Phylogeography and Conservation Genetics of Two Endangered Amphibians, Blanchard's Cricket Frog (Acris crepitans blanchardi) and the Puerto Rican Crested Toad (Peltophryne lemur)
Kaela B. Beauclerc
A thesis submitted to the Committee on Graduate Studies in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Faculty of Arts and Science
TRENT UNIVERSITY
Peterborough, Ontario, Canada
© Kaela B. Beauclerc 2009
Environmental and Life Sciences Ph.D. Program
May 2009
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Abstract
Phylogeography and Conservation Genetics of Two Endangered Amphibians, Blanchard's Cricket Frog (Acris crepitans blanchardi) and the Puerto Rican Crested Toad (Peltophryne lemur)
Kaela B. Beauclerc
I investigated the genetic diversity and structure of two endangered amphibians with the
goal of developing conservation recommendations. The Puerto Rican crested toad
(Peltophryne lemur) is a critically endangered tropical bufonid, for which one wild
population remains. Declines are primarily due to habitat modification, and recovery
efforts include captive breeding of northern and southern populations. In contrast,
Blanchard's cricket frog (Acris crepitans blanchardi) is a temperate hylid that is
declining at the northern edge of its range, but for which many large southern populations
exist. The causes of declines are not well understood, and few conservation efforts have
been initiated. I profiled the captive and wild populations of P. lemur, and 185 locations
encompassing all Acris taxa, at the mitochondrial control region and several novel
microsatellite loci. P. lemur had moderate microsatellite allelic diversity, but northern
and southern populations were each fixed for a different mitochondrial haplotype. The
northern population possessed many private microsatellite alleles that, when combined
with habitat differences, may be indicative of adaptive variation. Given the highly inbred
nature of the northern population and its likely extirpation, I recommend that a third
breeding colony be established in which northern and southern individuals are mixed to
preserve any unique northern traits. Profiling of A. c. blanchardi revealed a relatively
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. uniform northern clade and a substructured southern clade. Low genetic diversity in the
north may be contributing to declines. The south was likely a refugium during
Pleistocene glaciations, while the north experienced repeated population expansions and
contractions. Phylogenetic analysis of all Acris species and subspecies indicated that
substantial revisions to current taxonomy and distributions are required, including
elevation of A. blanchardi to species status. Diversification within this complex
primarily reflects large rivers, changes in elevation, and Pleistocene glaciations.
Recognition of A. blanchardi as a species increases the urgency of conservation actions,
and the distinctiveness of northern populations suggests that they may possess adaptive
traits that should be conserved. Phylogeographic and spatial analysis provide a
framework for actions such as reintroductions. Overall, this research demonstrates the
importance of incorporating genetic information into recovery recommendations and
management actions for threatened species.
Keywords: amphibian, anuran, declining amphibian populations, endangered species,
Acris, Peltophryne lemur, cricket frog, Puerto Rican crested toad, microsatellite,
mitochondrial DNA, control region, phylogeography, genetic structure, conservation
genetics, Pleistocene glaciation
11
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Acknowledgements
Immense thanks go to my advisor, Dr. Brad White, for having the patience to see this through to the end. He provided the right amount of prodding, was always available for discussions, and could be counted on to keep the "bigger picture" in focus. I am also grateful to my committee members, Drs. Michael Berrill and David Galbraith, for providing a fresh perspective and forcing me to think outside the DNA. Bob Johnson at the Toronto Zoo is the inspiration for this work and life in general. His passion for these little frogs and their conservation is contagious. I am indebted to him for providing me with these fascinating projects, and for letting me tag along to Puerto Rico and participate in recovery efforts for the crested toad. This was full of unforgettable experiences, including swimming in the Caribbean Sea, maniac drivers, bomba with some locals, rainforests, tiny toad metamorphs, and roadside roasted chicken. Very special thanks go to Drs. Chris Wilson and Paul Wilson for countless chats about my research and my future. Dr. Tim Frasier cannot be thanked enough for his time explaining the minutiae to me and critiquing some of this work. Linda Cardwell of the ENLS program helped to smooth out the endless bumps encountered along the way. Her enthusiasm is refreshing. Andrew Lentini coordinated samples from the Toronto Zoo and endured many annoying emails from me. The cast and crew of the NRDPFC have made this experience enjoyable and unforgettable. Many technicians were instrumental in generating the data and I am sincerely grateful to all of them: Sue White-Sobey, Karen Mills, Kristyne Wozney, Smolly Coulson, and Jen Dart have variously sequenced, genotyped, and picogreened samples. Blane Bell is the automation wiz that maintained my sanity by extracting almost one thousand samples. Very special thanks go to my cohort of grad students, particularly Drs. Cathy Cullingham, Tim Frasier, Brenna McLeod, Roxanne Gillet, and Mark Ball for assistance, sympathy, rides to school, and life outside the lab. Dr. Stephen Petersen and his Mac were always ready to run ModelTest for me.
