be helpful for making weed management decisions based on how quickly resistance will appear and subsequently move into otherwise sensitive populations.
We have demonstrated that an alanine»* to valine mutation in the ALS gene of common sunflower plays a pivotal role in resistance to imazethapyr and chlorimuron. The production of an ALS resistant hybrid after only one generation suggests that resistance will spread rapidly in a natural environment. The ability of Jerusalem artichoke to hybridize with common sunflower coupled with a highly conserved ALS gene increases the risk of resistance moving into a perennial population. The potential for escape into a perennial 60 species may pose new challenges with respect to managing herbicide resistance. Moreover, the rapid movement of the resistance gene into a sensitive common sunflower biotype sheds new light on what consequences may result from the release of a commercially available sunflower variety containing the ALS resistance gene.
Sources of Materials
1 Miracle Gro Excell, Scotts-Sierra Horticultural Co., 14111 Scottslawn Rd. Marysville, OH
43041.
2 X-77, a mixture of alkylaryl-polyoxyethylene glycols, free fatty acids and isopropanol.
Valent USA Corp., 575 Market Street, San Francisco, CA 94110.
3 Ammonium sulfate, Riverside/Terra Corp. 600 4* Street, P.O. Box 6000, Sioux City, IA
51102.
4 Applied Extmsion Technologies, P.O. Box 582, Middletown, DE 19709. 3 Model 3110. Biospec Products. P.O. Box 722, Bartlesville, OK 74005.
6 GIBCOBRL Custom Primers, Life Technologies, P.O. Box 6482,9800 Medical Center Dr.,
Rockville, MD 20849-6482.
7 PCR Kit, Invitrogen Corp., 1600 Faraday Ave., Carlsbad, CA 92008.
8 pGEM-T Easy Vector System I. Promega Corporation, 2800 Woods Hollow Road,
Madison, WI 53711.
9 Micro Centrifuge Model 235B, Fisher Scientific 585 Alpha Dr., Pittsburgh, PA 15238
10 Applied Biosystems Florescent Sequencing System, DNA Sequencing and Synthesis
Facility, 1184 Molecular Biology Building, Ames, IA 50011-3260. 61
Literature Cited
Arias, D. M and L. H. Rieseberg. 1994. Gene flow between cultivated and wild sunflowers.
Theor. Appl. Genet. 89:655-660.
Bemasconi, P., A. R Woodworth, B. A. Rosen, M. V. Subramanian, and D. L. Siehl. 1995.
A naturally occurring point mutation confers broad range tolerance to herbicides that
target acetolactate synthase. J. Biol. Chem. 270:17381-17385.
Boudry, P., M Morchen, P. Saumitou-Laprade, P. Vernet, and H. Van-Dijk. The origin and
evaluation of weed beets: Consequences for the breeding and release of herbicide -
resistant transgenic sugar beets. Theor. Appl. Genet. 87:471-478.
ChalefÇ R S. and N. F. Bascomb. 1987. Genetic and biochemical evidence for multiple
forms of acetolactate synthase in Nicoticma tabacum. Mol. Gen. Genet. 210:33-38.
Chipman, D, Z. Barak, J. V. Schloss. 1998. Biosynthesis of 2-aceto-2 hydroxy acids:
acetolactate synthases and acetohydroxyacid synthases. Biochim. Biophys. Acta.
1385:401-419.
Chang, A. K. and R. G. Duggleby. 1998. Herbicide-resistant forms of Arabidopsis thaliana
acetohydroxyacid synthase: characterization of the catalytic properties and sensitivity to
inhibitors of four defined mutants. Biochem. J. 33:765-777.
Chong, C. K. and J. D. Choi. 2000. Amino acid residues conferring herbicide tolerance in
tobacco acetolactate synthase. Biochem and Biophys. Res. Comm. 279:462-467.
Chong, C. K. H. J. Shin, S. I. Chang, and J. D. Choi. 1999. Role of tryptophanyl residues in
tobacco acetolactate synthase. Biochem and Biophys. Res. Comm. 259:136-140 62
Curric, R S., M. J. Horak, and W. L. Rooney. 1996. Inheritance of imazethapyr resistance
in Palmer pigweed (Amaranthuspalmeri). Proc. North Cent. Weed Sci. Soc. 51:97-98.
Devine, M D., S. O. Duke, and C. Fedtke. 1993. Physiology of Herbicide Action. Prentice
Hall, Englewood, NJ. 441p.
Doyle, J. J. and J. L. Doyle. 1990. Isolation of plant DNA from fresh tissue. Focus. 12:13-
15.
Foes, M J., L. Liu, G. Vigue, E. W. Stoller, L. M. Wax, and P. J. Tranel. 1999. A kochia
(Kochia scoparia) biotype resistant to triazine and ALS-inhibiting herbicides. Weed Sci.
47:21-27.
Gressel, J 2002. Molecular Biology of Weed Control. Taylor and Francis, London. In
Press.
Guttieri, M J., C. V. Eberlein, and D. C. Thill. 1995. Diverse mutations in the acetolactate
synthase gene confer chlorsulfuron resistance in kochia (Kochia scoparia) biotypes.
Weed Sci. 43:175-178.
Guttieri, M J., C. V. Eberlein, C A. Mallory-Smhh, D. C. Thill, and D. L Hoffman. 1992.
DNA sequence variation in Domain A of the acetolactate synthase genes of herbicide-
resistant and -susceptible weed biotypes. Weed Sci. 40:670-676.
Hartnett, M. E., C F Chui, C. J. Mauvais, R E McDevitt, S. Knowlton, J. K. Smith, S. C
Falco, and B. J. Mazur. 1990. Herbicide resistant plants carrying mutated acetolactate
synthase genes. Am. Chem. Soc. Symp. Series. 421:459-473.
Haughn, G. W., J. Smith, B. Mazur and C. Somerville. 1988 Transformation with a mutant
Arabidopsis acetolactate synthase gene renders tobacco resistant to sulfonylurea
herbicides. MoL Gen. Genet. 211:266-271. 63
Hinz. J. R. R. and M. D K. Owen. 1997. Acetolactate synthase resistance in a common
waterhemp (Amaranthus rudis) population. Weed Technol. 11:13-18.
Jorgensen, R B, and B. Anderson. 1994. Spontaneous hybridization between oilseed rape
(Brassica rapus) and weedy B. campestris (Brassicaceae): A risk of growing genetically
modified oilseed rape. Am. J. Bot. 81:1620-1626.
Jorgensen, R. B, T. Hawser, T. R Mikkelsen, and H. Ostergard. 1996. Transfer of
engineered genes from crop to wild plants. Trends in Plant Sci. 1:356-358.
