Comparison of the Chromosome Structures Between the Chicken

Home , EXOC1, Microchromosome, WDR3

Comparison of the Chromosome Structures between the Chicken and Three Anserid Species, the Domestic Duck (Anas platyrhynchos), Muscovy Duck (Cairina moschata), and Chinese Goose (Anser cygnoides), and the Delineation of their Karyotype Evolution by Comparative Chromosome Mapping

Fhamida B. Islam1, Yoshinobu Uno1, Mitsuo Nunome1, Osamu Nishimura2, 3, Hiroshi Tarui4, Kiyokazu Agata3 and Yoichi Matsuda1, 5

1 Laboratory of Animal Genetics, Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, Japan 2 Genome Resource and Analysis Unit, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan 3 Department of Biophysics, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan 4 Division of Genomic Technologies, Center for Life Science Technology, RIKEN, Yokohama 230-0045, Japan 5 Avian Bioscience Research Center, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, Japan

To better understand the process of karyotype evolution in Galloanserae (Galliformes and Anseriformes), we performed comparative chromosome painting with chicken chromosome-specific DNA probes and FISH mapping of the 18S-28S ribosomal RNA (rRNA) genes, telomeric (TTAGGG)n repeats, and cDNA clones of 37 genes for three anserid species, the domestic duck (Anas platyrhynchos), Muscovy duck (Cairina moschata), and Chinese goose (Anser cygnoides). Each chicken probe of chromosomes 1-9 and the Z chromosome painted a single pair of chromosomes in the three species except for the chromosome 4 probe, which painted acrocentric chromosome 4 and a pair of microchromosomes. The 18S-28S rRNA genes were localized to four pairs of microchromosomes in the domestic duck and Muscovy duck, and eight pairs of microchromosomes in the Chinese goose. The (TTAGGG)n repeats were localized to both telomeric ends of all chromosomes in the three species, and were additionally located in the interstitial region of the short arm of chromosome 1 in the domestic duck and in the centromeric region of chromosome 1 in the Muscovy duck. Comparative gene mapping of 37 chicken chromosome 1-4-linked and Z- linked genes revealed high chromosome homologies among three anserid species and also between the chicken and the three anserid species, although there were several chromosome rearrangements: pericentric inversion in chromosome 2, pericentric and paracentric inversions or centromere repositioning in the Z chromosome between the chicken and the anserid species, and pericentric inversions in chromosome 4 and the Z chromosome between the Chinese goose and the two duck species. These results collectively suggest that karyotypes have been highly conserved in Anseriformes and that chromosome rearrangements also occurred less frequently between Galliformes and Anseriformes after they diverged around 100 million years ago.

Key words: Anseriformes, chromosome homology, chromosome mapping, chromosome rearrangement, Galliformes, karyotype evolution J. Poult. Sci., 51: 1-13, 2014

Introduction The order Anseriformes contains about 161 living species Received: May 13, 2013, Accepted: June 18, 2013 in four extant families: Anhimidae, Anseranatidae, Dendro- Released Online Advance Publication: July 25, 2013 Correspondence: Dr. Y. Matsuda, Laboratory of Animal Genetics, Depart- cygnidae, and Anatidae. More than 140 species of water- ment of Applied Molecular Biosciences, Graduate School of Bioagricul- fowls belong to the Anatidae family (Monroe and Sibley, tural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464- 1993; Pereira and Baker, 2009). All species of this order are 8601, Japan. (E-mail: [email protected]) highly adapted for an aquatic existence at the water surface 2 Journal of Poultry Science, 51 (1) e.g.; they have fully webbed feet and are good swimmers. ferent species makes it difficult to delineate the process of The earliest known Anseriformes is the recently discovered avian karyotype evolution precisely. Vegavis, which lived during the Cretaceous period (Clarke et In Anseriformes, a comparative map was only constructed al., 2005). Anseriformes may have appeared about 100 for the domestic duck (Anas platyrhynchos) by fluorescent in million years ago when the original Galloanserae split into situ hybridization (FISH) using BAC clones of functional the two main lineages of Anseriformes and Galliformes genes (Fillon et al., 2007; Skinner et al., 2009). Compared (Pereira and Baker, 2006, 2009; Brown et al., 2008; Kan et to the abundant data of comparative mapping in Galliformes, al., 2010; Pacheco et al., 2011). Anseriformes and Galli- information on chromosome mapping is still lacking in formes are the most primitive neognathous birds, which Anseriformes. Therefore, the process of karyotype reorgan- typically follow ratites and tinamous in the phylogeny of ization has not been clearly understood in Anseriformes. birds. The karyotypes of Anseriformes are characterized by Here, to compare chromosome structures among anserid high diploid chromosome numbers (2n＝78-84), consisting species and between the chicken and anserids, we performed of a small number of macrochromosomes and numerous in- chromosome painting with chicken chromosome-specific distinguishable microchromosomes (Christidis, 1990). This probes, chromosome mapping of telomeric (TTAGGG)n typical avian karyotype is widely conserved in all palaeogna- repeats, the 18S-28S rRNA genes, and cDNA clones of thous and most neognathous bird species (Takagi and Sasaki, chromosome 1-4-linked and Z-linked genes for the domestic 1974; Belterman and de Boer, 1984; Nishida-Umehara et al., duck (Anas platyrhynchos), Muscovy duck (Cairina moscha- 2007); in contrast, the atypical karyotype, characterized by a ta), and Chinese goose (Anser cygnoides). Based on the lower diploid chromosome number, no large macrochromo- mapping data of these three anserid species, we discussed the somes, many medium-sized and small chromosomes, and process of karyotype evolution in Galloanserae (Galliformes only a few pairs of microchromosomes, are commonly found and Anseriformes). in accipitrid species (Amaral and Jorge, 2003; de Oliveira et Materials and Methods al., 2005, 2010; Nanda et al., 2006; Nishida et al., 2008, 2013). Specimens, Cell Cultures, and Chromosome Preparations Cross-species chromosome painting is a powerful tool to Cultured fibroblast cells of the domestic duck (Anas identify homologous chromosome regions among different platyrhynchos), Muscovy duck (Cairina moschata), and species at the whole chromosome level, which enables us to Chinese goose (Anser cygnoides) were used in this study. delineate the process of karyotype evolution and reconstruct Fibroblast cells of two males and one female each of A. the chromosomal phylogeny (Wienberg and Stanyon, 1995). platyrhynchos and C. moschata used in Islam et al. (2013) Recent chromosome painting studies in birds with chicken were recovered from liquid nitrogen and subsequently cul- chromosome-specific DNA probes have revealed chromo- tured. Fibroblast cells of the Chinese goose were collected some homologies and interchromosomal rearrangements from embryos at 10-13 days. Fertilized eggs were purchased between the chicken and 52 avian species representing 12 from a breeding farm in Japan and incubated at our labo- orders (Griffin et al., 2007; Nishida-Umehara et al., 2007; ratory. After removing the heads and internal organs from Nanda et al., 2007, 2011; de Oliveira et al., 2008, 2010; the embryos, the embryonic bodies were minced and cul- Nishida et al., 2008, 2013; Nie et al., 2009). The distri- tured. We determined the sex of the embryos by a molecular bution of telomeric (TTAGGG)n repeats and the 18S-28S sexing method using PCR analysis of the CHD1 genes on the ribosomal RNA (rRNA) genes have also provided us with Z and W sex chromosomes (Griffiths et al., 1998), and used basic information on karyotype reorganization in avian the fibroblast cells of one male and one female embryo for species because the chromosomal distributions of the 18S- chromosome analysis. All experimental procedures using 28S rRNA genes are highly variable between species and the animals conformed to the guidelines established by the presence of interstitial telomeric repeats is one piece of Animal Care Committee, Nagoya University, Japan. Fibro- evidence for telomere-to-telomere fusions in chromosomes blast cells were cultured and chromosome preparations were (Meyne et al., 1990; Nanda et al., 2002; Nishida-Umehara et made as described in our previous study (Islam et al., 2013). al., 2007; Delany et al., 2009; Nishida et al., 2013). Fur- Replication R-banding for gene mapping by FISH was thermore, comparative chromosome mapping has enabled us performed as described previously (Matsuda and Chapman, to identify intrachromosomal rearrangements, which cannot 1995). Fibroblast cell cultures were treated with 5-bromo- be detected precisely by chromosome painting. However, 2′-deoxyuridine (BrdU) (25 μg/ml) (Sigma-Aldrich) at the comparative chromosome mapping with functional genes late replication stage and cell culturing was continued for an and/or cytogenetic DNA markers has been performed for a additional 5 hours, including 45 min of colcemid (0.025 μg/ few avian species (including the California condor, domestic ml) treatment before harvesting. Chromosome slides were duck, flycatchers, Guinea fowl, Japanese quail, New World made as described above and dried at room temperature for quails, turkey, and zebra finch) (Shibusawa et al., 2001, 2-3 days. After staining the slides with Hoechst 33258 (1 2002, 2004a; Itoh et al., 2006; Fillon et al., 2007; Stapley et μg/ml) for 10 min, R-bands were obtained by heating them at al., 2008; Modi et al., 2009; Skinner et al., 2009; Backström 65℃ for 3 min and then exposing them to UV light at 65℃ et al., 2010; Zhang et al., 2011). Therefore, a lack of in- for an additional 6.5 min. The slides were then kept at −80 formation of intrachromosomal rearrangements between dif- ℃ until use. Islam et al.: Comparative Mapping of Anseriformes and Galliformes 3