111
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Ariana Rickard and Edi Sonntag are thanked for dragging me along during their field work in Michigan so I could have some perspective on cricket frogs in real life. I am indebted to the following people for providing tissue samples of Acris: Joe Bartoszek, Neil Bass, Neil Bernstein, Will Bird, Luis Bonachea, Ron Bonnett, Jeff Briggler, Liz Burton, Brian Butterfield, Jeffrey Camper, Keith Coleman, Jeffrey Davis, Kevin Enge, Amy Estep, Eugenia Farrar, Dan Fogell, Carl Franklin, David Garcia, Dave Golden, Wayne Hildebrand, John Himes, John Jensen, Glen Johnson, Bob Jones, John Kleopfer, Kenny Krysko, Mike Lannoo, Jim Lee, Lisa Lehnhoff, Richard Lehtinen, Gregory Lipps, Mike Lodato, Malcolm McCallum, Brian Metts, Jonathan Micancin, Richard Montanucci, Nate Nazdrowicz, Jeff Parmelee, Steve Perrill, John Petzing, Stephen Richter, Ariana Rickard, Leslie Rissler, Floyd Scott, Don Shepard, Dirk Stevenson, David Swanson, Ashley Traut, Stan Trauth, and Zack Walker. Special thanks go to Donna Dittman at Louisiana State University Museum of Natural Science and Travis Taggart at the Sternberg Museum of Natural History, Fort Hays State University for arranging substantial tissue loans of Acris. Many thanks go to Miguel Canals of the Guanica State Forest and Rick Dietz of the Audubon Nature Institute for providing tissue samples of the Puerto Rican crested toad. Dr. Juan Rivero graciously allowed me to sample the historic specimens in his private collection, Jaime Matos-Torres provided additional specimens, and Gail Ross tromped around Puerto Rico collecting historic tissue samples, but these unfortunately were not incorporated. My family deserves special recognition for enduring me throughout my seemingly infinite university education. My parents, Murray and Marianne Jacobs, have encouraged and supported my education goals and love of biology and animals since I first protected that acre of rainforest in grade 9. Parker made sure I knew there was a world outside of my laptop and got some fresh air and exercise twice a day. My husband Michael encouraged, supported, listened, laughed, and vacuumed the house every week. He has seen me at my worst throughout this, and stuck it out anyways. He is my emotional stability and my best friend. Thank you for believing in me.
