DOCSLIB.ORG

In Vivo Gene Expression in Granulosa Cells During Pig Terminal Follicular Development. A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In Vivo Gene Expression in Granulosa Cells During Pig Terminal Follicular Development. A In vivo gene expression in granulosa cells during pig terminal follicular development. A. Bonnet, Kim-Anh Lê Cao, M. Sancristobal, F. Benne, C. Robert-Granié, G. Law-So, S. Fabre, Philippe Besse, E. de Billy, Hélène Quesnel, et al. To cite this version: A. Bonnet, Kim-Anh Lê Cao, M. Sancristobal, F. Benne, C. Robert-Granié, et al.. In vivo gene expression in granulosa cells during pig terminal follicular development.. Reproduction, BioScientifica, 2008, 136 (2), pp.211-24. 10.1530/REP-07-0312. hal-00960020 HAL Id: hal-00960020 https://hal.archives-ouvertes.fr/hal-00960020 Submitted on 30 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. REPRODUCTIONRESEARCH In vivo gene expression in granulosa cells during pig terminal follicular development A Bonnet, K A Leˆ Cao1,3, M SanCristobal, F Benne, C Robert-Granie´1, G Law-So, S Fabre2, P Besse3, E De Billy, H Quesnel4, F Hatey and G Tosser-Klopp INRA, UMR 444, Ge´ne´tique Cellulaire, F-31326 Castanet-Tolosan Cedex, France, 1INRA, UR, Station d’Ame´lioration Ge´ne´tique des Animaux, F-31326 Castanet-Tolosan Cedex, France, 2INRA, UMR6175, Physiologie de la Reproduction et des Comportements, CNRS, Universite´ de Tours, Haras Nationaux, F-37380 Nouzilly, France, 3Universite´ Paul Sabatier, UMR 5219, Institut de Mathe´matiques, F-31062 Toulouse Cedex 9, France and 4INRA, UMR INRA/AgroCampus Rennes: Syste`mes d’Elevage, Nutrition Animale et Humaine, F-35590 Saint Gilles, France Correspondence should be addressed to A Bonnet; Email: [email protected] Abstract Ovarian antral follicular development is clearly dependent on pituitary gonadotrophins FSH and LH. Although the endocrine mechanism that controls ovarian folliculogenesis leading to ovulation is quite well understood, the detailed mechanisms and molecular determinants in the different follicular compartments remain to be clarified. The aim of this study was to identify the genes differentially expressed in pig granulosa cells along the terminal ovarian follicle growth, to gain a comprehensive view of these molecular mechanisms. First, we developed a specific micro-array using cDNAs from suppression subtractive hybridization libraries (345 contigs) obtained by comparison of three follicle size classes: small, medium and large antral healthy follicles. In a second step, a transcriptomic analysis using cDNA probes from these three follicle classes identified 79 differentially expressed transcripts along the terminal follicular growth and 26 predictive genes of size classes. The differential expression of 18 genes has been controlled using real-time PCR experiments validating the micro-array analysis. Finally, the integration of the data using Ingenuity Pathways Analysis identified five gene networks providing descriptive elements of the terminal follicular development. Specifically, we observed: (1) the down-expression of ribosomal protein genes, (2) the genes involved in lipid metabolism and (3) the down-expression of cell morphology and ion-binding genes. In conclusion, this study gives new insight into the gene expression during pig terminal follicular growth in vivo and suggested, in particular, a morphological change in pig granulosa cells accompanying terminal follicular growth. Reproduction (2008) 136 211–224 Introduction Those factors control follicular growth either directly or The growth and development of ovarian follicles leading indirectly: for example, bone morphogenetic protein or to ovulation require a series of coordinated events that the insulin-like growth factor (IGF) systems (Monget et al. lead to follicular somatic cell differentiation and oocyte 2002, Mazerbourg et al. 2003, Shimasaki et al. 2004) development. It includes two successive periods, modify the sensitivity of follicular cells to FSH, and preantral (primordial, primary and secondary follicles) epidermal growth factor signalling network potentializes and antral (early antral, antral and preovulatory follicles) LH action (Hattori et al. 1995). Follicular development is follicular developments. Follicles undergo morpho- thus a complex process and requires the coordinate logical and functional changes as they progress towards expression of a large number of genes. The mechanisms ovulation. Among all