Langevin, S. A., K. Clay, and J. B. Grace. 1990. The incidence and effects of hybridization
between cultivated rice and its related weed red rice ( 44:1000-1008. Lee, Y. T, A. K. Chang, and R G. Duggleby. 1999. Effect of mutagenesis at serine 653 of Arabidopsis thaliana acetohydroxyacid synthase on the sensitivity to imidazolinone and sulfonylurea herbicdes. FEBS Letters. 452:341-345. Lee, K Y , J Townsend, J. Tapperman, M Black, C. F. Chui, B. Mazur, P. Dunsmuir, and J. Bedbrook. 1988. The molecular basis of sulfonylurea herbicide resistance in tobacco. EMBOJ. 7:1241-1248. Levin, D. and H. Kerster. 1974. Gene flow in seed plants. Evol. Bio. 7:139-220. Linder, C. R, I Taha, G. J Seiler, A. A. Snow, and L. H. Rieseberg. 1998. Long-term introgression of crop genes into wild sunflower populations. Theor. Appl. Genet 96:339-347. Mallory-Smith, C A., D. C. Thill, and M J Dial. 1990. Identification of sulfonylurea herbicide-resistant prickly lettuce (Lactuca serriola L ) Weed Technol. 4:163-168. Marshall, M W, K. Al-Khatib, and T Loughin. 2001. Gene flow, growth, and competitiveness in imazethapyr resistant common sunflower. Weed Sci. 49:14-21. Maxwell, B. D. and A. M Mortimer. 1994. Selection for herbicide resistance. Pages 1-25. In S. B. Powles and J. A. M Hokum, eds. Herbicide Resistance in Plants: Biology and Biochemistry. Boca Raton, FL: CRC Press, Inc. Ott K. H., J. G. Kwagh, G W Stockton, V. Sidirov, and K. Kakefuda. 1996. Rational molecular design and genetic engineering of herbicide resistant crops by structure modeling and site-directed mutagenesis of acetohydroxyacid synthase. J. Mol. Biol. 263:359-368. Saari, L. L , J. C. Cotterman, and D. C. Thill. 1994. Resistance to acetolactate synthase inhibiting herbicides. Pages 83-139. In S. B. Powles and J. A. M Holtum, eds. Herbicide Resistance in Plants: Biology and Biochemistry. Boca Raton, FL: CRC Press, Inc. Sambrook, J., E. F Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Second Ed. Cold Spring Harbor Lab. Press, pp. 1.25-1.28. Sathasvian, K., G. W. Haughn, and N. Murai. 1991. Molecular basis of imidazolinone herbicide resistance in Arabidopsis thaliana var. Columbia. Plant Physiol. 97:1044- 1050. Seefeldt, S. S., D. L. Hoffman, D. R Gealy, and E. P. Fuerst. 1998. Inheritance of diclofop resistance in wild oat (Avena fatua L.) biotypes from the Williamette Valley of Oregon. Weed Sci. 46:170-175. Snow, A. A., P. Moran-Palma, L. H. Rieseberg, A. Wszelaki, G. J. Seiler. 1998. Fecundity, phenology, and seed dormancy of Fi wild-crop hybrids in sunflower 0Helianthus annuus, Asteraceae). Am. J. Bot. 85:794-801. Stailings, G. P., D. C. Thill, C. A. Mallory-Smith, and B. Shafh. 1995. Pollen-mediated gene flow of sulfonylurea resistant kochia (Kochia scoparia). Weed Sci. 43:95-102. Subramanian, M., P. Bemasconi, and F. D. Hess. 1996. Approaches to assess the frequency of resistance development to new herbicides. Copenhagen: Second Int. Weed Control Congress. 2:1-8. Subramanian, M V., H Hung, J. M Dias, V. W. Miner, J. H Butler, and J. J. Jachetta. 1990. Properties of mutant acetolactate synthases resistant to trizolopyrimidine sulfonamide Plant Physiol. 94:239-244. White, A. D, M. D. K. Owen, R G. Hartzler, and J. Cardina. 2001. Common sunflower (Helianthus annuus L.) resistance to acetolactate synthase inhibiting herbicides. Resist. Pest Manage. 11:3-4. Wiersma, P. A., J. E. Hachey, W L. Crosby, and M. M. Moloney. 1990. Sequence of two acetohydroxyacid synthase genes from Tea mays. MoL Gen. Genet. 224:155-159. Woodworth, A., P. Bemasconi, M Subramanian, and B. Rosen. 1996a. A second naturally occurring point mutation confers broad-based tolerance to acetolactate synthase inhibitors. Plant Physiol. 111:105(symposium abstracts). Woodworth, A. R, B. A. Rosen, and P. Bemasconi. 1996b. Broad range resistance to herbicides targeting acetolactate synthase (ALS) in a field isolate of Amaranthus sp. is conferred by a Trp to Leu mutation in the ALS gene. Plant Physiol. 111:1353 66 Wright, T. R., N. F. Bascomb, S. F Stumer, and D Penner 1998. Biochemical mechanism and molecular basis of ALS-inhibhing herbicide resistance in sugarbeet (Beta vulgaris) somatic cell selections. Weed Sci. 46:13-23. 67 Table I. ALS gene sequence identification from various plant species used in initial primer design. Nucleotide Locus' accession numbers6 Plant species ab49823 AB049823 Oryza satrvab. zmahasl09 X63554 lea mays L. aO 10684 AF310684 Lolium multiflorum L. bnahsyii ZU525 Brassica napus L. bnals XI6708 Brassica napus L. bnaalsZ M60068 Brassica napus L. atcsrll X51514 Arabidopsis thaliana (L.) Heyhn a063369 AF363369 Amaranthus retroflexus L asu55852 U55852 Amaranthus sp. af094326 AF094326 Kochia scoparia L. ntalsura X07644 Nicotiana tabacum L ntalsurb X07645 Nicotiana tabacum L a008649 AF308649 Solanum ptycanthum L. a008650 AF308650 Solarium ptycanthum L. a£308648 AF308648 Solanum ptycanthum L xsu16279 U16279 Xanthium strumarium L. xsul6280 U16280 Xanthium strumarium L. ghahasal9 Z46957 Gossipium hirsutum L. ghahasaS Z46960 Gossipium hirsutum L • a _ • j i • ,.