IV
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table of Contents
Abstract ...... ii
Acknowledgements ...... iv
List ofFigures ...... vii
List of Tables ...... viii
Chapter 1 General Introduction ...... 1
Declining amphibian populations ...... 1 Conservation genetics ...... 3 Biology and conservation of Peltophryne lemur ...... 7 Biology and conservation of A eris crepitans blanchardi ...... 14 Thesis objectives and overview ...... 22
Chapter 2 Genetic Rescue of an Inbred Captive Population of the Critically Endangered Puerto Rican Crested Toad (Peltophryne lemur) by Mixing Lineages ...... 27
Abstract ...... 28 Introduction ...... 29 Materials and Methods ...... 34 Results ...... 39 Discussion ...... 46
Chapter 3 Characterisation, Multiplex Conditions, and Cross-Species Utility of Tetranucleotide Microsatellite Loci for Blanchard's Cricket Frog (Acris crepitans blanchardi) ...... 55
Abstract ...... 56 Introduction ...... 57 Materials and Methods ...... 57 Results and Discussion ...... 63
V
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Chapter 4 Phylogeography and Spatial Structure of Blanchard's Cricket Frog (Acris crepitans blanchardi): Conservation Issues at the Northern Edge of its Range ...... 68
Abstract ...... 69 Introduction ...... 70 Materials and Methods ...... 74 Results ...... 79 Discussion ...... 90
Chapter 5 Molecular Phylogenetics of the North American Cricket Frog Complex (Genus Acris) Across its Range ...... 99
Abstract ...... 100 Introduction ...... 101 Materials and Methods ...... 108 Results ...... 116 Discussion ...... 131
Chapter 6 General Discussion ...... 157
Conservation genetics of Peltophryne lemur ...... 157 Synthesis of Acris data and conservation genetics of A. blanchardi ...... 158 Value of genetics to conservation biology ...... 164 Conclusion ...... 166
Literature Cited ...... 167
Appendices ...... 199
Vl
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. List of Figures
Figure 1.1. Male and female P. lemur ...... 9
Figure 1.2. Large costume character of P. lemur used for public education ...... 13
Figure 1.3. Currently accepted species and subspecies of A eris ...... 15
Figure 2.1. Map of Puerto Rico and the British Virgin Islands with extirpated and extant populations of P. lemur ...... 31
Figure 2.2. Microsatellite allele frequencies for three P. lemur populations ...... 42
Figure 4.1. Location of sampling sites for A. c. blanchardi ...... 71
Figure 4.2. Linear regression of nucleotide diversity with latitude and longitude for A. c. blanchardi ...... 81
Figure 4.3. Median joining network of A. c. blanchardi haplotypes ...... 82
Figure 4.4. FcT and Fsc for groupings of A. c. blanchardi sites using spatial analysis of molecular variance ...... 83
Figure 4.5. Correlograms of genetic and geographic distance for A. c. blanchardi ...... 86
Figure 4.6. Pairwise mismatch distributions for A. c. blanchardi groups ...... 89
Figure 5.1. Distribution of currently accepted A eris taxa ...... 104
Figure 5.2. Distribution of sample collection sites and major clades of Acris ...... 109
Figure 5.3. Unrooted Bayesian phylogenetic tree for Acris haplotypes ...... 118
Figure 5.4. Bayesian phylogenetic tree of A. c. blanchardi haplotypes ...... 126
Figure 5.5. Bayesian phylogenetic tree of A. gryllus haplotypes ...... 129
Figure 5.6. Geographic boundaries for Acris identified using BARRIER ...... 130
Figure 5.7. The Mississippi Delta showing localities containing A. blanchardi and A. gryllus specimens ...... 138
Figure 5.8. Major physiographic divisions of the United States ...... 140
Figure 5.9. Geographic distribution of allozymes among A eris populations ...... 150
Vll
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. List of Tables
Table 2.1. Primers and amplification conditions for six microsatellite loci isolated from P. lemur ...... 38
Table 2.2. Characteristics of six microsatellite loci in three populations of P. lemur ...... 41
Table 2.3. Diversity indices for six microsatellite loci in three populations of P. lemur ...... 43
Table 2.4. Genetic distance measures using six microsatellite loci for three populations of P. lemur ...... 45
Table 3.1. Characteristics of tetranucleotide microsatellite loci and multiplex amplification conditions for A. c. blanchardi ...... 59
Table 3.2. Genetic diversity indices for 16 tetranucleotide microsatellite loci in two populations of A. c. blanchardi ...... 62
Table 3.3. Genetic distance measures for 16 microsatellite loci in two populations of A. c. blanchardi ...... 64
Table 3.4. Cross-amplification ability of A c. blanchardi microsatellite loci in related A eris subspecies and species ...... 67
Table 4.1. Summary of sampling sites for A. c. blanchardi ...... 75
Table 4.2. Characteristics of seven A. c. blanchardi groups identified using spatial analysis of molecular variance ...... 85
Table 4.3. Neutrality tests and parameters of the mismatch distribution for A. c. blanchardi groups ...... 87