growing follicles, only a small underlying this development have been intensively proportion of them (less than 1%) will ovulate. Most of studied mainly in granulosa cells because they constitute them undergo a degenerative process called atresia that an important compartment in the mammalian ovarian occurs at the different developmental stages. The antral follicle. They actively participate in the endocrine follicular development depends on a complex regulatory function of the ovaries by secreting oestradiol or network with endocrine regulation by pituitary gonado- progesterone under FSH or LH stimulation (Duda 1997). trophins follicle-stimulating hormone (FSH) and luteiniz- In pigs, in vitro experiments or in situ hybridization ing hormone (LH) but also with autocrine and paracrine have allowed the individual description of gene pathways (Hsueh 1986) including the action of steroids expression in granulosa cells during the growth of antral and peptides (Hillier & Miro 1993, Drummond 2006). follicles. They referred mainly to the role of FSH, the IGF q 2008 Society for Reproduction and Fertility DOI: 10.1530/REP-07-0312 ISSN 1470–1626 (paper) 1741–7899 (online) Online version via www.reproduction-online.org 212 A Bonnet and others system and growth factors on gene expression sequences (35%) corresponded to the whole insert regulation, and the expression of genes involved in (presence of vector flanking sequences). The average steroidogenesis such as CYP19A (Chan & Tan 1987) and insert sequence length was 640 bp. STAR (Balasubramanian et al. 1997). Despite continuing All sequences were deposited in EMBL public progress in the area of ovarian biology, many of the database (accession numbers: CR939025–CR940296; specific mechanisms involved in follicular development, CT971504–CT971571; CT990474–CT990531) and sub- including the initiation of primordial follicle growth, mitted to an assembly process (Sigenae contig assembly; antrum formation, follicular growth/selection and Pig V3 p.sc.3, 30/01/2006). Our 1378 sequences were follicular atresia, remain to be elucidated in greater part of 345 contigs, 63 of which were new sequences. detail. Then, global approaches have been undertaken to The contig analysis revealed a global redundancy of identify new genes involved in antral follicle maturation. 75%. This redundancy was explained by the high Our previous data obtained on porcine granulosa cells proportion of sequences coming from only three genes, in vitro by suppression subtractive hybridization (SSH) or CYP19A, GSTA and PGFS1 representing 15, 13.5 and differential display PCR suggested a role of FSH in 10% of the sequences respectively. There was no contig extracellular matrix synthesis, chromatin remodelling, overlap between the forward and reverse libraries for SF regulation of transcription activity and protection against versus LF comparison and around 10–18% for SF versus atresia (Clouscard-Martinato et al. 1998, Bonnet et al. MF comparison. 2006b). Moreover, different cDNA libraries obtained The PCR products of the 1697 clones (345 genes/con- from whole follicles of different size classes were tigs) resulting from SSH experiments were spotted onto generated to create a catalogue of differentially nylon membrane along with 1056 already sequenced expressed genes along antral follicle development PCR products (954 genes/contigs) to generate our micro- using sequence frequency in each library (Jiang et al. array platform (GEO accession number GPL3978). 2004). However, despite the development of DNA micro-array techniques in the pig (Tuggle et al. 2007), only few transcriptomic data are available concerning Micro-array analysis the ovarian function. In order to identify genes whose expression differs along Thus, using the pig as a model and a transcriptomic the terminal growth and maturation of porcine ovarian approach, the aim of this study was to identify follicles, 14 complex cDNA radiolabelled probes syn- differentially expressed genes along terminal ovarian thesized from the three different size class follicles were follicular development, before the onset of preovulatory hybridized onto our specific cDNA micro-array (1275 LH surge. The experiment has focused especially on genes/contigs). Data (GEO accession number GSE5798 the time of expression of functional LH receptors in dataset) were pre-processed resulting in a list of 1564 granulosa cells that occur in 4–5 mm follicle size expressed cDNAs, corresponding to 515 different genes and classically considered as a maturation marker in or contigs of sequences assembled by SIGENAE. follicle development (May & Schomberg 1984). Then, A mixed linear model was applied to the 1564 cDNAs we developed first a micro-array using cDNAs from to quantify the hybridization signal intensity measured SSH libraries obtained