Giemsa Staining and G-banding (Life Technologies) and SuperScript II RNase H- Reverse Slides were stained with 3% Giemsa in phosphate buffer Transcriptase (Life Technologies) following the manufac- (pH 6.8) for 10 min for karyotyping. Chromosome slides turer’s protocol. PCR conditions were as follows: initial were treated with 0.025% trypsin at 4℃ for 3-4 minutes and denaturation at 94℃ for2min,followedby35cyclesof90℃ then stained with 3% Giemsa solution for 10 minutes for G- for 30 s, 50-60℃ for 30 s and 72℃ for 35 s, and finally 72℃ banding. for 5 min for a final extension (Table 3). PCR products were Molecular Cloning of the cDNA Fragments of Functional separated with 2% agarose gel electrophoresis and were then Genes stained with ethidium bromide. The DNA fragments were Chicken cDNA clones were isolated from a chicken brain extracted from the ethidium bromide-stained gel using a cDNA library for chromosome mapping of chromosome 1- QIAquick Gel Extraction Kit (Qiagen), ligated into pGEM T- and 3-linked genes and two Z-linked genes (HMGCS1, Easy Vector System I (Promega), then transformed into RCL1)ofthechicken(Gallus gallus, GGA) (Tables 1 and 2). competent cells of Escherichia coli strain DH5α (Toyobo). Homologs of chicken chromosome 2- and 4-linked genes Nucleotide sequences were determined with an ABI PRISM were cloned from A. platyrhynchos and seven Z-linked gene 3130 DNA Analyzer (Applied Biosystems) after sequencing homologs (ATP5A1, CHD1, GHR, NTRK2, RPS6, SPIN, reactions with a Big Dye Terminator v1.1 Cycle Sequenc- TMOD1) from A. platyrhynchos, C. moschata and/or A. ing Kit (Applied Biosystems). Nucleotide sequences were cygnoides using the RT-PCR method (Tables 1 and 2). The searched with the National Center for Biotechnology In- nucleotide sequences of primers used for cDNA cloning of formation database using the blastx and blastn programs the genes are listed in Table 3. The PCR primers described (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and the clones were in Tsuda et al. (2007) were used to clone the seven Z-linked used for FISH after confirming that they were the real gene homologs. Total RNA was isolated from the livers of homologs of the chicken genes. A. platyrhynchos and C. moschata and embryos of A. Fluorescence in situ Hybridization (FISH) cygnoides using TRIzol reagents (Invitrogen) following the Cross-species chromosome painting with chicken probes manufacturer’s protocol. cDNA was synthesized from total was performed as described previously (Nishida-Umehara et

RNA by reverse transcription using an oligo (dT)12-18 primer al., 2007). Chicken (Gallus gallus, GGA) chromosome-