à ... b Accession numbers can be used to access additional sequence information in Genbank®. Amino acid sequences can also be obtained from this internet site. 68 Table 2. DNA sequences for the primers used for PCR screening in Helianthus sp. Plant species Primer* Sequence1* (5* to 3') Region Various' ForA GGNGCNTCNATGGAGAT A RevA TCATCAAACCTNACNCCAA A ForB TTTGGNGTNAGGTTTGATGA B RevB CTATNAC ATCC AAC ANGT A B Helianthus spp.A ForA CGATGGAGATCCACCAAG A RevA AACGCAAGCAACAAATCACT A ForB TGGTACGGTTTATGCGAATT B RevB ACATCCAACAGGTAAGGC B e Forward (ForA and ForB) and reverse (RevA and RevB) primers for Regions A and B, respectively. b Primers containing an *N' indicate degenerate nucleotide positions. N represents an A, T, I G, or C was used. c Primers derived from sequence alignments in Table 1. PCR products from these primers were cloned, sequenced and used to make specific primers for Helianthus spp. d Primers used for final sequencing. 69 Table 3. Acetolactate synthase mutations conferring resistance to ALS-inhibitor herbicides modified from Gressel (2002). Amino Acid Mutation* Plant species Reference Met 124 -* Glu Nicotiana tabacum L Ottetal. 1996 De Nicotiana tabacum L. Ottetal. 1996 Ala 155 —> Thr Xanthium strumarium L. Bernasconi et al. 1995 Nicotiana tabacum L Chong and Choi 2000 Pro 197 -> His Lactuca serriola L. Guttieri et al. 1992 Gin Nicotiana tabacum L. Lee et al. 1988 Ala Nicotiana tabacum L. Lee et al. 1988 Ser Arabidopsis thaliana (L.) Heyhn Haughn et al. 1988 Beta vulgaris L. Wright et al. 1998 Thr Kochia scoparia L. Guttieri et al. 1995 Leu Kochia scoparia L Guttieri et al 1995 Arg 199 Ala Nicotiana tabacum L Ottetal. 1996 Glu Nicotiana tabacum L. Ottetal. 1996 Ala 205 —> Asp Nicotiana tabacum L. Hartnett et al. 1990 Val Xanthium strumarium L. Woodworth et al. 1996a Ser 236 -> Leu Beta vulgaris L Wright et al. 1998 Gin 269 -> His Xanthium strumarium L. Bernasconi et al. 1995 Asn 522 -> Ser Xanthium strumarium L. Bemasconi et al. 1995 Trp 574 -> Leu Xanthium strumarium L. Bernasconi et al. 1995 Kochia scoparia L Foes et al. 1999 Amaranthus sp. Woodworth et al. 1996b Ser Arabidopsis thaliana (L.) Heyhn Chang and Duggleby 1998 Phe Nicotiana tabacum L. Chong et al. 1999 Ser 653 -> Asn Arabidopsis thaliana (L.) Heyhn Sathasvian et al. 1991 Thr Arabidopsis thaliana (L.) Heyhn Lee et al. 1999 Phe Arabidopsis thaliana (L.) Heyhn Lee et al. 1999 "Mutations are listed according to the numbering system used for Arabidopsis, which may not match the original publication. 70 Region A Region B ForA ForB ^ ^ RevA RevB Figure 1. Fragments (dotted regions) of DNA amplified from the ALS gene in both resistant and sensitive common sunflower and sensitive Jerusalem artichoke. Arrows represent flanking regions of oligonucleotide primers. * CTP, chloroplast transit peptide. Arrows correspond to the oligonucleotide primers that flank regions A and B White area indicates unsequenced amino acids. 71 MK-16 UB-2k RSB-9 unc-2 RSB-3 * « TUB-X TUB-2 $85 55:' BAO-2 RSB-2fc smr-i TOB-4 rums BAO-S SOTT-5 tiweS9 baahqpil at«acl2 mOeS36B M«sns2 *£094326 *00664» ftOOMSO lOOMWrm1K19 hm16280 Figure 2. Alignment of amino acid clone sequences for Region A of the ALS gene in Helianthus sp. compared to published sequences from other plant species. Clones and sequences of the ALS gene from various Helianthus populations are described above the horizontal line in the sequence alignment. Sequences below the line are from plant species listed in Table 1. The arrow at the top indicates the alanine for valine substitution thought to play a role in ALS resistance (position 204; Region A). The entire sequence generated from Helianthus sp. is not shown in this figure and can be viewed in Appendix m. Clones with identical consensus sequences are shown as one sequence (HSD-3 & 4). 72 I 1 «îe 4SI «ae 44# 469 *49823 «£310884 bMluyii tnul<2 efccsrl2 «£363369 ta«558S2 •£094326 gtil wtIi «£309649 •£308650 «£308648«•«18279 «#«18260 $0*2-1b BSD 2-6 Bâ02-lb 3, * 4 881* *0*2-3 1082-2 1082-4 1082-3 BSD 2-4 10*2-5 BSD2-2 TO2-5 10*2-1 80*2-1 t 80*2-4 80*2-5 em-2-i Bà02-5 Figure 3. Alignment of amino acid clone sequences for Region B of the ALS gene in Helianthus sp. compared to other plant species. Clones and sequences of the ALS gene from various Helianthus populations are described below the horizontal line in the sequence alignment. Sequences above the line are from plant species listed in Table 1. The arrows at the top denote the area (positions 437-440; Region B) where a frame shift is present. The entire sequence generated from Helianthus sp. is not shown in this figure and can be viewed in Appendix HI. Clones with identical consensus sequences are shown as one sequence (BA02-1,3, & 4; SUN2-1 & 2). Figure 4. A. Response of the ANK-HSD cross to imazethapyr and chlorimuron 21 DAT. Plants 1 and 5 correspond to a sensitive and resistant plant, respectively. Ten of the twelve plants from the ANK-HSD hybrid survived the herbicide treatment (not all shown). B. Response of the AM1-HSD cross to imazethapyr and chlorimuron 21 DAT. Remainder of AM1-HSD hybrid plants did not survive the herbicide treatment 74 B 75 CHAPTER 4. GENERAL CONCLUSIONS Acetolactate synthase inhibitor herbicides play an important paît of weed management in a number of crops. Unfortunately, resistance to ALS inhibitors has increased more over the past 10 years than has resistance to any other mode of action (Heap 2001). In 1996, resistance to ALS inhibitor herbicides was suspected in a common sunflower population found near Howard, SD. Although, Baumgartner et al. (1999) evaluated the existence of cross-resistance in a Kansas common sunflower population, they did not examine the cause of resistance at the enzyme or gene level. The first objective of this research was to confirm that an insensitive enzyme was responsible for reduced common sunflower control. Whole-plant ALS enzyme assays confirmed that ALS resistance was due to an altered ALS enzyme in the Howard common sunflower population. 