Load more

Recommended publications
  • Chronic Exposure of Humans to High Level Natural Background Radiation Leads to Robust Expression of Protective Stress Response Proteins S
    www.nature.com/scientificreports OPEN Chronic exposure of humans to high level natural background radiation leads to robust expression of protective stress response proteins S. Nishad1,2, Pankaj Kumar Chauhan3, R. Sowdhamini3 & Anu Ghosh1,2* Understanding exposures to low doses of ionizing radiation are relevant since most environmental, diagnostic radiology and occupational exposures lie in this region. However, the molecular mechanisms that drive cellular responses at these doses, and the subsequent health outcomes, remain unclear. A local monazite-rich high level natural radiation area (HLNRA) in the state of Kerala on the south-west coast of Indian subcontinent show radiation doses extending from ≤ 1 to ≥ 45 mGy/y and thus, serve as a model resource to understand low dose mechanisms directly on healthy humans. We performed quantitative discovery proteomics based on multiplexed isobaric tags (iTRAQ) coupled with LC–MS/MS on human peripheral blood mononuclear cells from HLNRA individuals. Several proteins involved in diverse biological processes such as DNA repair, RNA processing, chromatin modifcations and cytoskeletal organization showed distinct expression in HLNRA individuals, suggestive of both recovery and adaptation to low dose radiation. In protein–protein interaction (PPI) networks, YWHAZ (14-3-3ζ) emerged as the top-most hub protein that may direct phosphorylation driven pro- survival cellular processes against radiation stress. PPI networks also identifed an integral role for the cytoskeletal protein ACTB, signaling protein PRKACA; and the molecular chaperone HSPA8. The data will allow better integration of radiation biology and epidemiology for risk assessment [Data are available via ProteomeXchange with identifer PXD022380]. Te basic principles of low linear energy transfer (LET) ionizing radiation (IR) induced efects on mammalian systems have been broadly explored and there exists comprehensive knowledge on the health efects of high doses of IR delivered at high dose rates.
    [Show full text]
  • Visualization of Human Karyopherin Beta-1/Importin Beta-1 Interactions
    www.nature.com/scientificreports OPEN Visualization of human karyopherin beta-1/importin beta-1 interactions with protein partners in mitotic Received: 28 April 2017 Accepted: 29 December 2017 cells by co-immunoprecipitation Published: xx xx xxxx and proximity ligation assays Laura Di Francesco1,4, Annalisa Verrico2, Italia Anna Asteriti2, Paola Rovella2, Pietro Cirigliano3, Giulia Guarguaglini2, Maria Eugenia Schinin1 & Patrizia Lavia 2 Karyopherin beta-1/Importin beta-1 is a conserved nuclear transport receptor, acting in protein nuclear import in interphase and as a global regulator of mitosis. These pleiotropic functions refect its ability to interact with, and regulate, diferent pathways during the cell cycle, operating as a major efector of the GTPase RAN. Importin beta-1 is overexpressed in cancers characterized by high genetic instability, an observation that highlights the importance of identifying its partners in mitosis. Here we present the frst comprehensive profle of importin beta-1 interactors from human mitotic cells. By combining co-immunoprecipitation and proteome-wide mass spectrometry analysis of synchronized cell extracts, we identifed expected (e.g., RAN and SUMO pathway factors) and novel mitotic interactors of importin beta-1, many with RNA-binding ability, that had not been previously associated with importin beta-1. These data complement interactomic studies of interphase transport pathways. We further developed automated proximity ligation assay (PLA) protocols to validate selected interactors. We succeeded in obtaining spatial and temporal resolution of genuine importin beta-1 interactions, which were visualized and localized in situ in intact mitotic cells. Further developments of PLA protocols will be helpful to dissect importin beta-1-orchestrated pathways during mitosis.
