Death by HDAC Inhibition in Synovial Sarcoma Cells Aimee N

Published OnlineFirst September 6, 2017; DOI: 10.1158/1535-7163.MCT-17-0397

Small Molecule Therapeutics Molecular Cancer Therapeutics Death by HDAC Inhibition in Synovial Sarcoma Cells Aimee N. Laporte1, Neal M. Poulin1, Jared J. Barrott2, Xiu Qing Wang1, Alireza Lorzadeh3, Ryan Vander Werff4, Kevin B. Jones2, T. Michael Underhill4, and Torsten O. Nielsen1

Abstract

Conventional cytotoxic therapies for synovial sarcoma pro- group targets were reactivated, including tumor suppressor vide limited benefit,andnodrugsspecifically targeting the CDKN2A, and proapoptotic transcriptional patterns were causative SS18-SSX fusion oncoprotein are currently available. induced. Functional analyses revealed that ROS-mediated Histone deacetylase (HDAC) inhibition has been shown in FOXO activation and proapoptotic factors BIK, BIM, and BMF previous studies to disrupt the synovial sarcoma oncoprotein were important to apoptosis induction following HDAC inhi- complex, resulting in apoptosis. To understand the molecular bition in synovial sarcoma. HDAC inhibitor pathway activa- effects of HDAC inhibition, RNA-seq transcriptome analysis tion results in apoptosis and decreased tumor burden follow- fl/fl was undertaken in six human synovial sarcoma cell lines. ing a 7-day quisinostat treatment in the Pten ;hSS2 mouse HDAC inhibition induced pathways of cell-cycle arrest, neu- model of synovial sarcoma. This study provides mechanistic ronal differentiation, and response to oxygen-containing spe- support for a particular susceptibility of synovial sarcoma to cies, effects also observed in other cancers treated with this HDAC inhibition as a means of clinical treatment. Mol Cancer class of drugs. More specific to synovial sarcoma, polycomb Ther; 16(12); 2656–67. 2017 AACR.

Introduction Current cytotoxic therapies, including doxorubicin and ifo- sphamide, provide limited benefit for synovial sarcoma patients. Synovial sarcoma is an aggressive soft tissue malignancy that Following surgery and radiation, patients remain at high risk for primarily affects adolescents and young adults (1). It is charac- both early and late metastases, and despite the use of multimodal terized by the driving chimeric oncoprotein SS18-SSX, derived therapies the mortality rate remains approximately 50% within 10 from the t(X;18)(p11.2;q11.2) translocation (2). The SS18-SSX years of diagnosis (6). Thus, there is a significant need for targeted fusion oncoprotein has been proposed to interact in place of therapies against synovial sarcoma. native SS18, leading to aberrant SWI/SNF–mediated transcrip- Histone deacetylase (HDAC) inhibition has been shown to tion (3), and to act as a nidus for abnormal assembly of elicit apoptosis in synovial sarcoma models, as well as to disrupt polycomb group members (PcG) and transcription factors that SS18-SSX–mediated repressive complexes (4, 7). This inhibition lead to transcriptional repression by EZH2-mediated H3K27 was observed to elicit reactivation of repressed gene targets, trimethylation (4). Expression of tumor suppressor genes including CDKN2A (4, 7, 8). As a result, a phase II study of a EGR1 and CDKN2A has been shown to be directly repressed pan-HDAC inhibitor, pracinostat, was initiated in translocation- by SS18-SSX, whereas the antiapoptotic protein BCL2 is char- associated sarcomas, from which stable disease was achieved in acteristically upregulated (5) leading to a proliferative and three of three assessable SS18-SSX–positive patients (9). While antiapoptotic phenotype. this study had to be terminated prematurely due to unexpected interruptions in the supply of the studied compound, initial results did warrant further investigation. 1Faculty of Medicine, Vancouver Coastal Health Research Institute, University of Histone acetylation status is an important element in the British Columbia, Vancouver, British Columbia, Canada. 2Huntsman Cancer regulation of gene expression. HDAC inhibition has been Institute, University of Utah, Salt Lake City, Utah. 3Department of Microbiology shown to induce cell-cycle arrest (10), senescence (11), differ- and Immunology, Michael Smith Laboratories Centre for High-Throughput entiation (12), and apoptosis (13) in cancer cells, generally Biology, University of British Columbia, Vancouver, British Columbia, Canada. 4 leading to a decrease in tumor burden (14). While maintaining Department of Cellular and Physiological Sciences, Biomedical Research Cen- some pathway commonalities, the distinct mechanism of tre, University of British Columbia, Vancouver, British Columbia, Canada. HDAC inhibitor–induced cell death may be specifictothe Note: Supplementary data for this article are available at Molecular Cancer underlying oncogenic context. With efficacy observed in revers- Therapeutics Online (http://mct.aacrjournals.org/). ing the abnormal epigenetic status of several cancer subtypes, a Corresponding Author: Torsten O. Nielsen, University of British Columbia, 855 variety of HDAC inhibitors are currently under clinical inves- W. 12th Avenue, Vancouver, British Columbia V5Z 1M9, Canada. Phone: 604-875- tigation. Since 2006, five clinical drugs have been approved as 4111, ext. 62649; Fax: 604-875-5707; E-mail: [email protected] treatments for advanced T-cell lymphoma or multiple myeloma, doi: 10.1158/1535-7163.MCT-17-0397 while several additional HDAC-inhibiting compounds are cur- 2017 American Association for Cancer Research. rently under investigation in solid tumor clinical trials (14).