Table 1. List of the cDNA fragments used as probes for FISH

Gene symbol Gene name Speciesa Chromosome Size (bp) Accession number ACOT9 Acyl-CoA thioesterase 9 GGA 1 3618 NM001012823 DENND5B DENN/MADD domain containing 5B GGA 1 1316 XM001235264 GAPDH Glyceraldehyde-3-phosphate dehydrogenase GGA 1 1288 NM204305 LIN7A LIN-7 homolog A GGA 1 3241 XM416117 PICALM Phosphatidylinositol binding clathrin assembly protein GGA 1 3770 XM423671 RABL2B RAB, member of RAS oncogene family-like 2B GGA 1 1025 XM424473 RNF219 Ring finger protein 219 GGA 1 2673 XM416999 SSTR3 Somatostatin receptor 3 GGA 1 13675 NM1024583 WDR3 WD repeat domain 3 GGA 1 3483 NM1031485 CCT5 Haperonin containing TCP1 APL 2 1197 AB807671 CTNNB1 Catenin (cadherin-associated protein), beta 1 APL 2 1201 AB807672 ENPP2 Ectonucleotide pyrophosphatase/phosphodiesterase 2 APL 2 954 AB807673 PDIA4 Protein disulfide isomerase family A, member 4 APL 2 1171 AB807674 RARB Retinoic acid receptor, beta APL 2 896 AB807675 RSU1 Ras suppressor protein 1 APL 2 763 AB807676 WAC WW domain containing adaptor with coiled-coil APL 2 1125 AB807677 WWP1 WW domain containing E3 ubiquitin protein ligase 1 APL 2 1481 AB807678 ADI1 Acireductone dioxygenase 1 GGA 3 2251 NM1031089 FILIP1 Filamin A interacting protein 1 GGA 3 4628 XM419877 GJA1 Gap junction protein, alpha 1 GGA 3 1560 NM204586 MIA3 Melanoma inhibitory activity family, member 3 GGA 3 4460 NM001277558 RCAN2 Regulator of calcineurin 2 GGA 3 2075 XM429912 ACSL1 Acyl-CoA synthetase long-chain family member 1 APL 4 784 AB807665 ATRN Attractin APL 4 943 AB807666 EXOC1 Exocyst complex component 1 APL 4 1123 AB807667 NSG1 Neuron specific gene family member 1 APL 4 953 AB807668 RAP1GDS1 RAP1, GTP-GDP dissociation stimulator 1 APL 4 991 AB807669 UCHL1 Ubiquitin carboxyl-terminal esterase L1 APL 4 597 AB807670 a GGA, Gallus gallus; APL, Anas platyrhynchos 4 Journal of Poultry Science, 51 (1)

Table 2. The cDNA fragments of homologs of chicken Z-linked genes used as probes for FISH, which were isolated from A. platyrhynchos, C. moschata, A. cygnoides or G. gallus

Gene symbol Gene name Speciesa Chromosome Size (bp) Accession number ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, APL Z 991b AB807693, AB807694 alpha subunit 1, cardiac muscle CMO Z 1469b AB807701 - 807703 ACY Z 1434b AB807679 - 807681 CHD1 Chromodomain helicase DNA binding protein 1 APL Z 787 AB807700 CMO Z 787 AB807708 ACY Z 1103b AB807691, AB807692 GHR Growth hormone receptor APL Z 1620b AB807695 - 807697 CMO Z 1150b AB807704, AB807705 ACY Z 1620b AB807684 - 807686 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 GGA Z 1874 NM205411 NTRK2 Neurotrophic tyrosine kinase, receptor, type 2 ACY Z 939b AB807682, AB807683 RCL1 RNA terminal phosphate cyclase-like 1 GGA Z 1310 XM424808 RPS6 Ribosomal protein S6 APL Z 593 AB807698 CMO Z 593 AB807706 ACY Z 561 AB807689 SPIN Spindlin 1 APL Z 576 AB807699 CMO Z 575 AB807707 TMOD1 Tropomodulin 1 CMO Z 906b AB807709, AB807710 ACY Z 906b AB807687, AB807688 a APL, Anas platyrhynchos; CMO, Cairina moschata; ACY, Anser cygnoides; GGA, Gallus gallus b Total length of cDNA fragment concatenated by multiple PCR products.

specific DNA probes for chromosomes 1-9 and Z (GGA1-9 Results and GGAZ) (Griffin et al., 1999) were used. FISH images of chromosome painting were captured with the 550 CW- Karyotype of the Three Anserid Species QFISH application program of Leica Microsystems Imaging The diploid chromosome numbers and karyotypes of A. Solution Ltd. (Cambridge, UK) using a cooled CCD camera platyrhynchos and C. moschata were described in our mounted on a Leica DMRA fluorescence microscope. previous study (Islam et al., 2013). We counted chromo- The 5.8 kb pHr21Ab and 7.3 kb pHr14E3 fragments of the some numbers for seven metaphase spreads of one A. human ribosomal RNA genes provided by the Japanese cygnoides female, and determined the karyotype of this Cancer Research Resource Bank (JCRRB), Tokyo, were species. A. cygnoides showed the same diploid chromosome used for chromosome mapping of the 18S-28S ribosomal number (2n＝80) as the two duck species; however, morph- RNA genes. A biotin-labeled 42 bp oligonucleotide probe ological differences were found for several chromosome complementary to telomeric (TTAGGG)n repeats was used pairs (Fig. 1). The third largest chromosome was acrocentric for chromosome mapping of telomeric repeated sequences. in A. platyrhynchos and subtelocentric in C. moschata and A. After hybridization, the slides were stained with FITC- cygnoides. The fourth largest chromosome was acrocentric avidin and subsequently counter-stained with propidium in A. platyrhynchos and C. moschata, but metacentric in A. iodide (PI) (0.75 μg/ml) after washing. cygnoides. The Z chromosomes were subtelocentric in A. A total of 250 μg of the cDNA fragment was labeled with platyrhynchos, acrocentric in C. moschata, and submetacen- biotin-16-dUTP and ethanol precipitated with salmon sperm tric in A. cygnoides. The W chromosome was acrocentric in DNA and Escherichia coli tRNA for chromosomal localiza- A. platyrhynchos and C. moschata, but metacentric in A. tion of functional genes. After hybridization, probe DNA cygnoides. These results were consistent with those of pre- was reacted with the goat anti-biotin antibody (Vector Labo- vious reports (Belterman and de Boer, 1984; Wójcik and ratories), and was then stained with the Alexa Fluor 488 Smalec, 2008). The G-banded chromosomes of A. platyr- rabbit anti-goat-IgG (H+L) conjugate (Invitrogen-Molecular hynchos, C. moschata, and A. cygnoides were obtained using Probes) and subsequently counter-stained with 0.75 μg/ml PI the GTG (G-bands by trypsin using Giemsa) technique, and (Matsuda and Chapman, 1995). FISH images were captured the G-banded ideograms were constructed to identify each using a cooled CCD camera mounted on a Nikon fluores- chromosome and determine the chromosomal locations of cence microscope. FISH signals precisely. Seven pairs of autosomal macrochromosomes and the Z and W chromosomes are shown in Islam et al.: Comparative Mapping of Anseriformes and Galliformes 5

Table 3. List of the degenerate oligonucleotide primers used for molecular cloning of the cDNA fragments of anserid homologs of chicken chromosome 2-, 4-, and Z-linked genes