    [Show full text]
  • 1 Title: Ultra-Conserved Elements in the Human Genome Authors And
    4/22/2004 Title: Ultra-conserved elements in the human genome Authors and affiliations: Gill Bejerano*, Michael Pheasant**, Igor Makunin**, Stuart Stephen**, W. James Kent*, John S. Mattick** and David Haussler*** *Department of Biomolecular Engineering and ***Howard Hughes Medical Institute, University of California Santa Cruz, Santa Cruz, CA 95064, USA **ARC Special Research Centre for Functional and Applied Genomics, Institute for Molecular Bioscience, University of Queensland, Brisbane, QLD 4072, Australia Corresponding authors: Gill Bejerano ([email protected]) and David Haussler ([email protected]) -------------------------------------------------------------------------------------------------------------------- Supporting on-line material: Separate figures, Like Figure 1 but for each individual chromosome are available in postscript and PDF format, at http://www.cse.ucsc.edu/~jill/ultra.html. Table S1. A table listing all 481 ultra conserved elements and their properties can be found at http://www.cse.ucsc.edu/~jill/ultra.html. The elements were extracted from an alignment of NCBI Build 34 of the human genome (July 2003, UCSC hg16), mouse NCBI Build 30 (February 2003, UCSC mm3), and rat Baylor HGSC v3.1 (June 2003, UCSC rn3). This table does not include an additional, probably ultra conserved element (uc.10) overlapping an alternatively spliced exon of FUSIP1, which is not yet placed in the current assembly of human chromosome 1. Nor does the list contain the ultra conserved elements found in ribosomal RNA sequences, as these are not currently present as part of the draft genome sequences. The small subunit 18S rRNA includes 3 ultra conserved regions of sizes 399, 224, 212bp and the large subunit 28S rRNA contains 3 additional regions of sizes 277, 335, 227bp (the later two are one base apart).
    [Show full text]
  • Hnrnp U (HNRNPU) (NM 031844) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214320 hnRNP U (HNRNPU) (NM_031844) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: hnRNP U (HNRNPU) (NM_031844) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HNRNPU Synonyms: DEE54; EIEE54; GRIP120; hnRNP U; HNRNPU-AS1; HNRPU; pp120; SAF-A; SAFA; U21.1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 hnRNP U (HNRNPU) (NM_031844) Human Tagged ORF Clone – RC214320 ORF Nucleotide >RC214320 representing NM_031844 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTTCCTCGCCTGTTAATGTAAAAAAGCTGAAGGTGTCGGAGCTGAAAGAGGAGCTCAAGAAGCGAC GCCTTTCTGACAAGGGTCTCAAGGCCGAGCTCATGGAGCGACTCCAGGCTGCGCTGGACGACGAGGAGGC CGGGGGCCGCCCCGCCATGGAGCCCGGGAACGGCAGCCTAGACCTGGGCGGGGATTCCGCTGGGCGCTCG GGAGCAGGCCTCGAGCAGGAGGCCGCGGCCGGCGGCGATGAAGAGGAGGAGGAAGAGGAAGAGGAGGAGG AAGGAATCTCCGCTCTGGACGGCGACCAGATGGAGCTAGGAGAGGAGAACGGGGCCGCGGGGGCGGCCGA CTCGGGCCCGATGGAGGAGGAGGAGGCCGCCTCGGAAGACGAGAACGGCGACGATCAGGGTTTCCAGGAA GGGGAAGATGAGCTCGGGGACGAAGAGGAAGGCGCGGGCGACGAGAACGGGCACGGGGAGCAGCAGCCTC AACCGCCGGCGACGCAGCAGCAACAGCCCCAACAGCAGCGCGGGGCCGCCAAGGAGGCCGCGGGGAAGAG
    [Show full text]
  • Wilms' Tumour 1 (WT1) in Development, Homeostasis and Disease