1» values indicated the resistant population required 39 and 9 times more imazethapyr and chlorimuron, respectively, to obtain the same level of enzyme inhibition compared to the sensitive biotype. The second objective was to evaluate cross-resistance between imazethapyr and chlorimuron and determine the ratio of resistant to sensitive individuals within the population. Ratios of 7:1 and 9.5:1 for chlorimuron and imazethapyr, respectively, indicated the resistant population was not homogeneously resistant to either herbicide. The differential resistance ratios may be due to a specific mutation in the gene that codes for the ALS enzyme. Different mutations in the ALS gene greatly affect the sensitivity to various ALS inhibitor herbicides (Guttieri et al. 1995; Saari et al. 1994). 76 Foliar uptake and translocation of chlorimuron and imazethapyr varied between the resistant and sensitive common sunflower populations. Although the rate of herbicide uptake was the same for both populations, the amount of 14C absorbed was significantly higher for the resistant population. Distribution to various plant parts was not different between the two populations. The differential uptake of l4C suggested that biochemical or physical differences exist between the resistant and sensitive common sunflower populations. Many reports of polymorphisms or mutations in the gene coding for ALS have been reported in a variety of plant species that confer resistance to one or more ALS inhibitor herbicides. Sequencing of the ALS gene in Helianthus sp. was successful between nucleotides 354 and 1941 (divided into Regions A and B). Minor polymorphisms seen in Regions A and B were discounted as playing a role in ALS inhibitor resistance since most were not found in biotypes expressing resistance (HSD and ANK-HSD). The only significant mutation was found at position 204 (Region A). A substitution of an alanine for valine was seen in six of seven clones from resistant biotypes. Hartnett et al. (1996) and Woodworth et al. (1996) reported two mutations at this locus, including an alanine to valine substituion, that conferred resistance to imidazolinones and partial resistance to sulfonylureas. The Howard common sunflower population exhibited this same pattern of resistance to imazethapyr and chlorimuron, suggesting that the mutation at position 204 plays a pivotal role in ALS resistance. In addition, a frame shift in Region B provided substantial evidence that more than one copy of the ALS gene existed in the genome. The existence of the alanine to valine substitution on more than one copy has not been confirmed. Although cross-pollination of Helianthus sp. was not highly successful, the Fi progeny from the ANK-HSD cross followed a segregation pattern of 1:2:1 77 (sensitive: intermediate: resistant). Therefore, the ALS cross resistance observed in the Howard common sunflower population was likely due to a semi-dominant, nuclear-encoded gene Additional research is needed with respect to ALS resistance in common sunflower. Studies should be conducted to evaluate leaf wax characteristics or other barriers to herbicide movement in these common sunflower populations (resistant vs. sensitive). These studies may help identify why 14C uptake was lower in the resistant population compared to the sensitive biotype. Additional gene sequencing should be done to obtain the complete sequence for the ALS gene in Helianthus sp. and to determine if mutations exist outside the area we sequenced. Southern blot analysis of genomic DNA from common sunflower and Jerusalem artichoke is necessary to confirm the exact copy number of the ALS gene in the respective species. The possibility of the resistance gene moving into a sensitive common sunflower population or other Helianthus population is real. Research is necessary to further examine gene dominance and the repercussions of the gene transferring into a sensitive Helianthsu population. Resistance to chlorimuron and imazethapyr in the Howard common sunflower was based primarily on a point mutation in the DNA coding for ALS and appears to be semi- dominant. Although the Howard common sunflower expressed differential uptake and translocation characteristics, the differences were not substantial enough to fully explain the nature of resistance. 78 APPENDIX I LOCUS IDENTIFICATION, GENBANK® ACCESSION NUMBERS, AND CORRESPONDING PLANT SPECIES FOR ALS GENES 79 Nuclotide Locus accession numbers Plant species ab49823 AB049823 Oryza sativa L. zmahasl09 X63554 Zea mays L. aO 10684 AF310684 Lolium multiflorum L. bnahsyii Z11525 Brassica napus L. bnals X16708 Brassica napus L. bnaals2 M60068 Brassica napus L. atcsrl2 X51514 Arabidopsis thaliana (L.) Heyhn af363369 AF363369 Amaranthus retroflexus L. asu55852 U55852 Amaranthus sp. af094326 AF094326 Kochia scoparia L ntalsura X07644 Nicotiana tabacum L. ntalsurb X07645 Nicotiana tabacum L. aG08649 AF308649 Solanum ptycanthum L a£308650 AF308650 Solanum ptycanthum L. af308648 AF308648 Solanum ptycanthum L. xsu16279 U16279 Xanthium strumarium L. xsul6280 U16280 Xanthium strumarium L. ghahasal9 Z46957 Gossipium hirsutum L. ghahasaS Z46960 Gossipium hirsutum L. * Complete sequence alignments can be obtained from Appendix n and m Accession cumbers can be used to access additional sequence information in Genbank* at the internet location: http://wwwjicbi.nlnLnih.gov/ 80 APPENDIX O AMINO ACID SEQUENCE ALIGNMENTS FROM HELIANTHUS CLONES AND PLANT SPECIES USED IN INITIAL PCR PRIMER DESIGN. 