Annealing Chromo- Gene Forward primer (5′-3′) Reverse primer (5′-3′) temperature some (℃) 2 CCT5 GATGATGARATTGGRGATGGA CTCCAGGCYTACGRATRTCATC 60 2 CTNNB1 TGGACCACAAGYAGRGTGCa CAACTGGRTAGTCAGCACCAa 54 2ENPP2 GCYTGTCACTGCTCWGAAGACTGCa CGBTCHACCARTAAATGGABATCCTCa 57 2 PDIA4 CAYTGCAAGCARTTTGCTCC TCAGARTCAAAYTCTTCTGG 50 2 RARB TGAAACHCAGAGCACCAGYTC AACATRTGAGGYTTGYTGGGTC 59 2 RSU1 GTGGAGGAGAGYMGGGAGAAG TGTTCYTGGCTGCCAGAGGYT 60 2 WAC GATTACAGAAGAGAGGTGATGa GGCCANCCTTGAACATGYTTa 55 2 WWP1 GAAARGATCCTCATGGKAGAAC CTTCCCATRAGYTCAGCAAATC 57 4 ACSL1 AGTGTGTARTKCTGTGYCATGGa CCTGCAAGCTCTCTCCRTGGACa 53 4 ATRN AAGGAGCTRCAGAAGATBCAG GRCTGAAGGTGAAYTGATAGT 54 4 EXOC1 TGCTGTKGTHGAYGCCAAAGATGCa CCHGAGCTTCCATGRAGACTCTCa 57 4 NSG1 CTGGAAGAATGGTGAAACTGG CACTCTAGTTATGGCTGKGG 55 4 RAP1GDS1 TGTGGCATGCTGATGAACTATAGCa TACRTGTTCRCTRGTTGCCATGGa 57 4 UCHL1 CCCCGAGATGCTGAACAAAGTGa TTGCAGARAGCCACRGCAGAa 54 Z ATP5A1 GAARACTGGCACHGCWGARRTRTCCTCb GGCAATBGADGTTTTSCCMGTCTGYCTGTCb 58 CCATTGGYCGKGGYCAGCRTGAGCTSATYAb GCRGACACATCACCMGCCTGYGTTTCb CGYCTKCTGGARAGAGCAGCBAARATGb CTGKTCWGAGATYTTSCCMTCAGWCCTGb Z CHD1 TCAYGARCATCARYTGTATGGVCCTTb CTGCTAGGATGTCCAGCATCCb 55 GTTACTGATTCGTCTACGAGAb,c TCTGCATCGCTAAATCCTTTb,d Z GHR ATGGATCTTCGGCAKCTGYTGYTTAb ACTTCTTTGTACTGCAATTCATACTCCAGb 58 CCCCCTGTSCAYCTTAACTGGACTCTGCb AGATCTGGGTCAATCCCTTTAATCTTTGGAb AARGATGATGAYTCTGGACGWGCCAGb GCTAHGGCAKGATTTTGTTCAGTTGGb Z NTRK2 ATYCCWGTCATYGARAAYCCMCAGTAb TGYTGKGANGCCAGGTAVACCATDCCb 58 GGBGAYCCMCTCATCATGGTYTTTGAb GGYTCYCKYTGCCARCANCCCAGCATSTb Z RPS6 CACTGGCTGCCAGAAGCTCATb GGCCTCCTTCATTCTCTTTGb 55 Z SPIN GCAGAATACAGCATGGATGGb TCTAGGATGTYTTCACCAARTCRTAGACb 55 Z TMOD1 CTRGAGAAATAYCGDGACCTGGATGb CATGCCMAGRATVGCWGCAATGTCACAb 58 GGCATGCACACSYTSATGAGYAACCAGCb CTCTTCCTCACWAGGTCRTTGTTRTTCb a Srikulnath et al. (2009) b Tsuda et al. (2007) c Fridolfsson and Ellegren (1999) d Griffiths et al. (1996)

Fig. 2. hybridization signals of (TTAGGG)n repeats were small on Comparative Chromosome Painting the telomeric ends of macrochromosomes, whereas the Chromosome painting with chicken chromosomes 1-9and amplification of the (TTAGGG)n repeats was observed on Z probes was performed for A. platyrhynchos, C. moschata, almost all microchromosomes. and A. cygnoides (Fig. 3). Each probe painted a single pair Comparison of Cytogenetic Maps Between the Chicken and of chromosomes, except for GGA4, in the three species. The the Three Anserid Species GGA4 probe hybridized to the fourth largest acrocentric We constructed cytogenetic maps of chromosomes 1, 2, 3, chromosome and additionally to a single pair of microchro- and 4 and the Z chromosome with 37 functional genes in the mosomes (Fig. 4). three anserid species (Tables 1 and 2, Figs. 6 and 7), and Chromosomal Locations of the 18S-28S rRNA Genes and compared the chromosomal locations of the genes among the Telomeric (TTAGGG)n Repeats anserid species and also between the chicken (G. gallus, The 18S-28S rRNA genes were localized to four pairs of GGA) and anserid species. No difference was observed in microchromosomes in both A. platyrhynchos and C. the chromosomal location of genes and the gene order in moschata, and to eight pairs of microchromosomes in A. chromosomes 1 and 3 among all species. In chromosome 2, cygnoides (Fig. 5). The (TTAGGG)n repeats were localized PDIA4 was located in the proximal region of the GGA2 long to both telomeric ends of all chromosomes in the three arm, while it was localized to the proximal region of the short species and additionally in the interstitial region of the short arm in the three anserid species. The order of EXOC1, arm of A. platyrhynchos chromosome 1 and in the cen- UCHL1, NSG1, and ATRN genes in chromosome 4 was tromeric region of C. moschata chromosome 1 (Fig. 5). The identical between the chicken and the three anserid species. 6 Journal of Poultry Science, 51 (1)

Fig. 1. Giemsa-stained karyotypes of the domestic duck (A. platyrhynchos) (A), Muscovy duck( C. moschata) (B), and Chinese goose (A. cygnoides)(C). Scale bar＝5 μm.

