The Role of Substance P in Opioid Induced Reward

Home , Biphalin, Lanepitant, Nociception assay, Substance P

Item Type text; Electronic Dissertation

Authors Sandweiss, Alexander Jordan

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.

Download date 02/10/2021 14:53:26

Link to Item http://hdl.handle.net/10150/621568

THE ROLE OF SUBSTANCE P IN OPIOID INDUCED REWARD

Alexander J. Sandweiss

A Dissertation Submitted to the Faculty of the

DEPARTMENT OF PHARMACOLOGY

In Partial Fulfillment of the Requirements

For the Degree of

DOCTOR OF PHILOSOPHY

In the Graduate College

THE UNIVERSITY OF ARIZONA

2016

THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE

As members of the Dissertation Committee, we certify that we have read the dissertation prepared by Alexander J. Sandweiss, titled The Role of Substance P in Opioid Induced Reward and recommend that it be accepted as fulfilling the dissertation requirement for the Degree of Doctor of Philosophy.

______Date: June 13, 2016 Edward D. French, Ph.D.

______Date: June 13, 2016 Rajesh Khanna, Ph.D.

______Date: June 13, 2016 Victor H. Hruby, Ph.D.

______Date: June 13, 2016 Naomi Rance, M.D., Ph.D.

______Date: June 13, 2016 Todd W. Vanderah, Ph.D.

Final approval and acceptance of this dissertation is contingent upon the candidate’s submission of the final copies of the dissertation to the Graduate College.

I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement.

______Date: June 13, 2016 Dissertation Director: Todd W. Vanderah, Ph.D.

STATEMENT BY AUTHOR

This dissertation has been submitted in partial fulfillment of the requirements for an advanced degree at the University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.

Brief quotations from this dissertation are allowable without special permission, provided that an accurate acknowledgement of the source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the head of the major department or the Dean of the Graduate College when in his or her judgment the proposed use of the material is in the interests of scholarship. In all other instances, however, permission must be obtained from the author.

SIGNED: Alexander J. Sandweiss

ACKNOWLEDGEMENTS

The following text would not exist without the support of many individuals.

First, Dr. Todd Vanderah, who offered me a position in the lab as an undergraduate while I attempted to figure things out about life and my future. On the same track as every other premed, I joined the lab to help myself get into medical school-- and maybe learn a few things along the way. It didn’t take long while working in this lab before I switched gears and deeply considered a career as a Ph.D. The science was fascinating. The process of asking the right questions and knowing how to answer them was intriguing. Watching the critical thinking unfold in others was awe-inspiring. All the cool stuff in the lab had this nerd hooked: I was going to be a scientist. But the prospect of not seeing patients and having a direct influence in their care bothered me. This naïve undergrad pondered how one could combine two careers into one. Dr. Vanderah lent a great deal of effort and time to help me reach my goals, starting with acceptance into medical school via the MD/Ph.D. program. It was easy to see why every single student in medical school likes Dr. Vanderah. He is inviting. He loves to teach, and he loves seeing the “ah-ha!” moment. He is non-judgmental.

And he knows the brain! I hope one day, in my future career as a physician- scientist, professor, and mentor, I can be half as well-respected as Dr. Vanderah.

This text likewise would not exist if it weren’t for Dr. Tally Largent-Milnes.

As an undergrad, I contacted her (then Tally) and asked if she could help me find a lab to join, since she was my sister’s college roommate and good friend (now

great family friend). She had me in the lab by the end of the week and told me about these great peptides she was characterizing to inhibit pain. I asked “what the heck is a peptide?” She has seen me grow into the medical student and

Ph.D. student I have become, and I have seen her grow into the magnificent scientist and mentor she has become. Thank you Tally; I wouldn’t be in the extremely lucky position I’m in without you.

The members of my committee, Dr. Naomi Rance, Dr. Raj Khanna, Dr. Ed

French, and Dr. Victor Hruby, have been extraordinarily helpful along the way.

They have all provided great wisdom, sometimes scientific, sometimes philosophical. I have realized how important BOTH are to the success of a Ph.D. and M.D. After all, it’s called a ‘Doctor of Philosophy’ for a reason.

The M.D./Ph.D. program director, Dr. Kenneth Ramos, has been instrumental in my success as well. He has asked extremely pertinent question regarding my project, helped with my NIH grant application, and has done a superb job reinvigorating the program here at the University of Arizona.

The following text describes one of four major projects I spent much of my time participating in during my Ph.D. The other three major projects I worked on relate to migraine, conducting a clinical pilot study, and traumatic brain injury.

The migraine project has come a long way; it was my first project in the lab as an undergraduate working with the now Dr. David Skinner. In addition, the TBI project was a very relevant/exciting project that I knew I wanted to be a part of to gain additional experience in the neurosciences, learn new scientific techniques,

and begin the networking process with those on the other side: the physicians.

Dr. Bellal Joseph and Dr. Kareem Ibraheem have helped in my development into a physician-scientist more than they probably know. The pilot clinical study is related to my thesis written here. It would have fit nicely into this manuscript, but just as clinical research has gone for decades, we haven’t been able to recruit enough patients just yet. This is a critical skill I have learned from Dr. Kai

Schoenage in the Department of Anesthesiology; a necessary component of my training as a physician-scientist that I would not have otherwise received. Thank you to each of you.

I would like to acknowledge all of the other students in the Vanderah lab, past and present, graduate, undergraduate, and medical students. Dr. Kat

Hanlon, Dr. Alysia Ondoua, Dr. Ashley Simons, Dr. Lauren Slosky, Warren

Wang, Shaness Grenald, Karissa Cottier and Hong Zhang, all who will make excellent scientists as they complete their degrees. Dr. Aswini Giri has been a great friend and colleague to have in the chemistry department. The first undergraduate to help me on my project was Martin Faridian. He is now finishing up pharmacy school and will make an outstanding pharmacist. Likewise, Jackie

Hu and Saul Ortega are finishing up their pharmacy degrees and Josh Stark provided vital assistance. Dr. Alex Podolsky is on his way to becoming an excellent neurologist at the prestigious University of Michigan. Mary McIntosh has been the most helpful undergraduate student to grace a lab. Her tireless

work ethic and devotion to doing good for the world will make her an outstanding doctor one day.

Of course I wouldn’t have gotten through this phase in my life without my family. My mom, dad, Rebecca, Joshy-poo (supplied the Fruigees), Howie, and the lovely Dr. Dana McKee have pushed me and supported me along the way.

Fruigees will be a household name soon and Dana will make an awesome

Ob/Gyn, delivering babies tirelessly for the next 4 years.

DEDICATION

This manuscript is dedicated to my grandparents. My late grandmother

Jan Hyman was one of the kindest people I ever knew. She has a lasting impression on me with her gratitude, selflessness, and warm personality. She cared so much about her grandchildren and the future they would have. She died in 2005 when I was sixteen. The last thing she said to me--while on high dose morphine-- was “your skin hasn’t cleared up yet!” It’s cleared up now grandma, I promise.

My grandpa Ed couldn’t wait until I was 13 so he could take his first son/grandson to the shooting range to teach me how to aim and shoot a 0.22.

I’ve had my sights on the target ever since.

My dad’s dad died before I had the chance to meet him but I’m told I get many of my superficial traits including my left-handedness and musicality from him. That was very right of him.

My Bubbe is a super-grandma. She has so many grandchildren and now great grandchildren I don’t know how she keeps up with all of it. She’s constantly calling her children, grandchildren, and greatgrandchildren to hear what’s up.

She suffers from a painful hip, one of the things that drives me in this field.

TABLE OF CONTENTS

LIST OF FIGURES……………………………………………………………..…...... 12

LIST OF TABLES……………………………………………………………………..15

ABSTRACT………………………………………………………………...…….……16

LIST OF ABBREVIATIONS………………………………………………..………...18

CHAPTER 1: INTRODUCTION……………………………………...…….………..20

1.1 PAIN……………..……………………………………………...…...... ………..20

A. PAIN ANATOMY AND NEUROTRANSMISSION………………..…...... 21

B. NEUROKININS…………………………………………….……….….………28

NEUROKININ PHARMACOLOGY…………………………………….28

NEUROKININS IN THE NOCICEPTIVE CIRCUIT………….……….31

NEUROKININ REMODELLING IN CHRONIC PAIN………………..36

NEUROKININ ANTAGONISTS AS ANALGESICS...……….…...... 40

C. OPIATE MEDIATED ANALGESIA...... ……………………...... …..…...... 43

GREAT SUCCESS, SOME FAILURE…………..……….....……...... 45

OPIATE INDUCED REMODELLING……………………....…...... 46

MAJOR SIDE EFFECTS…………………………….….....…………..48

1.2 ADDICTION………………………………………………………...... ………48

A. REWARD NEUROTRANSMISSION…………………………………...... 49

THE OPIOID EPIDEMIC……………………………………..…………52

NEUROKININS IN THE REWARD PATHWAY…………..….………55

B. A NOVEL STRATEGY TO COMBAT THE OPIOID EPIDEMIC….……..65

CHAPTER 2: MATERIALS AND METHODS……………………………...... 70

2.1 ANIMALS…….……………………………………………………………..……70

2.2 SURGICAL TECHNIQUES…………………….………………………...…….70

2.3 NK1R KO CRISPR DESIGN…………………………………………………...72

2.4 INJECTION TECHNIQUES……………….……………………………………74

2.5 in vivo PRECLINICAL ASSAYS……………………………………………...77

2.6 STATISTICAL ANALYSIS……………….…………………………….………84

CHAPTER 3: SUBSTANCE P IN THE VTA…………..…………………...... 85

3.1 MORPHINE INCREASES SP RELEASE VIA GABA DISINHIBITION..….85

3.2 NK1 RECEPTOR KNOCKOUTS IN THE VTA LACK CPP TO MORPHINE.102

CHAPTER 4: TY032 INHIBITS NOCICEPTION IN ANIMALS MODELS OF PAIN..108

4.1 ACUTE NOCICEPTION…….…………………….…………..………………...108

A. MOUSE TAIL FLICK ASSAY……………………...…………….……..108

B. RAT HARGREAVES ASSAY……….…………………..…….………..114

4.2 NEUROPATHIC PAIN……………………………………….………………….118

A. THERMAL HYPERALGESIA………………………………………………118

B. MECHANICAL ALLODYNIA………………………………………………118

4.3 MOTOR IMPAIRMENT………………………………………………………….119

CHAPTER 5: TY032 IS NOT ADDICTIVE………………………………………..125

5.1 TY032 DOES NOT INCREASE DOPAMINE RELEASE……….…………..125

5.2 ANIMALS DO NOT SEEK TY032 AFTER CPP PARADIGM….…………..125

CHAPTER 6: DISCUSSION………………………………………….…………….129

APPENDIX: PUBLICATIONS…………………………...…………………………143

REFERENCES……………………………………………………………………….210

LIST OF FIGURES

FIGURE 1.1: NEUROKININ SIGNALING IN THE REWARD PATHWAY……...68

FIGURE 1.2: SCHEMATIC OF VTA NEURONAL SIGNALING IN THE

REWARD PATHWAY…………………………………………………………………69

FIGURE 2.1: CRISPR gRNA DESIGN AND SEQUENCE…………………...... 76

FIGURE 3.1: ILLUSTRATION OF VTA MICRODIALYSIS PROTOCOL…...... 87

FIGURE 3.2: SYSTEMIC MORPHINE ACUTELY INCREASES SP RELEASE IN

THE VTA……………………………………………………………………….……….88

FIGURE 3.3: BICUCULLINE INFUSION INTO THE VTA INCREASES SP

RELEASE IN THE VTA……………………………………………………………….90

FIGURE 3.4: REPRESENTATIVE VTA MICRODIALYSIS PROBE

VERIFICATION…………………………………………………………………….….92

FIGURE 3.5: ILLUSTRATION OF VTA MICROINJECTION AND NAc

MICRODIALYSIS……………………………………………………………………...95

FIGURE 3.6: INTRA-VTA ADMINISTRATION OF MORPHINE OR SP

INCREASES DOPAMINE RELEASE IN THE NAc……………………………….96

FIGURE 3.7: NK1R ANTAGONIST PREVENTS SP INDUCED DOPAMINE

RELEASE……………………………………………………………………………....98

FIGURE 3.8: NK1R ANTAGONIST PREVENTS MORPHINE INDUCED

DOPAMINE RELEASE……………………………………………………………...100

FIGURE 3.9: REPRESENTATIVE VTA MICROINJECTOR AND NAc

MICRODIALYSIS PROBE VERIFICATION…………………………………..…..101

FIGURE 3.10: ILLUSTRATION OF CRISPR ACTING ON NK1R GENE….…..103

FIGURE 3.11: CRISPR MEDIATED KO OF NK1R IN VTA INHIBITS CPP TO

MORPHINE………………………………………………………………………...…104

FIGURE 3.12: CRISPR MEDIATED KO OF NK1R IN VTA DOES NOT AFFECT

FEEDING IN RATS…………………………………………………………………..105

FIGURE 3.13: CRISPR MEDIATED KO OF NK1R IN VTA REDUCES NK1R

DENSITY IN VTA…………………………………………………………………….106

FIGURE 4.1: AKG-177 DOES NOT SAFELY PROVIDE SIGNIFICANT

ANTINOCICEPTION IN A DOSE DEPENDENT MANOR…………………...... 111

FIGURE 4.2: AKG-CRA-137 DOES NOT SAFELY PROVIDE SIGNIFICANT

ANTINOCICEPTION IN A DOSE DEPENDENT MANOR………………………112

FIGURE 4.3: TY032 PROVIDES SIGNIFICANT ANTINOCICEPTION IN MOUSE

TAILFLICK ASSAY, PARTIALLY BLOCKED BY NALOXONE…….…………113

FIGURE 4.4: TY032 PREVENTS INTRATHECAL SP INDUCED FLINCHING

AND BITING BEHAVIORS, PARTIALLY BLOCKED BY NALOXONE………115

FIGURE 4.5: PERIPHERALLY ADMINISTERED TY032 PROVIDES

SIGNIFICANT ANTINOCICEPTION IN HARGREAVES THERMAL ASSAY...116

FIGURE 4.6: INTRATHECAL TY032 PROVIDES DOSE DEPENDENT

ANTIHYPERAGESIA IN RAT MODEL OF NEUROPATHIC PAIN……………120

FIGURE 4.7: INTRATHECAL TY032 PROVIDES DOSE DEPENDENT

ANTIALLODYNIA IN RAT MODEL OF NEUROPATHIC PAIN……….……….122

FIGURE 4.8: INTRATHECAL TY032 DOES NOT PRODUCE MOTOR

IMPAIRMENT………………………………………………………………………...124

FIGURE 5.1: TY032 DOES NOT POSSESS THE POTENTIAL FOR ABUSE.....127

LIST OF TABLES

NO TABLES TO REPORT

ABSTRACT

Chronic pain affects approximately 100 million Americans. Opioids are the mainstay therapy for the treatment of chronic pain. While physicians and patients alike are apprehensive about using opioids due to their side effects including respiratory depression and addiction, 259 million opioid prescriptions were written in 2012. Although opioids are the most efficacious available analgesics, they increase both positive and negative reinforcement, ultimately leading to addiction. The pro-nociceptive neurotransmitter, Substance P (SP) and its corresponding receptor (NK1R), are not only found on pain pathways to promote pain but also found in the ventral tegmental area associated with dopamine neurons. Studies have shown that Substance P can potentiate positive reinforcement of opiates and may play a role in opioid reward. Here using in vivo microdialysis, we show that systemic morphine significantly increases SP release in the VTA, an effect mediated by ventral midbrain GABAergic neurons.

Substance P administered to the VTA results in a significant increase in dopamine release in the nucleus accumbens (NAc). Using CRISPR-Cas9 knockdown of NK1R in the VTA we prevent the induction of opiate reward as tested using a conditioned place preference paradigm (CPP). Finally, we developed a novel opioid agonist/NK1R antagonist bifunctional compound,

TY032, which inhibits acute and chronic pain in male rats. Importantly, TY032 microinjection into the VTA did not increase extracellular dopamine release in the

NAc and did not produce a positive CPP score. These data indicate dual

targeting of the dopamine reward circuitry and pain pathways with multifunctional opioid-NK1R compounds may be an effective strategy in developing future analgesics that lack the potential for abuse.

LIST OF ABBREVIATIONS

American Pain Society, APS G-protein linked inwardly rectifying K+

Area under the curve, AUC channel, GIRK

Blood brain barrier, BBB Green fluorescent protein, GFP

Brain derived neurotrophic factor, BDNF Guide RNA, gRNA

Calcitonin gene-related peptide, CGRP Habenula, Hb

Centers for Disease Control, CDC Interfering RNA, RNAi

Central nervous system, CNS Interpeduncular nucleus, IPN

Chemotherapy induced nausea and Intraperitoneal, i.p. vomiting, CINV Intrathecal, i.t.

Chemotherapy induced neuropathy, CIN Intravenous, i.v.

Clustered regularly interspaced short Medium spiny neurons, MSN palindromic repeat, CRISPR National Institute for Drug Abuse, NIDA

Cold and menthol sensitive receptor, CMR National Institutes of Health, NIH

Complete Fruend’s adjuvant, CFA Nerve growth factor, NGF

Conditioned place preference, CPP Neurokinin A, NKA

Corticotropin releasing factor, CRF Neurokinin B, NKB

Dorsal root ganglia, DRG Neurokinin Receptor 1, NK1R

Endothelin converting enzyme, ECE Non-homologous end joining, NHEJ

Extracellular signal regulated kinase, ERK Nucleus Accumbens, NAc

Food and Drug Administration, FDA Paw withdrawal latency, PWL

G-protein coupled receptor, GPCR Paw withdrawal threshold, PWT

Glial derived neurotrophic factor, GDNF Periaqueductal grey, PAG

Glial fibrillary acidic protein, GFAP Peripheral nervous system, PNS

Protein kinase C, PKC Transient receptor potential, TRP

Rostral ventromedial medulla, RVM Tyrosine hydroxylase, TH

Spinal nerve ligation, SNL Ventral tegmental area, VTA

Substance P, SP World Health Organization, WHO

Tail withdrawal latency, TWL Zinc Finger Nuclease, ZFN

Transcription activator like effector nuclease, TALEN

CHAPTER 1: INTRODUCTION

1.1 PAIN

According to the International Association for the Study of Pain, pain is an unpleasant sensory and emotional experience associated with actual or potential tissue damage1. The history of the study of pain was a long and arduous one indeed2, with multiple modifications to the definition along the way. But what has not changed in the nearly four hundred years since Descarte’s illustration of the pain pathway is the fact that many human pathologies eventually lead to pain and potential suffering. Of course, the differences between acute and chronic pain are numerous and diverse. Chronic pain affects approximately 30% of the

United States population, more than the sum of heart disease, cancer and diabetes.3 While clinicians do have an array of analgesics in their toolbox to treat the multitude of acute painful presentations, chronic pain has limited therapeutic alternatives4. While in the acute setting opiates such as morphine provide the necessary pain relief patients are seeking, in the long term they bring with them intolerable and ultimately unacceptable side effects, often worse than the original pain itself5. In the following sections, the pain circuit will be discussed with a particular emphasis on a specific neurotransmitter, substance p. Later, the mechanisms of pain relief will be discussed and how the use of opioid analgesics transitioned into “The Opioid Epidemic.”

A. PAIN ANATOMY AND NEUROTRANSMISSION

The pain circuit is a complex set of neurons and support cells organized to carry various modalities of nociceptive input from the periphery to the brain.

Along the way, multiple synapses between neurons are made such that spinal reflexes can assist in the removal of the insult before the conscious processing has even begun. Nociceptive inputs include thermal, mechanical or chemical stimuli carried from the periphery to the spinal cord by either medium diameter myelinated Aδ fibers or small diameter unmyelinated C fibers6. The myelinated afferents mediate the acute, sharp, “fast” pain while the unmyelinated afferents carry a duller, poorly localized, “slow” pain. All nociceptors contain a cell body located outside of the spinal cord in a cluster of nuclei called the dorsal root ganglia (DRG) for somatic pain or outside the brainstem in the trigeminal ganglion for facial or head pain. The cell bodies send a central projection to the dorsal horn of the spinal cord or the nucleus caudalis of the medulla and a peripherally directed axon to the target tissue. In this way, a nociceptive stimulus in the tissue, when adequately noxious, will direct an action potential through the primary afferent, propagating toward the central nervous system and terminating in the dorsal horn where it will synapse with a second order neuron. At the synapse, the primary afferent will release pronociceptive neurotransmitter which may be amino acids or peptidergic in nature.

A given subtype of nociceptor (Aδ or C) is considered heterogeneous in that it can carry multiple modalities of nociceptive input. For instance Aδ fibers

can respond to both mechanical and chemical stimuli or thermal and chemical stimuli for the “fast” pain response. Likewise, the unmyelinated C-fibers are considered heterogeneous in that they can transmit mechanical and thermal input. This would lead to a slower, duller pain.

The chemical transmitter released in the dorsal horn is of critical importance for functional organization and understanding of the various nociceptors. C-fibers are subdivided into those that release peptides such as substance p (SP) and calcitonin gene-related peptide (CGRP), and those that are non-peptidergic. The peptidergic C-fibers are responsive to nerve growth factor

(NGF) as they express the TrkA neurotrophin receptor, a growth factor receptor that plays a role in neuronal differentiation (into SP containing neurons in this case). The non-peptidergic fibers are responsive to glial derived neurotrophic factor (GDNF), neurturin and artemin.

The primary afferent will release its chemical messenger to the second order neuron at various layers, or lamina, of the dorsal horn. While the light-touch sensitive Aβ fibers project to the deeper dorsal horn lamina V, the nociceptive fibers tend to synapse more superficially. The C fibers project to laminae I and II

(termed substantia gelatinosa) while the Aδs project to lamina I and V. Within each lamina, there is extraordinary further subdivision. For example, while C fibers do project to both laminae I and II, the peptidergic C fibers specifically project to lamina I and the dorsal part of lamina II7. The non-peptidergic fibers terminate mid/inner lamina II. From the dorsal horn, the second order neuron will

immediately decussate and ascend the spinal cord via the spinothalamic tract where the nociceptive signal will be relayed to many higher order central nuclei.

In the dorsal horn, the primary afferent releases its neurotransmitter into the synaptic space where it will eventually bind to and activate its receptor on the second order neuron. In the case of the neurotransmitter glutamate, it will activate glutamate receptors which can be either ionotropic or metabotropic in nature. The ionotropic receptors on the post-synaptic side include AMPA, NMDA, and kainate8, of which NMDA is typically silent in an uninjured state9. The metabotropic glutamate receptors (mGluR1-5) are on the second order neurons themselves, but also on the support cells, glia10,11. SP and CGRP are released and act on their only known receptors, metabotropic receptors which are GPCRs.

Any of these receptors on the second order neuron can, and usually are, upregulated during a hyperalgesic state while NMDA receptors come out of quiescence, one mechanism of central sensitization.

The three canonical modalities of pain--temperature, mechanical, and chemical--must be transduced into the language of the nervous system, electrical conduction. Each modality no doubt has multiple, if not dozens of transducer varieties-- each flavor converting the energetic signal and intensity into a graded electrical impulse ultimately producing a centrally directed action potential that will alert the CNS of impending danger or tissue damage. The transducer, or device that converts energy from one form to another, is usually a membrane bound protein in the form of a receptor.

For temperature transduction, the transient receptor potential (TRP) channels, nonspecific cation channels, convert thermal energy into electrical energy by opening and allowing the influx of Na+ and Ca2+ in response to heat.

TRPV1 in particular is activated at the noxious temperature of 43°C12 while some of the other 30 members of the TRP channels are opened at higher temperatures13 to signal an even greater impending disaster. For the nociceptive signaling of noxious cold, the peripheral nervous system employs the TRPM814 channel, previously called the cold and menthol sensitive receptor (CMR1)15.

Much like the TRPV1 channels, TRPM8 is a nonspecific excitatory membrane bound channel that opens upon noxious cold stimulation. Of course, lower threshold cold receptors exist as well, notably TRPA1, formerly called

ANKTM116. The biophysical properties of both heat and cold sensitive proteins can be altered by numerous signal transduction pathways leading to greater sensitivity, or lower threshold to activation. For instance, a sunburn on the skin can induce an inflammatory response, eliciting downstream intracellular mediators that ultimately phosphorylate the TRPV1 channel and/or reduce its interaction with membrane bound PIP2, reducing TRPV1 threshold for activation.

In this way, an innocuous temperature will activate the TRPV1 and thus, the sensory fiber, and signal nociception. Since its cloning in 1997, TRPV1 has been an obvious pharmacological target in the pharmaceutical industry as a potential analgesic. Multiple TRPV1 antagonists have been developed with optimistic expectations of their potential efficacy in the chronic pain population.

Unfortunately, a major side effect of the TRPV1 antagonists was a pyretic response due to its blocking of hypothalamic TRPV1 receptors critical in regulating the body’s temperature17. There are still multiple strategies to overcome obstacles in the TRP channel field, but it may be several years before an efficacious analgesic hits the market for safe use in patients.

Chemical modalities of nociceptive transduction typically utilize membrane bound receptors, either metabotropic or ionotropic. The TRP channels discussed earlier in thermo-nociception have a prominent role in chemo-nociception as well.

Capsaicin, menthol, and the isothiocyanates found in mustard are exogenous ligands that activate TRPV1, TRPM8, and TRPA1 channels respectively. Other ligand gated ion channels include the acid sensing ion channel (ASIC) family of receptors that sense the acidic environment and signal nociceptive input if the appropriate threshold of [H+] is reached. A few notable metabotropic receptors involved in chemo-transduction in the nociceptive pathway include the bradykinin, prostaglandin, histamine, and substance p GPCRs located in the nerve endings of nociceptors. The downstream intracellular cascades may lead to either acute nociception, an altering of the sensitivity of other nociceptive transducers, or an upregulation of other transducers such as TRPV117. It is thought that cytokines such as the interleukins and growth factors like nerve growth factor will act on their cognate tyrosine kinase receptor specifically to alter the nociceptive threshold.

Mechanotransduction, the conversion of kinetic energy into electrical impulses, is the third modality of nociceptive input. Candidate mechanoreceptors, or pressure sensitive proteins, have been elusive at best over the years. The consensus has been, that when found, it will be a pressure sensitive cation channel allowing Na+/Ca2+ influx to depolarize the fiber. The previously described

TRP channels have been candidate mechanotransducers with some evidence providing clarity for TRPV2 in particular18. Finally in 2010, the identity of a novel mechanically activated cation channel was identified and named “Piezo” (Greek for pressure)19. Six years after their discovery, we still know very little about the piezo receptors20. We know they are expressed on DRG and trigeminal neurons, and within the trigeminal system they are expressed on 30% of corneal afferents21. Furthermore, the algogenic peptide bradykinin (and likely other inflammatory mediators not yet investigated) increases the expression of piezo in

HEK cells, and PKA or PKC mediated phosphorylation of piezo decreases its threshold of activation, thus increasing its activity, much like that of the TRP channels22. While Piezo knockout mice are nonviable, conditional knockouts in the DRGs alter the electrophysiological kinetics of Aδ, Aβ, and C fibers23.

While it is common to consider pain fibers as unidirectional cells, transmitting an electrical signal from the periphery to the spinal cord, the reality of these sophisticated neurons is quite different. Termed pseudo-unipolar, DRG nociceptors are actually a bidirectional signaling apparatus such that both central and peripheral terminals have the capacity to release chemical signals. When the

peripheral terminals release chemical agents such as SP or CGRP, a process called neurogenic inflammation, vasodilatory actions and extravasation ensue. Of course, it makes sense that only the peripheral terminals will respond to environmental stimuli such as temperature and mechanical stimulation, but both the peripheral and central processes can respond to chemical stimuli. Chemical stimuli such as acid, neurotransmitters, and lipid mediators can evoke an acute nociceptive response as described above or alter the sensitivity of the nociceptors.

There are supraspinal contributions to the processing of pain as well24, including but not limited to the descending pathway25. A critical neuroanatomical description of descending fibers originating in the ventromedial medulla, passing through the dorsolateral funiculus, and terminating in the spinal dorsal horn was published in PNAS out of Howard Fields’ lab at UCSF in 197626. Importantly, they described descending serotonergic fibers from the dorsal raphe prevented noxious stimulus induced dorsal horn activation. In addition to the dorsal horn of the spinal cord, comparable descending projections terminate in the nucleus caudalis as well27. Initially presented at Society for Neuroscience in 1982, and later published in J. Neuroscience in 1983, the Fields group described ON and

OFF cells in the rostral ventromedial medulla (RVM), such that during noxious hindpaw stimulation, neuronal discharge of the OFF cells stops while the discharge of ON cells increases28. In addition to the RVM, the periaqueductal gray (PAG) of the brain stem plays an important role in descending modulation

as well24, specifically sending projections to the RVM to modulate efferent tone to the spinal cord.

B. NEUROKININS

In 1931, Ulf Von Euler and John Gaddum were on an expedition of sorts, in search of the distribution of acetylcholine in various equine organs. They came across a previously unidentified substance that they were able to concentrate in a powdered form, thus naming it “substance p29.” By the 1950s SP was well accepted as a polypeptide located in the central nervous system (CNS), particularly concentrated in the thalamus, hypothalamus, basal ganglia, and tegmentum in addition to the dorsal root ganglia of the peripheral nervous system

(PNS30). However, it was not until 1970 when Susan Leeman was able to isolate, characterize, and sequence SP as an 11-amino-acid peptide that the neurokinin field really evolved31. With the newly available antibodies to SP, immunohistochemical techniques allowed more precise characterization of

SPergic neurons in the peripheral and central nervous systems.

NEUROKININ PHARMACOLOGY

In 1983, neurokinin A and neurokinin B (NKA and NKB, respectively) were discovered and characterized, putting them in the same family as SP (the

32 33 tachykinin family ) based on similar –CO2 terminal sequences. By 1984 all three neurokinin receptors had been proposed34-37 followed by the permanent nomenclature: neurokinin-1 receptor (NK1R), neurokinin-2 receptor (NK2R), and

38 neurokinin-3 receptor (NK3R) in 1986. Each ligand can bind and activate each

receptor, however they all have their preference owing to a graded affinity: SP preferentially activates NK1R, NKA preferentially activates NK2R, and NKB

39 preferentially activates NK3R (Table 1). Cellular and molecular experiments linked neurokinin receptor activation to inositol phospholipid hydrolysis40-42 (later referred to as Gq coupling). Following receptor activation, the NK1R is rapidly

+ internalized leading to visual NK1R endosomal varicosities in the dendrites and somata of neurons, disappearing an hour later.43 This discovery made future cellular investigations into neurokinin pharmacology easier to trace.

Following clathrin mediated endocytosis, the NK1R-SP complex is disassembled and SP is degraded by an endosomal metalloendopeptidase, endothelin converting enzyme-1 (ECE-1)44. Termination of this endosomal signalosome promotes the trafficking of NK1R back to the plasma membrane and re-sensitizes the neurokinin axis45. Therefore, degradation of SP in the endosome does not decrease SPergic effects, but rather sustains SPergic effects. This is demonstrated using an inflammatory model of SP signaling whereby an ECE-1 inhibitor prevented neurokinin receptor re-sensitization and reduced overall SP induced inflammation46.

In addition to post synaptic intracellular SP termination, SP is also broken down in the synaptic cleft47 by a variety of peptidases, most importantly by neprilysin48, a cell surface metalloendopeptidase and enkephalinase. In the case of extracellular SP metabolism, the SPergic effects on vasodilation are diminished with a neprilysin inhibitor in the hamster cheek pouch in vivo49.

Despite this preclinical outcome, a study using small human resistance arteries from patients with coronary artery disease showed no effect of the neprilysin inhibitor thiorphan on SP induced vasodilation50, a problem that plagues much of translational research (see below).

Receptor localization is important in determining how the pharmacology affects a local neuronal circuit. Complicating the picture, G-protein coupled receptors (GPCRs) like the neurokinin family of receptors can act in both rapid

(Ca2+ or Na+ induced cell activation) and delayed (transcriptional) ways.

Validating this notion, the activation of the neurokinin family of receptors will

2+ ultimately lead to an increase in [Ca ]intracellular, thus potentiating neuronal mechanisms of firing an action potential, in addition to activating the nuclear translocation of certain transcription factors including NF-ĸB.51 Additionally, recent evidence implicates swift activation of a Na+ leak channel, NALCN, as well as the closure of G-protein-linked inwardly rectifying K+ (GIRK) channels in the rapid SP-induced activation of neuronal action potentials.52-54

For years, neurokinin antagonist studies were made very difficult by the lack of penetration of the available ligands (ie. only peptidergic antagonists were available).55 The breakthrough came in 1991 when scientists at Pfizer discovered the first nonpeptide molecule with classical competitive antagonism at the

56,57 NK1R. The identification of this compound led to the discovery of even more selective, structurally diverse, nonpeptidic NK1R antagonists at other pharmaceuticals, namely Merck’s MK-869, which later became known in the

clinic as the antiemetic Aprepitant (EMEND®).58 While considerable time and money went into the possibility of Aprepitant working as a standalone analgesic and/or antidepressant (without much success, see Neurokinin Antagonists as

59 Analgesics), the prospect of an NK1R antagonist for the treatment of addiction still remains viable (see Neurokinins in the Reward Pathway).

NEUROKININS IN THE NOCICEPTIVE CIRCUIT

Early experiments involving SP (circa. 1940s-1950s) provided evidence for higher concentrations of the peptide in the dorsal horn than other locations.60

As early as 1956, administration of SP was shown to prevent morphine analgesia61, and i.v. injections of SP would induce pronociceptive behaviors62.

Further, intrathecal SP administration induced concentration-dependent, rapid, and transient caudally directed biting and licking, hind-limb scratching, writhing and retching63. In a human population of familial dysautonomia (Riley-Day syndrome), in which patients exhibit a severe diminution of temperature and pain sensitivity, a reduced population of SP-positive primary afferents were found in addition to smaller Lissauer’s tracts64. As early as the 1960s, multiple groups proposed morphine’s analgesic effect was mediated by inhibiting the release of

SP from the primary afferent.

Microiontophoretic application of SP directly onto dorsal horn grey matter produced reversible and immediate excitation in neurons also excitable by the application of glutamate65. Neuronal excitation corresponded to increased

2+ 66 [Ca ]influx in the dendrites of dorsal horn neurons, lasting about 10-50 seconds .

Anatomical studies using IHC found SP immunoreactivity specifically in the substantia gelatinosa in the rat, cat67,68, and finally in the human69, and peripheral subcutaneous tissue in the cat70, with agreement amongst the neurokinin community that SP was a putative neurotransmitter with both central and peripheral release71. The evidence of release from isolated nerve endings following electrical pulsation induced, Ca2+ dependent depolarization finally came in 197672, and its storage in large dense core vesicles was confirmed in DRG neurons in 197773-75. Leeman’s group further characterized the ultrastructural

SPergic synapses in the dorsal horn with most observed synapses being axodendritic in nature, with axoaxonic and axosomatic synapses also observed, albeit to a lesser extent76. Upon nociceptive stimulation by either a strong hindpaw pinch or hindpaw injection of capsaicin, the distribution of NK1R immunoreactivity is drastically altered such that internalization of the receptor in lamina I second order neuron distal dendrites appears as “strings of swollen varicosities connected by thin fibers77.” Additionally, when noxious heat or cold, but not innocuous warm or cool, are applied to the hindpaw of anesthetized rats, a graded NK1R internalization is observed corresponding to the intensity of

78 temperature applied . NK1R internalization and subsequent resensitization appears to take 60min to complete79. Since NKA and SP are coreleased from primary afferents, and the NK2R does not exist in the dorsal horn, an investigation into the differential effects of each of the neurotransmitters proceeded to clarify the potential role of NKA in nociception. The study out of the

Basbaum lab found that NKA release from the primary afferent equally activate

80 and internalize NK1Rs found in the distal dendrites of dorsal horn neurons , and concluded that NKA may actually have a greater influence on nociceptive signaling.

Capsaicin induced--central and peripheral--SP release lent further evidence for the role of SP as a primary afferent, pronociceptive neurotransmitter81,82. Strikingly, when newborn rats were administered capsaicin, they demonstrated an irreversible loss of spinal and peripheral SP83. When capsaicin was administered intrathecally to adults, a robust irritation lasting 10-15 minutes ensued in the rats84. However, the next day thermal and chemical nociceptive thresholds were significantly increased while dorsal horn SP was significantly decreased. The authors suggested the analgesic properties of capsaicin were mediated by a depletion of spinal SP, a fact that has reinforced the use of over-the-counter capsaicin containing analgesics like Capzasin.

Further investigation revealed capsaicin administration reduced SP content in synaptic vesicles83. In vivo studies demonstrated a block of capsaicin induced SP release by morphine85--reversed by naloxone-- providing some of the first evidence for morphine’s analgesic mechanisms. Further, μ and δ opioid agonists prevented evoked SP release, but ĸ agonists did not86. The same study demonstrated that α2-adrenergic agonists, but not α1 or β-receptor agonists, prevented stimulation evoked SP release.

The peripheral effects of SP induced by antidromic stimulation of DRG neurons were further characterized and shown to have a potent vasodilatory and extravasatory effect87 by activating cutaneous mast cells which subsequently release histamine to promote neurogenic inflammation88, but not in denervated skin89,90. While there are some reports of direct activation of primary afferents by

91,92 SP in the periphery , thus requiring NK1R to be located on the peripheral terminal of the primary afferent, the large pool of evidence of SP acting in the periphery points to indirect activation of the nociceptor93. That is, SP is unequivocally released by bipolar DRG nociceptors in the periphery, acting on and activating immune cells94 such as macrophages95 to induce an oxidative burst and IL-196 and thromboxane release97, monocytes to induce production of

IL-1 and TNF-α94 and chemotaxis98, and mast cells to release histamine99 and leukotrienes. Each of these factors on their own have the propensity to directly activate peripheral nerve endings of nociceptors94. Additionally, neurogenic release of SP at the peripheral nerve terminal will act directly on the endothelium100,101 in the vasculature, particularly in arterioles, capillaries, and venules, to induce vasodilation102,103 and extravasation104-106. Each of these effects have been effectively blocked by a NK1R antagonist.

While glutamate and SP/NKA are co-localized in the same primary afferents107,108, different activating stimuli are necessary for the differential release of each. In other words, they each have their own threshold for release.

For example, a higher frequency of stimulation is required for SP release than is

needed for glutamate release from the primary afferent109. Therefore, it seems plausible that glutamate signals all intensities of pain while SP signals only high intensities of pain. This is what a study using a knockout of the tachykinin 1 gene

(Tac1) found in mice110. The group also found neurogenic inflammation was significantly reduced in the Tac1 KO mice, such that mice lacked post-capillary venule extravasation of protein. In the same issue of Nature, another group found

-/- 111 that in NK1R mice, only acute inflammatory pain was disrupted . Similarly, a

PNAS report the following year described intact tail-flick in Tac1-/- but lacked a response to subcutaneous formalin112.

In addition to the spinal cord, supraspinal pain processing utilizing neurokinin signaling exists as well. For example, some of the dorsal horn second

113 order neurons containing NK1R project to the PAG . In addition, SPergic projections are found in the PAG114, where they apparently increase nociceptive thresholds to both thermal and mechanical stimuli115. Interestingly, systemic morphine increases PAG SP release, a potential mechanism of morphine analgesia (discussed below). About 6% of the total neuronal population of the

PAG express NK1R, particularly- in the dorsal PAG- mostly contained to cell bodies and dendrites116.

The canonical view of descending modulation of pain states that PAG descending neurons project to the RVM, which further descends to the dorsal horn of the spinal cord117. In the RVM, microiontophoretic application of SP significantly increased spontaneous activity and NMDA-evoked activity of ON

118 cells and blocked by a selective NK1R antagonist, with no effect on OFF cells .

Subsequent IHC revealed NK1Rs are coexpressed on nearly all NMDAR containing neurons in the RVM. When administered into the RVM in vivo, an

NK1R antagonist blocked intraplantar capsaicin induced thermal hyperalgesia and mechanical allodynia in rats119. This provided some of the first evidence that

SP may be acting in a descending modulatory manner to alter nociceptive sensitivity.

NEUROKININ REMODELLING IN CHRONIC PAIN

Chronic pain is an undesired, long-term reception of nociceptive input. In some cases it may be due to peripheral sensitization and some due to central sensitization. SP and its receptors play a role in both.

Inflammatory conditions have the most pronounced effect on the neurokinin system, rendering the nociceptive fibers more sensitive to noxious, and sometime even innocuous stimuli. An early study providing evidence that SP plays a role in inflammatory pain found that injections of SP directly into the foot pad of the rat hindpaw induced long-lasting hyperalgesia, suggesting endogenous SP released from local inflammatory cells may mediate long term changes in chronic inflammatory pain120. Likewise, intrathecal SP administration

121 increased spinal prostaglandin E2 and led to hyperalgesia. The intrathecal SP induced hyperalgesia was blocked by an intrathecally administered protein kinase C (PKC) inhibitor122 suggesting the downstream intracellular signaling cascades induced by Gq coupling may lead to hyperalgesia via phosphorylation

events, particularly of the NMDA receptor. In the spinal cord grey matter (lamina I and II), Tacr1 mRNA was found in two-fold greater concentrations after Freund’s adjuvant-induced hindpaw inflammation123. This increase corresponded to an

124 increase in immunostaining for NK1R in lamina I , and parallels the behavioral

125 changes seen in injury . In follow up studies, NK1R internalization was increased after noxious mechanical and thermal stimulation in an inflammatory model compared to naïve animals126. Critically, 75% of neurons in lamina I contained internalized NK1Rs following innocuous, light brushing of the hindpaw, supporting its possible use as a ‘molecular marker’ of allodynia. In another animal model of inflammatory pain, intra-plantar injection of tuberculosis had a

-/- reduced effect on footpad swelling and mechanical hyperalgesia in NK1R compared to control127. Additionally, pre-pro-tachykinin A (PPT-A) mRNA expression was increased in the lumbar DRG following either formalin or

Freund’s adjuvant injection into the hindpaw128. In fact, Aβ fibers, which normally convey light innocuous touch and do not typically release SP, undergo a phenotypic switch under inflammatory conditions such that they start to express

SP and convey noxious information to the CNS129. The typical nociceptors containing SP are reliant on nerve growth factor (NGF) for proper maturation and function such that application of NGF to these neurons increases SP content in both the dorsal spinal cord and in peripheral subcutaneous tissue130.

Inflammation increases NGF levels in the periphery131, thus mediating the

increased expression of SP in nociceptors132,133. In the case of Aβ switch to nociceptive fiber, the phenotypic shift is NGF dependent.

In nerve injury models, Tacr1 knockout animals do not exhibit decreased withdrawal thresholds to mechanical nociceptive stimuli, indicating a less prominent role in acute pain and more crucial role for the receptor in nerve injury induced neuropathic pain134. When the sciatic nerve was transected, intrathecal

SP produced increased biting and scratching behavior than controls, indicating an increased sensitivity of the neurokinin system following nerve injury135. Further work demonstrated that, DRG SP was depleted 10 days after the transection.

Similarly, in a partial nerve injury model, SP content was significantly decreased in the DRG, while much like in the inflammatory model, NK1R expression was increased in laminae I and II of the dorsal horn136 following an increase in the expression of Tacr1 mRNA137. However, in PKCγ-/- mice, those nerve injury induced spinal alterations were lost. Critically, when the NK1R antagonist L-

732,138 was administered intrathecally prior to and post-sciatic nerve constriction, mechanical allodynia and thermal hyperalgesia were significantly attenuated 8 days post-injury138. When the compound was administered 8 days after the surgical injury, it too attenuated pain behaviors. This crucially points to the fact that the neurokinin system is involved in the induction and maintenance phases of neuropathic pain.

Paclitaxel is a major chemotherapeutic with one of the dose limiting side effects being chemotherapy induced neuropathy (CIN)139. In an animal model of

CIN, paclitaxel induced peripheral neuropathy was reversed by an inhibitor of SP release, pemirolast140, and by L-732,138141. Additionally, paclitaxel significantly increased SP release from cultured DRG neurons, an effect blocked by a PKC inhibitor142. Not all chemotherapeutics lead to neuropathic pain via alterations in the neurokinin system. For instance oxaliplatin, working via a completely different mechanism than paclitaxel, does not alter the neurokinin system, be it SP peptide or NK1R expression.

In an animal model of diabetic neuropathy using streptozotocin, SP content was significantly reduced in DRG neurons while NK1R binding sites were significantly increased in the dorsal horn, leading the authors to conclude the neurokinin system may be supersensitive in diabetic neuropathy eventuating in a

143 lowered nociceptive threshold . Correspondingly, an NK1R antagonist administered 4 weeks after the induction of diabetes prevented mechanical allodynia and thermal hypersensitivity144.

Following experimental chronic inflammatory insult, there are significant changes in the RVM- cyto and molecular- architecture and in paw withdrawal latency to thermal stimuli and mechanical withdrawal threshold. Consonant with this notion, the density of SP immunoreactive fibers were significantly increased following intraplantar injection of complete Freund’s adjuvant (CFA)145. Using

NK1R internalization as a marker of SP signaling, CFA treated animals exhibited increased neurokinin activity only after noxious thermal stimulation146, highlighting the fact that endogenous SP is not released in the RVM under

normal circumstances, and even under the condition of chronic inflammation only exerts its effects after an elicited noxious stimulus. Much like many brain regions, the RVM is composed of multiple nuclei and exhibits a marked heterogeneity.

Thus, it was important to determine which cells may be facilitating the endogenous actions of SP in promoting hyperalgesia. NK1R is certainly

118 expressed on ON cells in the RVM . An NK1R antagonist was shown to attenuate capsaicin evoked excitation of ON cells, but had no effect on OFF

147 cells . Behaviorally, as expected, intra-RVM administration of NK1R antagonists significantly attenuate the thermal hyperalgesia but not mechanical allodynia

148 induced by CFA , and ablation of NK1R expressing neurons in the RVM using the conjugated SP-SAP likewise prevented capsaicin induced hyperalgeisa149.

Complicating the role of NK1R activation of descending inputs in the RVM, intra-

RVM SP administration affected spinal processing of nociceptive input via dorsal horn modulation of 5-HT signaling, NMDAR phosphorylation, and even shifted the GABAAR anion potential through phosphorylation of the Na-K-Cl cotransporter150.

NEUROKININ ANTAGONISTS AS ANALGESICS

With all of this wonderful preclinical evidence for how the neurokinin axis is involved in pain processing and how it is altered in chronic pain states, it seems reasonable that a neurokinin antagonist would effectively block pain transmission in humans; unfortunately this is not the case. The 1990’s brought about several clinical investigations into the family of NK1R antagonists’ efficacy

in pain relief. Presented at the 1998 American Society for Clinical Pharmacology and Therapeutics Conference in New Orleans were two failed studies out of Eli

151 Lilly on Lanepitant. Lanepitant, although a selective NK1R antagonist and potent inhibitor of neurogenic dural inflammation152, failed to demonstrate efficacy in acute migraine attacks in established migraineuers153-155. Similarly,

Lanepitant failed to provide analgesia in painful diabetic neuropathy156,157 and

158 osteoarthritis . Novartis’ NK1R antagonist TKA731 also failed to reduce pain ratings in a multicenter, randomized, double-blind, placebo-controlled and parallel-group study on painful diabetic neuropathy159. L-754,030, also called MK-

0869 developed by Merck, was ineffective at relieving post dental surgery pain compared to placebo160 and equally ineffective in treating postherpetic neuralgia161. This compound would later prove useful for the prevention of chemotherapy induced nausea and vomiting and is now known as Aprepitant162.

Aprepitant was later investigated in human volunteers in an experimentally induced model of central sensitization, providing no analgesic efficacy163. In another human volunteer study investigating the functional connectivity of various brain regions involved in pain processing, Aprepitant had no effect on reducing the activity of such areas while buprenorphine did164. Pfizer’s CJ11974, also known as Ezlopitant, was ineffective in relieving pain associated with fibromyalgia165.

One of the only studies to demonstrate clinical analgesic efficacy of NK1R antagonism was in a human dental pain model166, albeit the reduction in pain was modest- about half that of ibuprofen.

With such an expensive failure for an entire drug class in a potentially hugely profitable market, speculation as to why NK1R antagonists were unsuccessful has invoked a variety of probable causes. Undoubtedly, the translatability of preclinical studies to effective clinical therapeutics is a problem that plagues much of the health sciences. It will suffice to include here for completion that perhaps there are differences in animal and human physiology/pathophysiology such that the neurokinin system does not play as critical a role in human pathogenesis.

In regards specifically to the neurokinin system, preclinical studies provided a critical role for SP in chronic, not acute, nociception. Importantly, animal studies indicated induction and maintenance of chronic inflammatory and neuropathic pain was, at least in part, mediated by the neurokinin axis. Why then, would acute postoperative dental pain (tooth extraction) be used to assess the clinical efficacy of Aprepitant? The reason, is that these patients are readily available to assess analgesic efficacy, which has in the past provided evidence of analgesia with opioids, the most lucrative class of analgesics on the market.

The NK1R antagonists also failed in postherpetic neuralgia, diabetic neuropathy, and fibromyalgia, populations of patients one might expect to be more positively affected by this class of drugs. So while the clinical populations that failed in

achieving analgesia in clinical trials seemed unsuitable to examine the analgesic efficacy of NK1R antagonists in the first place, more appropriate groups of patients likewise did not achieve adequate analgesia with these drugs. Perhaps the best clinical population for a standalone NK1R antagonist would be those suffering from bone cancer pain, rheumatoid arthritis, and visceral pain as these conditions include extensive involvement of NK1R.

Alternatively, one should consider NK1R antagonists will not provide the necessary clinical analgesia as standalone therapeutics. Perhaps in combination with another proven analgesic, NK1R antagonists could complement the pain relief with an additional mechanism of action. Studying dual acting drugs can be time consuming and difficult to assess. With many analgesics to choose from,

167 selecting the correct drug to use with the NK1R adjuvant is critical .

OPIATE MEDIATED ANALGESIA

Unlike NK1R antagonists, there is little doubt as to the efficacy of opioids in treating acute pain and cancer pain168. In fact, the World Health Organization

(WHO) specifically advocates for the effective treatment of cancer pain with opioids169. The use of opioids for various forms of chronic non-cancer pain, however, is controversial. While some may argue that neuropathic pain is opioid resistant170, others have found morphine to exhibit, for instance, even greater pain control of postherpetic neuralgia than lidocaine171. A systematic review of opioid efficacy revealed effectiveness of morphine or oxycodone in phantom limb pain, diabetic neuropathy, and osteoarthritis, but not musculoskeletal pain168.

Following the identification of opioid receptors in 1973172 and the differentiation of opioid receptor subtypes in 1977173, multiple groups investigated the mechanism of action by which opioids exert their effect on the pain pathway.

Direct dorsal horn administration of morphine was sufficient to reduce second order neuron firing174, primary afferent SP release85, and intrathecal administration in vivo was adequate to prevent the nociceptive spinal reflex and operant response, both effects inhibited by naloxone175. The genes for μ, δ, and ĸ opioid receptors were cloned176; μ-receptor knockouts were insensitive to the analgesic, rewarding, and withdrawal effects of morphine177, and in drug-free states had reduced nociceptive thresholds178, suggesting endogenous opioid peptides were crucial for baseline nociceptive activity. In the primary afferent, opioid receptors were found at central terminals in the dorsal horn179,180, co- expressed with either SP, glutamate, or CGRP181 where opioid receptor activation inhibits Ca2+ channel activity182 via protein-protein interaction between

2+ 183 the βγ-complex of the opioid receptor and the α1-subunit of the Ca channel .

In addition to its action at the Ca2+ channel, the βγ-complex may also directly bind to and inactivate the synaptosome-associated protein (SNAP-25) to inhibit presynaptic release of neurotransmitter184. Beyond its presynaptic actions, μ-, δ-, and ĸ-opioid receptor activation in dorsal horn neurons, particularly in the substantia gelatinosa, hyperpolarize the postsynaptic cell by increasing K+ conductance185-187.

In addition to central terminals of primary afferents, μ-opioid receptors are also expressed along the axon in naïve animals188, and upregulated in neuropathic pain states189. The three subtypes of opioid receptor are expressed differentially on various nociceptive fibers. MOR is predominately found on peptidergic, TRPV1+ afferents while DOR is on non-peptidergic mechanosensitive fibers, such that MOR agonists block thermal pain and DOR agonists block mechanical190,191.

Opioids exert their analgesic effect in supraspinal regions as well, particularly in the PAG and RVM. In the nucleus raphe magnus of the RVM, opiate administration activates descending inhibitory fibers that ultimately attenuate nociceptive signaling at the first dorsal horn synapse192, suggesting endogenous brainstem analgesic circuits exist to gate which nociceptive information is perceived. Application of opioids to the midbrain PAG also activates descending RVM fibers193, particularly the OFF cells described previously by a disinhibitory mechanism194 involving midbrain GABAergic neurons195.

GREAT SUCCESS, SOME FAILURE

Opiates have been cultivated from poppies since at least around 2,000

B.C. when the Sumerians, who lived in modern day Iraq, refined “gil” (the word for joy; opium) and used it as a euphoriant196. Even Homer wrote about the drug in “The Odyssey” referencing its ability to “lull all pain and anger.” In 1806, the active ingredient was finally isolated and named morphine after “Morpheus,” the

god of dreams197. Despite efforts to ban morphine due to its known side effects, addiction became a common problem, particularly in China where they smoked it during the tobacco ban. While morphine and its opiate analogues (heroin, codeine, hydromorphone, etc.) are excellent analgesics for certain types of pain, addiction, tolerance, respiratory depression, and constipation have plagued every single one of them.

OPIATE INDUCED REMODELLING

After multiple days of opiate administration, the dose necessary for analgesia is no longer sufficient and must be escalated, a phenomenon called tolerance; and sometimes, extended use of morphine can cause, paradoxically, opioid induced hyperalgesia in distinct locations from the original complaint of pain198. For instance, after five days of intrathecal morphine in rats, hind-paw compression evokes a greater NK1R internalization in the dorsal horn than that

199 seen on day one , an effect blocked by an NK1R antagonist suggesting chronic morphine actually loses its ability to suppress the release of nociceptive neurotransmitter. How opioids lead to greater nociceptive signaling has been at debate for many years with some providing evidence of direct central sensitization in both ascending and descending circuits200 and some evidence for indirect inflammatory changes201. What’s known is that NMDAR

202,203 204 205 antagonists , CGRP antagonists , NK1R antagonists , and TRPV1 antagonists206, in animals, can block both tolerance to opioids and opioid induced

hyperalgesia. Indeed some articles report that CGRP immunoreactivity is increased while SP immunoreactivity is unchanged following chronic opiate exposure, others suggest otherwise207; SP and CGRP release is actually increased after chronic morphine exposure208,209. Further, δ-opioid receptors appear to be upregulated and/or have altered binding parameters following chronic morphine treatment, while μ-opioid receptors are unchanged210. δ-opioid receptors also become phosphorylated after prolonged opiate exposure, desensitizing the receptor from further stimulation211. TRPV1 exhibits a modest increase in expression following prolonged opiate administration206, and intracellular phosphorylation events appear to mediate much of the change in sensitivity of many of these pronociceptive receptors207. Much like its role in promoting neuropathic pain described above, PKC is a likely intracellular neural substrate activated by morphine that promotes tolerance to- and hyperalgesia from- opiates212; PKA and Raf-1 kinase may also be crucial in mediating opiates’ hyperalgesic effects213, in addition to the activation of MAPK and the transcription factor CREB.

Peripherally, opiates exert a profound effect on the resident inflammatory cells as well, potentiating the process of central sensitization214. Opioid receptors are expressed on multiple subtypes of inflammatory cells214 in addition to non- classical opioid receptors that activate inflammatory function215. Resident microglia in the spinal cord appear to be one of the more important inflammatory cell subtypes mediating opiate induced remodeling216. Although there is

controversy about exactly how opiates activate microglia, what’s clear is that when they are activated they release proinflammatory TNF-α217, NO218, IL-1β219,

IL-6, and other chemokines. As mentioned in multiple previous sections, intracellular kinases are critical in mediating opioid induced cellular activation.

Particularly promising in activating the inflammatory cascade is PKCε, which in microglia stimulates Akt, eventually leading to activation of ERK1/2 and iNOS to promote cytokine release and NO production220. When released, these inflammatory mediators act directly on dorsal horn neurons leading to central sensitization and tolerance217. Minocycline, a broad microglial inhibitor, blocks morphine induced activation of microglia and analgesic tolerance221.

Interestingly, an NK1R antagonist is sufficient to prevent opioid induced inflammatory activation222. Of course, analgesic tolerance and opioid induced hyperalgesia are not the only side effects of opioids that limit their use.

MAJOR SIDE EFFECTS

There are a number of side effects of opioids that limit their use clinically besides their inability to maintain potency. The μ-receptor appears to mediate most of the negative actions of opioids, be it body temperature223, respiratory rate5, or gastrointestinal propulsion (constipation)224,225. The most problematic of these in the acute setting is respiratory depression as it is usually the cause of mortality in opiate overdose226. In addition, withdrawal symptoms from the discontinuation of opioids, while not lethal, are considered quite unpleasant to patients227,228.

Perhaps the best documented side effect of opiates and the source of great

concern for prescribing physicians and patients alike, is the potential for abuse due to addiction.

1.2 ADDICTION

Addiction is a complex neurobiological and psychological disease that results from repetitive drug administration. It a process that is modulated by experiential and environmental factors in addition to genetic and developmental factors229. It is characterized by compulsive drug-seeking behavior despite serious negative socioeconomic and health consequences. 230Some addiction experts propose addiction accesses the same neurophysiological mechanisms used by the brain for normal learning and adaptive behaviors231; in other words:

“hijacking” the reward system232. Others are discontent with that terminology233.

However addiction should be philosophically labeled, it is clear that drugs of abuse give the abuser the sensation of euphoria234. It’s likely that the “reward circuitry,” as Olds and Milner termed it in the 1950s235, was not established in primitive animals to convey the sense of euphoria to drugs of abuse. Yet every drug of abuse studied as of yet has an effect on the “reward circuitry.” That is, they all increase the release or otherwise potentiate, perhaps even hijack, the action of a critical rewarding neural substrate, dopamine.

A. REWARD NEUROTRANSMISSION

The reward circuit is composed of the mesocorticolimbic dopaminergic pathway; dopaminergic neurons originating in the ventral tegmental area (VTA)

of the midbrain (meso), project to and bathe cortical (cortico) and limbic regions including the basal forebrain, or the ventral striatum230 containing the nucleus accumbens (NAc)236. Benzodiazepines237,238, nicotine239, cocaine240, morphine, amphetamine241, ketamine242, Δ-THC243, and alcohol244,245, all lead to increased dopamine release in the nucleus accumbens, albeit through different mechanisms246.

It is out of the scope of this text to discuss the mechanism of action for increasing extracellular dopamine concentrations in the NAc for each of the drugs of abuse mentioned; opioids in particular will be discussed here.

Opiates such as heroin and morphine have long been known to be readily self-administered i.v. by animals and produce particular behavioral effects247, a phenomenon blocked by either systemic or centrally administered naloxone248-

252. Bilateral injections of morphine into the VTA induce increased locomotion, rearing, licking and sniffing which is reversed by intra-NAc dopamine antagonists253. Additionally, intra-VTA morphine administration produces robust place preference254, a model of reward, but distinguishable from physical dependence255. In 1992, Johnson and North showed morphine activates dopamine cells in the VTA indirectly, via inhibition of GABAergic interneurons256 synapsing onto dopamine cells. As GABA is an inhibitory transmitter itself, this was termed “disinhibition.” Opiate receptors are also localized in the NAc itself where opioids directly act on NAc neurons to promote excessive limbic signaling, way out of proportion to what endogenous systems typically provide257. While we

still do not have a complete understanding of opiate action in the reward circuit, in the acute setting, morphine’s ability to alter dopamine concentrations in the

NAc is relatively simple.258 Chronic opioid exposure however has a more complicated molecular and phenotypic signature259. Chronic morphine exposure increases the expression and/or activity of multiple kinases including that of 1)

PKA in the NAc leading to potentiated cAMP signaling260, much like what is seen in the spinal cord and locus ceruleus261,262, and of 2) extracellular signal regulated kinases (ERKs) which when phosphorylated and thus activated produce multiple downstream transcriptional activities263. In the VTA, tyrosine hydroxylase (TH), the rate limiting step in dopamine synthesis, is upregulated after chronic morphine exposure,264 an effect likely mediated by the increased

PKA and downstream CREB activity265. However, while there is increased TH expression in the VTA prompting one to hypothesize greater dopaminergic activity, chronic morphine actually decreases the expression of neurofilaments

NF-200, NF-160 and NF-68 in the VTA, and thus about 50% decreased axonal transport from the VTA to the NAc266,267. This implies a greater concentration of morphine is required to have the same effect on NAc dopamine release, and is likely one of the mechanisms of opiate tolerance. Additionally, the astrocytic marker of activation, glial fibrillary acidic protein (GFAP), is significantly increased following chronic morphine administration268, likely accounting for the increased

“inflammatory” response seen in the reward circuit after chronic drug abuse; this parallels what’s seen in the spinal cord after chronic opiate exposure.

Interestingly, each of the chronic effects of morphine on the VTA-NAc axis are reversible and prevented by administration of the prototypic neurotrophin brain derived neurotrophic factor (BDNF)257,269.

In the NAc, there are a specific subtype of neurons, expressing D1 dopamine receptors, that receive a large majority of dopaminergic projections from the VTA, called medium spiny neurons (MSNs)270-273. 95% of NAc neurons are GABAergic MSNs, some of which also express SP270. In the NAc MSNs, the transcription factor ΔFOSB is significantly upregulated and activated following chronic opiate administration274. The downstream transcriptional targets of

ΔFOSB include synaptotagmin, microtubule associated proteins, cyclin dependent kinase 5, and other proteins that alter NAc dendritic spine arborization, suggesting it plays a major role in structural plasticity275,276. It also controls the expression of AMPA receptors, Ca2+ channels, and CaMKII.

Interestingly, ΔFOSB can also activate the inflammatory transcription factor

NFĸB, opening up Pandora’s Box of possible downstream transcriptional profiles277.

With evidence abound for how opiates 1) decrease pain in the acute setting and 2) produce positive reinforcement and the potential for abuse, it should come as no surprise that opiates have become one of the most abused drugs in the US, leading physicians, scientists, and the mainstream media alike to refer to this vast, country wide, overuse and abuse as “The Opioid

Epidemic.”278-281

THE OPIOID EPIDEMIC

Despite the recognized side effects of opiate analgesics, they now hold the position as most commonly prescribed class of medication in the US282. In fact, 245 million opioid prescriptions were dispensed in 2014283, of which about

10 million were indicated for long term use284. The use of long term opioids for chronic non-cancer pain has evolved into abuse leading the US into what officials term “The Opioid Epidemic.”

During the national epidemic, the US has seen the prevalence of opioid addiction skyrocket as 1.9 million Americans abuse prescription opioids285.