2656 Mol Cancer Ther; 16(12) December 2017

HDAC Inhibition in Synovial Sarcoma Cells

Quisinostat (15), used in this study, is a second-generation Reads of quality 10 or greater were enumerated on the sense HDAC inhibitor showing promising efficacy against synovial strand for the exonic regions of each gene. Fragments Per Kilobase sarcoma in preclinical experiments (16). of exon per Million mapped reads (FPKM) values were calculated Although strong and specific responses to HDAC inhibition using the robust normalization method of DESeq2, and variance have been consistently observed in synovial sarcoma, the mech- stabilized log fold changes were calculated using the regularized anism of apoptosis induction remains unclear. Advancing under- log transformation of DESeq2 (24). DESeq2 was used to deter- standing of this relationship may lead to improved targeted mine significance values for differential expression between trea- therapy development and improved trial design, as well as aid ted and untreated cells, specifying pairwise comparison of drug in further elucidating the important pathways implicated in effects across cell lines. A significance threshold of 0.01 was synovial sarcoma oncogenesis. In this study, we used next-gen- selected for adjusted P values. Gene enrichment analyses were eration sequencing analyses of six human synovial sarcoma cell performed for gene ontologies using PANTHER with Bonferroni lines to investigate the mechanisms of induced cell-cycle arrest correction (25), and for the MsigDB (molecular signatures data- and cell death in synovial sarcoma following HDAC inhibition by base) v5.2 (26) using the hypergeometric test. quisinostat, a relatively new, orally available HDAC inhibitor that Raw count data for the TCGA sarcoma dataset were obtained was the top hit in a synovial sarcoma drug screen (16). from Genomic Data Commons (https://gdc.cancer.gov/node/ 31). FPKM, log2 fold changes, and significance values were deter- Materials and Methods mined using DESeq2, comparing synovial sarcoma to all other sarcoma types. Cell culture and chemicals The following human synovial sarcoma cell lines were kindly Public microarray studies provided: SYO-1 (ref. 17; Dr. Akira Kawai, National Cancer Centre The gene expression ominibus was surveyed for studies of Hospital, Tokyo, Japan, 2004), FUJI (ref. 18; Dr. Kazuo Naga- HDAC inhibition at lethal doses in cancer cell lines, and five shima, Hokkaido University School of Medicine, Sapporo, Japan, studies on more recent microarray platforms were selected for 2003), YaFuss (19), and HS-SY-II (ref.20; Dr. Marc Ladanyi, comparison [prostatic adenocarcinoma: GSE74418, neuroblas- Memorial Sloan Kettering Cancer Centre, New York, NY, toma: GSE49158, NUT midline carcinoma: GSE18668, ovarian 2014), MoJo (ref. 21; Dr. K. Jones, University of Utah, Salt Lake carcinoma GSE53603, atypical teratoid rhabdoid tumor (AT/RT): City, UT, 2014), and Yamato-SS (ref. 22; Dr. K. Itoh, Osaka GSE37373]. Expression data were downloaded from the pro- Medical Center for Cancer and Cardiovascular Diseases, Japan, cessed data files supplied to Gene Expression Omnibus (GEO; 2013). Sarcoma cell lines were maintained in RPMI1640 medium series matrix files), and differential expression was determined supplemented with 10% FBS (Life Technologies) and the presence using uniform criteria for each study using Limma (27). Gene IDs of a disease-defining SS18-SSX fusion oncogene was confirmed by were mapped to the RNA-seq dataset using the supplied platform RT-PCR analysis. Mycoplasma testing was undertaken every six specifications. Expression data for GEO studies was ranked weeks by RT-PCR analysis and any cell lines found positive were according to log fold change of treatment versus control, and 2 discarded. All cells were grown at 37 C, 95% humidity, and 5% Gene Set Enrichment Analysis (GSEA version 2.2.3) was used to CO2. Pharmacologic compounds were purchased from Selleck gauge the extent of over-representation of significant fold changes Chemicals. from RNA-seq data.

Cell line RNA-seq Western blots Using the RNeasy Mini kit (Qiagen), total RNA was isolated Protein was collected from indicated cell lines grown in 10-cm from six human synovial sarcoma cell lines treated for 16 hours dishes or following 24-hour treatments with indicated com- with the HDAC inhibitor quisinostat at 0.025 mmol/L or with pounds. Samples were separated by 10% SDS-PAGE and vehicle (0.1% DMSO) control. Quality control was performed transferred to polyvinylidene diﬂuoride membranes (Bio-Rad using the Agilent 2100 Bioanalyzer to conﬁrm RNA Integrity Laboratories). Blots were incubated with indicated antibodies: Numbers over 8. Qualifying samples were further prepared using SS18 sc-28698 1:200, GAPDH sc-25778 1:1500, BIK (NBK) the TruSeq stranded mRNA library kit (Illumina) on the Neoprep sc-305625 1:500, BIM sc-374358 1:500, BCL2 sc-492 1:250, Library System (Illumina). Paired-end sequencing was performed p-BCL2 sc-101762 1:250 (Santa Cruz Biotechnology); p16INK4a on a NextSeq 500 sequencer to a read length of 81, with a median ab108349 1:500, p14ARF ab124282 1:500 (Abcam). Signals of 26.3 million reads per sample. Sequence quality metrics were were visualized using the Odyssey Infrared System (LI-COR evaluated using FastQC (http://www.bioinformatics.babraham. Biosciences). ac.uk/projects/fastqc/): across cell line specimens (n ¼ 12), the average quality of sequenced reads at any position was 33.6, and Reverse transcriptase quantitative PCR 90% of base calls were of quality 30 or greater. Alignment statistics Total RNA was isolated from treated samples using the were assessed using Picard tools (http://broadinstitute.github.io/ RNeasy Mini kit (Qiagen) and reverse transcribed to cDNA using picard/): across 12 specimens, the average value of median insert Oligo(dT) (Invitrogen) and SuperScript III (Invitrogen). SYBR size was 226 bp, and the average percentage of high quality Green (Roche) reagent was used for qPCR expression analysis, alignments was 95% (map quality of 20 or greater). Paired reads using an Applied Biosystems ViiA7 qPCR system. All transcript were aligned to the human genome version hg38 (v24) using levels were normalized to GAPDH RNA expression as well as to STAR (23) with default parameter settings. Sequence data have DMSO-treated conditions to calculate relative fold induction of been deposited at the European Genome-phenome Archive (EGA, expression using the comparative Ct (DDCt) method. BIK: sense: http://www.ebi.ac.uk/ega/), which is hosted by the EBI, under AGATGGACGTGAGCCTCAGG antisense: CTAATGTCCTCAG- accession number EGAS00001002637. TCTGGTCGTAG; BIM: sense: GGTCCTCCAGTGGGTATTTCTCTT

www.aacrjournals.org Mol Cancer Ther; 16(12) December 2017 2657

Laporte et al.