ACSL1 and RAP1GDS1 were located in the proximal region of acrocentric chromosome 4 of A. platyrhynchos and C. moschata, while they were localized to the proximal region of the long arm of metacentric A. cygnoides chromosome 4. In the Z chromosome, the gene order of nine genes was almost the same among the subtelocentric A. platyrhynchos, acrocentric C. moschata, and metacentric chicken Z chromosomes, even though the location of the centromere differed between the chicken and duck Z chromosomes. TMOD and CHD1, which were located near the centromere of the long arm of the acrocentric A. platyrhynchos and C. moschata Z chromosomes, were localized to the proximal region of the short arm of the metacentric A. cygnoides Z chromosome. Discussion We compared chromosome structures among the chicken and three anserid species, A. platyrhynchos, C. moschata, and A. cygnoides, by karyotype analysis, comparative chromosome painting with chicken chromosome-specific paints (GGA1-9 and Z), and FISH mapping of the 18S-28SrRNA genes, telomeric (TTAGGG)n repeats, and 37 gene homologs of chicken chromosome 1-4-linked and Z-linked genes. The diploid chromosome numbers of the three anserid species were all 2n＝80, which is one pair of chromosomes Fig. 2. G-banded karyotypes of the macrochromosomes more than that of the chicken (2n＝78). The diploid chro- (chromosomes 1-7, Z and W chromosomes) of A. platyr- mosome numbers in birds range from 40 (Falco columbar- hynchos (A), C. moschata (B), and A. cygnoides (C). Scale ius) to 126 (Upupa epops) (Christidis, 1990; Amaral and bar＝5 μm. Jorge, 2003), and the mode of the chromosome number in birds is 2n＝80. Therefore, the karyotypes of the chicken (2n＝78) and the three anserid species (2n＝80), consisting of a small number of large- and medium-sized macrochromo- Islam et al.: Comparative Mapping of Anseriformes and Galliformes 7

Fig. 3. Chromosome hybridization patterns with chicken (Gallus gallus, GGA) chromosome 1, 3, 8, and Z paints (GGA1, GGA3, GGA8, GGAZ) on the PI-stained metaphase chromosome spreads of A. platyrhynchos (A-D), C. moschata (E-H), and A. cygnoides (I-L). Scale bar＝10 μm.

somes and a large number of indistinguishable microchromo- Galliformes split from the common ancestor of Galloanserae. somes, retain the ancestral avian karyotype (Takagi and However, in the related species of A. cygnoides, the greylag Sasaki, 1974; Belterman and de Boer, 1984). Hybridization goose (Anser anser), GGA4 paint hybridized to a single pair with chicken paints (GGA1-9 and Z) showed that each of submetacentric chromosome 4 (Guttenbach et al., 2003), chicken probe hybridized to a single pair of chromosomes for suggesting that the fusion between ancestral acrocentric all three anserid species with the exception that GGA4 chromosome 4 and a microchromosome occurred in A. anser hybridized to the fourth largest acrocentric chromosome and after the genus Anser appeared. a single pair of microchromosomes. The same results have The 18S-28S rRNA genes were localized to four pairs of also been reported in palaeognathous birds and many microchromosomes in two duck species (A. platyrhynchos galliform species (including pheasants, turkeys, capercaillie, and C. moschata) and eight pairs of microchromosomes in A. New World quails, and plain chachalaca) (Shetty et al., cygnoides. Considering that the 18S-28S rRNA genes are 1999; Shibusawa et al., 2004a, 2004b; Nishida-Umehara et supposed to have been located in a single pair of micro- al., 2007), suggesting that the fusion of a microchromosome chromosomes in the ancestral avian karyotype, which were to ancestral acrocentric chromosome 4 occurred in the line- found in palaeognathous birds and the chicken (Nishida- ages of the chicken and other several phasianid species Umehara et al., 2007; Delany et al., 2009), this result sug- (including Old World quails, peafowls, and partridges) after gests that rRNA genes were dispersed in different micro- 8 Journal of Poultry Science, 51 (1)

Fig. 4. Comparative chromosome painting with the chicken chromosome 4-specific DNA probe (GGA4) on the PI-stained metaphase chromosome spreads of A. platyrhynchos (A), C. moschata (B), and A. cygnoides (C). Arrows and arrowheads indicate acrocentric chromosome 4 and a pair of microchromosomes, respectively, which were hybridized with the GGA4 probe. Scale bar＝10 μm.

Fig. 5. FISH patterns of the 18S-28S ribosomal RNA (rRNA) genes and telomeric (TTAGGG)n repeats on PI-stained metaphase chromosome spreads. (A-C) the 18S-28SrRNA genes. (D-F) telomeric (TTAGGG)n repeats. (A, D) A. platyrhynchos. (B, E) C. moschata. (C, F) A. cygnoides. Arrows indicate the signals of interstitial telomeric sequences (ITSs) (D, E). Scale bar＝10 μm. Islam et al.: Comparative Mapping of Anseriformes and Galliformes 9

Fig. 6. FISH mapping of functional genes for the three anserid species using cDNA fragments. (A, B) Representative PI-stained (A) and Hoechst-stained (B) metaphase spreads of C. moschata.(A)TMOD on the Z chromosome. (C-E) GAPDH on chromosome 1. (F-H) PDIA4 on chromosome 2. (I-K) MIA3 on chromosome 3. (L-N) ATRN on chromosome 4. (O-T) ATP5A1 on the Z chromosome. (C, F, I, L, O, P) A. platyrhynchos. (A, B, D, G, J, M, Q, R) C. moschata. (E,H,K,N,S, T) A. cygnoides. (B, P, R, T) Hoechst-stained patterns of the same metaphase spreads shown in (A, O, Q, S), respectively. The arrow indicates the hybridization signal on the Z chromosome (A). Scale bars represent 10 μmin(A,B)and5μmin(C-T). 10 Journal of Poultry Science, 51 (1)