    © 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 2862-2872 doi:10.1242/dev.153163 PRIMER Wilms’ tumour 1 (WT1) in development, homeostasis and disease Nicholas D. Hastie* ABSTRACT particularly those involving mesenchyme-to-epithelial transitions The study of genes mutated in human disease often leads to new (MET) and the reverse process, epithelial-to-mesenchyme transition insights into biology as well as disease mechanisms. One such gene (EMT); (3) the cellular origins of mesenchymal progenitors for a is Wilms’ tumour 1 (WT1), which plays multiple roles in development, variety of tissue types, pinpointing the key role of the mesothelium; tissue homeostasis and disease. In this Primer, I summarise how this and (4) fundamental aspects of transcription and epigenetic multifaceted gene functions in various mammalian tissues and regulation. WT1 is also an example of how protein isoforms organs, including the kidney, gonads, heart and nervous system. differing by just a few amino acids may have profoundly different This is followed by a discussion of our current understanding of the functions. Here, I provide an overview of the WT1 gene, molecular mechanisms by which WT1 and its two major isoforms highlighting how it functions in the development and homeostasis regulate these processes at the transcriptional and post- of various organs and tissues, and how its mutation can lead to transcriptional levels. disease. KEY WORDS: WT1, Developmental disorders, Homeostasis, WT1 structure, evolution and isoforms Molecular mechanisms of disease The mammalian WT1 gene is ∼50 kb in length, encoding proteins from as many as ten exons. There are at least 36 potential Introduction mammalian WT1 isoforms, the diversity created through a The Wilms’ tumour 1 (WT1) gene was first identified in 1990 as a combination of alternative transcription start sites, translation start strong candidate predisposition gene for Wilms’ tumour(Calletal., sites, splicing and RNA editing (Fig.
    [Show full text]
  • Genome-Wide Analysis of Organ-Preferential Metastasis of Human Small Cell Lung Cancer in Mice
    Vol. 1, 485–499, May 2003 Molecular Cancer Research 485 Genome-Wide Analysis of Organ-Preferential Metastasis of Human Small Cell Lung Cancer in Mice Soji Kakiuchi,1 Yataro Daigo,1 Tatsuhiko Tsunoda,2 Seiji Yano,3 Saburo Sone,3 and Yusuke Nakamura1 1Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, The University of Tokyo, Tokyo, Japan; 2Laboratory for Medical Informatics, SNP Research Center, Riken (Institute of Physical and Chemical Research), Tokyo, Japan; and 3Department of Internal Medicine and Molecular Therapeutics, The University of Tokushima School of Medicine, Tokushima, Japan Abstract Molecular interactions between cancer cells and their Although a number of molecules have been implicated in microenvironment(s) play important roles throughout the the process of cancer metastasis, the organ-selective multiple steps of metastasis (5). Blood flow and other nature of cancer cells is still poorly understood. To environmental factors influence the dissemination of cancer investigate this issue, we established a metastasis model cells to specific organs (6). However, the organ specificity of in mice with multiple organ dissemination by i.v. injection metastasis (i.e., some organs preferentially permit migration, of human small cell lung cancer (SBC-5) cells. We invasion, and growth of specific cancer cells, but others do not) analyzed gene-expression profiles of 25 metastatic is a crucial determinant of metastatic outcome, and proteins lesions from four organs (lung, liver, kidney, and bone) involved in the metastatic process are considered to be using a cDNA microarray representing 23,040 genes and promising therapeutic targets. extracted 435 genes that seemed to reflect the organ More than a century ago, Stephen Paget suggested that the specificity of the metastatic cells and the cross-talk distribution of metastases was not determined by chance, but between cancer cells and microenvironment.