Table 5.1. Summary of samples collected for five Acris subspecies ...... 111
Table 5.2. Characteristics of three Acris phylogenetic clades ...... 119
Table 5.3. Sequence divergences between various Acris lineages ...... 120
Table 5.4. Analysis of molecular variance for various Acris groupings ...... 122
Table 5.5. Pairwise
Vlll
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 1 -
Chapter 1
General Introduction
Declining amphibian populations
Declining amphibian populations have received widespread attention since the
First World Congress of Herpetology in 1989, when researchers shared anecdotes of
disappearing amphibian populations around the globe (Barinaga 1990; Phillips 1990;
Wyman 1990). Initial skepticism suggested that these declines may simply be artifacts of
the short duration of most studies, during which natural population fluctuations were
mistaken to be catastrophic declines or extinctions (Pechmann et al. 1991; Pechmann and
Wilbur 1994; Alford and Richards 1999; Skelly et al. 2003). For example, many
amphibian species are thought to exist as metapopulations, in which local populations are
periodically extirpated but recolonised several years later (Blaustein et al. 1994; Hanski
1998; Alford and Richards 1999; Marsh and Trenham 2001). Some species will also
forego breeding in years with unfavourable climate; since most amphibian surveys focus
on reproductive habitat, researchers may wrongly conclude that a population has become
extirpated in such instances (Crump et al. 1992; Alford and Richards 1999; Skelly et al.
2003). However, numerous studies have since established the reality of global amphibian
declines. Models have suggested that the combination of events at some locations is
highly unlikely to have occurred by chance alone (Pounds et al. 1997, 1999; Alford and
Richards 1999; Houlahan et al. 2000). Continued monitoring has substantiated the
extinction of some species (Pounds et al. 1999; Meyer et al. 2004; Pounds and Savage
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 2 -
2004), while others have documented the decline of healthy populations in real time (Lips
et al. 2006). A recent survey of the IUCN Global Amphibian Assessment found that
more than 30% of the world's amphibians are globally threatened, far more than either
birds or mammals (Stuart et al. 2004). We may be in the midst of a sixth mass extinction
(Wake and Vredenburg 2008), with the disappearance of amphibians possibly 45 000
times greater than the background rate of extinction (Mccallum 2007).
Numerous factors are considered to be involved in the decline of amphibian
populations around the world. Disappearances of many populations can be attributed to
"obvious" causes for which there is a good understanding of the underlying ecological
mechanisms; these include habitat alteration and fragmentation, introduced species that
prey upon and/or compete with native species, and over-exploitation for human
consumption, medicinal use, and the pet trade ("class I" hypotheses; Collins and Storfer
2003). However, many populations, primarily in Neotropical montane regions and
Australia, have declined despite their existence in protected and seemingly intact habitats
(Stuart et al. 2004). The underlying mechanisms of these "enigmatic" declines are poorly
understood, but likely involve global change ( encompassing climate and UV radiation),
chemicals, and emerging infectious diseases ("class II" hypotheses; Collins and Storfer
2003). Interaction among multiple stressors can compound the effects of these individual
factors and exacerbate declines of amphibian populations. For example, climate-induced
reductions in water depth resulted in increased exposure to UV-Band subsequent greater
infection by the fungus Saprolegniaferax in western toads (Bufo boreas) in the northwest
USA (Kiesecker et al. 2001). Similarly, climate warming has resulted in reduced mist
frequency in Neotropical,montane regions (Pounds et al. 1999, 2006), which has been
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 3 -
linked to outbreaks of the emergent pathogenic fungus Batrachochytrium dendrobatidis
that resulted in rapid, massive die-offs of aquatic amphibians in this area (Pounds and
Crump 1994; Burrowes et al. 2004; Lips et al. 2006; but see Rohr et al. 2008). Species
with restricted geographic ranges may be at greatest risk of extinction, as they typically
occupy highly specialised niches and are more vulnerable to stochastic events (Sodhi et
al. 2008). Pond-breeding anurans may be most affected by habitat fragmentation, as they
require more frequent dispersal due to large population fluctuations in an unstable habitat
(Green 2003). Larger body size, which is associated with lower reproductive rate and
reduced recovery potential, and pronounced seasonality, which increases susceptibility to
changes in climate, may also increase a species' extinction risk (Sodhi et al. 2008).