antisense: ACTGAGATAGTGGTTGAAGGCCTGG; BMF: sense: minutes with AlexaFluor secondary antibody (Life Technologies). CCCTTGGGGAGCAGCCCCCTG antisense: GCCGATGGAACT- Fluorescence was detected using a Zeiss Axioplan 2 microscope GGTCTGCAA; CDKN2A: sense: CAACGCACCGAATAGTTACGG, at 40. antisense: AACTTCGTCCTCCAGAGTCGC Mice fl/fl Cell viability assays Pten ;hSS2 mice (as previously described in ref. 29) received Cells were seeded in 96-well plates at 1 104 cells/well and a10-mL injection of 42 mmol/L TATCre in the hindlimb at treated in triplicate at indicated doses of the tested compounds. 4 weeks of age, to induce expression of SS18-SSX2. A cohort of 3 IC50 doses were determined in synovial sarcoma cell lines by dose 8 mice with tumor volumes ranging from 600 to 1,500 mm curve studies. Cell viability was assessed in the cell lines as were randomly assigned treatment of quisinostat (2 mg/kg; compared with the vehicle condition (0.1% DMSO) at 48 hours n ¼ 4) or vehicle control (10% hydroxyl-propyl-b-cyclodextrin/ n ¼ posttreatment using MTS reagent (Promega). Cell confluency and 25 mg/mL mannitol/H2O) ( 4). Mice received daily intra- apoptosis induction were assessed over a 48-hour timeframe peritoneal injections and tumor volumes were measured three 3 utilizing the IncuCyte Zoom live cell imaging software (Essen times weekly for 7 days. Tumor volumes (mm )weremeasured BioScience). Apoptosis was assessed using the IncuCyte Kinetic using digital calipers and calculated with the formula (length 2 Caspase-3/7 Apoptosis Assay Reagent (Essen BioScience). width )/2 (30). Mice were monitored daily and tumors monitored at least three times weekly during treatment. Tumors Dichlorofluorescein diacetate assay were excised and RNA was isolated with the RNeasy Mini kit Reactive oxygen species (ROS) levels were assessed by dichlor- (Qiagen) ofluorescein diacetate (DCFDA) assay (Abcam, ab113851). Cells No toxicity was observed in the treatment regimens of these were seeded in a 96-well plate at 1 104 cells/well. The following mice. Mice demonstrating poor mobility, poor feeding/water- day cells were treated with indicated compounds. At 24 hours ing behaviors, or poor interactions with cage mates, suggestive posttreatment, wells were overlayed with 2 diluted DCFDA of ill-health or discomfort, were humanely euthanized. Any reagent, as suggested by the manufacturer's protocol. Fluorescence tumor burden greater than 10% body mass, that impeded was read by microplate reader at Ex/Em ¼ 485/535 nm. A ratio of mobility, feeding, or watering or that caused apparent discom- untreated to treated wells was calculated to determine relative fort, or any ulcerated mass or weight loss of more than 20% response. Wells were normalized to media-only wells to account was also managed by humane euthanasia. Mice were eutha- for background signal. nized by exposure to compressed CO2 followed by a bilateral thoracotomy. This study was carried out in strict accordance with the recommendations in the Guide for the Care and RNA interference Use of Laboratory Animals of the NIH (Bethesda, MD). The Duplex oligo (sense, CAAGAAGCCAGCAGAGGAATT; anti- protocol was approved by the Institutional Animal Care sense, UUCCUCUGCUGGCUUCUUGTT) siRNAs were designed and Use Committee of the University of Utah (permit number: SSX SS18-SSX to target the portion of using the Integrated DNA 14-01016). Technologies RNA interference (RNAi) design tool, and synthe- sized by Integrated DNA Technologies as described previously IHC staining (28). siFOXO1 (sc-35382), siFOXO3 (sc-37887), and siFOXO4 All IHC analysis was performed on 4-mm formalin-fixed par- (sc-29650) were purchased from Santa Cruz Biotechnology. affin-embedded whole sections. Unstained slides were processed siBIK (L-004388-00-0005), siBIM (L-004383-00-0005), and with the Ventana Discovery XT automated system (Ventana siBMF (L-004393-00-0005) were purchased from GE Healthcare Medical Systems), according to the manufacturer's protocol with Dharmacon. siFOXO1 (sc-35382), siFOXO3 (sc-37887), and proprietary reagents. The heat-induced antigen retrieval method siFOXO4 (sc-29650) were purchased from Santa Cruz Biotech- was used in Cell Conditioning solution (CC1-Tris-based EDTA nology. SYO-1 cells were seeded in 6-well plates. At 60% conflu- buffer, pH 8.0; Ventana Medical Systems). Rabbit monoclonal ence, cells were transfected with 30 pmol pooled siRNA and 9 mL Ki-67 (clone SP6, CRM 325 A, Biocare Medical) was used for Lipofectamine RNAiMax transfection reagent (Invitrogen) in primary incubation, for 60 minutes (37C) at a 1:50 dilution. Opti-MEM serum-free media (Life Technologies), according to Biotinylated goat anti-rabbit IgG antibody (BA-1000, Vector the manufacturer's protocol. Protein was harvested at 48 hours Laboratories) was incubated for 32 minutes at 37C. The detec- posttransfection, and knockdown was confirmed by Western blot tion systems used was the DABMap kit (760-124, Ventana Med- (Supplementary Fig. S1). ical Systems).

Immunofluorescence Cells were seeded in culture-treated chamber slides at 3 104 Results cells/well. The following day, wells were treated with indicated HDAC inhibition modulates common transcriptional compounds. Following indicated incubation times, cells were programs across synovial sarcoma cell lines then washed twice with PBS, fixed with methanol at 20C, and Quisinostat significantly decreases cell viability in synovial permeabilized with 0.1% Triton X-100. Wells were blocked with sarcoma cell lines (Supplementary Fig. S2). The complete blocking buffer and incubated overnight at 4C with primary expression profiles from six synovial sarcoma cell lines follow- antibodies at a 1:250 dilution: FOXO1 (sc-374427), FOXO3 ing 16-hour treatment with the HDAC inhibitor quisinostat (sc-11351), FOXO4 (sc-5221), Ac-FOXO1 (sc-49437; Santa Cruz at 25 nmol/L or vehicle control (DMSO) was assembled by Biotechnology), P-FOXO1 (Cell Signaling Technology 9464S). RNA-seq. The time point and dose were selected on the basis of Wells were washed three times with PBST then incubated for 45 previous studies demonstrating these variables to elicit the

2658 Mol Cancer Ther; 16(12) December 2017 Molecular Cancer Therapeutics

HDAC Inhibition in Synovial Sarcoma Cells

Figure 1. HDAC inhibition modulates common transcriptional programs across six synovial sarcoma cell lines. A, Average differential expression significantly changed gene targets in response to HDAC inhibition in six human synovial sarcoma cell lines. B, Summarized gene ontology and significantly enriched targets of up- (red) and downregulated (blue) genes reveal effects of HDAC inhibition in synovial sarcoma. Detailed effects are observed by gene ontology (C) and MSigDB analysis of upregulated targets (D), as well as gene ontology (E), and MSigDB analysis of downregulated targets (F). most significant transcriptional changes (8, 16). To focus neural differentiation were also observed to be upregulated upon on larger transcriptional changes, genes showing significant treatment with quisinostat, including PAX6, SOX2, POU3F1, differential expression in paired comparisons of treatment to POU3F2, POU4F1, and POU4F2 (Fig. 1B and C). control were analyzed, as defined by an adjusted P value of less than 0.01 and a log2 fold change greater than 1, in combination Antigen presentation with expression above the 25th percentile observed in quisino- HDAC inhibition in synovial sarcoma cells was associated stat-treated conditions across a minimum of 4 of the 6 cell lines with upregulation of several components of MHC class I and (Fig. 1A). In this manner, lists of 1,967 upregulated genes and class II antigen presentation, the immunoproteasome component 609 downregulated protein-coding genes were compiled. Anal- PSMB9, and natural killer ligands MICA, MICB, and ULBP1-3 ysis of expression patterns with gene ontology (GO) revealed at (Fig. 1B and C). least six highly enriched categories when using the genes observed to be up- and downregulated. These core effects of Response to ROS HDAC inhibitors in synovial sarcoma are summarized with Upregulation of factors important for response to oxygen- representative genes in Fig. 1B. containing species occurred following HDAC inhibition (Fig. 1B and C), including FOXO1, FOXO4, JAK3, and SESN3. Neural differentiation A number of the highly enriched gene ontology categories relate Polycomb targets to neuron differentiation, including pronounced upregulation of Significant enrichments in the MSigDB dataset included upre- genes encoding a spectrum of synapse components, neurotrans- gulation to targets of polycomb components SUZ12, EZH2, and mitter systems, and BDNF/NGFR/NTRK1 signaling. Expression EED in hESC, which are known to regulate proximal promoters levels of homeodomain transcription factors characteristic of with high CpG content (refs. 31–33; Fig. 1D). Significant overlap

www.aacrjournals.org Mol Cancer Ther; 16(12) December 2017 2659

Laporte et al.