81 ririNMOaïïSKK k : :^SS2îssl KM SSSooSLS »I •«•«>> 2éïzz*mzz 2:33::: «OkMOOririllOUe «Ai losl SB «m:*##:*»»*e*2.e.i •>> *•«« DSWSfiMKftktM mmmnoa* IÏ5 6655 A2S2: •kkkkftIMNkk hhrii) WmomM ****** kkkk ÎSBsss Su:: lllîKKSS (•KJU »** **•» **##hhtlri SSS5 •« >*** iiao •kNkliK HKNK issri: !;;a!M« « «•• HXO m M I »âiï ™™SSS5"-°—"S SânMnHnhhnHn^H«nnn«a38M ÉiÉSÊÉâiÉsÉiêglÊêiih (Kidcifirie«M MMMMMMMMMMMMMMMM>M il.» rit utirrri Ltd 1 t I I I I I I I ( f I I I I M I I I I illiMMHMIMIItl (T1 I t <( I I I I I I t I I I I I I t I I MM £8 84 I ^**********************88**55*5555555*8 • ^»• ••• • • • • IMAMflriNriW AriNMrtMMM SÉÉiiÉâÉÉÉÉÊSÉÉÉiêÉi §11 86 MMMNCiei NMflftMCinflMflfl I Cl 87 •N« «4HeMOf IS1 88 M |«ri |fin« 6 (••••« < 1 • » • I i i I ill T i T Ti i T i « 89 APPENDIX HI NUCLEOTIDE SEQUENCE ALIGNMENTS USED FOR INITIAL PGR PRIMER DESIGN. 90 ab49B23-o: ai3io««4-: mhulOf taatafyil tceotcoict tiwli tcEotootct bnul«2 afccsrlZ UUUMJLAH.TU.T TUUil-CrOCAAAICAOCAr ntalnn llQIU.li.CglU-lUJ>CaTOCTOCJ>OC. . o ntalwtb MUHUaJiailUMIWCWMCC. . .c a£30««4»-.- a£30««48-: a£30e«50-z afl«33<9-; asusses2 a»S432«-l ual(27l XSU162S0 {hahasall ghahasaS ab49!23-o: toaunaw110 .. . li atiio««4-: bioecncn «•ahaslOS bnaheyll WICCTCOOTTTOOB bnal* irercrccomcoa bnaalag atesrll ntaleera ntalaub a£30««4»-t a£30«64e-i aooesso-i (fjiuii-; aeessesa a£0 94324-1 UB1I2TI iaat<2IO gbahaaalt ghahaeaS . . . ICO . . . 170 . . . 180 . . . ISO . . . 200 . . . 210 . . . 220 ab4M23-o: i3orawiacraiooBgroTO^oaa'ri:j#cu:T»i.i.nTccn.iuooocoa| a£3io««4-: îacmaooTiiciœaooorizrc •ahaelO» 141 teahiyll 19 *LLWU#MLiiUW.IMI bnaalmt 31 atoaxl2 130 ntalsura HCTCaunqraHTTOOM. ljU#JUUUUWI 111. ntalfufe 131 a£30«64S-$ af30#«4#-: a£308«S0-i a£3433«»-i 13UClXVJUiC«CTagU>CTQUtTC»Ct.liMfjrCTCTa>OOaMm> IHHHMl II II ase33es2 i47Ltiuwcmc%*inu^auacmoci#woTCR»ooaMu*i#i*iiMi u in a£0»4326-l 141C XSU1427* MBiiiteiceauuuxaicattQtJeM.T. zsai«2«o i4sa»cxocMMoaakoaaaycKKz.T. flhahaeal» 147QCOa>flMtXUUTUajaCXlJULIt Tf#COUUUU»*CTQCTOCT. 14 fumnxaacoBOOBoaott 91 . 230 . 240 . 250 . . . 240 ... 270 ... 290 ... 290 ... 300 •M9C23-0: *Z310#«-: naba«109 besheyil *teerl2 Btaleera 211 •talnxb 213 •130S649-Z at308C49-i 1» e£30e<50-« 1- •floso-i aeu55eS2 223 at09432«-l 211 ZSU1S279 213 xeul«290 213 gh*ku«19 211 gkatwaS 211 . 310 320 . . 330 . 340 . 350 390 . 370 . ab49923-o: •010M4-: mhulOt baahsyil ato»12 Btalnra 291 •tail wri) 29 a<309S49-i 7i af309649-1 af30MS0-s *£3«33S9-i *nSMS2 •£094326-1 2! *eel«27» 29 *sel«2«0 29 gheheeal9 29: " 2ft 92 480 470 4M 490 soo 510 ... 320 .. ab48823-e: K310M4-: mebaelOS bnahsyll atenU nfcalsera afSOMWi a£3oe«4«-i tfsoino-i tfMlMI-i aeeSMSa KOMSM-I xeol«278 xeel«280 flbahaealS 830 . 840 . . . 880 . .. 880 ... 870 8*0 . . . <00 ab48823-« tflioiM-: Bahwioi bnahiyll >MHl2 atenU atdaan afl08«48-> «*308848-1 lfSOIISO-i aflMSlM xnltt7l u«uno «10. . . €20 . «30 «MflU-o: 881 mf310884 881 fill «108 883 baahayll 881 bnal» 881 iMIMlrt 471 *tesrl2 884 Btalnn 8K ntalauk 884 #*308*4* 381 a£308«48-i 381 •£308880-: 381 a£3«33«8-: 881 *#«88882 884 af08432*H 881 UU1C278 884 xeul«280 884 ghahanU S8C ah»l>m5 8M 93 MO ... TOO 7X0 ... 720 ab4M23-e: «73 a!310S84-: C«4 •ahaalO» «« tonaheyll «71 tonale «71 tonaal*2 BSC ateeria «71 ntaleera ««1 ntaleezb «SI a£308«4»-i 442 a£308«48-« 441 af30#«30-, 441 a*3«33«8-: «71 aenS6eS2 ««1 a£0»432CH ««a xeel«37» «si 3teel«280 «SI ghahaeais ««i «Cl ab48823-« 74 «010M4-: 74 aahulOf 7: bnaheyil 74 tonal» 74 Iwiaal *7 S2' atesrl» 74! ntaleera 73! ntaleezb 7: a£308«48-t 81, af30««48-i SU a£3M«80-. 81 af3(SMI-i 74 aeeSS8S2 7 a£09432«H 73' xeel«27S 7i xeel«280 7: flhahaaal» 73! flhaliaaaB 73! ab48«23-e; afllO«4-: HMhaalOS koahayu ateeell ntaleera Btalaub a£3OT#48-t a£308««8-t a£30MS0-i a£3«33«»-; aeeSS8S2 af0»432H xeel«27t xeel«280 ghahaeais 94 •10 •20 •30 •40 •SO mc lb4H23-« W miom-: •? nhulOf «7; tuhfyll I 70 *tesrl2 ntaleera #7 ntalwit I 100H4I-I « If30l(4l-i «3 af30MS0-i <9 a£3«33«9-: Mi aeeSSMa ••: ifOHUH M xeel«279 • xeeicaao f flhahaeal» #7 Ihtfiwal #7 .1010 ab4M23-« »S! af3!0«04-: *S: Ottbaaio* *4 fcoaheyll 98! hnale 93: hailrt 13 ateeria 9: ntaleera Mi ntaleezb 94 a£300«49-t 72! af30#44# 78! afSOOCSO-t 71 a£3«3369-i •' aeessasa •< aZ094324-1 •«; seel4279 M xeel«280 94 flhahaeal9 98: ghttiii» 98; .1040 .1070 . . .1000 .1090 1100 .1110 .1120 ab49023-oA0; af310404-a0 nntaael0910l! buheyU 10 lanale 10 Miami #2 90! ateerl2 10 ntaleera 102 ntal eeit) 10H af309#49 90 a£30e«40-i #0 aOOMSO-: #0 a£3«33«9-d.04: aeessssa 104 af09432«-n.0: xeel«279 101 *eel«200 1011 gbahaeal9l02' ghahaeaS 102 95 .1130 .1140 . .1150 11C0 .1170 . .1110 .11*0 .1200 aMM23-oaiO if310«U-lH mahaal0»10* baahayll. no hnale 110 Iwttilrt **< ateatlZ 110 ntaleora 10»! Btaleub 10# af300<4*-> #7 a£30«#4«-i #7 af30B«S0-i #7 a£3«33«»-411 aeu55*52 111 a£o#«32e-nio zeal<27# io# leainw 10# gtiahaeaUlO#! gtuhaaiB 10# .1210 . .1220 .1230 .1240 1250 .12C0 . .1270 ab4**23-«117 a£310«*4-3.17: •ahaaioeil# beahem lie tonale 11* fmaal u7 IOS ateerl2 11 ntaleera 117 ntalwrti 11# a£30*«4*-i *4 af30*44*-i *4 a£30*C*0-t *4: a£3«33«*-41 aeu3S*82 11 afo*432«-eie S8U1C279 