Additionally, over half a million Americans abuse the recreational opioid heroin.

Of these heroin abusers, it is estimated that 23% have developed an addiction286.

All opioids, prescription and recreational, led to almost 30,000 overdose deaths in 2014287. In fact, the transition from prescription to street opioids is blamed for the abuse and misuse of heroin. One report found individuals shifted from prescription opioids to heroin because “heroin is cheaper and stronger than the prescription drugs listed, and the supply is typically pretty consistent288.”

While fatal overdose rates are on the slight decline for prescription opioids since 2011289, they are still on the rise for heroin290. This suggests prescription pain killer monitoring programs291 and other potential solutions may be curbing prescription opiate overdose, but addicted patients are still finding ways to obtain opioids, even if illegally292. Oxycodone (Oxycontin) is implicated as the most

fatally overdosed prescription opioid293. Its “abuse deterrent” reformulation has coincided with increased rates of heroin abuse294.

Some estimates put the cumulative cost of prescription opioid abuse between $53-73 billion per year, accounting for insurance and fraud, lost productivity, criminal justice costs, treatment, and medical complications280,295.

The prescription epidemic is affecting ages 18-25 the greatest, males more than females, and predictably, those with psychiatric conditions are at the greatest risk of prescription opioid abuse296-298. Heroin produces more homogeneous demographics affecting men and women equally288. While mostly Hispanics and

African Americans were heroin users in the 1970s-80s, now 90% of new users are Caucasians299.

Many authors in the scientific literature and mainstream media blame the healthcare industry for the rise in opioid abuse. In 1989, Wilson and Pendleton, rightly or not, coined the term oligoanalgesia referring to the fact that physicians were misusing drugs by not prescribing analgesics enough300. They reviewed charts of 198 patients admitted to the emergency department and found that 56% received no analgesic medication. Six years later, with a true, unwavering compassion for those suffering from intense pain the president of the American

Pain Society (APS), James Campbell MD, described his vision for “Pain as the

5th vita sign” in his 1995 Presidential Address301. In the address he mentioned the potential for greater use of opioid analgesics. While most don’t question his authentic concern for patients suffering with pain, some authors point to this

address as a turning point in the history of opioid analgesics—a concept laced with unintended consequences302.

Much of the blame has been apportioned to one particular pharmaceutical company, Purdue Pharmaceuticals, for perhaps misrepresenting the addictive potential of their blockbuster drug, oxycontin in the mid-late 1990s303. In fact, in a

2000 JAMA retrospective study authored by physicians with financial ties to

Purdue Pharmaceuticals, they concluded “The present trend of increasing medical use of opioid analgesics to treat pain does not appear to be contributing to increases in the health consequences of opioid analgesic abuse304.”

These alarming statistics and misappropriated conclusions beg the question: can we prevent opiate addiction? To answer this question, it is necessary to return to the reward circuit and discuss how other neurotransmitter systems, such as neurokinins, alter the reward pathway to affect dopamine release.

NEUROKININS IN THE REWARD PATHWAY

Even with the rather rudimentary techniques available in the 1970s (ie. lesion studies), SPergic projections were specifically found traveling from habenula (Hb) to the interpeduncular nucleus (IPN) and VTA via the fasciculus retroflexus305-308, the striatum to the substantia nigra via the striato-nigral pathway309, and the NAc to the ventral pallidum (specifically the nucleus basalis magnocellularis310), with further evidence supporting SP as a neurotransmitter

with vesicular release (Figure 1.173). At roughly the same time, the importance of dopamine in the mesolimbic and mesocortical pathways on drug seeking behavior was finally coming to fruition311-317. With the basic topography of SP signaling in place, the next step was determining its functionality in the mesolimbic system. Indeed, it was shown that SP could directly activate dopaminergic neurons in the VTA318-321.

While SPergic cell bodies have been found in a number of CNS foci including the septal complex, nucleus tractus diagonalis (diagonal band of

Broca), nucleus accumbens and habenula,322 with projections to various regions including the nucleus basalis magnocellularis, VTA, and interpeduncular nucleus, each constituent seems to have a unique function in the limbic loop. A recent report links NK1R activation to μ-opioid receptor recycling, offering direct evidence for a neurokinin mediated opioid resensitization.323 In fact, the neurokinin system is consistently found co-localized or in other ways affecting endogenous opioid, dopamine, and serotonergic signaling, thereby exerting its effect on affective and drug seeking behavior.324,325

NEUROKININS IN THE REWARD PATHWAY-VTA

Important to the reward pathway and the study thereof, the VTA most notably sends dopaminergic projections to the NAc where dopamine release triggers euphoria or positive reinforcement.326,327 Critically, intra-VTA injections of both an NK1R agonist and NK3R agonist facilitate dopamine release in the

328 NAc. Indeed, autoradiographic studies using the radiolabeled NK3R agonist

3 [ H]senktide confirmed the presence of NK3Rs in the VTA in addition to the IPN

329 and Hb. This complemented the previously studied NK1R localization in the

VTA amongst other CNS locations.330 While in vitro electrophysiologic studies in the VTA demonstrated NK3Rs may mediate more of the excitatory effects of dopaminergic neurons,331 in vivo electrophysiologic recordings in the VTA confirmed that systemic administration of an NK1R antagonist was sufficient to block dopamine cell firing.332 Notably, the firing rate of VTA dopaminergic neurons is in fact increased following VTA application of SP.333 These apparent discrepancies in dopaminergic activity and neurokinin pharmacology may be in part due to the marked heterogeneity of the VTA.334

The expression of various neurokinin receptor subtypes is rather diverse.

For example, while there is somatodendritic expression of the NK1R in the cell

335 membrane of dopaminergic and non-dopaminergic neurons of the VTA, NK3Rs are mostly found in the cytoplasm of dopaminergic and non-dopaminergic neurons of the VTA (however mostly non-dopaminergic).336,337 Additionally, the

NK3Rs found in the plasma membrane are mostly extrasynaptic. Furthermore,

VTA glia exhibit substantially more NK3Rs than NK1Rs, suggesting the importance of the immune cells in the reward pathway. Overall, the expression of

338 NK3Rs in the VTA is twice that of NK1Rs. Interestingly, NK3Rs, but not NK1R or

NK2Rs, were found within the nuclear envelope of projection neurons of the VTA.

This suggests the possibility of direct NK3R involvement in gene transcription.

Indeed, ligand-dependent and independent nuclear translocation of the NK3R in

the VTA has been observed.339,340 The significance of these nuclear events in the reward pathway has not been fully elucidated.

The literature on the NK2R in the VTA is sparse, however it has been shown that i.v. infusion of the selective NK2R antagonist SR-48968 did not alter basal dopaminergic firing rate.341 Peculiarly, the acute administration of SR-

48968 i.p. increased basal firing rate, however this may be due to dosing differences or possible pharmacologically active metabolites. The intracellular interaction between neurokinin receptors has also been studied. When expressed by the same cell, NK1R activation sequesters β-arrestins in

342 endosomes impeding ligand-dependent NK3R endocytosis. The paucity of information regarding how heterologous interactions between neurokinin receptors affects the reward pathway indicates the necessity of future research in addiction.

Some of the earliest investigations into neurokinin’s ability to functionally impel the reward pathway came in 1985 when Staubli and Huston showed that injection of SP into the medial forebrain bundle, the neuronal tract that connects the VTA to the NAc, resulted in positive conditioned place preference

(CPP).343,344 In regards to specific drugs of abuse, microinjection of the SP analog DiMe-C7 induced reinstatement of cocaine seeking behavior which could

345 be reduced by the D1 receptor antagonist SCH23390.

NEUROKININS IN THE REWARD PATHWAY-Nucleus Accumbens

The NAc is often regarded as the limbic-motor interface receiving inputs from the VTA, and amygdala among other regions and sending projections to the cortex, ventral pallidum, globus pallidus, and reciprocal projections to the VTA and amygdala.346 One study provided evidence that the NAc required input from both the VTA and the basolateral amygdala for excitation of NAc efferents.347

SP injected into the NAc by itself increases concentrations of extracellular DA but does not induce positive CPP.348 A SP antibody injected into the NAc prevents amphetamine induced increase of extracellular DA in the NAc.321 Likewise, NAc administration of the NK1R antagonist L-733,060 significantly diminishes cocaine induced DA release.349

NEUROKININS IN THE REWARD PATHWAY-Nucleus Basalis

Magnocellularis-Substantia Innominata

Evidence for SPergic fibers projecting to the nucleus basalis magnocellularis (nucleus basalis of Meynert) comes from simple light microscopic images and immunohistochemical staining.350 Accordingly, the injection of SP or the C-terminal fragment of SP into the nucleus basalis magnocellularis resulted in a positive CPP, which the authors attributed to the positive reinforcing effects of the specific C-terminal sequence of SP.351-353 The

C-terminal fragment is shared amongst all tachykinin ligands so resolving which receptor subtype was responsible was an obvious next step. With the use of selective agonists they went on to show that this effect was mediated by both

354 NK1R and NK3R activation. Further, SP injection into the nucleus basalis

magnocellularis indeed increased extracellular dopamine content in the NAc,355 a barometer of positive reinforcement. The fact that injection of the NK3R agonist amino-senktide into the nucleus basalis magnocellularis inhibits alcohol intake at first glance contradicts the aforementioned positive reinforcement.356,357 The authors speculated that alcohol may actually be mediating its effects on the reward pathway via NK3R, thereby rendering an NK3R agonist a substitute for the

358 rewarding properties of alcohol. Whether or not alcohol engages the NK3R system in the nucleus basalis magnocellularis remains to be seen.

NKB fibers have been traced from the dorsal and ventral striatum to the substantia innominate.359 Pre-protachykinin-B, the mRNA for NKB, has also been found heavily concentrated in fibers from the lateral stripe of the striatum, a region just lateral to the shell of the NAc, to the nucleus basalis magnocellularis.360 The importance of these projections in reward is not well understood, however it should be noted that NKB is the most efficacious endogenous ligand for the NK3R in mammals.

NEUROKININS IN THE REWARD PATHWAY-Habenula

The habenula is an understudied brain region let alone the role neurokinins play in its function. What we do know is that its white matter tracts tie it extensively to other regions of the limbic pathway including the ventral pallidum and ventral midbrain. Moreover, SPergic and NKBergic cell bodies are indeed found in the medial habenula with axons projecting to the VTA and the adjacent interpeduncular nucleus.361,362 The role of the VTA in reward is well described;

the interpeduncular nucleus also seems to contribute to positive reinforcement.363

The habenula has been long known to be involved in nicotine dependence and more recently cocaine and morphine as well.364 No studies to our knowledge have examined the direct role of habenular neurokinin antagonists on addictive behavior in animals, however NK1R and NK3Rs were found to be involved in nicotine induced excitation of habenular neurons.365

NEUROKININS IN THE REWARD PATHWAY-Amygdala

Neurokinin receptors have been found in relatively high concentrations in the amygdala of primates.366,367 Accordingly, SP microinjection into the central amygdala in one study enhanced passive avoidance learning behaviors368 and in another study generated conditioned place preference.369 While efferent projections from the amygdala are abundant and promiscuous, specific projections to regions of the limbic loop will be discussed here.

Regarding neurokinins in addiction, the ‘smoking gun’ of sorts came in the

-/- seminal 2000 Nature paper by Murtra et al when they documented NK1R exhibited a lack of morphine CPP.370 Knockouts additionally eliminated CPP to amphetamines but surprisingly retained a positive CPP to cocaine and food, indicating distinct mechanisms mediating reward for each of these natural and

371 unnatural rewards. The role of NK1R in opioid reward was further corroborated

-/- 372 using a self-administration paradigm in NK1R mice. To better understand which neuroanatomical location may play the principal role in neurokinin mediated opioid reward, SP-saporin (a ribosome inactivating toxin) was used to

ablate NK1R expressing neurons in the amygdala. Indeed, mice with ablation of

+ NK1R neurons in the amygdala demonstrated similar CPP scores for both morphine and saline.373 These observations support the role of the neurokinin system in facilitating opioid reward via amygdaloid processes, although it does not rule out the importance of other limbic regions. Importantly, the neurokinin knockout data is supported by the fact that intracerebral ventricular administration of an NK1R antagonist has no effect on cocaine self- administration,374 ruling out possible developmental confounders to the knockout

-/- mice. Though cocaine CPP was not altered in the NK1R mice, reinstatement of cocaine is in fact supplemented by administration of the SP analog

9 11 375 [Sar Met(O2) ]-SP. This at the very least implicates the neurokinin system in cocaine reinstatement, albeit endogenous SP may not play a role as two separate NK1R antagonists were unable to inhibit cocaine reinstatement.

Alcohol reward may be mediated in the amygdala as well. SP levels were lower in the central amygdala of Indiana alcohol preferring rats than nonpreferring rats as measured by SP mRNA.376 For that reason, the investigators microinfused SP into the central amygdala of alcohol preferring rats, rendering the animals indifferent to alcohol consumption while sucrose seeking remained the same. The apparent paradox in neurokinin signaling and alcohol reward has been noted twice now: SP injection in the nucleus basalis magnocellularis reduces alcohol consumption in Sardinian alcohol preferring rats and SP injection in the central amygdala facilitates a similar effect in Indiana alcohol preferring

rats. The concern with these studies lies in the fact that the alcohol preferring animals are selectively bred and do not represent the typical human or even rodent condition.377 These studies contradict the vast majority of studies in rodents and humans that indicate a neurokinin antagonist reduces alcohol preference378.

Illustrating this, mild and severe emotional stressors are sufficient to release SP in the medial amygdala.379,380 Clear evidence exists linking stress to alcoholic relapse381 so naturally, linking stress induced SP release to stress induced alcohol reinstatement was the logical next step. Expectedly, the NK1R antagonist, L822429, was adequate to prevent alcohol reinstatement in an alcohol self-administration paradigm in wild-type Wistar rats.382 A related study demonstrated efficacy of the NK1R antagonist in suppressing alcohol seeking in wild-type mice at baseline and in preventing escalation of voluntary alcohol

383 intake. Corroborating this data, NK1R silencing with a microRNA directed at the receptors’ transcript reduced alcohol consumption in mice.384 The study noted attenuated NK1R expression in the hippocampus, the only subcortical area they examined for proof of action. To the contrary, ezlopitant, the NK1R antagonist developed for chemotherapy induced nausea and vomiting (CINV) in the clinic, exhibited little to no efficacy in reducing operant self-administration of alcohol in Long-Evans rats.385 The aforementioned inconsistency raises a valid point about nonconserved regions of the neurokinin receptors between humans

and rodents, giving rise to potential obstacles in extrapolating preclinical models to the human condition.386

While stress has been shown to increase extracellular SP in the amygdala, it should be mentioned that SP and NKA have been found colocalized in neurons of the infundibulum of the CNS and myenteric plexus of enteric nervous system, a possibility that has not been specifically investigated in

387,388 neurons of the amygdala. In fact, NK2Rs do appear in a significant

389 concentration in the amygdala, and the NK2R antagonist SR48968 was sufficient to block stress induced behaviors in mice and central neuronal markers of stress in rats.390

An analogous pathway observed in the alcohol reward system in relation to neurokinin pharmacology is that observed with corticotropin releasing factor

(CRF)391-393. There is extensive research into the effects of CRF and other neuropeptides on addiction that are out of the scope of this review. It is generally accepted in the addiction field that the stress response is mediated by some of these neurotransmitter systems including CRF and SP, thus precipitating undesirable outcomes such as relapse394,395.

NEUROKININS IN THE REWARD PATHWAY-Frontal Cortex

The literature on neurokinins in the cortex is more scant than other brain regions; nevertheless cortical neurokinins seem to play an important role in the limbic system. As one of the terminal sites of mesencephalic dopaminergic projections, the medial prefrontal cortex has been shown to have increased

dopamine metabolites (DOPAC) in response to stress (ie. footshock).396,397 This increase in cortical dopamine is correlated to periods of intoxication and craving,

229,398 particularly with cocaine abuse. Pretreatment with the selective NK1R antagonist (S)-GR205171 i.p. was sufficient to prevent footshock induced dopamine release in the cortex.399 In addition to stress, morphine injections i.p. increased SP levels in the cortex which subsequently dropped significantly when naloxone was introduced.400 The relative importance of the frontal cortex in neurokinin mediated addiction is not entirely understood and warrants further exploration.

A NOVEL STRATEGY TO COMBAT THE OPIOID EPIDEMIC

Although opioids are profusely abused and have led to the opioid epidemic we now experience in the United States, 100 million Americans suffering from chronic pain still need to be attended to with efficacious analgesics401. Recent extended release and other pharmacokinetic perturbing formulations have been developed, but even those are under scrutiny for the potential of increasing unintended opioid induced injury402. While suggestions in the mainstream media to combat the opioid epidemic include removing opioids from the physician’s toolbox403, multiple strategies to develop efficacious pain relievers that lack the potential for abuse do exist.

As outlined above, SP has a storied role in propagating both the nociceptive and reward pathways in the peripheral and central nervous

systems404. As an undecapeptide (11-amino acids) with principle biological activity at the NK1R, SP has been shown to induce unique behavioral outputs in animals from pronociceptive flinching and scratching behaviors when administered i.t.405, to positive CPP when administered to multiple CNS nuclei343.

Therefore, the neurokinin system is a very attractive pharmacological target for both pain and addiction. While the analgesic morphine has the propensity to inhibit presynaptic SP release from dorsal root ganglia neurons in the spinal cord85, it also maintains the ability to indirectly increase dopaminergic cell firing in the VTA of the midbrain by inhibiting tonically active inhibitory GABAergic

256 neurons . Although NK1Rs are located in the VTA amongst other CNS regions330, and their activation with SP elicits dopaminergic firing333, the role of

SP in mediating the rewarding action of drugs of abuse is far from clear.

In this thesis, I sought to further characterize the physiology of neurokinins in mediating opioid reward. Performing both acute and chronic studies I asked the following questions:

- Is SP acutely increased in the VTA following morphine administration, and

if so, what is the cellular target and neuronal circuitry mediating this

effect?

- Does SP act via VTA NK1R to drive dopamine release in the NAc and

does this correspond to a behavioral signature?

- Based on the pharmacology and physiology of opioid/neurokinin

interactions, can a novel, non-addictive narcotic be developed?

Here, with the assistance and resources of the Vanderah Lab, I show that engineering the genome with CRISPR-Cas9 to knockout the NK1R specifically in the VTA, while leaving the neuronal circuit intact in adult rats, renders morphine non-rewarding. Additionally, we demonstrate that morphine exerts its rewarding actions, at least in part, by inhibiting GABAergic input onto SP neurons in the

VTA, subsequently increasing SP release onto dopaminergic neurons (Figure

1.2). Finally, I pursued a bivalent pharmacophore with activity as a μ/δ opioid agonist and NK1R antagonist to inhibit nociception in an animal model of acute pain while lacking the positive reinforcement as indicated by NAc extracellular dopamine release and conditioned place preference studies.

Figure 1.1

FIGURE 1.1: NEUROKININ SIGNALING IN THE REWARD PATHWAY Illustration demonstrating specific known neurokinin projections in the CNS involved in reward processing. Illustration by Alexander J. Sandweiss ©2015

Figure 1.2

FIGURE 1.2 SCHEMATIC OF VTA NEURONAL SIGNALING IN THE REWARD

PATHWAY Inhibitory GABAergic neurons (red) maintain tonic control over dopamine cells (blue) in the ventral tegmental area (VTA) of the midbrain, preventing their release of dopamine in the nucleus accumbens (NAc) of the ventral striatum. Opiates like morphine inhibit GABAergic neurons, thus preventing the release of GABA onto dopamine neurons. This disinhibition allows dopamine cells to fire and release their contents in the NAc. Dopamine in the NAc relays positive reinforcement. We hypothesize that GABAergic neurons also maintain inhibitory control over substance p

(SP) cells (green). When morphine inhibits GABAergic neurons, SPergic neurons fire and release their contents onto dopamine cells, acting as a “driver” of dopamine function.

CHAPTER 2: MATERIALS AND METHODS

2.1 ANIMALS

Male Sprague Dawley rats (250-300g) and male ICR (20-25g) mice purchased from Harlan (Indianapolis, IN) were housed in a climate controlled room on a regular 12 hour light/dark cycle with lights on at 7:00 am with food and water ad libitum. Rats were housed 3 per cage and split into 1 per cage after surgeries for all microdialysis, and spinal nerve ligation (SNL) studies; mice were housed 5 per cage and used for acute tail flick in a hot water bath and flinching studies. All procedures were performed during the 12-hour light cycle and according to the policies and recommendations of the International Association for the Study of Pain, the NIH guidelines for laboratory animals, and were approved by the IACUC of the University of Arizona.

2.3 SURGICAL TECHNIQUES

Microdialysis Guide Cannula Implantation

Rats were anesthetized with 80% ketamine/20% xylazine and stereotaxically fixed (Stoelting). For VTA microdialysis experiments, a guide cannula (AG-10, EiCom) was lowered 7.5mm through a burr hole drilled in the skull at P: 5.0mm, L: 0.7mm from bregma. The guide cannula was fixed in place with dental cement and a dummy probe (AD-10, EiCom) was screwed in place to maintain guide cannula patency and the animal was given prophylactic subcutaneous antibiotic (gentamycin, 1mg/kg).

Animals were allowed to recover for 3 days before microdialysis experiments.

For NAc microdialysis experiments, NAc microdialysis and VTA microinjection guide cannulas were installed. For the NAc, a microdialysis guide cannula (AG-8, EiCom) was lowered 6.0mm through a hole drilled in the skull at

A: 1.7mm, L: 1.0mm from bregma. A dummy probe (AD-8, EiCom) was screwed in place to maintain guide cannula patency. The VTA microinjector guide cannula

(22GA, 10mm length from pedestal, PlasticsOne) was lowered 7.5mm through a hole drilled at P: 5.0mm, L: 0.7mm from bregma. The NAc and VTA guide cannulas were fixed in place with dental cement and the animal was given prophylactic subcutaneous antibiotic (gentamycin, 1mg/kg). Rats were then allowed to recover for 3 days before executing microdialysis experiments.

Lumbar i.t. catheter implant surgery for spinal drug delivery in rats

Male Sprague-Dawley rats were prepared with intrathecal catheters as described by Yaksh and Rudy for direct central drug administration406. Rats were anesthetized with 80% ketamine/20% xylazine (1mg/kg, i.p.) and placed in a stereotaxic frame (Stoelting). The cisterna magna was opened and a 7.5cm catheter (PE10) was implanted in the spinal column, terminating in the lumbar region. The catheter was sewn into the cervical muscle to maintain its position and animals were given prophylactic subcutaneous antibiotic (gentamycin,

1mg/kg). The rats were allowed to recover for 7 days before SNL surgeries and

sham surgeries were performed. Any animals exhibiting paralysis were excluded from further surgeries or testing.

Spinal nerve ligation for induction of neuropathic pain in rats

SNL was utilized to induce neuropathic pain as described by Chung et

407 al . Animals were anesthetized with 5% isoflurane in O2 (2.5L/min) and subsequently maintained with 2.5% isoflurane. The left lumbar/sacral region of the dorsal vertebral column was exposed and the left L6 vertebra was removed.

Both L5 and L6 nerves were individually ligated with 4-0 suture silk. The incision was closed and the animals were allowed to recover for 7 days. Animals exhibiting motor deficiencies or a lack of tactile allodynia were excluded from further testing. Sham control animals underwent the same procedures excluding the ligation of the L5/L6 nerves.

NK1R KO CRISPR DESIGN gRNA design for Tacr1 gene targeting

Our strategy was to target the tachykinin receptor 1 (Tacr1) gene using a gRNA designed to match the 5’ end of the protein sequence which is most likely to result in a complete loss of the protein. We identified and extracted the sequence of the Tacr1 gene from the genomic sequence of the chromosome 4 from Sprague-dawley rat (AC_000072.1). To design the gRNA sequence, we screened for potential off-targets using the gRNA design tool

(http://crispr.mit.edu)408. No potential gRNA sequence met our criteria of selectivity in the first exon from the Tacr1 gene, thus the gRNA selected for knockout was located in the exon 2 (on the reverse strand:

GATGACCACTTTGGTAGCCG, score 89) (Figure 2.1). As a control, we chose a gRNA targeting the same gene but in a non-coding region located in the intron 1 of the Tacr1 gene (on the reverse strand: gTAAAATGGATATTTCGGTGC, score

89, a g was added at the 5’ end to ensure better expression downstream of the

U6 promoter)409.

Cloning of gRNAs

We used the pSpCas9(BB)-2A-GFP plasmid (PX458, Cat#48138,

Addgene, Cambridge, MA)410 that allows for simultaneous expression of the

Cas9 enzyme with the gRNA and green fluorescent protein (GFP) to control for transfection efficiency. The plasmid was cut using BbsI restriction enzyme according to manufacturer’s instructions (Cat#FD1014; Thermo Fisher Scientific;

Waltham, MA). The digested plasmid was extracted from a 1% agarose gel

(Cat#K0691; Thermo Fisher Scientific; Waltham, MA). Oligonucleotides were designed410 for the cloning of either exon 2 targeting gRNA (Tacr1 forward: 5’-

CACCGATGACCACTTTGGTAGCCG-3’; Tacr1 reverse: 5’-

AAACCGGCTACCAAAGTGGTCATC-3’) or intron 1 targeting gRNA (Tacr1 control forward: 5’- CACCGTAAAATGGATATTTCGGTGC-3’; Tacr1 control reverse: AAACGCACCGAAATATCCATTTTAC) and were obtained from

Eurofins. A 10 µM solution of forward and reverse oligonucleotides was annealed in a thermocycler using the following protocol: 37°C for 30 min, 95°C for 5 min, with a cooling to 25°C at a rate of 5°C.min-1. Then, 100 ng of the digested pSpCas9(BB)-2A-GFP plasmid was set up for ligation with 50 nM of the annealed oligonucleotides at 22°C for 5 min using Rapid DNA ligation Kit

(Cat#K1422; Thermo Fisher Scientific; Waltham, MA). The ligation products were transformed into E. coli DH5α competent bacteria (Cat#C2987; New England

Biolabs; Ipswich, MA) according to manufacturer’s instructions. The integrity of all plasmids was checked by Sanger sequencing (Eurofins). A 100% efficiency was observed for the insertion of gRNA sequences into the pSpCas9(BB)-2A-GFP plasmid. Plasmids were purified from DH5α E. coli using the NucleoBond® Xtra

Maxi kit (Cat# 740414, Macherey-Nagel, Germany).

INJECTION TECHNIQUES in vivo transfection of CRISPR plasmids

For in vivo transfection, the plasmids pSpCas9(BB)-2A-GFP-Tacr1-gRNA or pSpCas9(BB)-2A-GFP-Tacr1-control-gRNA were diluted to 0.5 µg/µl in 5% sterile glucose solution. Then, Turbofect in vivo transfection reagent (Cat#R0541,

Thermo Fisher Scientific,Waltham,MA) was added following manufacturer’s instructions. Finally, 0.5 µL of the plasmid complexes were injected into the VTA, bilaterally, of Sprague Dawley rats.

Rats were anesthetized with 5% isoflurane in O2 (2.5L/min) and maintained at 2.5% isoflurane fixed in a stereotaxic frame. Animals were microinjected NK1R gRNA/Cas9 or blank directly into the VTA bilaterally, but each side individually, for a total volume of 0.5μL over 5 min per side. The cannula was slowly removed and the burr hole was filled with bone wax (Medline

Industries, Inc); animals were given prophylactic subcutaneous antibiotic

(gentamycin, 1mg/kg) and were used for CPP experiments 3 weeks later.

Figure 2.1

FIGURE 2.1 CRISPR gRNA DESIGN AND SEQUENCE Tacr1 gene is located on chromosome 4 of the rat. The viable encoding region exon 2 was selected for gRNA complimentary design based on the highest selectivity score using the CRISPR design tool (http://crispr.mit.edu). Intron 1 was selected as a non-coding control region. Both regions of the gene possess the necessary PAM sequence for Cas9 functionality (CCA).

in vivo PRECLINICAL ASSAYS

Microdialysis in the NAc and VTA

Microdialysis experiments were performed 3 days after surgical implantation of the guide cannulas. For the VTA microdialysis experiments, the dummy probe was removed from the guide and a microdialysis probe (AZ-10-2,

EiCom) was inserted and screwed into place. The probe was attached to a cannular swivel at the top of the cage to allow for real time sampling in awake, freely moving rats. The microdialysis probe was perfused with artificial cerebral spinal fluid (aCSF, NaCl 147mM, KCl 2.8mM, CaCl2 1.2mM MgCl2 1.2mM) at a rate 0.5μL/min. VTA dialysate was collected in microcentrifuge tubes containing

1μL aprotinin placed in an automated, cooled, timed turnstile set to 1 hour bins.

Baseline microdialysis was run for 2 hours before any pharmacological manipulations. Morphine (10mg/kg) or vehicle (saline) were injected i.p. and 4 dialysate samples over 4 hours were collected. After each hour, the microcentrifuge tube was snap frozen in liquid nitrogen and subsequently stored at -80°C until the dialysate was analyzed for SP content. VTA dialysate was analyzed for SP using a commercial SP ELISA (R&D Systems).

For the NAc microdialysis experiments, the dummy probe was removed from the guide cannula and a microdialysis probe (AZ-8-2, EiCom) was inserted and screwed into place. Perfusing the probe at a rate of 2μL/min, dialysate was collected in cooled microcentrifuge tubes containing an antioxidant solution (L- cysteine 6mM, Oxalic acid 2.0mM, Glacial Acetic Acid 1.3%) to prevent the

oxidation of dopamine and collected in 30 min bins. Baseline microdialysis was run for 2 hours before any pharmacological manipulations in the VTA. Drugs

(either morphine 5μg, SP 1 μg, L-732,138 1μg, TY032 2μg, or vehicle) were administered in 0.5μL volumes over 50 seconds (0.01μL/second) directly into the

VTA via the surgically installed VTA guide cannula. Briefly, the dummy probe was removed at the time of drug administration and a prefilled 2μL Hamilton syringe was attached to the VTA guide cannula. Drugs were administered slowly to ensure minimal disruption of the VTA parenchyma. Dialysate was collected every 30 min for 3 hours; cocaine 20mg/kg was then injected i.p. as a positive control for NAc extracellular dopamine content. Microcentrifuge tubes were stored in -80°C until HPLC analysis for dopamine content. NAc dialysate was analyzed using HPLC (Agilent 1100, Coulochem III 5014B electrochemical detector). Briefly, Catecholamines were separated using a MD-150 analytical column and MD-TM mobile phase (ESA) with 9% acetonitrile. The flow rate was set to 0.4mL/min and Agilent Chemstation software was used to analyze the chromatograms. Dopamine levels are reported as %change from baseline.

Microdialysis probe verification

Following microdialysis experiments, animals were sacrificed, brains harvested and fixed in 4% paraformaldehyde, and VTA/NAc blocks were sectioned in 40μm increments in the coronal orientation on a cryostat (Microm HM 525) and mounted on Superfrost Plus microscope slides. Slides were viewed

microscopically for visual identification of NAc and VTA cannula placements.

Terminations of the guide cannulas were plotted on a rat brain atlas411 for verification.

Conditioned place preference paradigm

There were two experiments involving the CPP paradigm: 1) to determine if CRISPR-Cas9 knockout of NK1R in the VTA prevented systemic morphine

CPP; 2) to determine if systemic TY032 produced rewarding behaviors in naïve animals.

Three weeks post VTA Cas9 injections, animals were baselined in a modified, three chambered, rat-conditioned place preference/aversion

(CPP/CPA) apparatus (San Diego Instruments, San Diego, CA) as previously reported 412: 1) end chamber with rough floor and horizontal black/white striped walls; 2) end chamber with smooth floor and solid black walls; 3) center chamber with solid grey walls and metal rod flooring. Rats were placed in the center chamber and a 15 minute recording period indicated entrance into chambers and time spent in chambers. Any rat with >80% preference to any chamber during baseline was excluded from the study. The rats were subdivided into morphine

(10mg/kg, i.p.), TY032 (10mg/kg, i.p.) or vehicle (1mL/kg, i.p.) groups and trained to associate one end chamber with the experimental drug and the other with vehicle for 15 min, alternating days for a total of five drug exposures. After ten

days of training, animals are placed in the center chamber and time spent in all three chambers is recorded over 15 min. CPP score is calculated as:

CPP score = time spent in drug paired chamberexp – time spent in drug paired chamberBL

IHC to verify NK1 receptor knockdown

Following CPP experiments, rats were sacrificed via transcardial perfusion with

0.1M PB and 4% paraformaldehyde for tissue fixing. The brains were removed; the VTA was blocked and placed in 4% paraformaldehyde for 30 min followed by

30% sucrose in 0.1M PB for 2 days or until the specimen sunk. The VTA was sliced in coronal, 40μm thick sections and placed in cooled 0.1M PB in a 12-well plate. The sections were placed in 1% sodium borohydride for 30 min followed by a copious rinse with 0.1M PB 3 X 10 min. Sections were then rinsed in 0.1M Tris saline 2 X 5 min followed by an incubation in 0.5% BSA in Tris saline for 30 min for blocking. Tissue specimens were transferred to scintillation vials with a fine brush and incubated in anti-NK1 receptor primary antibody (1:5000; RA25001,

Neuromics) in 0.1%BSA/0.25% triton in Tris saline for 2 days at 4°C. Following incubation, tissue was transferred to 12-well plate with fine brush and rinsed with

0.1M Tris saline 3 X 10 min. The slices were then incubated and light protected in anti-rabbit secondary antibody (Alexa-Flour goat anti-rabbit, 1:800) in 0.1%

BSA/0.1M Tris saline for 2 hours at room temperature. With continued protection

from light, the tissue was rinsed in 0.1M Tris saline 3 X 10 min and then 0.1M PB

3 X 10 min. The tissue was mounted onto slides in 0.05M PB and cover-slipped with Prolong Gold Antifade w/DAPI. Images were viewed on a UV scope and merged.

Acute thermal nociception in mice

Warm water bath (52 °C) was used as a nociceptive stimulus to assay acute thermal nociception in mice. The thermal tail withdrawal latency (TWL) was defined as the time (seconds) from immersion of the tail in water to its withdrawal. Baseline values for all animals were obtained prior to drug administration; animals were excluded if their TWL was greater than 7 s at baseline. Administration of compounds in mice were performed via intrathecal

(i.t.) injection using a slightly modified method of the Hylden and Wilcox technique 405,413. A 10μL Hamilton injector fitted with a 30-guage needle was used to administer 5μL. Tail-flick times were then measured every 20 minutes for

2 hours. A cut-off latency of 10.0 s was implemented to prevent tissue damage to the distal third of the tail.

Maximal percent efficacy was calculated and expressed as:

% Antinociception = 100*(test latency after drug treatment –baseline latency)/(cutoff – baseline latency)

SP-induced nocifensive behaviors in mice

SP i.t. elicits nocifensive behaviors such as flinching as previously described 63.

We injected mice i.t. with TY032 (3μg/5μL), naloxone (1mg/kg), and SP

(0.3μg/5μL) and observed flinching behavior for 5 min to determine if the NK1 antagonist blocked these elicited behaviors. Naloxone or vehicle was injected 15 min prior to TY032 or vehicle, which was subsequently injected 5 minutes prior to

SP injection.

Thermal hypersensitivity

Rats were assessed for thermal hypersensitivity using a modified method developed by Hargreaves et al414. Animals were allowed to acclimate for thirty minutes in a Plexiglas enclosure fixed on a clear glass plate. A mobile radiant infrared (IR) heat source was focused onto the left hind paw from underneath the glass plate. A standard infrared intensity was used for all animals and an automatic cutoff point of 32.4 s was set to prevent tissue damage. The heat source and timer were activated simultaneously by the experimenter and cutoff by a motion detector on the apparatus focused directly on the plantar surface of the left hindpaw. Pre-injury was assessed prior to SNL; post-injury baseline was assessed prior to i.t. drug administration. Paw withdrawal latencies (PWL) were collected every 20 minutes for 3 hours after i.t. drug administration.

Mechanical allodynia

Rats were assessed for mechanical allodynia one week after SNL induced neuropathic pain using calibrated von Frey filaments (0.4-15.0g). First, rats were allowed to acclimate in suspended wire-mesh cages for 30 min. The von Frey filaments were used to probe the plantar surface of the left hind paw perpendicularly. A response was elicited when the animal retracted the hind paw off the wire-mesh floor. Pre-injury was assessed prior to SNL; post-injury baseline was assessed prior to i.t. drug administration via the surgically installed i.t. catheter. von Frey filament probing was repeated every 20 minutes for 3 hours after i.t. administration.

Rotarod motor impairment

Male Sprague-Dawley rats were trained to walk on a spinning rotarod device

(Columbus Instruments International, Columbus, OH) as described by Vanderah et al.415 until all animals were able to remain on the rotating platform for 180s at a speed of 10 revolutions per minute. Following i.t. administration of TY032 or vehicle via the surgically installed i.t. catheter, the length of time the rats were able to remain on the device without falling was recorded at 20 minute intervals for 120 minutes.

STATISTICAL ANALYSES

Data were analyzed by nonparametric two-way analysis of variance (ANOVA; post-hoc Student-Newman-Keuls), one-way ANOVA, and Student’s t-test when appropriate. Data were plotted in GraphPad Prism 7 (GraphPad Software, La

Jolla, CA) and represent the mean ± SEM with statistical significance represented by p < 0.05.

CHAPTER 3: SUBSTANCE P IN THE VTA

3.1 Systemic morphine acutely increases intra-VTA SP release via disinhibition of GABAergic neurons

To examine the role SP plays in opiate activation of the reward circuit, we employed microdialysis in both the NAc and VTA of male Sprague Dawley rats

(Figure 3.1). Intraperitoneal administration of morphine sulfate (10mg/kg) significantly increased VTA SP release in the first hour compared to vehicle

(75.72 ± 19.01 pg/mL, n=7, and 39.79 ± 5.53 pg/mL, n=10, respectively; p<0.005;

Figure 3.2A). SP release returned to baseline following the first hour of increased release in the morphine treated animals. Area under the curve (AUC) analysis was conducted; the AUC was 108.7 ± 15.75 for vehicle treated animals.

Morphine treated animals exhibited a statistically significant increase in AUC of

SP release in the VTA (207.1 ± 45.65, p<0.05; Figure 3.2B).

It is established that morphine inhibits the firing of GABAergic neurons in the VTA preventing the release of the inhibitory neurotransmitter GABA onto dopaminergic neurons256. As such, opioid mediated disinhibition has been recognized as the primary mechanism of dopamine firing in the VTA. To assess our hypothesis that GABAergic tone additionally inhibits SP firing and subsequent release, we administered the GABAA receptor antagonist bicuculline directly into the VTA via reverse microdialysis while sampling the endogenous

CSF for SP release. Twenty minutes post VTA administration of bicuculline

(n=9), SP release was significantly increased to +62.87 ± 11.52% of BL

compared to vehicle treated animals (-15.49 ± 4.64% of BL, n=8; p<0.0001;

Figure 3.3A). AUC was graphed demonstrating a significant increase in SP release in bicuculline treated animals (94.63 ± 5.96, n=9) vs vehicle (60.66 ±

10.52, n=6; p<0.05; Figure 3.3B). Only animals verified to have the guide cannula correctly positioned in the VTA were used in the analysis of data (Figure

3.4). Systemic morphine study: 17/19 animals used in data analysis following surgery, experiment, and probe verification. The VTA-bicuculline study included

17/21 animals following surgeries, experiment, and probe verification.

Figure 3.1

FIGURE 3.1 ILLUSTRATION OF VTA MICRODIALYSIS PROTOCOL A guide cannula is installed 1mm superior to the VTA such that when the microdialysis probe is inserted for the experiment, it will protrude 1mm past the guide and perfuse the VTA.

Figure 3.2

FIGURE 3.2 SYSTEMIC MORPHINE ACUTELY INCREASES SP RELEASE IN THE

VTA (A) Rats demonstrated a baseline VTA [SP] of 46.51 ± 9.34 pg/mL and 37.92 ±

4.58 pg/mL for morphine and vehicle groups respectively. I.P. injection of morphine

10mg/kg induced significantly increased SP release (75.72 ± 19.01 pg/mL, n=7) in the

VTA for 1 hour post injection compared to vehicle treated animals (39.79 ± 5.53 pg/mL, n=10) and returned to baseline by hour 2. (B) AUC was graphed for vehicle vs morphine groups over the microdialysis time course. AUC for vehicle treated animals was 108.7 ±

15.75; AUC was statistically significant for morphine 10mg/kg treated animals (207.1 ±

45.65). *p<0.05, **p<0.005

Figure 3.3

FIGURE 3.3 BICUCULLINE INFUSION INTO THE VTA INCREASES SP RELEASE IN

THE VTA (A) Rats demonstrated a baseline VTA [SP] of 28.97 ± 1.64 pg/mL and 28.41

± 1.61 pg/mL for bicuculline and vehicle groups respectively. VTA infusion via reverse microdialysis of bicuculline 10μM induced significantly increased SP release (44.73 ±

4.22 pg/mL, n=9) in the VTA for 1 hour post administration compared to vehicle treated animals (24.15 ± 1.85 pg/mL, n=8) and returned to baseline by hour 2. (B) AUC was graphed for vehicle vs bicuculline groups over the microdialysis time course. AUC for vehicle treated animals was 60.66 ± 10.52; AUC was statistically significant for bicuculline 10μM treated animals (94.63 ± 5.96). *p<0.05, **p<0.005 ****p<0.0001

Figure 3.4

FIGURE 3.4: REPRESENTATIVE VTA MICRODIALYSIS PROBE VERIFICATION Only those animals that were microscopically verified to have guide cannulas properly installed in the VTA were used in data analyses. This is a representative plot done for all experiments.

Intra-VTA NK1 antagonist blocks morphine induced dopamine release in the

NAc

Following the studies investigating how morphine impacts SP release in the VTA, we sought to determine how SP in the VTA affects NAc dopamine release in vivo using microdialysis (Figure 3.5). Morphine was dissolved in saline while SP was dissolved in 10% DMSO, 10% Tween, 80% saline. Intra-VTA administration of morphine 5μg/0.5μL (n=6) or SP 1μg/0.5μL (n=6) significantly increased NAc dopamine release 30-60 min post injection compared to their respective vehicle treated animals (saline n=5, p<0.05 and DMSO/Twn/saline n=7, p<0.05 respectively; Figure 3.6A). AUC was graphed demonstrating a significantly increased effect on NAc dopamine release after VTA morphine (8752 ± 3162, n=6, p<0.05) and SP (10331 ± 2247, n=6, p<0.05) administration compared to their respective vehicle controls (Figure 3.6B). 24/31 animals were included in data analysis following surgeries, experiments, and probe verifications. We next sought to block intra-VTA SP induced dopamine release with the NK1R antagonist L-732,138. When administered in conjunction with SP, intra-VTA L-

732,138 had no significant effect on dopamine release in the NAc compared to vehicle (Figure 3.7). 16/29 animals were included in data analysis for this study following surgeries, experiments, and probe verification. To determine if the

NK1R antagonist could attenuate intra-VTA morphine induced dopamine release, we administered the NK1R antagonist L-732, 138 1μg/0.5μL in conjunction with morphine 5μg/0.5μL directly into the VTA and measured dopamine release in the

NAc. The combination did not significantly increase dopamine release (n=8) compared to vehicle treated animals (n=7; Figure 3.8). 19/27 animals were included in data analysis for this study following surgeries, experiments, and probe verification.

Only animals with proper VTA microinjector and NAc microdialysis guide cannula placements were included in data analysis (Figure 3.9).

Figure 3.5

FIGURE 3.5: SCHEMATIC OF VTA MICROINJECTION AND NAc MICRODIALYSIS A

VTA microinjector guide cannula and NAc microdialysis guide cannula are installed.

During the experiment, compounds are injected into the VTA and dopamine release is sampled in the NAc.

Figure 3.6

FIGURE 3.6: INTRA-VTA ADMINISTRATION OF MORPHINE OR SP INCREASES

DOPAMINE RELEASE IN THE NAc (A) % change of dopamine release was measured in the NAc of freely moving rats after VTA injection of morphine 5μg/0.5μL and SP

1μg/0.5μL. Values are compared to baseline dopamine release which is set at 0%, the average of two consecutive baseline collections before drug administration. Morphine administration (n=6) significantly increased DA release +78.23 ± 30.19% in the 30-60min time point compared to saline (-2.54 ± 7.53%, n=5). SP administration (n=6) significantly increased DA release +74.47 ± 34.91% in the 30-60min time point compared to

DMSO/Twn/Sal (-1.09 ± 9.06%, n=7). (B) AUC was constructed using the 0-180min time points. Saline AUC for DA release was -705.9 ± 1178; morphine was significantly increased (8752 ± 3162). DMSO/Twn/Sal produced an AUC of 867.9 ± 323.7 while SP produced a significantly larger AUC (10331 ± 2274). Time course analyzed with Two-

Way ANOVA corrected for multiple comparisons; AUC analyzed with One-way ANOVA;

*p<0.05, **p<0.005.

Figure 3.7

FIGURE 3.7: NK1R ANTAGONIST PREVENTS SP INDUCED DOPAMINE RELEASE

The NK1R antagonist was administered in the VTA with SP to determine if it blocks SP induced DA release in the NAc. Values are expressed as % change from baseline with baseline set at 0%. L-732,138 1μg/0.5μL (n=5) did not produce a significant change in

DA release compared to vehicle during the time course. SP produced a significant increase in DA release, peaking at 30-60min post administration (+74.47 ± 34.91%, n=6) compared to vehicle. The combination treatment of L-732,138 and SP (n=5) produced no significant change compared to vehicle treated animals. Data analyzed with Two-way

ANOVA for time course; *p<0.05, **p<0.005

Figure 3.8

FIGURE 3.8: NK1R ANTAGONIST PREVENTS MORPHINE INDUCED DOPAMINE

RELEASE The ability of morphine to induce DA release in the NAc was assessed in the presence of the NK1R antagonist L-732,138. DA release is presented as % change from baseline. Vehicles did not significantly change DA release from baseline, nor did L-

732,138 by itself. Morphine administration in the VTA induced a significant increase in

DA release, peaking at the 30-60min time point (+78.23 ± 30.19%) compared to vehicle.

The combination of L-732,138 and morphine administration into the VTA did not significantly change DA release in the NAc. Time course data analyzed with Two-Way

ANOVA with multiple comparisons. *p<0.05, **p<0.005.

100

Figure 3.9

FIGURE 3.9: REPRESENTATIVE VTA MICROINJECTOR AND NAc MICRODIALYSIS

PROBE VERIFICATION Only those animals with both anatomically verified VTA microinjector and NAc microdialysis guide cannula placement were used in data analysis. This is a representative plot done for all experiments.

101

3.2 CRISPR-Cas9 knockout of NK1R in the VTA prevents morphine CPP

We next investigated whether selectively knocking out the NK1R gene, Tacr1, specifically in the VTA of male Sprague-Dawley rats would block CPP to morphine. Three weeks after injecting the animals in the VTA with the

CRISPR/Cas9 plasmid with the gRNA targeting either exon 2 (NK1R KO; Figure

3.10) or intron 1 (control) of the Tacr1 gene, we began a training paradigm for morphine 10mg/kg and assessed the animal’s preference after 10 days. Control animals trained with morphine (n=18) exhibited significantly elevated CPP scores compared to vehicle treated animals (n=11; 144.93 ± 50.17 and -13.52 ± 46.61 respectively, p<0.05; Figure 3.11). VTA-NK1R KO animals (n=16) exhibited no difference in CPP score to morphine compared to vehicle treated animals (n=11,

-25.63 ± 33.95 and -30.52 ± 46.61 respectively) while the KO group was significantly different than the controls trained to morphine (p<0.01). For 55 days post CRISPR-Cas9 injection, both NK1R KO and control groups gained body weight at the same rate (Figure 3.12), indicating the reward processing for food intake/appetite was still intact while the reward processing of opioids was rendered nonfunctional. NK1R densities were compared between KO and control animals using immunohistochemistry (Figure 3.13a). Control animals displayed a

NK1R density of 2.73 ± 0.73 while KO animals displayed significantly decreased receptor densities (0.77 ± 0.15, p<0.05; Figure 3.13b).

102

Figure 3.10

FIGURE 3.10: ILLUSTRATION OF CRISPR ACTING ON NK1R GENE The gRNA and

Cas9 endonuclease are injected into the VTA of male rats. They are delivered into the nucleus where the gRNA binds the complimentary sequence of DNA in the genome and a binding pocket of the Cas9 protein. The Cas9 will then make a double stranded cut with enzymatic endonuclease activity. The gRNA is directed towards exon 2 of the NK1R gene found on chromosome 4 of the rat genome.

103

Figure 3.11

FIGURE 3.11: CRISPR-Cas9 MEDIATED KO OF NK1R IN VTA INHIBITS CPP TO

MORPHINE Rats were assessed for preference to morphine after a 10 day training paradigm. Saline treated animals in the Control CRISPR and NK1R CRISPR groups had a CPP score of -13.43 ± 44.09 (n=11) and -30.52 ± 46.61 (n=11) respectively. The

Control CRISPR group paired with morphine had a significantly increased CPP score of

144.9 ± 50.17 (n=17) while the NK1R CRISPR animals paired with morphine had an average CPP score of -25.63 ± 33.95 (n=16), which was not statistically significant from vehicle treated animals. *p<0.05, **p<0.005.

104

Figure 3.12

FIGURE 3.12: CRISPR MEDIATED KO OF NK1R IN VTA DOES NOT AFFECT

FEEDING IN RATS Following injection of either Control CRISPR or NK1R CRISPR, animals were weighed for up to 55 days. Animals weighed 279.44 ± 1.76g and 278.57 ±

2.34g on the day of injection in the Control and NK1R CRISPR groups respectively. They gained weight at approximately the same rate for 55 days, at which point they weighed

372.22 ± 5.30g and 386.43 ± 5.46g for the Control and NK1R KO groups respectively.

Data analyzed by Two-Way ANOVA.

105

Figure 3.13

106

FIGURE 3.13: CRISPR MEDIATED KO OF NK1R IN VTA REDUCES NK1R DENSITY

IN VTA (A) Representative immunohistochemical images of NK1R in Blank CRISPR and

NK1R KO CRISPR animals with DAPI co-stain. (B) Quantification of pixel density representing NK1R expression. NK1R KO CRISPR animals have a significantly reduced standardized density (NK1R density/DAPI density). Blank CRISPR animals have an average standardized density of 2.73 ± 0.73 (n=9) while NK1R KO CRISPR animals have an average standardized density of 0.77 ± 0.15 (n=7). Data was analyzed using unpaired t test. *p<005.

107

CHAPTER 4: TY032 INHIBITS NOCICEPTION IN ANIMAL MODELS OF PAIN

With evidence that SP, via the NK1R, plays an important role in mediating opioid induced reward, we sought to assess the analgesic efficacy of multifunctional compounds, acting as an agonist at the opioid receptors and antagonist at the NK1R. We assessed AKG-177, AKG-CRA-137, and TY032.

TY032 found success as an antinociceptive agent so it was further pharmacologically characterized.

TY032 is a bivalent compound: The N-terminus (H-Dmt-D-Ala-Gly-Phe) is chemically based off of biphalin, an endogenous opioid with activity at both μ- and δ-opioid receptors. The C-terminus (Pro-Leu-Trp-NH-[3’,5’-(CF3)2-Bzl]) is modeled after the NK1R antagonist L-732,138, and a hinge region (Met) connects

416 the two pharmacophores . The compound possesses a μ-Ki=2.0nM, δ-Ki=0.18, and NK1R-Ki=2.3nM in the rat. Functionally, the compound possesses an

IC50=1.8 ± 0.6nM in electrically stimulated mouse vas deferens (δ), IC50=19 ±

5nM in electrically stimulated guinea pig ileum (μ), IC50=7.5 ± 0.5nM at guinea

416 pig ileum in the presence of SP (NK1) .

4.1 ACUTE NOCICEPTION

MOUSE TAIL FLICK ASSAY

The mouse tail flick assay utilizes a hot water bath to assess tail withdrawal latency (TWL) before and after compound administration in otherwise naïve animals. Experiments herein utilized ICR mice for tail flick assays.

AKG-177 (a modified opioid agonist/NK1R antagonist)

108

Four doses of AKG-177 (1, 3, 10 and 30 µg/5 µL; n=6-11/treatment) or vehicle were evaluated in mice using tail withdrawal latency (TWL) in a hot water bath. TWL of mice given AKG-177 (3 µg/5 µL, i.t.) were significantly higher than vehicle-treated mice and baseline values (p < 0.001) 30 min after the injection

(Figure 4.1). In contrast, the other doses of AKG-177 (1, 10 and 30 µg/5 µL) did not significantly increase PWLs compared to baseline values or vehicle treated controls. Notably, 2 of the 6 animals injected with 30 µg/5 µL exhibited seizures within 10 seconds of injection and succumbed; therefore the 30 µg group was removed from further analysis. Additionally, 1 out of 10 animals treated with 10

µg in 5 µL seized immediately after administration for approximately 10 seconds but survived. The area under the curve (AUC) was determined and was significantly increased for the 3 µg dose compared to vehicle (p<0.0001) while the other doses were not significantly increased. The % antinociception of peak effect, 30min, was 47.3% of max response however due to the compound terminating some of the animals, a dose-response curve was not constructed.

AKG-CRA-137 (a modified opioid agonist/NK1R antagonist)

Three doses of AKG-CRA-137(1, 3, and 10 µg/5 µL; n=5/treatment) or vehicle were evaluated in mice using tail withdrawal latency (TWL) in a hot water bath. TWL of mice given AKG-CRA-137 (both 1 and 3 µg/5 µL, i.t.) were significantly higher than vehicle-treated mice and baseline values (p < 0.01) 15 min after the injection (Figure 4.2). Mice given 10μg/5μL had significantly increased TWL at 30 min compared to vehicle. Notably, 2 of the 5 animals

109

injected with 1 µg/5 µL dose and 1 of the 5 animals injected with the 10 µg/5 µL dose exhibited immediate lower limb paralysis that lasted 15 seconds but then recovered and were indistinguishable from their littermates. Additionally, 1 out of

5 animals treated with 3 µg/5 µL immediately perished following the injection.

The area under the curve (AUC) was not significantly increased for any of the doses compared to vehicle. The % antinociception of peak effect, 15min, was

45.15% of max response in the 1 μg/5 μL dose. Interestingly, % antinociception trended downward as greater doses were used. For this reason, a dose- response curve was not constructed.

TY032 (a modified opioid agonist/NK1R antagonist)

TY032 3μg/5μL (n=5) significantly increased the tail withdrawal latency to

7.72 ± 1.33 sec 40 min post injection, compared to vehicle treated animals (n=7,

2.70 ± 0.40 sec, p<0.0005; Figure 4.3). Since TY032 was efficacious as an antinociceptive, we sought to further pharmacologically characterize the compound. To assess the opioidergic activity of our compound in vivo, we pretreated with naloxone 1mg/kg (n=7) which reduced TY032 antinociception by about 50% and was not significantly different from vehicle treated animals.

110

Figure 4.1

FIGURE 4.1: AKG-177 DOES NOT SAFELY PROVIDE SIGNIFICANT

ANTINOCICEPTION IN A DOSE DEPENDENT MANOR A response vs time graph was constructed using various doses of AKG-177 (data not shown). From the graph, AUC was constructed (shown above). Vehicle treated mice had an average AUC of 437.4 ±

200.9 (n=11). Only the 3μg dose had a significant antinociceptive effect on mice using the tail flick assay; those animals had an average AUC of 3396 ± 1227 (n=6). ***p<0.001

111

Figure 4.2

FIGURE 4.2: AKG-CRA-137 DOES NOT SAFELY PROVIDE SIGNIFICANT

ANTINOCICEPTION IN A DOSE DEPENDENT MANOR A response vs time graph was constructed using various doses of AKG-CRA-137 (data not shown). From the graph,

AUC was constructed (shown above). Vehicle treated mice had an average AUC of 237

± 101.1 (n=5). All three doses of the compound trended upward for antinociceptive efficacy, but none were significant.

112

Figure 4.3

FIGURE 4.3: TY032 PROVIDES SIGNIFICANT ANTINOCICEPTION IN MOUSE

TAILFLICK ASSAY, PARTIALLY BLOCKED BY NALOXONE Baseline values for TWL were 4.06 ± 0.15s and 3.30 ± 1.39s in vehicle and TY032 groups respectively. TY032

3μg/5μL significantly increased TWL from 20-120min post intrathecal administration, peaking at 40 min (7.79 ± 1.33s, n=5) compared to vehicle. Pretreatment with I.P. naloxone trended the TWL downward with a peak TWL at 60min (5.04 ± 0.48s, n=7).

Data analyzed using Two-way ANOVA with multiple comparisons; *p<0.05, **p<0.005,

***p<0.001, ****p<0.0005

113

INTRATHECAL SP INDUCED FLINCHING AND BITING

To further assess the functional pharmacological properties of TY032, we investigated if the compound would inhibit SP induced flinching in mice, with naloxone on board. SP 0.3μg/5μL (n=7) significantly increased flinching and scratching to 19.43 ± 3.48 in 5 min compared to vehicle (n=7, 1.14 ± 0.46 in 5 min, p<0.005; Figure 4.4). With naloxone 1mg/kg already on board, i.t. TY032

3μg/5μL (n=7) significantly reduced SP induced flinching and scratching to 4.86 ±

1.77 in 5 min (p<0.05). With naloxone already on board, this suggests TY032 is inhibiting SP induced flinching via its actions at the NK1R, not via its opioidergic activity.

RAT HARGREAVES ASSAY

Intravenous administration of TY032 10mg/kg (n=6) significantly increased

PWL in naïve animals, and thus percent antinociception, from 15-120min compared to vehicle, peaking at 15 min (+79.11 ± 6.15% s, p<0.005; Figure

4.5A).

Intraperitoneal administration of TY032 10mg/kg (n=6) significantly increased PWL in naïve animals, and thus percent antinociception, 15 min postinjection to +55.02 ± 12.95% BL compared to vehicle treated animals (n=6,

+16.94 ± 10.50% BL, p<0.005; Figure 4.5B). Percent-antinociception remained significantly elevated compared to vehicle 2 hours post-injection (p<0.05) and returned to baseline by 2.5 hours.

114

Figure 4.4

FIGURE 4.4: TY032 PREVENTS INTRATHECAL SP INDUCED FLINCHING AND

BITING BEHAVIORS, PARTIALLY BLOCKED BY NALOXONE Intrathecal administration of SP significantly increases the number of flinches in 5min compared to vehicle treated mice (19.43 ± 3.48 flinches, n=7, vs 1.14 ± 0.46 flinches, n=7, respectively). Pre-administration of intrathecal TY032 3μg/5μL and i.p. naloxone 1mg/kg significantly attenuated the number of flinches in 5 min (4.86 ± 1.77 flinches, n=7). Data analyzed using One-way ANOVA;

115

Figure 4.5

116

FIGURE 4.5: PERIPHERALLY ADMINISTERED TY032 PROVIDES SIGNIFICANT

ANTINOCICEPTION IN HARGREAVES THERMAL ASSAY (A) % antinociception is compared to baseline after assessing paw withdrawal latency in the Hargreaves thermal assay. 15 min post I.V. administration of TY032 10mg/kg, % antinociception significantly increases compared to vehicle (79.11 ± 6.15%, n=6 and 14.77 ± 10.42%, n=6 respectively), and remains statistically significant for 90min post administration before returning to baseline. (B) 15 min post I.P. administration of TY032 10mg/kg % antinociception was significantly increased to 55.02 ± 12.95%, n=6 compared to vehicle.

% antinociception remained elevated until 120min post administration, after which it returned to baseline. Time course analyzed using Two-way ANOVA with multiple comparisons; *p<0.05, **p<0.005

117

4.2 NEUROPATHIC PAIN

Spinal Nerve Ligation (SNL) was employed to induce a peripheral neuropathic pain state in the left hind-paw, which sensitizes the animal to nociceptive stimuli after 7 days.

THERMAL HYPERALGESIA

Animals exhibited a pre-injury baseline (BL) paw withdrawal latency (PWL) of 19.36 ± 0.148 s to the noxious thermal stimulus (Figure 4.6A). Seven days post SNL surgery, animals had a significantly reduced PWL of 8.05 ± 0.97 s

(p<0.0001). Intrathecal TY032 dose dependently increased PWL to thermal stimuli, peaking 20 minutes post administration to 22.44 ± 3.19 s (p<0.0001) for the 1.0μg/0.5μL dose. Using the 20 min time point, the peak effect, a dose response curve was generated and the A50 was determined to be 0.213 ± 0.51

μg/0.5μL (Figure 4.6B).

MECHANICAL ALLODYNIA

SNL was used to introduce a neuropathic pain insult, as above, and

TY032 was assessed for its antinociceptive efficacy in inhibiting mechanical allodynia. Pre-injury BL paw withdrawal threshold (PWT) was 15.0 ± 0.0 g

(Figure 4.7A). Seven days post injury, the PWT was significantly reduced to

1.735 ± 0.147 g (p<0.0001). TY032 dose dependently increased PWT peaking

80 min post intrathecal administration at 9.66 ± 1.81 g for the 0.3μg/0.5μL dose

(p<0.0001).

118

MOTOR IMPAIRMENT

To assess whether or not the compound produces motor impairment, a phenomenon known to occur with opioid drugs224, we employed the rotarod test in male rats and measured the latency with which the animals fall off the rotating walker. Animals administered intrathecal TY032 (n=6) remained on the rotating walker as long as vehicle treated animals (n=8) over the 120min testing period

(Figure 4.8). This indicates animals administered TY032 do not exhibit motor impairment.

119

Figure 4.6

120

FIGURE 4.6: INTRATHECAL TY032 PROVIDES DOSE DEPENDENT

ANTIHYPERAGESIA IN RAT MODEL OF NEUROPATHIC PAIN (A) Pre-injury baseline PWL was 19.04 ± 0.79s for all animals (n=33). Post-injury (SNL) baseline was significantly reduced to 8.85 ± 0.78s. Intrathecal TY032 1μg/5μL had the greatest antinociceptive effect at the 20min time point, significantly increasing PWL to 22.44 ±

3.19s (n=7) compared to vehicle (10.08 ± 1.08s, n=12). (B) A dose response curve was constructed for the 20 min time point. The A50 was calculated to be 0.1174μg/5μL. Time course analyzed using Two-way ANOVA with multiple comparisons; **p<0.005.

121

Figure 4.7

122

FIGURE 4.7: INTRATHECAL TY032 PROVIDES DOSE DEPENDENT

ANTIALLODYNIA IN RAT MODEL OF NEUROPATHIC PAIN (A) Pre-injury baseline

PWT was 15.0 ± 0.0g for all animals (n=37). Post-injury (SNL) baseline was significantly reduced to 2.06 ± 0.55g. Intrathecal TY032 0.3μg/5μL had the greatest antinociceptive effect at the 80min time point, significantly increasing PWT to 9.66 ± 1.81g (n=11) compared to vehicle (2.80 ± 1.05g, n=14). (B) A dose response curve was constructed for the 80 min time point. The A50 was calculated to be 0.167μg/5μL. Time course analyzed using Two-way ANOVA with multiple comparisons; **p<0.005.