Figure 2. Correlation of expression data from six cancer cell line studies following HDAC inhibitor treatment. A, The expression data from five published individual cancer cell line studies was compared by GSEA to synovial sarcoma cell line data, demonstrating significant correlation in transcription changes following HDAC inhibition. B, The significant differentially expressed gene targets among the six studies were assembled to uncover a core set of transcriptional changes; unsupervised hierarchical clustering was done with GENE-E software. Among at least five studies, common gene targets were assessed to uncover the most significantly increased (C) or decreased (D) biological terms. E, Core transcriptional patterns brought on by HDAC inhibition–induced up- (red) and downregulated (blue) genes were revealed.

with gene targets downregulated with EZH2 depletion was also Transcriptome analysis revealed class effects of HDAC observed (ref. 34; Fig. 1F). inhibition in synovial sarcoma and five additional cancer subtypes Apoptosis induction The derived average transcript expression values from the six The primary therapeutic goal of HDAC inhibition is the synovial sarcoma cell lines were compared to five available HDAC induction of cell death in cancer cells, and is reflected in the inhibitor treatment microarray human cell lines studies: neuro- increased expression of apoptosis genes in the synovial sarco- blastoma (GSE49158), NUT midline carcinoma (GSE18668), ma cell lines treated with 16-hour quisinostat, including atypical teratoid rhabdoid tumor (AT/RT): (GSE37373), prostatic activated inducers CDKN2A (p14ARF), BIK, BCL2L11,andBMF adenocarcinoma (GSE74418), and ovarian carcinoma (Fig. 1B). (GSE53603). Expression profiles in synovial sarcoma correlated significantly with the previous studies as measured by GSEA Cytostasis (Fig. 2A). A common core gene expression set was revealed by A major class effect of HDAC inhibition is the negative comparison analysis of significantly changed genes when com- regulation of proliferation, evident in the downregulation of paring the synovial sarcoma study to the five additional studies; E2F target genes including MCM and PCNA,concomitant 501 genes were upregulated and 678 genes were downregulated in with upregulation of several cyclin-dependent kinase inhibi- at least five studies (Fig. 2B). Gene ontology analysis revealed the tors. Cell-cycle progression GO terms were significantly most significantly increased biological terms included cell devel- decreased with HDAC inhibition (Fig. 1E and F). Expression opment processes, nervous system development and response to of cell-cycle effectors and macromolecule biogenesis globally ROS (Fig. 2C). The most significantly downregulated terms decreased following HDAC inhibition in synovial sarcoma, included cell-cycle progression, macromolecule biogenesis, and further suggesting the cells to be coming out of cycle (Sup- chromatin organization (Fig. 2D). A summary of the core effects plementary Fig. S3). of HDAC inhibition in cancer cell lines is presented in Fig. 2E,

2660 Mol Cancer Ther; 16(12) December 2017 Molecular Cancer Therapeutics

HDAC Inhibition in Synovial Sarcoma Cells

Figure 3. Expression profile characteristic of synovial sarcoma tumor phenotype was reversed by HDAC inhibition. A, Volcano plot demonstrating the differential expression of TCGA primary tumor mRNA sequencing data as compared with the post-HDAC inhibitor cell line data. B, Average expression across the synovial sarcoma TCGA dataset of HDAC inhibition–mediated up- (red), downregulated (blue), and insignificantly changed (gray) genes. C, Gene ontology analysis confirmed core effects of HDAC inhibition in synovial sarcoma. D, The expression profiles of synovial sarcoma microarray tumor samples reveal characteristic repression of cell-cycle regulators and upregulation of antiapoptotic targets, when compared with other sarcoma subtypes liposarcoma (subtype not specified) and leiomyosarcoma. E, This characteristic expression phenotype was reversed following HDAC inhibition in six synovial sarcoma cell lines. F, Expression reversal was specifictosynovialsarcomamostsignificantly with CDKN2A and BIK gene expression when compared with five additional transcriptome studies of HDAC inhibition.

including representative genes involved in nervous system (Fig. 3B). Gene ontology analysis confirmed core effects of development, response to ROS, cytostasis, and developmental HDAC inhibition in synovial sarcoma to include upregulation processes (Fig. 2E). of mesenchymal cell differentiation, nervous system development, response to stress and apoptosis, as well as downregula- HDAC inhibition in cell lines reactivates expression of genes tion of proliferation, macromolecule biogenesis, and transcrip- repressed in synovial sarcoma tumor tissue tion (Fig. 3C). To relate cell line–based findings to the expression profile of To demonstrate the specificity of this expression pattern rever- synovial sarcoma patient tumor tissue, published RNA-seq sal, published primary tumor microarray expression profiles of expression profiles of patient specimens from The Cancer patient specimens from the TCGA were examined in comparison Genome Atlas (TCGA) were examined in comparison with the with additional sarcoma subtypes (liposarcoma and leiomyosar- HDAC inhibitor–treated expression data revealing 1,323 signif- coma). Human synovial sarcoma tumor expression data is char- icantly upregulated and 3,368 significantly downregulated genes acterized by a distinctive repression of several cyclin-dependent (Fig. 3A). In comparing average expression across the (untreated) kinase inhibitors: CDKN2A (p16INK4a, p14ARF), CDKN2B synovial sarcoma TCGA dataset to HDAC inhibition–mediated (p15INK4b), CDKN2D (p19INK4d), CDKN1A (p21CIP1), and tumor changes from the cell line data, it was observed that globally, genes suppressor EGR1, as well as upregulation of cell cycle (CDK6, with low relative expression in the synovial sarcoma tumor data CCND1) and antiapoptotic effectors (BCL2; Fig. 3D). Transcrip- were reactivated in the quisinostat-treated cell line data, while tome analysis in the six synovial sarcoma cell lines comparing many highly expressed targets in the untreated tumor data HDAC inhibitor–treated to vehicle-treated conditions demon- decreased following HDAC inhibition in the cell lines strated a quisinostat-induced reversal of this proliferative

www.aacrjournals.org Mol Cancer Ther; 16(12) December 2017 2661

Laporte et al.