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]
  • Targeted in Situ Cross-Linking Mass Spectrometry and Integrative Modeling Reveal the Architectures of Three Proteins from SARS-Cov-2
    Targeted in situ cross-linking mass spectrometry and integrative modeling reveal the architectures of three proteins from SARS-CoV-2 Moriya Slavina,1, Joanna Zamela,1, Keren Zohara,1, Tsiona Eliyahua, Merav Braitbarda, Esther Briellea, Leah Barazb,c, Miri Stolovich-Rainc, Ahuva Friedmanc, Dana G. Wolfd, Alexander Rouvinskic, Michal Liniala,2, Dina Schneidman-Duhovnya,e,2, and Nir Kalismana,2 aDepartment of Biological Chemistry, Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 9190401, Israel; bHadassah Academic College Jerusalem, Jerusalem 9101001, Israel; cDepartment of Microbiology and Molecular Genetics, Institute for Medical Research Israel-Canada, The Kuvin Center for the Study of Infectious and Tropical Diseases, The Hebrew University-Hadassah Medical School, The Hebrew University of Jerusalem, Jerusalem 9190401, Israel; dClinical Virology Unit, Hadassah Hebrew University Medical Center, 9190401 Jerusalem, Israel; and eThe Rachel and Selim Benin School of Computer Science and Engineering, The Hebrew University of Jerusalem, Jerusalem 9190401, Israel Edited by Ivet Bahar, University of Pittsburgh School of Medicine, Pittsburgh, PA, and approved July 13, 2021 (received for review February 22, 2021) Atomic structures of several proteins from the coronavirus family In situ cross-linking and mass spectrometry (in situ CLMS) are still partial or unavailable. A possible reason for this gap is the allows probing protein structure inside intact cells (4, 5). In this instability of these proteins outside of the cellular context, thereby approach, cells are incubated with a membrane-permeable cross- prompting the use of in-cell approaches. In situ cross-linking and linking reagent, which reacts with the cellular proteins in their mass spectrometry (in situ CLMS) can provide information on the native environment.
    [Show full text]
  • Supplementary Data
    SUPPLEMENTARY METHODS 1) Characterisation of OCCC cell line gene expression profiles using Prediction Analysis for Microarrays (PAM) The ovarian cancer dataset from Hendrix et al (25) was used to predict the phenotypes of the cell lines used in this study. Hendrix et al (25) analysed a series of 103 ovarian samples using the Affymetrix U133A array platform (GEO: GSE6008). This dataset comprises clear cell (n=8), endometrioid (n=37), mucinous (n=13) and serous epithelial (n=41) primary ovarian carcinomas and samples from 4 normal ovaries. To build the predictor, the Prediction Analysis of Microarrays (PAM) package in R environment was employed (http://rss.acs.unt.edu/Rdoc/library/pamr/html/00Index.html). When more than one probe described the expression of a given gene, we used the probe with the highest median absolute deviation across the samples. The dataset from Hendrix et al. (25) and the dataset of OCCC cell lines described in this manuscript were then overlaid on the basis of 11536 common unique HGNC gene symbols. Only the 99 primary ovarian cancers samples and the four normal ovary samples were used to build the predictor. Following leave one out cross-validation, a predictor based upon 126 genes was able to identify correctly the four distinct phenotypes of primary ovarian tumour samples with a misclassification rate of 18.3%. This predictor was subsequently applied to the expression data from the 12 OCCC cell lines to determine the likeliest phenotype of the OCCC cell lines compared to primary ovarian cancers. Posterior probabilities were estimated for each cell line in comparison to the following phenotypes: clear cell, endometrioid, mucinous and serous epithelial.