123

Figure 4.8

FIGURE 4.8: INTRATHECAL TY032 DOES NOT PRODUCE MOTOR IMPAIRMENT

Baseline rotarod latencies were 180.0 ± 0.0s for both vehicle and TY032 treated animals. Animals exhibited similar rotarod latencies over the 120min testing period. Time course data analyzed with Two-way ANOVA with multiple comparisons.

124

CHAPTER 5: TY032 IS NOT ADDICTIVE

5.1 TY032 DOES NOT INCREASE DOPAMINE RELEASE

TY032 2.0μg/0.5μL was injected into the VTA while NAc extracellular fluid was collected via microdialysis to quantify dopamine release. TY032 (n=6) did not change dopamine release compared to vehicle (n=7; 10% DMSO, 10%

Tween, 80% saline) treated animals (Figure 5.1A). Only animals with positive dopamine release following i.p. cocaine administration and with NAc/VTA probes anatomically verified were used in the data analyses. 13/17 animals were used for data analysis for this study following surgeries, experiments, and probe verification.

5.2 ANIMALS DO NOT SEEK TY032 AFTER CPP PARADIGM

With TY032 demonstrating antinociceptive efficacy in mice and rats, and a lack of NAc dopamine release following VTA administration, we next investigated whether it has the potential for abuse. We enlisted the CPP paradigm described above wherein we paired male Sprague-Dawley rats with TY032 10mg/kg, morphine 10mg/kg, or vehicle with a particular chamber of the training box. After ten days we assessed their propensity to spend time in the chamber in which they received the paired drug (ie. preference). The vehicle for morphine was saline while the vehicle used for TY032 was 10% DMSO, 10% Tween, 80% saline. Saline training (n=15) produced a CPP score of 4.087 ± 40.64 while morphine 10mg/kg (n=13) produced a significantly increased CPP score of 128.0

125

± 41.76 (p<0.05; Figure 5.1B). The vehicle for TY032 (n=13) produced a CPP score of -13.85 ± 38.41; TY032 10mg/kg (n=14) did not produce a statistically significant difference in CPP score (1.11 ± 49.1) compared to vehicle, indicating that while TY032 does produce antinociceptive characteristics when administered systemically, it does not produce preference.

126

Figure 5.1

127

FIGURE 5.1: TY032 DOES NOT POSSESS THE POTENTIAL FOR ABUSE (A) NAc microdialysis was used to assess dopamine release following VTA injection of TY032

2μg/0.5μL. Values are expressed as % change from baseline. TY032 did not significantly change dopamine release in the NAc compared to vehicle or morphine/L-

732,138 over the 180min time course. (B) Systemic TY032 was assessed for preference after 10 days of the conditioned place preference paradigm. I.P. morphine 10mg/kg

(n=13) produced a significantly positive CPP score of 128 ± 41.76 compared to vehicle treated animals (n=15). TY032 10mg/kg (n=14) did not significantly increase CPP score compared to vehicle (1.11 ± 49.1 and -13.85 ± 38.41 respectively). Data analyzed using

One-way ANOVA; *p<0.05.

128

CHAPTER 6: DISCUSSION

The United States is in the midst of what is being called “The Opioid

Epidemic417.” With a brief overview of the history of pain and narcotics, it is not difficult to understand how we arrived at such concerns. Currently, chronic pain affects 100 million Americans, or 30% of the US population417, more than those affected by heart disease, cancer and diabetes combined418. In the 1990s, multiple individuals and agencies, with the best intentions in mind, called for greater control of pain specifically with the available opioids419. This, in combination with spurious promotion and marketing of new opioid analgesics despite a void of evidence, led to a vast increase in prescription opioid use420.

Particularly egregious, Purdue Pharmaceuticals aggressively marketed their

1996 blockbuster analgesic OxyContin, a slow release formulation of oxycodone.

Court documents reveal Purdue Pharmaceuticals claimed that OxyContin tablets, owing to their extended release formulations, were extremely difficult to abuse, although their own study shows a drug abuser can extract 68% of the oxycodone, a notion Purdue pleaded guilty to421. With examples like this and the fact that potential abusers were increasingly able to attain prescription narcotics through online, no-script pharmacies422, it is not challenging to predict the upcoming consequences423.

With the enormous increase in opioid prescriptions and sales in the

1990s424, the rise in opioid overdoses and mortality unsurprisingly followed425.

The scientific community, health professionals, NIH, CDC, and the FDA426,

129

perhaps reflexively, collaborated on multiple initiatives to reduce prescription opioid overdoses and mortality, leading to unintended consequences. The abuse of prescription opioids transitioned into abuse of street opioids like heroin427,428 introducing the US to a full-scale opioid epidemic, prescription and illicit. Now, not only do 100 million Americans still suffer from chronic pain, but 2.5 million suffer from opioid abuse285 placing researchers at an interesting crossroads of two epidemics429. It is the view of many that the health profession is responsible for acquainting the US to the opioid epidemic, and that as such, it is the responsibility of the health profession to confront it.

To combat both the pain epidemic and opioid epidemic simultaneously, a novel analgesic that effectively relieves pain but does not have the potential for abuse must be introduced. The interaction between opioids and neurokinins is a logical place to begin as an NK1R antagonist has been shown to inhibit the reinforcing properties of heroin430. As one of the primary nociceptive neurotransmitters in the dorsal horn of the spinal cord, the 11-amino acid peptide

SP is released upon noxious stimulation of peripheral DRG fibers431,432 where it propagates the ascending nociceptive signal to the brain by acting at postsynaptic NK1R. Opioids acting at μ-opioid receptors inhibit the release of SP from the primary afferent by blocking Ca2+ influx and by direct interaction between the βγ-complex and the synaptosome-associated protein (SNAP-25)184.

Various pain states have a profound effect on the neurokinin system in the nociceptive signaling process. Inflammatory conditions increase SP expression in

130

128,433 primary afferents and NK1R expression in superficial laminae of the dorsal horn123,124. Chronic use of opioids leads to increased inflammatory responses, possibly contributing to tolerance and, paradoxically, opioid induced

434,435 hyperalgesia, an effect blocked by NK1R antagonists .

In the reward circuitry, it is clear that opioids indirectly activate dopaminergic neurons in the VTA of the midbrain436, a physiological mechanism potentially responsible for the opioid epidemic. SP also activates dopaminergic neurons in the midbrain, but in a more direct fashion: NK1R is expressed on dopamine neurons437. With such extensive overlap and interaction in pain processing and mediation, we investigated the role SP and the neurokinin system plays in promoting opioid induced activation of the reward circuitry. This information directed the design of a bivalent, trifunctional antinociceptive compound that lacks the potential for abuse in animals.

Here, the data indicate that SP plays an important role in mediating opioid activation of the reward pathway. Not only does morphine inhibit GABAergic input directly onto dopamine neurons (the canonical model), but it also relieves tonic inhibition of SP containing neurons that apparently drive dopamine firing.

Using microdialysis, we sampled the VTA extracellular fluid and analyzed the content for SP using an ELISA. SP release was significantly increased in the first hour after systemic morphine administration. While some reports indicate SP levels are altered in the brain after chronic opiate exposure400, this is the first evidence that SP may in fact be mediating some of the transient neuronal effects

131

of morphine in the VTA. Since morphine signals via inhibitory G-proteins, we next asked how it increases SP release and hypothesized it was likely due to disinhibition of GABAergic control, a precedent established in the literature in the

438 early 1980s . Indeed bicuculline, the GABAAR antagonist, acutely increased SP release in the VTA when administered through the VTA probe via reverse microdialysis. When SP was administered directly into the VTA, an increase in dopamine release in the NAc shortly followed, authenticating our hypothesis that morphine indirectly activates dopamine cells by first indirectly activating SPergic neurons. This makes sense as simply relieving the “brakes” off of dopamine cells would not explain what “drives” them. We provide compelling evidence that SP is, at the very least, a co-driver of dopamine neurons. The excitatory amino acid neurotransmitter glutamate is almost certainly another co-driver of dopaminergic firing439; perhaps SP and glutamate are co-released from the same cell, much like in the dorsal horn of the spinal cord107. This is an avenue of research we would like to investigate in future studies.

Of interesting note about the NAc microdialysis experiments, it appears that systemic cocaine administration does not increase dopamine release to the same extent in NK1R antagonist treated animals compared to vehicle or

SP/morphine treated animals. While cocaine was only used as a positive control to ensure proper installation of the microdialysis guide cannula, and indeed it does increase dopamine release after administration, the amount released does not trend as high in those NK1R antagonist treated animals. Proper experimental

132

controls would be necessary to positively establish this link as this facet of the experiment is out of the scope of our primary goal. However it is fascinating to speculate how the neurokinin system plays a role in cocaine reward and potentially abuse in people. There is a precedent in the literature for the neurokinin system affecting striatal dopamine release in response to cocaine440 and preventing sensitization after chronic cocaine441. This makes sense because cocaine prevents the reuptake of dopamine in the synaptic cleft by inhibiting the function of the dopamine transporter (DAT). If the NK1R antagonist blocks dopamine release in the first place, cocaine has no potential to prevent its reuptake. This may be in stark contrast to the role VTA neurokinins play in amphetamine induced increase in dopamine release. Amphetamines work by directly binding to synaptic proteins in the presynaptic terminal, activating fusion of vesicles and release of dopamine. It seems unlikely that VTA NK1R antagonists would acutely block that effect. When administered into the NAc

442 however, NK1R antagonists do block amphetamine’s pro-dopamine effect .

Prior to this study, the necessity of SP neurons and their cognate receptor

-/- in the reward pathway was undeniable. Whole body NK1R exhibit a lack of

CPP370 and self-administration372 to morphine indicating a crucial role for the neurokinin system in mediating reward to opiates, albeit the role of neurodevelopmental neurokinins cannot be ruled out and precise brain regions facilitating this effect are not clear. Granted, a loss of CPP to morphine was seen

+ when amygdaloid NK1R cells were ablated using a SP-conjugated saporin to

133

induce cell death373, it seems plausible that eliminating an entire facet of the limbic loop would block the neuronal signaling involved in reward, much like cutting a wire would shut off an electrical circuit in series. More indicative of the role the tachykinins play in the reward circuit would be a set of experiments that localized the receptor knockout with in vivo genetic engineering while leaving intact the neurons that facilitate the neuronal signaling.

In the past, specific gene editing was executed with tools such as zinc- finger nucleases (ZFN)443,444 and transcription activator-like effector nucleases

(TALENs)445,446, two exciting genome engineering tools that required a new, tailored nuclease designed for the gene of interest. Although exciting tools, the feasibility, efficiency, and speed with which genes could be altered through the required protein-DNA interactions are suspect. Clustered regularly interspaced short palindromic repeat (CRISPR) systems such as Cas9, developed for scientific research in 2012408,447-449, requires only a complimentary guide RNA

(gRNA) for the gene of interest and a ubiquitous endonuclease, be it one of the many Cas proteins like Cas9449, Cpf1450, or others, and is opening new avenues for medical research by generating novel models of disease systems in vivo451.

The highly error prone DNA repair mechanism non-homologous end joining

(NHEJ)452 produces either insertions or deletions into the gene after the double stranded break by the endonuclease. This effectively removes the gene from the cell; and thus, an in vivo method to knockout a gene in a specific group of cells in an adult animal. The benefits of this method include avoiding

134

neurodevelopmental detriments of breeding out NK1R, localizing the knockout to a specific nuclei of cells in the brain (the VTA), and otherwise maintaining the health of those neurons. While interfering RNA (RNAi) may promise to achieve a similar goal by suppressing the expression of certain genes, temporal control is lost as the injection does not permanently silence the gene. It may require multiple injections to attain lasting effect, thus potentially introducing a loss of spatial control as well. CRISPR-Cas9 allows for both temporal and spatial control of the NK1R in the VTA; a region specific and permanent knockout.

There are numerous methods for delivering the necessary CRISPR components to a cell including liposomal delivery which directly carries the Cas9 protein and gRNA themselves to the cell, or electroporation of plasmids which are fast and efficient but often require prenatal intervention. We chose to transfect the cells with a proprietary cationic polymer called TurboFect which forms a stable positively charged core around the plasmid DNA. The plasmid is introduced to the VTA and penetrates, likely, into every cell with the payload in tow. The plasmid contains genes for the Cas9, the gRNA, and green fluorescent protein to ensure proper delivery to the region of interest. After injection, we allowed the plasmid to “incubate” in the animals for 3 weeks before experimental manipulations, appropriately permitting time for the NK1R gene to be removed.

We tracked the weight of CRISPR modified animals since physically and genetically manipulating the VTA could conceivably alter appetitive signaling in

453-456 the animal . Animals from both the control and NK1R KO groups gained

135

weight at the same rate over the course of 2 months, indicating that our manipulations did not affect their appetitive circuitry and food intake.

Three weeks after the bilateral VTA plasmid injections, the animals were used in the CPP paradigm. Half of the controls were trained with saline, the other half with morphine; half of the knockouts were likewise trained with saline and half with morphine. The control animals trained with morphine exhibited a positive CPP score. That is, they indicated they preferred morphine as many

457 papers in the literature have shown before . NK1R KO animals trained with morphine however did not exhibit a positive CPP score. They displayed no preference for either chamber of the CPP box indicating neurokinin signaling in the VTA is necessary for morphine conditioned place preference. This makes sense and corroborates the acute microdialysis data as NK1R antagonists in the

VTA were sufficient to block morphine induced dopamine release. In the NK1R

KO animals, it may be inferred that each morphine treatment did not acutely increase dopamine release in the NAc, such that the 10 day training paradigm did not promote euphoria, positive reinforcement, and thus preference.

Determining experimentally with microdialysis if dopamine release is blocked acutely in the NK1R KO animals post-morphine administration is indicated and represents a necessary future investigation to complete this proposition.

After the CPP experiments, animals were sacrificed and IHC was employed to histologically verify the CRISPR mediated NK1R knockouts. Indeed animals receiving NK1R KO CRISPR injections had a significantly reduced

136

standardized NK1R density compared to controls. DAPI staining was similar between the two groups indicating a lack of cell death in the experimental group.

Electrophysiological studies in the VTA have great potential to inform about the neural circuitry in the reward pathway. While the studies conducted here provide evidence that opioids inhibit GABAergic tone on SP neurons, thus increasing SP release onto dopamine neurons, electrophysiology may corroborate this theory and solidify this model. SP neurons are extremely difficult to patch, a process that may be too inefficient to attempt. However, with the combination of pharmacological and electrophysiological manipulation of dopamine neurons, it may be possible to support our working model, a goal for future studies. Additionally, IHC studies in the VTA can further our understanding of the neuronal circuitry in the reward system. For instance, probing for the coexpression of SP and GABAAR would provide compelling evidence that GABA signaling directly suppresses SP release in the VTA. The lack of operational

GABAAR antibodies developed for use in IHC has hindered our progress in this facet. Further optimization for our current target, the α2-subunit of the GABAA receptor, may be warranted.

Understanding the physiology of the neurokinin system in the brainstem and how it mediates opiate reward was important in guiding our efforts to develop non-addictive analgesics. Multiple compounds were assessed, first by a simple tail flick model of acute thermal nociception in mice. The goal was to fully assess and characterize the pharmacological properties of opioid agonist/NK1R

137

antagonist compounds in vivo. Intrathecal AKG-177 and AKG-CRA-137 did not possess substantial antinociceptive activity in the hot water bath assay so they weren’t further characterized using other models. An interesting point is raised here however about the utility of animal models of pain and warrants a brief aside.

There are certainly difficulties in the use of animal models of pain. For one, frustration has mounted over the last few decades at the limited success of translational studies, despite increasingly successful preclinical studies that provide new information about our physiology458. It is important to remember what questions a particular nociception assay can answer. For example, the hot water tail flick assay is likely limited to answering the question “does this compound attenuate the spinal reflex in response to an acute thermal stimulus?”

That’s an important distinction from “does this compound prevent pain?” With the appropriate recognition of limitations a particular nociceptive assay carries with it, data can be interpreted to an extent. In the case of the hot water tail flick assay, it may be used as a filter of sorts to prevent ineffective compounds from moving forward.

TY032 on the other hand did provide significant antinociception in the hot water tail flick assay, an effect partially attenuated by naloxone. This suggests that despite the opioid component of the compound rendered inactive, the NK1R antagonist pharmacophore is still acting, likely in the dorsal horn, to attenuate the spinal reflex and thus increase the latency of tail flick. When administered

138

systemically (both i.v. and i.p.), TY032 produced significant antinociception in the

Hargreave’s thermal nociception assay. While pharmacokinetic studies including blood-brain-barrier or blood-spinal-barrier permeability were not performed per se, the results of these systemic administration studies provide compelling evidence that TY032 does in fact reach its site of action in the dorsal horn and supra-spinal processing locations. Of course there are peripherally acting analgesics459 including the local anesthetics460, and opioid receptors are found along the peripheral primary afferent axon and maybe even produce modest analgesia there, particularly in non-naïve states461,462. But in naïve animals, it’s likely that the opioid agonist/NK1R antagonist are penetrating into the dorsal horn to exert their antinociceptive effects.

To further pharmacologically characterize the compound, we tested its ability to inhibit SP induced flinching. Intrathecal SP produced robust flinching over the course of 5 min as previously described63. TY032 significantly reduced the number of SP induced flinches in 5 min. One concern in the functional characterization of the compound is that μ-receptor activation alone may be sufficient to prevent flinching. To mitigate this conundrum, we pretreated animals with naloxone before intrathecal TY032 and still saw a significant reduction in SP induced flinching indicating that indeed it is the NK1R antagonist pharmacophore that is mediating that inhibition. This study provides evidence for two notions.

First, it decidedly shows that TY032 is in fact producing its antinociceptive effects through both pharmacophores. Second, it provides a foundation for the potential

139

to relieve inflammatory pain specifically. Studies involving inflammatory pain were not conducted here but it would be prudent to assess TY032 in an inflammatory pain model as inflammation produces an upregulation in SP content in the primary afferent.

We next assessed its antinociceptive properties in a model of neuropathic pain. The spinal nerve ligation (SNL) is sufficient to produce thermal hyperalgesia and mechanical allodynia in the hind paw 7 days post-injury. It has been shown that in addition to the inflammatory model, neuropathic pain also increases SP immunoreactivity in the dorsal horn124 lending itself as a worthy model to investigate the antihyperalgesic effects of TY032. Indeed, in assessing both thermal hyperalgesia and mechanical allodynia, TY032 produces a dose dependent effect. Additionally, TY032 did not induce motor impairment often seen with opioid containing compounds463. This is an important control experiment as motor impairment has the ability to disguise a lack of hind paw response as antinociception.

Finally, TY032 was assessed for its potential for abuse. We combined interpretations from two distinct experiments to make an informed conclusion about this compound. First, when administered directly to the VTA, TY032 had no acute effect on NAc dopamine release. Second, when animals were paired with TY032 in the CPP paradigm, they displayed no preference for the compound over vehicle, unlike that with which they displayed for morphine. These data indicate that TY032 lacks the potential for abuse by blocking the activation of the

140

NK1R in the VTA. The limitations however should be noted. In the microdialysis experiment, animals were administered the compound and extracellular fluid from the NAc was assessed in the acute setting. This does not exclude the potential for plastic changes in the VTA after multiple exposures and thus changes in dopamine release after the first day. It may be judicious to extend the microdialysis out past one day, or even run the experiment after multiple days of

TY032 exposure. It also doesn’t exclude the possibility that other regions of the brain that are known to modulate NAc dopamine release may indeed activate the reward circuitry even with TY032 on board. This can’t be inferred when TY032 is only administered in the VTA. However, with a lack of CPP following systemic administration of TY032, we believe this substantiates our claim that the NK1R pharmacophore is indeed preventing the opiate’s action on VTA dopamine cells.

A logical counterclaim would be that the compound isn’t penetrating into the CNS and thus the opiate isn’t reaching the VTA. A pharmacokinetic study analyzing its

BBB permeability would be necessary to demonstrate one way or the other if the compound is reaching its CNS targets.

The neurokinin system is a validated CNS target to block opiate induced reward. This has driven our efforts at rational drug design, with help from the wonderful chemists at The University of Arizona, to develop a novel analgesic that activates the opiate system to produce analgesia, but blocks the neurokinin signaling system to prevent activation of the reward circuitry. TY032 represents the future of analgesics: dual, even tri-functional compounds acting through

141

multiple mechanisms of the nociceptive and reward pathways to provide patients with the pain relief they so desperately need and the peace of mind they deserve.

142

APPENDIX: PUBLICATIONS

ACCEPTED AND SUBMITTED AS OF JUNE 2016

PAGES 143-209

Alexander T. Podolsky, Alexander Sandweiss, Jackie Hu, Edward J. Bilsky, Jim P. Cain, Vlad K. Kumirov, Yeon Sun Lee, Victor J. Hruby, Ruben S. Vardanyan, Todd W. Vanderah. “Novel fentanyl-based dual μ/δ-opioid agonists for the treatment of acute and chronic pain.” Life Sciences, Volume 93, Issues 25–26, 18 December 2013, Pages 1010-1016

Yeon Sun Lee, Dhanasekaran Muthu, Sara M. Hall, Cyf Ramos-Colon, David Rankin, Jackie Hu, Alexander J. Sandweiss, Milena De Felice, Jennifer Yanhua Xie, Todd W. Vanderah, Frank Porreca, Josephine Lai, and Victor J. Hruby. “Discovery of Amphipathic Dynorphin A Analogues to Inhibit the Neuroexcitatory Effects of Dynorphin A through Bradykinin Receptors in the Spinal Cord.” Journal of the American Chemical Society 2014 136 (18), 6608-6616.

Alexander J. Sandweiss, Todd W. Vanderah. “The Pharmacology of Neurokinin Receptors in Addiction: Prospects for Therapy.” Substance Abuse and Rehabilitation, Volume 2015:6, September 2015, pages 93-102.

Alexander J. Sandweiss, Todd W. Vanderah. “The Pharmacology of Neurokinin Receptors in Addiction: Prospects for Therapy.” Re-print with permission in University of Arizona Journal of Medicine. Volume 1, February 2016.

Ruben S. Vardanyan, James P. Cain, Sahgar Mowlazadeh Haghighi, Vlad K. Kumirov, Mary I. McIntosh, Alexander J. Sandweiss, Frank Porreca, Victor J. Hruby. “Synthesis and investigation of mixed μ- and δ-opioid agonists as possible bivalent ligands for treatment of pain.” Journal of Heterocyclic Chemistry. Online Preprint. June, 2016.

Alexander J. Sandweiss, Karissa E. Cottier, Mary I. McIntosh, Gregory Dussor, Thomas Davis, Todd W. Vanderah, Tally Largent-Milnes. “17-β-estradiol induces cortical spreading depression and pain behavior in alert female rats.” Manuscript Submitted to Headache, June 2016.

143

Life Sciences 93 (2013) 1010–1016

Contents lists available at ScienceDirect

Life Sciences

journal homepage: www.elsevier.com/locate/lifescie

Novel fentanyl-based dual μ/δ-opioid agonists for the treatment of acute and chronic pain

Alexander T. Podolsky a, Alexander Sandweiss a,JackieHua,EdwardJ.Bilskyc, Jim P. Cain b,VladK.Kumirovb, Yeon Sun Lee b,VictorJ.Hrubyb, Ruben S. Vardanyan b,ToddW.Vanderaha,c,⁎ a Department of Pharmacology, College of Medicine, University of Arizona, Tucson, AZ, USA b Department of Chemistry, University of Arizona, Tucson, AZ, USA c Department of Biomedical Sciences, College of Osteopathic Medicine, University of New England, Biddeford, ME, USA article info abstract

Article history: Approximately one third of the adult U.S. population suffers from some type of on-going, chronic pain annually, Received 14 July 2013 and many more will have some type of acute pain associated with trauma or surgery. First-line therapies for mod- Accepted 19 September 2013 erate to severe pain include prescriptions for common mu opioid receptor agonists such as morphine and its various derivatives. The epidemic use, misuse and diversion of prescription opioids have highlighted just one of the Keywords: adverse effects of mu opioid analgesics. Alternative approaches include novel opioids that target delta or kappa Chronic pain Allodynia opioid receptors, or compounds that interact with two or more of the opioid receptors. Hyperalgesia Aims: Here we report the pharmacology of a newly synthesized bifunctional opioid agonist (RV-Jim-C3) derived Inflammatory from combined structures of fentanyl and enkephalin in rodents. RV-Jim-C3 has high affinity binding to both mu Mice and delta opioid receptors. Rat Main methods: Mice and rats were used to test RV-Jim-C3 in a tailflick test with and without opioid selective an- Fentanyl tagonist for antinociception. RV-Jim-C3 was tested for anti-inflammatory and antihypersensitivity effects in a mu opioid model of formalin-induced flinching and spinal nerve ligation. To rule out motor impairment, rotarod was tested Delta opioid in rats. Spinal nerve ligation Key findings: RV-Jim-C3 demonstrates potent-efficacious activity in several in vivo pain models including inflam- Formalin flinch fi Naloxone matory pain, antihyperalgesia and antiallodynic with no signi cant motor impairment. Significance: This is the first report of a fentanyl-based structure with delta and mu opioid receptor activity that exhibits outstanding antinociceptive efficacy in neuropathic pain, reducing the propensity of unwanted side effects driven by current therapies that are unifunctional mu opioid agonists. © 2013 Elsevier Inc. All rights reserved.

Introduction spite of these negative potential outcomes the mechanism of opioid action provides a direct means for inhibiting pain sensation (Vanderah, Over 76 million people currently suffer from chronic pain, becoming 2010). The key is to develop a drug with analgesic efficacy but lacks the the most common reason to seek medical care (Institute of Medicine, adverse effects. 2011; Elliot et al., 1999). The effective management of chronic pain in- The majority of opioids prescribed today are simple modifications of cluding neuropathic pain is essential in order to reduce the associated the morphine alkaloid structure. Few studies have investigated the personal, social and financial morbidities. Despite the significance of chemical structure of fentanyl, a highly efficacious, μ-selective opioid this problem, the current medical treatment modalities only result in a agonist, with modifications to engage other opioid receptors such as 30% reduction in pain levels (Turk et al., 2011) demonstrating the essen- the δ-receptor. Functional association between μ-andδ-opioid recep- tial need for novel treatments for the management of chronic pain. tors was first suggested by studies showing that μ-activity could modu- Opioids have fallen out of favor for the treatment of chronic pain due late δ-ligands (Morinville et al., 2004; Decaillot et al., 2008). Yet the true to the wide array of adverse effects associated with long-term use role of δ-ligands remains unrevealed. Some authors have provided evi- (O'Connor and Dworkin, 2009) resulting in dose-limiting efficacy. In dence that δ-agonists increase antinociceptive responses alone or in combination with μ-receptor agonists (Gendron et al., 2007; Petrillo et al., 2003; Lee et al., 2011; Holdridge and Cahill, 2007) while others ⁎ Corresponding author at: P.O. Box 245050, 1501 N. Campbell Ave., LSN 647, Tucson, μ AZ 85724, USA. Fax: +1 520 626 7801. suggest that -agonist signaling can be equianalgesic by co-treatment E-mail address: [email protected] (T.W. Vanderah). with δ-selective antagonists while reducing the unwanted side effects

0024-3205/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.lfs.2013.09.016 A.T. Podolsky et al. / Life Sciences 93 (2013) 1010–1016 1011 of the μ-receptor agonists (Mosberg et al., 2013; Ananthan et al., 2012). assigned to all animals with tailflick times lasting equal to or greater A recent review emphasizes the potential role of δ-agonist as mood sta- than 15 s. Percent activity, or antinociception, was expressed as: bilizers that would enhance the affective component of chronic pain ðÞtest latency after drug treatment –ðÞbaseline latency (Lutz and Kieffer, 2012). Hence, there is a great need to further develop %Antinociception¼ 100 : and characterize compounds that can act at both μ-andδ-opioid recep- ðÞ15 seconds –ðÞbaseline latency tors for human use. One of the promising new approaches for the questions raised is the creation and investigation of bivalent ligands. Bivalent ligands Mouse formalin flinching/guarding test contain two pharmacophores that are fused together to act at distinct targets resulting in added or synergistic effects (Dietis et al., An acute inflammatory injury model was simulated in the mice 2009). Finding the correct pair of ligands with superposition, in vivo using the formalin test similar to that outlined by Zhao et al. (2003). efficacy and reduced side effects is an attractive yet difficult problem Mice were initially allowed to acclimate in a transparent Plexiglas box that should be pursued with alternative structures to morphine. placed on a rack for 30 min prior to injection. Drug or vehicle was The structure of morphine may cause a number of non-μ opioid injected i.t. and formalin was administered i.paw 10 min later by gently receptor-related unwanted effects via the TLR4 receptor. (+)Morphine restraining each mouse and injecting them with 20 μL of 2% formalin has been shown to activate immune cells, microglia and osteoclasts subcutaneously into the plantar surface of the left hind paw. Flinching causing morphine hypersensitivity, antinociceptive tolerance and and guarding behavior of the left hindpaw were measured in 5-minute bone wasting over time (Hutchinson et al., 2010; Franchi et al., 2012). intervals for 40 min. Flinches were characterized as vigorous shaking or Our preliminary investigations demonstrate a new bivalent ligand lifting of the paw and were counted by absolute number during each with a mixed μ/δ-profile representing combinations of fentanyl and time interval. Guarding behavior was described as licking or biting and enkephalin-like peptides (Vardanyan et al., submitted to J Med Chem was assessed in terms of overall duration during each time interval 2013), respectively, with in vivo activity in anti-inflammatory and neu- (Kayser et al., 2007). First phase responses were seen in the 0–10 min ropathic pain models. interval whereas the second phase responses were evident in the 10– 40 minute intervals. The 40 minute trial time was sufficient to allow Material and methods the mice to achieve near baseline levels of nociceptive behaviors after injection with formalin. Animals Rat intrathecal catheter implantation Male ICR (20–25 g) mice and male Sprague–Dawley (250–275 g) rats were used for all studies. The animals were housed in groups of 5 Each rat was given ketamine/xylazine 100 mg/kg (vol/vol: 80/20, (mice) or 2–3 (rats) in a temperature controlled room on a light–dark Sigma-Aldrich) i.p. for anesthesia and subsequently placed in a stereo- cycle (lights on 7:00). Food and water were available ad libitum. taxic head mount. An incision was made along the posterior aspect of All procedures were in accordance with the policies set forth by the skull in order to expose the cisterna magna. Once the cisterna the Institutional Animal Care and Use Committee of the University magna was exposed, it was then punctured and a 10 cm catheter (PE- of Arizona. 10 tubing) was inserted into the intrathecal space following the method described by Yaksh and Rudy (1976). The incision was closed by first su- Mouse injection techniques turing the muscle and then the outer skin, which effectively sutured the catheter in place. The exposed catheter was the cauterized to seal the Administration of the opioid compound in mice was performed open end. Any animals showing signs of neurological defects after via intrathecal (i.t.) injection using a slightly modified method of the 24 h were not used. All others were allowed to recover for 7 days before Hylden and Wilcox (1980) technique (Largent-Milnes et al., 2010). any subsequent procedure was performed. This was accomplished using a 10 μLHamiltoninjectorfitted with a 30-gauge needle. All volumes administered were 5 μL. Rat injection technique

Opioid antagonist challenge Compounds to be administered in rats were done using the intrathecal catheter that had been placed as previously described. Preparations The general opioid antagonist naloxone was used to assess opioid were made using a 25 μL Hamilton syringe and injector connected with activity of the test compounds. Naloxone (1 mg/kg) was given intraper- tubing. First, 9 μL of saline was drawn, followed by 1 μL of air and ﬁnally itoneally (i.p.) 10 min prior to injection of RV-Jim-C3 (i.t.). To determine 5 μL of drug or vehicle. Upon injection, the tip of the cauterized i.t. cath- opioid receptor selectivity, the delta antagonist naltrindole (5 μg/5 μL) eter was clipped and the Hamilton injector was inserted into the cathe- was given by the i.t. route 5 min prior to RV-Jim-C3 (10 μg/5 μL, i.t.). To ter. The prepared solution was then slowly injected into the catheter determine the amount of mu opioid receptor activity, CTAP (5 μg/5 μL), with the air bubble serving as a marker for drug/vehicle level and the sa- a selective mu receptor antagonist, was given by the i.t. route 5 min line acting as a ﬂush to ensure full delivery of the compound. Following prior to RV-Jim-C3 (10 μg/5μL, i.t.). injection, the tip of the catheter was re-cauterized.

Mouse tail-ﬂick test Spinal nerve ligation

The nociceptive stimulus used to initially test for antinociceptive A chronic pain model, which produces allodynia and hyperalgesia, efficacy was warm (52 °C) water. The method followed parameters was produced in the rats via spinal nerve ligation surgery. Each rat was similar to those set out by Jannsen et al. (1963).Inthiscase,tail first anesthetized using 2.5% isofluorane plus oxygen. The skin was first flinching, or the thermal tail withdrawal latency, was defined as the separated by making an incision along the lumbar region. In order to time (seconds) from immersion of the tail in water to its withdrawal. separate the muscle, a deep incision was made into the muscle, 1 cm Baseline values for all animals were obtained prior to drug administra- left from midline. As has been previously reported, once a proper win- tion. Animals were excluded if their tail-flick time was greater than dow was established, the left L5 and L6 nerves were exposed, isolated 7 s at baseline. Drug was then given i.t. and tail-flick times were then and ligated using 4-0 silk (Vanderah et al., 2008). The muscle incision measured at 15, 30, 45, and 60 min intervals. A maximal score was was then sutured closed while the skin was stapled. All animals were 1012 A.T. Podolsky et al. / Life Sciences 93 (2013) 1010–1016 allowed to recover for 7 days before any other procedures were after i.t. injection (20.5 ± 6.4%, 35.6 ± 15.8%, 76.7 ± 10.7%, respective- performed. Any animals exhibiting motor or sensory defects were ly). The A50 dose was calculated to be 3.92 μg (95% C.I.: 2.21–6.95). immediately euthanized. RV-JIM-C3 antinociception is blocked by naloxone, CTAP and Naltrindole Rotarod Spinal RV-Jim-C3 was injected following i.p. administered naloxone Following placement of the intrathecal catheters, the rats were then (t = −15 min) to determine if the antinociceptive effects were in fact trained to walk on a rotating rod (8 rev/min; Rotamex 4/8 device) with due to the opioid pharmacophore. RV-Jim-C3 treated animals at the a maximal cutoff time of 180 s (Vanderah et al., 2008). Training was ini- highest dose (10 μg/5 μL, i.t., 12.3 ± 1.38 s) with naloxone (1 mg/kg, tiated by placing the rats on a rotating rod and allowing them to walk on i.p.) pretreated animals resulted in a significant decrease in tail flick it until they either fell off or 180 s was reached. This process was repeat- latencies (3.4 ± 0.47 s, p = 0.001, n = 6) (Fig. 2A,B) and naloxone ed 6 times and the rats were allowed to recover for 24 h before begin- (1 mg/kg) alone did not display any antinociceptive behavior compared ning the treatment session. Prior to treatment, the rats were run once to vehicle treated animals (Fig. 2). on a moving rod in order to establish a baseline value. Compounds, ei- To test whether there was selective mu and/or delta opioid receptor ther vehicle or drug, were administered via the intrathecal catheter as analgesic activity, spinal administration of either CTAP (mu selective an- previously mentioned. Assessment consisted of placing the rats on the tagonist) or naltrindole (delta selective antagonist) were given spinally moving rod and timing until either they fell off or reached a maximum 5 min prior to spinal RV-Jim-C3. The spinal administration of RV-Jim-C3 of 180 s. This was repeated every 20 min for a total of 2 h. (10 μg/5 μL, i.t.) 5 min after vehicle resulted in a 83.5 ± 7.2% (n = 6) antinociceptive effect in the 52 °C tail flick test 15 min after admin- Tactile hypersensitivity istration (Fig. 3). CTAP (5 μg/5 μL, i.t.) given 5 min prior to RV-Jim-C3 (10 μg/5 μL, i.t.) resulted in a significant inhibition of the antinociceptive Prior to tactile testing, the rats were allowed to acclimate in suspended effects at 20.9 ± 13.4% (p b 0.01, n = 6) antinociception at the wire-mesh cages for 30 min. The protocol consisted of taking baseline 15 min time point in the 52 °C tail flick test (Fig. 3). Likewise, Naltrindole measurements (post-SNL) by measuring paw withdrawal thresholds (5 μg/5 μL, i.t.) given 5 min prior to RV-Jim-C3 (10 μg/5 μL, i.t.) resulted in (PWT) to calibrated von Frey filaments (0.4–15.0 g) that were probed asignificant inhibition of the antinociceptive effects at 30.3 ± 10.5% perpendicularly to the plantar surface of the left hind paw. Lifting of the (p b 0.01, n = 5) antinociception at the 15 minute time point in the paw or licking the paw was considered a positive response. This method 52 °C tail flick test (Fig. 3). was repeated following the up-down method described by Largent- Milnes et al. (2008). Drug or vehicle was then administered at t = 0 using the i.t. catheter route previously described. Filament probing was then repeated every 20 min for 2 h. Results were then calculated in grams using the Dixon non-parametric test. No testing was performed on the contralateral paw. 15 10 µg/5µl,µg /5µ l, i.t. 3 µg/5µl,µg/5µl, i.t.i.. Thermal hypersensitivity 1 µg/5µl,µg/5µl, i.t.i.. 10 Prior to thermal testing, the rats were allowed to acclimate in Plexiglas VehicleVehicle cages for 30 min. Baseline values were obtained prior to SNL surgery and again prior to administration of compound. Testing protocol consisted of 5 measuring paw withdrawal latency (PWL) in seconds by placing a mobile infrared heat source directly under the left hind paw as was described by Largent-Milnes et al. (2008). A positive response consisted of the animal 0 lifting or licking the paw. A maximum cutoff was set at 30 s. Drug or 15 30 45 60 Tail Withdrawal Latency (s ± SEM) vehicle was administered at time = 0 and PWLs were measured every Time (Min) 20 min for 2 h. The contralateral paw was not tested.

Results 100

RV-JIM-C3 (i.t.) produces dose dependent antinociception 80

Mouse baseline tail-flick withdrawal responses were recorded using 60 the warm water 52 °C bath apparatus. Mean baseline tail-flick latencies for animals were 3.59 ± 0.21 s (n = 30). Mice were injected intrathecal- 40 ly (i.t.) in the lumbar region as described (Largent-Milnes et al., 2010) A50 = 3.92 µg (95% CI = 2.2 – 6.9) (RV-JIM-C3 10 μg/5 μL, 3 μg/5 μL, 1 μg/5 μL; Vehicle 10% TWEEN, 10% % Response ( ± SEM) R2 = 0.95 DMSO, 80% saline) and tail withdrawal latency was recorded every 20 15 min for 60 min. Maximal effect of RV-JIM-C3 occurred 15 min after injection (Fig. 1A). The highest dose (10 μg/5 μL) resulted in a maximal 0 1103 μ μ μ μ tail withdrawal latency of 12.3 ± 1.4 s. The 3 g/5 Land1 g/5 L Dose (µg/5µl) doses produced a tail withdrawal latency of 8.0 ± 1.9 s and 6.1 ± 0.9 s, respectively (Fig. 1A).Eachdoseresultedinsignificantly higher paw with- Fig. 1. A) RV-Jim-C3 results in a dose- and time-related antinociceptive activity after spinal drawal latencies as compared to baseline or vehicle treated animals. administration. Warm water (52 °C) tail flick test using mice to demonstrate that Rv-Jim- Percent antinociception was calculated for each spinal dose of RV- C3 produces a maximal effect 15 min after intrathecal administration with recovery to baseline latencies by 60 min (N = 10 per dose). Intrathecal vehicle had no significant ef- JIM-C3 and a dose response curve was generated. The three doses fect on tail flick latencies. B) The dose response curve for RV-Jim-C3 in the tail flick test (1 μg, 3 μg, 10 μg) produced significant dose dependent antinociception 2 resulted in an A50 of 3.9 μg/5 μL (95% C.I. = 2.2–6.9 with R value of 0.95) at the 15 min- in non-injured mice compared to vehicle treated mice (Fig. 1B) 15 min utetimepoint. A.T. Podolsky et al. / Life Sciences 93 (2013) 1010–1016 1013

A formalin, i.paw, and (3) RV-Jim-C3 (10 μg/5 μL, i.t.) + 0.2% formalin, i.paw. The group of mice receiving vehicle and formalin had a peak 15 * number of flinches 5 min after formalin injection (56.17 ± 7.38, n = fi 12 6), which diminished signi cantly over the course of 40 min (6.83 ± * 0.96) (Fig. 4A). Mice receiving RV-Jim-C3 (10 μg/5 μL, i.t., −10 min) 9 pretreatment with formalin had significantly fewer flinches (5.16 ± * 3.24, p = 0.001, n = 6) as compared to those receiving only vehicle 6 ** and formalin (56.17 ± 7.38, n = 6) at t = 5 min. Those animals re- fi 3 ceiving RV-Jim-C3 and saline were not signi cantly different from animals receiving vehicle and saline at t = 5 min (0.17 ± 0.18, n = 6, 0 and 2.0 ± 0.57, n = 6, Fig. 4A). Vehicle 1 µg 3 µg 10 µg 10 µg RV-Jim-C3

Tail-Flick Latencies (sec ± SEM) + The group of mice receiving vehicle and formalin had a peak hindpaw 1 mg/kg Naloxone - - - guarding effect 5 min after formalin injection (96.83 ± 13.14 s, n = 6), which diminished significantly over the course of 40 min (4.50 ± B 3.19 s) (Fig. 4B). Mice receiving RV-Jim-C3 (10 μg/5 μL, i.t., −10 min) 100 * pretreatment with formalin had significantly less guarding (3.17 ± 80 2.19 s, p = 0.001, n = 6) as compared to those receiving only vehicle and formalin (96.83 ± 13.14 s, n = 6) at t = 5 min. Those animals re- 60 * ceiving RV-Jim-C3 and saline were not significantly different from ani- 40 mals receiving vehicle and saline at t = 5 min (1.50 ± 1.12 s, n = 6, * and 5.83 ± 3.49 s, n = 6, Fig. 4B). 20 **

0 Spinal RV-JIM-C3 reverses nerve injury induced hypersensitivities % Antinociception (± SEM) Vehicle 1 µg 3 µg 10 µg 10 µg RV-Jim-C3 + - - - 1 mg/kg Naloxone Animals undergoing SNL surgeries were tested for pre-injury ipsilateral hindpaw baseline latencies and thresholds using the IR thermal Fig. 2. A) Systemic naloxone blocks the antinociceptive effects of RV-Jim-C3. RV-Jim-C3 testing and the von Frey mechanical testing setups, respectively. Animals when administered by the i.t. route results in a significant increase in tailflick latencies were post-injury baselined on day 7, and thermal latencies and mechan- with a maximum effect at 10 μg/5 μL. The RV-Jim-C3 increase in tail flick latencies was significantly reduced by a 10 min pretreatment with 1 mg/kg naloxone. B) Demonstrates the ical thresholds recorded. Animals with significant nerve injury-induced percent antinociceptive activity of RV-Jim-C3 in the absence and presence of systemic nal- reductions in thermal hindpaw latencies and mechanical hindpaw oxone. Naloxone alone had no effect. (n = 10, *p b 0.05, **p b 0.001). thresholds ipsilateral to the injury were administered an acute bolus

ﬂ RV-JIM-C3 attenuates formalin induced inching and guarding A 70 Mice were separated into three groups: (1) vehicle (10%TWEEN/ 60 Vehicle, i.t. – Saline, i.paw 10%DMSO/80%saline), i.t. + 0.9% saline, i.paw, (2) vehicle, i.t. + 0.2% Vehicle, i.t. – 2% formalin, i.paw 50 RV-JIM-C3, 10µg, i.t, – 2% formalin, i.paw 40 100 30

# of Flinches 20 80 10 0

5 1015202530354010 15 20 60 B Time ((min)m * 100 Vehicle, i.t. – Saline, i.paw 80 40 * Vehicle, i.t. – 2% formalin, i.paw RV-JIM-C3, 10µg, i.t, – 2% formalin, i.paw

% Response ( ± SEM) 60

20 40

20 0

Guarding Time (sec ± SEM) 0

5 10152025303540 Time (min)

Fig. 4. A) Formalin (2%/20 μL, i.paw) in mice results in two phases of paw flinching characterized as phase I, 0–10 min and phase II, from 10 min to 40 min. RV-Jim-C3 (10 μg/5 μL) when given intrathecally 10 min prior to formalin resulted in a significant decrease in flinching in both the first and second phase at all time points (n = 6). B) Likewise, formalin Fig. 3. The 5 minute intrathecal pretreatment with either Naltrindole (5 μg/5 μL), or CTAP (2%/20 μL, i.paw) in mice results in two phases of paw guarding. RV-Jim-C3 (10 μg/5 μL, i.t.) (5 μg/5 μL) significantly attenuated the antinociceptive activity of intrathecal RV-Jim-C3. 10 min prior to formalin significantly reduced paw guarding in both phases (n = 6). Vehicle (n = 6, *p b 0.05). has no effect on formalin flinching or guarding (n = 6). 1014 A.T. Podolsky et al. / Life Sciences 93 (2013) 1010–1016 of RV-Jim-C3 (10 μg/5 μL, i.t.) or vehicle (5 μL, i.t.). Paw withdrawal la- (n = 11) (Fig. 6). Vehicle treated animals remained on the rotarod for tency and paw withdrawal threshold were measured and recorded an average of 180 ± 0 s over the course of 120 min. Animals treated every 20 min over a 160 min time course. with 10 μg/5 μL, i.t. of RV-Jim-C3 remained on the rotating rod for a min- Mean pre-injury paw withdrawal latency baseline value for all par- imum of 160 ± 22.4 s, not significantly different from control (Fig. 6). ticipating animals was 19.8 ± 0.37 s (n = 12). Mean post-injury paw withdrawal latency baseline value was 10.4 ± 0.36 s, indicating the de- Discussion velopment of thermal hyperalgesia due to spinal nerve ligation (Fig. 5A). Administration of RV-Jim-C3 induced a significant reduction Although there are more analgesics available on the market today of thermal hypersensitivity within 20 min after injection and peaked than ever in history there is an overwhelming loss in confidence by phy- at 40 min post injection compared to vehicle (19.57 ± 3.12 s, p = sicians and the public in prescribing and taking opioid analgesics due to 0.01, n = 6) (Fig. 5A). The paw withdrawal latencies for drug treated the combination of abuse potential, unwanted side effects and/or lack of animals returned to post-injury baseline levels at 160 min after acute analgesic efficacy (Jensen and Finnerup, 2009; Institute of Medicine, spinal administration (11.12 ± 2.64 s, 10 μg/5 μL, p = 0.01, n = 6) 2011; Rowbotham et al., 2003). There has been a lack of success in de- (Fig. 5A). Vehicle (5 μL, i.t.) had no significant effect on post-injury signing novel pain-relieving drugs over the past 50 years. As humans paw withdrawal thresholds over a 160 min time course. continue to live longer due to the advances in other areas of medicine Mean pre-injury paw withdrawal threshold baseline value for all an- including novel antivirals, antibiotics, chemotherapeutics, autoimmune imals was 15 ± 0 g (n = 12). Mean post-injury ipsilateral paw with- disease therapies, early tests for detection of diseases, advancing surgi- drawal threshold baseline value was 2.19 ± 0.37 g, indicating the cal and other new procedures, the need to improve medications for development of mechanical allodynia due to spinal nerve ligation. acute and chronic pain amplifies desperately. Attenuation of mechanical allodynia was evident in RV-Jim-C3 treated Treatment of chronic pain relies a great deal upon μ opioid analge- animals only 20 min post spinal injection as compared to vehicle sics, while δ opioid agonists are known to produce analgesic effects (7.72 ± 2.12 g and 3.86 ± 1.80 g, respectively, p = 0.01, n = 6) but, are not clinically available. There is evidence to indicate that bifunc- (Fig. 5B) with the peak effect 100 min post injection (13.93 ± 1.12 g, tional μ–δ opioid compounds with unique biological activity profiles p = 0.001, n = 6) and return to post-injury baseline levels at 120 min. may have therapeutic potential as efficacious analgesics with reduced Vehicle (5 μL, i.t.) treated animals did not result in any significant increase unwanted side effects (Harvey et al., 2012; Kotlinska et al., 2013; in hindpaw withdrawal thresholds over post-injury baselines (Fig. 5B, Yamamoto et al., 2011). There has been several novel compounds n=6). designed to target both μ and δ opioid yet, the majority of compounds are based on peptidic structures, non-peptidic structures or utilize the RV-Jim-C3 does not produce motor deficits such as sedation or paralysis in morphine alkaloid structure (Schiller, 2010; Elmagbari et al., 2004; rats Lowery et al., 2011; Codd et al., 2009; Ananthan et al., 2012). Such peptidic structures may result in poor absorption, poor access to the RV-Jim-C3 (i.t.) was evaluated for typical motor deficits found with CNS and shorter stability with more frequent dosing (Morphy and opioid use including sedation. Rats were trained to walk on a rotating Rankovic, 2005; Cavalli et al., 2008). Morphine based structures pro- rod with a maximal cutoff time of 180 s prior to administration of drug duce off-target activation of Toll-like receptor 4 (TLR4) in a non- or vehicle. The mean baseline latency for all animals was 170 ± 10.5 s stereospecific manner; that is, unnatural enantiomers of alkaloid opioids, which do not activate endogenous opioid receptors, have activity at TLR4. Several studies have provided evidence for the non-stereospecific A activation of TLR4 signaling by opioids including morphine in vivo and 25 * * * in vitro (Hutchinson et al., 2010; Franchi et al., 2012; Loram et al., 2012; 20 * Due et al., 2012). TLR-4 activation is an innate immune receptor complex found on myelo-monocytic cells including macrophages, myeloid pro- 15 * genitor cells, and osteoclasts resulting in a number of unwanted effects 10 including activation of the innate inflammatory response, an increase in (sec ± SEM) fl 5 the production of more in ammatory cells and enhanced bone wasting (Li et al., 2013).Herewepresentanovelcompoundthatactsatboth Paw Withdrawal Latency 0 20 40 60 80 100 120 140 160 mu and delta opioid receptors based on a fentanyl structure, reducing Time (min) B Vehicle, 5µL, i.t. 20 RV-JIM-C3, 10µg/5µL, i.t, * * 15 * Vehicle, 5µL, i.t. * * 200 10 RV-JIM-C3, 10µg/5µL, i.t, (g ± SEM) 5 150

0 100 Paw Withdrawal Threshold

20 40 60 80 100 120 140 160 (s ± SEM) Time (min) 50 Time on Rotorod

Fig. 5. The spinal administration of RV-Jim-C3 (10 μg/5 μL) resulted in a significant inhibi- 0 0 20 40 60 80 100 120 tion of spinal nerve ligation (SNL)-induced thermal and mechanical hypersensitivities in rats. A) Paw withdrawal latencies resulted in a significant decrease post-SNL that was sig- Time (sec) nificantly reversed at the 20 and 40 minute time points as well as later time points with a return to post-injury baselines at 160 min (n = 6, *p b 0.05). B) Paw withdrawal thresh- Fig. 6. Rats were tested for sedation and/or motor impairment using a rotating rod. Ani- olds resulted in a significant decrease post-SNL that was significantly reversed at the 20 mals are trained on a rotating rod for 3 consecutive trials for a total of 120 s. The spinal through till the 100 minute time point with a return to post-injury baselines at 140 min administration of RV-Jim-C3 or vehicle did not result in any significant changes in an an- (n = 6, *p b 0.05). Vehicle had no effect on mechanical or thermal latencies. imals' ability to walk on a rotating rod when compared to naive baselines. A.T. Podolsky et al. / Life Sciences 93 (2013) 1010–1016 1015 the peptidic aspects as well as the off-target adverse effects mediated of the novel, non-peptidic opioid compound RV-Jim-C3 in treating neu- by the TLR4 receptor that may hinder a mixed μ–δ opioid compound ropathic pain while lacking sedation and motor incoordination. reaching the clinic. Initial design and synthesis of RV-Jim-C3 demonstrat- Recent decisions by the FDA to limit the acetaminophen in com- ed micromolar binding affinities and in vitro efficacy at both μ and δ opi- bination products containing mu opioid agonists (i.e., vicodin® and oid receptors (Vardyanan R, in review Journal of Medicinal Chemistry, percocet®) due to liver toxicity have resulted in an urgent need to 2013) with significant analgesic efficacy in several pain models. produce better opioids for chronic pain without unwanted side effects RV-Jim-C3 demonstrated significant analgesia using a warm water (FDA Options Paper, 2009; Chen et al., 2002). In light of this, it is widely tail flick test after the spinal administration. These effects were blocked accepted that biological activity at a single receptor is often insufficient by naloxone suggesting opioid receptor mediated effects. Furthermore, with recent research focusing on innovative compounds that have more the significant attenuation by the mu selective antagonist CTAP than one site of action (Morphy and Rankovic, 2005; Cavalli et al., and by the delta selective antagonist naltrindole suggests that the 2008). Bifunctional drugs may have improved efficacy due to synergis- antinociception produced by CV-Jim-C3 is indeed mediated by tic effects with added benefits of reducing side effects. Bifunctional both mu and delta opioid receptors. drugs as compared with individual drug combinations result in more In order to determine whether RV-Jim-C3 has anti-inflammatory ef- predictable pharmacokinetic (PK) and pharmacodynamic (PD) relation- fects it was tested in a murine formalin flinch model. A well-established ship. There is often unpredictable variability between patients in drug model for testing acute pain in mice is by using intradermal formalin in- mixtures versus a bifunctional compound due to variability in relative jections and recording paw flicking and guarding. While certain tests, rates of metabolism between patients. Finally, bifunctional drugs may like the tail-flick model, rely on reflex pain, the formalin model pro- result in improved patient compliance and a lower risk of drug–drug duces pain through direct tissue damage. This is crucial since the pain interactions compared to individual drug combinations (Edwards and produced more closely resembles that which occurs in true clinical Aronson, 2000). pain (Abbott et al., 1999; Dubuisson and Dennis, 1977; Murray et al., 1988). The formalin model is highly reproducible with the behavior Conclusions resulting in two distinct phases that correspond to the specific nociceptive neurons that are activated. The first phase is mediated by direct There is a great need to develop novel pharmaceuticals for chronic chemical stimulation of primary myelinated nociceptive afferent fibers pain. Current therapies are dose limiting due to the unwanted side ef- (Aδ-fiber), the second phase is mediated by activation of central path- fects and lack of efficacy. Studies here demonstrate a novel dual acting ways via inflammation and continued unmyelinated (C-fiber) activity fentanyl-based structure that contains both mu and delta opioid recep- (Dubner and Ren, 1999; Hunskaar and Hole, 1987; Puig and Sorkin, tor agonist activity resulting in high efficacy in an anti-inflammatory 1996; Dickenson and Sullivan, 1987). Therefore, using the formalin and neuropathic pain model with the potential of reduced unwanted model is an effective means by which to test the efficacy of novel opioid side effects. A mu/delta opioid agonist, non-morphine based struc- compounds in the acute inflammatory setting. RV-Jim-C3 resulted in ture like RV-Jim-C3 is less likely to produce TLR4 receptor mediated significant inhibition of formalin-induced flinching in both the first hyperalgesia, resulting in the propensity of long-lasting pain relief. and second phase suggesting analgesia by inhibiting both Aδ-and C-fiber activities. Although opioids are often prescribed for acute nociceptive pain, Conflict of interest statement they have limited analgesic efficacy for neuropathic pain at doses that No competing interests. do not produce severe sedation, somnolence and respiratory depression (Rowbotham et al., 2003). In humans, neuropathic pain tends to be a persistent or chronic condition, and thus it is important to utilize a Acknowledgments pain model that expands beyond the confines of the acute pain generated by formalin. One popular method, described by Kim and Chung (1992),is We would like to acknowledge Martin K. Faridin and Saul Ortega to ligate the 5th and 6th lumbar spinal nerves, which are chieflysensory, for their help with animal studies. distal to the dorsal root ganglia. The key to using this method is that ligation causes injury to both myelinated and unmyelinated fibers (Basbaum et al., 1991). This has the effect of stimulating the Aδ-andC-fibers that are References activated in neuropathic pain. Furthermore, the nerve ligation involves a Abbott FV, Ocvirk R, Najafee R, Franklin KB. Improving the efficiency of the formalin test. more long-term form of injury, unlike the tissue damage that occurs Pain 1999;83:561–9. acutely with formalin, effectively producing a chronic pain syndrome. Fi- Ananthan S, Saini SK, Dersch CM, Xu H, McGlinchey N, Giuvelis D, et al. 14-Alkoxy- and 14-acyloxypyridomorphinans: μ agonist/δ antagonist opioid analgesics with dimin- nally, the nerve ligation produces only a partial injury that allows some ished tolerance and dependence side effects. J Med Chem 2012;55:8350–63. afferent input to still be received, facilitating the use of behavioral models Basbaum AI, Gautron M, Jazat F, Mayes M, Guilbaud G. The spectrum of fiber loss in a in pain testing. Here we measured an animal's ability to withdraw the model of neuropathic pain in the rat: an electron microscopic study. Pain 1991;47: 359–67. nerve injured, hindpaw from non-noxious (mechanical allodynia) and Cavalli A, Bolognesi ML, Minarini A, Rosini M, Tumiatti V, Recanatini M, et al. Multi- from noxious (thermal hypersensitivity) stimuli in the absence and pres- target-directed ligands to combat neurodegenerative diseases. J Med Chem ence of spinal RV-Jim-C3 administration. Unlike many of the current mu 2008;51(3):347–72. Chen L, Schneider S, Wax P. Knowledge about acetaminophen toxicity among emergency opioid agonists such as morphine that are available for chronic pain, department visitors. Vet Hum Toxicol 2002;44(6):370–3. RV-Jim-C3 resulted in significant mechanical antiallodynia and ther- Codd EE, Carson JR, Colburn RW, Stone DJ, Van Besien CR, Zhang SP, et al. JNJ-20788560 mal antihypersensitivity in the nerve injured animal. Such studies [9-(8-azabicyclo[3.2.1]oct-3-ylidene)-9H-xanthene-3-carboxylic acid diethylamide], fi suggest that a fentanyl based, mixed mu-delta opioid agonist can act a selective delta opioid receptor agonist, is a potent and ef cacious antihyperalgesic agent that does not produce respiratory depression, pharmacologic tolerance, or to inhibit neuropathic pain. Rotarod experiments were performed in physical dependence. J Pharmacol Exp Ther 2009;329(1):241–51. order to demonstrate the lack of RV-Jim-C3-induced motor paralysis Decaillot FM, Rozenfeld R, Gupta A, Devi LA. Cell surface targeting of mu-delta opioid re- – and/or signs of sedation since such behavior would mask paw with- ceptor heterodimers by RTP4. Proc Natl Acad Sci U S A 2008;105:16045 50. Dickenson AH, Sullivan AF. Peripheral origins and central modulation of subcutaneous drawal results in our pain behavior tests. Due to the added analgesic ef- formalin-induced activity of rat dorsal horn neurones. Neurosci Lett 1987;83:207–11. fects of delta opioid receptor occupation, less mu receptor occupation is Dietis N, Guerrini R, Calo G, Salvadori S, Rowbotham DJ, Lambert DG. Simultaneous required essentially decreasing the dose and unwanted side effects targeting of multiple opioid receptors: a strategy to improve side-effect profile. Br J Anaesth 2009;103(1):38–49. driven by mu opioid receptor agonists. Ultimately, by using a combina- Dubner R, Ren K. Endogenous mechanisms of sensory modulation. Pain 1999(Suppl. 6): tion of acute and chronic pain models, we demonstrate here the efficacy S45–53. 1016 A.T. Podolsky et al. / Life Sciences 93 (2013) 1010–1016

Dubuisson D, Dennis SG. The formalin test: a quantitative study of the analgesic effects of Largent-Milnes TM, Yamamoto T, Nair P, Hruby VJ, Lai J, Porreca F, et al. Spinal or systemic morphine, meperidine, and brain stem stimulation in rats and cats. Pain 1977;4: TY005, a peptidic opioid agonist/neurokinin 1 antagonist, attenuates pain with re- 161–74. duced tolerance. Br J Pharmacol 2010;161(5):968–1001. Due MR, Piekarz AD, Wilson N, Feldman P, Ripsch MS, Chavez S, et al. Neuroexcitatory ef- Lee Y-S, Kulkarani V, Cowell SM, Ma S-W, Davis P, Hanlon KE, et al. Development of po- fects of morphine-3-glucuronide are dependent on Toll-like receptor 4 signaling. J tent m and d opioid agonists with high lipophilicity. J Med Chem 2011;54(1):382–6. Neuroinflammation 2012;9(200):1–12. Li J, Wang X, Zhang F, Yin H. Toll-like receptors as therapeutic targets for autoimmune Edwards IR, Aronson JK. Adverse drug reactions: definitions, diagnosis, and management. connective tissue diseases. Pharmacol Ther 2013;138(3):441–51. Lancet 2000;356(9237):1255–9. Loram LC, Grace PM, Strand KA, Taylor FR, Ellis A, Berkelhammer D, et al. Prior exposure to Elliott AM, Smith BH, Penny KI, Smith WC, Chambers WA. The epidemiology of chronic repeated morphine potentiates mechanical allodynia induced by peripheral inflam- pain in the community. Lancet 1999;354:1248–52. mation and neuropathy. Brain Behav Immun 2012;26:1256–64. Elmagbari NO, Egleton RD, Palian MM, Lowery JJ, Schmid WR, Davis P, et al. Antinociceptive Lowery JJ, Raymond TJ, Giuvelis D, Bidlack JM, Polt R, Bilsky EJ. In vivo characterization of structure-activity studies with enkephalin-based opioid glycopeptides. J Pharmacol Exp MMP-2200, a mixed δ/μ opioid agonist, in mice. J Pharmacol Exp Ther 2011;336:767–78. Ther 2004;311:290–7. Lutz PE, Kieffer BL. Opioid receptors: distinct roles in mood disorders. Trends Neurosci FDA Options Paper. Acetaminophen overdose and liver injury — background and options 2012;12:S0166–2236. for reducing, injury; 2009. Morinville A, Cahill CM, Kieffer B, Collier B, Beaudet A. Mu-opioid receptor knockout pre- Franchi S, Moretti S, Castelli M, Lattuada D, Scavullo C, Panerai AE, et al. Mu opioid recep- vents changes in delta-opioid receptor trafficking induced by chronic inflammatory tor activation modulates Toll like receptor 4 in murine macrophages. Brain Behav pain. Pain 2004;109:266–73. Immun 2012;26:480–8. Morphy R, Rankovic Z. Designed multiple ligands. An emerging drug discovery paradigm. Gendron L, Pintar JE, Chavkin C. Essential role of mu opioid receptor in the regulation J Med Chem 2005;48(21):6523–43. of delta opioid receptor-mediated antihyperalgesia. Neuroscience 2007;150:807–17. Mosberg HI, Yeomans L, Harland AA, Bender AM, Sobczyk-Kojiro K, Anand JP, et al. Opioid Harvey JH, Long DH, England PM, Whistler JL. Tuned-affinity bivalent ligands for peptidomimetics: leads for the design of bioavailable mixed efficacy μ opioid receptor the characterization of opioid receptor heteromers. ACS Med Chem Lett 2012;3(8): (MOR) agonist/δ opioid receptor (DOR) antagonist ligands. J Med Chem 2013;56: 640–4. 2139–49. Holdridge SV, Cahill CM. Spinal administration of a delta opioid receptor agonist attenu- Murray CW, Porreca F, Cowan A. Methodological refinements to the mouse paw formalin ates hyperalgesia and allodynia in a rat model of neuropathic pain. Eur J Pain test. An animal model of tonic pain. J Pharmacol 1988;20:175–86. 2007;11:685–93. O'Connor AB, Dworkin RH. Treatment of neuropathic pain: an overview of recent guide- Hunskaar S, Hole K. The formalin test in mice: dissociation between inflammatory and lines. Am J Med 2009;122:S22–32. non-inflammatory pain. Pain 1987;30:103–14. Petrillo P, Angelici O, Bingham S, Ficalora G, Garnier M, Zaratin PF, et al. Evidence for Hutchinson MR, Lewis SS, Coats BD, Rezvani N, Zhang Y, Wieseler JL, et al. Possible in- a selective role of the delta-opioid agonist [8R-(4bS*,8aalpha, 8abeta, 12bbeta)] volvement of toll-like receptor 4/myeloid differentiation factor-2 activity of opioid in- 7,10-Dimethyl-1-methoxy-11-(2-methylpropyl) oxycarbonyl 5,6,7,8,12,12b- active isomers causes spinal proinflammation and related behavioral consequences. hexahydro-(9H)-4,8-methanobenzofuro (3,2-e) pyrrolo (2,3-g) isoquinoli ne Neuroscience 2010;167:880–93. hydrochloride (SB-235863) in blocking hyperalgesia associated with inflam- Hylden JLK, Wilcox GL. Intrathecal morphine in mice: a new technique. Eur J Pharmacol matory and neuropathic pain responses. J Pharmacol Exp Ther 2003;307: 1980;67:313–6. 1079–89. Institute of Medicine Report from the Committee on Advancing Pain Research, Care, and Puig S, Sorkin LS. Formalin-evoked activity in identified primary afferent fibers: systemic Education. Relieving pain in America, A blueprint for transforming prevention, care, lidocaine suppresses phase-2 activity. Pain 1996;64:345–55. education and research. Washington, DC: The National Academy Press; 2011. Rowbotham MC, Twilling L, Davies PS, Reisner L, Taylor K, Mohr D. Oral opioid therapy for Jannsen PAJ, Niemcgeers CJE, Dorg JGH. The inhibitory effects of fentanyl and other chronic peripheral and central neuropathic pain. N Engl J Med 2003;348:1223–32. morphine-like analgesics on the warm-water-induced tail-withdrawal reflex in Schiller PW. Bi- or multifunctional opioid peptide drugs. Life Sci 2010;86:598–603. rats. Arzneim Forsch 1963;13:502–5. Turk DC, Wilson HD, Cahana A. Treatment of chronic non-cancer pain. Lancet 2011;377: Jensen TS, Finnerup NB. Neuropathic pain treatment: a further step forward. Lancet 2226–35. 2009;374:1218–9. Vanderah TW. Delta and kappa opioid receptors as suitable drug targets for pain. Clin J Kayser V, Elfassi IE, Aubel B, Melfort M, Julius D, Gingrich JA, et al. Mechanical, thermal and Pain 2010;26:S10–5. formalin-induced nociception is differentially altered in 5-HT1A−/−,5-HT1B−/−, Vanderah TW, Largent-Milnes T, Lai J, Porreca F, Houghten RA, Menzaghi F, et al. Novel 5-HT2A−/−,5-HT3A−/− and 5-HTT−/− knock-out male mice. Pain 2007;130: D-amino acid tetrapeptides produce potent antinociception by selectively acting at 235–48. peripheral kappa-opioid receptors. Eur J Pharmacol 2008;583:62–72. Kim SH, Chung JM. An experimental model for peripheral neuropathy produced by seg- Yaksh TL, Rudy TA. Chronic catheterization of the spinal subarachnoid space. Physiol mental spinal nerve ligation in the rat. Pain 1992;50:355–63. Behav 1976;17:1031–6. Kotlinska JH, Gibula-Bruzda E, Witkowska E, Chung NN, Schiller PW, Izdebski J. Yamamoto T, Nair P, Largent-Milnes TM, Jacobsen NE, Davis P, Ma SW, et al. Discovery of a Antinociceptive effects of two deltorphins analogs in the tail-immersion test in potent and efficacious peptide derivative for δ/μ opioid agonist/neurokinin 1 antago- rats. Peptides 2013;39:103–10. nist activity with a 2′,6′-dimethyl-L-tyrosine: in vitro, in vivo, and NMR-based struc- Largent-Milnes TM, Guo W, Wang HY, Burns LH, Vanderah TW. Oxycodone plus tural studies. J Med Chem 2011;54(7):2029–38. ultra-low-dose naltrexone attenuates neuropathic pain and associated mu-opioid Zhao CS, Tao YX, Tall JM, Donovan DM, Meyer RA, Raja SN. Role of micro-opioid receptors receptor-Gs coupling. J Pain 2008;9:700–13. in formalin-induced pain behavior in mice. Exp Neurol 2003;184:839–45. This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes.