Fig. 7. Comparative cytogenetic maps of A. platyrhynchos, C. moschata, and A. cygnoides constructed with 37 genes. (A) Chromosome 1. (B) Chromosome 2. (C) Chromosome 3. (D) Chromosome 4. (E) The Z chromosome. APL, Anas platyrhynchos; CMO, Cairina moschata; ACY, Anser cygnoides. The chicken Z chromosome map has been inverted to facilitate a comparison with anserid Z chromosomes. The locations of the genes on chicken chromosomes were taken from the Ensembl Chicken Genome Browser (http://www.ensembl.org/Gallus_gallus). The gene symbols written in red indicate the genes that were included in chromosome rearrangements which occurred between the chicken and anserids or among three anserid species. chromosomes during the process of homogenization of cen- ITSs, in addition to the regular telomeric sites, were found in tromeric heterochromatin between different microchromo- the short arm of A. platyrhynchos chromosome 1 and the somes. centromeric region of C. moschata chromosome 1, which Interstitial telomeric sequences (ITSs) have been reported confirmed Nanda et al. (2002). However, the ITS signal in in many avian species as well as mammals and lower chromosome 1q, which was found in the graylag goose (A. vertebrates (Meyne et al., 1990; Nanda et al., 2002). These anser) (Nanda et al., 2002), was not observed in A. cyg- non-telomeric sites of (TTAGGG)n repeats and the co- noides, indicating species differences in the chromosomal localization of telomeric repeats and satellite DNA sequences distribution of non-telomeric sites in the genus Anser.No are most likely the result of chromosome rearrangements supporting cytogenetic evidence for telomere-to-telomere involving the chromosome ends (including inversions, fusion or inversion containing telomeric ends at these sites centric fusion, and telomere-to-telomere fusion) (Go et al., was obtained in the present study. In contrast, no hybrid- 2000; Li et al., 2000; Lear, 2001; Hartmann and Scherthan, ization signals of ITSs were detected in Falconidae and 2004; Ventura et al., 2006; Tsipouri et al., 2008). In addi- Accipitridae of Falconiformes by FISH mapping of telomeric tion, sequence analysis of ITSs revealed that the interstitial (TTAGGG)n repeats, although telomere-to-telomere fusions arrays of (TTAGGG)n repeats could be inserted at intra- frequently occurred between macro- and microchromosomes chromosomal sites through double-strand breaks in ancient and between microchromosomes in these species (Nishida chromosomes (Azzalin et al., 2001; Nergadze et al., 2004). et al., 2008, 2013). Nucleotide sequence-based analysis is Islam et al.: Comparative Mapping of Anseriformes and Galliformes 11 needed to understand the structures of ITSs and their origins CHD1, SPIN, and NTRK2 in the A. platyrhynchos Z chro- in these avian species. mosome when compared to the fine ostrich (Struthio Comparative gene mapping of 37 genes revealed rear- camelus) Z chromosome map (Tsuda et al., 2007). These rangements in chromosome 2 and the Z chromosome be- results indicate that the A. platyrhynchos Z chromosome tween the chicken and anserid species and in chromosome 4 retains the ancestral state of the Z chromosome of Gallo- and the Z chromosome between A. cygnoides and the two anserae and that centromere repositioning or multiple ex- duck species. Our previous karyological observation showed tensive inversions occurred in the lineage of the chicken after morphological differences in chromosome 1 and the Z chro- Galliformes diverged from the common ancestor of Gal- mosome between A. platyrhynchos and C. moschata:the loanserae. Therefore, the submetacentric A. cygnoides Z short arm of chromosome 1 was longer in A. platyrhynchos chromosome may have resulted from a pericentric inversion than C. moschata; and the Z chromosome was subtelocentric that occurred in the ancestral acrocentric Z chromosome of in A. platyrhynchos and acrocentric in C. moschata (Islam et Anseriformes. al., 2013). However, no cytogenetic evidence of small peri- The gene order on the acrocentric chromosome 4 in two centric inversions was found for chromosome 1 and the Z duck species (A. platyrhynchos and C. moschata) was similar chromosome between the two species in the present com- to that on the long arm of chicken submetacentric chromo- parative mapping. In previous studies (Fillon et al., 2007; some 4. Considering that the short arm of chicken chro- Skinner et al., 2009), chromosome rearrangements were mosome 4 was derived from a centric fusion between a found for chromosome 2 and the Z chromosome between the microchromosome and the ancestral acrocentric chromosome chicken and A. platyrhynchos. A small pericentric inversion 4, metacentric A. cygnoides chromosome 4 may have re- in chromosome 1, which was reported in Fillon et al. (2007) sulted from a pericentric inversion that occurred in the and Skinner et al. (2009), was not confirmed in the present ancestral acrocentric chromosome 4 of Anseriformes. study because the hybridization signal of GAPDH was These results conclusively suggest that karyotypes have detected near the centromere of the long arm in both the been highly conserved in Anseriformes because chromosome chicken and anserid species. However, a small pericentric rearrangements occurred less frequently among anserid spe- inversion in chromosome 2 and multiple inversions or cen- cies and also between Galliformes and Anseriformes after tromere-repositioning in the Z chromosome was confirmed they diverged around 100 million years ago (Pereira and in the present study. Baker, 2006, 2009; Brown et al., 2008; Kan et al., 2010; In the Z chromosome, genes in the distal regions of Pacheco et al., 2011). The findings in the present molecular- GGAZq (TMOD, CHD1) and GGAZp (HMGCS1, GHR, based cytogenetic analyses of chromosomes confirm earlier ATP5A1) were inversely localized to the proximal and distal studies and improve our understanding of the process of regions of the long arm of the A. platyrhynchos Z chromo- karyotype evolution in the lineage of Galloanserae. some, respectively, in the same order (Fillon et al., 2007; Acknowledgments Skinner et al., 2009; the present study), and the orders of nine Z-linked genes were almost the same between two We thank Darren Griffin of Kent University for providing species, although the centromere position differed between chicken chromosome-specific DNA probes of chromosomes two species: the A. platyrhynchos Z chromosome is sub- 1-9 and Z. This work was financially supported by Grants- telocentric, while GGAZ is metacentric. This result leads us in-Aid for Scientific Research on Innovative Areas (No. to predict two possibilities for the process of chromosome 23113004) and Scientific Research (B) (No. 22370081) from rearrangements in the Z chromosomes: 1) the metacentric the Ministry of Education, Culture, Sports, Science and chicken Z chromosome resulted from centromere reposition- Technology (MEXT), Japan. ing that occurred in the ancestral acrocentric Z chromosome References of Galloancerae, whose gene order remains almost intact in the A. platyrhynchos and C. moschata Z chromosomes; and Amaral KF and Jorge W. The chromosomes of the Order Falconi- 2) a large pericentric inversion occurred at the breakpoint formes: a review. Ararajuba, 11: 65-73. 2003. between RCL1 and HMGCS1 in the ancestral acrocentric Z Azzalin CM, Nergadze SG and Giulotto E. Human intrachromo- chromosome, followed by at least one large paracentric somal telomeric-like repeats: sequence organization and mech- inversion at the breakpoints between the centromere and anisms of origin. Chromosoma, 110: 75-82. 2001. Backström N, Palkopoulou E, Qvarnström A and Ellegren H. No TMOD1 and between RCL1 and the distal end (almost the evidence for Z-chromosome rearrangements between the pied whole region of the short arm) of the derived-metacentric Z flycatcher and the collared flycatcher as judged by gene-based chromosome, leading to the chicken Z chromosome, which comparative genetic maps. Molecular Ecology, 19: 3394- has a similar gene order to that of the A. platyrhynchos Z 3405. 2010. chromosome. The chromosomal locations of genes in the Belterman RHR and de Boer LEM. A karyological study of 55 proximal and distal regions of the acrocentric A. platyrhyn- species of birds, including karyotypes of 39 species new to chos Z chromosome and their gene order is very similar to cytology. Genetica, 65: 39-82. 1984. those of the ancestral Z chromosome of palaeognathous birds Brown JW, Rest JS, García-Moreno J, Sorenson MD and Mindell (Tsuda et al., 2007), although it is supposed that a para- DP. Strong mitochondrial DNA support for a Cretaceous origin centric inversion occurred in the interstitial region containing of modern avian lineages. BMC Biology, 6: 6. 2008. 12 Journal of Poultry Science, 51 (1)