phenotype concomitant with induction of proapoptotic effector An inducible mouse model of synovial sarcoma was treated expression [BIK, BCL2L11 (BIM), BMF, FOXO1, JUN, FOS; Fig. by HDAC inhibition to assess efficacy of apoptosis induction in 3E). Expression reversal was specific to synovial sarcoma most vivo. At 7 days posttreatment, the quisinostat-treated tumors significantly in CDKN2A and BIK when compared with the five had decreased in volume by approximately 40% while vehicle- published transcriptome studies of HDAC inhibition in cell lines treated tumors grew by approximately 30% (Fig. 6G and H). In representing other cancer subtypes (Fig. 3F). comparison with other proapoptotic factors, tumor BIK mRNA levels were found to be significantly higher following treatment HDAC inhibition induces ROS accumulation and activates a than the vehicle-treated group, again resulting in a proapopto- FOXO-mediated proapoptotic program tic shift in the ratio of BCL2:BIK (Fig. 6I). Tumor cell prolif- FOXO-regulated targets involved in apoptotic and cell-cycle eration decreases with quisinostat treatment, as measured by regulation (BIM, BMF, GADD45) were upregulated in the tran- Ki-67 staining (Fig. 6J and K) scriptome data following HDAC inhibition, whereas FOXO-reg- CDKN2A is a known target of SS18-SSX–mediated repression. ulated antioxidant factors (SOD1 and SOD2) were reduced, albeit In depleting the oncoprotein or when treating with quisinostat, a not significantly changed, suggesting a systemic switch toward reactivation of p14ARF and p16INK4A protein was observed, and a apoptosis in response to ROS accumulation (Fig. 4A). The tran- loss of SS18-SSX protein in response to HDAC inhibition was scriptome analysis further revealed an HDAC inhibitor–mediated confirmed (Fig. 6A). CDKN2A depletion attenuated BIK activa- significant increase in FOXO transcription factor levels in the six tion at the RNA (Fig. 6B) and protein levels (Fig. 6C), resulting in a synovial sarcoma cell lines, particularly in FOXO1 (Fig. 4A). decrease in cleaved caspase-3/7 induction following quisinostat On the basis of the observed modulation of factors related to treatment (Fig. 6D), suggesting CDKN2A is necessary for BIK the regulation of the cellular oxidative environment upon quisi- activity in response to HDAC inhibition. nostat treatment, we further investigated ROS levels. This revealed that quisinostat treatment induces ROS accumulation in a dose- dependent manner (Fig. 4B) that can be attenuated by N-acet- Discussion ylcysteine (N-AC) treatment (Fig. 4C). Recovering the ROS accu- Current cytotoxic therapies offer limited benefit against mulation induced by HDAC inhibition with N-AC rescues syno- synovial sarcoma; more targeted therapeutic approaches are vial sarcoma cell lines by approximately 50%, as measured by needed to improve outcome when local control measures are increased cell viability (Fig. 4D). not curative. The synovial sarcoma fusion oncoprotein SS18- Consistent with this observation, FOXO1, FOXO3, and FOXO4 SSX disrupts gene expression in a characteristic manner leading translocate into the nucleus following quisinostat treatment, to a distinctive phenotype. Previous studies have shown HDAC aligning with their activation in response to HDAC inhibition inhibition disrupts the driving complex in synovial sarcoma, (Fig. 4E). Under vehicle-treated conditions FOXO1 exists phos- resulting in reactivated expression of tumor suppressors oth- phorylated (as measured at Thr24) in the cytoplasm (Fig. 4F). erwise repressed by SS18-SSX (4, 16). In this study, we delineate Following knockdown of FOXO1 and FOXO3 transcription fac- the common transcriptional patterns present across studies of tors, the quisinostat-induced activation of proapoptotic factors HDAC inhibition in six cancer subtypes to uncover core class BIM and BMF was significantly attenuated (Fig. 4G), whereas effects, investigate the effects of HDAC inhibition specificto FOXO4 depletion had no observable effect. FOXO knockdown synovial sarcoma and uncover mechanisms of apoptosis induc- rescues HDAC inhibitor–induced apoptosis in synovial sarcoma tion in this cancer type. cell lines, by approximately 50% for FOXO1 (Fig. 4H). Quisinostat treatment was found to bring about mesenchymal and neuronal differentiation transcriptional patterns in six cell HDAC inhibition shifts the ratio of BCL2:BIK and induces line studies of different cancer subtypes as well as to promote apoptosis in synovial sarcoma by mechanisms involving cytostasis and responses to oxidative stress. HDAC inhibition is CDKN2A-mediated apoptosis pathways thought to further counteract the proliferative and antiapoptotic BCL2 levels are known to be elevated in synovial sarcoma phenotype of synovial sarcoma by activating repressed gene tumors resulting in an antiapoptotic phenotype (5). Following targets, such as CDKN2A which, in turn, facilitate expression of HDAC inhibition, mRNA levels of the proapoptotic factor BIK cell-cycle regulators and proapoptotic proteins. ROS accumula- increased by an average of approximately 23-fold, significantly tion in response to HDAC inhibition and proapoptotic protein- more than other proapoptotic factors (Fig. 5A and B). This mediated mitochondrial permeabilization further drives apopto- resulted in a shift in the average ratio of BCL2:BIK from approx- tic pathways. imately 58:1 pretreatment down to almost 1:1 following HDAC Expression of cell-cycle regulator CCND1 (cyclin D1) and inhibitor treatment, favoring apoptosis (Fig. 5C). Cleaved cas- cyclin-dependent kinases CDK4 and CDK6 decreased with the pase-3/7 could be detected at increasing levels with increased upregulation of CDKN2A and CDKN2B in response to quisinostat doses of quisinostat over time, indicating apoptosis was occurring treatment. The cyclin D1/CDK4/CDK6 axis is required for cell- at much higher levels than with standard doxorubicin treatment cycle progression through G1–S phase and is known to be highly assayed in this manner (Fig. 6D). At the protein level, increases in active in synovial sarcoma (35). Under normal conditions, CDK4 BIK and BIM as well as the phosphorylation of BCL2 occurred in a and CDK6 are inhibited by p16INK4A (CDKN2A) and p15INK4B dose-dependent manner with increasing levels of quisinostat (CDKN2B), negatively regulating cell division. Hampering the treatment in synovial sarcoma cell lines (Fig. 5E). Cleaved cas- cyclin D1/CDK4/CDK6 axis by reactivation of CDKN2A and pase-3/7 levels were decreased with the depletion of BIK, BIM, and CDKN2B may therefore contribute to the observed cell-cycle arrest BMF suggesting each was important for apoptosis induction in response to HDAC inhibition. following HDAC inhibition, with the most significant contribu- The CDKN2A locus has been previously shown to be directly tion by BIK (Fig. 5F). repressed by SS18-SSX in synovial sarcoma (4). CDKN2A is