Article

pubs.acs.org/JACS

Discovery of Amphipathic Dynorphin A Analogues to Inhibit the Neuroexcitatory Eﬀects of Dynorphin A through Bradykinin Receptors in the Spinal Cord Yeon Sun Lee,† Dhanasekaran Muthu,† Sara M. Hall,† Cyf Ramos-Colon,† David Rankin,‡ Jackie Hu,‡ Alexander J. Sandweiss,‡ Milena De Felice,‡ Jennifer Yanhua Xie,‡ Todd W. Vanderah,‡ Frank Porreca,‡ Josephine Lai,‡ and Victor J. Hruby*,†

† ‡ Department of Chemistry and Biochemistry and Department of Pharmacology, The University of Arizona, Tucson, Arizona 85721, United States

*S Supporting Information

ABSTRACT: We hypothesized that under chronic pain conditions, up-regulated dynorphin A (Dyn A) interacts with bradykinin receptors (BRs) in the spinal cord to promote hyperalgesia through an excitatory effect, which is opposite to the well-known inhibitory effect of opioid receptors. Considering the structural dissimilarity between Dyn A and endogenous BR ligands, bradykinin (BK) and kallidin (KD), this interaction could not be predicted, but it allowed us to discover a potential neuroexcitatory target. Well-known BR ligands, BK, [des-Arg10, Leu9]-kallidin (DALKD), and HOE140 showed different binding profiles at rat brain BRs than that previously reported. These results suggest that neuronal BRs in the rat central nervous system (CNS) may be pharmacologically distinct from those previously defined in non-neuronal tissues. Systematic structure−activity relationship (SAR) study at the rat brain BRs was performed, and as a result, a new key structural feature of Dyn A for BR recognition was identified: amphipathicity. NMR studies of two lead ligands, Dyn A-(4−11) 7 and [des-Arg7]-Dyn A-(4−11) 14, which showed the same high binding affinity, confirmed that the Arg residue in position 7, which is known to be crucial for Dyn A’s biological activity, is not necessary, and that a type I β-turn structure at the C-terminal part of both ligands plays an important role in retaining good binding affinities at the BRs. Our lead ligand 14 blocked Dyn A- (2−13) 10-induced hyperalgesic effects and motor impairment in in vivo assays using naivë rats. In a model of peripheral neuropathy, intrathecal (i.th.) administration of ligand 14 reversed thermal hyperalgesia and mechanical hypersensitivity in a dose-dependent manner in nerve-injured rats. Thus, ligand 14 may inhibit abnormal pain states by blocking the neuroexcitatory effects of enhanced levels of Dyn A, which are likely to be mediated by BRs in the spinal cord.

■ INTRODUCTION analogues can produce motor impairment, paralysis, and − Dynorphin A (Dyn A, Figure 1) is a known endogenous opioid enhanced sensitivity to sensory stimuli.3 7 These effects are peptide along with enkephalin and endorphin, and is not blocked by naloxone, and thus are nonopioid in nature. It has been proposed that after nerve injury, up-regulated Dyn A in the spinal cord may interact directly with spinal bradykinin receptors (BRs) to promote neuropathic pain.8,9 Figure 1. The structures of Dyn A and Dyn A-(2−13). Considering the lack of structural similarity between Dyn A and the endogenous ligands for the BRs, bradykinin (BK) and characterized by its high affinity for mu (μ), delta (δ), and kallidin (KD), this interaction between Dyn A and BR could kappa (κ) opioid receptors. The high affinity of Dyn A for the not be predicted but allowed us to identify a putative direct opioid receptors is mainly due to the N-terminal tyrosine, neuroexcitatory target. Here, we test the therapeutic potential ffi because des-tyrosyl fragments show very low binding a nity at of a pharmacological intervention of Dyn A at spinal BRs in opioid receptors.1 In vivo, Dyn A is degraded rapidly upon chronic pain states by developing BR antagonists based on the release to the des-tyrosyl analogue by aminopeptidases in the synapse to terminate Dyn A’s agonist action at the opioid prototypic structures of Dyn A. receptors.2 Dyn A inhibits smooth muscle contractility, which is characteristic of opioid agonists and is blocked by naloxone. It Received: October 10, 2013 is also well documented that Dyn A and its des-tyrosyl Published: April 17, 2014

Table 1. Binding Aﬃnities of Dyn A (H-Tyr1-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln17-OH) Fragments and Dyn A-(4−11) Analogues at BRs in Rat Brain

BRa,[3H]DALKD b no. ligand log [IC50] IC50 (nM) 1 Dyn A-(3−6) −6.02 ± 0.08 960 2 Dyn A-(3−7) −5.01 ± 0.10 9800 3 Dyn A-(3−8) −5.63 ± 0.27 2300 4 Dyn A-(3−9) −6.11 ± 0.09 780 5 Dyn A-(3−10) −6.09 ± 0.28 810 6 Dyn A-(3−11) −6.88 ± 0.08 130 7 Dyn A-(4−11) −6.86 ± 0.06 140 8 Dyn A-(5−11) −6.55 ± 0.06 280 9 Dyn A-(5−12) −5.15 ± 0.09 7100 10 Dyn A-(2−13)c −6.78 ± 0.09 170 11 Dyn A-(3−13) −6.50 ± 0.07 320 12 Dyn A-(4−13) −6.41 ± 0.13 390 13 Dyn A-(5−13) −6.33 ± 0.16 470 14 H-Phe-Leu-Arg-Ile-Arg-Pro-Lys-OHc −6.71 ± 0.11 190 − ± 15 H-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-NH2 5.19 0.20 6500 16 Ac- Phe-Leu-Arg-Ile-Arg-Pro-Lys-OH −6.92 ± 0.28 120 17 Ac- Phe-Leu-Arg-Ile-Arg-Pro-DLys-OH −6.20 ± 0.15 630 18 Ac-DPhe-Leu-Arg-Ile-Arg-Pro-Lys-OH −6.44 ± 0.13 360 19 H-Phe-Leu-Arg-Ile-Arg-Pro-Arg-OH −6.67 ± 0.15 210 20 Ac- Phe-Leu-Arg-Ile-Arg-Pro-Arg-OH −6.86 ± 0.20 140 21 Ac-DPhe-Leu-Arg-Ile-Arg-Pro-Arg-OH −6.84 ± 0.12 150 22 H-Phe-Nle-Arg-Nle-Arg-Pro-Arg-OH −6.86 ± 0.12 140 23 Ac-Phe-Nle-Arg-Nle-Arg-Pro-Arg-OH −6.85 ± 0.08 140 24 Ac-DPhe-Nle-Arg-Nle-Arg-Pro-Arg-OH −6.70 ± 0.29 200 25 H-Phe-Ala-Arg-Ala-Arg-Pro-Arg-OH −6.35 ± 0.18 450 26 H-Phe-Leu-Arg-Arg-Ile-Arg-Arg-Pro-Lys-OH −6.96 ± 0.20 110 BK H-Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg-OHc −6.93 ± 0.08 120 DALKD H-Arg-Pro-Pro-Gly-Phe-Ser-Pro-Leu-OH −7.12 ± 0.11 76 aCompetition assays were carried out at pH 7.4 using rat brain membranes. bLogarithmic values determined from the nonlinear regression analysis c − ± − ± of data collected from at least two independent experiments in duplicate. 10: log [IC50]= 7.29 0.21, IC50 = 51 nM. 14: log [IC50]= 6.85 − ± 3 0.04, IC50 = 140 nM. BK: log [IC50]= 7.81 0.17, IC50 = 15 nM at pH 6.8 in competition assays using [ H]BK, and transfected HEK 293 cells expressing the human B2R. ffi ■ RESULTS AND DISCUSSION terminus its a nity was reduced 15-fold (9,IC50 = 7100 nM). Structure−Activity Relationships (SAR) Study. The key However, subsequent truncation of a Leu residue at the C- step in the rational design of BR antagonists is to identify the terminus recovered or even increased its binding to the pharmacophore of Dyn A that directly interacts with the BRs as receptor (8,IC50 = 280 nM). This distinct SAR at the C- fi terminus was maintained during the successive truncations of an agonist and then to re ne the structure for the binding site fi by examining the effects of different substituents to obtain an C-terminal residues, and this result con rmed the important antagonist.10 First, each amino acid at the C-terminal or N- role of a positive charge for the C-terminal amino acid residues terminal position of Dyn A-(2−13) (10), which has been in receptor recognition. reported to have neuroexcitatory nonopioid effects through On the other hand, consecutive truncations of the N-terminal ff ffi BRs in the spinal cord,1,7,8 was truncated in sequence and the amino acid residues to position 4 did not a ect their a nities to resulting fragments were tested for their binding to BRs against the receptor. The truncation of two amino acid residues, Gly [3H][des-Arg10,Leu9]-kallidin ([3H]DALKD) or [3H]BK in rat and Phe, in 6 and 10 resulted in negligible reduction of the ffi brain membranes. As a result, a key pharmacophore of Dyn A a nities to the receptor. These results suggest that the N- for the BRs was identified as well as distinct SAR (Table 1). terminal part of the Dyn A is remote and thus not involved in Dyn A-(4−11) (7), which has the same range of binding binding to the BRs. This is an important feature of SAR to ffi fi a nity (IC50 = 140 nM) as 10 (IC50 = 170 nM), was identi ed understand how Dyn A analogues recognize the receptor. The as a good pharmacophore for the BRs. Also, the SAR results positive charge of the C-terminal basic amino acid residue may revealed that the BR recognition predominantly depends on the be mainly involved in electrostatic interactions with the basicity of the C-terminal amino acid residue. receptor. The Dyn A fragments 4, 6, and 13, which have a C-terminal Further SAR studies on the minimum pharmacophore 7 were basic amino acid such as Lys or Arg, showed higher binding performed to distinguish the receptor interaction and to affinities than those fragments (3, 5, and 9) with a C-terminal increase the potency and in vivo stability. Although two Arg hydrophobic amino acid such as Ile, Pro, or Leu. For example, residues at positions 6 and 7 have been known to be important − ffi 11,12 Dyn A-(5 13) (13) showed moderate a nity (IC50 = 470 nM) for the biological activity of Dyn A, on the basis of our at the receptor, and after truncation of a Lys residue at the C- primary SAR results and the amphipathic properties of Dyn A

6609 dx.doi.org/10.1021/ja501677q | J. Am. Chem. Soc. 2014, 136, 6608−6616 Journal of the American Chemical Society Article structure, it did not seem to be necessary to retain two Arg from rat brain BR binding sites differ significantly from that residues for binding to BRs. Therefore, the Arg residue at using guinea pig ileum (GPI) where both BK and HOE140 had ffi position 7 was deleted, and interestingly the resulting ligand 14 high a nity (IC50 = 3.5 nM and 0.43 nM, respectively) similar ffi 13−16 retained high binding a nity (IC50 = 190 nM) to the BRs. The to that previously reported. Thus, in the rat central removal of the Arg residue at position 7 did not affect binding nervous system, we may be targeting a neuronal BR that is affinity at all. This is remarkable because in general, deleting pharmacologically distinct from that previously defined in non- one amino acid in the middle of a bioactive sequence typically neuronal tissues. Furthermore, this neuronal BR exhibits affinity causes significant topographical changes and a different for Dyn A in the nanomolar range. biological profile. For comparison, selected Dyn A ligands that showed good As discussed earlier, the C-terminal basic amino acid residue affinities at rat brain BRs were tested for their binding affinities plays an important role in BR recognition. If the receptor in transfected human embryonic kidney (HEK) 293 cells recognition is mainly through electrostatic interactions with expressing the human B2R or B1R. Ligands 10 (IC50 = 51 nM), positive charges of the side chain group of a basic amino acid 14 (IC50 = 140 nM), and other ligands (see Supporting residue, the amidation of a C-terminal acid group can be a Information) exhibited a similar range of binding affinities for useful modification to increase in vivo stability in the same the HEKB2R as for the rat brain BRs (Table 1). However, none range of binding affinity. For this purpose, the C-terminal acid of the Dyn A ligands showed affinities at the HEKB1R where was amidated in 15, but the modified ligand had greatly their affinities are >10000 nM. These results suggest that Dyn A ffi reduced binding a nity (IC50 = 6500 nM). All other amidated ligands are selective for B2R over B1R. ligands (see Supporting Information) exhibited very low NMR Structures. As discussed earlier, the most important binding affinities in the micromolar range, and this confirms SAR result was that removal of the Arg residue at position 7 did the role of a C-terminal acid in the recognition of the BR. not affect binding affinities. Therefore, for the comparison of In contrast, modifications of the N-terminal part had little topographical structures of [des-Arg7]-Dyn A and Dyn A, effect on binding affinities. Acetylation of Nα-amino group in ligands 7, Dyn A-(4−11), and 14, [des-Arg7]-Dyn A-(4−11), ligand 16 (IC50 = 120 nM), 20 (IC50 = 140 nM) and 23 (IC50 = were selected and tested for their conformations in membrane- 140 nM) retained good binding affinities in the same range as like sodium dodecyl sulfate (SDS) micelles by 1H 2D-NMR nonacetylated analogues. Even the inversion of chirality of the spectroscopy.17 As G-protein coupled receptors (GPCRs) such Phe residue from L to D did not reduce their binding affinities as BRs have their binding sites close to the lipophilic at the BR in 18 (IC = 360 nM), 21 (IC = 150 nM), and 24 transmembrane (TM) domains, their ligand−membrane 50 50 18 (IC = 200 nM). On the other hand, the same modification at interactions play an important role in biological activities. 50 − the C-terminus by D-Lys decreased its binding more than 10- The membrane can also promote ligand receptor docking by 19,20 fold in 17 (IC50 = 630 nM). However, thanks to the same basic stabilizing their secondary structural elements. Therefore, property, the substitution of a Lys residue at the C-terminus for further insight into biological profiles it is crucial to identify with an Arg in ligands 19−24 was tolerated well to maintain the the membrane-bound structures of the ligands in these same high binding affinities as 14, even with various circumstances. In nuclear Overhauser effect (NOE) summary modifications of the N-terminal position. (Figure 2), both ligands showed strong consecutive dαN(i, i + In order to identify the role of hydrophobic amino acids neighboring Arg residues, the Leu and Ile residues were replaced by an Ala residue, and the resulting ligand 25 had ffi decreased binding a nity (IC50 = 450 nM). Even with the slight loss of affinity, this result suggests that hydrophobicity and size of the hydrophobic amino acid residues play a role in isolating basic amino acid residues. When the two Ala residues in 25 were replaced by two Nle, respectively, the modification recovered binding affinity (22,IC = 140 nM) to the same 50 Figure 2. NOE summary and temperature coefficient values for 7 and range as 19. Further acetylation did not change the binding ffi 14. The thickness of the line corresponds approximately to the a nity in ligands 23 (IC50 = 140 nM) and 24 (IC50 = 200 nM). intensity of NOE cross peaks. These results clarify SAR at the N-terminal part, where neither acetylation nor D-amino acid replacement affects binding affinities of 14, 16, and 18. Heterogeneity of Bradykinin 2 Receptors (B2Rs). 1) with a break at the Pro residue due to the imide nature of Interestingly, the binding affinity of BK in the rat brain the residue; i.e., the Pro residue lacks an amide proton. 3 − ± membrane using [ H]BK (IC50 = 91 nM; log [IC50]= 7.04 Similarly they also displayed sequential dβN(i, i + 1) NOEs 3 − ± 0.11) or [ H]DALKD (IC50 = 120 nM; log [IC50]= 6.93 throughout the sequence. Apart from trivial NOEs, consecutive 0.08) is lower than that (nanomolar range) reported previously dNN(i, i + 1) NOEs and a number of medium range dαN(i, i + for the B2R, which is the predominant BR type constitutively 2) NOEs in the middle segment were observed. It is − expressed in all tissues.13 16 On the other hand, DALKD, noteworthy to observe consecutive medium range NOEs for which has been defined as a bradykinin type 1 receptor (B1R) shorter linear peptides such as ligands 7 and 14. These α selective antagonist, binds to the BRs (IC50 = 130 nM; log observations along with no -helical signature NOEs such as − ± − ± [IC50]= 6.90 0.07 and IC50 = 76 nM; log [IC50]= 7.12 dαN(i, i + 3), dαN(i, i + 4) strongly suggest both ligands fold into 3 3 0.11 vs, [ H]BK and [ H]DALKD, respectively) in rat brain consecutive turns or a 310-type helical fold. The observation of membranes in the same range as BK.11,14 The B2R selective similar NOE patterns in both ligands indicates that the removal ffi fi ff antagonist, HOE140, had very low a nity (IC50 > 10 000 nM) of an Arg residue does not signi cantly a ect the overall against [3H]BK binding in rat brain membranes. These results conformation of these ligands in a membrane environment.

6610 dx.doi.org/10.1021/ja501677q | J. Am. Chem. Soc. 2014, 136, 6608−6616 Journal of the American Chemical Society Article

CαH chemical shifts are very sensitive to conformational structures, and their consecutive negative and positive deviations from random coil values indicate a helical fold and β-sheet structures, respectively.21 Chemical shift index (CSI) plots (Figure 3) for both ligands 7 and 14 displayed a similar

Figure 4. Lowest energy structure and overlay of 10 low energy Figure 3. Chemical shift deviation of observed CαH values from the structures of 7 (lower) and 14 (upper) from the simulated annealing random coil values (CSI plot). It should be noted here that peptide 14 molecular dynamics calculations. The hydrogen atoms are not shown does not contain the Arg4 residue. for clarity. The ribbon diagram shows the secondary structure of the peptide. RMSD between structures is 2.013 Å (1.694 Å for 14) when trend. Although it is difficult to conclude simply on the basis of all the atoms are considered but is reduced significantly to 0.502 Å the CSI plot since 7 and 14 are very short peptides, the (0.155 Å for 7) when only backbone atoms are considered. negative deviations from the random coil suggest a conformational space in the helical domain for both ligands. It could be important role in the receptor interactions and thus does not β affect ligand binding. Also one Arg residue at position 3 of either a -turn structure or a 310-type helical structure. ffi Simulated annealing molecular dynamics calculations were ligand 14 seems to be su cient for receptor recognition similar carried out in order to obtain three-dimensional structures. to the two Arg residues in ligand 7. In Figure 3, the Arg residue at positions 5 or 6 showed high positive deviations, which NMR-derived distance and dihedral angle constraints were β applied in the calculations as described in the Supporting indicate the formation of -sheet structures. When one more fi Arg residue was inserted between positions 6 and 7 in ligand 7, Information. The stereochemical quality for the nal minimized ffi structures was verified by the distribution of per-residue the resulting ligand 26 retained nearly the same binding a nity (IC50 = 110 nM) at the receptor as 7 and 14. backbone dihedral angles (Phi and Psi) in the Ramachandran ffi plot. The distribution of Phi and Psi angles for 14 is Binding A nities and pH Sensitivity. It has been concentrated in only one region for all residues except the C- previously shown that the optimal binding conditions for the BR to its endogenous ligands, including BK, is at pH 6.8.22 terminal Lys residue, suggesting that the conformational ff ensemble contains a single family of structures with conforma- Thus, we also tested the e ect of pH 6.8 on the ability of Dyn A tional flexibility at the C-terminus around the Lys residue analogues to bind to the BR in rat brain membranes (Table 2, (Figure 4). A closer examination of dihedral values and their fi Table 2. Binding Affinities of Dyn A Analogues at BRs in Rat distribution in the Ramachandran plot identi es two consec- a β β Brain at pH 6.8 or 7.4 utive type III -turns (or a short 310-helix: type III -turns and 310-helix have the same dihedral angle values) at the N- [3H]DALKD, pH 7.4 [3H]DALKD, pH 6.8 terminus, and a distorted type 1 β-turn at C-terminal region centered at Pro7-Lys8 in 7. However, the removal of an Arg ligand log [IC50]IC50 (nM) log [IC50]IC50 (nM) residue in 14 resulted in a single type III β-turn at the N- 7 −6.86 ± 0.06 140 −7.16 ± 0.16 69 terminus and the same distorted type I β-turn at the C- 10 −6.78 ± 0.09 170 −7.67 ± 0.05 21 terminus. The consecutive turn structure at the N-terminus in 7 14 −6.71 ± 0.11 190 −7.16 ± 0.09 69 may not be necessary for the B2R interactions considering the 26 −6.96 ± 0.20 110 −7.13 ± 0.04 74 same range of binding affinities of 7 and 14. Ramachandran BK −6.93 ± 0.08 120 −7.01 ± 0.05 98 plots of each amino acid for all the final hundred structures of 7 DALKD −7.12 ± 0.11 76 −6.98 ± 0.10 100 revealed semi rigid conformations for all the residues except for aDetails described in Table 1. the Arg, or Arg and Lys residues where the Psi angle deviation is greater than 30 degrees from the average value. We suggest Figure 5). These initial analyses found that the affinity for all 4 that the flexibility of the three basic amino acids in 14 could analogues selected was enhanced by 2 to 8 fold. Additional contribute to the receptor recognition by adapting the same analyses shown in Table 3 demonstrate that other analogues conformation as 7. also interact with the rat brain BR with affinities in the The NMR study showed that the two ligands, 7 and 14, have nanomolar range. These data validate the optimal binding the same distorted type 1 β-turn structure at the C-terminus, conditions for the Dyn A analogues to be at pH 6.8, which is which is considered a key region for binding. This explains how consistent with the binding conditions previously established the two ligands bind to the receptor with the same affinity even for BRs. with a dissimilarity of structure at the N-terminus. As Identification of Dyn A Pharmacophore for BRs. On mentioned above, the N-terminal part does not play an the basis of the binding affinities of the three ligands 7, 14, and

6611 dx.doi.org/10.1021/ja501677q | J. Am. Chem. Soc. 2014, 136, 6608−6616 Journal of the American Chemical Society Article

considered as a minimum pharmacophore to fulfill the structural requirement (l =0,m = 2, one Pro). Together, it suggests that the BR recognition depends on the electrostatic interactions between positive charges of the ligand and negative charges of the BR, and thus to amplify the electrostatic interactions, the positive charges of the ligand should be allocated by making a proper topographical structure. This may be the role of hydrophobic amino acid residues including the Pro. Off-Target Screening and Functional Assay. As shown Figure 5. Inhibition of [3H]DALKD binding to rat brain membrane at in Figure 6, the pharmacophore of Dyn A for BRs represents a 3 pH 6.8. Rat brain membrane was incubated with [ H]DALKD and simple amphipathic structure. In order to ensure the specificity increasing concentrations of ligands. Data for each nonlinear of the Dyn A analogues for the BR, lead ligands 14 and 32 were regression analysis were collected from at least two independent screened at 43 off-target receptors. While the screen was experiments. limited, the blinded analysis supports the notion that the ligands’ interaction with BR is specific (see Supporting Table 3. Amphipathic Dyn A Analogues and Their Binding a Information). We also tested selected Dyn A analogues for Affinities for BR in Rat Brain at pH 6.8 their binding to the three cloned opioid receptors ([3H]- 3 3 BR, [3H]DALKD DAMGO, ([ H]deltorphin, and [ H]U69,593 for the rat mu opioid receptor (rMOR), human delta opioid receptor IC50 no. structure log [IC50] (nM) (hDOR), and human kappa opioid receptor (hKOR), ffi μ δ 27 H-Leu-Arg-Ile-Arg-Pro-Lys-Leu-Lys −7.52 ± 0.09 30 respectively). No ligand showed a nities for the and -OH opioid receptors but ligands 10−13, which include a longer N- − ± ffi 28 H-Nle-Lys-Nle-Lys-Pro-Lys-Nle-Lys- 7.04 0.10 91 terminus part, exhibited low a nities (10, Ki = 560 nM; 11, Ki OH = 2400 nM; 13, K = 2200 nM) at the κ opioid receptor (n = 2). − ± i 29 H- Lys-Nle-Lys-Pro-Lys-Nle-Lys-OH 7.07 0.16 85 However, our lead ligands, 14 and 32, did not exhibit affinity at − ± 30 H-Nle-Lys-Pro-Lys-Nle-Lys-OH 7.11 0.14 78 the κ opioid receptor (K > 10 000 nM, n = 2). These results − ± i 31 H- Lys-Pro-Lys-Nle-Lys-OH 6.64 0.13 230 show that our strategies have successfully differentiated opioid − ± 32 H- Arg-Pro-Lys-Leu-Lys-OH 7.24 0.12 58 and nonopioid functions. − ± 33 H-Pro-Lys-Leu-Lys-OH 6.68 0.10 210 To determine the functional activity of ligand 14, we tested a Details described in Table 1. its ability to stimulate the hydrolysis of [3H]inositol phosphates in transfected HEK 293 cells expressing the human B2R. This bioassay measures the production of the intracellular second 26, it was considered that two neighboring basic amino acid messenger, inositol triphosphate, which has been defined as the residues are not necessary for BR recognition, and furthermore primary signal produced upon the activation of B2R by BK.23 In it was observed that in relatively longer length analogues such the HEKB2R cells (Figure 7), BK stimulated the production of as ligand 27, truncation of the Arg residue increased their ffi − ± binding a nities (log [IC50]= 7.17 0.10, IC50 =68nMat pH 7.4, cf. 13) (Table 3). From the structure of ligand 27,itis clear that the ligand consists of basic amino acids and hydrophobic amino acids possessing amphipathic properties and a Pro residue making a turn structure. This is similar to other ligands that show good binding affinities to the BR. Successive truncations of N-terminus and substitutions of a basic amino acid residue and hydrophobic amino acid residue with a Lys and Nle did not change their affinities. Analyzing the structure of all the ligands that showed good binding affinities at the BRs provides the following insight regarding the Figure 7. Phosphatidylinositol (PI) assay. The effect of test drug on pharmacophore of Dyn A analogues for the rat BR in the production of [3H]inositol phosphates was expressed as a ratio of CNS: It requires a basic amino acid residue such as a Lys and stimulated over basal activity defined as the amount detected in the Arg at the C-terminus, combinations of basic amino acid absence of test drug. EC50: concentration at 50% of maximal residues and hydrophobic amino acid residues, and a Pro stimulation. Data are representative of 3 independent experiments. residue as a hydrophobic residue to make a turn structure. On the basis of the SAR results, the pharmacophore for the BR can 3 ± be simplified as an amphipathic structure as shown below in [ H]inositol phosphates with an EC50 of 3.9 2.4 nM. Ligand ffi μ Figure 6. Ligand 32, which retained high binding a nity (IC50 14, in contrast, showed no stimulation up to a dose of 10 M. = 58 nM) after successive truncation at the N-terminus, is Also, there was no overt cell death observed in ligand 14 up to 10 μM. In Vivo Assay: Toxic and Hyperalgesic Effects. The nontoxic effect of ligand 14 was also demonstrated by in vivo rotarod and hindlimb tests using naivë rats (Figure 8). In the rotarod test, intrathecal (i.th.) administrations (3 nmol) of 14 retained the similar latencies as vehicle and 10. In the hindlimb Figure 6. Pharmacophore of Dyn A for BRs. test, i.th. administration of 14 did not show any motor

6612 dx.doi.org/10.1021/ja501677q | J. Am. Chem. Soc. 2014, 136, 6608−6616 Journal of the American Chemical Society Article

Figure 8. Rotarod (left) and Hindlimb (right) tests by i.th. administration of 10 or/and 14 in naivë rats. Figure 10. Dose-dependent reversal of thermal hyperalgesia (left, impairments at a high dose (30 nmol), but 10 (25 nmol, i.th) radiant heat test) and tactile hypersensitivity (right, von Frey test) induced paralysis that occurred within a few minutes post- using varying doses of 14 (i.th.) in L5/L6 SNL-operated male SD rats. Statistical significance was determined by 95% confidence interval (*P injection and lasted for 30 to 40 min. In addition, pretreatment ** ≥ of 14 (30 nmol, i.th.) completely blocked ligand 10 (25 nmol, < 0.05, P < 0.01 vs vehicle; n 6). i.th.)-induced paralysis, suggesting that ligand 14 may inhibit ’ ff BRs as a therapeutic target for neuropathic pain. 14 is a Dyn A s excitatory e ects in vivo. ’ To evaluate the hyperalgesic effects of 10 and 14, radiant structure derived from Dyn A s interaction at the BRs. Together heat and von Frey filaments tests were performed in naivë rats with our previous studies characterizing the role of spinal Dyn (Figure 9). Paw withdrawal latencies and thresholds of all A in neuropathic pain, the results of the present study not only support a structural basis for Dyn A’s actions at the spinal BRs to promote pain, but also show that it is possible to develop antagonists like 14 that target CNS BRs for therapy. Peripheral Effects: Paw Edema and Plasma Extrava- sation. Local administration of 14 had no effect on BK- induced paw edema and plasma extravasation (Figure 11).

Figure 9. Effects of ligand 10 or/and 14 on thermal hyperalgesia (left, radiant heat test) and tactile hypersensitivity (right, von Frey test) 2 h after i.th. administration in naivë rats. Ligand 10 decreased thermal latency and tactile thresholds after i.th. administration. Ligand 14 blocked ligand 10-induced thermal hyperalgesia and tactile hyper- fi sensitivity after coadministration. Statistical signi cance was deter- Figure 11. Effect of i.pl. injection of BK, given alone or in combination mined by 95% confidence interval (*P < 0.05, **P < 0.01, ***P < ≥ with HOE140 or 14 on paw edema (left) and plasma extravasation 0.001 vs vehicle; n 6). (right). Values shown represent the differences between volumes (mL) of vehicle and drug combination (BK/vehicle, BK/HOE140, animals were 18.7 ± 0.6 s and 15 ± 0 g, respectively. As and BK/14) paws (left, *P < 0.05 vs vehicle) and the difference expected, i.th. administration (3 nmol/5 μL) of ligand 10 absorbance (percent) of two hind paws (one vehicle only, the other reduced these values to 11.4 ± 1.0 s and 7.3 ± 1.0 g in 1 h, BK/vehicle, BK/HOE140, and BK/14) at 620 nm by the content of demonstrating thermal hyperalgesia (paw withdrawal latency: Evans Blue dye (right). area under curve (AUC) ± SEM = 2067 ± 137 in 2 h) and mechanical hypersensitivity (paw withdrawal threshold: AUC ± SEM = 1074 ± 68 in 2 h). In contrast, administration of 14 increased latency of paw withdrawal from a heat source when Intraplantar (i.pl.) injection of BK (10 nmol) induced robust compared with vehicle control, an effect that is defined as paw swelling and edema that peaked at 30 min postdose. The analgesic (Figure 9, left panel). 14 did not alter mechanical paw volume difference between the ipsi- and contralateral hind sensitivity (Figure 9, right panel). Coadministration of 10 and paws increased from 0.03 ± 0.09 mL (baseline) to 0.43 ± 0.08, 14 prevented the hyperlalgegia induced by 10 when given 0.35 ± 0.08 and 0.23 ± 0.07 mL at 30, 60, and 90 min alone. These data suggest that ligand 14 can effectively block postdose, respectively. As expected, coadministration of a B2R ligand 10, to induce abnormal pain states in vivo, presumably antagonist, HOE140 (10 nmol, i.pl.), reduced the BK-induced mediated by spinal BRs as an antagonist. paw volume increase to 0.22 ± 0.03 mL at 30 min postdose by Thermal and tactile hypersensitivities were also assessed in 50%. In contrast, 14 (10 nmol, i.pl.) had no effect on paw ± rats that had received unilateral L5/L6 spinal nerve ligation edema with the same degree of paw volume increase (0.42 (SNL) injury (Figure 10). Before injury, paw withdrawal 0.07 mL at 30 min postdose) as that of BK alone. The same latencies and thresholds of all animals were between 19.3−20.9 trend of effects was also observed in a plasma extravasation test. s and 15 g, respectively. SNL injury reduced these values to Coadministration of BK with 14 did not affect the BK-induced 8.6−11.3 s and 2.2−2.9 g, respectively, indicating abnormal plasma extravasation, although HOE140 at this concentration sensitivities to thermal and tactile stimuli in the injured hind was effective in reducing the extravasation on its own. This paw. Injured animals treated with ligand 14 showed result suggests that our lead ligand 14 does not inhibit BK’s antihyperalgesic effects in both tests in a dose dependent action at the peripheral BRs, and therefore there will be little manner in 2 h. The greatest antihyperalgesic effects occurred at impact on the BK’s cardiovascular function at the region. Paw the highest dose of 3 nmol/10 μL in both tests. edema and plasma extravasation tests show the possibility of The ability of 14 to reverse abnormal pain states in this ligand 14 as a drug candidate to block hyperalgesia in chronic model of neuropathy underscores the potential role of spinal pain states without serious cardiovascular side effects.

6613 dx.doi.org/10.1021/ja501677q | J. Am. Chem. Soc. 2014, 136, 6608−6616 Journal of the American Chemical Society Article ■ CONCLUSIONS XWINNMR (Bruker, Inc.) and FELIX2000 (Accelrys, Inc., San Diego, CA). Mixing times for TOCSY and NOESY spectrum were 60 and We have discovered a lead ligand 14 for CNS BRs and the 300 ms, respectively. All experiments were 750 increments in t1, 16, or human B2R through a systematic SAR study on Dyn A. Further 32 scans each, 1.5 s relaxation delay, size 2 or 4K, and the spectral modification of the lead ligand asserted the key structural processing was with shifted sine bell window multiplications in both features of the BR pharmacophore: amphipathicity. NMR study dimensions. The water suppression was achieved by using WATER- − 7 3 of two ligands 7 (Dyn A-(4 11)) and 14 ([des-Arg ]-Dyn A- GATE pulse sequence. Coupling constants ( JαH‑NH) were measured (4−11)) showed the same distorted type 1 β-turn structure at from double quantum filtered correlation spectroscopy (DQF-COSY) the C-terminus, a key region for the binding. Considering the experiments. pH dependence of the ligand’s binding affinities, the BR Structure Calculation Methods. Distance constraints for the recognitions seem to correlate with the electrostatic inter- structure calculation were obtained from integral volumes of the NOESY peaks. The NOE integral volumes were classified into strong, actions between Dyn and BRs and thus for the optimization of medium, and weak with 3.0, 4.0, and 5.0 Å as upper bound distance. their interactions, allocation of positive charges in ligands may Molecular dynamics simulation was done with the INSIGHT/ be critical. DISCOVER package (Accelrys, Inc., San Diego, CA) with consistent Ligand 14 inhibited ligand 10-induced thermal and valency force field (CVFF). All calculations were done in vacuo. A mechanical hyperalgesia in naivë animals. In nerve injured distance dependent dielectric constant (2.5r where r is the distance in animals, ligand 14 blocked thermal and mechanical hyper- Å) was used. All peptide bonds were constrained to trans sensitivity in a dose-dependent manner. At high dose, ligand 10 conformation by a 100 kcal/mol energetic penalty. Distance restraints fl showed serious motor impairment in vivo. In contrast, 14 did with a force constant of 25 kcal/mol were applied in the form of a at- not show any toxicity, and motor impairment and furthermore bottom potential well with a common lower bound of 1.8 Å and an 10 upper bound of 3.0, 4.0, and 5.0 Å, respectively, in accordance with blocked ligand -induced paralysis in vivo. These in vivo observed weak, moderate, or strong NOE intensities. Only the activities of ligand 14 may be localized in the CNS, since there distance restraints from inter-residue NOEs were included in the is no peripheral activity of ligand 14 shown in the paw edema calculation. Dihedral angle restraints based on CαH CSI were imposed and plasma extravasation tests. As we predicted, ligand 14 on the residues displaying negative deviation. Thus, for a CSI > −0.10 inhibits the actions of endogenous Dyn A’s fragment, Dyn A- ppm, the ϕ and ψ restraints were in the range −90° to −30° and −60° (2−13), resulting in antihyperalgesic effects in the CNS. This to 0°, respectively, while for a CSI ≤−0.10 ppm, the corresponding work further supports our hypothesis that the actions of spinal ranges were −150° to −30° for ϕ and −90° to 150° for ψ. Dyn A at BRs underlie pathological pain states. These results Radioligand Competition Binding Assays. Binding affinities of Dyn A analogues at the BRs were determined by radioligand also demonstrate that ligand 14 has the therapeutic potential 3 3 for chronic pain states via a novel mechanism of BRs in the competition analysis using [ H]DALKD or [ H]BK in rat brain membranes or in transfected HEK 293 cells expressing the human CNS. B2R. Crude rat brain membranes were pelleted and resuspended in 50 mM Tris buffer containing 50 μg/mL bacitracin, 10 μM captopril, 100 ■ EXPERIMENTAL SECTION μM PMSF, and 5 mg/mL bovine serum albumin (BSA). Ten Synthesis. Dyn A analogues were synthesized by standard solid concentrations of a test compound were each incubated with 50 μgof phase peptide synthesis using Nα-Fmoc-chemistry (Fmoc = 9- membranes and [3H]DALKD (1 nM, 76.0 Ci/mmol) or [3H]BK (1 fluorenylcarboxy) on amino acid preloaded Wang resin (100−200 nM, 85.4 Ci/mmol) at 25 °C for 2 h. Nonspecific binding was defined mesh, Novabiochem) in high yields (overall yield >40%), except for by that in the presence of 10 μM KD in all assays. Reactions were the analogues with a Pro residue at the C-terminus. Because of serious terminated by rapid filtration through Whatman GF/B filters side reactions of Pro on the resin, Chlorotrityl resin (200−400 mesh, presoaked in 1% polyethylenimine, followed with four washes of 2 1% DVB, Novabiochem) was used as an alternative.24 Coupling was mL each of cold saline. Radioactivity was determined by liquid performed using 3 equiv 2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethy- scintillation counting in a Beckman LS5000 TD. Data were analyzed laminium hexafluorophosphate (HBTU)/3 equiv N-hydroxybenzo- by nonlinear least-squares analysis using GraphPad Prism 4. triazole (HOBt)/6 equiv diisopropylethylamine (DIPEA) in N,N- Logarithmic values were determined from nonlinear regression dimethylformamide (DMF) for 1 h at rt, and Nα-Fmoc-group was analysis of data collected from at least two independent experiments. deprotected by 20% piperidine in DMF for 20 min at rt. In most cases, Functional Assays. Phosphatidylinositol (PI) assays were crude peptides were obtained by cleavage using a 95% trifluoroacetic performed using [3H]inositol phosphates tracer growth media (myo acid (TFA) solution containing 2.5% triisopropylsilane (TIS) and tritium inositol) in poly-D-Lys-coated cell culture plates, and the 2.5% water for 3 h in high purity (70−90%) and could be isolated with method used to measure the accumulation of [3H]inositol phosphates more than 97% purity by preparative reverse phase high performance was according to that described earlier with additional wash with liquid chromatography (RP-HPLC) using gradient (10−40% acetoni- water, 5 mM sodium tetraborate/60 mM sodium formate before trile in water containing 0.1% TFA in 15 min) in a short time (<15 elution with 0.2 mM ammonium formate/0.1 M formic acid through min) because of their hydrophilic characters (refer to aLogPs in Biorad AG 1-X8 Resin.25 Supporting Information). The purified Dyn A analogues were In Vivo Assays. The experiments were carried out using nonfasted validated by analytical RP-HPLC and high resolution mass spectros- male Sprague−Dawley rats (250−300g; Harlan; Indianapolis, IN) kept copy in positive ion mode. in a room controlled for temperature (22 ± 2 °C) and illumination NMR Spectroscopy Methods. NMR studies of ligands 7 and 14 (12 h on and 12 h off). All experiments were performed under a in SDS micelles were performed on a Bruker DRX600 (600 MHz) at protocol approved by Institutional Animal Care and Use Committee 25 °C and at pH 5.5. Peptide concentrations for the NMR experiments (IACUC) of the University of Arizona, and in accordance with policies were 5.8 mM and 6.1 mM for 7 and 14, respectively. The micelle and guidelines for the care and use of laboratory animals as adopted by samples were prepared by dissolving the peptides and 50 equiv of International Association for the Study of Pain (IASP) and the perdeuterated SDS in 0.6 mL of acetate buffer (10 mM) containing National Institutes of Health (NIH). Intrathecal (i.th.) catheterization 10% D2O. The pH of each sample was adjusted to 5.5 by using DCl or was performed under ketamine/xylazine (80/12 mg/kg, i.p.) NaOD as necessary. Deuterated 3-(trimethylsilyl)propionic acid anesthesia. Some groups of rats were implanted with i.th. catheters (TSP) was added as an internal standard for referencing. Two- (polyethylene 10, 7.8 cm) through atlanto-occipital membrane dimensional nuclear Overhauser enhancement spectroscopy (NOESY) extended to the level of the lumbar spinal cord for drug administration. and total correlated spectroscopy (TOCSY) (Supporting Information) Animals were allowed to recover for 7 days. L5/L6 spinal nerve ligation were acquired using standard pulse sequences and processed using (SNL) injury was induced as described by Chung and colleagues.26

6614 dx.doi.org/10.1021/ja501677q | J. Am. Chem. Soc. 2014, 136, 6608−6616 Journal of the American Chemical Society Article

Rotarod latencies, paw-withdrawal latencies, and paw-withdrawal Notes ± thresholds were calculated and expressed as the mean AUC SEM The authors declare no competing financial interest. in Graph Pad Prism 6 (GraphPad Software, La Jolla, CA). One-way analysis of variance (ANOVA) was performed in FlashCalc (University of Arizona, Tucson), and statistical significance achieved when p ≤ ■ ACKNOWLEDGMENTS 0.05. We thank Jose Juan Ortiz Navarro, Ann Ngyuene, Alyssa Peake, Rotarod Test. Rats were trained to walk on an automated rotating Alice Cai, and Robert Kupp for their help in synthesis and rod (8 rev/min, Rotamex 4/8, Columbus Instrument, Columbus, OH) ff for maximal cutoff time of 180s.27 Baseline values were recorded for bioassay of ligands. O -target receptor screening was each animal. Compounds were administered (i.th.) and assessment generously provided by the National Institute of Mental occurred every 20 min for the first 120 min. The rotarod latencies Health’s Psychoactive Drug Screening Program, Contract # were recorded at each time point. HHSN-271-2008-025C (NIMH PDSP). The NIMH PDSP is Motor Function and Paralysis. Paralysis was evaluated as directed by Bryan L. Roth at the University of North Carolina flaccidity of the hind limbs following i.th. injection as previously ffi reported by Spampinato and colleagues.28 Drugs were injected in a at Chapel Hill and Project O cer Jamie Driscol at NIMH, volume of 5 μL, followed by a 1 μL air bubble and a 9 μL saline flush. Bethesda MD, USA. This work was supported by the U.S. Flaccidity of the hind limbs was measured for 2 h after drug Public Health Services, NIH, and NIDA (P01DA006284). administration. Thermal HypersensitivityTest(RadiantHeat).Thermal ■ REFERENCES hypersensitivity was assessed using the rat plantar test (Ugo Basile, Italy) as described earlier.27 Rats were allowed to acclimate within (1) Lai, J.; Ossipov, M.; Vanderah, T. W.; Malan, T. P.; Porreca, F. Plexiglas enclosures on a clear glass plate. A mobile radiant heat source Mol. Interventions 2001, 1, 160−167. (halogen bulb coupled to an infrared filter) was located under the glass (2) Young, E. A.; Walker, J. M.; Houghten, R.; Akil, H. Peptides 1987, plate and focused onto the hind paw. Paw withdrawal latencies were 8, 701−707. recorded in seconds. An automatic cut off point of 33 s was set to (3) Faden, A. I.; Jacobs, T. P. Br. J. Pharmacol. 1984, 81, 271−276. prevent tissue damage. The apparatus was calibrated to give a paw (4) Friederich, M. W.; Friederich, D. P.; Walker, J. M. Peptides 1987, withdrawal latency of approximately 20 s on the uninjured paw. The 8, 837−840. radiant heat source was activated with a timer and focused onto the (5) Long, J. B.; Martinez-Arizala, A.; Echevarria, E. E.; Tidwell, R. E.; plantar surface of the hind paw. Holaday, J. W. Eur. J. Pharm. 1988, 153,45−54. Tactile Hypersensitivity Test (von Frey, Innocuous). The (6) Walker, J. M.; Moises, H. C.; Coy, D. H.; Baldrighi, B.; Akil, H. assessment of mechanical hypersensitivity consisted of measuring the Science 1982, 218, 1136−1138. withdrawal threshold of the paw ipsilateral to the site of nerve injury in (7) Tang, Q.; Lynch, R. M.; Porreca, F.; Lai, J. J. Neurophysiol. 2000, 27 response to probing with a series of calibrated von Frey filaments. 83, 2610−2615. fi Each lament was applied perpendicularly to the plantar surface of the (8) Lai, J.; Luo, M. C.; Chen, Q.; Ma, S.; Gardell, L. R.; Ossipov, M.; ligated paw of rats kept in suspended wire-mesh cages. Measurements Porreca, F. Nat. Neurosci. 2006, 9, 1534−1540. were taken both before and after administration of drug or vehicle. (9) Altier, C.; Zamponi, G. W. Nat. Neurosci. 2006, 9, 1465−1467. The paw withdrawal threshold was determined by sequentially (10) Hruby, V. J. Nat. Rev. Drug Discovery 2002, 1, 847−858. “ − ” increasing and decreasing the stimulus strength ( up down method) (11) Chavkin, C.; Goldstein, A. Proc. Natl. Acad. Sci. U. S. A. 1981, analyzed using a Dixon nonparametric test16. 78, 6543−6547. Measurement of Rat Paw Edema and Plasma Extravasation. (12) Turcotte, A.; Lalonde, J. M.; St-Pierre, S.; Lemaire, S. Int. J. Pept. Under ketamine/xylazine (80/12 mg/kg, i.p.) anesthesia animals Protein Res. 1984, 23, 361−367. received an injection of Evans Blue (30 mg/mL/kg, i.v.) via tail vein, (13) Marceau, F.; Hess, J. F.; Bachvarov, D. R. Pharm. Rev. 1998, 50, and baseline paw volume for both hind paws was measured by use of a 357−386. plethysmometer (Ugo Basile). Animals then received 0.1 mL i.pl. (14) Innis, R. B.; Manning, D. C.; Stewart, J. M.; Snyder, S. H. Proc. injections in one hind paw of normal saline (0.9% NaCl) containing Natl. Acad. Sci. U. S. A. 1981, 78, 2630−2634. BK either alone or mixed with HOE140 or 14 (10 nmol/paw each). (15) Liebmann, C.; Bosse, R.; Escher, E. Mol. Pharmacol. 1994, 46, The contralateral paw received 0.1 mL of saline and was used as a − control. Edema was measured at several 30, 60, and 90 min after i.pl. 949 956. ff (16) Hess, J. F.; Borkowski, J. A.; Macneil, T.; Stonesifer, G. Y.; injections and expressed in mL as the di erence between the test and − control paws. Three hours after BK injections, animals were sacrificed, Fraher, J.; Strader, C. D.; Ransom, R. W. Mol. Pharmacol. 1993, 45,1 and patches (10 × 5 mm) of the dorsal skin from both hind paws were 8. collected. The skin patches were then incubated separately in (17) Dhanasekaran, M.; Palian, M. M.; Alves, I.; Yeomans, L.; Keyari, Eppendorf tubes containing 1.8 mL of formamide at 60 °C water C. M.; Davis, P.; Bilsky, E. J.; Egleton, R. D.; Yamamura, H. I.; bath for 24 h to extract the dye. The tissue extraction was then Jacobsen, N. E.; Tollin, G.; Hruby, V. J.; Polt, R. J. Am. Chem. Soc. centrifuged at 15 000 rpm for 15 min, and the supernatant was 2005, 127, 5435−5448. pipetted to a 96 well plate as triplicates and the absorbance was (18) Berthold, M.; Bartfai, T. Neurochem. Res. 1997, 22, 1023−1031. determined at 620 nm. The difference of the mean absorbance (19) Sargent, D. F.; Schwyzer, R. Proc. Natl. Acad. Sci. U. S. A. 1986, between the two hind paws of each rat was used to compare the 83, 5774−5778. degree of plasma extravasation in different treatment groups. (20) Palian, M. M.; Boguslavsky, V. I.; O’Brien, D. F.; Polt, R. J. Am. Chem. Soc. 2003, 125, 5823−5831. ■ ASSOCIATED CONTENT (21) Wishart, D. D.; Bigam, C. G.; Holm, A.; Hodges, R. R.; Sykes, B. − *S Supporting Information D. J. Biomol. NMR 1995, 5,67 81. − Analytical data, binding affinity data, NMR spectroscopy. This (22) Regoli, D.; Barabe, J. Pharmacol. Rev. 1980, 32,1 46. (23) Graneβ, A.; Adomeit, A.; Heinze, R.; Wetzker, R.; Liebmann, C. material is available free of charge via the Internet at http:// J. Biol. Chem. 1998, 273, 32016−32022. pubs.acs.org. (24) Chiva, C.; Vilaseca, M.; Giralt, E.; Albericio, F. J. Pept. Sci. 1999, − ■ AUTHOR INFORMATION 5, 131 140. (25) Berridge, M. J.; Downes, C. P.; Hanley, M. R. Biochem. J. 1982, Corresponding Author 206, 587−595. [email protected] (26) Chung, J. M.; Kim, S. H. Pain 1992, 50, 355−363.

6615 dx.doi.org/10.1021/ja501677q | J. Am. Chem. Soc. 2014, 136, 6608−6616 Journal of the American Chemical Society Article

(27) Largent-Milnes, T. M.; Yamamoto, T.; Nair, P.; Moulton, J. W.; Hruby, V. J.; Lai, J.; Porreca, F.; Vanderah, T. W. Br. J. Pharmacol. 2010, 161, 986−1001. (28) Spampinato, S.; Romualdi, P.; Candeletti, S.; Cavicchini, E.; Ferri, S. Pain 1988, 35,95−104.

6616 dx.doi.org/10.1021/ja501677q | J. Am. Chem. Soc. 2014, 136, 6608−6616 Substance Abuse and Rehabilitation Dovepress open access to scientific and medical research

Open Access Full Text Article Review The pharmacology of neurokinin receptors in addiction: prospects for therapy

Alexander J Sandweiss Abstract: Addiction is a chronic disorder in which consumption of a substance or a habitual Todd W Vanderah behavior becomes compulsive and often recurrent, despite adverse consequences. Substance p (SP) is an undecapeptide and was the first neuropeptide of the neurokinin family to bediscovered. Department of Pharmacology, College of Medicine, University of Arizona, The subsequent decades of research after its discovery implicated SP and its neurokinin relatives Tucson, AZ, USA as neurotransmitters involved in the modulation of the reward pathway. Here, we review the neurokinin literature, giving a brief historical perspective of neurokinin pharmacology, localization in various brain regions involved in addictive behaviors, and the functional aspects of neurokinin pharmacology in relation to reward in preclinical models of addiction that have shaped the rational drug design of neurokinin antagonists that could translate into human research. Finally, we will cover the clinical investigations using neurokinin antagonists and discuss their potential as a therapy for drug abuse. Video abstract Keywords: reward, substance p, alcohol, morphine, cocaine, dopamine

Introduction Drugs of abuse such as opioids, cocaine, amphetamines, alcohol, and nicotine affect the reward pathway in unique ways, leading to the potential of addiction. In the United States, the cost of substance abuse to society is more than $700 billion per year, neces- sitating new strategies in the management of addiction.1 Particularly alarming is the rate of deaths due to heroin overdose, which has skyrocketed since 2010. The National Institute on Drug Abuse (NIDA) and Centers for Disease Control and Prevention attribute this increase in heroin usage and mortality to an inadvertent consequence Point your SmartPhone at the code above. If you have a of reducing the availability of prescription painkillers.2 While abstinence from drugs QR code reader the video abstract will appear. Or use: http://youtu.be/sBhNwvm77wc of abuse seems like the most logical strategy, this has proven to be only an illusory goal. Therefore, the FDA and NIDA have planned to change the requirements for new therapies designed as deterrents for drugs of abuse; a reduction in the use of drugs of abuse over the long term may be the more appropriate requirement for FDA approval. Neurokinins are a family of peptide transmitters involved in the reward pathway for each of the drugs of abuse, giving researchers a target to design new medications aimed at reducing the addictive profile of said drugs of abuse. Correspondence: Todd W Vanderah Substance p (SP) was the first member of the neurokinin family of peptides to Department of Pharmacology, be isolated, initially from equine intestine and brain in 1931, and shown to act as a College of Medicine, University of Arizona, 1501 N Campbell Ave, vasodepressor.3 The subsequent decades of research implicated SP and its neurokinin LSN 647, Tucson, AZ 85721, USA cousins in numerous central nervous system (CNS) disorders including anxiety, Tel +1 520 626 7801 Email [email protected] depression, migraine, schizophrenia, and addiction. Here, we review the basic and

submit your manuscript | www.dovepress.com Substance Abuse and Rehabilitation 2015:6 93–102 93 Dovepress © 2015 Sandweiss and Vanderah. This work is published by Dove Medical Press Limited, and licensed under Creative Commons Attribution – Non Commercial (unported, v3.0) License. The full terms of the License are available at http://creativecommons.org/licenses/by-nc/3.0/. Non-commercial uses of the work are permitted http://dx.doi.org/10.2147/SAR.S70350 without any further permission from Dove Medical Press Limited, provided the work is properly attributed. Permissions beyond the scope of the License are administered by Dove Medical Press Limited. Information on how to request permission may be found at: http://www.dovepress.com/permissions.php Sandweiss and Vanderah Dovepress clinical science of the last 80 years that have helped shape newly available antibodies to SP, immunohistochemical our current understanding of how neurokinins specifically techniques allowed more precise characterization of SPergic alter the neuronal pathway involved in addiction. We will neurons in the CNS. Even with the rather rudimentary tech- then introduce potential neurokinin-directed therapies that niques available in the 1970s (ie, no optogenetics), SPergic may have efficacy in clinical practice relating to addiction. projections were specifically found traveling from habenula (Hb) to the interpeduncular nucleus (IPN) and ventral teg- Historical overview of neurokinins mental area (VTA) via the fasciculus retroflexus,8 the striatum In 1931, Ulf Von Euler and John Gaddum were on an expe to the substantia nigra via the striato-nigral pathway,9 and dition of sorts, in search of the distribution of acetylcholine the nucleus accumbens (NAc) to the ventral pallidum (spe- in various equine organs. They came across a previously cifically the nucleus basalis magnocellularis),10 with further unidentified substance that they were able to concentrate in a evidence supporting SP as a neurotransmitter with vesicular powdered form, thus naming it “substance p”.4 By the 1950s, release (Figure 1).11 At roughly the same time, the importance SP was well accepted as a polypeptide located in the CNS, of dopamine in the mesolimbic and mesocortical pathways particularly concentrated in the thalamus, hypothalamus, on drug seeking behavior was coming to fruition.12,13 Most basal ganglia, and tegmentum in addition to the dorsal root importantly, it seemed that dopaminergic projections from ganglia of the peripheral nervous system, mediating noci- the VTA to the NAc and other regions facilitated reward.14 ceptive transmission from the primary afferent.5,6 However, With the basic topography of SP signaling in place, the next it was not until 1970 when Chang and Leeman were able to step was determining its functionality in the mesolimbic isolate, characterize, and sequence SP as an 11-amino-acid system. Indeed, it was shown that SP could directly activate peptide that the neurokinin field really evolved.7 With the dopaminergic neurons in the VTA,15 but how was SP signaling

Medial forebrain bundle

Hb NAc Fasciculus Accumbal-basalis NBM retroflexus projection VTA

AMG

Legend Neurokininergic Dopaminergic Glutamatergic Acetylcholinergic

Figure 1 Neurokininergic projections in the reward pathway. Notes: Neurokininergic projections are thought to facilitate the reward pathway. Intra-Hb SPergic interneurons facilitate reward. SPergic projections from Hb to VTA and IPN exist; however, the role of the IPN is not well understood (near VTA, not pictured). The VTA also receives SP from the NAc. The NAc additionally projects SP to the NBM. An intra-AMG SP fiber likely exists; however, its termination neuron is undetermined. Abbreviations: Hb, habenula; VTA, ventral tegmental area; IPN, interpeduncular nucleus; NAc, nucleus accumbens; NBM, nucleus basalis magnocellularis or nucleus basalis of Meynert; AMG, amygdala; SP, substance p.