Conservation genetics
Addressing the environmental ( e.g. habitat destruction, contaminants, road
mortality) and demographic (e.g. stochastic variation in recruitment or sex structure)
issues that contribute to population declines is critical for the effective recovery of an
endangered species. However, it is the genetic variation within populations that will
determine their ability to adapt to changing environments, and thus their long-term
viability (Mace et al. 1996). The role of genetics in conservation has been recognised for
over 20 years (A vise 1989), but the field of "conservation genetics" has only emerged
during the past decade. A number of initiatives, including the journal Conservation
Genetics in 2000 and an introductory textbook (Frank.ham et al. 2002), have enabled this
field to flourish and become an integral component to the recovery of endangered
species. The primary genetic issues that should be considered within a conservation
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 4 -
framework include determining levels of genetic diversity, structure, and gene flow
among populations; resolving taxonomic uncertainties and defining management units;
evaluating the deleterious consequences of small population size and isolation; and the
application of management tools such as ex situ breeding programs and reintroductions.
Determining the geographic patterns of genetic diversity, structure, and gene flow
among populations, or phylogeography, is fundamental to understanding the biology and
evolutionary history of a species (A vise 2000). However, it also provides a framework
for developing appropriate and practical management strategies for endangered species.
For example, a phylogeographic study can determine whether isolated populations have
experienced recent gene flow, or if they represent independently evolving lineages
(James and Moritz 2000; Carpenter et al. 2001; Eizirik et al. 2001; Burns et al. 2007;
Amato et al. 2008). It may identify populations that are important to conserve because
they are reservoirs of genetic variation (Rowe et al. 1998; Tarr and Fleischer 1999), or
those with limited variation and thus reduced evolutionary potential that are at greatest
risk of extirpation (Bos and Sites 2001; Vianna et al. 2006). One important outcome of a
broad-scale phylogeographic study is the evaluation of existing taxonomy and the
identification of distinct population units. Phenotypic traits can be highly polymorphic
and may be influenced by environmental conditions; consequently, traditional taxonomic
assignments based on morphology may not precisely reflect patterns of genetic variation
(Burbrink et al. 2000; Culver et al. 2000; Nittinger et al. 2007; but see Avise and Walker
1999). This can waste available resources on groups that are not genetically distinct and
therefore have limited conservation value to the species (Avise and Nelson 1989; Zink et
al. 2000). Alternatively, a phylogeographic study may detect the presence of distinct
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 5 -
lineages that warrant separate management as species, subspecies, or evolutionary
significant units (Moritz 1999; Fraser and Bernatchez 2001 ). Early recognition of such
lineages is imperative, as they may be at greater extinction risk due to rarity (Daugherty
et al. 1990; Wang et al. 1999, 2008; Nielson et al. 2001; Vredenburg et al. 2007).
Small, isolated populations are known to be more vulnerable to stochastic
environmental and demographic events, such as hurricanes, droughts, low recruitment, or
skewed sex ratios. However, they also commonly suffer from genetic impoverishment.