Christidis L. Animal Cytogenetics, vol. 4. Chordata 3: Aves (John Poultry Science, 50: 311-320. 2013. B, Kayano H and Levan A eds.). Gebrüder Borntraeger, Berlin. Itoh Y, Kampf K and Arnold AP. Comparison of the chicken and 1990. zebra finch Z chromosomes shows evolutionary rearrange- Clarke JA, Tambussi CP, Noriega JI, Erickson GM and Ketcham ments. Chromosome Research, 14: 805-815. 2006. RA. Definitive fossil evidence for the extant avian radiation in Kan X-Z, Li X-F, Lei Z-P, Chen L, Gao H, Yang Z-Y, Yang J-K, the Cretaceous. Nature, 433: 305-308. 2005. Guo Z-C, Yu L, Zhang L-Q and Qian C-J. Estimation of Delany ME, Robinson CM, Goto RM and Miller MM. Architecture divergence times for major lineages of galliformes birds: and organization of chicken microchromosome 16: order of the Evidence from complete mitochondrial genome sequences. NOR, MHC-Y,andMHC-B subregions. Journal of Heredity, African Journal of Biotechnology, 9: 3073-3078. 2010. 100: 507-514. 2009. Lear TL. Chromosomal distribution of the telomere sequence de Oliveira EHC, Habermann FA, Lacerda O, Sbalqueiro IJ, (TTAGGG)n in the Equidae. Cytogenetics and Cell Genetics, Wienberg J and Müller S. Chromosome reshuffling in birds of 93: 127-130. 2001. prey: the karyotype of the world's largest eagle (Harpy eagle, Li Y-C, Lee C, Sanoudou D, Hsu T-H, Li S-Y and Lin C-C. Harpia harpyja) compared to that of the chicken (Gallus Interstitial colocalization of two cervid satellite DNAs involved gallus). Chromosoma, 114: 338-343. 2005. in the genesis of the Indian muntjac karyotype. Chromosome de Oliveira EHC, de Moura SP, dos Anjos LJS, Nagamachi CY, Research, 8: 363-373. 2000. Pieczarka JC, O’Brien PCM and Ferguson-Smith MA. Com- Matsuda Y and Chapman VM. Application of fluorescence in situ parative chromosome painting between chicken and spectacled hybridization in genome analysis of the mouse. Electro- owl (Pulsatrix perspicillata): implications for chromosomal phoresis, 16: 261-272. 1995. evolution in the Strigidae (Aves, Strigiformes). Cytogenetic Meyne J, Baker RJ, Hobart HH, Hsu TC, Ryder OA, Ward OG, and Genome Research, 122: 157-162. 2008. Wiley JE, Wurster-Hill DH, Yates TL and Moyzis RK. de Oliveira EHC, Tagliarini MM, Rissino JD, Pieczarka JC, Distribution of non-telomeric sites of the (TTAGGG)n telomer- Nagamachi CY, O’Brien PCM and Ferguson-Smith MA. Re- ic sequence in vertebrate chromosomes. Chromosoma, 99: ciprocal chromosome painting between white hawk (Leu- 3-10. 1990. copternis albicollis) and chicken reveals extensive fusions and Modi WS, Romanov M, Green ED and Ryder O. Molecular cyto- fissions during karyotype evolution of accipitridae (Aves, genetics of the California condor: evolutionary and conserva- Falconiformes). Chromosome Research, 18: 349-355. 2010. tion implications. Cytogenetic and Genome Research, 127: FillonV, Vignoles M, Crooijmans RPMA, Groenen MAM, Zoorob 26-32. 2009. R and Vignal A. FISH mapping of 57 BAC clones reveals Monroe Jr BL and Sibley CG. A World Checklist of Birds. Yale strong conservation of synteny between Galliformes and An- University Press, New Haven, CT, USA. 1993. seriformes. Animal Genetics, 38: 303-307. 2007. Nanda I, Schrama D, Feichtinger W, Haaf T, Schartl M and Schmid

Fridolfsson A-Kand Ellegren H. A simple and universal method for M. Distribution of telomeric (TTAGGG)n sequences in avian molecular sexing of non-ratite birds. Journal of Avian Biology, chromosomes. Chromosoma, 111: 215-227. 2002. 30: 116-121. 1999. Nanda I, Karl E, Volobouev V, Griffin DK, Schartl M and Schmid Go Y, Rakotoarisoa G, Kawamoto Y, Randrianjafy A, Koyama N M. Extensive gross genomic rearrangements between chicken and Hirai H. PRINS analysis of the telomeric sequence in seven and Old World vultures (Falconiformes: Accipitridae). Cyto- lemurs. Chromosome Research, 8: 57-65. 2000. genetic and Genome Research, 112: 286-295. 2006. Griffin DK, Haberman F, Masabanda J, O’Brien P, Bagga M, Nanda I, Karl E, Griffin DK, Schartl M and Schmid M. Chro- Sazanov A, Smith J, Burt DW, Ferguson-Smith M and mosome repatterning in three representative parrots (Psitta- Wienberg J. Micro- and macrochromosome paints generated by ciformes) inferred from comparative chromosome painting. flow cytometry and microdissection: tools for mapping the Cytogenetic and Genome Research, 117: 43-53. 2007. chicken genome. Cytogenetic and Cell Genetics, 87: 278-281. Nanda I, Benisch P, Fetting D, Haff T and Schmid M. Synteny 1999. conservation of chicken macrochromosomes 1-10 in different Griffin DK, Robertson LBW, Tempest HG and Skinner BM. The avian lineages revealed by cross-species chromosome painting. evolution of the avian genome as revealed by comparative Cytogenetic and Genome Research, 132: 165-181. 2011. molecular cytogenetics. Cytogenetic and Genome Research, Nergadze SG, Rocchi M, Azzalin CM, Mondello C and Giulotto E. 117: 64-77. 2007. Insertion of telomeric repeats at intrachromosomal break sites Griffiths R, Daan S and Dijkstra C. Sex identification in birds using during primate evolution. Genome Research, 14: 1704-1710. two CHD genes. Proceedings of the Royal Society B: Bio- 2004. logical Sciences, 263: 1251-1256. 1996. Nie W, O’Brien PCM, Ng BL, Fu B, Volobouev V, Carter NP, Griffiths R, Double MC, Orr Kand Dawson RJ. A DNA test to sex Ferguson-Smith MA and Yang F. Avian comparative ge- most birds. Molecular Ecology, 7: 1071-1075. 1998. nomics: reciprocal chromosome painting between domestic Guttenbach M, Nanda I, Feichtinger W, Masabanda JS, Griffin DK chicken (Gallus gallus) and the stone curlew (Burhinus and Schmid M. Comparative chromosome painting of chicken oedicnemus, Charadriiformes) -An atypical species with low autosomal paints 1-9 in nine different bird species. Cytogenetic diploid number. Chromosome Research, 17: 99-113. 2009. and Genome Research, 103: 173-184. 2003. Nishida-Umehara C, Tsuda Y, Ishijima J, Ando J, Fujiwara A, Hartmann N and Scherthan H. Characterization of ancestral chro- Matsuda Y and Griffin DK. The molecular basis of chromo- mosome fusion points in the Indian muntjac deer. Chromo- some orthologies and sex chromosomal differentiation in soma, 112: 213-220. 2004. palaeognathous birds. Chromosome Research, 15: 721-734. Islam FB, Ishishita S, Uno Y, Mollah MBR, Srikulnath Kand 2007. Matsuda Y. Male hybrid sterility in the mule duck is associated Nishida C, Ishijima J, Kosaka A, Tanabe H, Habermann FA, Griffin with meiotic arrest of primary spermatocytes. Journal of DKand Matsuda Y. Characterization of chromosome structures Islam et al.: Comparative Mapping of Anseriformes and Galliformes 13