94 submit your manuscript | www.dovepress.com Substance Abuse and Rehabilitation 2015:6 Dovepress Dovepress Neurokinins in addiction to the postsynaptic neuron and were there other ligands of the potentiating neuronal mechanisms of firing an action potential, same family in humans? in addition to activating the nuclear translocation of certain transcription factors including NF-κB.23 Additionally, recent Basic neurokinin pharmacology evidence implicates swift activation of a Na+ leak channel, The ensuing era of neurokinin research revolved around the NALCN, as well as the closure of G-protein-linked inwardly characterization of two more human neurokinins and their rectifying K+ channels in the rapid SP-induced activation of 24,25 receptors. In 1983, neurokinin A and neurokinin B (NKA neuronal action potentials. and NKB, respectively) were discovered and characterized, For years, neurokinin antagonist studies were made very putting them in the same family as SP (the tachykinin difficult by the lack of penetration of the available ligands 26 16 17 (ie, only peptidergic antagonists were available). The family ) based on similar −CO2 terminal sequences. By 1984, all three neurokinin receptors had been proposed,18 breakthrough came in 1991 when scientists at Pfizerdiscovered followed by the permanent nomenclature: neurokinin-1 the first nonpeptide molecule with classical competitive antag- 27 onism at the NK1R. The identification of this compound led receptor (NK1R), neurokinin-2 receptor (NK2R), and neu- 19 to the discovery of even more selective, structurally diverse, rokinin-3 receptor (NK3R) in 1986. Each ligand can bind and activate each receptor; however, they all have their nonpeptidic NK1R antagonists at other pharmaceuticals, preference owing to a graded affinity: SP preferentially namely, Merck’s MK-869, which later became known in the clinic as the antiemetic aprepitant (EMEND®, Merck & Co, activates NK1R, NKA preferentially activates NK2R, and 28 20 NJ, USA). While considerable time and money went into NKB preferentially activates NK3R (Table 1). Cellular and molecular experiments linked neurokinin receptor activation the possibility of aprepitant working as a standalone analgesic 29 to inositol phospholipid hydrolysis21 (later referred to as Gq and/or antidepressant (without much success), the prospect

of an NK1R antagonist for the treatment of addiction still coupling). Following receptor activation, the NK1R is rapidly + remains viable. The rest of this review will cover the specifics internalized, leading to visual NK1R endosomal varicosities in the dendrites and somata of neurons, disappearing an hour of neurokinin pharmacology in addiction. later.22 This discovery made future cellular investigations into neurokinin pharmacology easier to trace. Neurokinins in the reward pathway Receptor localization is important in determining how the While SPergic cell bodies have been found in a number pharmacology affects a local neuronal circuit. Unfortunately of CNS foci including the septal complex, nucleus tractus 30 for neuroscientists, the reward circuitry and accompanying diagonalis (diagonal band of Broca), NAc, and Hb, with pharmacology is quite complex. Further complicating the projections to various regions including the nucleus basalis picture, G-protein-coupled receptors like the neurokinin magnocellularis, VTA, and IPN, each constituent seems to family of receptors can act in both rapid (Ca2+ or Na+ induced have a unique function in the limbic loop. A recent report links cell activation) and delayed (transcriptional) ways. Validating NK1R activation to µ-opioid receptor recycling, offering direct 31 this notion, the activation of the neurokinin family of receptors evidence for a neurokinin-mediated opioid resensitization. In will ultimately lead to an increase in intracellular Ca2+, thus fact, the neurokinin system is consistently found colocalized or in other ways affecting endogenous opioid, dopamine, and serotonergic signaling, thereby exerting its effect on affective Table 1 IC values of the three primary endogenous neurokinin 50 32,33 ligands for the three primary neurokinin receptors and drug-seeking behavior. Endogenous Receptor ligand Ventral tegmental area NK1R NK2R NK3R Substance P 0.19±0.02 100±39 67±19 Important to the reward pathway and the study thereof, the Neurokinin A 20±7 0.32±0.07 28±3 VTA most notably sends dopaminergic projections to the NAc Neurokinin B 63±13 5.5±3.7 0.37±0.03 where dopamine release triggers euphoria or positive rein- Notes: SP has the greatest functional activity at the NK R, NKA at the NK R, 34 1 2 forcement. Critically, intra-VTA injections of both an NK1R and NKB at the NK3R. All values are in nM. Reproduced with permission from Ingi T, Kitajima Y, Minamitake Y, Nakanishi S. Characterization of ligand-binding agonist and NK3R agonist facilitate dopamine release in the properties and selectivities of three rat tachykinin receptors by transfection and NAc.35 Indeed, autoradiographic studies using the radiolabeled functional expression of their cloned cDNAs in mammalian cells. J Pharmacol Exp 121 3 Ther. 1991;259(3):968–975. NK3R agonist [ H]senktide confirmed thepresence of NK3Rs Abbreviations: IC , half maximal inhibitory concentration; NK R, neurokinin receptor 1; 36 50 1 in the VTA in addition to the IPN and Hb. This comple- NK2R, neurokinin receptor 2; NK3R, neurokinin receptor 3; SP, substance p; NKA, neurokinin A; NKB, neurokinin B. mented the previously studied NK1R localization in the VTA

Substance Abuse and Rehabilitation 2015:6 submit your manuscript | www.dovepress.com 95 Dovepress Sandweiss and Vanderah Dovepress among other CNS locations.37 While in vitro electrophysi- the VTA to the NAc, resulted in positive conditioned place ologic studies in the VTA demonstrated NK3Rs may mediate preference (CPP). With regard to specific drugs of abuse, more of the excitatory effects of dopaminergic neurons while microinjection of the SP analog DiMe-C7 induced reinstate- leaving a role for SP out,38 in vivo electrophysiologic record- ment of cocaine-seeking behavior, which could be significantly 50 ings in the VTA confirmed that systemic administration of an reduced by the D1 receptor antagonist SCH23390. 39 NK1R antagonist was sufficient to block dopamine cell firing. In addition, studies demonstrated an increased firing rate of Nucleus accumbens VTA dopaminergic neurons due to the application of SP.40 The NAc is often regarded as the limbic–motor interface These apparent discrepancies in dopaminergic activity and receiving inputs from the VTA and amygdala, among neurokinin pharmacology may be in part due to the marked other regions, and sending projections to the cortex, ventral receptor heterogeneity of the VTA.41 pallidum, globus pallidus, and reciprocal projections to the The expression of various neurokinin receptor subtypes VTA and amygdala.51 One study provided evidence that the is rather diverse. For example, while there is somatodendritic NAc required input from both the VTA and the basolateral amygdala for excitation of NAc efferents.52 expression of the NK1R in the cell membrane of dopaminergic 42 SP injected into the NAc by itself increases concentrations and nondopaminergic neurons of the VTA, NK3Rs are often found in the cytoplasm of dopaminergic and nondo- of extracellular DA but does not induce positive CPP.53 An 43 SP antibody injected into the NAc prevents amphetamine- paminergic neurons of the VTA. Additionally, the NK3Rs found in the plasma membrane are frequently extrasynaptic. induced increase of extracellular DA in the NAc.54 Likewise, NAc administration of the NK R antagonist L-733,060 Furthermore, VTA glia exhibit substantially more NK3Rs 1 significantly diminishes cocaine-induced DA release.55 than NK1Rs, suggesting the importance of the immune cells in the reward pathway (see “Involvement of the immune system in addiction” for more details). Overall, the expression Nucleus basalis magnocellularis- 44 of NK3Rs in the VTA is twice that of NK1Rs. Interestingly, substantia innominata

NK3Rs, but not NK1R or NK2Rs, were found within the Evidence for SPergic fibers projecting to the nucleus basalis nuclear envelope of projection neurons of the VTA. This magnocellularis (nucleus basalis of Meynert) comes from suggests the possibility of direct NK3R involvement in gene simple light microscopic images and immunohistochemical transcription. Indeed, ligand-dependent and -independent staining.56 Accordingly, the injection of SP or the C-terminal nuclear translocation of the NK3R in the VTA has been fragment of SP into the nucleus basalis magnocellularis observed.45,46 The significance of these nuclear events in the resulted in a positive CPP, which the authors attributed to the reward pathway has not been fully elucidated. positive reinforcing effects of the specific C-terminal sequence 57 The literature on the NK2R in the VTA is sparse; however, of SP. Of course, the C-terminal fragment is shared among it has been shown that intravenous infusion of the selective all tachykinin ligands, so resolving which receptor subtype

NK2R antagonist SR-48968 did not alter basal dopaminer- responsible was an obvious next step. With the use of selective gic firing rate in rats.47 Peculiarly, the acute administration agonists, they went on to show that this effect was mediated by 58 of SR-48968 intraperitoneal (ip) increased the number of both NK1R and NK3R activation. Furthermore, SP injection spontaneously active VTA DA neurons; however, this may be into the nucleus basalis magnocellularis increased extracel- due to dosing differences or possible pharmacologically active lular dopamine content in the NAc,59 a barometer of positive metabolites. The intracellular interaction between neurokinin reinforcement. The fact that the injection of the NK3R agonist receptors has also been studied. When expressed by the same amino-senktide into the nucleus basalis magnocellularis inhib- cell, NK1R activation sequesters β-arrestins in endosomes, its alcohol intake at first glance contradicts the aforementioned 48 60 impeding ligand-dependent NK3R endocytosis. The paucity positive reinforcement. The authors speculated that alcohol of information regarding how heterologous interactions may actually be mediating its effects on the reward pathway between neurokinin receptors affects the reward pathway via NK3R, thereby rendering an NK3R agonist a substitute for indicates the necessity of future research in addiction. the rewarding properties of alcohol.61 Whether or not alcohol

Some of the earliest investigations into neurokinin’s engages the NK3R system in the nucleus basalis magnocel- ability to functionally impel the reward pathway came in 1985 lularis remains to be investigated. when Staubli and Huston49 showed that injection of SP into NKB fibers have been traced from the dorsal AND ventral the medial forebrain bundle, the neuronal tract that connects striatum to the substantia innominata.62 Pre-protachykinin-B,

96 submit your manuscript | www.dovepress.com Substance Abuse and Rehabilitation 2015:6 Dovepress Dovepress Neurokinins in addiction the mRNA for NKB, has also been found heavily concentrated These observations support the role of the neurokinin system in in fibers from the lateral stripe of the striatum, a region facilitating opioid reward via amygdaloid processes, although just lateral to the shell of the NAc, to the nucleus basalis it does not rule out the importance of other limbic regions. magnocellularis.63 The importance of these projections Importantly, the neurokinin knockout data are supported by in reward is not well understood; however, it should be the fact that intracerebral ventricular administration of an 76 remembered that NKB is the most efficacious endogenous NK1R antagonist has no effect on cocaine self-administration, ligand for the NK3R in mammals. ruling out possible developmental confounders to the knockout −/− mice. Although cocaine CPP was not altered in the NK1R Habenula mice, reinstatement of cocaine is in fact supplemented by 9 11 77 The Hb is an understudied brain region, let alone the role administration of the SP analog [Sar Met(O2) ]-SP. This, neurokinins play in its function. What is known is that the Hb at the very least, implicates the neurokinin system in cocaine white matter tracts tie it extensively to other regions of the reinstatement, albeit endogenous SP may not play a role as limbic pathway, including the ventral pallidum and ventral two separate NK1R antagonists were unable to inhibit cocaine midbrain. Moreover, SPergic and NKBergic cell bodies are reinstatement. indeed found in the medial Hb with axons projecting to the Alcohol reward may be mediated in the amygdala as VTA and the adjacent IPN.64,65 The role of the VTA in reward well. SP levels were lower in the central amygdala of Indiana is well described; the IPN also seems to contribute to positive alcohol-preferring rats than nonpreferring rats as measured by reinforcement.66 The Hb has long been known to be involved SP mRNA.78 For this reason, the investigators microinfused in nicotine dependence and, more recently, in cocaine and mor- SP into the central amygdala of alcohol-preferring rats, ren- phine dependence as well.67 No studies to our knowledge have dering the animals indifferent to alcohol consumption while examined the direct role of habenular neurokinin antagonists sucrose seeking remained the same. The apparent paradox in on addictive behavior in animals; however, NK1R and NK3Rs neurokinin signaling and alcohol reward has been noted twice: were found to be involved in nicotine-induced excitation of SP injection in the nucleus basalis magnocellularis reduces habenular neurons.68 alcohol consumption in Sardinian alcohol-preferring rats and SP injection in the central amygdala facilitates a similar effect Amygdala in Indiana alcohol-preferring rats. The concern with these Neurokinin receptors have been found in relatively high studies lies in the fact that the alcohol-preferring animals are concentrations in the amygdala of primates.69 Accordingly, selectively bred and do not represent the typical rodent or SP microinjection into the central amygdala enhanced passive primate condition.79 These studies contradict the vast majority avoidance learning behaviors70 and generated CPP.71 While of studies in rodents and humans that indicate a neurokinin efferent projections from the amygdala are abundant and antagonist reduces alcohol preference (see “Neurokinin in promiscuous, specific projections to regions of the limbic the clinic” for more details).80 loop will be discussed here. Clear evidence exists linking stress to alcoholic relapse.81 Regarding neurokinins in addiction, the smoking gun Mild and severe emotional stressors are sufficient to release of sorts came in the seminal 2000 Nature paper by Murtra SP in the medial amygdala.82 Naturally, linking stress- 72 −/− et al when they documented NK1R exhibited a lack of induced SP release to stress-induced alcohol reinstatement morphine CPP. Knockouts additionally eliminated CPP to was studied. Expectedly, the NK1R antagonist, L822429, amphetamines but surprisingly retained a positive CPP to was adequate to prevent alcohol reinstatement in an alcohol cocaine and food, indicating distinct mechanisms mediating self-administration paradigm in wild-type Wistar rats.83 73 reward for each of these natural and unnatural rewards. A related study demonstrated efficacy of the NK1R antagonist

The role of NK1R in opioid reward was further corroborated in suppressing alcohol seeking in wild-type mice at baseline −/− 74 84 using the self-administration paradigm in NK1R mice. To and in preventing escalation of voluntary alcohol intake. better understand which neuroanatomical location may play Corroborating this data, NK1R silencing with a microRNA the principle role in neurokinin-mediated opioid reward, SP- directed at the receptors’ transcript reduced alcohol consump- 85 saporin (a ribosome inactivating toxin) was used to ablate tion in mice. The study noted attenuated NK1R expression

NK1R expressing neurons in the amygdala. Indeed, mice in the hippocampus, the only subcortical area they examined + with ablation of NK1R neurons in the amygdala demon- for proof of action. To the contrary, ezlopitant, the NK1R strated similar CPP scores for both morphine and saline.75 antagonist developed for chemotherapy induced nausea and

Substance Abuse and Rehabilitation 2015:6 submit your manuscript | www.dovepress.com 97 Dovepress Sandweiss and Vanderah Dovepress vomiting, exhibited little to no efficacy in reducing operant neuronal signaling.97 Importantly, microglia and astrocytes self-administration of alcohol in Long–Evans rats.86 The have recently been implicated in addictive processes as aforementioned inconsistency raises a valid point about activated microglia release “proinflammatory” cytokines nonconserved regions of the neurokinin receptors between that act at the neuronal synapse, strengthening the signal.98 humans and rodents, giving rise to potential obstacles in Expanding on this notion, alcohol, cocaine, morphine, and extrapolating preclinical models to the human condition.87 amphetamines have all been indicted for their role in micro- While stress has been shown to increase extracellular SP glial activation with microglial activation proven to be criti- in the amygdala, it should be mentioned that SP and NKA cal to the maintenance of addictive behaviors.99 Critically, have been found colocalized in neurons of the infundibulum NK1Rs are located on microglia and are inducible by IL-1β of the CNS and myenteric plexus of enteric nervous system, in astrocytes.100,101 SP has been shown to activate NF-κB a possibility that has not been specifically investigated in neu- in microglia, which has a strong, yet neglected, role in the 88,89 102 rons of the amygdala. In fact, NK2Rs do appear in a signifi- progression of addiction. In astrocytes, SP application 90 − cant concentration in the amygdala, and the NK2R antagonist induces a complex depolarization by modulating Cl and SR48968 was sufficient to block stress-induced behaviors in K+ currents.103 Astrocytes are probably most notorious for mice and central neuronal markers of stress in rats.91 their role in glutamate homeostasis, and so there is a high An analogous pathway observed in the alcohol reward likelihood of the neurokinin system modulating extracellular system in relation to neurokinin pharmacology is that glutamate in brain regions, including those of the limbic observed with corticotrophin-releasing factor (CRF).92 system. There is substantial information on both neurokinins There is extensive research into the effects of CRF and other and glia in the reward pathway, yet a dearth of information on neuropeptides on addiction that are out of the scope of this the interaction between the two. It may end up representing review. In general, it is accepted in the addiction field that one of the more promising avenues in addiction research. the stress response is mediated by several neurotransmitter systems including CRF and SP, thus precipitating undesirable Neurokinin in the clinic outcomes such as relapse. We have outlined the neural and pharmacological basis for the use of neurokinin antagonists in addiction. To summarize, Frontal cortex SP appears to be overexpressed after chronic administration The literature on neurokinins in the cortex is more scant of drugs of abuse and mediates some of the negative effects than other brain regions; nevertheless, cortical neurokinins such as CPP and reinstatement. Here, the focus will be on the seem to play an important role in the limbic system. As one use of neurokinin antagonists specifically in humans and the of the terminal sites of mesencephalic dopaminergic projec- potential success as a therapeutic. While SP has long been tions, the frontal cortex has been shown to have increased infamous as one of the primary pronociceptive neurotransmit- dopamine metabolites (DOPAC) in response to stress (ie, foot- ters, an NK1R antagonist did not achieve appreciable analgesia shock).93 This increase in cortical dopamine is correlated to as a standalone medication in patients suffering from pain.29 periods of intoxication and craving, particularly with cocaine However, one of the first investigations into neurokinins in 94 abuse. Pretreatment with the selective NK1R antagonist human disease with positive results demonstrated elevated (S)-GR205171 ip was sufficient to preventfootshock- induced cerebrospinal fluid levels of SP in psychiatric patients with dopamine release in the cortex.95 In addition to stress, depression or schizophrenia.104 With the development of morphine injections ip increased SP levels in the cortex that radiolabeled substance p antagonists (SPAs), imaging of subsequently significantly decreased due to the administration receptor localization and saturation in humans became of the opioid antagonist, naloxone.96 The relative importance possible with positron emission tomography.105 [18F]-SPA-RQ of the frontal cortex in neurokinin-mediated addiction is not was taken up in the brain of healthy male volunteers in the well understood and warrants further exploration. regions already described that are involved in reward including the VTA, amygdala, Hb, and ventral striatum.106 The most

Involvement of the immune notable differences from rats were the high density of NK1Rs system in addiction in the cortex of humans and a greater NK1R/NK3R ratio in The role of the resident immune cells in the brain, the the VTA of humans.107,108 glia (astrocytes, microglia, and oligodendrocytes), has Functionally, the NK1R antagonist aprepitant has an effect been emerging in the last 20 years as critical for normal on positive incentive in humans. In an experiment enlisting

98 submit your manuscript | www.dovepress.com Substance Abuse and Rehabilitation 2015:6 Dovepress Dovepress Neurokinins in addiction healthy volunteers of both sexes, monetary incentive delay was patients with comorbid posttraumatic stress disorder (PTSD) the paradigm used to determine if the NK1R antagonist could and alcoholism experienced no reduction in symptoms of 116 prevent NAc activation typical of incentive anticipation. Indeed, alcohol craving after administration of an NK1R antagonist. when subjects expected a monetary reward for completing a This may point to the fact that comorbidity with PTSD task in the study, aprepitant reduced NAc blood oxygenation- complicates the syndrome by adding another “stress”-related level-dependent (BOLD) contrast compared to control as seen illness. on fMRI, indicating the attenuation of NAc activation.109

An association between various NK1R gene (TACR1) Neurokinin prospects for therapy single nucleotide polymorphisms (SNPs) and alcoholism may The neurokinin field indeed does seem poised to produce exist. In a large sample of heavy drinkers (7 drinks per day significant contributions to addiction research and therapy. on average), 5 SNPs of the TACR1 gene were predictive of We have outlined the role neurokinins play in the reward

BOLD activation as assessed by fMRI in response to alcohol pathway, particularly via NK1Rs and NK3Rs. Accordingly, 110 cues. In a separate study, 1 SNP and 2 haplotypes (a specific GlaxoSmithKline has a dual NK1R/NK3R antagonist, combination of alleles on the same chromosome) of the GSK1144814, in the pipeline for future clinical trials for TACR1 gene were associated with alcohol dependence.111 psychiatric disorders.117 Vanda Pharmaceuticals acquired The significance of these studies is not well understood; worldwide licensing for LY686017 (now called VLY-686) however, they point to a link between a specific neurokinin from Eli Lilly after the proof of concept studies in alcohol genotype and alcohol-dependent phenotype that may have cravings mentioned earlier. Vanda is now attempting to potential as a drug target. Of course, the NK1R is not the commercialize and develop this compound “for all human only SNP found to dysregulate the reward pathway as conditions”, including an indication for substance abuse. Our OPRM1 (µ-opioid receptor) has also been highlighted as pharmacology/chemistry group has created several opioid 112 a troublesome gene of interest. Much like carriers of agonist/NK1R antagonist compounds that have efficacy certain OPRM1, SNPs are more sensitive to the effects of in antinociception and do not produce CPP or increase 118–120 naltrexone on reducing alcohol cravings, so too should NK1R extracellular dopamine content in the NAc. antagonists on specific TACR1 SNP-related addictions.113 In addition to the new compounds in the pipeline, the orig-

Unexpectedly, in a clinical study examining the role of inal gold standard NK1R antagonist is still under investigation aprepitant on oxycodone abuse liability, the authors found for its effects on substance abuse potential since it already the NK1R antagonist actually increased the abuse potential of has FDA approval for the clinic. A brief ClinicalTrials.gov oxycodone in patients who were already opioid drug abusers.114 search reveals that aprepitant is currently undergoing clinical Several explanations for the unanticipated outcomes were trials for the evaluation of its effects on cannabis cravings in proposed, including the pharmacokinetic interaction between cannabis-dependent outpatients, comorbid alcoholic and can- the two drugs. That is, aprepitant and oxycodone compete for nabis-dependent patients, and in opioid-dependent patients. metabolism by the enzyme CYP3A4, rendering higher concen- More compounds that selectively block the neurokinin trations of serum oxycodone than expected. The unfortunate system will undoubtedly materialize in the drug pipeline as pharmacokinetic profiles of many drugs have hindered their preclinical and clinical studies further identify the role of the success in the past, despite promising pharmacodynamic neurokinin system in drug addiction. actions on the biology of the system. Future studies on opioid dependence may require a novel neurokinin antagonist that is Disclosure not involved in CYP3A4 metabolism, a requirement that will The authors report no conflicts of interest in this report. surely prove challenging though not impossible. In alcohol-dependent humans who were recently detoxi- References 1. Trends and Statistics. Available from http://www.drugabuse.gov/related- fied, LY686017, a brain penetrant NK R antagonist with 1 topics/trends-statistics#costs. Accessed July 28, 2015. high bioavailability was efficacious in suppressing spon- 2. Volkow N. What is the Federal Government Doing to Combat the Opioid taneous alcohol cravings as assessed by the Alcohol Urge Abuse Epidemic? Bethesda, MD: NIDA: NIH; 2015. 3. V Euler US, Gaddum JH. An unidentified depressor substance in certain 115 Questionaire. When the alcohol-dependent subjects were tissue extracts. J Physiol. 1931;72(1):74–87. then provoked with a combined stress test and alcohol-cue 4. Gaddum JH, Schild H. Depressor substances in extracts of intestine. J Physiol. 1934;83(1):1–14. challenge, the treatment group still had reduced cravings for 5. Pernow B. Distribution of substance P in the central and peripheral nervous alcohol compared to controls. To the contrary, psychiatric system. Nature. 1953;171(4356):746.

Substance Abuse and Rehabilitation 2015:6 submit your manuscript | www.dovepress.com 99 Dovepress Sandweiss and Vanderah Dovepress

6. Yaksh TL, Jessell TM, Gamse R, Mudge AW, Leeman SE. Intrathecal 28. Kramer MS, Cutler N, Feighner J, et al. Distinct mechanism for antide- morphine inhibits substance P release from mammalian spinal cord pressant activity by blockade of central substance P receptors. Science. in vivo. Nature. 1980;286(5769):155–157. 1998;281(5383):1640–1645. 7. Chang MM, Leeman SE. Isolation of a sialogogic peptide from bovine 29. Hill R. NK1 (substance P) receptor antagonists – why are they not hypothalamic tissue and its characterization as substance P. J Biol Chem. analgesic in humans? Trends Pharmacol Sci. 2000;21(7):244–246. 1970;245(18):4784–4790. 30. Ljungdahl A, Hokfelt T, Nilsson G. Distribution of substance P-like 8. Mroz ED, Brownstein MJ, Leeman SE. Evidence for substance P in immunoreactivity in the central nervous system of the rat – I. Cell bodies the habenulo-interpeduncular tract. Brain Res. 1976;113(3):597–599. and nerve terminals. Neuroscience. 1978;3(10):861–943. 9. Kanazawa I, Emson PC, Cuello AC. Evidence for the existence of sub- 31. Bowman SL, Soohoo AL, Shiwarski DJ, Schulz S, Pradhan AA, stance P-containing fibres in striato-nigral and pallido-nigral pathways Puthenveedu MA. Cell-Autonomous Regulation of Mu-Opioid Receptor in rat brain. Brain Res. 1977;119(2):447–453. Recycling by Substance P. Cell Rep. 2015;10(11):1925–1936. 10. Napier TC, Mitrovic I, Churchill L, Klitenick MA, Lu XY, Kalivas PW. 32. Santarelli L, Gobbi G, Blier P, Hen R. Behavioral and physiologic Substance P in the ventral pallidum: projection from the ventral striatum, effects of genetic or pharmacologic inactivation of the substance P and electrophysiological and behavioral consequences of pallidal sub- receptor (NK1). J Clin Psychiatry. 2002;63(Suppl 11):11–17. stance P. Neuroscience. 1995;69(1):59–70. 33. Mantyh PW. Neurobiology of substance P and the NK1 receptor. J Clin 11. Cuello AC, Jessell TM, Kanazawa I, Iversen LL. Substance P: localization Psychiatry. 2002;63(Suppl 11):6–10. in synaptic vesicles in rat central nervous system. J Neurochem. 34. Wise RA, Koob GF. The development and maintenance of drug 1977;29(4):747–751. addiction. Neuropsychopharmacology. 2014;39(2):254–262. 12. Kelly PH, Iversen SD. Selective 6OHDA-induced destruction of 35. Elliott PJ, Mason GS, Stephens-Smith M, Hagan RM. Behavioural mesolimbic dopamine neurons: abolition of psychostimulant-induced and biochemical responses following activation of midbrain dopamine locomotor activity in rats. Eur J Pharmacol. 1976;40(1):45–56. pathways by receptor selective neurokinin agonists. Neuropeptides. 13. Spyraki C, Fibiger HC, Phillips AG. Attenuation of heroin reward in rats 1991;19(2):119–126. by disruption of the mesolimbic dopamine system. Psychophamacology. 36. Dam TV, Escher E, Quirion R. Visualization of neurokinin-3 receptor 1983;79(2–3):278–283. sites in rat brain using the highly selective ligand [3H]senktide. Brain 14. Baik JH. Dopamine signaling in reward-related behaviors. Front Neural Res. 1990;506(1):175–179. Circuits. 2013;7:152. 37. Mantyh PW, Gates T, Mantyh CR, Maggio JE. Autoradiographic 15. Stinus L, Kelley AE, Iversen SD. Increased spontaneous activity fol- localization and characterization of tachykinin receptor binding lowing substance P infusion into A10 dopaminergic area. Nature. 1978; sites in the rat brain and peripheral tissues. J Neurosci. 1989;9(1): 276(5688):616–618. 258–279. 16. Erspamer V, Anastasi A. Polypeptides active on plain muscle in the 38. Seabrook GR, Bowery BJ, Hill RG. Pharmacology of tachykinin recep- amphibian skin. Paper presented at: Proceedings of the International tors on neurones in the ventral tegmental area of rat brain slices. Eur J Symposium: Hypotensive Peptides; October 25–29, 1965, 1966; Pharmacol. 1995;273(1–2):113–119. Florence, Italy. 39. Minabe Y, Emori K, Toor A, Stutzmann GE, Ashby CR Jr. The effect 17. Kimura S, Okada M, Sugita Y, Kanazawa I, Munekata E. Novel neuro- of the acute and chronic administration of CP 96,345, a selective neu- peptides, neurokinin-alpha and neurokinin-beta isolated from porcine rokinin1 receptor antagonist, on midbrain dopamine neurons in the spinal-cord. P Jpn Acad B Phys. 1983;59(4):101–104. rat: a single unit, extracellular recording study. Synapse. 1996;22(1): 18. Buck SH, Burcher E, Shults CW, Lovenberg W, O’Donohue TL. Novel 35–45. pharmacology of substance K-binding sites: a third type of tachykinin 40. Korotkova TM, Brown RE, Sergeeva OA, Ponomarenko AA, Haas HL. receptor. Science. 1984;226(4677):987–989. Effects of arousal- and feeding-related neuropeptides on dopaminergic 19. Henry JL. Substance P and neurokinins. Paper presented at: Proceedings and GABAergic neurons in the ventral tegmental area of the rat. Eur J of “Substance P and Neurokinins-Montreal ’86.” A Satellite Sympo- Neurosci. 2006;23(10):2677–2685. sium of the XXX International Congress of The International Union 41. Sanchez-Catalan MJ, Kaufling J, Georges F, Veinante P, Barrot M. of Physiological Sciences; 1986; Montreal, Canada. The antero-posterior heterogeneity of the ventral tegmental area. 20. Regoli D, Drapeau G, Dion S, D’Orleans-Juste P. Pharmacological recep- Neuroscience. 2014;282C:198–216. tors for substance P and neurokinins. Life Sci. 1987;40(2):109–117. 42. Lessard A, Pickel VM. Subcellular distribution and plasticity of 21. Mantyh PW, Pinnock RD, Downes CP, Goedert M, Hunt SP. Correlation neurokinin-1 receptors in the rat substantia nigra and ventral tegmental between inositol phospholipid hydrolysis and substance P receptors in area. Neuroscience. 2005;135(4):1309–1323. rat CNS. Nature. 1984;309(5971):795–797. 43. Lessard A, Grady EF, Bunnett NW, Pickel VM. Predominant surface 22. Mantyh PW, Allen CJ, Ghilardi JR, et al. Rapid endocytosis of a G distribution of neurokinin-3 receptors in non-dopaminergic dendrites protein-coupled receptor: substance P evoked internalization of its in the rat substantia nigra and ventral tegmental area. Neuroscience. receptor in the rat striatum in vivo. Proc Natl Acad Sci U S A. 1995; 2007;144(4):1393–1408. 92(7):2622–2626. 44. Lessard A, Savard M, Gobeil F Jr, Pierce JP, Pickel VM. The 23. Steinhoff MS, von Mentzer B, Geppetti P, Pothoulakis C, Bunnett NW. neurokinin-3 (NK3) and the neurokinin-1 (NK1) receptors are differen- Tachykinins and their receptors: contributions to physiological control tially targeted to mesocortical and mesolimbic projection neurons and to and the mechanisms of disease. Physiol Rev. 2014;94(1):265–301. neuronal nuclei in the rat ventral tegmental area. Synapse. 2009;63(6): 24. Lu B, Su Y, Das S, et al. Peptide neurotransmitters activate a cation 484–501. channel complex of NALCN and UNC-80. Nature. 2009;457(7230): 45. Hether S, Misono K, Lessard A. The neurokinin-3 receptor (NK3R) 741–744. antagonist SB222200 prevents the apomorphine-evoked surface but 25. Koike-Tani M, Collins JM, Kawano T, et al. Signal transduction path- not nuclear NK3R redistribution in dopaminergic neurons of the rat way for the substance P-induced inhibition of rat Kir3 (GIRK) channel. ventral tegmental area. Neuroscience. 2013;247:12–24. J Physiol. 2005;564(Pt 2):489–500. 46. Sladek CD, Stevens W, Levinson SR, Song Z, Jensen DD, Flynn FW. 26. Iversen L. Leslie Iversen. In: Squire LR, editor. The History of Neu- Characterization of nuclear neurokinin 3 receptor expression in rat roscience in Autobiography. Vol 6. Oxford: Oxford University Press; brain. Neuroscience. 2011;196:35–48. 2009:190–225. 47. Minabe Y, Ashby CR Jr. Effect of the acute and chronic administration 27. Snider RM, Constantine JW, Lowe JA III, et al. A potent nonpeptide of the selective neurokinin2 receptor antagonist SR 48968 on midbrain antagonist of the substance P (NK1) receptor. Science. 1991;251(4992): dopamine neurons in the rat: an in vivo extracellular single cell study. 435–437. Synapse. 1997;25(2):196–204.

100 submit your manuscript | www.dovepress.com Substance Abuse and Rehabilitation 2015:6 Dovepress Dovepress Neurokinins in addiction

48. Schmidlin F, Dery O, Bunnett NW, Grady EF. Heterologous 69. Nagano M, Saitow F, Haneda E, Konishi S, Hayashi M, Suzuki H. regulation of trafficking and signaling of G protein-coupled receptors: Distribution and pharmacological characterization of primate NK-1 beta-arrestin-dependent interactions between neurokinin receptors. Proc and NK-3 tachykinin receptors in the central nervous system of the Natl Acad Sci U S A. 2002;99(5):3324–3329. rhesus monkey. Br J Pharmacol. 2006;147(3):316–323. 49. Staubli U, Huston JP. Central action of substance P: possible role in 70. Kertes E, Laszlo K, Berta B, Lenard L. Effects of substance P microinjec- reward. Behav Neural Biol. 1985;43(1):100–108. tions into the globus pallidus and central nucleus of amygdala on passive 50. Placenza FM, Fletcher PJ, Rotzinger S, Vaccarino FJ. Infusion of avoidance learning in rats. Behav Brain Res. 2009;198(2):397–403. the substance P analogue, DiMe-C7, into the ventral tegmental 71. Kertes E, Laszlo K, Berta B, Lenard L. Positive reinforcing effects of area induces reinstatement of cocaine-seeking behaviour in rats. substance P in the rat central nucleus of amygdala. Behav Brain Res. Psychopharmacology. 2004;177(1–2):111–120. 2009;205(1):307–310. 51. Mogenson GJ, Wu M, Jones DL. Locomotor activity elicited by injections 72. Murtra P, Sheasby AM, Hunt SP, De Felipe C. Rewarding effects of of picrotoxin into the ventral tegmental area is attenuated by injections opiates are absent in mice lacking the receptor for substance P. Nature. of GABA into the globus pallidus. Brain Res. 1980;191(2):569–571. 2000;405(6783):180–183. 52. Ambroggi F, Ishikawa A, Fields HL, Nicola SM. Basolateral amygdala 73. Murtra P, Sheasby A, Hunt SP, De Felipe C. Loss of Rewarding Effects neurons facilitate reward-seeking behavior by exciting nucleus accum- of Morphine and Amphetamine, But Not Cocaine, in Mice with Dis- bens neurons. Neuron. 2008;59(4):648–661. ruption of the Substance P Receptor (NK1) Gene. New Orleans, LA: 53. Schildein S, Agmo A, Huston JP, Schwarting RK. Intraaccumbens Society for Neuroscience; 2000. injections of substance P, morphine and amphetamine: effects on 74. Ripley T. Lack of self-administration and behavioural sensitisa- conditioned place preference and behavioral activity. Brain Res. 1998; tion to morphine, but not cocaine, in mice lacking NK1 receptors. 790(1–2):185–194. Neuropharmacology. 2002;43(8):1258–1268. 54. Elliott PJ, Nemeroff CB, Kilts CD. Evidence for a tonic facilitatory 75. Gadd CA, Murtra P, De Felipe C, Hunt SP. Neurokinin-1 receptor- influence of substance P on dopamine release in the nucleus accumbens. expressing neurons in the amygdala modulate morphine reward and Brain Res. 1986;385(2):379–382. anxiety behaviors in the mouse. J Neurosc. 2003;23(23):8271–8280. 55. Loonam TM, Noailles PA, Yu J, Zhu JP, Angulo JA. Substance P 76. Placenza FM, Fletcher PJ, Vaccarino FJ, Erb S. Effects of central and cholecystokinin regulate neurochemical responses to cocaine and neurokinin-1 receptor antagonism on cocaine- and opiate-induced methamphetamine in the striatum. Life Sci. 2003;73(6):727–739. locomotor activity and self-administration behaviour in rats. Pharmacol 56. Beach TG, Tago H, McGeer EG. Light microscopic evidence for a Biochem Behav. 2006;84(1):94–101. substance P-containing innervation of the human nucleus basalis of 77. Placenza FM, Vaccarino FJ, Fletcher PJ, Erb S. Activation of central Meynert. Brain Res. 1987;408(1–2):251–257. neurokinin-1 receptors induces reinstatement of cocaine-seeking 57. Hasenohrl RU, Gerhardt P, Huston JP. Positively reinforcing effects behavior. Neurosci Lett. 2005;390(1):42–47. of the neurokinin substance P in the basal forebrain: mediation by its 78. Yang AR, Yi HS, Mamczarz J, June HL Jr, Hwang BH, June HL Sr. C-terminal sequence. Exp Neurol. 1992;115(2):282–291. Deficits in substance P mRNA levels in the CeA are inversely associated 58. Nikolaus S, Huston JP, Hasenohrl RU. Reinforcing effects of neurokinin with alcohol-motivated responding. Synapse. 2009;63(11):972–981. substance P in the ventral pallidum: mediation by the tachykinin NK1 79. Lumeng L, Hawkins TD, Li TK. New strains of rats with alcohol receptor. Eur J Pharmacol. 1999;370(2):93–99. preference and nonpreference. In: Ronald G. Thurman JRW, Henry 59. Boix F, Sandor P, Nogueira PJ, Huston JP, Schwarting RK. Relationship Drott, Britton Chance, editors. Alcohol and Aldehyde Metabolizing between dopamine release in nucleus accumbens and place preference Systems: Intermediary Metabolism and Neurochemistry. Vol 3. New induced by substance P injected into the nucleus basalis magnocellularis York: Academic Press, Inc.; 1977:537–544. region. Neuroscience. 1995;64(4):1045–1055. 80. Higley AE, Koob GF, Mason BJ. Treatment of alcohol dependence 60. Ciccocioppo R, Panocka I, Polidori C, De Caro G, Regoli D, Massi M. with drug antagonists of the stress response. Alcohol Res. 2012;34(4): Stimulation of tachykinin NK-3 receptors in the nucleus basalis magnocel- 516–521. lularis reduces alcohol intake in rats. Peptides. 1997;18(9):1349–1355. 81. Sinha R. How does stress lead to risk of alcohol relapse? Alcohol Res. 61. Ciccocioppo R, Panocka I, Polidori C, Froldi R, Angeletti S, Massi M. 2012;34(4):432–440. Mechanism of action for reduction of ethanol intake in rats by the 82. Ebner K, Rupniak NM, Saria A, Singewald N. Substance P in the medial tachykinin NK-3 receptor agonist aminosenktide. Pharmacol Biochem amygdala: emotional stress-sensitive release and modulation of anxiety- Behav. 1998;61(4):459–464. related behavior in rats. Proc Natl Acad Sci U S A. 2004;101(12): 62. Furuta T, Mori T, Lee T, Kaneko T. Third group of neostriatofugal 4280–4285. neurons: neurokinin B-producing neurons that send axons predominantly 83. Schank JR, Pickens CL, Rowe KE, et al. Stress-induced reinstatement to the substantia innominata. J Comp Neurol. 2000;426(2):279–296. of alcohol-seeking in rats is selectively suppressed by the neurokinin 1 63. Zhou L, Furuta T, Kaneko T. Neurokinin B-producing projection (NK1) antagonist L822429. Psychopharmacology. 2011;218(1): neurons in the lateral stripe of the striatum and cell clusters of the 111–119. accumbens nucleus in the rat. J Comp Neurol. 2004;480(2):143–161. 84. Thorsell A, Schank JR, Singley E, Hunt SP, Heilig M. Neurokinin-1 64. Velasquez KM, Molfese DL, Salas R. The role of the habenula in drug receptors (NK1R:s), alcohol consumption, and alcohol reward in mice. addiction. Front Hum Neurosci. 2014;8:174. Psychopharmacology. 2010;209(1):103–111. 65. Burgunder JM, Young WS III. Neurokinin B and substance P genes are 85. Baek MN, Jung KH, Halder D, et al. Artificial microRNA-based co-expressed in a subset of neurons in the rat habenula. Neuropeptides. neurokinin-1 receptor gene silencing reduces alcohol consumption in 1989;13(3):165–169. mice. Neurosci Lett. 2010;475(3):124–128. 66. Antolin-Fontes B, Ables JL, Gorlich A, Ibanez-Tallon I. The habenulo- 86. Steensland P, Simms JA, Nielsen CK, Holgate J, Bito-Onon JJ, Bartlett SE. interpeduncular pathway in nicotine aversion and withdrawal. The neurokinin 1 receptor antagonist, ezlopitant, reduces appetitive Neuropharmacology. 2015;96(Pt B):213–222. responding for sucrose and ethanol. PLoS One. 2010;5(9):e12527. 67. Glick SD, Ramirez RL, Livi JM, Maisonneuve IM. 18-Methoxycoonaridine 87. Jensen CJ, Gerard NP, Schwartz TW, Gether U. The species selectivity acts in the medial habenula and/or interpeduncular nucleus to decrease of chemically distinct tachykinin nonpeptide antagonists is dependent morphine self-administration in rats. Eur J Pharmacol. 2006;537(1–3): on common divergent residues of the rat and human neurokinin-1 94–98. receptors. Mol Pharmacol. 1994;45(2):294–299. 68. Dao DQ, Perez EE, Teng Y, Dani JA, De Biasi M. Nicotine enhances 88. Hrabovszky E, Borsay BA, Racz K, et al. Substance P immunoreactivity excitability of medial habenular neurons via facilitation of neurokinin exhibits frequent colocalization with kisspeptin and neurokinin B in signaling. J Neurosci. 2014;34(12):4273–4284. the human infundibular region. PloS One. 2013;8(8):e72369.

Substance Abuse and Rehabilitation 2015:6 submit your manuscript | www.dovepress.com 101 Dovepress Sandweiss and Vanderah Dovepress

89. Deacon CF, Agoston DV, Nau R, Conlon JM. Conversion of 107. Whitty CJ, Paul MA, Bannon MJ. Neurokinin receptor mRNA neuropeptide K to neurokinin A and vesicular colocalization of neu- localization in human midbrain dopamine neurons. J Comp Neurol. rokinin A and substance P in neurons of the guinea pig small intestine. 1997;382(3):394–400. J Neurochem. 1987;48(1):141–146. 108. Okumura M, Arakawa R, Ito H, et al. Quantitative analysis of NK1 90. Nagano M, Oishi T, Suzuki H. Distribution and pharmacological char- receptor in the human brain using PET with 18F-FE-SPA-RQ. J Nucl acterization of primate NK-2 tachykinin receptor in the central nervous Med. 2008;49(11):1749–1755. system of the rhesus monkey. Neurosci Lett. 2011;503(1):23–26. 109. Saji K, Ikeda Y, Kim W, et al. Acute NK(1) receptor antagonist 91. Steinberg R, Alonso R, Griebel G, et al. Selective blockade of administration affects reward incentive anticipation processing neurokinin-2 receptors produces antidepressant-like effects associated in healthy volunteers. Int J Neuropsychopharmacol. 2013;16(7): with reduced corticotropin-releasing factor function. J Pharmacology 1461–1471. Exp Ther. 2001;299(2):449–458. 110. Blaine S, Claus E, Harlaar N, Hutchison K. TACR1 genotypes predict 92. Leggio L, Cardone S, Ferrulli A, et al. Turning the clock ahead: fMRI response to alcohol cues and level of alcohol dependence. potential preclinical and clinical neuropharmacological targets for Alcohol Clin Exp Res. 2013;37(Suppl 1):E125–E130. alcohol dependence. Curr Pharm Des. 2010;16(19):2159–2118. 111. Seneviratne C, Ait-Daoud N, Ma JZ, Chen G, Johnson BA, Li MD. 93. Herman JP, Guillonneau D, Dantzer R, Scatton B, Semerdjian- Susceptibility locus in neurokinin-1 receptor gene associated with alcohol Rouquier L, Le Moal M. Differential effects of inescapable footshocks dependence. Neuropsychopharmacology. 2009;34(11):2442–2449. and of stimuli previously paired with inescapable footshocks on 112. Heilig M, Goldman D, Berrettini W, O’Brien CP. Pharmacogenetic dopamine turnover in cortical and limbic areas of the rat. Life Sci. approaches to the treatment of alcohol addiction. Nat Rev Neurosci. 1982;30(25):2207–2214. 2011;12(11):670–684. 94. Goldstein RZ, Volkow ND. Drug addiction and its underlying neuro- 113. Anton RF, Oroszi G, O’Malley S, et al. An evaluation of mu-opioid biological basis: neuroimaging evidence for the involvement of the receptor (OPRM1) as a predictor of naltrexone response in the treatment frontal cortex. Am J Psychiatry. 2002;159(10):1642–1652. of alcohol dependence: results from the Combined Pharmacotherapies 95. Hutson PH, Patel S, Jay MT, Barton CL. Stress-induced increase and Behavioral Interventions for Alcohol Dependence (COMBINE) of cortical dopamine metabolism: attenuation by a tachykinin NK1 study. Arch Gen Psychiatry. 2008;65(2):135–144. receptor antagonist. Eur J Pharmacol. 2004;484(1):57–64. 114. Walsh SL, Heilig M, Nuzzo PA, Henderson P, Lofwall MR. Effects 96. Morley JE, Yamada T, Walsh JH, et al. Morphine addiction and of the NK1 antagonist, aprepitant, on response to oral and intranasal withdrawal alters brain peptide concentrations. Life Sci. 1980;26(26): oxycodone in prescription opioid abusers. Addict Biol. 2013;18(2): 2239–2244. 332–343. 97. Pfrieger FW, Barres BA. Synaptic efficacy enhanced by glial cells 115. George DT, Gilman J, Hersh J, et al. Neurokinin 1 receptor antago- in vitro. Science. 1997;277(5332):1684–1687. nism as a possible therapy for alcoholism. Science. 2008;319(5869): 98. Kovacs KJ. Microglia and drug-induced plasticity in reward-related 1536–1539. neuronal circuits. Front Mol Neurosci. 2012;5:74. 116. Kwako LE, George DT, Schwandt ML, et al. The neurokinin-1 99. Crews FT, Zou J, Qin L. Induction of innate immune genes in receptor antagonist aprepitant in co-morbid alcohol dependence brain create the neurobiology of addiction. Brain Behav Immun. and posttraumatic stress disorder: a human experimental study. 2011;25(Suppl 1):S4–S12. Psychopharmacology. 2015;232(1):295–304. 100. Guo CJ, Douglas SD, Gao Z, et al. Interleukin-1beta upregulates 117. Ridler K, Gunn RN, Searle GE, et al. Characterising the plasma-target functional expression of neurokinin-1 receptor (NK-1R) via NF- occupancy relationship of the neurokinin antagonist GSK1144814 kappaB in astrocytes. Glia. 2004;48(3):259–266. with PET. J Psychopharmacol. 2014;28(3):244–253. 101. Rasley A, Bost KL, Olson JK, Miller SD, Marriott I. Expression of 118. Largent-Milnes TM, Yamamoto T, Nair P, et al. Spinal or systemic functional NK-1 receptors in murine microglia. Glia. 2002;37(3): TY005, a peptidic opioid agonist/neurokinin 1 antagonist, attenuates pain 258–267. with reduced tolerance. Br J Pharmacol. 2010;161(5):986–1001. 102. Yang J, Yu J, Jia X, et al. Inhibition of nuclear factor-kappaB impairs 119. Yamamoto T, Nair P, Jacobsen NE, et al. The importance of micelle- reconsolidation of morphine reward memory in rats. Behav Brain Res. bound states for the bioactivities of bifunctional peptide derivatives 2011;216(2):592–596. for delta/mu opioid receptor agonists and neurokinin 1 receptor 103. Backus KH, Berger T, Kettenmann H. Activation of neurokinin recep- antagonists. J Med Chem. 2008;51(20):6334–6347. tors modulates K+ and Cl- channel activity in cultured astrocytes from 120. Sandweiss A, Stark J, Largent-Milnes, TM, et al. An opioid agonist/ rat cortex. Brain Res. 1991;541(1):103–109. NK1 antagonist inhibits nociception in an animal model of neuropathic 104. Rimon R, Le Greves P, Nyberg F, Heikkila L, Salmela L, Terenius L. pain while lacking accumbens dopamine release. International Elevation of substance P-like peptides in the CSF of psychiatric Narcotics Research Conference; 2015; Phoenix, AZ. patients. Biol Psychiatry. 1984;19(4):509–516. 121. Ingi T, Kitajima Y, Minamitake Y, Nakanishi S. Characterization 105. Hargreaves R. Imaging substance P receptors (NK1) in the living of ligand-binding properties and selectivities of three rat tachykinin human brain using positron emission tomography. J Clin Psychiatry. receptors by transfection and functional expression of their cloned 2002;63:18–24. cDNAs in mammalian cells. J Pharmacol Exp Ther. 1991;259(3): 106. Hietala J, Nyman MJ, Eskola O, et al. Visualization and quantification 968–975. of neurokinin-1 (NK1) receptors in the human brain. Mol Imaging Biol. 2005;7(4):262–272.

Substance Abuse and Rehabilitation Dovepress Publish your work in this journal Substance Abuse and Rehabilitation is an international, peer-reviewed, peer-review system. Visit http://www.dovepress.com/testimonials.php open access journal publishing original research, case reports, editorials, to read real quotes from published authors. reviews and commentaries on all areas of addiction and substance abuse and options for treatment and rehabilitation. The manuscript management system is completely online and includes a very quick and fair

Submit your manuscript here: http://www.dovepress.com/substance abuse-and-rehabilitation-journal

102 submit your manuscript | www.dovepress.com Substance Abuse and Rehabilitation 2015:6 Dovepress Month 2016 Synthesis and Investigation of Mixed μ-Opioid and δ-Opioid Agonists as Possible Bivalent Ligands for Treatment of Pain Ruben S. Vardanyan,a* James P. Cain,a Saghar Mowlazadeh Haghighi,a Vlad K. Kumirov,a Mary I. McIntosh,b Alexander J. Sandweiss,b Frank Porreca,b and Victor J. Hrubya

aDepartment of Chemistry and Biochemistry, University of Arizona, Tucson, Arizona 85721, USA bDepartment of Pharmacology, University of Arizona Health Sciences Center, Tucson, Arizona 85724, USA *E-mail: [email protected] Additional Supporting Information may be found in the online version of this article. Received February 11, 2016 DOI 10.1002/jhet.2696 Published online 00 Month 2016 in Wiley Online Library (wileyonlinelibrary.com).

Several studies have suggested functional association between μ-opioid and δ-opioid receptors and showed that μ-activity could be modulated by δ-ligands. The general conclusion is that agonists for the δ- receptor can enhance the analgesic potency and efficacy of μ-agonists. Our preliminary investigations demonstrate that new bivalent ligands constructed from the μ-agonist fentanyl and the δ-agonist enkephalin-like peptides are promising entities for creation of new analgesics with reduced side effects for treatment of neuropathic pain. A new superposition of the mentioned pharmacophores led to novel μ-bivalent/δ-bivalent compounds that demonstrate both μ-opioid and δ-opioid receptor agonist activity and high efficacy in anti-inflammatory and neuropathic pain models with the potential of reduced unwanted side effects.

J. Heterocyclic Chem., 00, 00 (2016).

INTRODUCTION agonists [18–20] while others state that μ-agonist signaling can be enhanced by co-treatment with δ-selective antago- μ-Opioid analgesics are the mainstay for treatment of nists [21,22]. Others indicate differential localizations and moderate to severe pain, but they have significant side pain relieving profiles of the μ-receptors and δ-receptors effects including constipation, respiratory depression, tol- in dorsal root ganglion cells [23]. erance, addiction, and even death [1]. Convincing data One of the promising new approaches to answer the (biochemical, pharmacological, and studies using geneti- questions raised could be the creation and investigation cally modified animals) regarding the modulatory interac- of bivalent ligands. Bivalent ligands contain two tions between opioid receptors exist in the literature. pharmacophores that are fused or variably separated by a Several studies indicate that δ-receptor agonists as well as chemical spacer, and there are several interesting examples δ-receptor antagonists provide significant modulation of of them in the literature [24–41]. Finding the “correct” pair the pharmacological effects of μ-agonists. It has been of two ligands and their “correct” superposition is an at- shown that agonists at the δ-receptor can enhance the anal- tractive yet challenging problem. gesic potency and efficacy of μ-agonists while Our preliminary investigations demonstrate that new δ-antagonists can prevent or diminish the development of bivalent ligands with mixed μ-profile/δ-profile, which rep- tolerance and physical dependence by μ-agonists; multiple resents one attempt at combining fentanyl 1 and and controversial interpretations of the observed phenom- enkephalin-like peptides 2 (Fig. 1), are promising com- ena have been made [2–16]. pounds with high binding affinities to both μ-receptors Functional association between μ-opioid and δ-opioid and δ-receptors [42–46]. receptors was first suggested by studies showing that μ- Recently, we have designed and synthesized compounds activity could be modulated by δ-ligands [17], but the true of types 3 and 4 (Fig. 2), which differ mainly in super- role of δ-ligands remains obscure. Some authors insist that position of the μ/δ constituents. Compounds in series 3 δ-agonists increase antinociceptive responses to μ-receptor display binding affinities in the range of 30–60 nM for

Figure 1. Structures of fentanyl 1 and enkephalin-like peptides 2. Figure 3. Structures of novel μ-bivalent/δ-bivalent ligands. both receptors [44–46]. Compounds in series 4 display higher affinity (~0.4 nM) for both receptors with perchlorates chemistry”—preparation of succinisoimidium increased hydrophobicity (aLogP 3.01–4.74). Binding perchlorates from succinamic acids with acetic anhydride affinities of series 4 exceed desired affinities and cross and perchloric acid [49–52]. Previously, this method was the threshold of nanomolar into picomolar range at both extended and simplified by us, implementing it for the cre- μ-opioid and δ-opioid receptors [42,43]. The bivalent ation of new type of isoimidium compounds— ligands with synergistic action on different subtypes glutarisoimidium and 3-oxaglutarisoimidium perchlorates of the same (opioid) receptors could be called concor- (8b, c) [47]. All three isoimidium perchlorates smoothly dant ligands. produce appropriate hydrazides (9a, b, c) when treated Another novel attempt to create μ-bivalent/δ-bivalent with N-Boc-phenylalanine hydrazide, which on further compounds using both a different superposition of ligands Boc deprotection with trifluoroacetic acid gave (10a, b, and a different linker (carboxy group) and spacer c). Coupling of the obtained products with Boc-protected (hydrazino group) is presented in Figure 3 and is the Tyr-D-Ala-Gly-OH followed by deprotection gave the subject of the present publication. desired bivalent ligands with mixed μ-profile/δ-profile (11a, b, c). Another potentially convenient method for the creation RESULTS AND DISCUSSION of compounds of the formula (11) by direct coupling of hydrazides (12) (Fig. 4) with enkephalin-like peptides was Chemistry. The gram scale synthesis of functionalized undertaken, but our various attempts to develop a protocol fentanyls—carboxyfentanyl (7a), carboxymethyl-fentanyl for their preparative synthesis failed. Direct hydrazination (7b), and fentanyl derivative (7c) starting from 1- of both (7) and (8) gave very poor yields of an unstable phenethyl-N-phenylpiperidin-4-amine (6)—was previously product (12). However, use of Boc or benzylhydrazines described by our group for the synthesis of μ-agonist/ gave excellent yields of protected products (13) and (14). NK1-antagonist bivalent ligands [47,48]. The synthetic But upon deprotection, Boc hydrazides (13) decomposed Scheme 1 ensures good yields of the desired compounds. in different ways depending on conditions, and the nature A “peptide chemistry” method with carbodiimide of the linker between the two carbonyl groups. Bn- activation of the carboxyl function of (7a, b, c) hydrazides (14) decomposed on H2/Pd-C hydrogenation with EDAC/HOBt [1-ethyl-3-(3-dimethylaminopropyl) to give 1-alkyl-1,2,3,6-tetrahydropyridines (16) (Fig. 4). carbodiimide/hydroxybenzotriazole] was successfully The bivalent ligands with mixed μ-/δ-profile (11a, b, c) implemented for the creation of N-Boc-phenylalanine demonstrated good binding affinity to both μ-opioid and hydrazides (9a, b, c) acylated with fentanyl carboxylic δ-opioid receptors (Table 1). acids (7a, b, c). Compound (11b) was selected for testing in several Another convenient method for creation of substituted in vivo pain models, including inflammatory pain, using fentanyls has been developed using “succinisoimidium the formalin flinch assay and antiallodynia, in a nerve

Figure 2. Structures of μ-bivalent/δ-bivalent ligands already proposed by our group.

Journal of Heterocyclic Chemistry DOI 10.1002/jhet Month 2016 Synthesis and Investigation of Mixed μ-Opioid and δ-Opioid Agonists as Possible Bivalent Ligands for Treatment of Pain

Scheme 1. Synthesis of novel μ-bivalent/δ-bivalent ligands. Reagents and conditions: (a) succinic, glutaric, or diglycolic anhydride in CH2Cl2; (b) Ac2O, HClO4; (c) N-Boc-PheNHNH2, EDAC, HOBt, CHCl3; (d) N-Boc-PheNHNH2,Et3N, CHCl3; (e) CF3COOH/CH2Cl2; (f) 1. Boc-Tyr(Boc)-D-Ala-Gly-OH, BOP, HOBt, DMF; 2. CF3COOH/CH2Cl2. [Color ﬁgure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

ligation model with no significant sedation, or motor administration. The three doses (1, 3, and 10 μg) produced impairment and demonstrates potent and efficacious activ- significant dose-dependent antinociception in non-injured ity. This is the first report of a fentanyl-based structure with mice compared with vehicle-treated mice 15 min after intra- δ-opioid and μ-opioid receptor activity that exhibits out- thecal injection (21 ± 6.4%, 36 ± 15.8%, and 77 ± 10.7%, standing antinociceptive efficacy in neuropathic pain, respectively). The A50 dose was calculated to be 3.92 μg. reducing the propensity of unwanted side effects that occur These effects were blocked by naloxone, indicating that with current μ-opioid agonist therapies. they were opioid receptor-mediated effects. Furthermore, Compound (11b) demonstrated significant antinocice- the significant attenuation by the μ-selective antagonist, (D- ption using a warm water tail-flick test after the spinal Phe-Cys-Tyr-D-Trp-Arg-Thr-Pen-Thr-NH2)CTAP,andby

Figure 4. Failed attempts of the synthesis of hydrazides (12).