11» xenicaao 11# flhahaeal*ll7 " 117 12*0 . . .12*0 . . .1300 . . .1310 . . .1320 . . .1330 .1340 . . .1350 ab4M23-ol2S< a%310##4 124 saahael0*l24i boaheyll koala i: fcwaale2 11: ateerl2 ntaleera 124 Btaleub 124 af30##4*-&02 a£30*«4*-402< afsoeeso-ao* a£3#33S*-4,2«i aeu55*S2 121 a*0*432«-112S' xeul«27* 124 xeel«2«0 124 ghahaeal»124' ghahmS 124 iiiiiiiiiiiiiiiiiw AJUJUUUUUUUUwUS 97 .15*0 • i*oo • • .1*10 . . ,i*ao . . .1*30 . . .1*40 . . ab«M23-olS» af310**4-lS4 aeahael091S4 tnahiyli MS teala 18" IWMlli 14 atearia 159 ntaUun 154 ntilwit 154 lf30H4l-ilU af30M4l-U2 afSMISO-ASS af3UMI-lH aeessssa 15* a£094X2<-&55 xeul*a79 184 *eel«a*0 184 ehahaeal9184 184 .1*40 .1*70 .1*00 1**0 .1700 .1710 .1730 iMMaa-oaca a£310**4-l* taahaal091*l teaheyll 1*3 teals 1*2 bM«1rt ISO ateseia 1C: ntalaura 1* ntaleetb 1*1 aOO««49-aS9 a«30e*4*-43S a<30**S0-43»l a£3*33*»-a*4 asessesa 1 a£0S432*-H* XSU1C279 1*1 xenieaeo 1*1 «hahaaalVl* gtiahaaas 1* .1730 .1740 .1780 .17*0 .1770 .1710 .1790 ab4M33-«170' af310*#4 1*9 •ahaelOSl*»! teahayll 1701*1 teala 1701 bnaal»? is*: atearia 170 ntalsura 1*11 Btaloub 1**1 afS0**4»-a4T a*30**4* 147 aOO*«SO-a.4T af3*33*9 171 aseSSMa 1713 af0»432*-&70-1 mil *379 1*91 «Micaao 1*91 ehaha*al9ie*l ghahaeaS 1*91 98 -1§10 . . .1820. ..1830 .1840 . . .1850 1860 «M9823-477 •£310684-177: z*eha*100.7 boahsyii. 177 tonale 177 toe*al«2 165 •tearl2 177 Btelsu*ml77i ntalrab 176 •£308649-154 •£308648-154 •£308650-154 •£363369-178 •SU55852178 •£094326-178 x«ul6279176 xsul6280176 ghahas*13.77 jh«h«w5177 1890 . . .1900 . . .1910 . . .1920 . . .1930 . . ab49823-<185 •£310684-184 EMliMlOae* baahsyli.184 toult 184 toaaal«2 173 •tcerl2 185: ntaleura 18 ntalsuztolBS •£308649-1 •£3086481 •£3086501 •£363369-18 •«U5585218 •£094326185 *•«16279183! Mill6280183 ghelmeaiae* ghaheeeS 184! 99 LITERATURE CITED Al-Khatib, K. J. R. Baumgartner, D. E. Peterson, and R. S. Currie. 1998. Imazethapyr resistance in common sunflower. Weed Sci. 46:403-407. Anderson, P. C. and K. A Hibberd. 1985. Evidence for the interaction of an imidazolinone herbicide with leucine, valine and isoleucine metabolism. Weed Sci. 33:479-483. Anonymous. 2001. Greenbook Home-C & P Press. Internet address: http:7Avww.greenbook.net. Last accessed November, 2001. Arias, D. M and L. H. Rieseberg. 1994. Gene flow between cultivated and wild sunflowers. Theor. Appl. Genet. 89:655-660. Bader, B. M , M. S. DeFelice, J. S. Dilbeck, and C. S. Holman. 1994. Herbicide resistant weed populations discovered in Missouri. Proc. North Cent. Weed Sci. Soc. 49:89-90. Barrett, S. C. H 1988. The evolution, maintenance, and loss of self-incompatibility systems. Pages 98-124. In I. Lovett Doust and L Lovett Doust, eds. Reproductive Ecology of Plants: Patterns and Strategies. Oxford University Press, Oxford. Baumgartner, J. R., K. Al-Khatib, R. S. Currie. 1997. Imazethapyr resistance in common sunflower. Proc North Cent Weed Sci. Soc. 52:162. Baumgartner, J. R., K. Al-Khatib, and R. S. Currie. 1999. Cross resistance of imazethapyr- resistant common sunflower (Helianthus anmats) to selected imidazolinone, sulfonylurea, and triazolopyrimidine herbicides. Weed Technol. 13:489-493. Bekkaoui, F, J. A. Condie, F A Neustaedter, M. M. Moloney, and W L. Crosby. 1991. Isolation, structure and expression of a cDNA for acetolactate synthase from Brassica napus. Plant Mol. Biol. 16:741-744. Bekkaoui, F., P. Schorr, and W L. Crosby. 1993. Acetolactate synthase from Brassica napus: immunological characterization and quaternary structure of the native enzyme. Physiol. Plant 88:475-484. Bernasconi, P., A. R. Wood worth, M. V. Subramanian, and D. L. Siehl. 1995. A naturally occurring point mutation confers broad range tolerance to herbicides that target acetolacatate synthase. J. Biol. Chem. 270:17381-17385. Brown, HM. 1990. Mode of action, crop selectivity, and soil relations of the sulfonylurea herbicides. Pestic. Sci. 29:263-281. Brown, KM. and S.M. Neighbors. 1987. Soybean metabolism of chlorimuron ethyl: physiological basis for soybean selectivity. Pestic. Biochem. and Physiol. 29:112-120. Brown, J. and A P. Brown. 1996. Gene transfer between canola (Brassica napus L. and B. campestris L.) and related weed species. Ann. Appl. Biol. 129:513-522. Bryan, J.K. 1990. Advances in the biochemistry of amino acid biosynthesis. Pages 161- 195. In B.J. Miflin and P. J. Lea, eds. The Biochemistry of Plants. Academic Press, New York, NY. ChalefÇ R. S. and N. F. Bascomb. 1987. Genetic and biochemical evidence for multiple forms of acetolactate synthase in Nicotiana tabacum. Mol. Gen. Genet. 210:33-38. Chipman, D , Z. Barak, and J. V. Schloss. 1998. Biosynthesis of 2-aceto-2hydroxy acids: acetolactate synthases and acetohydroxyacid synthases. Biochim. Biophys. Acta. 1385:401-419. Christopher, SJ$. Powles, and J AM Hokum. 1992. Resistance to acetolactate synthase- inhibiting herbicides in annual ryegrass (Lolhtm rigidum) involves at least two mechanisms. Plant Physiol. 100:1909-1913. Cobb, A. 1992. Herbicides and Plant Physiology. Pages 126-142. Chapman and Hall. New York, NY. Desrochers, A. M. and L. H. Rieseberg. 1998. Mentor effects in wild species of Hetianthus (asteraceae). Am. J. Bot. 85:770-775. Devine, M. D, S. O. Duke, and C Dedtke. 1993. Physiology of Herbicide Action. Prentice Hall, Englewood, NJ. 441p. Dumas, R., D Job, J. Y. Ortholand, G. Emeric, A Greiner, and R. Douce. 