of Falconinae (Falconidae, Falconiformes, Aves) by chromo- D, Fowler KE, Crooijmans RPMA, Hall AD, Griffin DK and some painting and delineation of chromosome rearrangements Völker M. Comparative genomics in chicken and Pekin duck during their differentiation. Chromosome Research, 16: 171- using FISH mapping and microarray analysis. BMC Genomics, 181. 2008. 10: 357. 2009. Nishida C, Ishijima J, Ishishita S, Yamada K, Griffin CK, Yamazaki Srikulnath K, Nishida C, Matsubara K, Uno Y, Thongpan A, T and Matsuda Y. Karyotype reorganization with conserved Suputtitada S, Apisitwanich S and Matsuda Y. Karyotypic genomic compartmentalization in dot-shaped microchromo- evolution in squamate reptiles: comparative gene mapping somes in the Japanese mountain hawk-eagle (Nisaetus nipalen- revealed highly conserved linkage homology between the sis orientalis, Accipitridae). Cytogenetic and Genome Research, butterfly lizard (Leiolepis reevesii rubritaeniata, Agamidae, 141: 284-294. 2013. Lacertilia) and the Japanese four-striped rat snake (Elaphe Pacheco MA, Battistuzzi FU, Lentino M, Aguilar RF, Kumar S and quadrivirgata, Colubridae, Serpentes). Chromosome Research Escalante AA. Evolution of modern birds revealed by mito- 17: 975-986. 2009. genomics: timing the radiation and origin of major orders. Stapley J, Birkhead TR, Burke T and Slate J. A linkage map of the Molecular Biology and Evolution, 28: 1927-1942. 2011. zebra finch Taeniopygia guttata provides new insights into Pereira SL and Baker AJ. A mitogenomic timescale for birds detects avian genome evolution. Genetics, 179: 651-667. 2008. variable phylogenetic rates of molecular evolution and refutes Takagi N and Sasaki M. A phylogenetic study of bird karyotypes. the standard molecular clock. Molecular Biology and Evolu- Chromosoma, 46: 91-120. 1974. tion, 23: 1731-1740. 2006. Tsipouri V, Schueler MG, Hu S, NISC Comparative Sequencing Pereira SL and Baker AJ. Waterfowl and gamefowl (Galloanserae). Program, Dutra A, Pak E, Riethman H and Green ED. Com- In: The Timetree of Life (Hedges SB and Kumar S eds.). pp parative sequence analyses reveal sites of ancestral chromoso- 415-418. Oxford University Press, Oxford, UK. 2009. mal fusions in the Indian muntjac genome. Genome Biology, 9: Shetty S, Griffin DKand Graves JAM. Comparative painting R155. 2008. reveals strong chromosome homology over 80 million years of Tsuda Y, Nishida-Umehara C, Ishijima J, Yamada Kand Matsuda bird evolution. Chromosome Research, 7: 289-295. 1999. Y. Comparison of the Z and W sex chromosomal architectures Shibusawa M, Minai S, Nishida-Umehara C, Suzuki T, Mano T, in elegant crested tinamou (Eudromia elegans) and ostrich Yamada K, Namikawa T and Matsuda Y. A comparative (Struthio camelus) and the process of sex chromosome dif- cytogenetic study of chromosome homology between chicken ferentiation in palaeognathous birds. Chromosoma, 116: 159- and Japanese quail. Cytogenetics and Cell Genetics, 95: 103- 173. 2007. 109. 2001. Ventura K, Silva MJJ, Fagundes V, Christoff AU and Yonenaga- Shibusawa M, Nishida-Umehara C, Masabanda J, Griffin DK, Isobe Yassuda Y. Non-telomeric sites as evidence of chromosomal

T and Matsuda Y. Chromosome rearrangements between rearrangement and repetitive (TTAGGG)n arrays in heterochro- chicken and guinea fowl defined by comparative chromosome matic and euchromatic regions in four species of Akodon painting and FISH mapping of DNA clones. Cytogenetic and (Rodentia, Muridae). Cytogenetic and Genome Research, 115: Genome Research, 98: 225-230. 2002. 169-175. 2006. Shibusawa M, Nishida-Umehara C, Tsudzuki M, Masabanda J, Wienberg J and Stanyon R. Chromosome painting in mammals as an Griffin DKand Matsuda Y. A comparative karyological study approach to comparative genomics. Current Opinion in Ge- of the blue-breasted quail (Coturnix chinensis, Phasianidae) netics and Development, 5: 792-797. 1995. and California quail (Callipepla californica, Odontophoridae). Wójcik E and Smalec E. Description of the Anser cygnoides goose Cytogenetic and Genome Research 106: 82-90. 2004a. karyotype. Folia Biologica, 56: 37-42. 2008. Shibusawa M, Nishibori M, Nishida-Umehara C, Tsudzuki M, Zhang Y, Zhang X, O’Hare TH, Payne WS, Dong JJ, Scheuring CF, Masabanda J, Griffin DKand Matsuda Y. Karyotypicevolution Zhang M, Huang JJ, Lee M-K, Delany ME, Zhang H-B and in the Galliformes: An examination of the process of karyo- Dodgson JB. A comparative physical map reveals the pattern of typic evolution by comparison of the molecular cytogenetic chromosomal evolution between the turkey (Meleagris gal- findings with the molecular phylogeny. Cytogenetic and Ge- lopavo) and chicken (Gallus gallus) genomes. BMC Genomics, nome Research, 106: 111-119. 2004b. 12: 447. 2011. Skinner BM, Robertson LBW, Tempest HG, Langley EJ, Ioannou