Journal of Heterocyclic Chemistry DOI 10.1002/jhet R. S. Vardanyan, J. P. Cain, S. M. Haghighi, V. K. Kumirov, M. I. McIntosh, Vol 000 A. J. Sandweiss, F. Porreca, and V. J. Hruby

Table 1 agonist constituents reveal high efficacy in anti- Results in the MVD and GPI/LMMP assays. inflammatory and neuropathic pain models with the potential of reduced unwanted side effects. In addition, Compound MVD GPI/LMMP μ-agonists/δ-agonists have been shown to significantly a Agonist activity (nM IC50 ± sem) decrease anxiety in mice and rats. This latter aspect needs 11a 69 ± 12 44 ± 9.7 to be further investigated. Detailed pharmacological 11b 39 ± 8.2 63 ± 13 investigation on (11b) is in progress. 11c 48 ± 16 42 ± 8.3 MVD, mouse vas deferens; GPI, guinea pig isolated ileum; LMMP, lon- gitudinal muscle with myenteric plexus; sem, standard error of mean. aConcentration of compounds at 50% specific binding. EXPERIMENTAL

Chemistry. The compounds were characterized by 1H the δ-selective antagonist, naltrindole, suggests that the and 13C nuclear magnetic resonance (NMR). NMR antinociceptionproducedby(11b)isindeedmediatedby spectra were recorded on a Bruker (Billerica, MA) DRX- both the μ-opioid and δ-opioid receptors. In order to deter- 600 spectrometer using tetramethylsilane as an internal mine whether (11b) has anti-inflammatory effects, it was standard. The compounds were analyzed by electrospray tested in a murine formalin flinch model. Compound (11b) mass spectrometry (MS) on a Thermo Electron resulted in significant inhibition of formalin-induced (Waltham, MA) (Finnigan) LCQ classic ion trap mass flinchinginboththefirst and second phases, suggesting spectrometer. Direct infusion (10 μL/min) was applied to antinociception by inhibiting both δ-fiber and C-fiber activity. about 50 μM solutions of the samples in MeOH/H2O 1:1 Implementing the Kim and Chung model for peripheral 2% AcOH. Standard electrospray ionization conditions neuropathy [53,54], it was shown that (11b) resulted in were applied, and the masses of protonated molecules significant mechanical antiallodynia and thermal [MH]+ were measured. Optical rotations were measured antihypersensitivity in the nerve injured animal. Such stud- on a Rudolph Research Analytical (Hackettstown, NJ) ies suggest that a fentanyl-based, mixed mu-delta opioid AutoPol III polarimeter using the Na-D line. The purity agonist (11b) can act to inhibit neuropathic pain. Rotorod of the compounds was determined by thin-layer experiments were performed and demonstrated that the chromatography on silica gel plates (Analtech, Newark, lack of (11b) induced motor paralysis and/or signs of seda- DE; 02521), solvent system MeOH/CHCl3 1:4. Melting tion because such behavior would mask paw withdrawal points are uncorrected. The purity of the compounds was results in our pain behavior tests. Owing to the added anal- also checked by analytical reversed-phase high- gesic effects of δ-opioid receptor occupation, less μ- performance liquid chromatography using an Amersham receptor occupation is required, essentially decreasing the Pharmacia Biotech (Piscataway, NJ) Äkta Basic 10F with dose and unwanted side effects driven by μ-opioid receptor a ODS-A C18 (120 Å, 5 μm, 250 mm × 4.6 mm) column agonists. Ultimately, by using a combination of acute and (Omnicrom; YMC Europe GmbH, Dinslaken, Germany) chronic pain models, we demonstrate the efficacy of the monitored at 220 and 254 nm and by high-resolution novel μ-bivalent/δ-bivalent compound (11b) in treating mass spectral analysis (Supporting Information). neuropathic pain without sedation and motor impairment. General method for the synthesis of the 4-oxo-4-((1- Overall, these studies demonstrate a novel fentanyl- phenethylpiperidin-4-yl)(phenyl)amino)alcanoic acids (7a, b, based structure that contains both μ-opioid and δ-opioid c). A mixture of [1-(2-phenyl)-ethyl-piperidin-4-yl]- receptor agonist activity resulting in high efficacy in anti- phenyl-amine (2.8 g, 10 mmol), appropriate acid anhydride inflammatory and neuropathic pain models; they also have (succinic, glutaric, or diglycolic, 11 mmol) and two to three the potential to reduce unwanted side effects. There may drops of acetic acid in dichloromethane (30 mL) was heated also be the added potential of being anxiolytic, which will in a closed pressure-proof flask in a boiling water bath for need to be further investigated. Detailed pharmacological 5 h and left overnight at room temperature. The solvent was investigations on (11b) are already published [1]. evaporated; ethyl acetate (50 mL) was added, and the mixture was heated to dissolve the content of the flask. For the cases (7b)and(7c), it is necessary to add some ethanol CONCLUSION (5–10 mL). Crystals of the appropriate acid separated on coolingwith80–90% yield. The result of these studies indicate that our design and 4-Oxo-4-((1-phenethylpiperidin-4-yl)(phenyl)amino) synthesis of novel non-peptide μ-agonists/δ-agonists butanoic acid (7a). Crystalline solid; yield: 3.4 g (89%); 1 resulted in new series of compounds such as (11), which mp 119–120 °C; H-NMR (600 MHz, methanol-d4): have potent analgesic effects. Novel fentanyl-based struc- δ = 7.50 (t, J = 7.3 Hz, 2H), 7.48–7.43 (m, 1H), 7.32–7.25 tures that contain both μ-opioid and δ-opioid receptor (m, 4H), 7.25–7.18 (m, 3H), 4.70 (tt, J = 12.0, 3.5 Hz,

Journal of Heterocyclic Chemistry DOI 10.1002/jhet Month 2016 Synthesis and Investigation of Mixed μ-Opioid and δ-Opioid Agonists as Possible Bivalent Ligands for Treatment of Pain

1H), 3.42 (d, J = 12.2 Hz, 2H), 3.00 (m, 2H), 2.90 (dd, General method for the synthesis of the N-Boc-phenylalanine J = 10.5, 6.1 Hz, 2H), 2.80 (t, J = 12.0 Hz, 2H), 2.42 (t, hydrazides acylated with fentanyl carboxylic acids (9a, b, c). J = 6.8 Hz, 2H), 2.18 (t, J = 6.8 Hz, 2H), 2.00 (d, Peptide chemistry method. To the stirred mixture of acid J = 12.2 Hz, 2H), 1.62 ppm (dq, J = 3.3, 13.1 Hz, 2H); (7a, b, c, 0.25 mmol) in CHCl3 (25 mL) cooling in ice 13 C-NMR (150 MHz, methanol-d4): δ = 172.77, 138.08, bath, EDAC (0.048 mL, 0.275 mmol) was added. After 137.48, 130.16, 129.40, 128.65, 128.31, 126.44, 58.09, 15 min, HOBt (0.04 g, 0.275 mmol) was added, and 51.92, 50.76, 30.85, 30.47, 30.25, 28.14 ppm; MS [electron after stirring for additional 15 min, N-Boc-PheNHNH2 impact (EI), 70 eV] m/z (%): 381; high-resolution MS fast (0.07 g, 0.275 mmol) was added. The reaction mixture atom bombardment (HRMS-FAB) m/z [M+H]+ calcd for was allowed to come to room temperature and left C23H29N2O3:381.2178; found: 381.2183. overnight. The solvent was removed in vacuo,and 5-Oxo-5-((1-phenethylpiperidin-4-yl)(phenyl)amino) acetone (15 mL) was added to the remaining mixture, pentanoic acid (7b). Crystalline solid; 3.42 g (87%); mp which was then refluxed for 5–10minandallowedto 1 104–105 °C; H-NMR (600 MHz, methanol-d4): δ =7.49(t, cool. Precipitate of the obtained acetone hydrazone J =7.3Hz,2H),7.45(d,J = 7.2 Hz, 1H), 7.29 (t, J =7.2Hz, formed from excess of N-Boc-PheNHNH2 was filtered, 2H), 7.24–7.19 (m, 5H), 4.72 (tt, J = 12.0, 3.6 Hz, 1H), 3.42 acetone was removed in vacuo,CHCl3 (25 mL) was (d, J = 12.3 Hz, 2H), 2.99 (m, 2H), 2.89 (m, 2H), 2.79 (t, added to remaining solid, and the solution was washed J = 11.9 Hz, 2H), 2.10 (t, J = 7.3 Hz, 2H), 2.05–1.95 (m, twice with 5% NaHCO3 (10 mL) and with water and 4H), 1.79 (dd, J = 14.7, 7.3 Hz, 2H), 1.61 ppm (dd, J = 12.8, driedonMgSO4. Solvent evaporation gave pure (7a, b, 13 3.2 Hz, 2H); C-NMR (150 MHz, methanol-d4): δ = 173.27, c)with70–80% yield. If necessary, product can be 138.07, 137.56, 130.05, 129.44, 128.66, 128.32, 126.43, purified on silica gel column with the 4:1 58.11, 51.87, 50.78, 34.52, 33.99, 30.89, 28.19, 21.05 ppm; chloroform/methanol solvent mixture. m z m z M + MS (EI, 70 eV) / (%): 395; HRMS-FAB / [ +H] Isoimidium perchlorates method. N-Boc-PheNHNH2 calcd for C24H31N2O3: 395.2325; found: 395.2323. (0.07 g, 0.275 mmol) was added to the stirred suspension of 2-(2-Oxo-2-((1-phenethylpiperidin-4-yl)(phenyl)amino) perchlorate (8)(0.25mmol)inCHCl3 (25 mL), and the ethoxy)acetic acid (7c). Crystalline solid; 3.12 g (79%); solution was cooled in an ice bath before a dropwise 1 mp 143–144 °C; H-NMR (600 MHz, methanol-d4): addition of triethylamine (0.13 mL, 1 mmol) in CHCl3 δ = 7.55–7.45 (m, 3H), 7.35–7.26 (m, 4H), 7.25–7.22 (m, (5mL). The reaction mixture was allowed to come to room 3H), 4.74 (tt, J = 12.1, 3.6 Hz, 1H), 3.86 (d, J = 6.0 Hz, temperature and left overnight. The solvent was removed in 4H), 3.56 (d, J = 12.3 Hz, 2H), 3.15 (dd, J = 10.3, 6.6 Hz, vacuo, and acetone (15 mL) was added to the remaining 2H), 3.01 (t, J = 12.2 Hz, 2H), 2.95 (dd, J = 10.3, 6.6 Hz, mixture, which was then refluxed for 5–10 min and allowed 2H), 2.09 (d, J = 12.7 Hz, 2H), 1.72 ppm (dd, J = 12.8, to cool. Precipitate of the obtained acetone hydrazone was 13 2.8 Hz, 2H); C-NMR (150 MHz, methanol-d4): filtered, acetone was removed in vacuo,CHCl3 (25 mL) was δ = 174.52, 170.05, 136.78, 136.17, 129.90, 129.70, added to the remaining solid, and the solution was washed 129.28, 128.46, 128.33, 126.67, 69.40, 68.52, 57.60, twice with 5% NaHCO3 (10 mL) and with water before it 51.69, 50.81, 30.36, 27.41, 19.81 ppm; MS (EI, 70 eV) was dried on MgSO4. Solvent evaporation gave pure (7a, b, m/z (%): 397; HRMS-FAB m/z [M+H]+ calcd for c)with65–70% yield. If necessary, the product can be C23H29N2O4: 397.2127; found: 397.2123. purified on silica gel column with the 4:1 General method for the synthesis of the isoimidium chloroform/methanol mixture. perchlorates (8a, b, c). The stirred mixture of acid (7a, Tert-butyl (1-oxo-1-(2-(4-oxo-4-((1-phenethylpiperidin-4-yl) b, c, 0.5 mmol) in acetic anhydride (1.5 mL) was slightly (phenyl)amino)butanoyl)hydrazinyl)-3-phenylpropan-2-yl) heated until the beginning of dissolution of the starting carbamate (9a). Viscous oil; 0.12 g (75%); 1H-NMR material. Then, the heater was turned off, but stirring was (600 MHz, CDCl3): δ = 7.42–7.39 (m, 2H), 7.27–7.09 continued for 1 h. The mixture was cooled (ice bath), and (m, 13H), 5.69 (d, J =8.8Hz,1H),5.39(d,J =8.8Hz, J 70% HClO4 (0.15 mL) was carefully added dropwise. 1H), 5.38 (d, = 9.6 Hz, 1H), 4.65 (m, 2H), 4.10 (s, The obtained solution was allowed to come to room 2H), 3.83 (s, 2H), 3.16 (m, 2H), 3.01 (d, J =10.3Hz, temperature overnight, and 5 mL of dry ether was added 2H), 2.72 (m, 2H), 2.54 (m, 2H), 2.16 (m, 2H), 1.82 with stirring. After 15–20 min, the liquid was separated (m, 2H), 1.46 (qd, J = 12.3, 3.8 Hz, 2H), 1.36 ppm (s, 13 from the precipitated perchlorate, and the solid residue 9H); C-NMR (150 MHz, CDCl3) δ = 171.64, 169.01, was washed with three portions of ether (5 mL). For 167.63, 155.49, 139.80, 136.95, 136.61, 130.28, analytical purposes, the residue was dried overnight in a 129.62, 129.49, 129.48, 128.70, 128.53, 128.49, vacuum desiccator over phosphorous pentoxide. For 126.84, 126.22, 77.37, 60.12, 54.06, 52.88, 52.83, synthetic purposes, it was dissolved in CHCl3/CH3CN 38.66, 33.38, 30.55, 30.07, 29.18, 28.36; MS (EI, (5 mL/1 mL) mixture and added to a solution of N-Boc- 70 eV) m/z (%): 641; HRMS-FAB m/z [M+H]+ calcd for phenylalanine hydrazide. C37H47N5O5: 641.3577; found: 641.3583.

Journal of Heterocyclic Chemistry DOI 10.1002/jhet R. S. Vardanyan, J. P. Cain, S. M. Haghighi, V. K. Kumirov, M. I. McIntosh, Vol 000 A. J. Sandweiss, F. Porreca, and V. J. Hruby Tert-butyl (1-oxo-1-(2-(5-oxo-5-((1-phenethylpiperidin-4-yl) chloro-1H-benzotriazole-1-yl)-1,1,3,3-tetramethylaminium (phenyl)amino)pentanoyl)hydrazinyl)-3-phenylpropan-2-yl) hexafluorophosphate] (2.06 g, 5.0 mmol), and DIEA carbamate (9b). Viscous oil; 0.12 g (73%); 1H-NMR (1.74 mL, 10.0 mmol) in DMF (12 mL) were added, and (600 MHz, CDCl3): δ = 7.41–7.34 (m, 2H), 7.29–7.05 (m, the mixture was shaken for 30 min, followed by washing 13H), 5.57 (d, J = 8.8 Hz, 1H), 5.41 (d, J = 8.8 Hz, 1H), with DMF and CH2Cl2. After subsequent Fmoc 5.33 (d, J = 9.6 Hz, 1H), 4.64 (m, 2H), 3.13 (m, 2H), 3.01 deprotection 5 and 13 min and washing, Boc-Tyr(tBu)- (d, J = 10.3 Hz, 2H), 2.72 (m, 2H), 2.52 (m, 2H), 2.26 (t, OH (1.69 g, 5.0 mmol), HCTU (2.06 g, 5.0 mmol), and J = 7.3 Hz), 2.13 (m, 2H), 2.03 (m, 2H), 1.84 (quintet, DIEA (1.74 mL, 10.0 mmol) in DMF (12 mL) were added, J = 7.3 Hz), 1.79 (m, 2H), 1.42 (m, 2H), 1.35 ppm (s, 9H); followed by mixing for 30 min and washing with DMF 13 C-NMR (150 MHz, CDCl3) δ = 172.25, 168.65, 167.09, and CH2Cl2. The protected tripeptide was cleaved from 155.61, 140.29, 136.96, 136.53, 130.37, 129.56, 129.49, the resin with 12 mL of 20% hexafluoroisopropanol in 129.48, 128.72, 128.62, 128.49, 126.96, 126.14, 77.37, CH2Cl2 for 1.5 h, which was evaporated to provide 60.55, 54.15, 53.18, 53.14, 38.61, 33.91, 33.72, 33.15, (0.406 g, 87.1%) of the product. Boc-Tyr(tBu)-D-Ala-Gly- 30.61, 28.40, 21.37; MS (EI, 70 eV) m/z (%): 655; OH (0.122 g, 0.24 mmol), 10 (a–c) (0.22 mmol), BOP + HRMS-FAB m/z [M+H] calcd for C38H49N5O5: (0.115 g, 0.26 mmol), HOBt (0.035 g, 0.26 mmol), and 655.3734 found: 655.3743 DIEA (114 μL, 0.65 mmol) in DMF (1.5 mL) were stirred Tert-butyl (1-oxo-1-(2-(2-(2-oxo-2-((1-phenethylpiperidin-4- overnight. The reaction mixture was diluted with ethyl yl)(phenyl)amino)ethoxy)acetyl)hydrazinyl)-3-phenylpropan-2- acetate and washed with 10% (aq.) potassium carbonate yl)carbamate (9c). Viscous oil; 0.11 g (67%); 1H-NMR and then dried over solid potassium carbonate. After fi (600 MHz, CDCl3): δ =7.39–7.33 (m, 2H), 7.27–7.07 (m, ltering, the solvent was evaporated. The resulting residue 13H), 5.58 (d, J = 8.8 Hz, 1H), 5.36 (d, J = 8.8 Hz, 1H), 5.33 was dissolved in 1:1 CH2Cl2/CF3COOH (4 mL) and (d, J = 9.6 Hz, 1H), 4.63 (m, 2H), 3.14 (m, 2H), 3.04 (d, stirred for 30 min. After evaporating the reaction solvent J= 10.3 Hz, 2H), 2.74 (m, 2H), 2.59 (m, 2H), 2.50 (t, and coevaporation of excess CF3COOH with toluene and J= 7.3 Hz), 2.26 (t, J = 7.3 Hz), 2.19 (m, 2H), 1.79 (m, 2H), diethyl ether, the residue was purified by reversed-phase 1.47 (qd, J = 12.3, 3.8 Hz, 2H), 1.34 ppm (s, 9H); 13C-NMR high-performance liquid chromatography (C18) using a – (150 MHz, CDCl3) δ = 169.34, 168.93, 167.50, 155.62, 30 70% gradient of acetonitrile in 0.1% aq. CF3COOH 140.11, 136.59, 136.29, 130.14, 129.79, 129.51, 129.46, and lyophilized. Owing to the limited sensitivity of 128.64, 128.50, 128.42, 126.80, 126.10, 77.37, 71.23, natural-abundance 13C and the relatively large size of 70.68, 60.38, 54.04, 52.93, 52.87, 38.66, 33.76, 30.16, compounds 11a–c, the 13C spectra were not conclusive. 28.33; MS (EI, 70 eV) m/z (%): 657; HRMS-FAB m/z [M Instead, the 1H spectra were resolved using 2D total + +H] calcd for C37H47N5O6: 657.3526; found: 657.3543 correlation spectroscopy and 2D rotational Overhauser General method for the Boc deprotection of the effect spectroscopy to confirm the connectivity. N-Boc-phenylalanine hydrazides acylated with fentanyl 4-(2-((R)-2-(2-((S)-2-((R)-2-Amino-3-(4-hydroxyphenyl) carboxylic acids (10a, b, c). To the stirred mixture of propanamido)propanamido) acetamido)-3-phenylpropanoyl) hydrazinyl)-4-oxo-N N hydrazide (10,0.25mmol)inCH2Cl2 (10 mL), on cooling, a -(1-phenethylpiperidin-4-yl)- -phenyl- fl solution of CF3COOH (7 mL) in CH2Cl2 (7 mL) was added butanamide tri uoroacetate (11a). Viscous oil; 0.13 g 1 d δ dropwise. The reaction mixture was allowed to come to (71%); H-NMR (600 MHz, DMSO- 6): = 10.03 (d, room temperature overnight. The solvent and excess of J = 11.1 Hz, 1H), 9.82 (d, J = 13.7 Hz, 1H), 9.36 (s, 1H), J J CF3COOH were removed in vacuo,andCH2Cl2 (25 mL) 8.53 (d, = 7.6 Hz, 1H), 8.15 (t, = 6.4 Hz, 1H), 8.09 (d, was added to the remaining mixture. The mixture was J = 8.2 Hz, 1H), 7.51 (t, J = 7.5 Hz, 2H), 7.46 (t, J = 7.5 Hz, J – cooled in an ice bath and basified with 28–30% NH4OH 1H), 7.31 (t, = 7.5 Hz, 2H), 7.29 7.15 (m, 10H), 7.00 (d, solution. The organic layer was separated and dried on J = 8.5 Hz, 2H), 6.69 (d, J = 8.5 Hz, 2H), 4.69 (m, 1H), 4.56 MgSO4, and obtained (10a, b, c)wereacylatedwithBoc- (m, 1H), 4.30 (m, 1H), 3.97 (m, 1H), 3.72 (m, 1H), 3.58 Tyr(Boc)-D-Ala-Gly-OH. (m, 1H), 3.51 (m, 2H), 3.16 (m, 2H), 3.06 (m, 2H), 2.99 General method for the synthesis of ligands with mixed (m, 1H), 2.87 (m, 4H), 2.76 (m, 1H), 2.33 (m, 2H), 2.07 (t, J μ-profile/δ-profile (11a, b, c). Fmoc-Gly-OH (0.35 g, = 7.1 Hz, 2H), 1.92 (m, 2H), 1.49 (m, 2H), 1.03 ppm (d, J ½α 20 c 1.2 mmol) and diisopropylethylamine (DIEA) (0.84 mL, = 7.3 Hz, 3H); D =+57° ( 0.2; DMSO); MS (EI, 4.8 mmol) was added to a stirred suspension of 2-chlorotrityl 70 eV) m/z (%): 832; HRMS-FAB m/z [M+H]+ calcd for chloride resin (0.834 g, 1.0 mmol) in CH2Cl2 (10 mL). After C46H56N8O7: 832.4272; found: 832.4283. 2h, the resin was filtered and washed with 5-(2-((R)-2-(2-((S)-2-((R)-2-Amino-3-(4-hydroxyphenyl) dimethylformamide (DMF) and CH2Cl2.Theresinwas propanamido)propanamido)acetamido)-3-phenylpropanoyl) treated twice with 20% piperidine in DMF with mixing for 5 hydrazinyl)-5-oxo-N-(1-phenethylpiperidin-4-yl)-N-phenyl- fl and 13 min and washed with DMF and CH2Cl2. pentanamide tri uoroacetate (11b). Viscous oil; 0.14 g 1 >Fmoc-D-Ala-OH (1.558 g, 5.0 mmol), HCTU [2-(6- (75%); H-NMR (600 MHz, DMSO-d6): δ =10.06 (s, 1H),

Journal of Heterocyclic Chemistry DOI 10.1002/jhet Month 2016 Synthesis and Investigation of Mixed μ-Opioid and δ-Opioid Agonists as Possible Bivalent Ligands for Treatment of Pain

9.89 (s, 1H), 9.47 (s, 1H), 8.59 (d, J = 7.1 Hz, 1H), 8.20 (t, [13] Gupta, A.; Decaillot, F. M.; Devi, L. A. AAPS J 2006, 8, J = 6.5 Hz, 1H), 8.16 (d, J =8.2Hz,1H),7.49(t,J=6.8Hz, E153. J J – [14] Kabli, N.; Martin, N.; Fan, T.; Nguyen, T.; Hasbi, A.; Balboni, 2H), 7.44 (t, = 6.8 Hz, 1H), 7.31 (t, = 7.2 Hz, 2H), 7.27 G.; O’Dowd, B. F.; George, S. R. Brit J Pharm 2010, 161, 1122. 7.15 (m, 10H), 7.00 (d, J = 8.2 Hz, 2H), 6.69 (d, J=8.2Hz, [15] George, S. R.; Fan, T.; Xie, Z.; Tse, R.; Tam, V.; Varghese, G.; 2H), 4.72 (m, 1H), 4.55 (m, 1H), 4.29 (m, 1H), 3.97 (m, O’Dowd, B. F. J. Biol Chem 2000, 275, 26128. [16] He, S.-Q.; Zhang, Z.-N.; Guan, J.-S.; Liu, H.-R.; Zhao, B.; 1H), 3.70 (m, 1H), 3.57 (m, 1H), 3.50 (m, 2H), 3.16 (m, Wang, H.-B.; Yang, Q.; Li, H.; Luo, J.; Li, Z.-Y.; Wang, Q.; Lu, Y.-J.; 2H), 3.08 (m, 2H), 2.98 (m, 1H), 2.87 (m, 4H), 2.75 (m, Bao, L.; Zhang, X. Neuron 2011, 69, 120. 1H), 2.01 (t, J = 7.1 Hz, 2H), 1.94 (m, 2H), 1.87 (t, [17] Lee, N. M.; Leybin, L.; Chang, J. K.; Loh, H. H. Eur J J = 7.1 Hz, 2H), 1.66 (quintet, J = 7.1 Hz, 2H) 1.48 (m, Pharmacol 1980, 68, 181. [18] Porreca, F.; Takemori, A. E.; Sultana, M.; Portoghese, P. S.; J ½α 20 c 2H), 1.02 ppm (d, =7.3Hz, 3H); D =+58° ( 0.2; Bowen, W. D.; Mosberg, H. I. J. Pharm Exp Therapeutics 1992, 263, 147. DMSO); MS (EI, 70 eV) m/z (%): 846; HRMS-FAB m/z [19] Heyman, J. S.; Vaught, J. L.; Mosberg, H. I.; Haaseth, R. C.; M + Porreca, F. Eur J Pharm 1989, 165, 1. [ +H] calcd for C47H58N8O7: 846.4418; found: 846.4428. [20] Heyman, J. S.; Jang, Q.; Rothman, R. B.; Mosberg, H. I.; (R)-2-Amino-N-((9R,15S)-9-benzyl-1,5,8,11,14-pentaoxo-1- Porreca, F. Eur J Pharm 1989, 169, 43. ((1-phenethylpiperidin-4-yl)(phenyl)amino)-3-oxa-6,7,10,13- [21] Rozenfeld, R.; Devi, L. A. FASEB J 2007, 21, 2455. tetraazahexadecan-15-yl)-3-(4-hydroxyphenyl)propanamide [22] Gomes, I.; Gupta, A.; Filipovska, J.; Szeto, H. H.; Pintar, J. E.; Devi, L. A Proc Natl Acad Sci USA 2004, 101, 5135. 1 triﬂuoroacetate (11c). Viscous oil; 0.14 g (75%); H- [23] Scherrer, G.; Imamachi, N.; Cao, Y. Q.; Contet, C.; ’ NMR (600 MHz, DMSO-d6): δ = 10.09 (s, 1H), 9.89 (s, Mennicken, F.; O Donnell, D.; Kieffer, B. L.; Basbaum, A. I. Cell 2009, 1H), 9.47 (s, 1H), 8.59 (d, J = 7.3 Hz, 1H), 8.20 (m, 1H), 137, 1148. J – [24] Dietis, N.; Guerrini, R.; Calo, G.; Salvadori, S.; Rowbotham, 8.16 (d, = 8.4 Hz, 1H), 7.52 7.44 (m, 3H), 7.30 (t, D. J.; Lambert, D. G. Brit J Anaesth 2009, 103, 38. J = 7.3 Hz, 2H), 7.29–7.15 (m, 10H), 7.00 (d, J = 8.1 Hz, [25] Hruby, V. J.; Porreca, F.; Yamamura, H. I.; Tollin, G.; Agnes, 2H), 6.69 (d, J = 8.1 Hz, 2H), 4.71 (m, 1H), 4.56 (td, R. S.; Lee, Y. S.; Cai, M.; Alves, I.; Cowell, S.; Varga, E.; Davis, P.; J Salamon, Z.; Roeske, W.; Vanderah, T.; Lai, J. AAPS J 2006, 8, E450. = 9.3, 4.3 Hz, 1H), 4.28 (m, 1H), 4.01 (s, 2H), 3.97 (m, [26] Schiller, P. W. Life Sci 2010, 86, 598–603. 1H), 3.76 (s, 1H), 3.71 (m, 1H), 3.57 (m, 1H), 3.53 (m, [27] Ballet, S.; Pietsch, M.; Abell, A. D. Protein & Peptide Lett 2H), 3.16 (m, 2H), 3.10 (m, 2H), 2.98 (m, 1H) 2.87 (m, 2008, 15, 668. [28] Liu, Z.; Zhang, J.; Zhang, A. Curr Pharm Design 2009, 15, 4H), 2.76 (m, 1H), 1.96 (m, 2H), 1.51 (m, 2H), 1.02 ppm 682. J ½α 20 c (d, = 6.8 Hz, 3H); D = +61° ( 0.2; DMSO); MS (EI, [29] Zhang, A.; Liu, Z.; Kan, Y. Curr Top Med Chem 2007, 7, 343. 70 eV) m/z (%): 848; HRMS-FAB m/z [M+H]+ calcd for [30] Messer, J. R.; William, S. Curr Pharm Design 2004, 10, 2015. [31] Pasternak, G. W Neuropharmacol 2004, 47(Suppl. 1), 312. C46H56N8O7: 848.4221; found: 848.4233. [32] Vance, D.; Shah, M.; Joshi, A.; Kane, R. S. Biotechnol Bioen- gineer 2008, 101, 429. [33] Zhang, S.; Yekkirala, A.; Tang, Y.; Portoghese, P. S. Bioorg Acknowledgments. This work was supported by the U.S. Public Med Chem Lett 2009, 19, 6978. [34] Zheng, Y.; Akgun, E.; Harikumar, K. G.; Hopson, J.; Powers, Health Service National Institute of Health DA 13449, DA M. D.; Lunzer, M. M.; Miller, L. J.; Portoghese, P. S. J. Med Chem 2009, 06284, and DA 06789. 52, 247. [35] Yekkirala, A. S.; Lunzer, M. M.; McCurdy, C. R.; Powers, M. D.; Kalyuzhny, A. E.; Roerig, S. C.; Portoghese, P. S Proc Natl Acad REFERENCES AND NOTES Sci USA 2011, 108, 5098. [36] Balboni, G.; Salvadori, S.; Marczak, E. D.; Knapp, B. I.; [1] Podolsky, A. T.; Sandweiss, A.; Hu, J.; Bilsky, E. J.; Cain, Bidlack, J. M.; Lazarus, L. H.; Peng, X.; Si, Y. G.; Neumeyer, J. L. Eur J. P.; Kumirov, V. K.; Lee, Y.; Hruby, V. J.; Vardanyan, R. S.; Vanderah, J Med Chem 2011, 46, 799. T. W. Life Sci 2013, 93, 1010–1016. [37] Valant, C.; Lane, J. R.; Sexton, P. M.; Christopoulos, A. Ann [2] Ananthan, S. AAPS J 2006, 8, E118. Rev Pharmacol Toxicol 2012, 52, 153. [3] Hruby, V. J.; Porreca, F.; Yamamura, H. I.; Tollin, G.; Agnes, [38] Halazy, S. Exp Opin Ther Pat 1999, 9, 431. R. S.; Lee, Y.-S.; Cai, M.; Alves, I.; Cowell, S.; Varga, E.; Davis, P.; [39] Shonberg, J.; Scammells, P. J.; Capuano, B. ChemMedChem Salamon, Z.; Roeske, W.; Vanderah, T.; Lai, J. AAPS J 2006, 8, E450. 2011, 6, 963. [4] Dietis, N.; Guerrini, R.; Calo, G.; Salvadori, S.; Rowbotham, [40] Erlanson, D. A. ACS Chem Biol 2007, 2, 779. D. J.; Lambert, D. G. Brit J Anaesth 2009, 103, 38. [41] Hruby, V. J.; Agnes, R. S.; Davis, P.; Ma, S. W.; Lee, Y. S.; [5] Balboni, G.; Salvadori, S.; Trapella, C.; Knapp, B. I.; Bidlack, Vanderah, T. W.; Lai, J.; Porreca, F. Life Sci 2003, 73, 699. J. M.; Lazarus, L. H.; Peng, X.; Neumeyer, J. L. ACS Chem Neurosci [42] Lee, Y. S.; Nyberg, J.; Moye, S.; Agnes, R. S.; Davis, P.; Wu, 2010, 1, 155. S.; Ma, S.; Lai, J.; Porreca, F.; Vardanyan, R.; Hruby, V. J. Bioorg Med [6] Rozenfeld, R.; Devi, L. A. Trends Pharm Sci 2010, 31, 124. Chem Lett 2007, 17, 2161. [7] Pasternak, G. W.; Pan, Y.-X. Neuron 2011, 69, 6. [43] Lee, Y. S.; Kulkarani, V.; Cowell, S. M.; Ma, S. W.; Davis, P.; [8] Tao, P. L.; Law, P.-Y.; Loh, H. H. IUBMB Life 2010, 62, 103. Hanlon, K. E.; Vanderah, T. W.; Lai, J.; Porreca, F.; Vardanyan, R.; [9] Rozenfeld, R.; Abul-Husn, N. S.; Gomes, I.; Devi, L. A. Hruby, V. J. J Med Chem 2011, 54, 382. ScientiﬁcWorld 2007, 7(Suppl. 2), 64. [44] Lee, Y. S.; Petrov, R.; Kulkarni, V.; Min, B. J.; Ma, S.; Davis, [10] Kabli, N.; Martin, N.; Fan, T.; Nguyen, T.; Hasbi, A.; Balboni, P.; Oyarzo, J.; Vanderah, T.; Lai, J.; Porreca, F.; Vardanyan, R.; Hruby, G.; O’Dowd, B. F.; George, S. R. Brit J Pharmacol 2010, 161, V. J. Adv Exp Med Biol 2009, 611, 517. 1122–1136. [45] Lee, Y. S.; Agnes, R. S.; Cain, J. P.; Kulkarni, V.; Cai, M.; [11] Gomes, I.; Gupta, A.; Filipovska, J.; Szeto, H. H.; Pintar, J. E.; Salibay, C.; Ciano, K.; Petrov, R.; Mayorov, A.; Vagner, J.; Trivedi, D.; Devi, L. A Proc Natl Acad Sci USA 2004, 101, 5135. Davis, P.; Ma, S.; Lai, J.; Porreca, F.; Vardanyan, R.; Hruby, V. J. Pept [12] Zhang, Z.; Pan, Z. Z. J. Neurosci 2010, 30, 4735. Sci 2008, 90, 433.

Journal of Heterocyclic Chemistry DOI 10.1002/jhet R. S. Vardanyan, J. P. Cain, S. M. Haghighi, V. K. Kumirov, M. I. McIntosh, Vol 000 A. J. Sandweiss, F. Porreca, and V. J. Hruby

[46] Lee, Y. S.; Petrov, R.; Park, C. K.; Ma, S.; Davis, P.; Lai, [50] Baydar, A. E.; Boyd, G. V. J Chem Soc, Perkin Trans 1 1978, J.; Porreca, F.; Vardanyan, R.; Hruby, V. J. J. Med Chem 2007, 50, 11, 1360. 5528. [51] Boyd, G. V.; Monteil, R. L. J Chem Soc, Perkin Trans 1 1978, [47] Vardanyan, R.; Kumirov, V. K.; Nichol, G. S.; Davis, P.; 11, 1338. Liktor-Busa, E.; Rankin, D.; Varga, E.; Vanderah, T.; Porreca, F.; Lai, [52] Balaban, A. R.; Balaban, T. S.; Boyd, G. V. Synthesis 1987, 6, 577. J.; Hruby, V. J. Bioorg Med Chem 2011, 19, 6135. [53] Kim, S. H.; Chung, J. M. Pain 1992, 50, 355. [48] Nichol, G. S.; Kumirov, V. K.; Vardanyan, R.; Hruby, V. J. [54] Schiller, P. W.; Fundytus, M. E.; Merovitz, L.; Weltrowska, CrystEngComm 2010, 12, 3651. G.; Nguyen, T. M.; Lemieux, C.; Chung, N. N.; Coderre, T. J. J. Med [49] Hoogewerff, S.; van Dorp, W. A. Rec Trav Chim 1892, 11, 84. Chem 1999, 42, 3520.

Journal of Heterocyclic Chemistry DOI 10.1002/jhet Headache

17βestradiol induces cortical spreading depression and pain behavior in alert female rats

ForJournal: HeadachePeer Review Manuscript ID Headache-16-06-0279

Manuscript type: Research Submissions

Key Words: migraine, aura, estrogen, sumatriptan, trigeminal

Area of Expertise: Hormonal aspects of headache, Mechanism, Pathophysiology

Page 1 of 38 Headache

1 2 3 Abstract 4 5 Objective: Test the putative contribution of highdose estrogen in the development of cortical 6 7 8 spreading depression events and head pain in awake, nonrestrained rats. 9 10 Background: Migraine headache is one of the most common neurological disorders affecting 11 12 roughly 1 billion people worldwide. While the mechanisms contributing to migraine 13 14 pathophysiology are not fully elucidated, the disproportionate number of women afflicted 15 16 suggests a prominent role for estrogen in migraine susceptibility; few preclinical studies use 17 18 female subjects. For Peer Review 19 20 21 Materials and Methods: Female, SpragueDawley rats were left intact or underwent 22 23 ovariectomy followed one week later by surgery to place electrodes onto the dura to detect 24 25 epidural electroencephalographic activity (dEEG). dEEG activity was recorded two days later for 26 27 12 hours after systemic administration of 17βestradiol (180g/kg, i.p.). A separate set of rats 28 29 were observed for changes in natural exploratory, ambulatory, fine, and rearing behaviors; 30 31 periorbital allodynia was also assessed. 32 33 34 Results: A bolus of 17βestradiol significantly elevated serum estrogen levels, increased CSD 35 36 episodes over a 12hour recording period and decreased rearing behaviors in ovariectomized 37 38 rats. Preadministration of ICI 182,780, an estrogen receptor antagonist, blocked estradiol 39 40 evoked CSD events and pain behaviors; similar results were observed when the antimigraine 41 42 therapeutic sumatriptan was used. 43 44 Conclusion: These data indicate that an estrogen receptormediated mechanism contributes to 45 46 47 CSD events and pain behaviors in ovariectomizedbut not intactrats suggesting that natural 48 49 estrogens play a role in migraine protection whereas changes in concentration may influence 50 51 susceptibility. This is the first study to relate estrogen peaks to CSD and pain behaviors in 52 53 awake, freely moving female rats, establishing a framework for future preclinical migraine 54 55 studies. 56 57 58 59 60 1

Headache Page 2 of 38

1 2 3 Introduction 4 5 Migraine is one of the most common neurological disorders in the world, affecting 14.2% 6 7 1 8 of US adults. Overall, migraineurs spend nearly 2.5 times more than nonmigraineurs in direct 9 10 healthcare costs and results in approximately 11 days of missed work that costs up to 11 12 $10,000/case annually.2, 3 Roughly twothirds of migraineurs are female suggesting a potential 13 14 role for estrogens in migraine pathophysiology,4 yet very few preclinical studies have used 15 16 female subjects.5, 6 17 18 According to For the International Peer Classiﬁcation Review of Headache Disorders, two types of 19 20 21 migraine are described: migraine with and without aura. Migraine with aura (MA), a focal 22 23 neurological disturbance exhibiting predominantly visual symptoms, affects onethird of all 24 25 migraineurs;79 this phenomenon is closely associated with cortical spreading depression (CSD). 26 27 CSD events are selfpropagating waves of membrane depolarization that travel at a rate of 25 28 29 mm/min that is followed by both a negative shift of the direct current (DC) potential and 30 31 increases in cerebral blood flow.10, 11 In MA, CSDs are thought to occur during the aura phase of 32

33 12 34 migraine and precede the headache phase. CSD susceptibility (i.e., reduced CSD thresholds) 35 1315 36 and the probability of migraine attack are enhanced by increases in cortical excitability and 37 38 result in an increased BOLD signal on fMRI.14, 1619 39 40 Female reproductive hormones, including estrogen and progesterone, are implicated in 41 42 migraine development both clinically and preclinically.20, 21,22 Clinically, the onset of migraine 43 44 attacks coincides with hormonal fluctuations such as those associated with puberty, some oral 45

46 21, 2325 47 contraceptives, pregnancy, and menopause. Moreover, it is wellaccepted that migraine 48 49 without aura can be triggered by steeply declining levels of ovarian hormones whereas MA is 50 51 exacerbated by increasing levels of female reproductive hormones.6, 26 Preclinical studies have 52 53 shown that estrogens, acting through both nuclear α and βestrogen receptors as well as 54 55 GPR30,27, 28 increase cortical excitability and CSD susceptibility in brain slices.29 In anesthetized 56 57 58 59 60 2

Page 3 of 38 Headache

1 2 3 rodent models of CSD, estrogen fluctuations reduced the CSD threshold and increased the 4 5 13, 30, 31 6 frequency and velocity of CSD events. 7 8 To date, no studies have investigated the contribution of estrogen to CSD induction and 9 10 headache pain behavior in awake, freelymoving, female rats. Here, we addressed this gap in 11 12 knowledge and study the contribution of 17βestradiol to CSD and headache pain using our 13 14 nonanesthetized rodent model32, 33, 34 including estrogenreceptor dependence and responsivity 15 16 to sumatriptan, the leading abortive antimigraine. Estradiol administration induced CSDs and 17 18 For Peer Review 19 behaviors associated with headache pain. Both CSDs and pain behavior were inhibited by the 20 21 estrogen receptor antagonist ICI 182,780 and sumatriptan, confirming both estrogen receptor 22 23 dependence and responsivity to the leading abortive antimigraine, respectively. 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 3

Headache Page 4 of 38

1 2 3 Materials and Methods 4 5 6 Animals 7 8 9 Female, Sprague Dawley rats (275300g) purchased from Harlan (Indianapolis, IN) were 10 11 housed in a climate controlled room on a regular 12 hour light/dark cycle with lights on at 7:00 12 13 am with food and water ad libitum. All procedures were performed during the 12hour light cycle 14 15 and according to the policies and recommendations of the International Association for the 16 17 Study of Pain, the NIH guidelines for laboratory animals, and were approved by the IACUC of 18 For Peer Review 19 the University of Arizona. 20 21 22 23 24 Drugs 25 26 Ketamine/xylazine was purchased from Western Medical Supply (Arcadia, CA). 17βestradiol, 27 28 ICI 182,780 and sumatriptan were purchased from Tocris (Ellisville, MO). 17βestradiol and ICI 29 30 182,780 were dissolved in castor oil to appropriate concentrations the day of experiments. 31 32 Sumatriptan was dissolved in saline. Castor oil and sterile saline (0.9%) served as appropriate 33 34 35 controls. All drugs were administered via intraperitoneal (i.p.) injections. 36 37 38 39 Removal of Ovaries 40 41 Rats were anaesthetized with ketamine:xylazine (dose: 80:12 mg/kg, 1ml/kg) and 42 43 ovariectomized.35 The ovaries were removed via a bilateral side approach, whereby a 35 mm 44 45 incision is made through the skin, fascia and muscle. Ovarian arteries were ligated and the 46 47 48 ovary excised. Prophylactic gentamicin 8mg/mL, 1mL/kg was delivered i.p. following surgery. 49 50 The rats were given 7 days to recover before implantation of recording electrodes and/or any 51 52 experiments (Figure 1A). 53 54 55 56 Vaginal Smears 57 58 59 60 4

Page 5 of 38 Headache

1 2 3 Estrous cycles of intact female rats were monitored by daily vaginal smears. The vaginal 4 5 36 6 smears were interpreted as described by Goldman et al. Briefly, vaginal openings were 7 8 flushed with 200 L of sterile saline. Fresh samples were evaluated for cytology at the same 9 10 time daily for 8 days using a Zeiss Axioskop 40 (10x/0.3 numerical aperture EC PlanNeofluar 11 12 objective). CSD events, serum concentrations, and pain behaviors were assessed on diestrus 13 14 day 2. 15 16 17 18 For Peer Review 19 Serum Estrogen Concentration 20 21 Serum concentrations of estrogen before and at 30 min, 2, 4, 6, 12 and 24 hours post injection 22 37, 38 23 of either a dose of 17βestradiol (180 g/kg, i.p., n=3/timepoint) or vehicle (castor oil, 24 25 1ml/kg) were determined. Briefly, ~1.5mL of blood were drawn via intracardiac puncture under 26 27 isoflurane anesthesia (5% induction, 2.5% maintenance in air 2L/min); animals were then 28 29 decapitated. Samples were allowed to clot for 30 min at RT then spun in microcentrifuge tubes 30 31 32 at 10,000 RPM for 30 min at 4°C to separate serum from erythrocytes. Serum was collected, 33 34 flash frozen in liquid nitrogen, and kept frozen at 80°C until day of concentration determination. 35 36 An enzyme linked immunosorbent assay (ELISA) kit for rat estrogen (E2) was purchased 37 38 (Calbiotech, Spring Valley, CA) and performed according to manufacturer’s instructions. 39 40 41 42 Implantation of recording electrodes: 43 44 45 Silver chloride (AgCl) electrodes were prepared by flaming 0.25mm Ag wire (AM Systems, Inc., 46 47 Everett, WA) into spherical tips (1mm diameter) and subsequently coating the tips with chloride 48 49 as previously reported.32 Rats were anaesthetized with ketamine/xylazine, as above, 7 days 50 51 postovariectomy. The rats were fixed to a stereotaxic frame (Stoelting) and three burr holes 52 53 were drilled through the skull using a manual drill to allow placement of the AgCl recording 54 55 electrodes. The frontal and parietal lead electrodes were placed in the right hemisphere 2 mm 56 57 58 lateral and 1.5 mm anterior to bregma and 2 mm lateral and 2.5 mm posterior to bregma, 59 60 5

Headache Page 6 of 38

1 2 3 respectively; the reference electrode was placed 7.5mm posterior to bregma (Figure 1B). Two 4 5 6 screws (#MPX0803F1M, Small Parts Inc., Miami Lakes, FL) were fastened into the left 7 8 hemisphere of the skull separated by 2mm without going through the skull. The front screw 9 10 served as a mounting support to assist in anchoring the multipin connector. The back screw 11 12 served as a ground electrode, which was made by soldering silver wire onto the head of the 13 14 screw. The four electrodes (three silver chloride electrodes and one ground electrode) were 15 16 soldered into the bottom of a multipin connector (Continental Connector, Hatfield, PA) and the 17 18 For Peer Review 19 apparatus was fixed into place using dental cement. 20 21 22 23 Electrophysiological Recordings 24 25 Fortyeight hours after dural electrode implantation, rats were placed in a recording chamber (40 26 27 cm L x 49 cm W x 37 cm H) and the multipin connector attached to an electrocannular swivel 28 29 (#CAY6756 commutator, Airflyte, Bayonne, NJ) mounted in the ceiling of the chamber. The 30 31 32 swivel allowed rats to freely move about the chamber during the recording period. Animals were 33 34 allowed to habituate to the chamber for one hour prior to any pharmacological intervention to 35 36 permit electrical recordings to stabilize. Only those rats with stable electrical recordings were 37 38 included in experimental groups. Signals led to separate DC and AC amplifiers (Grass Model 15 39 40 amplifier system, 15A12 DC and 15A54 AC amplifiers, West Warick, RI) through insulated 41 42 cables and collected with dEEG recording analysis software Gamma v.4.9 (AstroMed, Inc. 43 44 45 West Warick, RI). Following 17βestradiol or vehicle injection, the rats were observed for 12 46 47 hours without interruption. Subsequent to dEEG recordings, animals were sacrificed and 48 49 cemented electrodes were carefully removed to ensure there was no damage to the dura. Data 50 51 from rats with damaged dura were excluded from analysis. 52 53 54 55 Electrophysiological Recording Analysis 56 57 58 59 60 6

Page 7 of 38 Headache

1 2 3 Following 12 hours of electrophysiological recording, the recording data was reviewed with 4 5 6 Gamma Reviewer (AstroMed, Inc. West Warick, RI) and analyzed for the CSDs offline. CSD 7 8 events were determined by the DC shifts that were calculated from both the frontal and parietal 9 10 electrodes that recorded the shifts. Cortical activity was defined as depressed during these 11 12 events by measuring the significant reductions in both the power and amplitude of the dEEG 13 14 tracings (i.e., recorded electrical activity was only considered a CSD event when in both frontal 15 16 and parietal electrodes: 1) the AC current was reduced by half; 2) the DC current exhibited a 17 18 For Peer Review 19 downward shift by a minimum of 1mV; and 3) for a minimal duration of 30 s; Figure 1C). The 20 21 velocity of CSD propagation was determined by analyzing the difference in time of onset of DC 22 23 current depression between the frontal and parietal electrodes and dividing into 4mm (the 24 25 distance between the two electrodes). 26 27 28 CSD velocity = _____4mm______X 60 sec 29 (depression onsetdiff) 1min 30 31 32 33 Activity Testing 34 35 Activity testing was conducted using behavioral techniques similar to those previously 36

37 34, 3941 38 described. Rats were acclimated to the testing room, but not to the activity recording 39 40 chambers for 1 hour prior to injection. Rats were then administered an estrogen antagonist (ICI 41 42 182,780), sumatriptan, or vehicle 2 hours prior to 17βestradiol or vehicle injection. Two hours 43 44 after the second injection, animals were placed in individual recording chambers (41 cm long X 45 46 41 cm wide X 39 cm high, Tru Scan Photobeam system: Coulbourn Instruments or 27.5 in long 47 48 X 8.75 in wide X 13.125 in high, Place Preference system: San Diego Instruments). Each Tru 49 50 51 Scan chamber has 2 photobeam sensor rings that measure all movements in 3 dimensions. 52 53 One ring is located near the floor of the chamber measuring all horizontal movements including 54 55 time, distance, and velocity of movements. The second ring is at the same fixed height across 56 57 all chambers and records the vertical movements (i.e. rearing behavior) including the number of 58 59 60 7

Headache Page 8 of 38

1 2 3 plane breaks and time the rat is vertical. Locomotor/exploratory activity was recorded and 4 5 6 analyzed using Tru Scan software v.3.11 (Coulbourn Instruments). The Place Preference 7 8 system records movement with a 4 X 16 photobeam array providing x,y movement, captured 9 10 into PAS Software (San Diego Instruments) which displays the information as exploration, 11 12 ambulation, and fine movements. Vertical rears were counted each time a rat stood on both 13 14 hind paws without grooming. 15 16 17 18 For Peer Review 19 Periorbital mechanical allodynia: 20 21 Rats were acclimated to testing box 1 hour prior to evaluation of periorbital mechanical allodynia 22 32 23 with von Frey filaments as previously described. Behavioral responses were determined by 24 25 applying calibrated von Frey filaments perpendicularly to the midline of the forehead at the level 26 27 of the eyes with sufficient force to cause the filament to slightly bend while held for 5 seconds. A 28 29 response was indicated by a sharp withdrawal of the head. Mechanical thresholds were 30 31 32 evaluated at baseline, 6 days post OVX before drug administration, and 2 hours post 17β 33 34 estradiol (180 g/kg) or vehicle (castor oil, 1ml/kg) administration. 35 36 37 38 Statistical Analysis 39 40 Prism software was employed to perform statistical analysis. For CSD and periorbital allodynia 41 42 studies, the data were expressed as mean ± standard error of the mean (SEM). A repeated 43 44 45 measure twoway analysis of variance (ANOVA) was employed to analyze differences among 46 47 treatment groups with a StudentNeumanKeuls test applied posthoc. In rearing experiments, 48 49 data were expressed as mean ± SEM. A oneway ANOVA was used and an unpaired ttest with 50 51 Welch’s correction to determine statistical significance. A p < 0.05 was accepted as statistically 52 53 significant. 54 55 56 57 58 59 60 8

Page 9 of 38 Headache

1 2 3 Results 4 5 Serum estrogen (E2) levels 6 7 6, 26 8 Fluctuations in estradiol serum concentrations are associated with CSD and migraine. 17β 9 10 estradiol (180g/kg) or vehicle (castor oil) was injected 7 days postOVX or in intact rats, and 11 12 samples were drawn at before (t=0) and 30 min, 2, 4, 6, 12, and 24 hour after injection to 13 14 quantify estrogen levels. In naturally cycling female rats injected during the diestrus phase of the 15 16 estrogen cycle, basal serum estrogen levels were 3.53 ± 0.76 pg/mL (Table 1, n=6). 17 18 Administration of 17βestradiolFor (180g/kg)Peer significantly Review elevated serum estrogen levels (>300 19 20 21 pg/mL, n=3, p<0.0001) after 30 min and remained significantly elevated for 2 hours above the 22 23 ELISA kit limit of detection (300pg/mL) before returning to baseline after 24 hours (3.29 ± 0.05 24 25 pg/mL, n=3). Vehicle treatment did not change serum estrogen levels in intact rats (n=3). We 26 27 next determined if 17βestradiol administration similarly elevated serum estrogen levels in OVX 28 29 rats, subjects typically used in preclinical studies. OVX rats had basal serum estrogen levels of 30 31 2.57 ± 0.32 pg/mL (n=6) consistent with previous reports6. Acute administration of 17βestradiol 32 33 34 elevated serum estrogen concentration which peaked 30 min postinjection at the limit of kit 35 36 detection (>300pg/mL, n=3, p<0.0005) and remained significantly elevated for 6 hours (164.05 37 38 pg/mL ± 48.58, p=0.005); levels returned to baseline after 24 hours (4.07 pg/mL ± 0.48, n=3). 39 40 No significant fluctuation in serum E2 levels (t=0) was observed in vehicletreated, OVX rats 41 42 (n=3) at any time over the 24 h postinjection. 43 44

45 46 47 17βestradiol induces CSD events 48 49 Elevated estradiol levels are correlated with an increase in MA frequency. Since the 50 51 distinguishing factor between MA and migraine without aura is the aura, typically associated 52 53 with CSD events, we next asked if 17βestradiol induces CSDs in awake, freelymoving, female 54 55 rats. Dural electroencephalogram traces were recorded for 12 hours following either 17β 56 57 estradiol (180g/kg) or vehicle administration. In intact rats, estradiol did not increase the 58 59 60 9

Headache Page 10 of 38

1 2 3 number of CSD events in the 12 hours following administration compared to vehicletreated 4 5 6 animals (0.00 ± 0.00, n=7, and 0.13 ± 0.14 CSDs/animal, n=8 respectively; p=0.99; Figure 1D). 7 8 Although 12.5% of intact rats treated with vehicle experienced a CSD event, no intact animals 9 10 treated with 17βestradiol had detectable CSD events (Table 2). In contrast, 6 out of 10 OVX 11 12 rats (60%) experienced a CSD event in 12 hours post administration of 17βestradiol compared 13 14 to 1 out of 10 (10%) in vehicletreated animals (Table 2). The average number of CSD events 15 16 per animal in 12 hours post injection was significantly increased in 17βestradiol injected rats 17 18 For Peer Review 19 as compared to vehicle treated controls (1.4 ± 0.40, n=10, and 0.13 ± 0.13 CSDs/animal, n=10, 20 21 respectively; p<0.005). Estrogen evoked CSD events in OVX rats propagated at a velocity of 22 23 11.9 ± 1.79 mm/min. DCshifts had an amplitude of 1.27 ± 0.09 mV and duration of 62.20 ± 8.80 24 25 seconds (Table 2). These data suggest that removal of the ovaries increases susceptibility to 26 27 17βestradiol induced CSD events. 28 29 30 31 32 17βestradiol elicits pain behaviors after OVX 33 34 Induced CSD events are not always associated with pain behaviors such as periorbital 35 32 36 allodynia, and headache can occur independent from CSD. Therefore, we evaluated pain 37 38 behaviors in intact or OVX rats exposed to 17βestradiol or castor oil. Animals were evaluated 39 40 for periorbital mechanical allodynia with calibrated von Frey filaments; baseline mechanical 41 42 thresholds were 7.85 ± 0.15 g. Administration of 17βestradiol significantly reduced mechanical 43 44 45 threshold at 2 h in both intact and OVX rats compared to baseline (intact: 4.22 ± 1.11 g, p<0.05; 46 47 OVX: 3.99 ± 1.03 g, p<0.005; Figure 2A). Castor oil vehicle had no effect on facial sensitivity in 48 49 naturally cycling or OVX rats as compared to baseline values. 50 51 In addition to periorbital allodynia, suppression of exploratory behaviors was recently 52 53 linked to preclinical migraine.34, 37, 40 We determined if total time of exploration, ambulation, and 54 55 fine movements, as well as rearing events were decreased in rats 2 hours after exposure to 56 57 58 high dose 17βestradiol or vehicle. Exploratory behaviors such as transitional exploratory 59 60 10

Page 11 of 38 Headache

1 2 3 events (i.e. chamber to chamber), ambulatory events, and fine movements were not significantly 4 5 6 different between 17βestradiol and vehicle controls suggesting that these behaviors were not 7 8 suppressed (p = 0.05, 0.12, and 0.25, respectively; Figure 2BD) 2h after administration of 17β 9 10 estradiol. The total number of rearing events was assessed over 30 minutes, 2 h after vehicle or 11 12 17βestradiol administration. Rearing behavior was not significantly different between intact 13 14 vehicle and 17βestradiol treated animals (52.73 ± 10.74, n=11 and 44.30 ± 6.21, n=10 15 16 respectively, p=0.85; Figure 2E). The total number of rearing events over a 30 min time course 17 18 For Peer Review 19 was significantly reduced in OVX vehicle treated rats (19.38 ± 5.23, n=8, p<0.05) and for OVX 20 21 animals treated with 17βestradiol (9.857 ± 1.98, n=7, p<0.005) compared to intact vehicle 22 23 treated animals. To determine if reduced rearing correlated to exploring new environment, we 24 25 assessed events in 5 min bins (Figure 2F). Most rearing events occurred in the first 5 minutes, 26 27 consistent with exploring a new environment and subsided to very few (i.e. 02 events) over the 28 29 30 min. Consistent with the total rearing data, both vehicle (8.25 ± 1.79, n=8, p<0.05; Figure 2C) 30 31 32 and 17βestradiol (3.00 ± 0.65, n=7, p<0.005) treated OVX animals reared less over the first 10 33 34 min as compared to intact vehicletreated rats. These data, together with periorbital allodynia, 35 36 indicate that 17βestradiol induced distinct manifestations of pain behaviors in both intact and 37 38 OVX rats. 39 40 41 42 17βestradiol evoked CSD events and suppressed rearing requires estrogen receptors 43 44 45 Focusing on the OVX rats, which had a significantly higher number of CSDs and prominent pain 46 47 48 behavior, we asked if estrogen receptor activation was required for 17βestradiolinduced 49 50 CSDs and suppression of rearing behaviors. We administered the estrogen antagonist ICI 51 52 182,780 (10mg/kg, i.p.) 2 hr before 17βestradiol or vehicle. 17βestradiol evoked CSD events 53 54 were blocked in the presence of ICI 182,780 (Table 1, Figure 3A). Importantly, ICI 182,720 did 55 56 not elicit CSD events when administered alone. Similarly, pretreatment with ICI 182,780 57 58 59 60 11

Headache Page 12 of 38

1 2 3 significantly prevented 17βestradiolinduced suppression of rearing events in rats (12.5 ± 2.26, 4 5 6 n=6, p<0.05; Figure 3B). Thus, 17βestradiol induced CSD events and pain behaviors by 7 8 activating estrogen receptors in OVX rats. 9 10 11 12 Sumatriptan prevents 17βestradiol evoked CSD events and suppressed rearing 13 14 We assessed the ability of the migraine therapeutic sumatriptan (0.6mg/kg, i.p.) to prevent 17β 15 16 estradiol CSD events or rearing behaviors. Pretreatment with sumatriptan 2 hours before 17β 17 18 For Peer Review 19 estradiol prevented the induction of CSD events in all rats (Table 1, Figure 4A); sumatriptan did 20 21 not induce CSDs on its own. Sumatriptan pretreatment increased the number of rears in 17β 22 23 estradiol treated OVX animals (10.6 ± 1.95, n=10) back to that of OVXvehicle treated rats 24 25 (12.27 ± 3.14, n=6, p=0.21; Figure 4B). 26 27 28 29 Discussion 30 31 Migraine with aura is a debilitating disease that affects nearly 8% of migraineurs, the majority of 32

33 4244 34 whom are female. In addition to the aura and headache, the patients suffer from a greatly 35 36 diminished quality of life as evidenced by a greater absenteeism from work/school, less 37 38 productivity, and less overall energy.45 Increases in estrogen levels are implicated in the 39 40 development of MA, but preclinical studies of this phenomenon in female subjects are lacking.6 41 42 Here, we examined the role of estradiol in the induction of CSD events and headache pain, two 43 44 characterizing features of MA, in nonanesthetized female rats. We show for the first time that 45 46 47 high levels of 17βestradiol elicits CSD events and corresponding pain behaviors in both intact 48 49 and OVX rats. These events likely require estrogen receptors and are prevented by pre 50 51 administration of sumatriptan. 52 53 Women are 3 times more likely to suffer from migraine headaches than males and on 54 55 average have increased sensitivity to pain, implicating a role for estrogens in migraine.5, 46 56 57 Plasma estradiol and progesterone levels in nonmigrainous women not taking hormonal birth 58 59 60 12

Page 13 of 38 Headache

1 2 3 control are lower throughout the menstrual cycle compared to migraineurs47 further supporting a 4 5 6 role for estrogens within the female migraineurs population. Additionally, women who start 7 8 menarche early (<12 years old) and postmenopausal women on estrogen hormone replacement 9 10 therapy (HRT) suffer from more migraines when compared to control groups of women having 11 12 later menarche (>12 years) and postmenopausal women not taking HRT, respectively.5, 48 13 14 Moreover 67% of women with known migraine who had a surgical menopause report a 15 16 worsening of headache.49 Interestingly, female migraineurs without aura taking combined oral 17 18 For Peer Review 19 contraceptives (i.e., those containing estrogen; COC) have been reported to have increased 20 21 migraine attacks in between courses when serum estrogen levels drop or are at the lowest 22 50 23 point; serum estradiol levels peak following administration of oral contraception between 100 24 25 120pg/ml.5153 In contrast, in migraineurs with aura, COCs are associated with increased 26 27 frequency and severity of migraine attack as well as increased risk of ischemic stroke54 and are 28 29 thus contraindicated. Importantly, progesteroneonly pills are not contraindicated in this 30 31 55 32 population. These clinical findings highlight the idea that estrogen fluctuations can influence 33 34 subpopulations of migraineurs differently. 35 36 In the present study, we found that a single high dose of 17βestradiol increased serum 37 38 concentrations of estradiol in both intact and OVX rats for up to 6 hrs. Elevated levels of 39 40 estradiol in women with MA are associated with increases in migraine frequency and severity6, 41 42 24, 56 and induction of CSD events.6, 13, 14, 18, 57 In our current investigation, spontaneous CSD 43 44 45 events occurred after estrogen levels peaked suggesting that changing estrogen levels were 46 47 required to induce CSDs. Interestingly, CSDs persisted after estradiol levels had returned to 48 49 baseline values (up to 12 hours) indicating a constant and increased susceptibility to neuronal 50 51 dysregulation after 17βestradiol peak levels. Notably, OVX rats had an increased susceptibility 52 53 to CSD induction as evidenced by a higher percentage of animals with CSD events in response 54 55 to 17βestradiol, as well as an increased frequency of CSD events. These observations align 56 57 58 with work by Sachs and colleagues showing that acute estrogen alone was able to induce CSDs 59 60 13

Headache Page 14 of 38

1 2 3 in rat neocortical slices29, as well as studies showing that chronic estrogen can reduce the 4 5 30 6 threshold for initiation of KClinduced CSDs in anesthetized, OVX rats. Our data now show 7 8 that 17βestradiol plays a role in CSD susceptibility and frequency in nonanesthetized, female 9 10 rats after OVX. 11 12 CSD events are linked to the aura that precedes migraine headache in 30% of 13 14 migraineurs. Previously, we have demonstrated that CSD events were not sufficient to induce 15 16 headachelike pain behaviors alone but required concurrent activation of dural nociceptors.32 17 18 For Peer Review 19 Our present studies show that 17βestradiol induces periorbital allodynia in both naturally 20 21 cycling and OVX rats to similar degrees. However, 17βestradiol only suppressed spontaneous 22 23 rearing behavior in OVX rats. This latter observation aligns with a recent study by An et al., 24 25 showing that estrogen administered to OVX rats enhanced incision evoked tactile sensitivity.58 26 27 Interestingly, OVXvehicle treated rats also reared less than intact rats. This may reflect residual 28 29 sensitivity due to surgery as OVX animals remained sensitive up to 14 days postOVX (data not 30 31 59, 60 32 shown) as estrogen fluctuations after OVX are minimal . Future studies will assess how OVX 33 34 sensitizes animals to pain, including that induced by 17βestradiol. 35 36 Various mechanisms of pain are attributed to estrogen. One study showed a decrease in 37 38 cephalic pain sensitivity, inferred by attenuated dural mast cell recruitment during the peak 39 40 estrous period (proestrus) of the rat estrous cycle in intact female rats.61 The same study also 41 42 showed chronic administration of estrogen to ovariectomized animals increased mast cell 43 44 61 45 recruitment and degranulation. This highlights the difference between the actual phenotype 46 47 observed in intact female rats versus that simulated by hormone replacement. Another study 48 49 suggests there is an increase in markers of migraine associated neuronal activation following 50 51 chronic administration of estrogen.62 52 53 Estradiol acts at nuclear α and βestrogen receptors as well as the membrane receptor 54 55 GPR30.27, 28 These estrogen receptors are located throughout the craniofacial pain axis and the 56 57 6, 6366 58 central nervous system. Interestingly, fluctuations in estrogen levels or total loss of 59 60 14

Page 15 of 38 Headache

1 2 3 endogenous estrogens can lead to changes in receptor expression,67, 68 including in the 4 5 64, 69 6 trigeminal ganglia and cortex. In the present study, we showed that the nonselective 7 8 estrogen receptor antagonist ICI 182,780 effectively prevented the induction of 17βestradiol 9 10 induced CSDs and suppressed rearing behavior suggesting that estrogen receptors were 11 12 activated. Additional studies will be required to assess contribution of individual receptor 13 14 subtypes to migraine with aura in this model. 15 16 17 Triptans are firstline therapies for episodic migraine associated with high therapeutic 18 For Peer Review 19 gains and favorable sideeffect profiles8, 7073. These compounds comprise 80% of migraine 20 21 72 72 22 prescriptions , and sumatriptan represents approximately 50% of the market . In the current 23 24 study we showed that pretreatment with sumatriptan prevented 17βestradiol induced CSD 25 26 events. In contrast to our observation, acute sumatriptan did not reduce cGMP or KClinduced 27 28 CSD events in preclinical studies74, 75. These differences may reflect variability in subject sex, 29 30 intact versus OVX, alertness (i.e., anesthetized/awake), and model of CSD induction. In addition 31 32 to preventing CSD induction, sumatriptan restored natural rearing behaviors to OVX, 17β 33 34 35 estradiol treated rats suggesting that this behavior was migrainelike and mimicked those 36 45, 73, 76, 77 37 reported by migraineurs. These data are consistent with reports that triptans need to be 38 39 onboard during prodrome for effect in migraineurs, and that triptans are ineffective when taken 40 41 at the headache phase70, 73, 7880. 42 43 44 45 Limitations of this study 46 47 48 While we provide a novel model of CSD induction, a few limitations to this study exist. Intact rats 49 6, 36 50 were assessed only in diestrus when estrogen levels are at their lowest . Moreover, only OVX 51 52 rats exhibit estradiolinduced CSD. While this doesn’t necessarily recapitulate the human 53 54 condition in most of the migraine patient population, it provides a compelling proof of concept 55 56 with highly reproducible CSD induction and allows for the study of CSD and migraine with aura 57 58 59 60 15