2662 Mol Cancer Ther; 16(12) December 2017 Molecular Cancer Therapeutics

HDAC Inhibition in Synovial Sarcoma Cells

Figure 4. FOXO transcription activation by ROS accumulation initiates proapoptotic gene expression. A, mRNA expression profile following HDAC inhibition demonstrates an increase in FOXO transcription factors, proapoptotic, and cell-cycle regulation factors (BIM, BMF, GADD45), while antioxidant factors were not significantly affected (SOD1 and SOD2). B, HDAC inhibition elicits ROS accumulation at 16 hours posttreatment, which is attenuated by 10 mmol/L N-acetylcysteine (N-AC) treatments (C) and rescues HDAC inhibitor–induced decreases in cell viability in SYO-1 cells (D). E, FOXO proteins enter the nucleus following 0.025 mmol/L quisinostat treatment in SYO-1 cells. F, Under vehicle-treated conditions, p-FOXO1 is in the cytoplasm, and when treated with quisinostat, it becomes translocated to the nucleus. G, Knockdown of FOXO1 and FOXO3 attenuates BIM and BMF activation. H, FOXO1 knockdown rescues HDAC inhibitor–induced apoptosis. Scale bars, 20 mm. Statistical significance compared with vehicle treatment controls was determined by Student t test: , P < 0.05; , P < 0.01; , P < 0.001. Error bars, SEM from conditions performed in triplicate.

www.aacrjournals.org Mol Cancer Ther; 16(12) December 2017 2663

Laporte et al.

Figure 5. HDAC inhibition shifts the BCL2:BIK ratio and induces apoptosis in synovial sarcoma. Differential expression profile (A) of apoptosis regulators following HDAC inhibition demonstrates an increase in proapoptotic factor BIK expression (B) by approximately 23-fold. C, BCL2/BIK is decreased following quisinostat treatment. D, Cleaved caspase-3/7 levels increase with quisinostat, significantly more so than doxorubicin in SYO-1 cells. E, BIK and BIM levels increase in a dose-dependent manner with increasing quisinostat in SYO-1 cells at 16 hours posttreatment, quantified by densitometric measurements relative to GAPDH loading control using ImageJ software. F, Cleaved caspase-3/7 levels decrease with depletion of BIK, BIM,andBMF.G, Tumors excised from Ptenfl/fl;hSS2 mouse model of synovial sarcoma treated with quisinostat for 7 days. H, Quisinostat-treated tumors shrunk by approximately 40%, while vehicle-treated tumors grew by approximately 30%. I, mRNA expression analysis demonstrated a significant increase in BIK levels in the quisinostat treatment group when compared with the vehicle-treated tumors. J, Ki-67 staining by IHC was stronger in the vehicle-treated mouse tumors than the quisinostat-treated tumors; staining score was quantified in K. Scale bars in G represent 1 cm, and in J represent 100 mm. Statistical significance compared with vehicle treatment controls was determined by Student t test. , P < 0.01; , P < 0.001. Error bars, SEM from conditions performed in triplicate.

2664 Mol Cancer Ther; 16(12) December 2017 Molecular Cancer Therapeutics

HDAC Inhibition in Synovial Sarcoma Cells

Figure 6. HDAC inhibition–induced apoptosis in synovial sarcoma involves CDKN2A-mediated mechanisms. A, p14ARF and p16INK4A are reactivated following SS18-SSX depletion and quisinostat treatment in SYO-1 cells. SS18-SSX protein level decreases following HDAC inhibition. Depletion of CDKN2A attenuates BIK activation at the RNA (B) and protein level (C) and inhibits cleaved caspase-3/7 induction (D) in response to HDAC inhibition in SYO-1 cells. normally regulated by polycomb group proteins, repressing its sensors that become modified posttranslationally in response expression in the recruitment of EZH2 (36), and is activated by to oxidative stress (41). FOXOs are negatively regulated by SWI/SNF-mediated polycomb eviction (37). In this study, we PI3K/AKT signaling (42) and translocate to the nucleus when validate the reactivation of CDKN2A-encoded proteins p16INK4A activated by ROS accumulation where they can initiate tran- and p14ARF in response to SS18-SSX knockdown and HDAC scription of antioxidant effectors such as superoxide dismutase inhibition, and demonstrate an epistatic relationship between 2 (SOD2) to promote survival (41). FOXO transcription factors CDKN2A expression and BIK activation in synovial sarcoma. The are also important in initiating expression of proapoptotic transcriptome data reveal proapoptotic factor BIK activation to be effectors in response to ROS (42). As described herein, the significant in all studied synovial sarcoma cell lines following induced FOXO program favors expression of proapoptotic HDAC inhibition. BIK has been shown in previous studies to factors BIM and BMF and is important for apoptotic induction be inhibited by BCL2, and when activated to function in in response to quisinostat. PTEN-mediated repression of the initiating the mitochondrial apoptosis pathway (38). p14ARF PI3K/AKT pathway is important for FOXO activation (42), has been observed to increase BIK levels by inhibition of which may be promoted in synovial sarcoma by reactivation transcriptional repressor CtBP (39) as well as to activate p53 of repressed EGR1 in response to HDAC inhibition (8, 28). by inhibiting MDM2, inducing mitochondrial-mediated PTEN deficiency in synovial sarcoma has further been shown to apoptosis (40). HDAC inhibition may therefore impede promote tumor angiogenesis and metastasis (43). SS18-SSX–mediated repression of the CDKN2A locus, allowing In synovial sarcoma, HDAC inhibition acts at multiple sites for reactivation of normal cell-cycle regulation and induction of resulting in blocked cell-cycle progression, ROS accumulation, proapoptotic pathways. and initiation of proapoptotic programs regulated by FOXO In this study, we further find that ROS accumulation sec- transcription factors. Through HDAC-mediated reactivation of ondary to HDAC inhibition results in an initiation of FOXO repressed CDKN2A, proapoptotic factors are able to counteract transcriptionfactoractivationinsynovialsarcoma.FOXOclass elevated BCL2 levels. Quisinostat also increases antigen pre- forkhead transcription factors are known to act as cellular redox sentation pathways, which may have implications for immune-

www.aacrjournals.org Mol Cancer Ther; 16(12) December 2017 2665

Laporte et al.