The genetic bottleneck that may accompany a population crash can significantly erode
genetic variation, measured as heterozygosity and number of alleles, as only a portion of
the population's original genetic composition survives (Hoelzel et al. 1993; Whitehouse
and Harley 2001; Frankham et al. 2002; Larson et al. 2002). Genetic drift also has a
greater impact on rates of fixation in small populations, and can cause further loss of
diversity and increase the genetic distance between isolated populations as they become
fixed for different alleles ( Goodman et al. 2001; Hedrick 2001; Wilson et al. 2008). The
low diversity that results from genetic drift and inbreeding in small populations may be
associated with physical abnormalities and reduced fitness (Patenaude et al. 1994;
Westemeier et al. 1998; Rowe et al. 1999; Hedrick and Kalinowski 2000; Halverson et al.
2006; Siddle et al. 2007). The reduced genetic variation that often characterises small
populations may limit its ability to respond to changing environments, thereby increasing
its chance of extinction (Mehlman 1997; Bridges and Semlitsch 2001; Frankham et al.
2002). Populations at the periphery of a species' range are typically small and isolated,
experiencing reduced gene flow, increased genetic drift, and greater levels of inbreeding
(Lesica and Allendorf 1995). This may leave these populations genetically depauperate
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 6 -
and thus more susceptible to extirpation from stochastic events (Descimon and
Napolitano 1993; Rowe et al. 1999; Hutchison 2003; but see Lomolino and Channell
1995; Eckert et al. 2008). Conversely, peripheral populations may be a source for
speciation, as isolation and genetic drift facilitate divergence from core populations in
response to local selection pressures (Lesica and Allendorf 1995; Garcia-Ramos and
Kirkpatrick 1997). Furthermore, the highly variable conditions to which they are
subjected may enable them to maintain unique genetic diversity and evolve greater
resistance to environmental extremes and future changes (Volis et al. 1998; Eckstein et
al. 2006; Bohme et al. 2007). For these reasons, peripheral populations, even of
relatively widespread species, may be valuable and worthy of conservation efforts
(Hunter and Hutchinson 1994; Lesica and Allendorf 1995).
A thorough understanding of genetic diversity and structure of a species is crucial
to implementing efficient and optimal recovery activities, such as identifying populations
for use in translocation or reintroduction efforts (Shaffer et al. 2000, 2004a; Godoy et al.
2004; Wilson et al. 2008). Source populations should be genetically similar to the
recipient population to reduce outbreeding depression, increase survival potential, and
maintain evolutionary trajectories (Drew et al. 2003; Kraaijeveld-Smit et al. 2005), but
also genetically diverse to maximise variation, minimise swamping of native individuals,
and reduce current and future inbreeding depression (Madsen et al. 1999; Friar et al.
2000; Frankham et al. 2002; Land et al. 2004). A genetic survey can be critical to these
efforts, as geographically proximal populations are not necessarily the most genetically or
adaptively similar (Chek et al. 2001; Trapnell et al. 2007).
The effectiveness of reintroductions as a means of facilitating the recovery of
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 7 -
endangered amphibian populations is controversial (Burke 1991; Dodd and Seigel 1991;
Bloxam and Tonge 1995; Marsh and Trenham 2001; Trenham and Marsh 2002; Seigel
and Dodd 2002; Germano and Bishop 2009). Although many reintroduction attempts
have failed and the outcome of others remains unclear (Dodd and Seigel 1991 ), an
extensive recovery program involving habitat restoration, genetic analyses, and
reintroductions has successfully established at least six new populations of the natterjack
toad (Bufo calamita) in formerly occupied areas in Britain (Denton et al. 1997).