Headache Page 16 of 38

1 2 3 in relation to the female sex hormones. Although we did use a high dose of estradiol to induce 4 5 6 CSD events, the efficacy of lower doses in this model is not excluded. Further, the acute 7 8 administration and rapid onset of estradiol in our model does not replicate most migraineurs but 9 10 does allow for the induction and analysis of CSD in order to study how estrogen peaks 11 12 contribute to CSD development. 13 14 15 16 Conclusion 17 18 For Peer Review 50 19 While estrogen withdrawal is associated with induction of migraine without aura in humans, 20 21 elevated estradiol likely contributes to MA. To our knowledge, this is the first report utilizing 22 23 awake adultfemale rats measuring both pain behaviors and cortical spreading depression as a 24 25 marker for MA that links supraphysiologic 17βestradiol levels81, 82, to induction of CSD events 26 27 and generation of pain behaviors in OVX rats in the absence of anesthetic. Our studies validate 28 29 17βestradiol as an innovative behavioral model that recapitulates several aspects of clinical 30 31 32 migraine and therapy responsiveness. Importantly, dEEG recording electrodes were installed 33 34 via limited craniotomy; previous work has highlighted that dural damage alone may induce CSD 35 32 36 events. Furthermore, high dose 17βestradiol was administered systemically allowing for an 37 38 induction of pain behaviors to test therapy responsiveness in female rats free from craniotomy. 39 40 These data corroborate a review by EikermannHaerter and colleagues suggesting that both the 41 42 direction, rate of change, and basal set point of estrogen levels may influence migraine 43 44 13 45 pathogenesis. 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 16

Page 17 of 38 Headache

1 2 3 References 4 5 1. Burch RC, Loder S, Loder E, Smitherman TA. The prevalence and burden of migraine 6 7 8 and severe headache in the United States: updated statistics from government health 9 10 surveillance studies. Headache. 2015;55:2134. 11 12 2. Truth and Consequences: Gambling, shifting, and hoping in Arizona Healthcare. In; 13 14 2009. 15 16 3. Messali A, Sanderson JC, Blumenfeld AM, et al. Direct and Indirect Costs of Chronic 17 18 and Episodic MigraineFor in the United Peer States: A WebBased Review Survey. Headache. 2016;56:306322. 19 20 21 4. Marcus DA. Interrelationships of neurochemicals, estrogen, and recurring headache. 22 23 Pain. 1995;62:129139. 24 25 5. Aegidius KL, Zwart JA, Hagen K, Dyb G, Holmen TL, Stovner LJ. Increased headache 26 27 prevalence in female adolescents and adult women with early menarche. The HeadHUNT 28 29 Studies. Eur J Neurol. 2011;18:321328. 30 31 6. Bolay H, Berman NE, Akcali D. Sexrelated differences in animal models of migraine 32 33 34 headache. Headache. 2011;51:891904. 35 36 7. Lipton RB, Scher AI, Kolodner K, Liberman J, Steiner TJ, Stewart WF. Migraine in the 37 38 United States: epidemiology and patterns of health care use. Neurology. 2002;58:885894. 39 40 8. Ferrari MD. Migraine. Lancet. 1998;351:10431051. 41 42 9. Rasmussen BK, Olesen J. Migraine with aura and migraine without aura: an 43 44 epidemiological study. Cephalalgia : an international journal of headache. 1992;12:221228; 45 46 47 discussion 186. 48 49 10. Grafstein B. Mechanism of spreading cortical depression. Journal of neurophysiology. 50 51 1956;19:154171. 52 53 11. AP L. Spreading Depression of Activity in the Cerebral Cortex. Journal of 54 55 neurophysiology. 1944;7:359390. 56 57 58 59 60 17

Headache Page 18 of 38

1 2 3 12. BurgosVega C, Moy J, Dussor G. Meningeal afferent signaling and the pathophysiology 4 5 6 of migraine. Progress in molecular biology and translational science. 2015;131:537564. 7 8 13. EikermannHaerter K, Kudo C, Moskowitz MA. Cortical spreading depression and 9 10 estrogen. Headache. 2007;47 Suppl 2:S7985. 11 12 14. Hadjikhani N, Sanchez Del Rio M, Wu O, et al. Mechanisms of migraine aura revealed 13 14 by functional MRI in human visual cortex. Proceedings of the National Academy of Sciences of 15 16 the United States of America. 2001;98:46874692. 17 18 For Peer Review 19 15. Lauritzen M, Dreier JP, Fabricius M, Hartings JA, Graf R, Strong AJ. Clinical relevance 20 21 of cortical spreading depression in neurological disorders: migraine, malignant stroke, 22 23 subarachnoid and intracranial hemorrhage, and traumatic brain injury. J Cereb Blood Flow 24 25 Metab. 2011;31:1735. 26 27 16. Aurora SK, Cao Y, Bowyer SM, Welch KM. The occipital cortex is hyperexcitable in 28 29 migraine: experimental evidence. Headache. 1999;39:469476. 30 31 32 17. Ayata C, Lauritzen M. Spreading Depression, Spreading Depolarizations, and the 33 34 Cerebral Vasculature. Physiol Rev. 2015;95:953993. 35 36 18. EikermannHaerter K, Dilekoz E, Kudo C, et al. Genetic and hormonal factors modulate 37 38 spreading depression and transient hemiparesis in mouse models of familial hemiplegic 39 40 migraine type 1. The Journal of clinical investigation. 2009;119:99109. 41 42 19. Ostergaard L, Dreier JP, Hadjikhani N, Jespersen SN, Dirnagl U, Dalkara T. 43 44 45 Neurovascular coupling during cortical spreading depolarization and depression. Stroke; a 46 47 journal of cerebral circulation. 2015;46:13921401. 48 49 20. Sacco S, Ricci S, Degan D, Carolei A. Migraine in women: the role of hormones and 50 51 their impact on vascular diseases. J Headache Pain. 2012;13:177189. 52 53 21. Martin VT, Behbehani M. Ovarian hormones and migraine headache: understanding 54 55 mechanisms and pathogenesispart I. Headache. 2006;46:323. 56 57 58 59 60 18

Page 19 of 38 Headache

1 2 3 22. Silberstein SD. Headache and female hormones: what you need to know. Curr Opin 4 5 6 Neurol. 2001;14:323333. 7 8 23. Aegidius KL, Zwart JA, Hagen K, Schei B, Stovner LJ. Hormone replacement therapy 9 10 and headache prevalence in postmenopausal women. The HeadHUNT study. Eur J Neurol. 11 12 2007;14:7378. 13 14 24. Chai NC, Peterlin BL, Calhoun AH. Migraine and estrogen. Curr Opin Neurol. 15 16 2014;27:315324. 17 18 For Peer Review 19 25. Martin VT, Pavlovic J, Fanning KM, Buse DC, Reed ML, Lipton RB. Perimenopause and 20 21 Menopause Are Associated With High Frequency Headache in Women With Migraine: Results 22 23 of the American Migraine Prevalence and Prevention Study. Headache. 2016. 24 25 26. Borsook D, Erpelding N, Lebel A, et al. Sex and the migraine brain. Neurobiology of 26 27 disease. 2014;68:200214. 28 29 27. Gu Q, Korach KS, Moss RL. Rapid action of 17betaestradiol on kainateinduced 30 31 32 currents in hippocampal neurons lacking intracellular estrogen receptors. Endocrinology. 33 34 1999;140:660666. 35 36 28. Razandi M, Pedram A, Greene GL, Levin ER. Cell membrane and nuclear estrogen 37 38 receptors (ERs) originate from a single transcript: studies of ERalpha and ERbeta expressed in 39 40 Chinese hamster ovary cells. Mol Endocrinol. 1999;13:307319. 41 42 29. Sachs M, Pape HC, Speckmann EJ, Gorji A. The effect of estrogen and progesterone on 43 44 45 spreading depression in rat neocortical tissues. Neurobiology of disease. 2007;25:2734. 46 47 30. Chauvel V, Schoenen J, Multon S. Influence of ovarian hormones on cortical spreading 48 49 depression and its suppression by Lkynurenine in rat. PloS one. 2013;8:e82279. 50 51 31. Chauvel V, Vamos E, Pardutz A, Vecsei L, Schoenen J, Multon S. Effect of systemic 52 53 kynurenine on cortical spreading depression and its modulation by sex hormones in rat. 54 55 Experimental neurology. 2012;236:207214. 56 57 58 59 60 19

Headache Page 20 of 38

1 2 3 32. Fioravanti B, Kasasbeh A, Edelmayer R, et al. Evaluation of cutaneous allodynia 4 5 6 following induction of cortical spreading depression in freely moving rats. Cephalalgia : an 7 8 international journal of headache. 2011;31:10901100. 9 10 33. Edelmayer RM, Vanderah TW, Majuta L, et al. Medullary pain facilitating neurons 11 12 mediate allodynia in headacherelated pain. Annals of neurology. 2009;65:184193. 13 14 34. Edelmayer RM, Le LN, Yan J, et al. Activation of TRPA1 on dural afferents: a potential 15 16 mechanism of headache pain. Pain. 2012;153:19491958. 17 18 For Peer Review 19 35. Lam KK, Hu CT, Ou TY, Yen MH, Chen HI. Effects of oestrogen replacement on steady 20 21 and pulsatile haemodynamics in ovariectomized rats. British journal of pharmacology. 22 23 2002;136:811818. 24 25 36. Goldman JM, Murr AS, Cooper RL. The rodent estrous cycle: characterization of vaginal 26 27 cytology and its utility in toxicological studies. Birth defects research Part B, Developmental and 28 29 reproductive toxicology. 2007;80:8497. 30 31 32 37. Vermeer LM, Gregory E, Winter MK, McCarson KE, Berman NE. Behavioral effects and 33 34 mechanisms of migraine pathogenesis following estradiol exposure in a multibehavioral model 35 36 of migraine in rat. Experimental neurology. 2015;263:816. 37 38 38. Becker JB, Arnold AP, Berkley KJ, et al. Strategies and methods for research on sex 39 40 differences in brain and behavior. Endocrinology. 2005;146:16501673. 41 42 39. Matson DJ, Broom DC, Cortright DN. Locomotor activity in a novel environment as a test 43 44 45 of inflammatory pain in rats. Methods in molecular biology. 2010;617:6778. 46 47 40. Stucky NL, Gregory E, Winter MK, et al. Sex differences in behavior and expression of 48 49 CGRPrelated genes in a rodent model of chronic migraine. Headache. 2011;51:674692. 50 51 41. Wallace VC, Blackbeard J, Segerdahl AR, et al. Characterization of rodent models of 52 53 HIVgp120 and antiretroviralassociated neuropathic pain. Brain : a journal of neurology. 54 55 2007;130:26882702. 56 57 58 59 60 20

Page 21 of 38 Headache

1 2 3 42. Russell MB, Rasmussen BK, Thorvaldsen P, Olesen J. Prevalence and sexratio of the 4 5 6 subtypes of migraine. International journal of epidemiology. 1995;24:612618. 7 8 43. Burstein R, Noseda R, Borsook D. Migraine: multiple processes, complex 9 10 pathophysiology. J Neurosci. 2015;35:66196629. 11 12 44. Faria V, Erpelding N, Lebel A, et al. The migraine brain in transition: girls vs boys. Pain. 13 14 2015;156:22122221. 15 16 45. Jhingran P, Davis SM, LaVange LM, Miller DW, Helms RW. MSQ: MigraineSpecific 17 18 For Peer Review 19 QualityofLife Questionnaire. Further investigation of the factor structure. Pharmacoeconomics. 20 21 1998;13:707717. 22 23 46. Ruau D, Liu LY, Clark JD, Angst MS, Butte AJ. Sex differences in reported pain across 24 25 11,000 patients captured in electronic medical records. The journal of pain : official journal of the 26 27 American Pain Society. 2012;13:228234. 28 29 47. Epstein MT, Hockaday JM, Hockaday TD. Migraine and reporoductive hormones 30 31 32 throughout the menstrual cycle. Lancet. 1975;1:543548. 33 34 48. Misakian AL, Langer RD, Bensenor IM, et al. Postmenopausal hormone therapy and 35 36 migraine headache. Journal of women's health. 2003;12:10271036. 37 38 49. MacGregor EA. Estrogen replacement and migraine. Maturitas. 2009;63:5155. 39 40 50. Somerville BW. The role of estradiol withdrawal in the etiology of menstrual migraine. 41 42 Neurology. 1972;22:355365. 43 44 45 51. Edelman AB, Cherala G, Munar MY, McInnis M, Stanczyk FZ, Jensen JT. Correcting 46 47 oral contraceptive pharmacokinetic alterations due to obesity: a randomized controlled trial. 48 49 Contraception. 2014;90:550556. 50 51 52. Cawello W, Rosenkranz B, Schmid B, Wierich W. Pharmacodynamic and 52 53 pharmacokinetic evaluation of coadministration of lacosamide and an oral contraceptive 54 55 (levonorgestrel plus ethinylestradiol) in healthy female volunteers. Epilepsia. 2013;54:530536. 56 57 58 59 60 21

Headache Page 22 of 38

1 2 3 53. Edelman AB, Cherala G, Munar MY, et al. Prolonged monitoring of ethinyl estradiol and 4 5 6 levonorgestrel levels confirms an altered pharmacokinetic profile in obese oral contraceptives 7 8 users. Contraception. 2013;87:220226. 9 10 54. MacGregor EA. Migraine and use of combined hormonal contraceptives: a clinical 11 12 review. J Fam Plann Reprod Health Care. 2007;33:159169. 13 14 55. Aegidius K, Zwart JA, Hagen K, Schei B, Stovner LJ. Oral contraceptives and increased 15 16 headache prevalence: the HeadHUNT Study. Neurology. 2006;66:349353. 17 18 For Peer Review 19 56. Brandes JL. The influence of estrogen on migraine: a systematic review. Jama. 20 21 2006;295:18241830. 22 23 57. Bowyer SM, Aurora KS, Moran JE, Tepley N, Welch KM. Magnetoencephalographic 24 25 fields from patients with spontaneous and induced migraine aura. Annals of neurology. 26 27 2001;50:582587. 28 29 58. An G, Li W, Yan T, Li S. Estrogen rapidly enhances incisional pain of ovariectomized 30 31 32 rats primarily through the G proteincoupled estrogen receptor. International journal of molecular 33 34 sciences. 2014;15:1047910491. 35 36 59. Fan XL, Duan XB, Chen ZH, Li M, Xu JS, Ding GM. Lack of estrogen downregulates 37 38 CXCR4 expression on Treg cells and reduces Treg cell population in bone marrow in OVX 39 40 mice. Cell Mol Biol (Noisy-le-grand). 2015;61:1317. 41 42 60. Zeng QM, Liu DC, Zhang XC, et al. Estrogen deficiency inducing shifted cytokines profile 43 44 45 in bone marrow stromal cells inhibits Treg cells function in OVX mice. Cell Mol Biol (Noisy-le- 46 47 grand). 2015;61:6468. 48 49 61. Boes T, Levy D. Influence of sex, estrous cycle, and estrogen on intracranial dural mast 50 51 cells. Cephalalgia : an international journal of headache. 2012;32:924931. 52 53 62. Greco R, Tassorelli C, Mangione AS, et al. Effect of sex and estrogens on neuronal 54 55 activation in an animal model of migraine. Headache. 2013;53:288296. 56 57 58 59 60 22

Page 23 of 38 Headache

1 2 3 63. Fenzi F, Rizzzuto N. Estrogen receptors localization in the spinal trigeminal nucleus: an 4 5 6 immunohistochemical study in humans. European journal of pain. 2011;15:10021007. 7 8 64. Puri J, Bellinger LL, Kramer PR. Estrogen in cycling rats alters gene expression in the 9 10 temporomandibular joint, trigeminal ganglia and trigeminal subnucleus caudalis/upper cervical 11 12 cord junction. Journal of cellular physiology. 2011;226:31693180. 13 14 65. Vanderhorst VG, Terasawa E, Ralston HJ, 3rd. Estrogen receptoralpha immunoreactive 15 16 neurons in the brainstem and spinal cord of the female rhesus monkey: speciesspecific 17 18 For Peer Review 19 characteristics. Neuroscience. 2009;158:798810. 20 21 66. Wang MW, Kumar U, Dong XD, Cairns BE. Expression of NMDA and oestrogen 22 23 receptors by trigeminal ganglion neurons that innervate the rat temporalis muscle. The Chinese 24 25 journal of dental research : the official journal of the Scientific Section of the Chinese 26 27 Stomatological Association (CSA). 2012;15:8997. 28 29 67. Spary EJ, Chapman SE, Sinfield JK, Maqbool A, Kaye J, Batten TF. Novel G protein 30 31 32 coupled oestrogen receptor GPR30 shows changes in mRNA expression in the rat brain over 33 34 the oestrous cycle. Neuro-Signals. 2013;21:1427. 35 36 68. Mohamed MK, AbdelRahman AA. Effect of longterm ovariectomy and estrogen 37 38 replacement on the expression of estrogen receptor gene in female rats. European journal of 39 40 endocrinology / European Federation of Endocrine Societies. 2000;142:307314. 41 42 69. Liverman CS, Brown JW, Sandhir R, McCarson KE, Berman NE. Role of the oestrogen 43 44 45 receptors GPR30 and ERalpha in peripheral sensitization: relevance to trigeminal pain disorders 46 47 in women. Cephalalgia : an international journal of headache. 2009;29:729741. 48 49 70. Gilmore B, Michael M. Treatment of acute migraine headache. American family 50 51 physician. 2011;83:271280. 52 53 71. Humphrey PP, Feniuk W, Perren MJ, Beresford IJ, Skingle M, Whalley ET. Serotonin 54 55 and migraine. Ann N Y Acad Sci. 1990;600:587598; discussion 598600. 56 57 58 59 60 23

Headache Page 24 of 38

1 2 3 72. Smitherman TA, Burch R, Sheikh H, Loder E. The prevalence, impact, and treatment of 4 5 6 migraine and severe headaches in the United States: a review of statistics from national 7 8 surveillance studies. Headache. 2013;53:427436. 9 10 73. Thorlund K, Mills EJ, Wu P, et al. Comparative efficacy of triptans for the abortive 11 12 treatment of migraine: A multiple treatment comparison metaanalysis. Cephalalgia : an 13 14 international journal of headache. 2014;34:258267. 15 16 74. Bradley DP, Smith MI, Netsiri C, et al. Diffusionweighted MRI used to detect in vivo 17 18 For Peer Review 19 modulation of cortical spreading depression: comparison of sumatriptan and tonabersat. Exp 20 21 Neurol. 2001;172:342353. 22 23 75. Read SJ, Hirst WD, Upton N, Parsons AA. Cortical spreading depression produces 24 25 increased cGMP levels in cortex and brain stem that is inhibited by tonabersat (SB220453) but 26 27 not sumatriptan. Brain Res. 2001;891:6977. 28 29 76. RendasBaum R, Bloudek LM, Maglinte GA, Varon SF. The psychometric properties of 30 31 32 the MigraineSpecific Quality of Life Questionnaire version 2.1 (MSQ) in chronic migraine 33 34 patients. Qual Life Res. 2013;22:11231133. 35 36 77. Kim SY, Park SP. The role of headache chronicity among predictors contributing to 37 38 quality of life in patients with migraine: a hospitalbased study. J Headache Pain. 2014;15:68. 39 40 78. Bigal ME, Krymchantowski AV, Ho T. Migraine in the triptan era: progresses achieved, 41 42 lessons learned and future developments. Arquivos de neuro-psiquiatria. 2009;67:559569. 43 44 45 79. Bigal ME, Lipton RB. Excessive acute migraine medication use and migraine 46 47 progression. Neurology. 2008;71:18211828. 48 49 80. Martelletti P. The therapeutic armamentarium in migraine is quite elderly. Expert opinion 50 51 on drug metabolism & toxicology. 2015;11:175177. 52 53 81. Stricker R, Eberhart R, Chevailler MC, Quinn FA, Bischof P, Stricker R. Establishment of 54 55 detailed reference values for luteinizing hormone, follicle stimulating hormone, estradiol, and 56 57 58 59 60 24

Page 25 of 38 Headache

1 2 3 progesterone during different phases of the menstrual cycle on the Abbott ARCHITECT 4 5 6 analyzer. Clin Chem Lab Med. 2006;44:883887. 7 8 82. Mishell DR, Jr., Thorneycroft IH, Nakamura RM, Nagata Y, Stone SC. Serum estradiol in 9 10 women ingesting combination oral contraceptive steroids. Am J Obstet Gynecol. 1972;114:923 11 12 928. 13 14 15 16 17 18 For Peer Review 19 20

21 22 23 24 25 26 27 28 29 30 31 32 33

34 35 36 37 38 39 40 41 42 43 44 45 46

47 48 49 50 51 52 53 54 55 56 57 58 59 60 25

Page 33 of 38 Headache

1 2 3 Table 1. Serum estradiol levels in intact and OVX animals following i.p. administration of 17β 4 5 6 estradiol (180g/kg) or vehicle 7 8 9 Surgery Treatment BL 30 min 2 h 4 h 6 h 12 h 24 h 10 11 10.24 ± 8.16 ± 11.84 ± 12 Vehicle 8.72 ± 2.64 9.12 ± 2.92 8.26 ± 2.39 13 4.58 3.75 5.19 14 Intact 3.53 ± 0.76 15 16 203.77 ± 103.51 ± 57.63 ± 3.29 ± 17 17β >300.00 >300.00 18 For Peer Review50.29 36.74 43.83 0.01 19 20 2.30 ± 2.11 ± 2.46 ± 2.71 ± 1.99 ± 2.61 ± 21 Vehicle 22 0.15 0.02 0.29 0.32 0.04 0.17 23 24 OVX 2.57 ± 0.32 25 204.45 ± 157.08 ± 164.05 ± 8.40 ± 4.07 ± 26 17β >300.00 27 95.55 77.78 48.58 2.5 0.48 28 29 30 Data are presented as mean ± SEM (pg/mL) 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Headache Page 34 of 38

1 2 3 Table 2. CSD characteristics amongst groups 4 5 6 Speed of 7 % animals Amplitude Surgery Group propagation Duration (s) 8 with CSD (mV) 9 (mm/min) 10 1/8 11 Vehicle 7.70 1.05 43.00 12 (12.5%) 13 Intact 14 0/7 17β N/A N/A N/A 15 (0.0%) 16 17 1/10 Vehicle 7.70 2.64 118.00 18 For (10.0%)Peer Review 19 20 6/10 17β 11.90 ± 1.79 1.27 ± 0.09 62.20 ± 8.80 21 (60%) 22 23 1/6 24 ICI 18.75 2.64 118.00 25 (16.6%) 26 OVX 0/6 27 17β/ICI N/A N/A N/A 28 (0.0%) 29 0/6 30 Suma N/A N/A N/A 31 (0.0%) 32 33 0/6 17β/Suma N/A N/A N/A 34 (0.0%) 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 35 of 38 Headache

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 Figure 1. 17βestradiol administration induces CSD events in ovariectomized rats (A) Schematic timeline of 43 the procedures involved; electrode placement surgery is performed 1 week after ovariectomy and two days before dEEG recording. (B) Diagram of the electrode placement surgery. (C) A representative dEEG trace 44 displaying a CSD event with a propagation speed of 4mm/min. (D) Estrogen induced 1.4 ± 0.4 CSDs per 45 animal (n=10) in ovariectomized rats, while none were elicited in intact rats (n=7). Vehicle had no 46 significant effect on OVX (0.1 ± 0.1 CSDs/animal, n=10) or intact (0.13 ± 0.13 CSDs per animal, n=8) rats 47 over 12 hours. (E) Most CSD events were elicited during the first hour (4 CSDs) or between 79 hours (6 48 CSDs) post administration 17βestradiol in OVX rats. **p<0.005 49 50 293x307mm (300 x 300 DPI) 51 52 53 54 55 56 57 58 59 60 Headache Page 36 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 Figure 2. Pain evoked and suppressed behaviors elicited by 17βestradiol. (A) Facial withdrawal threshold 28 (FWT) is reduced by administration of 17βestradiol. Vehicle treated intact rats have a FWT of 7.85 ± 0.16 29 g (n=8), which is significantly reduced following estradiol administration (4.22 ± 1.11 g, n=8) or OVX and 30 17βestradiol administration 7 days later (3.99 ± 1.04 g, n=9). (B) Exploratory events in 30 min was not statistically significant between vehicle and 17βestradiol treated animals (82.88 ± 26.12 events and 63.75 31 ± 11.81 events respectively) (C) Ambulatory events in 30 min was not statistically significant between 32 vehicle and 17βestradiol treated animals (1098 ± 262 events and 827.3 ± 142 events respectively) (D) 33 Fine movements in 30 min was not statistically significant between vehicle and 17βestradiol treated 34 animals (238.8 ± 27.05 events and 199.8 ± 19.15 events respectively) (E) Number of rearing events in 30 35 min following 17βestradiol treatment in OVX animals (n=11) is significantly reduced compared to vehicle 36 treated intact animals (n=8). 17βestradiol treated OVX animals also exhibit significantly attenuated 37 rearing compared to OVX vehicle treated animals (n=9). (F) Rearing is significantly reduced in the first 5 38 min bin for both vehicle (n=8) and 17βestradiol (n=7) treated OVX animals compared to intact vehicle (n=8). *p<0.05, **p<0.005, ***p<0.001. 39 40 279x165mm (150 x 150 DPI) 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 37 of 38 Headache

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Figure 3. ICI 182,780For prevents estrogen Peer induced CSDReview and estrogen induced reduction in exploratory 19 behavior (A) 17βestradiol 180g/kg induces CSD events in OVX rats over 12 hours (1.4 ± 0.4 CSDs, 20 n=10) which is inhibited by ICI 182,780 10mg/kg, i.p. (0 ± 0 CSDs, n=10). (B) 17βestradiol reduction of 21 rearing behavior over 5 minutes (n=6) is inhibited by pretreatment with ICI 182,780 10mg/kg, i.p. (n=6). 22 *p<0.05; **p<0.005 23 24 370x118mm (150 x 150 DPI) 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Headache Page 38 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Figure 4. SumatriptanFor prevents estrogenPeer induced CSDReview and estrogen induced reduction in exploratory 19 behavior (A) 17βestradiol induces CSD events in 12 hours (1.4 ± 0.4 CSDs, n=10) which is inhibited by 20 sumatriptan 0.6mg/kg, i.p. (0 ± 0 CSDs, n=6) (B) 17βestradiol reduces rearing behavior over 5 minutes (n=6) which is inhibited by sumatriptan 0.6mg/kg, i.p. (n=6). *p<0.05, **p<0.005 21 22 382x117mm (150 x 150 DPI) 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

REFERENCES

1 IASP. Classification of Chronic Pain. 2nd edn, (IASP Press, Seattle, 1994). 2 Jensen, T. S. & Finnerup, N. B. A brief history of pain. Lancet Neurol 13, 872, doi:10.1016/S1474-4422(14)70187-5 (2014). 3 Medicine, I. o. Relieving Pain in America. (2011). 4 Volkow, N. D. & McLellan, A. T. Opioid Abuse in Chronic Pain - Misconceptions and Mitigation Strategies. The New England journal of medicine 374, 1253-1263, doi:10.1056/NEJMra1507771 (2016). 5 Weil, J. V., McCullough, R. E., Kline, J. S. & Sodal, I. E. Diminished ventilatory response to hypoxia and hypercapnia after morphine in normal man. The New England journal of medicine 292, 1103-1106, doi:10.1056/NEJM197505222922106 (1975). 6 Basbaum, A. I., Bautista, D. M., Scherrer, G. & Julius, D. Cellular and molecular mechanisms of pain. Cell 139, 267-284, doi:10.1016/j.cell.2009.09.028 (2009). 7 Todd, A. J. Anatomy of primary afferents and projection neurones in the rat spinal dorsal horn with particular emphasis on substance P and the neurokinin 1 receptor. Experimental physiology 87, 245-249 (2002). 8 Kew, J. N. & Kemp, J. A. Ionotropic and metabotropic glutamate receptor structure and pharmacology. Psychopharmacology 179, 4-29, doi:10.1007/s00213-005-2200-z (2005). 9 Ren, K., Hylden, J. L., Williams, G. M., Ruda, M. A. & Dubner, R. The effects of a non-competitive NMDA receptor antagonist, MK-801, on behavioral hyperalgesia and dorsal horn neuronal activity in rats with unilateral inflammation. Pain 50, 331-344 (1992). 10 Jia, H., Rustioni, A. & Valtschanoff, J. G. Metabotropic glutamate receptors in superficial laminae of the rat dorsal horn. The Journal of comparative neurology 410, 627-642 (1999). 11 Ikeda, H. & Murase, K. Glial nitric oxide-mediated long-term presynaptic facilitation revealed by optical imaging in rat spinal dorsal horn. The Journal of neuroscience : the official journal of the Society for Neuroscience 24, 9888-9896, doi:10.1523/JNEUROSCI.2608-04.2004 (2004). 12 Caterina, M. J. et al. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389, 816-824, doi:10.1038/39807 (1997). 13 Caterina, M. J., Rosen, T. A., Tominaga, M., Brake, A. J. & Julius, D. A capsaicin-receptor homologue with a high threshold for noxious heat. Nature 398, 436-441, doi:10.1038/18906 (1999). 14 Bautista, D. M. et al. The menthol receptor TRPM8 is the principal detector of environmental cold. Nature 448, 204-208, doi:10.1038/nature05910 (2007). 15 McKemy, D. D., Neuhausser, W. M. & Julius, D. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature 416, 52-58, doi:10.1038/nature719 (2002). 16 Story, G. M. et al. ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures. Cell 112, 819-829 (2003).

210

17 Cui, M., Gosu, V., Basith, S., Hong, S. & Choi, S. Polymodal Transient Receptor Potential Vanilloid Type 1 Nocisensor: Structure, Modulators, and Therapeutic Applications. Adv Protein Chem Struct Biol 104, 81-125, doi:10.1016/bs.apcsb.2015.11.005 (2016). 18 Muraki, K., Shigekawa, M. & Imaizumi, Y. in TRP Ion Channel Function in Sensory Transduction and Cellular Signaling Cascades Frontiers in Neuroscience (eds W. B. Liedtke & S. Heller) (2007). 19 Coste, B. et al. Piezo1 and Piezo2 are essential components of distinct mechanically activated cation channels. Science 330, 55-60, doi:10.1126/science.1193270 (2010). 20 Volkers, L., Mechioukhi, Y. & Coste, B. Piezo channels: from structure to function. Pflugers Arch 467, 95-99, doi:10.1007/s00424-014-1578-z (2015). 21 Bron, R., Wood, R. J., Brock, J. A. & Ivanusic, J. J. Piezo2 expression in corneal afferent neurons. The Journal of comparative neurology 522, 2967-2979, doi:10.1002/cne.23560 (2014). 22 Dubin, A. E. et al. Inflammatory signals enhance piezo2-mediated mechanosensitive currents. Cell reports 2, 511-517, doi:10.1016/j.celrep.2012.07.014 (2012). 23 Ranade, S. S. et al. Piezo2 is the major transducer of mechanical forces for touch sensation in mice. Nature 516, 121-125, doi:10.1038/nature13980 (2014). 24 Kuypers, H. G. The Descending Pathways to the Spinal Cord, Their Anatomy and Function. Progress in brain research 11, 178-202 (1964). 25 Wall, P. D. The laminar organization of dorsal horn and effects of descending impulses. The Journal of physiology 188, 403-423 (1967). 26 Basbaum, A. I., Clanton, C. H. & Fields, H. L. Opiate and stimulus-produced analgesia: functional anatomy of a medullospinal pathway. Proceedings of the National Academy of Sciences of the United States of America 73, 4685-4688 (1976). 27 Fields, H. L. & Basbaum, A. I. Brainstem control of spinal pain-transmission neurons. Annu Rev Physiol 40, 217-248, doi:10.1146/annurev.ph.40.030178.001245 (1978). 28 Fields, H. L., Bry, J., Hentall, I. & Zorman, G. The activity of neurons in the rostral medulla of the rat during withdrawal from noxious heat. The Journal of neuroscience : the official journal of the Society for Neuroscience 3, 2545-2552 (1983). 29 Gaddum, J. H. & Schild, H. Depressor substances in extracts of intestine. The Journal of physiology 83, 1-14 (1934). 30 Pernow, B. Distribution of substance P in the central and peripheral nervous system. Nature 171, 746 (1953). 31 Chang, M. M. & Leeman, S. E. Isolation of a sialogogic peptide from bovine hypothalamic tissue and its characterization as substance P. J Biol Chem 245, 4784-4790 (1970).

211

32 V. Erspamer, A. A. in Proceedings of the International Symposium: Hypotensive Peptides. (ed N Back Eg. Erdos, F Sicuteri, A Wilde) 63-75 (Springer-Verlag New York). 33 Kimura, S., Okada, M., Sugita, Y., Kanazawa, I. & Munekata, E. Novel Neuropeptides, Neurokinin-Alpha and Neurokinin-Beta Isolated from Porcine Spinal-Cord. P Jpn Acad B-Phys 59, 101-104, doi:DOI 10.2183/pjab.59.101 (1983). 34 Buck, S. H., Burcher, E., Shults, C. W., Lovenberg, W. & O'Donohue, T. L. Novel pharmacology of substance K-binding sites: a third type of tachykinin receptor. Science 226, 987-989 (1984). 35 Burcher, E., Shults, C. W., Buck, S. H., Chase, T. N. & O'Donohue, T. L. Autoradiographic distribution of substance K binding sites in rat gastrointestinal tract: a comparison with substance P. European journal of pharmacology 102, 561-562 (1984). 36 Maggi, C. A., Giuliani, S., Santicioli, P., Regoli, D. & Meli, A. Peripheral effects of neurokinins: functional evidence for the existence of multiple receptors. J Auton Pharmacol 7, 11-32 (1987). 37 International Substance P Symposium. Dublin, April 27-29, 1983. Abstracts. Ir J Med Sci 152 Suppl 1, 11-70 (1983). 38 Henry, J. L. in Proceedings of "Substance P and Neurokinins-Montreal '86" A Satellite Symposium of the XXX International Congress of The International Union of Physiological Sciences. (ed R. Couture J.L Henry, A.C. Cuello, G. Pelletier, R. Quirion, D. Regoli) xvii (Springer-Verlag). 39 Regoli, D., Drapeau, G., Dion, S. & D'Orleans-Juste, P. Pharmacological receptors for substance P and neurokinins. Life Sci 40, 109-117 (1987). 40 Hanley, M. R., Lee, C. M., Michell, R. H. & Jones, L. M. Similar effects of substance P and related peptides on salivation and on phosphatidylinositol turnover in rat salivary glands. Molecular pharmacology 18, 78-83 (1980). 41 Watson, S. P. & Downes, C. P. Substance P induced hydrolysis of inositol phospholipids in guinea-pig ileum and rat hypothalamus. European journal of pharmacology 93, 245-253 (1983). 42 Mantyh, P. W., Pinnock, R. D., Downes, C. P., Goedert, M. & Hunt, S. P. Correlation between inositol phospholipid hydrolysis and substance P receptors in rat CNS. Nature 309, 795-797 (1984). 43 Mantyh, P. W. et al. Rapid endocytosis of a G protein-coupled receptor: substance P evoked internalization of its receptor in the rat striatum in vivo. Proceedings of the National Academy of Sciences of the United States of America 92, 2622-2626 (1995). 44 Roosterman, D. et al. Endothelin-converting enzyme 1 degrades neuropeptides in endosomes to control receptor recycling. Proceedings of the National Academy of Sciences of the United States of America 104, 11838-11843, doi:10.1073/pnas.0701910104 (2007). 45 Pelayo, J. C., Poole, D. P., Steinhoff, M., Cottrell, G. S. & Bunnett, N. W. Endothelin-converting enzyme-1 regulates trafficking and signalling of the

212

neurokinin 1 receptor in endosomes of myenteric neurones. The Journal of physiology 589, 5213-5230, doi:10.1113/jphysiol.2011.214452 (2011). 46 Jensen, D. D. et al. Endothelin-converting enzyme 1 and beta-arrestins exert spatiotemporal control of substance P-induced inflammatory signals. J Biol Chem 289, 20283-20294, doi:10.1074/jbc.M114.578179 (2014). 47 Berger, H., Fechner, K., Albrecht, E. & Niedrich, H. Substance P: in vitro inactivation by rat brain fractions and human plasma. Biochemical pharmacology 28, 3173-3180 (1979). 48 Benuck, M. & Marks, N. Enzymatic inactivation of substance P by a partially purified enzyme from rat brain. Biochemical and biophysical research communications 65, 153-160 (1975). 49 Gao, X. P. & Rubinstein, I. Neutral endopeptidase modulates substance P-induced vasodilation in vivo. Journal of applied physiology 78, 562-568 (1995). 50 Dalzell, J. R. et al. Effects of neutral endopeptidase (neprilysin) inhibition on the response to other vasoactive peptides in small human resistance arteries: studies with thiorphan and omapatrilat. Cardiovasc Ther 32, 13-18, doi:10.1111/1755- 5922.12053 (2014). 51 Steinhoff, M. S., von Mentzer, B., Geppetti, P., Pothoulakis, C. & Bunnett, N. W. Tachykinins and their receptors: contributions to physiological control and the mechanisms of disease. Physiol Rev 94, 265-301, doi:10.1152/physrev.00031.2013 (2014). 52 Lu, B. et al. Peptide neurotransmitters activate a cation channel complex of NALCN and UNC-80. Nature 457, 741-744, doi:10.1038/nature07579 (2009). 53 Xia, Y. F., Margolis, E. B. & Hjelmstad, G. O. Substance P inhibits GABAB receptor signalling in the ventral tegmental area. The Journal of physiology 588, 1541-1549, doi:10.1113/jphysiol.2010.188367 (2010). 54 Koike-Tani, M. et al. Signal transduction pathway for the substance P-induced inhibition of rat Kir3 (GIRK) channel. The Journal of physiology 564, 489-500, doi:10.1113/jphysiol.2004.079285 (2005). 55 Iversen, L. in The History of Neuroscience in Autobiography Vol. 6 (ed Larry R. Squire) 190-225 (Oxford University Press, 2009). 56 Snider, R. M. et al. A potent nonpeptide antagonist of the substance P (NK1) receptor. Science 251, 435-437 (1991). 57 McLean, S. et al. Activity and distribution of binding sites in brain of a nonpeptide substance P (NK1) receptor antagonist. Science 251, 437-439 (1991). 58 Kramer, M. S. et al. Distinct mechanism for antidepressant activity by blockade of central substance P receptors. Science 281, 1640-1645 (1998). 59 Hill, R. NK1 (substance P) receptor antagonists--why are they not analgesic in humans? Trends in pharmacological sciences 21, 244-246 (2000). 60 Gasparovic, I., Hadzovic, S., Hukovic, S. & Stern, P. Contribution to the Theory That Substance P Has a Transmitter Role in Sensitive Pathway. Med Exp Int J Exp Med 10, 303-306 (1964).

213

61 Zetler, G. [Substance P, a polypeptide from the intestine and the brain, with depressive, hyperalgesic and morphine antagonist effects on CNS]. Naunyn Schmiedebergs Arch Exp Pathol Pharmakol 228, 513-538 (1956). 62 Potter, G. D., Guzman, F. & Lim, R. K. Visceral pain evoked by intra-arterial injection of substance P. Nature 193, 983-984 (1962). 63 Seybold, V. S., Hylden, J. L. & Wilcox, G. L. Intrathecal substance P and somatostatin in rats: behaviors indicative of sensation. Peptides 3, 49-54 (1982). 64 Pearson, J., Brandeis, L. & Cuello, A. C. Depletion of substance P-containing axons in substantia gelatinosa of patients with diminished pain sensitivity. Nature 295, 61-63 (1982). 65 Henry, J. L. Effects of substance P on functionally identified units in cat spinal cord. Brain research 114, 439-451 (1976). 66 Marvizon, J. C., Eskandari, S., Ennes, H. S. & Mayer, E. A. Substance P induces brief, localized increase in [Ca2+]i in dorsal horn neurons. Neuroreport 9, 3369- 3374 (1998). 67 Nilsson, G., Hokfelt, T. & Pernow, B. Distribution of substance P-like immunoreactivity in the rat central nervous system as revealed by immunohistochemistry. Med Biol 52, 424-427 (1974). 68 Hokfelt, T., Kellerth, J. O., Nilsson, G. & Pernow, B. Substance p: localization in the central nervous system and in some primary sensory neurons. Science 190, 889-890 (1975). 69 Cuello, A. C., Polak, J. M. & Pearse, A. G. Substance P: a naturally occurring transmitter in human spinal cord. Lancet 2, 1054-1056 (1976). 70 Hokfelt, T., Kellerth, J. O., Nilsson, G. & Pernow, B. Experimental immunohistochemical studies on the localization and distribution of substance P in cat primary sensory neurons. Brain research 100, 235-252 (1975). 71 Lembeck, F. & Gamse, R. Lack of algesic effect of substance P on paravascular pain receptors. Naunyn-Schmiedeberg's archives of pharmacology 299, 295-303 (1977). 72 Schenker, C., Mroz, E. A. & Leeman, S. E. Release of substance P from isolated nerve endings. Nature 264, 790-792 (1976). 73 Cuello, A. C., Jessell, T. M., Kanazawa, I. & Iversen, L. L. Substance P: localization in synaptic vesicles in rat central nervous system. Journal of neurochemistry 29, 747-751 (1977). 74 Lembeck, F., Mayer, N. & Schindler, G. Substance P in rat brain synaptosomes. Naunyn-Schmiedeberg's archives of pharmacology 301, 17-22 (1977). 75 Pickel, V. M., Reis, D. J. & Leeman, S. E. Ultrastructural localization of substance P in neurons of rat spinal cord. Brain research 122, 534-540 (1977). 76 Barber, R. P. et al. The origin, distribution and synaptic relationships of substance P axons in rat spinal cord. The Journal of comparative neurology 184, 331-351, doi:10.1002/cne.901840208 (1979). 77 Mantyh, P. W. et al. Receptor endocytosis and dendrite reshaping in spinal neurons after somatosensory stimulation. Science 268, 1629-1632 (1995).

214

78 Allen, B. J. et al. Noxious cutaneous thermal stimuli induce a graded release of endogenous substance P in the spinal cord: imaging peptide action in vivo. The Journal of neuroscience : the official journal of the Society for Neuroscience 17, 5921-5927 (1997). 79 Wang, X. & Marvizon, J. C. Time-course of the internalization and recycling of neurokinin 1 receptors in rat dorsal horn neurons. Brain research 944, 239-247 (2002). 80 Trafton, J. A., Abbadie, C. & Basbaum, A. I. Differential contribution of substance P and neurokinin A to spinal cord neurokinin-1 receptor signaling in the rat. The Journal of neuroscience : the official journal of the Society for Neuroscience 21, 3656-3664 (2001). 81 Gamse, R., Molnar, A. & Lembeck, F. Substance P release from spinal cord slices by capsaicin. Life Sci 25, 629-636 (1979). 82 Theriault, E., Otsuka, M. & Jessell, T. Capsaicin-evoked release of substance P from primary sensory neurons. Brain research 170, 209-213 (1979). 83 Gamse, R., Holzer, P. & Lembeck, F. Decrease of substance P in primary afferent neurones and impairment of neurogenic plasma extravasation by capsaicin. British journal of pharmacology 68, 207-213 (1980). 84 Yaksh, T. L., Farb, D. H., Leeman, S. E. & Jessell, T. M. Intrathecal capsaicin depletes substance P in the rat spinal cord and produces prolonged thermal analgesia. Science 206, 481-483 (1979). 85 Yaksh, T. L., Jessell, T. M., Gamse, R., Mudge, A. W. & Leeman, S. E. Intrathecal morphine inhibits substance P release from mammalian spinal cord in vivo. Nature 286, 155-157 (1980). 86 Go, V. L. & Yaksh, T. L. Release of substance P from the cat spinal cord. The Journal of physiology 391, 141-167 (1987). 87 Lembeck, F. & Holzer, P. Substance P as neurogenic mediator of antidromic vasodilation and neurogenic plasma extravasation. Naunyn-Schmiedeberg's archives of pharmacology 310, 175-183 (1979). 88 Erjavec, F. et al. Release of histamine by substance P. Naunyn-Schmiedeberg's archives of pharmacology 317, 67-70 (1981). 89 Lembeck, F. & Gamse, R. Substance P in peripheral sensory processes. Ciba Found Symp, 35-54 (1982). 90 Helme, R. D., Koschorke, G. M. & Zimmermann, M. Immunoreactive substance P release from skin nerves in the rat by noxious thermal stimulation. Neuroscience letters 63, 295-299 (1986). 91 Carlton, S. M., Zhou, S. & Coggeshall, R. E. Localization and activation of substance P receptors in unmyelinated axons of rat glabrous skin. Brain research 734, 103-108 (1996). 92 Maggi, C. A. Tachykinins as peripheral modulators of primary afferent nerves and visceral sensitivity. Pharmacol Res 36, 153-169, doi:10.1006/phrs.1997.0219 (1997).

215

93 Lecci, A., Giuliani, S., Tramontana, M., Carini, F. & Maggi, C. A. Peripheral actions of tachykinins. Neuropeptides 34, 303-313, doi:10.1054/npep.2000.0825 (2000). 94 Hartung, H. P. & Toyka, K. V. Substance P, the immune system and inflammation. Int Rev Immunol 4, 229-249 (1989). 95 Hartung, H. P., Wolters, K. & Toyka, K. V. Substance P: binding properties and studies on cellular responses in guinea pig macrophages. Journal of immunology 136, 3856-3863 (1986). 96 Kimball, E. S., Persico, F. J. & Vaught, J. L. Neurokinin-induced generation of interleukin-1 in a macrophage cell line. Annals of the New York Academy of Sciences 540, 688-690 (1988). 97 Hartung, H. P. & Toyka, K. V. Activation of macrophages by substance P: induction of oxidative burst and thromboxane release. European journal of pharmacology 89, 301-305 (1983). 98 Ruff, M. R., Wahl, S. M. & Pert, C. B. Substance P receptor-mediated chemotaxis of human monocytes. Peptides 6 Suppl 2, 107-111 (1985). 99 Foreman, J. C., Jordan, C. C. & Piotrowski, W. Interaction of neurotensin with the substance P receptor mediating histamine release from rat mast cells and the flare in human skin. British journal of pharmacology 77, 531-539 (1982). 100 Greeno, E. W., Mantyh, P., Vercellotti, G. M. & Moldow, C. F. Functional neurokinin 1 receptors for substance P are expressed by human vascular endothelium. J Exp Med 177, 1269-1276 (1993). 101 Stewart-Lee, A. & Burnstock, G. Actions of tachykinins on the rabbit mesenteric artery: substance P and [Glp6,L-Pro9]SP6-11 are potent agonists for endothelial neurokinin-1 receptors. British journal of pharmacology 97, 1218-1224 (1989). 102 Hua, X., Lundberg, J. M., Theodorsson-Norheim, E. & Brodin, E. Comparison of cardiovascular and bronchoconstrictor effects of substance P, substance K and other tachykinins. Naunyn-Schmiedeberg's archives of pharmacology 328, 196- 201 (1984). 103 Lundberg, J. M. et al. Neuropeptides with vascular activity: VIP, PHI, NPY and substance P. Bibl Cardiol, 60-69 (1984). 104 Lundberg, J. M., Brodin, E., Hua, X. & Saria, A. Vascular permeability changes and smooth muscle contraction in relation to capsaicin-sensitive substance P afferents in the guinea-pig. Acta Physiol Scand 120, 217-227, doi:10.1111/j.1748- 1716.1984.tb00127.x (1984). 105 Ruocco, I., Cuello, A. C., Shigemoto, R. & Ribeiro-da-Silva, A. Light and electron microscopic study of the distribution of substance P-immunoreactive fibers and neurokinin-1 receptors in the skin of the rat lower lip. The Journal of comparative neurology 432, 466-480 (2001). 106 Baluk, P. et al. Endothelial gaps: time course of formation and closure in inflamed venules of rats. Am J Physiol 272, L155-170 (1997). 107 De Biasi, S. & Rustioni, A. Glutamate and substance P coexist in primary afferent terminals in the superficial laminae of spinal cord. Proceedings of the National Academy of Sciences of the United States of America 85, 7820-7824 (1988).

216

108 Juranek, I. & Lembeck, F. Afferent C-fibres release substance P and glutamate. Can J Physiol Pharmacol 75, 661-664 (1997). 109 Duggan, A. W., Riley, R. C., Mark, M. A., MacMillan, S. J. & Schaible, H. G. Afferent volley patterns and the spinal release of immunoreactive substance P in the dorsal horn of the anaesthetized spinal cat. Neuroscience 65, 849-858 (1995). 110 Cao, Y. Q. et al. Primary afferent tachykinins are required to experience moderate to intense pain. Nature 392, 390-394, doi:10.1038/32897 (1998). 111 De Felipe, C. et al. Altered nociception, analgesia and aggression in mice lacking the receptor for substance P. Nature 392, 394-397, doi:10.1038/32904 (1998). 112 Zimmer, A. et al. Hypoalgesia in mice with a targeted deletion of the tachykinin 1 gene. Proceedings of the National Academy of Sciences of the United States of America 95, 2630-2635 (1998). 113 Li, J. L. et al. Substance P receptor (NK1)-immunoreactive neurons projecting to the periaqueductal gray: distribution in the spinal trigeminal nucleus and the spinal cord of the rat. Neuroscience research 30, 219-225 (1998). 114 Liu, R. P. & Swenberg, M. L. Autoradiographic localization of substance P ligand binding sites and distribution of immunoreactive neurons in the periaqueductal gray of the rat. Brain research 475, 73-79 (1988). 115 Rosen, A., Zhang, Y. X., Lund, I., Lundeberg, T. & Yu, L. C. Substance P microinjected into the periaqueductal gray matter induces antinociception and is released following morphine administration. Brain research 1001, 87-94, doi:10.1016/j.brainres.2003.11.060 (2004). 116 Barbaresi, P. Immunocytochemical localization of substance P receptor in rat periaqueductal gray matter: a light and electron microscopic study. The Journal of comparative neurology 398, 473-490 (1998). 117 Heinricher, M. M., Tavares, I., Leith, J. L. & Lumb, B. M. Descending control of nociception: Specificity, recruitment and plasticity. Brain research reviews 60, 214-225, doi:10.1016/j.brainresrev.2008.12.009 (2009). 118 Budai, D., Khasabov, S. G., Mantyh, P. W. & Simone, D. A. NK-1 receptors modulate the excitability of ON cells in the rostral ventromedial medulla. Journal of neurophysiology 97, 1388-1395, doi:10.1152/jn.00450.2006 (2007). 119 Pacharinsak, C., Khasabov, S. G., Beitz, A. J. & Simone, D. A. NK-1 receptors in the rostral ventromedial medulla contribute to hyperalgesia produced by intraplantar injection of capsaicin. Pain 139, 34-46, doi:10.1016/j.pain.2008.02.032 (2008). 120 Nakamura-Craig, M. & Smith, T. W. Substance P and peripheral inflammatory hyperalgesia. Pain 38, 91-98 (1989). 121 Hua, X. Y., Chen, P., Marsala, M. & Yaksh, T. L. Intrathecal substance P-induced thermal hyperalgesia and spinal release of prostaglandin E2 and amino acids. Neuroscience 89, 525-534 (1999). 122 Wajima, Z., Hua, X. Y. & Yaksh, T. L. Inhibition of spinal protein kinase C blocks substance P-mediated hyperalgesia. Brain research 877, 314-321 (2000).

217

123 Schafer, M. K., Nohr, D., Krause, J. E. & Weihe, E. Inflammation-induced upregulation of NK1 receptor mRNA in dorsal horn neurones. Neuroreport 4, 1007-1010 (1993). 124 Abbadie, C., Brown, J. L., Mantyh, P. W. & Basbaum, A. I. Spinal cord substance P receptor immunoreactivity increases in both inflammatory and nerve injury models of persistent pain. Neuroscience 70, 201-209 (1996). 125 Goff, J. R., Burkey, A. R., Goff, D. J. & Jasmin, L. Reorganization of the spinal dorsal horn in models of chronic pain: correlation with behaviour. Neuroscience 82, 559-574 (1998). 126 Abbadie, C., Trafton, J., Liu, H., Mantyh, P. W. & Basbaum, A. I. Inflammation increases the distribution of dorsal horn neurons that internalize the neurokinin-1 receptor in response to noxious and non-noxious stimulation. The Journal of neuroscience : the official journal of the Society for Neuroscience 17, 8049-8060 (1997). 127 Kidd, B. L. et al. Inhibition of inflammation and hyperalgesia in NK-1 receptor knock-out mice. Neuroreport 14, 2189-2192, doi:10.1097/01.wnr.0000097046.56589.ea (2003). 128 McCarson, K. E. & Krause, J. E. NK-1 and NK-3 type tachykinin receptor mRNA expression in the rat spinal cord dorsal horn is increased during adjuvant or formalin-induced nociception. The Journal of neuroscience : the official journal of the Society for Neuroscience 14, 712-720 (1994). 129 Neumann, S., Doubell, T. P., Leslie, T. & Woolf, C. J. Inflammatory pain hypersensitivity mediated by phenotypic switch in myelinated primary sensory neurons. Nature 384, 360-364, doi:10.1038/384360a0 (1996). 130 Otten, U., Goedert, M., Mayer, N. & Lembeck, F. Requirement of nerve growth factor for development of substance P-containing sensory neurones. Nature 287, 158-159 (1980). 131 Woolf, C. J., Safieh-Garabedian, B., Ma, Q. P., Crilly, P. & Winter, J. Nerve growth factor contributes to the generation of inflammatory sensory hypersensitivity. Neuroscience 62, 327-331 (1994). 132 Donnerer, J., Schuligoi, R. & Stein, C. Increased content and transport of substance P and calcitonin gene-related peptide in sensory nerves innervating inflamed tissue: evidence for a regulatory function of nerve growth factor in vivo. Neuroscience 49, 693-698 (1992). 133 Leslie, T. A., Emson, P. C., Dowd, P. M. & Woolf, C. J. Nerve growth factor contributes to the up-regulation of growth-associated protein 43 and preprotachykinin A messenger RNAs in primary sensory neurons following peripheral inflammation. Neuroscience 67, 753-761 (1995). 134 Mansikka, H. et al. Nerve injury-induced mechanical but not thermal hyperalgesia is attenuated in neurokinin-1 receptor knockout mice. Experimental neurology 162, 343-349, doi:10.1006/exnr.1999.7336 (2000). 135 Kuwahara, H. et al. Behavioural effects of intrathecally injected tachykinins in rats with peripheral nerve transection. Naunyn-Schmiedeberg's archives of pharmacology 336, 656-660 (1987).

218

136 Malmberg, A. B., Chen, C., Tonegawa, S. & Basbaum, A. I. Preserved acute pain and reduced neuropathic pain in mice lacking PKCgamma. Science 278, 279-283 (1997). 137 Taylor, B. K. & McCarson, K. E. Neurokinin-1 receptor gene expression in the mouse dorsal horn increases with neuropathic pain. The journal of pain : official journal of the American Pain Society 5, 71-76, doi:10.1016/j.jpain.2003.11.003 (2004). 138 Cahill, C. M. & Coderre, T. J. Attenuation of hyperalgesia in a rat model of neuropathic pain after intrathecal pre- or post-treatment with a neurokinin-1 antagonist. Pain 95, 277-285 (2002). 139 Gornstein, E. & Schwarz, T. L. The paradox of paclitaxel neurotoxicity: Mechanisms and unanswered questions. Neuropharmacology 76 Pt A, 175-183, doi:10.1016/j.neuropharm.2013.08.016 (2014). 140 Itoh, Y. et al. Pemirolast potently attenuates paclitaxel hypersensitivity reactions through inhibition of the release of sensory neuropeptides in rats. Neuropharmacology 46, 888-894, doi:10.1016/j.neuropharm.2003.11.018 (2004). 141 Tatsushima, Y. et al. Involvement of substance P in peripheral neuropathy induced by paclitaxel but not oxaliplatin. The Journal of pharmacology and experimental therapeutics 337, 226-235, doi:10.1124/jpet.110.175976 (2011). 142 Miyano, K. et al. Paclitaxel and vinorelbine, evoked the release of substance P from cultured rat dorsal root ganglion cells through different PKC isoform- sensitive ion channels. Neuropharmacology 57, 25-32, doi:10.1016/j.neuropharm.2009.04.001 (2009). 143 Kamei, J., Ogawa, M. & Kasuya, Y. Development of supersensitivity to substance P in the spinal cord of the streptozotocin-induced diabetic rats. Pharmacology, biochemistry, and behavior 35, 473-475 (1990). 144 Coudore-Civiale, M., Courteix, C., Boucher, M., Fialip, J. & Eschalier, A. Evidence for an involvement of tachykinins in allodynia in streptozocin-induced diabetic rats. European journal of pharmacology 401, 47-53 (2000). 145 Maduka, U. P. et al. Changes in the disposition of substance P in the rostral ventromedial medulla after inflammatory injury in the rat. Neuroscience 317, 1- 11, doi:10.1016/j.neuroscience.2015.12.054 (2016). 146 Hamity, M. V., Walder, R. Y. & Hammond, D. L. Increased neuronal expression of neurokinin-1 receptor and stimulus-evoked internalization of the receptor in the rostral ventromedial medulla of the rat after peripheral inflammatory injury. The Journal of comparative neurology 522, 3037-3051, doi:10.1002/cne.23564 (2014). 147 Brink, T. S., Pacharinsak, C., Khasabov, S. G., Beitz, A. J. & Simone, D. A. Differential modulation of neurons in the rostral ventromedial medulla by neurokinin-1 receptors. Journal of neurophysiology 107, 1210-1221, doi:10.1152/jn.00678.2011 (2012). 148 Hamity, M. V., White, S. R. & Hammond, D. L. Effects of neurokinin-1 receptor agonism and antagonism in the rostral ventromedial medulla of rats with acute or

219

persistent inflammatory nociception. Neuroscience 165, 902-913, doi:10.1016/j.neuroscience.2009.10.064 (2010). 149 Khasabov, S. G. & Simone, D. A. Loss of neurons in rostral ventromedial medulla that express neurokinin-1 receptors decreases the development of hyperalgesia. Neuroscience 250, 151-165, doi:10.1016/j.neuroscience.2013.06.057 (2013). 150 Lagraize, S. C. et al. Spinal cord mechanisms mediating behavioral hyperalgesia induced by neurokinin-1 tachykinin receptor activation in the rostral ventromedial medulla. Neuroscience 171, 1341-1356, doi:10.1016/j.neuroscience.2010.09.040 (2010). 151 Gitter, B. D. et al. Pharmacological characterization of LY303870: a novel, potent and selective nonpeptide substance P (neurokinin-1) receptor antagonist. The Journal of pharmacology and experimental therapeutics 275, 737-744 (1995). 152 Iyengar, S. et al. LY303870, a centrally active neurokinin-1 antagonist with a long duration of action. The Journal of pharmacology and experimental therapeutics 280, 774-785 (1997). 153 D.J. Goldstein, W. W. O., E.G. Klein. in American Society for Clinical Pharmacology and Therapeutics Vol. 65 129 (New Orleans, LA, 1998). 154 Goldstein, D. J. et al. Lanepitant, an NK-1 antagonist, in migraine prevention. Cephalalgia : an international journal of headache 21, 102-106 (2001). 155 Goldstein, D. J. et al. Ineffectiveness of neurokinin-1 antagonist in acute migraine: a crossover study. Cephalalgia : an international journal of headache 17, 785-790 (1997). 156 D.J. Goldstein, O. W. in American Society for Clinical Pharmacology and Therapeutics Vol. 65 119 (New Orleans, LA, 1998). 157 Goldstein, D. J., Wang, O., Gitter, B. D. & Iyengar, S. Dose-response study of the analgesic effect of lanepitant in patients with painful diabetic neuropathy. Clin Neuropharmacol 24, 16-22 (2001). 158 Goldstein, D. J., Wang, O., Todd, L.E. in American Society for Clinical Pharmacology and Therapeutics Vol. 63 143 (New Orleans, LA, 1998). 159 Sindrup, S. H., Graf, A. & Sfikas, N. The NK1-receptor antagonist TKA731 in painful diabetic neuropathy: a randomised, controlled trial. European journal of pain 10, 567-571, doi:10.1016/j.ejpain.2005.08.001 (2006). 160 Reinhardt, R. R., Laub, J. B., Fricke, J. R. Jr., Polis, A. B., Gertz, B. J. in Clinical pharmacology and therapeutics Vol. 63 168 (1998). 161 Gilbert A. Block, D. R., D. Panebianco, S. A. Mines. in Neurology (Minneapolis, Minnesota, 1998). 162 Navari, R. M. et al. Reduction of cisplatin-induced emesis by a selective neurokinin-1-receptor antagonist. L-754,030 Antiemetic Trials Group. The New England journal of medicine 340, 190-195, doi:10.1056/NEJM199901213400304 (1999). 163 Chizh, B. A. et al. Effects of oral pregabalin and aprepitant on pain and central sensitization in the electrical hyperalgesia model in human volunteers. British journal of anaesthesia 98, 246-254, doi:10.1093/bja/ael344 (2007).