1992. Isolation and kinetic properties of acetohydroxy acid isomeroreductase from spinach (Spinacia oleracea) chloroplasts overexpressed in Escherichia coli. Biochem J 288(3):865-874. Eberlein, C. V., M. J Guttieri, C. A Mallory-Smith, D C. Thill, and R. J. Baerg. 1997. Altered acetolactate synthase activity in ALS-inhibitor resistant prickly lettuce (Lactuca serriola). Weed Sci. 45(2):212-217. Geier, P. W , L D Maddux, L. J. Moshier, and P. W. Stahlman 1996. Common sunflower (Hetianthus anmtus) interference in soybean (Glycine max). Weed Technol. 10:317-321. Gillespie, G R and S. D. Miller. 1984. Sunflower competition in wheat. Can. J. Plant Sci. 64:105-111. Grabau, C., and J. E. Cronan, Jr. 1986. Nucleotide sequence and deduced amino acid sequence of Escherichia coli pyruvate oxidase, a lipid-activated flavoprotein. Nucleic Acids Res. 14:5449-5460. Gressel, J 1991. Why get resistance? Can it be prevented or delayed. Pages 1-26. In J C Caseley, G. W. Cussans, and R. K. Atkin, eds. Herbicide Resistance in Weeds and Crops. Butterworth-Heinemann, Ltd., Jordan Hill, Oxford. Guttieri, M. J., C V. Eberlein, C A Mallory-Smith, D. C Thill, and D. L. Hoffman. 1992. DNA sequence variation in Domain A of the acetolactate synthase genes of herbicide- resistant and-susceptible weed biotypes. Weed Sci. 40:670-676. Guttieri, M. J., C. V. Eberlein, C A Mallory-Smith, and D. C. Thill. 1996. Molecular genetics of target-rite resistance to acetolactate synthase inhibiting herbicides. Pages 10- 16. In T. M. Brown, ed. Molecular Genetics and Evolution of Pesticide Resistance. Am. Chem. Soc., Washington, DC. Harms, C. T , S. L Armour, J. J, DiMaio, L. A, Nfiddlesteadt, D Murray, D. V. Negrotto, H. Thompson-Taylor, K. Weymann, A L Montoya, R_ D Shillito, and G. C. Jen. 1992. Herbicide resistance due to amplification of a mutant acetohydroxyacid synthase gene. Mol. Gen. Genet. 233:427-435. Heap, I. M. 2001. International Survey of Herbicide Resistant Weeds. Internet location: http://www.weedscience.com- Last visited November, 2001. Heiser, C. B. 1978. Taxonomy of Helicmthus and origin of domesticated sunflower. Pages 31-53. In J. F. Carter, ed. Sunflower Science and Technol. Agron. Monog. A ASA, CSSA, SSSA, Madison, WI. Hinz, J.R.R. and M.D.K. Owen. 1996. NicosuMuron and primisulfuron selectivity in corn and two annual grass weeds. Weed Sci. 44:219-223. Hinz. J. R. R. and M. D. K. Owen. 1997. Acetolactate synthase resistance in a common waterhemp (Amaranthus rudis) population. Weed Technol. 11:13-18. Irons, S M and O.C. Bumside 1982a. Absorption, translocation, and metabolism of bentazon in sunflower (Hetianthus cmnuus). Weed Sci. 30:255-259. 103 Irons, S M. and O C Burnside. 1982b. Competitive and allelopathic effects of sunflower (Hetianthusanmtus). Weed Sci. 30:372-377. Kushnir, L. G. 1977. Economic and technical efficiencies of different methods of pollination of agricultural crops. Pages 134-145. In A. N. Melhichenko, ed. Pollination of Agricultural Crops by Bees. Vol. HI. Amerind Publishing Co., New Delhi. Larossa, R. A and J. V. Schloss. 1984. The sulfonylurea herbicide sulfometuron methyl is an extremely potent and selective inhibitor of acetolactate synthase in Salmonella typhimurium. J.Biol.Chem. 259:8753-8757. Lebaron, H. M. and J. Gressel. 1982. Herbicide Resistance in Plants. J. Wiley, New York, NY. 449 p. Lee, J. M. and M. D. K. Owen. 2000. Comparison of acetolactate synthase enzyme inhibition among resistant and susceptible Xanthium strumarium biotypes. Weed Sci. 48:286-290. Levin, D. and H. Kerster. 1974. Gene flow in seed plants. Evol. Bio. 7:139-220. Marshall, M. W , K. Al-Khatib, and T. Loughin. 2001. Gene flow, growth, and competitiveness in imazethapyr resistant common sunflower. Weed Sci. 49:14-21. Mazur, B. J., C. F. Chui, and J. K. Smith. 1987. Isolation and characterization of plant genes coding for acetolactate synthase, the target enzyme for two classes of herbicides. Plant Physiol. 85:1110-1117. McHughen, A and F Holm. 1991. Herbicide resistant transgenic flax field test Agronomic performance in normal and sulfonylurea-containing soils. Euphytica. 55:49-56. Miller, J. 1987. Sunflower. Pages 626-668. In W. R. Fehr, E. L. Fehr, and H. J. lessen, eds. Principle of Cultivar Development. Vol. 2. Macmillan Publishing, New York, NY. Mousdale, D. M. and J. R. Coggms. 1991. Amino acid synthesis. Pages 29-56. In R. C. Kirkwood, ed. Target Sites for Herbicide Action. Plenum Press, New York, NY. Newhouse, K., B. Singh, D. Shaner, and M. Stidham. 1991. Mutations in corn (Zea mays L.) conferring resistance to imidazolinone herbicides. Theor. Appl. Genet. 83:65-70. Nilsson, L. A, E. Rabakonandrianina, and B. Pettersson. 1992. Exact tracking of pollen transfer and mating in plants. Nature. 360:666-668. Powels, S. B. and JAM. Hokum. 1994. Herbicide Resistance in Plants: Biology and Biochemistry. Boca Raton, FL: CRC Press, Inc. 353p. Ray, T. B. 1980. Studies on the mode of action of DPX-4189. Proc. Brit. Crop Prot. Conf- Weeds. 15:7-14. Ray, T B 1984. She of action of chlorsulfuron inhibition of valine and isoleucine biosynthesis in plants. Plant Physiol. 75:827-831. Robinson, R. G. 1978. Production and culture. Pages 89-143. In J. S Wall and W. M. Ross, eds. Sorghum Production and Utilization. Agronomy 19. Madison, WI: Am. Soc. Agron., Madison, Wisconsin. Robinson, R. G. 1984. Distance from pollen source and yields of male sterile sunflower and sorghum. Can. J. Plant Sci. 64:858-861. Rogers, C E, T E. Thompson, and G. J Seiler. 