    [Show full text]
  • Cytogenomic Characterization of 1Q43q44 Deletion Associated with 4Q32.1Q35.2 Duplication and Phenotype Correlation A
    Mohamed et al. Molecular Cytogenetics (2018) 11:57 https://doi.org/10.1186/s13039-018-0406-0 CASE REPORT Open Access Cytogenomic characterization of 1q43q44 deletion associated with 4q32.1q35.2 duplication and phenotype correlation A. M. Mohamed1*, H. T. El-Bassyouni2, A. M. El-Gerzawy1, S. A. Hammad1, N. A. Helmy1, A. K. Kamel1, S. I. Ismail2, M. Y. Issa2, O. Eid1 and M. S. Zaki2 Abstract Background: Microdeletion of 1q43q44 causes a syndrome characterized by intellectual disability (ID), speech delay, seizures, microcephaly (MIC), corpus callosum abnormalities (CCA) and characteristic facial features. Duplication of 4q is presented with minor to severe ID, MIC and facial dysmorphism. We aimed to verify the correlation between genotype/phenotype in a patient with 1q43q44 deletion associated with 4q32.1q35.2 duplication. Case presentation: We report on a 3 year-old female patient with delayed motor and mental milestones, MIC and facial dysmorphism. She is a child of non-consanguineous parents and no similarly affected family members. CT brain showed abnormal gyral patterns, hypogenesis of corpus callosum and bilateral deep Sylvian fissure. Electroencephalogram showed frontotemporal epileptogenic focus. Her karyotype was revealed as 46,XX,add(1)(q44). Fluorescence in situ hybridization (FISH) using whole chromosome paint (WCP1) and subtelomere 1q revealed that the add segment was not derived from chromosome 1 and there was the deletion of subtelomere 1q. Multiple ligation probe amplification (MLPA) subtelomere kit revealed the deletion of 1q and duplication of 4q. Array CGH demonstrated the 6.5 Mb deletion of 1q and 31 Mb duplication of chromosome 4q. Conclusion: The phenotype of our patient mainly reflects the effects of haploinsufficiency of AKT3, HNRNPU, ZBTB18 genes associated with duplication of GLRA3, GMP6A, HAND2 genes.
    [Show full text]
  • Of the Human Genome
    GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAACTGGTGCAATGATGGTAGTGGAAATGGAGGAGAGGGGATTGATTCAAGATGCATTTAGGACCAAGAATCGGGAGCTTGTGAA CGTGTGTATGAGTACTGTAGACGGAGTGGGTGTGTCATCAGAGAAGATCTGAGCATTTGGGCTTGCTCTCCTCAGAGGCCCTGCGAGTGGAGTTCAGCTT TTCCTCATGGGGCAAATCTCACTTTCGCTCCAGTTCCTGGGGCTCAGAGTCCCTGGCCCAGATGCCTCTTGCCATCTCATCTTCACCCTGCCTGGCTTCC CTTGCTTGTTCCUltraconservationUltraconservationAGGATTGTTTCATAAAGAGGGATGTGGTTGGTCTTTAACCCTATGAATGC&&TGGC FunctionFunctionTGAGGATGCCTGCGGAACCTGTAGTGAAGCTTTC AGGGGCTGCTCGGGTTCTGGCTGGTAGGTGAACACTGTCCATCTTGCCGGCTGGGACACAGTGACTCTGGGTAGTTGTGTAAGAGAGGGGCCCTTGGCAG ACAAACAGGTTCTTCTCTGTTGGTGGGCCAGCCAGCAGGTCAGTGGGAAGGTTAAAGGTCATGGGGTTTGGGAGAACTGGGTGAGGAGTTCAGCCCCATC CCCCGTAAAGCTCCTGGGAAGinCACTT CTCTtheACTGGG GCAHumanGCCCCTGATACCAGGGCA GenomeCTCATTAACCCTCTGGGTGCCAGGGAAAGGGCAGGAGGTGAGT GCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAGGCTCAGGGCCCTGGAGTATAAAGCAGAA TGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCT CTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAG GAAAGACCTGTTGGAGGCTATGAATGCAATCAAGGTGACAGACAACTGGTGCAATGATGGTAGTGGAAATGGAGGAGAGGGGATTGATTCAAGATGCATT TAGGACCAAGAATCGGGAGCTTGTGAACGTGTGTATGAGTACTGTAGACGGAGTGGGTGTGTCATCAGAGAAGATCTGAGCATTTGGGCTTGCTCTCCTC AGAGGCCCTGCGAGTGGAGTTCAGCTTTTCCTCATGGGGCAAATCTCACTTTCGCTCCAGTTCCTGGGGCTCAGAGTCCCTGGCCCAGATGCCTCTTGCC
    [Show full text]