220

164 Upadhyay, J. et al. Imaging drugs with and without clinical analgesic efficacy. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 36, 2659-2673, doi:10.1038/npp.2011.156 (2011). 165 Urban, L. A. & Fox, A. J. NK1 receptor antagonists--are they really without effect in the pain clinic? Trends in pharmacological sciences 21, 462-464; author reply 465 (2000). 166 Dionne, R. A. et al. The substance P receptor antagonist CP-99,994 reduces acute postoperative pain. Clinical pharmacology and therapeutics 64, 562-568, doi:10.1016/S0009-9236(98)90140-0 (1998). 167 Tachykinins. Vol. 164 (Springer-Verlag Berlin, 2004). 168 Kalso, E., Edwards, J. E., Moore, R. A. & McQuay, H. J. Opioids in chronic non- cancer pain: systematic review of efficacy and safety. Pain 112, 372-380, doi:10.1016/j.pain.2004.09.019 (2004). 169 Organization, T. W. H. Cancer pain relief. (1996). 170 Arner, S. & Meyerson, B. A. Lack of analgesic effect of opioids on neuropathic and idiopathic forms of pain. Pain 33, 11-23 (1988). 171 Rowbotham, M. C., Reisner-Keller, L. A. & Fields, H. L. Both intravenous lidocaine and morphine reduce the pain of postherpetic neuralgia. Neurology 41, 1024-1028 (1991). 172 Pert, C. B. & Snyder, S. H. Opiate receptor: demonstration in nervous tissue. Science 179, 1011-1014 (1973). 173 Lord, J. A., Waterfield, A. A., Hughes, J. & Kosterlitz, H. W. Endogenous opioid peptides: multiple agonists and receptors. Nature 267, 495-499 (1977). 174 Yaksh, T. L. Opiate receptors for behavioral analgesia resemble those related to the depression of spinal nociceptive neurons. Science 199, 1231-1233 (1978). 175 Yaksh, T. L. & Rudy, T. A. Analgesia mediated by a direct spinal action of narcotics. Science 192, 1357-1358 (1976). 176 Kieffer, B. L. Recent advances in molecular recognition and signal transduction of active peptides: receptors for opioid peptides. Cellular and molecular neurobiology 15, 615-635 (1995). 177 Matthes, H. W. et al. Loss of morphine-induced analgesia, reward effect and withdrawal symptoms in mice lacking the mu-opioid-receptor gene. Nature 383, 819-823, doi:10.1038/383819a0 (1996). 178 Sora, I. et al. Opiate receptor knockout mice define mu receptor roles in endogenous nociceptive responses and morphine-induced analgesia. Proceedings of the National Academy of Sciences of the United States of America 94, 1544- 1549 (1997). 179 Besse, D., Lombard, M. C., Zajac, J. M., Roques, B. P. & Besson, J. M. Pre- and postsynaptic distribution of mu, delta and kappa opioid receptors in the superficial layers of the cervical dorsal horn of the rat spinal cord. Brain research 521, 15-22 (1990). 180 Ding, Y. Q., Kaneko, T., Nomura, S. & Mizuno, N. Immunohistochemical localization of mu-opioid receptors in the central nervous system of the rat. The

221

Journal of comparative neurology 367, 375-402, doi:10.1002/(SICI)1096- 9861(19960408)367:3<375::AID-CNE5>3.0.CO;2-2 (1996). 181 Li, J. L. et al. Immunocytochemical localization of mu-opioid receptor in primary afferent neurons containing substance P or calcitonin gene-related peptide. A light and electron microscope study in the rat. Brain research 794, 347-352 (1998). 182 Rusin, K. I. & Moises, H. C. mu-Opioid receptor activation reduces multiple components of high-threshold calcium current in rat sensory neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 15, 4315- 4327 (1995). 183 De Waard, M. et al. Direct binding of G-protein betagamma complex to voltage- dependent calcium channels. Nature 385, 446-450, doi:10.1038/385446a0 (1997). 184 Gerachshenko, T. et al. Gbetagamma acts at the C terminus of SNAP-25 to mediate presynaptic inhibition. Nature neuroscience 8, 597-605, doi:10.1038/nn1439 (2005). 185 Yoshimura, M. & North, R. A. Substantia gelatinosa neurones hyperpolarized in vitro by enkephalin. Nature 305, 529-530 (1983). 186 Grudt, T. J. & Williams, J. T. kappa-Opioid receptors also increase potassium conductance. Proceedings of the National Academy of Sciences of the United States of America 90, 11429-11432 (1993). 187 Eckert, W. A., 3rd & Light, A. R. Hyperpolarization of substantia gelatinosa neurons evoked by mu-, kappa-, delta 1-, and delta 2-selective opioids. The journal of pain : official journal of the American Pain Society 3, 115-125 (2002). 188 Mambretti, E. M. et al. Functional and structural characterization of axonal opioid receptors as targets for analgesia. Molecular pain 12, doi:10.1177/1744806916628734 (2016). 189 Truong, W., Cheng, C., Xu, Q. G., Li, X. Q. & Zochodne, D. W. Mu opioid receptors and analgesia at the site of a peripheral nerve injury. Annals of neurology 53, 366-375, doi:10.1002/ana.10465 (2003). 190 Scherrer, G. et al. Dissociation of the opioid receptor mechanisms that control mechanical and heat pain. Cell 137, 1148-1159, doi:10.1016/j.cell.2009.04.019 (2009). 191 Quirion, R. Pain, nociception and spinal opioid receptors. Progress in neuropsychopharmacology & biological psychiatry 8, 571-579 (1984). 192 Anderson, S. D., Basbaum, A. I. & Fields, H. L. Response of medullary raphe neurons to peripheral stimulation and to systemic opiates. Brain research 123, 363-368 (1977). 193 Fields, H. L. & Anderson, S. D. Evidence that raphe-spinal neurons mediate opiate and midbrain stimulation-produced analgesias. Pain 5, 333-349 (1978). 194 Fields, H. L., Vanegas, H., Hentall, I. D. & Zorman, G. Evidence that disinhibition of brain stem neurones contributes to morphine analgesia. Nature 306, 684-686 (1983). 195 Vaughan, C. W., Ingram, S. L., Connor, M. A. & Christie, M. J. How opioids inhibit GABA-mediated neurotransmission. Nature 390, 611-614, doi:10.1038/37610 (1997).

222

196 Brownstein, M. J. A brief history of opiates, opioid peptides, and opioid receptors. Proceedings of the National Academy of Sciences of the United States of America 90, 5391-5393 (1993). 197 Jurna, I. [Serturner and morphine--a historical vignette]. Schmerz 17, 280-283, doi:10.1007/s00482-003-0220-3 (2003). 198 Sjogren, P., Jensen, N. H. & Jensen, T. S. Disappearance of morphine-induced hyperalgesia after discontinuing or substituting morphine with other opioid agonists. Pain 59, 313-316 (1994). 199 Gu, G., Kondo, I., Hua, X. Y. & Yaksh, T. L. Resting and evoked spinal substance P release during chronic intrathecal morphine infusion: parallels with tolerance and dependence. The Journal of pharmacology and experimental therapeutics 314, 1362-1369, doi:10.1124/jpet.105.087718 (2005). 200 Vera-Portocarrero, L. P. et al. Spinal NK-1 receptor expressing neurons mediate opioid-induced hyperalgesia and antinociceptive tolerance via activation of descending pathways. Pain 129, 35-45, doi:10.1016/j.pain.2006.09.033 (2007). 201 Sun, Y., Sahbaie, P., Liang, D., Li, W. & Clark, J. D. opioids enhance CXCL1 expression and function after incision in mice. The journal of pain : official journal of the American Pain Society 15, 856-866, doi:10.1016/j.jpain.2014.05.003 (2014). 202 Elliott, K., Kest, B., Man, A., Kao, B. & Inturrisi, C. E. N-methyl-D-aspartate (NMDA) receptors, mu and kappa opioid tolerance, and perspectives on new analgesic drug development. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 13, 347-356, doi:10.1016/0893-133X(95)00083-P (1995). 203 Tiseo, P. J., Cheng, J., Pasternak, G. W. & Inturrisi, C. E. Modulation of morphine tolerance by the competitive N-methyl-D-aspartate receptor antagonist LY274614: assessment of opioid receptor changes. The Journal of pharmacology and experimental therapeutics 268, 195-201 (1994). 204 Menard, D. P. et al. A calcitonin gene-related peptide receptor antagonist prevents the development of tolerance to spinal morphine analgesia. The Journal of neuroscience : the official journal of the Society for Neuroscience 16, 2342-2351 (1996). 205 Powell, K. J., Quirion, R. & Jhamandas, K. Inhibition of neurokinin-1-substance P receptor and prostanoid activity prevents and reverses the development of morphine tolerance in vivo and the morphine-induced increase in CGRP expression in cultured dorsal root ganglion neurons. The European journal of neuroscience 18, 1572-1583 (2003). 206 Vardanyan, A. et al. TRPV1 receptor in expression of opioid-induced hyperalgesia. The journal of pain : official journal of the American Pain Society 10, 243-252, doi:10.1016/j.jpain.2008.07.004 (2009). 207 Ma, W., Zheng, W. H., Powell, K., Jhamandas, K. & Quirion, R. Chronic morphine exposure increases the phosphorylation of MAP kinases and the transcription factor CREB in dorsal root ganglion neurons: an in vitro and in vivo study. The European journal of neuroscience 14, 1091-1104 (2001).

223

208 King, T. et al. Role of NK-1 neurotransmission in opioid-induced hyperalgesia. Pain 116, 276-288, doi:10.1016/j.pain.2005.04.014 (2005). 209 Yue, X. et al. Sustained morphine treatment augments basal CGRP release from cultured primary sensory neurons in a Raf-1 dependent manner. European journal of pharmacology 584, 272-277, doi:10.1016/j.ejphar.2008.02.013 (2008). 210 Gouarderes, C. et al. Opioid and substance P receptor adaptations in the rat spinal cord following sub-chronic intrathecal treatment with morphine and naloxone. Neuroscience 54, 799-807 (1993). 211 Navratilova, E. et al. Morphine promotes phosphorylation of the human delta- opioid receptor at serine 363. European journal of pharmacology 519, 212-214, doi:10.1016/j.ejphar.2005.07.024 (2005). 212 Mao, J., Price, D. D. & Mayer, D. J. Mechanisms of hyperalgesia and morphine tolerance: a current view of their possible interactions. Pain 62, 259-274 (1995). 213 Tumati, S., Yamamura, H. I., Vanderah, T. W., Roeske, W. R. & Varga, E. V. Sustained morphine treatment augments capsaicin-evoked calcitonin gene-related peptide release from primary sensory neurons in a protein kinase A- and Raf-1- dependent manner. The Journal of pharmacology and experimental therapeutics 330, 810-817, doi:10.1124/jpet.109.151704 (2009). 214 Bidlack, J. M. Detection and function of opioid receptors on cells from the immune system. Clin Diagn Lab Immunol 7, 719-723 (2000). 215 Watkins, L. R., Hutchinson, M. R., Rice, K. C. & Maier, S. F. The "toll" of opioid-induced glial activation: improving the clinical efficacy of opioids by targeting glia. Trends in pharmacological sciences 30, 581-591, doi:10.1016/j.tips.2009.08.002 (2009). 216 Coller, J. K. & Hutchinson, M. R. Implications of central immune signaling caused by drugs of abuse: mechanisms, mediators and new therapeutic approaches for prediction and treatment of drug dependence. Pharmacology & therapeutics 134, 219-245, doi:10.1016/j.pharmthera.2012.01.008 (2012). 217 Sun, J., Liu, S., Mata, M., Fink, D. J. & Hao, S. Transgene-mediated expression of tumor necrosis factor soluble receptor attenuates morphine tolerance in rats. Gene Ther 19, 101-108, doi:10.1038/gt.2011.76 (2012). 218 Kong, L. Y., McMillian, M. K., Hudson, P. M., Jin, L. & Hong, J. S. Inhibition of lipopolysaccharide-induced nitric oxide and cytokine production by ultralow concentrations of dynorphins in mixed glia cultures. The Journal of pharmacology and experimental therapeutics 280, 61-66 (1997). 219 Jiang, C. et al. Selective suppression of microglial activation by paeoniflorin attenuates morphine tolerance. European journal of pain, doi:10.1002/ejp.617 (2014). 220 Merighi, S. et al. Morphine mediates a proinflammatory phenotype via mu-opioid receptor-PKCvarepsilon-Akt-ERK1/2 signaling pathway in activated microglial cells. Biochemical pharmacology 86, 487-496, doi:10.1016/j.bcp.2013.05.027 (2013).

224

221 Cui, Y. et al. A novel role of minocycline: attenuating morphine antinociceptive tolerance by inhibition of p38 MAPK in the activated spinal microglia. Brain, behavior, and immunity 22, 114-123, doi:10.1016/j.bbi.2007.07.014 (2008). 222 Tumati, S. et al. Tachykinin NK(1) receptor antagonist co-administration attenuates opioid withdrawal-mediated spinal microglia and astrocyte activation. European journal of pharmacology 684, 64-70 (2012). 223 Rawls, S. M. & Benamar, K. Effects of opioids, cannabinoids, and vanilloids on body temperature. Front Biosci (Schol Ed) 3, 822-845 (2011). 224 Hayes, A. G. & Tyers, M. B. Determination of receptors that mediate opiate side effects in the mouse. British journal of pharmacology 79, 731-736 (1983). 225 Kreek, M. J., Schaefer, R. A., Hahn, E. F. & Fishman, J. Naloxone, a specific opioid antagonist, reverses chronic idiopathic constipation. Lancet 1, 261-262 (1983). 226 Dahan, A., Aarts, L. & Smith, T. W. Incidence, Reversal, and Prevention of Opioid-induced Respiratory Depression. Anesthesiology 112, 226-238, doi:10.1097/ALN.0b013e3181c38c25 (2010). 227 Drdla, R., Gassner, M., Gingl, E. & Sandkuhler, J. Induction of synaptic long- term potentiation after opioid withdrawal. Science 325, 207-210, doi:10.1126/science.1171759 (2009). 228 Yaksh, T. L., Kohl, R. L. & Rudy, T. A. Induction of tolerance and withdrawal in rats receiving morphine in the spinal subarachnoid space. European journal of pharmacology 42, 275-284 (1977). 229 Goldstein, R. Z. & Volkow, N. D. Drug addiction and its underlying neurobiological basis: neuroimaging evidence for the involvement of the frontal cortex. The American journal of psychiatry 159, 1642-1652 (2002). 230 Justinova, Z., Panlilio, L. V. & Goldberg, S. R. Drug addiction. Current topics in behavioral neurosciences 1, 309-346, doi:10.1007/978-3-540-88955-7_13 (2009). 231 Redish, A. D. Addiction as a computational process gone awry. Science 306, 1944-1947, doi:10.1126/science.1102384 (2004). 232 Munro, M. The hijacked brain. Nature 522, S46-47, doi:10.1038/522S46a (2015). 233 O'connor, P. The Fallacy of the 'Hijacked Brain'. The New York Times (2012). . 234 Bearn, J. & O'Brien, M. "Addicted to Euphoria": The History, Clinical Presentation, and Management of Party Drug Misuse. International review of neurobiology 120, 205-233, doi:10.1016/bs.irn.2015.02.005 (2015). 235 Wise, R. A. Action of drugs of abuse on brain reward systems. Pharmacology, biochemistry, and behavior 13 Suppl 1, 213-223 (1980). 236 Roberts, A. J. & Koob, G. F. The neurobiology of addiction: an overview. Alcohol Health Res World 21, 101-106 (1997). 237 van der Laan, J. W., Eigeman, L. & Jansen van 't Land, C. Benzodiazepines preferentially affect mesolimbic dopamine turnover in rats. European neuropsychopharmacology : the journal of the European College of Neuropsychopharmacology 2, 425-431 (1992).

225

238 Spyraki, C. & Fibiger, H. C. A role for the mesolimbic dopamine system in the reinforcing properties of diazepam. Psychopharmacology 94, 133-137 (1988). 239 Pontieri, F. E., Tanda, G., Orzi, F. & Di Chiara, G. Effects of nicotine on the nucleus accumbens and similarity to those of addictive drugs. Nature 382, 255- 257, doi:10.1038/382255a0 (1996). 240 Hurd, Y. L., Weiss, F., Koob, G. F., And, N. E. & Ungerstedt, U. Cocaine reinforcement and extracellular dopamine overflow in rat nucleus accumbens: an in vivo microdialysis study. Brain research 498, 199-203 (1989). 241 Pontieri, F. E., Tanda, G. & Di Chiara, G. Intravenous cocaine, morphine, and amphetamine preferentially increase extracellular dopamine in the "shell" as compared with the "core" of the rat nucleus accumbens. Proceedings of the National Academy of Sciences of the United States of America 92, 12304-12308 (1995). 242 Masuzawa, M. et al. Pentobarbital inhibits ketamine-induced dopamine release in the rat nucleus accumbens: a microdialysis study. Anesthesia and analgesia 96, 148-152, table of contents (2003). 243 Chen, J. P. et al. Delta 9-tetrahydrocannabinol produces naloxone-blockable enhancement of presynaptic basal dopamine efflux in nucleus accumbens of conscious, freely-moving rats as measured by intracerebral microdialysis. Psychopharmacology 102, 156-162 (1990). 244 Brodie, M. S., Pesold, C. & Appel, S. B. Ethanol directly excites dopaminergic ventral tegmental area reward neurons. Alcoholism, clinical and experimental research 23, 1848-1852 (1999). 245 Brodie, M. S., McElvain, M. A., Bunney, E. B. & Appel, S. B. Pharmacological reduction of small conductance calcium-activated potassium current (SK) potentiates the excitatory effect of ethanol on ventral tegmental area dopamine neurons. The Journal of pharmacology and experimental therapeutics 290, 325- 333 (1999). 246 Wise, R. A. Neurobiology of addiction. Current opinion in neurobiology 6, 243- 251 (1996). 247 Stinus, L., Cador, M. & Le Moal, M. Interaction between endogenous opioids and dopamine within the nucleus accumbens. Annals of the New York Academy of Sciences 654, 254-273 (1992). 248 Negus, S. S. et al. Effect of antagonists selective for mu, delta and kappa opioid receptors on the reinforcing effects of heroin in rats. The Journal of pharmacology and experimental therapeutics 265, 1245-1252 (1993). 249 Vaccarino, F. J., Pettit, H. O., Bloom, F. E. & Koob, G. F. Effects of intracerebroventricular administration of methyl naloxonium chloride on heroin self-administration in the rat. Pharmacology, biochemistry, and behavior 23, 495- 498 (1985). 250 Weeks, J. R. & Collins, R. J. Changes in morphine self-administration in rats induced by prostaglandin E1 and naloxone. Prostaglandins 12, 11-19 (1976).

226

251 Goldberg, S. R., Woods, J. H. & Schuster, C. R. Nalorphine-induced changes in morphine self-administration in rhesus monkeys. The Journal of pharmacology and experimental therapeutics 176, 464-471 (1971). 252 Koob, G. F., Pettit, H. O., Ettenberg, A. & Bloom, F. E. Effects of opiate antagonists and their quaternary derivatives on heroin self-administration in the rat. The Journal of pharmacology and experimental therapeutics 229, 481-486 (1984). 253 Kalivas, P. W., Widerlov, E., Stanley, D., Breese, G. & Prange, A. J., Jr. Enkephalin action on the mesolimbic system: a dopamine-dependent and a dopamine-independent increase in locomotor activity. The Journal of pharmacology and experimental therapeutics 227, 229-237 (1983). 254 Di Chiara, G. Reinforcing drug seeking. Trends in pharmacological sciences 13, 428-429 (1992). 255 Bozarth, M. A. & Wise, R. A. Anatomically distinct opiate receptor fields mediate reward and physical dependence. Science 224, 516-517 (1984). 256 Johnson, S. W. & North, R. A. Opioids excite dopamine neurons by hyperpolarization of local interneurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 12, 483-488 (1992). 257 Nestler, E. J. Under siege: The brain on opiates. Neuron 16, 897-900 (1996). 258 Koob, G. F. Drug addiction: the yin and yang of hedonic homeostasis. Neuron 16, 893-896 (1996). 259 Koob, G. F., Sanna, P. P. & Bloom, F. E. Neuroscience of addiction. Neuron 21, 467-476 (1998). 260 Self, D. W. & Nestler, E. J. Molecular mechanisms of drug reinforcement and addiction. Annu Rev Neurosci 18, 463-495, doi:10.1146/annurev.ne.18.030195.002335 (1995). 261 Nestler, E. J., Hope, B. T. & Widnell, K. L. Drug addiction: a model for the molecular basis of neural plasticity. Neuron 11, 995-1006 (1993). 262 Nestler, E. J. & Aghajanian, G. K. Molecular and cellular basis of addiction. Science 278, 58-63 (1997). 263 Berhow, M. T., Hiroi, N. & Nestler, E. J. Regulation of ERK (extracellular signal regulated kinase), part of the neurotrophin signal transduction cascade, in the rat mesolimbic dopamine system by chronic exposure to morphine or cocaine. The Journal of neuroscience : the official journal of the Society for Neuroscience 16, 4707-4715 (1996). 264 Beitner-Johnson, D. & Nestler, E. J. Morphine and cocaine exert common chronic actions on tyrosine hydroxylase in dopaminergic brain reward regions. Journal of neurochemistry 57, 344-347 (1991). 265 Aurelian, L., Warnock, K. T., Balan, I., Puche, A. & June, H. TLR4 signaling in VTA dopaminergic neurons regulates impulsivity through tyrosine hydroxylase modulation. Translational psychiatry 6, e815, doi:10.1038/tp.2016.72 (2016). 266 Beitner-Johnson, D. & Nestler, E. J. Chronic morphine impairs axoplasmic transport in the rat mesolimbic dopamine system. Neuroreport 5, 57-60 (1993).

227

267 Beitner-Johnson, D., Guitart, X. & Nestler, E. J. Neurofilament proteins and the mesolimbic dopamine system: common regulation by chronic morphine and chronic cocaine in the rat ventral tegmental area. The Journal of neuroscience : the official journal of the Society for Neuroscience 12, 2165-2176 (1992). 268 Beitner-Johnson, D., Guitart, X. & Nestler, E. J. Glial fibrillary acidic protein and the mesolimbic dopamine system: regulation by chronic morphine and Lewis- Fischer strain differences in the rat ventral tegmental area. Journal of neurochemistry 61, 1766-1773 (1993). 269 Berhow, M. T. et al. Influence of neurotrophic factors on morphine- and cocaine- induced biochemical changes in the mesolimbic dopamine system. Neuroscience 68, 969-979 (1995). 270 Robison, A. J. & Nestler, E. J. Transcriptional and epigenetic mechanisms of addiction. Nature reviews. Neuroscience 12, 623-637, doi:10.1038/nrn3111 (2011). 271 Surmeier, D. J., Ding, J., Day, M., Wang, Z. & Shen, W. D1 and D2 dopamine- receptor modulation of striatal glutamatergic signaling in striatal medium spiny neurons. Trends in neurosciences 30, 228-235, doi:10.1016/j.tins.2007.03.008 (2007). 272 Hernandez-Lopez, S., Bargas, J., Surmeier, D. J., Reyes, A. & Galarraga, E. D1 receptor activation enhances evoked discharge in neostriatal medium spiny neurons by modulating an L-type Ca2+ conductance. The Journal of neuroscience : the official journal of the Society for Neuroscience 17, 3334-3342 (1997). 273 Surmeier, D. J., Song, W. J. & Yan, Z. Coordinated expression of dopamine receptors in neostriatal medium spiny neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 16, 6579-6591 (1996). 274 Lobo, M. K. et al. DeltaFosB induction in striatal medium spiny neuron subtypes in response to chronic pharmacological, emotional, and optogenetic stimuli. The Journal of neuroscience : the official journal of the Society for Neuroscience 33, 18381-18395, doi:10.1523/JNEUROSCI.1875-13.2013 (2013). 275 Russo, S. J. et al. The addicted synapse: mechanisms of synaptic and structural plasticity in nucleus accumbens. Trends in neurosciences 33, 267-276, doi:10.1016/j.tins.2010.02.002 (2010). 276 Bibb, J. A. et al. Effects of chronic exposure to cocaine are regulated by the neuronal protein Cdk5. Nature 410, 376-380, doi:10.1038/35066591 (2001). 277 Nestler, E. J. Review. Transcriptional mechanisms of addiction: role of DeltaFosB. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 363, 3245-3255, doi:10.1098/rstb.2008.0067 (2008). 278 Scruggs, K. The Opioid Epidemic: How Did We Get Here? The Huffington Post (2016). . 279 Mariani, M. How the American opiate epidemic was started by one pharmaceutical company. The Week (2015). .

228

280 Wilkerson, R. G., Kim, H. K., Windsor, T. A. & Mareiniss, D. P. The Opioid Epidemic in the United States. Emerg Med Clin North Am 34, e1-e23, doi:10.1016/j.emc.2015.11.002 (2016). 281 Considered, A. T. (ed National Public Radio) (2015). 282 Branch, T. A. a. H. C. S. National Ambulatory Medical Care Survewy: 2012 State and National Summary Tables. (2012). 283 in House Committee on Energy and Commerce Subcommittee on Oversight and Investigations (Nora Volkow, National Institute on Drug Abuse, 2014). 284 Boudreau, D. et al. Trends in long-term opioid therapy for chronic non-cancer pain. Pharmacoepidemiol Drug Saf 18, 1166-1175, doi:10.1002/pds.1833 (2009). 285 ASAM. Opioid Addiction Facts & Figures. (2016). 286 NIDA. DrugFacts: Heroin, (2014). 287 CDC. Number and age adjusted rates of drug-poisoning deaths involving opioid analgesics and heroin: United States, 2000-2014. (2015). 288 Cicero, T. J., Ellis, M. S., Surratt, H. L. & Kurtz, S. P. The changing face of heroin use in the United States: a retrospective analysis of the past 50 years. JAMA psychiatry 71, 821-826, doi:10.1001/jamapsychiatry.2014.366 (2014). 289 Dart, R. C. et al. Trends in opioid analgesic abuse and mortality in the United States. The New England journal of medicine 372, 241-248, doi:10.1056/NEJMsa1406143 (2015). 290 Rudd, R. A. et al. Increases in heroin overdose deaths - 28 States, 2010 to 2012. MMWR Morb Mortal Wkly Rep 63, 849-854 (2014). 291 McCann, D. J. & Skolnick, P. Trends in opioid analgesic abuse and mortality in the United States. The New England journal of medicine 372, 1572-1573, doi:10.1056/NEJMc1501822#SA1 (2015). 292 Bolash, R. B. Trends in opioid analgesic abuse and mortality in the United States. The New England journal of medicine 372, 1573, doi:10.1056/NEJMc1501822#SA2 (2015). 293 Mowry, J. B., Spyker, D. A., Cantilena, L. R., Jr., McMillan, N. & Ford, M. 2013 Annual Report of the American Association of Poison Control Centers' National Poison Data System (NPDS): 31st Annual Report. Clin Toxicol (Phila) 52, 1032- 1283, doi:10.3109/15563650.2014.987397 (2014). 294 Cicero, T. J. & Ellis, M. S. Nonmedical Prescription-Opioid Use and Heroin Use. The New England journal of medicine 374, 1295-1296, doi:10.1056/NEJMc1601875#SA1 (2016). 295 Hansen, R. N., Oster, G., Edelsberg, J., Woody, G. E. & Sullivan, S. D. Economic costs of nonmedical use of prescription opioids. The Clinical journal of pain 27, 194-202, doi:10.1097/AJP.0b013e3181ff04ca (2011). 296 Becker, W. C., Sullivan, L. E., Tetrault, J. M., Desai, R. A. & Fiellin, D. A. Non- medical use, abuse and dependence on prescription opioids among U.S. adults: psychiatric, medical and substance use correlates. Drug and alcohol dependence 94, 38-47, doi:10.1016/j.drugalcdep.2007.09.018 (2008).

229

297 Hall, A. J. et al. Patterns of abuse among unintentional pharmaceutical overdose fatalities. Jama 300, 2613-2620, doi:10.1001/jama.2008.802 (2008). 298 Jones, C. M. Frequency of prescription pain reliever nonmedical use: 2002-2003 and 2009-2010. Arch Intern Med 172, 1265-1267, doi:10.1001/archinternmed.2012.2533 (2012). 299 Martins, S. S., Santaella-Tenorio, J., Marshall, B. D., Maldonado, A. & Cerda, M. Racial/ethnic differences in trends in heroin use and heroin-related risk behaviors among nonmedical prescription opioid users. Drug and alcohol dependence 151, 278-283, doi:10.1016/j.drugalcdep.2015.03.020 (2015). 300 Wilson, J. E. & Pendleton, J. M. Oligoanalgesia in the emergency department. Am J Emerg Med 7, 620-623 (1989). 301 Campbell, J. N. APS 1995 Presidential address. Pain Forum 5, 85-88, doi:10.1016/s1082-3174(96)80076-6 (1996). 302 Morone, N. E. & Weiner, D. K. Pain as the fifth vital sign: exposing the vital need for pain education. Clin Ther 35, 1728-1732, doi:10.1016/j.clinthera.2013.10.001 (2013). 303 Dyer, O. Kentucky seeks $1bn from Purdue Pharma for misrepresenting addictive potential of oxycodone. BMJ 349, g6605, doi:10.1136/bmj.g6605 (2014). 304 Joranson, D. E., Ryan, K. M., Gilson, A. M. & Dahl, J. L. Trends in medical use and abuse of opioid analgesics. Jama 283, 1710-1714 (2000). 305 Brownstein, M. J., Mroz, E. A., Kizer, J. S., Palkovits, M. & Leeman, S. E. Regional distribution of substance P in the brain of the rat. Brain research 116, 299-305 (1976). 306 Mroz, E. D., Brownstein, M. J. & Leeman, S. E. Evidence for substance P in the habenulo-interpeduncular tract. Brain research 113, 597-599 (1976). 307 Emson, P. C., Cuello, A. C., Paxinos, G., Jessell, T. & Iversen, L. L. The origin of substance P and acetylcholine projections to the ventral tegmental area and interpeduncular nucleus in the rat. Acta Physiol Scand Suppl 452, 43-46 (1977). 308 Cuello, A. C., Emson, P. C., Paxinos, G. & Jessell, T. Substance P containing and cholinergic projections from the habenula. Brain research 149, 413-429 (1978). 309 Kanazawa, I., Emson, P. C. & Cuello, A. C. Evidence for the existence of substance P-containing fibres in striato-nigral and pallido-nigral pathways in rat brain. Brain research 119, 447-453 (1977). 310 Napier, T. C. et al. Substance P in the ventral pallidum: projection from the ventral striatum, and electrophysiological and behavioral consequences of pallidal substance P. Neuroscience 69, 59-70 (1995). 311 Horn, A. S., Cuello, A. C. & Miller, R. J. Dopamine in the mesolimbic system of the rat brain: endogenous levels and the effects of drugs on the uptake mechanism and stimulation of adenylate cyclase activity. Journal of neurochemistry 22, 265- 270 (1974). 312 Costall, B. & Naylor, R. J. The behavioural effects of dopamine applied intracerebrally to areas of the mesolimbic system. European journal of pharmacology 32, 87-92 (1975).

230

313 Kelly, P. H. & Iversen, S. D. Selective 6OHDA-induced destruction of mesolimbic dopamine neurons: abolition of psychostimulant-induced locomotor activity in rats. European journal of pharmacology 40, 45-56 (1976). 314 Phillipson, O. T. Afferent projections to the ventral tegmental area of Tsai and interfascicular nucleus: a horseradish peroxidase study in the rat. The Journal of comparative neurology 187, 117-143, doi:10.1002/cne.901870108 (1979). 315 Bannon, M. J. & Roth, R. H. Pharmacology of mesocortical dopamine neurons. Pharmacol Rev 35, 53-68 (1983). 316 Spyraki, C., Fibiger, H. C. & Phillips, A. G. Attenuation of heroin reward in rats by disruption of the mesolimbic dopamine system. Psychopharmacology 79, 278- 283 (1983). 317 Di Chiara, G. & Imperato, A. Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats. Proceedings of the National Academy of Sciences of the United States of America 85, 5274-5278 (1988). 318 Stinus, L., Kelley, A. E. & Iversen, S. D. Increased spontaneous activity following substance P infusion into A10 dopaminergic area. Nature 276, 616-618 (1978). 319 Petit, F. & Glowinski, J. Stimulatory effect of substance P on the spontaneous release of newly synthesized [3H]dopamine from rat striatal slices: a tetrodotoxin- sensitive process. Neuropharmacology 25, 1015-1021 (1986). 320 Tamiya, R., Hanada, M., Kawai, Y., Inagaki, S. & Takagi, H. Substance P afferents have synaptic contacts with dopaminergic neurons in the ventral tegmental area of the rat. Neuroscience letters 110, 11-15 (1990). 321 Elliott, P. J., Nemeroff, C. B. & Kilts, C. D. Evidence for a tonic facilitatory influence of substance P on dopamine release in the nucleus accumbens. Brain research 385, 379-382 (1986). 322 Ljungdahl, A., Hokfelt, T. & Nilsson, G. Distribution of substance P-like immunoreactivity in the central nervous system of the rat--I. Cell bodies and nerve terminals. Neuroscience 3, 861-943 (1978). 323 Bowman, S. L. et al. Cell-Autonomous Regulation of Mu-Opioid Receptor Recycling by Substance P. Cell reports, doi:10.1016/j.celrep.2015.02.045 (2015). 324 Santarelli, L., Gobbi, G., Blier, P. & Hen, R. Behavioral and physiologic effects of genetic or pharmacologic inactivation of the substance P receptor (NK1). The Journal of clinical psychiatry 63 Suppl 11, 11-17 (2002). 325 Mantyh, P. W. Neurobiology of substance P and the NK1 receptor. The Journal of clinical psychiatry 63 Suppl 11, 6-10 (2002). 326 Wise, R. A. & Koob, G. F. The development and maintenance of drug addiction. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 39, 254-262, doi:10.1038/npp.2013.261 (2014). 327 Buchta, W. C. & Riegel, A. C. Chronic cocaine disrupts mesocortical learning mechanisms. Brain research, doi:10.1016/j.brainres.2015.02.003 (2015).

231

328 Elliott, P. J., Mason, G. S., Stephens-Smith, M. & Hagan, R. M. Behavioural and biochemical responses following activation of midbrain dopamine pathways by receptor selective neurokinin agonists. Neuropeptides 19, 119-126 (1991). 329 Dam, T. V., Escher, E. & Quirion, R. Visualization of neurokinin-3 receptor sites in rat brain using the highly selective ligand [3H]senktide. Brain research 506, 175-179 (1990). 330 Mantyh, P. W., Gates, T., Mantyh, C. R. & Maggio, J. E. Autoradiographic localization and characterization of tachykinin receptor binding sites in the rat brain and peripheral tissues. The Journal of neuroscience : the official journal of the Society for Neuroscience 9, 258-279 (1989). 331 Seabrook, G. R., Bowery, B. J. & Hill, R. G. Pharmacology of tachykinin receptors on neurones in the ventral tegmental area of rat brain slices. European journal of pharmacology 273, 113-119 (1995). 332 Minabe, Y., Emori, K., Toor, A., Stutzmann, G. E. & Ashby, C. R., Jr. The effect of the acute and chronic administration of CP 96,345, a selective neurokinin1 receptor antagonist, on midbrain dopamine neurons in the rat: a single unit, extracellular recording study. Synapse 22, 35-45, doi:10.1002/(SICI)1098- 2396(199601)22:1<35::AID-SYN4>3.0.CO;2-J (1996). 333 Korotkova, T. M., Brown, R. E., Sergeeva, O. A., Ponomarenko, A. A. & Haas, H. L. Effects of arousal- and feeding-related neuropeptides on dopaminergic and GABAergic neurons in the ventral tegmental area of the rat. The European journal of neuroscience 23, 2677-2685, doi:10.1111/j.1460-9568.2006.04792.x (2006). 334 Sanchez-Catalan, M. J., Kaufling, J., Georges, F., Veinante, P. & Barrot, M. The antero-posterior heterogeneity of the ventral tegmental area. Neuroscience 282C, 198-216, doi:10.1016/j.neuroscience.2014.09.025 (2014). 335 Lessard, A. & Pickel, V. M. Subcellular distribution and plasticity of neurokinin-1 receptors in the rat substantia nigra and ventral tegmental area. Neuroscience 135, 1309-1323, doi:10.1016/j.neuroscience.2005.07.025 (2005). 336 Lessard, A., Grady, E. F., Bunnett, N. W. & Pickel, V. M. Predominant surface distribution of neurokinin-3 receptors in non-dopaminergic dendrites in the rat substantia nigra and ventral tegmental area. Neuroscience 144, 1393-1408, doi:10.1016/j.neuroscience.2006.10.058 (2007). 337 Langlois, X., Wintmolders, C., te Riele, P., Leysen, J. E. & Jurzak, M. Detailed distribution of Neurokinin 3 receptors in the rat, guinea pig and gerbil brain: a comparative autoradiographic study. Neuropharmacology 40, 242-253 (2001). 338 Lessard, A., Savard, M., Gobeil, F., Jr., Pierce, J. P. & Pickel, V. M. The neurokinin-3 (NK3) and the neurokinin-1 (NK1) receptors are differentially targeted to mesocortical and mesolimbic projection neurons and to neuronal nuclei in the rat ventral tegmental area. Synapse 63, 484-501, doi:10.1002/syn.20627 (2009). 339 Hether, S., Misono, K. & Lessard, A. The neurokinin-3 receptor (NK3R) antagonist SB222200 prevents the apomorphine-evoked surface but not nuclear

232

NK3R redistribution in dopaminergic neurons of the rat ventral tegmental area. Neuroscience 247, 12-24, doi:10.1016/j.neuroscience.2013.05.006 (2013). 340 Sladek, C. D. et al. Characterization of nuclear neurokinin 3 receptor expression in rat brain. Neuroscience 196, 35-48, doi:10.1016/j.neuroscience.2011.08.044 (2011). 341 Minabe, Y. & Ashby, C. R., Jr. Effect of the acute and chronic administration of the selective neurokinin2 receptor antagonist SR 48968 on midbrain dopamine neurons in the rat: an in vivo extracellular single cell study. Synapse 25, 196-204, doi:10.1002/(SICI)1098-2396(199702)25:2<196::AID-SYN10>3.0.CO;2-X (1997). 342 Schmidlin, F., Dery, O., Bunnett, N. W. & Grady, E. F. Heterologous regulation of trafficking and signaling of G protein-coupled receptors: beta-arrestin- dependent interactions between neurokinin receptors. Proceedings of the National Academy of Sciences of the United States of America 99, 3324-3329, doi:10.1073/pnas.052161299 (2002). 343 Staubli, U. & Huston, J. P. Central action of substance P: possible role in reward. Behav Neural Biol 43, 100-108 (1985). 344 Holzhauer-Oitzl, M. S., Boucke, K. & Huston, J. P. Reinforcing properties of substance P in the lateral hypothalamus revealed by conditioned place preference. Pharmacology, biochemistry, and behavior 28, 511-515 (1987). 345 Placenza, F. M., Fletcher, P. J., Rotzinger, S. & Vaccarino, F. J. Infusion of the substance P analogue, DiMe-C7, into the ventral tegmental area induces reinstatement of cocaine-seeking behaviour in rats. Psychopharmacology 177, 111-120, doi:10.1007/s00213-004-1912-9 (2004). 346 Mogenson, G. J., Wu, M. & Jones, D. L. Locomotor activity elicited by injections of picrotoxin into the ventral tegmental area is attenuated by injections of GABA into the globus pallidus. Brain research 191, 569-571 (1980). 347 Ambroggi, F., Ishikawa, A., Fields, H. L. & Nicola, S. M. Basolateral amygdala neurons facilitate reward-seeking behavior by exciting nucleus accumbens neurons. Neuron 59, 648-661, doi:10.1016/j.neuron.2008.07.004 (2008). 348 Schildein, S., Agmo, A., Huston, J. P. & Schwarting, R. K. Intraaccumbens injections of substance P, morphine and amphetamine: effects on conditioned place preference and behavioral activity. Brain research 790, 185-194 (1998). 349 Loonam, T. M., Noailles, P. A., Yu, J., Zhu, J. P. & Angulo, J. A. Substance P and cholecystokinin regulate neurochemical responses to cocaine and methamphetamine in the striatum. Life Sci 73, 727-739 (2003). 350 Beach, T. G., Tago, H. & McGeer, E. G. Light microscopic evidence for a substance P-containing innervation of the human nucleus basalis of Meynert. Brain research 408, 251-257 (1987). 351 Hasenohrl, R. U., Gerhardt, P. & Huston, J. P. Positively reinforcing effects of the neurokinin substance P in the basal forebrain: mediation by its C-terminal sequence. Experimental neurology 115, 282-291 (1992).

233

352 Holzhauer-Oitzl, M. S., Hasenohrl, R. & Huston, J. P. Reinforcing properties of substance P in the region of the nucleus basalis magnocellularis in rats. Neuropharmacology 27, 749-756 (1988). 353 Huston, J. P., Hasenohrl, R. U., Boix, F., Gerhardt, P. & Schwarting, R. K. Sequence-specific effects of neurokinin substance P on memory, reinforcement, and brain dopamine activity. Psychopharmacology 112, 147-162 (1993). 354 Nikolaus, S., Huston, J. P. & Hasenohrl, R. U. Reinforcing effects of neurokinin substance P in the ventral pallidum: mediation by the tachykinin NK1 receptor. European journal of pharmacology 370, 93-99 (1999). 355 Boix, F., Sandor, P., Nogueira, P. J., Huston, J. P. & Schwarting, R. K. Relationship between dopamine release in nucleus accumbens and place preference induced by substance P injected into the nucleus basalis magnocellularis region. Neuroscience 64, 1045-1055 (1995). 356 Ciccocioppo, R. et al. Stimulation of tachykinin NK-3 receptors in the nucleus basalis magnocellularis reduces alcohol intake in rats. Peptides 18, 1349-1355 (1997). 357 Ciccocioppo, R., Panocka, I., Pompei, P., De Caro, G. & Massi, M. Selective agonists at NK3 tachykinin receptors inhibit alcohol intake in Sardinian alcohol- preferring rats. Brain research bulletin 33, 71-77 (1994). 358 Ciccocioppo, R. et al. Mechanism of action for reduction of ethanol intake in rats by the tachykinin NK-3 receptor agonist aminosenktide. Pharmacology, biochemistry, and behavior 61, 459-464 (1998). 359 Furuta, T., Mori, T., Lee, T. & Kaneko, T. Third group of neostriatofugal neurons: neurokinin B-producing neurons that send axons predominantly to the substantia innominata. The Journal of comparative neurology 426, 279-296 (2000). 360 Zhou, L., Furuta, T. & Kaneko, T. Neurokinin B-producing projection neurons in the lateral stripe of the striatum and cell clusters of the accumbens nucleus in the rat. The Journal of comparative neurology 480, 143-161, doi:10.1002/cne.20331 (2004). 361 Velasquez, K. M., Molfese, D. L. & Salas, R. The role of the habenula in drug addiction. Frontiers in human neuroscience 8, 174, doi:10.3389/fnhum.2014.00174 (2014). 362 Burgunder, J. M. & Young, W. S., 3rd. Neurokinin B and substance P genes are co-expressed in a subset of neurons in the rat habenula. Neuropeptides 13, 165- 169 (1989). 363 Antolin-Fontes, B., Ables, J. L., Gorlich, A. & Ibanez-Tallon, I. The habenulo- interpeduncular pathway in nicotine aversion and withdrawal. Neuropharmacology, doi:10.1016/j.neuropharm.2014.11.019 (2014). 364 Glick, S. D., Ramirez, R. L., Livi, J. M. & Maisonneuve, I. M. 18- Methoxycoronaridine acts in the medial habenula and/or interpeduncular nucleus to decrease morphine self-administration in rats. European journal of pharmacology 537, 94-98, doi:10.1016/j.ejphar.2006.03.045 (2006).

234

365 Dao, D. Q., Perez, E. E., Teng, Y., Dani, J. A. & De Biasi, M. Nicotine enhances excitability of medial habenular neurons via facilitation of neurokinin signaling. The Journal of neuroscience : the official journal of the Society for Neuroscience 34, 4273-4284, doi:10.1523/JNEUROSCI.2736-13.2014 (2014). 366 Nagano, M. et al. Distribution and pharmacological characterization of primate NK-1 and NK-3 tachykinin receptors in the central nervous system of the rhesus monkey. British journal of pharmacology 147, 316-323, doi:10.1038/sj.bjp.0706561 (2006). 367 Weidenhofer, J. et al. Immunohistochemical localisation of the NK1 receptor in the human amygdala: preliminary investigation in schizophrenia. Progress in neuro-psychopharmacology & biological psychiatry 30, 1313-1321, doi:10.1016/j.pnpbp.2006.05.008 (2006). 368 Kertes, E., Laszlo, K., Berta, B. & Lenard, L. Effects of substance P microinjections into the globus pallidus and central nucleus of amygdala on passive avoidance learning in rats. Behavioural brain research 198, 397-403, doi:10.1016/j.bbr.2008.11.021 (2009). 369 Kertes, E., Laszlo, K., Berta, B. & Lenard, L. Positive reinforcing effects of substance P in the rat central nucleus of amygdala. Behavioural brain research 205, 307-310, doi:10.1016/j.bbr.2009.06.028 (2009). 370 Murtra, P., Sheasby, A. M., Hunt, S. P. & De Felipe, C. Rewarding effects of opiates are absent in mice lacking the receptor for substance P. Nature 405, 180- 183, doi:10.1038/35012069 (2000). 371 Murtra, P., Sheasby, A., Hunt, S.P., De Felipe, C. in Society for Neuroscience (New Orleans, LA, 2000). 372 Ripley, T. L., Gadd, C. A., De Felipe, C., Hunt, S. P. & Stephens, D. N. Lack of self-administration and behavioural sensitisation to morphine, but not cocaine, in mice lacking NK1 receptors. Neuropharmacology 43, 1258-1268 (2002). 373 Gadd, C. A., Murtra, P., De Felipe, C. & Hunt, S. P. Neurokinin-1 receptor- expressing neurons in the amygdala modulate morphine reward and anxiety behaviors in the mouse. The Journal of neuroscience : the official journal of the Society for Neuroscience 23, 8271-8280 (2003). 374 Placenza, F. M., Fletcher, P. J., Vaccarino, F. J. & Erb, S. Effects of central neurokinin-1 receptor antagonism on cocaine- and opiate-induced locomotor activity and self-administration behaviour in rats. Pharmacology, biochemistry, and behavior 84, 94-101, doi:10.1016/j.pbb.2006.04.011 (2006). 375 Placenza, F. M., Vaccarino, F. J., Fletcher, P. J. & Erb, S. Activation of central neurokinin-1 receptors induces reinstatement of cocaine-seeking behavior. Neuroscience letters 390, 42-47, doi:10.1016/j.neulet.2005.07.050 (2005). 376 Yang, A. R. et al. Deficits in substance P mRNA levels in the CeA are inversely associated with alcohol-motivated responding. Synapse 63, 972-981, doi:10.1002/syn.20677 (2009). 377 L. Lumeng, T. D. H., T.K. Li. in Alcohol and Aldehyde Metabolizing Systems: Intermediary Metabolism and Neurochemistry Vol. 3 (ed John R. Williamson

235

Ronald G. Thurman, Henry Drott, Britton Chance) 537-544 (Academic Press, Inc., 1977). 378 Higley, A. E., Koob, G. F. & Mason, B. J. Treatment of alcohol dependence with drug antagonists of the stress response. Alcohol research : current reviews 34, 516-521 (2012). 379 Ebner, K., Rupniak, N. M., Saria, A. & Singewald, N. Substance P in the medial amygdala: emotional stress-sensitive release and modulation of anxiety-related behavior in rats. Proceedings of the National Academy of Sciences of the United States of America 101, 4280-4285, doi:10.1073/pnas.0400794101 (2004). 380 Ebner, K., Muigg, P., Singewald, G. & Singewald, N. Substance P in stress and anxiety: NK-1 receptor antagonism interacts with key brain areas of the stress circuitry. Annals of the New York Academy of Sciences 1144, 61-73, doi:10.1196/annals.1418.018 (2008). 381 Sinha, R. How does stress lead to risk of alcohol relapse? Alcohol research : current reviews 34, 432-440 (2012). 382 Schank, J. R. et al. Stress-induced reinstatement of alcohol-seeking in rats is selectively suppressed by the neurokinin 1 (NK1) antagonist L822429. Psychopharmacology 218, 111-119, doi:10.1007/s00213-011-2201-z (2011). 383 Thorsell, A., Schank, J. R., Singley, E., Hunt, S. P. & Heilig, M. Neurokinin-1 receptors (NK1R:s), alcohol consumption, and alcohol reward in mice. Psychopharmacology 209, 103-111, doi:10.1007/s00213-010-1775-1 (2010). 384 Baek, M. N. et al. Artificial microRNA-based neurokinin-1 receptor gene silencing reduces alcohol consumption in mice. Neuroscience letters 475, 124- 128, doi:10.1016/j.neulet.2010.03.051 (2010). 385 Steensland, P. et al. The neurokinin 1 receptor antagonist, ezlopitant, reduces appetitive responding for sucrose and ethanol. PloS one 5, doi:10.1371/journal.pone.0012527 (2010). 386 Jensen, C. J., Gerard, N. P., Schwartz, T. W. & Gether, U. The species selectivity of chemically distinct tachykinin nonpeptide antagonists is dependent on common divergent residues of the rat and human neurokinin-1 receptors. Molecular pharmacology 45, 294-299 (1994). 387 Hrabovszky, E. et al. Substance P immunoreactivity exhibits frequent colocalization with kisspeptin and neurokinin B in the human infundibular region. PloS one 8, e72369, doi:10.1371/journal.pone.0072369 (2013). 388 Deacon, C. F., Agoston, D. V., Nau, R. & Conlon, J. M. Conversion of neuropeptide K to neurokinin A and vesicular colocalization of neurokinin A and substance P in neurons of the guinea pig small intestine. Journal of neurochemistry 48, 141-146 (1987). 389 Nagano, M., Oishi, T. & Suzuki, H. Distribution and pharmacological characterization of primate NK-2 tachykinin receptor in the central nervous system of the rhesus monkey. Neuroscience letters 503, 23-26, doi:10.1016/j.neulet.2011.07.057 (2011). 390 Steinberg, R. et al. Selective blockade of neurokinin-2 receptors produces antidepressant-like effects associated with reduced corticotropin-releasing factor

236

function. The Journal of pharmacology and experimental therapeutics 299, 449- 458 (2001). 391 Schank, J. R., Ryabinin, A. E., Giardino, W. J., Ciccocioppo, R. & Heilig, M. Stress-related neuropeptides and addictive behaviors: beyond the usual suspects. Neuron 76, 192-208, doi:10.1016/j.neuron.2012.09.026 (2012). 392 Zorrilla, E. P., Logrip, M. L. & Koob, G. F. Corticotropin releasing factor: a key role in the neurobiology of addiction. Frontiers in neuroendocrinology 35, 234- 244, doi:10.1016/j.yfrne.2014.01.001 (2014). 393 Leggio, L. et al. Turning the clock ahead: potential preclinical and clinical neuropharmacological targets for alcohol dependence. Current pharmaceutical design 16, 2159-2118 (2010). 394 Saal, D., Dong, Y., Bonci, A. & Malenka, R. C. Drugs of abuse and stress trigger a common synaptic adaptation in dopamine neurons. Neuron 37, 577-582 (2003). 395 Bradesi, S. et al. Role of spinal microglia in visceral hyperalgesia and NK1R upregulation in a rat model of chronic stress. Gastroenterology 136, 1339-1348, e1331-1332, doi:10.1053/j.gastro.2008.12.044 (2009). 396 Kaneyuki, H. et al. Psychological stress increases dopamine turnover selectively in mesoprefrontal dopamine neurons of rats: reversal by diazepam. Brain research 557, 154-161 (1991). 397 Herman, J. P. et al. Differential effects of inescapable footshocks and of stimuli previously paired with inescapable footshocks on dopamine turnover in cortical and limbic areas of the rat. Life Sci 30, 2207-2214 (1982). 398 Goldstein, R. Z. & Volkow, N. D. Dysfunction of the prefrontal cortex in addiction: neuroimaging findings and clinical implications. Nature reviews. Neuroscience 12, 652-669, doi:10.1038/nrn3119 (2011). 399 Hutson, P. H., Patel, S., Jay, M. T. & Barton, C. L. Stress-induced increase of cortical dopamine metabolism: attenuation by a tachykinin NK1 receptor antagonist. European journal of pharmacology 484, 57-64 (2004). 400 Morley, J. E. et al. Morphine addiction and withdrawal alters brain peptide concentrations. Life Sciences 26, 2239-2244, doi:10.1016/0024-3205(80)90208-8 (1980). 401 Califf, R. M., Woodcock, J. & Ostroff, S. A Proactive Response to Prescription Opioid Abuse. The New England journal of medicine, doi:10.1056/NEJMsr1601307 (2016). 402 Miller, M. et al. Prescription Opioid Duration of Action and the Risk of Unintentional Overdose Among Patients Receiving Opioid Therapy. JAMA internal medicine, doi:10.1001/jamainternmed.2014.8071 (2015). 403 Papenfuss, M. New Jersey hospital 1st in US to ban opioid painkillers in emergency room as first line of treatment. International Business Times (2016). . 404 Sandweiss, A. J. & Vanderah, T. W. The pharmacology of neurokinin receptors in addiction: prospects for therapy. Subst Abuse Rehabil 6, 93-102, doi:10.2147/SAR.S70350 (2015).

237

405 Largent-Milnes, T. M. et al. Spinal or systemic TY005, a peptidic opioid agonist/neurokinin 1 antagonist, attenuates pain with reduced tolerance. British journal of pharmacology 161, 986-1001, doi:10.1111/j.1476-5381.2010.00824.x (2010). 406 Yaksh, T. L. & Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiology & behavior 17, 1031-1036 (1976). 407 Kim, S. H. & Chung, J. M. An experimental model for peripheral neuropathy produced by segmental spinal nerve ligation in the rat. Pain 50, 355-363 (1992). 408 Hsu, P. D. et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature biotechnology 31, 827-832, doi:10.1038/nbt.2647 (2013). 409 Guschin, D. Y. et al. A rapid and general assay for monitoring endogenous gene modification. Methods in molecular biology 649, 247-256, doi:10.1007/978-1- 60761-753-2_15 (2010). 410 Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nature protocols 8, 2281-2308, doi:10.1038/nprot.2013.143 (2013). 411 Paxinos, G., Watson, C. The Rat Brain in Stereotaxic Coordinates. 5th Edition edn, (Elsevier Academic Press, 2005). 412 Largent-Milnes, T. M. et al. Building a better analgesic: multifunctional compounds that address injury-induced pathology to enhance analgesic efficacy while eliminating unwanted side effects. The Journal of pharmacology and experimental therapeutics 347, 7-19, doi:10.1124/jpet.113.205245 (2013). 413 Hylden, J. L. & Wilcox, G. L. Intrathecal morphine in mice: a new technique. European journal of pharmacology 67, 313-316 (1980). 414 Hargreaves, K., Dubner, R., Brown, F., Flores, C. & Joris, J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 32, 77-88 (1988). 415 Vanderah, T. W. et al. Novel D-amino acid tetrapeptides produce potent antinociception by selectively acting at peripheral kappa-opioid receptors. European journal of pharmacology 583, 62-72, doi:10.1016/j.ejphar.2008.01.011 (2008). 416 Yamamoto, T. et al. Discovery of a potent and efficacious peptide derivative for delta/mu opioid agonist/neurokinin 1 antagonist activity with a 2',6'-dimethyl-L- tyrosine: in vitro, in vivo, and NMR-based structural studies. Journal of medicinal chemistry 54, 2029-2038, doi:10.1021/jm101023r (2011). 417 Manchikanti, L. et al. Opioid epidemic in the United States. Pain physician 15, ES9-38 (2012). 418 Relieving Pain in America: A Blueprint for Transforming Prevention, Care, Education, and Research. Mil Med 181, 397-399, doi:10.7205/MILMED-D-16- 00012 (2016). 419 Pizzo, P. A. & Clark, N. M. Alleviating suffering 101--pain relief in the United States. The New England journal of medicine 366, 197-199, doi:10.1056/NEJMp1109084 (2012).

238

420 Van Zee, A. The promotion and marketing of oxycontin: commercial triumph, public health tragedy. Am J Public Health 99, 221-227, doi:10.2105/AJPH.2007.131714 (2009). 421 Jones, J. P. (ed IN THE UNITED STATES DISTRICT COURT FOR THE WESTERN DISTRICT OF VIRGINIA ABINGDON DIVISION) (2007). 422 Robert F. Forman, L. G. B. The Marketing of Opioid Medications Without Prescription Over the Internet. American Marketing Association 25, 133-146 (2006). 423 Kuehn, B. M. Opioid prescriptions soar: increase in legitimate use as well as abuse. Jama 297, 249-251, doi:10.1001/jama.297.3.249 (2007). 424 Olsen, Y., Daumit, G. L. & Ford, D. E. Opioid prescriptions by U.S. primary care physicians from 1992 to 2001. The journal of pain : official journal of the American Pain Society 7, 225-235, doi:10.1016/j.jpain.2005.11.006 (2006). 425 Centers for Disease, C. & Prevention. Vital signs: overdoses of prescription opioid pain relievers---United States, 1999--2008. MMWR Morb Mortal Wkly Rep 60, 1487-1492 (2011). 426 Compton, W. M., Volkow, N. D., Throckmorton, D. C. & Lurie, P. Expanded access to opioid overdose intervention: research, practice, and policy needs. Ann Intern Med 158, 65-66, doi:10.7326/0003-4819-158-1-201301010-00013 (2013). 427 Dasgupta, N. et al. Observed transition from opioid analgesic deaths toward heroin. Drug and alcohol dependence 145, 238-241, doi:10.1016/j.drugalcdep.2014.10.005 (2014). 428 Conroy, S. & Hill, D. Failure to identify or effectively manage prescription opioid dependence acted as a gateway to heroin use-buprenorphine/naloxone treatment and recovery in a surgical patient. BMJ case reports 2014, doi:10.1136/bcr-2014- 207458 (2014). 429 Perrone, J. & Mycyk, M. B. A challenging crossroad for emergency medicine: the epidemics of pain and pain medication deaths. Academic emergency medicine : official journal of the Society for Academic Emergency Medicine 21, 334-336 (2014). 430 Barbier, E. et al. The NK1 receptor antagonist L822429 reduces heroin reinforcement. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 38, 976-984, doi:10.1038/npp.2012.261 (2013). 431 Hua, X. Y. et al. Capsaicin induced release of multiple tachykinins (substance P, neurokinin A and eledoisin-like material) from guinea-pig spinal cord and ureter. Neuroscience 19, 313-319 (1986). 432 Saria, A. et al. Simultaneous release of several tachykinins and calcitonin gene- related peptide from rat spinal cord slices. Neuroscience letters 63, 310-314 (1986). 433 Thompson, S. W., Dray, A. & Urban, L. Injury-induced plasticity of spinal reflex activity: NK1 neurokinin receptor activation and enhanced A- and C-fiber mediated responses in the rat spinal cord in vitro. The Journal of neuroscience : the official journal of the Society for Neuroscience 14, 3672-3687 (1994).

239

434 Grace, P. M., Maier, S. F. & Watkins, L. R. Opioid-Induced Central Immune Signaling: Implications for Opioid Analgesia. Headache, doi:10.1111/head.12552 (2015). 435 Li, X. & Clark, J. D. Hyperalgesia during opioid abstinence: mediation by glutamate and substance p. Anesthesia and analgesia 95, 979-984, table of contents (2002). 436 Margolis, E. B., Hjelmstad, G. O., Fujita, W. & Fields, H. L. Direct bidirectional mu-opioid control of midbrain dopamine neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 34, 14707-14716, doi:10.1523/JNEUROSCI.2144-14.2014 (2014). 437 Brimblecombe, K. R. & Cragg, S. J. Substance P Weights Striatal Dopamine Transmission Differently within the Striosome-Matrix Axis. The Journal of neuroscience : the official journal of the Society for Neuroscience 35, 9017-9023, doi:10.1523/JNEUROSCI.0870-15.2015 (2015). 438 Turski, L., Havemann, U., Schwarz, M. & Kuschinsky, K. Disinhibition of nigral GABA output neurons mediates muscular rigidity elicited by striatal opioid receptor stimulation. Life Sci 31, 2327-2330 (1982). 439 Morales, M. & Root, D. H. Glutamate neurons within the midbrain dopamine regions. Neuroscience 282C, 60-68, doi:10.1016/j.neuroscience.2014.05.032 (2014). 440 Kraft, M., Noailles, P. & Angulo, J. A. Substance P modulates cocaine-evoked dopamine overflow in the striatum of the rat brain. Annals of the New York Academy of Sciences 937, 121-131 (2001). 441 Davidson, C., Lee, T. H. & Ellinwood, E. H. The NK(1) receptor antagonist WIN51708 reduces sensitization after chronic cocaine. European journal of pharmacology 499, 355-356, doi:10.1016/j.ejphar.2004.08.006 (2004). 442 Angulo, J. A., Angulo, N. & Yu, J. Antagonists of the neurokinin-1 or dopamine D1 receptors confer protection from methamphetamine on dopamine terminals of the mouse striatum. Annals of the New York Academy of Sciences 1025, 171-180, doi:10.1196/annals.1316.022 (2004). 443 Kim, Y. G., Cha, J. & Chandrasegaran, S. Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. Proceedings of the National Academy of Sciences of the United States of America 93, 1156-1160 (1996). 444 Urnov, F. D. et al. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature 435, 646-651, doi:10.1038/nature03556 (2005). 445 Boch, J. et al. Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326, 1509-1512, doi:10.1126/science.1178811 (2009). 446 Moscou, M. J. & Bogdanove, A. J. A simple cipher governs DNA recognition by TAL effectors. Science 326, 1501, doi:10.1126/science.1178817 (2009). 447 Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821, doi:10.1126/science.1225829 (2012).

240

448 Qi, L. S. et al. Repurposing CRISPR as an RNA-guided platform for sequence- specific control of gene expression. Cell 152, 1173-1183, doi:10.1016/j.cell.2013.02.022 (2013). 449 Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823, doi:10.1126/science.1231143 (2013). 450 Zetsche, B. et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759-771, doi:10.1016/j.cell.2015.09.038 (2015). 451 Heidenreich, M. & Zhang, F. Applications of CRISPR-Cas systems in neuroscience. Nature reviews. Neuroscience 17, 36-44, doi:10.1038/nrn.2015.2 (2016). 452 Fishman-Lobell, J. & Haber, J. E. Removal of nonhomologous DNA ends in double-strand break recombination: the role of the yeast ultraviolet repair gene RAD1. Science 258, 480-484 (1992). 453 Abizaid, A. et al. Ghrelin modulates the activity and synaptic input organization of midbrain dopamine neurons while promoting appetite. The Journal of clinical investigation 116, 3229-3239, doi:10.1172/JCI29867 (2006). 454 Zheng, H., Patterson, L. M. & Berthoud, H. R. Orexin signaling in the ventral tegmental area is required for high-fat appetite induced by opioid stimulation of the nucleus accumbens. The Journal of neuroscience : the official journal of the Society for Neuroscience 27, 11075-11082, doi:10.1523/JNEUROSCI.3542- 07.2007 (2007). 455 Fulton, S. Appetite and reward. Frontiers in neuroendocrinology 31, 85-103, doi:10.1016/j.yfrne.2009.10.003 (2010). 456 Yeo, G. S. & Heisler, L. K. Unraveling the brain regulation of appetite: lessons from genetics. Nature neuroscience 15, 1343-1349, doi:10.1038/nn.3211 (2012). 457 Wu, X. et al. Morphine-induced conditioned place preference in rhesus monkeys: resistance to inactivation of insula and extinction. Neurobiology of learning and memory, doi:10.1016/j.nlm.2016.04.005 (2016). 458 Mogil, J. S. Animal models of pain: progress and challenges. Nature reviews. Neuroscience 10, 283-294, doi:10.1038/nrn2606 (2009). 459 Sawynok, J. Topical and peripherally acting analgesics. Pharmacol Rev 55, 1-20, doi:10.1124/pr.55.1.1 (2003). 460 Ragsdale, D. S., McPhee, J. C., Scheuer, T. & Catterall, W. A. Molecular determinants of state-dependent block of Na+ channels by local anesthetics. Science 265, 1724-1728 (1994). 461 Coggeshall, R. E., Zhou, S. & Carlton, S. M. Opioid receptors on peripheral sensory axons. Brain research 764, 126-132 (1997). 462 STEIN, C. in Opioids II (Springer-Verlag Berlin Heidelberg, 1993). 463 Atkinson, D. C. & Cowan, A. Reversal of yeast-induced motor impairment in rats as a test for narcotic and non-narcotic analgesics. J Pharm Pharmacol 26, 727- 729 (1974).

241