Furthermore, a recent review of amphibian translocations (Germano and Bishop 2009)
found a much greater success rate than was reported nearly 20 years ago (Dodd and
Seigel 1991). Most reintroduction programs for which long term data were available did
not incorporate genetic data into their design (Dodd and Seigel 1991); it is thus possible
that the failure of many of these programs was due in part to the lack of genetic
information prior to their initiation. Animals with limited dispersal capabilities, such as
amphibians, are particularly susceptible to increased genetic divergence between
populations, and substructuring may occur at very fine scales such as among individual
ponds (Shaffer et al. 2000). This suggests that the genetic composition of amphibian
populations is not trivial to the design of a recovery plan, and must be considered fully to
maximise the potential for successful restoration of endangered species.
Biology and conservation of Peltophryne lemur
The Puerto Rican crested toad (Peltophryne lemur) is the only toad endemic to
Puerto Rico. Peltophryne is a monophyletic genus consisting of ten species of bufonid
toads endemic to the West Indies (Schwartz and Henderson 1991 ), and has had a
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 8 -
tumultuous taxonomic history. The genus Peltophryne was first proposed by Fitzinger in
1843, but was later incorporated into Bufo (Gunther 1858; Stejneger 1902). The species
Peltaphryne lemur was first described, and misspelled (Smith and Goebel 1994), by Cope
(1868). In 1917 Barbour identified Bufo turpis on Virgin Gorda, which was later
considered to be Bufo lemur (Schwartz and Thomas 1975). Pregill (1981a) demonstrated
that all endemic West Indian bufonids formed a natural, monophyletic group distinct
from other members of Bufo based on the shared, unique feature of co-ossification of the
skull. He thus suggested that generic recognition of the West Indian bufonids was
appropriate, and resurrected the name Peltophryne. Further morphological and molecular
data also supported the monophyly of West Indian toads (Pramuk et al. 2001; Pramuk
2002). However, immunological distances (Hedges et al. 1992; Hass et al. 2001) and
mitochondrial DNA sequences (Graybeal 1997) showed that the genus Peltophryne was
nested within a paraphyletic Bufo; as such, Hedges (1996) stated that Peltophryne should
again be synonimised with Bufo. Most recently, Frost et al. (2006) proposed that the
large genus Bufo be partitioned into a number of distinct genera, including Peltophryne.
As this is the most recent treatment of West Indian toad taxonomy, I will refer to the
species group as Peltophryne.
Peltophryne lemur is a medium-sized toad, with a snout-vent length ranging from
72-120 mm (Rivero et al. 1980). It has a long, upturned snout, golden marbled eyes, and
prominent supraorbital crests (Figure 1.1) (Pregill 1981a). The toad's local name, sapo
concho, is derived from this latter feature and means shelled or crested toad. There is
conspicuous sexual dimorphism: breeding males are bright yellow, while females are
light to dark grey in colour, considerably larger, possess larger crests, and are wartier
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 9 -
Figure 1.1. Male (upper) and female P. lemur. Photo © Paddy Ryan/Ryan Photographic. Used with permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 10 -
(Figure 1.1) (Rivero et al. 1980). P. lemur has been collected from at least eight locations
across Puerto Rico and one on Virgin Gorda of the British Virgin Islands (Figure 2.1 ). It
generally occupies low-elevation(< 200 m), arid or semi-arid coastal regions and is often
associated with limestone karst formations (Schmidt 1928; Rivero et al. 1980; USFWS
1992). This rocky substrate provides abundant fissures and cavities into which it retreats
during the day, emerging late at night to feed and breed (Miller 1985). This may provide
an adaptive explanation for the co-ossification of their skulls: individuals have been
observed using their heads to block the entrance to their burrows (Rivero et al. 1980),
which may prevent desiccation (Seibert et al. 1974; Pregill 1981a). Breeding is sporadic
and occurs in temporary pools formed by heavy rains, with individuals likely breeding
only once per year (USFWS 1992). There appears to be high fidelity to breeding sites,
with individuals travelling up to four kilometres to reach a particular site (Miller 1985).