oncology approaches in a tumor type that characteristically Analysis and interpretation of data (e.g., statistical analysis, biostatistics, lacks an immunogenic phenotype. Our study provides mech- computational analysis): A.N. Laporte, N.M. Poulin, A. Lorzadeh anistic support for the use of HDAC inhibitors in the treatment Writing, review and/or revision of the manuscript: A.N. Laporte, N.M. Poulin, J.J. Barrott, T.M. Underhill, T.O. Nielsen of synovial sarcoma. While single-agent studies of HDAC Administrative, technical, or material support: A.N. Laporte, N.M. Poulin, inhibition in solid tumors have yielded mixed results, combi- A. Lorzadeh natorial drug protocols are the subject of active investigation Study supervision: T.O. Nielsen (44). Rational drug combinations incorporating HDAC inhibitors may enhance tumor penetration and synergistically affect Acknowledgments multiple pathways leading to apoptosis (45). In synovial sar- The authors would like to thank Angela Goytain for technical assistance and coma, low-dose combinations of HDAC and proteasome inhi- Drs. Martin Hirst, Gregg Morin, Chris Hughes, and Bertha Brodin for helpful fi bitors are particularly ef cacious in reactivating proapoptotic discussion. factors, inducing apoptosis and decreasing tumor burden in vivo This work was supported by grants from the Canadian Cancer Society (16). As shown here at the transcriptomic level, HDAC inhi- Research Institute (grant no. 701582; to T.O. Nielsen and T.M. Underhill), bition specifically reverses the proliferative and antiapoptotic the Terry Fox Research Institute (TFF 105265 New Frontiers in Cancer; phenotype brought about by SS18-SSX. to T.M. Underhill and T.O. Nielsen), the Liddy Shriver Sarcoma Initiative (to T.O. Nielsen and K.B. Jones), and the Sarcoma Cancer Foundation fl of Canada (Beth England's Sarcoma Research Fund; to T.O. Nielsen and Disclosure of Potential Con icts of Interest K.B. Jones). No potential conflicts of interest were disclosed.

Authors' Contributions The costs of publication of this article were defrayed in part by the Conception and design: A.N. Laporte, N.M. Poulin, T.M. Underhill, payment of page charges. This article must therefore be hereby marked advertisement T.O. Nielsen in accordance with 18 U.S.C. Section 1734 solely to indicate Development of methodology: A.N. Laporte, N.M. Poulin, K.B. Jones, this fact. T.M. Underhill, T.O. Nielsen Acquisition of data (provided animals, acquired and managed patients, Received May 3, 2017; revised August 28, 2017; accepted August 31, 2017; provided facilities, etc.): A.N. Laporte, J.J. Barrott, X.Q. Wang, R. Vander Werff published OnlineFirst September 6, 2017.

References 1. Okcu MF, Despa S, Choroszy M, Berrak SG, Cangir A, Jaffe N, et al. Synovial 12. Marks PA, Richon VM, Rifkind RA. Histone deacetylase inhibitors: inducers sarcoma in children and adolescents: thirty three years of experience with of differentiation or apoptosis of transformed cells. J Natl Cancer Inst multimodal therapy. Med Pediatr Oncol 2001;37:90–6. 2000;92:1210–6. 2. Sandberg AA, Bridge JA. Updates on the cytogenetics and molecular 13. Bolden JE, Peart MJ, Johnstone RW. Anticancer activities of histone dea- genetics of bone and soft tissue tumors. Synovial sarcoma. Cancer Genet cetylase inhibitors. Nat Rev Drug Discov 2006;5:769–84. Cytogenet 2002;133:1–23. 14. West AC, Johnstone RW. New and emerging HDAC inhibitors for cancer 3. Kadoch C, Crabtree GR. Reversible disruption of mSWI/SNF (BAF) com- treatment. J Clin Invest 2014;124:30–9. plexes by the SS18-SSX oncogenic fusion in synovial sarcoma. Cell 15. Arts J, King P, Marien A, Floren W, Belien A, Janssen L, et al. JNJ-26481585, a 2013;153:71–85. novel "second-generation" oral histone deacetylase inhibitor, shows 4. Su L, Sampaio AV, Jones KB, Pacheco M, Goytain A, Lin S, et al. Decon- broad-spectrum preclinical antitumoral activity. Clin Cancer Res 2009; struction of the SS18-SSX fusion oncoprotein complex: insights into 15:6841–51. disease etiology and therapeutics. Cancer Cell 2012;21:333–47. 16. Laporte AN, Barrott JJ, Yao RJ, Poulin NM, Brodin BA, Jones KB, et al. HDAC 5. Hirakawa N, Naka T, Yamamoto I, Fukuda T, Tsuneyoshi M. Overexpres- and proteasome inhibitors synergize to activate pro-apoptotic factors in sion of bcl-2 protein in synovial sarcoma: a comparative study of other soft synovial sarcoma. PLoS One 2017;12:e0169407. tissue spindle cell sarcomas and an additional analysis by fluorescence in 17. Kawai A, Naito N, Yoshida A, Morimoto Y, Ouchida M, Shimizu K, et al. situ hybridization. Hum Pathol 1996;27:1060–5. Establishment and characterization of a biphasic synovial sarcoma cell 6. Brennan B, Stiller C, Grimer R, Dennis N, Broggio J, Francis M. Outcome line, SYO-1. Cancer Lett 2004;204:105–13. and the effect of age and socioeconomic status in 1318 patients with 18. Nojima T, Wang YS, Abe S, Matsuno T, Yamawaki S, Nagashima K. synovial sarcoma in the English National Cancer Registry: 1985-2009. Clin Morphological and cytogenetic studies of a human synovial sarcoma Sarcoma Res 2016;6:18. xenotransplanted into nude mice. Acta Pathol Jpn 1990;40:486–93. 7. Laporte AN, Ji JX, Ma L, Nielsen TO, Brodin BA. Identification of cytotoxic 19. Ishibe T, Nakayama T, Okamoto T, Aoyama T, Nishijo K, Shibata KR, et al. agents disrupting synovial sarcoma oncoprotein interactions by proximity Disruption of fibroblast growth factor signal pathway inhibits the growth ligation assay. Oncotarget 2016;7:34384–94. of synovial sarcomas: potential application of signal inhibitors to molec- 8. Su L, Cheng H, Sampaio AV, Nielsen TO, Underhill TM. EGR1 reactivation ular target therapy. Clin Cancer Res 2005;11:2702–12. by histone deacetylase inhibitors promotes synovial sarcoma cell death 20. Sonobe H, Manabe Y, Furihata M, Iwata J, Oka T, Ohtsuki Y, et al. through the PTEN tumor suppressor. Oncogene 2010;29:4352–61. Establishment and characterization of a new human synovial sarcoma 9. Chu QS, Nielsen TO, Alcindor T, Gupta A, Endo M, Goytain A, et al. A phase cell line, HS-SY-II. Lab Invest 1992;67:498–505. II study of SB939, a novel pan-histone deacetylase inhibitor, in patients 21. Jones KB, Barrott JJ, Xie M, Haldar M, Jin H, Zhu JF, et al. The impact of with translocation-associated recurrent/metastatic sarcomas-NCIC-CTG chromosomal translocation locus and fusion oncogene coding sequence in IND 200dagger. Ann Oncol 2015;26:973–81. synovial sarcomagenesis. Oncogene 2016;35:5021–32. 10. Kim YB, Ki SW, Yoshida M, Horinouchi S. Mechanism of cell cycle arrest 22. Naka N, Takenaka S, Araki N, Miwa T, Hashimoto N, Yoshioka K, et al. caused by histone deacetylase inhibitors in human carcinoma cells. Synovial sarcoma is a stem cell malignancy. Stem Cells 2010;28:1119–31. J Antibiot 2000;53:1191–200. 23. Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, et al. Differential 11. Li XN, Shu Q, Su JM, Perlaky L, Blaney SM, Lau CC. Valproic acid induces gene and transcript expression analysis of RNA-seq experiments with growth arrest, apoptosis, and senescence in medulloblastomas by increas- TopHat and Cufflinks. Nat Protoc 2012;7:562–78. ing histone hyperacetylation and regulating expression of p21Cip1, CDK4, 24. Love MI, Huber W, Anders S. Moderated estimation of fold change and and CMYC. Mol Cancer Ther 2005;4:1912–22. dispersion for RNA-seq data with DESeq2. Genome Biol 2014;15:550.