1982. Sunflower species of the United States. National Sunflower Assoc. Fargo, ND. 75 p. Rost, T L , G Gladish, J StefFen, and J. Robbins 1990. Is there a relationship between branch amino acid pool size and cell cycle inhibition in roots treated with imidazolinone herbicides? J Plant Growth Regul. 9: 227-232. 105 Saari, L. L , J. C. Cotterman, and D. C. Thill. 1994. Resistance to acetolactate synthase inhibiting herbicides. Pages 83-139. In S. B. Powles and J. A. M. Holtum, eds. Herbicide Resistance in Plants: Biology and Biochemistry. CRC Press, Inc., Boca Raton, FL. Schloss, J. V. 1990. Acetolactate synthase, mechanism of action and its herbicide binding site. Pestic. Sci. 29:283-292. Schloss, J. V., L. M. Ciskanik, D E. Van-Dyk. 1988. Origin of the herbicide binding site of acetolactate synthase. Nature. 331:360-362. Schweizer, E. E. and L. D. Bridge. 1982. Sunflower (Helicmthus anrtuus) and velvetleaf (Abutilon theophrasti) interference in sugarbeets (Beta vu/garis). Weed Sci. 30:514-519. Seiler, G. J. and L. H. Rieseberg. 1997. Systematics, origin and germplasm resources of the wild and domesticated sunflower. Pages 21-66. In A A. Schnieter, ed. Sunflower Technology and Production. Monog. 35. ASA, CSSA, and SSSA, Madison, WI. Shaner, D. 1991. Physiological effects of the imidazolinone herbicides. Pages 129-137. In D. L Shaner and S. L. O'Connor, eds. The Imidazolinone Herbicides. CRC Press, Inc., Boca Raton, FL. Shaner, D. L, P. C. Anderson, and M. A Stidham. 1984. Imidazolinones. potent inhibitors of acetohydroxyacid synthase. Plant Physiol. 76:545-546. Shaner, D. L and M. L Reider. 1986. Physiological response of corn (Zea mays) to AC 243,997 in combination with valine, leucine, and isoleucine. Pestic. Biochem. Physiol. 25:248-257. Simpson, D. M. 1998. Understanding and preventing development of ALS-resistant weed populations. Down to Earth (Dow AgroSciences Publication). 53:26-35. S tailings, G. P., D. C Thill, C. A. Mallory-Smith, and B Shafh. 1995. Pollen-mediated gene flow of sulfonylurea resistant Lochia (Kochia scoparia). Weed Sci. 43:95-102. Stidham, M. A. and B. K. Singh. 1991. Imidazolinone-acetohydroxyacid synthase interactions. Pages 71-90. In D.L. Shaner and S L O'Connor, eds. The Imidazolinone Heibicides. CRC Press, Inc., Boca Raton, FL. Stubbendieck, J., G. Y. Friisoe, and M. R. Bolick. 1995. Weeds of Nebraska and the Great Plains. Second edition. Pages 144-149. Lincoln, Nebraska: Nebraska Dept. of Ag. Subramanian, M , P. Bemasconi, and F D Hess. 1996. Approaches to assess the frequency of resistance development to new herbicides. Proc. Second Int. Weed Control Congress- Copenhagen. 2:1-8. Subramanian, M. V., R Hung, J. M Dias, V. W. Miner, J. H Butler, and J. J. Jachetta. 1990. Properties of mutant acetolactate synthases resistant to trizolopyrimidine sulfonanilide. Plant Physiol. 94:239-244. Sweetser, P. B , G S Schow, and J. M. Hutchison. 1982. Metabolism of chlorsulfuron by plants: biological basis for selectivity of a new herbicide for cereals. Pestic. Biochem. Physiol. 17:18-23. Wiersma, P. A, J. E. Hachey, W L Crosby, and M M. Moloney. 1990. Sequence of two acetohydroxyacid synthase genes from Zea mays. Mol. Gen. Genet. 224:155-159. Wilson, R. E. and E. L. Rice. 1968. Allelopathy as expressed by Hetianthus ammus and its role in old-field succession. Bull. Torrey Bot. Club. 95:432-448. Woodworth, A. R., B. A Rosen, and P. Bemasconi. 1996. Broad range resistance to herbicides targeting acetolactate synthase (ALS) in a field isolate oïAmaranthus sp. is conferred by a Trp to Leu mutation in the ALS gene. Plant Physiol. 111:1353 107 Wright, T. R., N. F Bascomb, S. F Stumer, and D. Penner. 1998. Biochemical mechanism and molecular basis for ALS-inhibhing herbicide resistance in sugarbeet (Beta vulgaris) somatic cell selections. Weed Sci. 46:13-23. 108 ACKNOWLEDGEMENTS I would like to thank my co-advisors Dr. Mike Owen and Dr. Bob Hartzler for their guidance and the opportunity to further my education at Iowa State University. I wish to extend gratitude to Drs. Tom Junk, Kendall Lamkey, and Irvin Anderson for serving on my graduate committee and their input into my project. I would like to recognize Dr. Tom Moorman and Beth Douglas for providing me with equipment for conducting the herbicide uptake and translocation work. I owe a great deal of gratitude to Dr. Jonathan Wendel, Corrinne Osborne, Donald Pratt and several others in Bessey Hall for their help and guidance with DNA sequencing. I wish to extend a special thank you to Dr. Randy Shoemaker and everyone in the Shoemaker lab for providing the necessary means to troubleshoot and complete the sequencing work. I am forever indebted to Dr. Michelle Graham and 'Ms.' Nadja Hanson for their knowledge and wisdom regarding PCR and DNA sequencing. Thank you for being such great friends. I want to th*nlr my loving wife Barbara for her support and understanding. I also cherish the love and kindness my sons Kaleb Anthony and the late Matthew David have given me. I wish to thank my entire family in Illinois for their support and patience. A special thank you is extended to Brent Pringnitz, Kerry Taylor, Ian Zelaya, Matt Harbur, Ramon Leon, and others in the weed science program for their friendship and valuable input Lastly, I wish to acknowledge all of the hourly workers who assisted with my project.