2666 Mol Cancer Ther; 16(12) December 2017 Molecular Cancer Therapeutics

HDAC Inhibition in Synovial Sarcoma Cells

25. Mi H, Muruganujan A, Casagrande JT, Thomas PD. Large-scale gene palbociclib as a potential treatment for synovial sarcoma patients. Ann function analysis with the PANTHER classification system. Nat Protoc Surg Oncol 2016;23:2745–52. 2013;8:1551–66. 36. Bracken AP, Kleine-Kohlbrecher D, Dietrich N, Pasini D, Gargiulo G, 26. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Beekman C, et al. The Polycomb group proteins bind throughout the et al. Gene set enrichment analysis: a knowledge-based approach for INK4A-ARF locus and are disassociated in senescent cells. Genes Dev interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 2007;21:525–30. 2005;102:15545–50. 37. Kia SK, Gorski MM, Giannakopoulos S, Verrijzer CP. SWI/SNF mediates 27. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers polycomb eviction and epigenetic reprogramming of the INK4b-ARF- differential expression analyses for RNA-sequencing and microarray stud- INK4a locus. Mol Cell Biol 2008;28:3457–64. ies. Nucleic Acids Res 2015;43:e47. 38. Chinnadurai G, Vijayalingam S, Rashmi R. BIK, the founding member of 28. Lubieniecka JM, de Bruijn DR, Su L, van Dijk AH, Subramanian S, van de the BH3-only family proteins: mechanisms of cell death and role in cancer Rijn M, et al. Histone deacetylase inhibitors reverse SS18-SSX-mediated and pathogenic processes. Oncogene 2008;27:S20–9. polycomb silencing of the tumor suppressor early growth response 1 in 39. Kovi RC, Paliwal S, Pande S, Grossman SR. An ARF/CtBP2 complex synovial sarcoma. Cancer Res 2008;68:4303–10. regulates BH3-only gene expression and p53-independent apoptosis. Cell 29. Haldar M, Hancock JD, Coffin CM, Lessnick SL, Capecchi MR. A condi- Death Differ 2010;17:513–21. tional mouse model of synovial sarcoma: insights into a myogenic origin. 40. Muer A, Overkamp T, Gillissen B, Richter A, Pretzsch T, Milojkovic A, et al. Cancer Cell 2007;11:375–88. p14(ARF)-induced apoptosis in p53 protein-deficient cells is mediated 30. Faustino-Rocha A, Oliveira PA, Pinho-Oliveira J, Teixeira-Guedes C, by BH3-only protein-independent derepression of Bak protein through Soares-Maia R, da Costa RG, et al. Estimation of rat mammary tumor down-regulation of Mcl-1 and Bcl-xL proteins. J Biol Chem 2012;287: volume using caliper and ultrasonography measurements. Lab Anim 17343–52. 2013;42:217–24. 41. Klotz LO, Sanchez-Ramos C, Prieto-Arroyo I, Urbanek P, Steinbrenner H, 31. Meissner A, Mikkelsen TS, Gu H, Wernig M, Hanna J, Sivachenko A, et al. Monsalve M. Redox regulation of FoxO transcription factors. Redox Biol Genome-scale DNA methylation maps of pluripotent and differentiated 2015;6:51–72. cells. Nature 2008;454:766–70. 42. Luo H, Yang Y, Duan J, Wu P, Jiang Q, Xu C. PTEN-regulated AKT/FoxO3a/ 32. Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A, et al. An Bim signaling contributes to reactive oxygen species-mediated apoptosis in embryonic stem cell-like gene expression signature in poorly differentiated selenite-treated colorectal cancer cells. Cell Death Dis 2013;4:e481. aggressive human tumors. Nat Genet 2008;40:499–507. 43. Barrott JJ, Kafchinski LA, Jin H, Potter JW, Kannan SD, Kennedy R, et al. 33. Mikkelsen TS, Ku M, Jaffe DB, Issac B, Lieberman E, Giannoukos G, et al. Modeling synovial sarcoma metastasis in the mouse: PI3'-lipid signaling Genome-wide maps of chromatin state in pluripotent and lineage-com- and inflammation. J Exp Med 2016;213:2989–3005. mitted cells. Nature 2007;448:553–60. 44. Slingerland M, Guchelaar HJ, Gelderblom H. Histone deacetylase inhibi- 34. Nuytten M, Beke L, Van Eynde A, Ceulemans H, Beullens M, Van Hum- tors: an overview of the clinical studies in solid tumors. Anticancer Drugs melen P, et al. The transcriptional repressor NIPP1 is an essential player in 2014;25:140–9. EZH2-mediated gene silencing. Oncogene 2008;27:1449–60. 45. Thurn KT, Thomas S, Moore A, Munster PN. Rational therapeutic combi- 35. Vlenterie M, Hillebrandt-Roeffen MH, Schaars EW, Flucke UE, Fleuren ED, nations with histone deacetylase inhibitors for the treatment of cancer. Navis AC, et al. Targeting cyclin-dependent kinases in synovial sarcoma: Future Oncol 2011;7:263–83.

www.aacrjournals.org Mol Cancer Ther; 16(12) December 2017 2667

Death by HDAC Inhibition in Synovial Sarcoma Cells

Aimée N. Laporte, Neal M. Poulin, Jared J. Barrott, et al.

Mol Cancer Ther 2017;16:2656-2667. Published OnlineFirst September 6, 2017.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-17-0397

Supplementary Access the most recent supplemental material at: Material http://mct.aacrjournals.org/content/suppl/2017/09/06/1535-7163.MCT-17-0397.DC1

Cited articles This article cites 45 articles, 9 of which you can access for free at: http://mct.aacrjournals.org/content/16/12/2656.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://mct.aacrjournals.org/content/16/12/2656.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/16/12/2656. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.

Death by HDAC Inhibition in Synovial Sarcoma Cells Aimee N

Death by HDAC Inhibition in Synovial Sarcoma Cells Aimee N