Although fossil specimens from caves suggest that P. lemur was once abundant
throughout Puerto Rico (Pregill 1981 b ), it has been scarce since the initiation of specimen
collection for natural history museums (Stejneger 1902). It has not been seen on Virgin
Gorda for over 30 years (USFWS 1992), and was thought to be extinct from 1931-1965
(Rivero 1978). In 1966, several individuals were found near the town of Isabela in
northwest Puerto Rico (Garcia-Diaz 1967), and another population was found in nearby
Quebradillas in 1974 (Rivero et al. 1980) (Figure 2.1). It is likely that the semi-fossorial
nature of P. lemur, combined with poor collecting techniques, contributed to this species'
apparent scarcity (Pregill 1981 b ). In 1984, a large breeding population of 1000-2000
toads was found in southwest Puerto Rico at the Guanica State Forest Reserve (Moreno
1985). Currently, it is believed that the Guanica population is the only remaining wild
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 11 -
population, as no toads have been seen in the north since 1988 (Barber 2007).
Peltophryne lemur was granted SSP (Species Survival Plan) designation by the
Association of Zoos and Aquariums in 1984, the first amphibian to be included in the
program (Maruska 1986). It was listed as threatened under the US Endangered Species
Act in 1987. The primary cause of decline is habitat loss and alteration from
anthropogenic factors. Breeding sites have been drained or filled in for construction,
agriculture, and mosquito control (USFWS 1992). The main breeding pond in Guanica is
a beach parking lot that was frequently drained for access, and the area around the cattle
troughs where P. lemur was found breeding in Quebradillas is regularly sprayed with
pesticides (Johnson 1990). Predation by feral dogs, cats, and introduced mongooses
(Herpestes auropunctatus) may also be a factor (USFWS 1992). The cane toad (Bufo
marinus) was introduced to Puerto Rico in the 1920s to assist in the control of sugar cane
grubs and has since become firmly established across the island (Rivero et al. 1980).
Because P. lemur was rare prior to the introduction of B. marinus, it cannot be solely
blamed for the species' current scarcity. However, predation by the larger B. marinus has
been known to occur in Guanica, and may be directed towards the much smaller males of
P. lemur (Rivero et al. 1980; USFWS 1992). Competition is likely also a factor: B.
marinus was twenty times more abundant at one site, and its earlier metamorphosis
enables it to exclude P. lemur toadlets from refuges, resulting in their death from
exposure (USFWS 1992). The small size and isolation of the only remaining population
in Guanica means that it is also vulnerable to stochastic environmental and demographic
events. For example, many breeding toads were washed out to sea when a pond at the
Guanica State Forest Reserve was inundated during a hurricane in 1985 (Johnson 1990).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 12 -
Recovery efforts for P. lemur have been extensive in Puerto Rico. The Guanica
breeding pond is closed during the three-week breeding season and is no longer drained
for parking (Johnson 1990). At Guanica National Forest, toads have been radiotracked to
monitor movement, the chemistry of the breeding ponds has been analysed, and habitat
preferences of toads have been evaluated (Johnson 1990; Matos-Torres 2006). Four
individuals from Quebradillas were captured and used to establish a captive· breeding
colony in 1980. In 1985, 20 individuals from the newly discovered Guanica population
were used to establish a separate breeding colony representing the southern lineage, with
12 additional individuals later incorporated. These captive populations are maintained
separately because preliminary protein electrophoresis data (Lacy and Foster 1987),
combined with the large geographic distance that separates them, suggest that they may
be divergent. To date, more than 110 000 tadpoles have been released into constructed
ponds in Guanica Forest (Barber 2007), and in 2003 and 2005, captive-born adult toads
returned to breed (PRCT SSP 2006). Before de-listing will be considered, at least three
disjunct, self-sustaining populations of 1500-2000 individuals must be maintained on
each of the northern and southern coasts of the island for 10 years (USFWS 1992). This
will limit the erosion of genetic variation and provide a source for recolonisation in the
event of extirpation of one population. To meet these requirements, several additional
ponds have been constructed in Guanica and Gabia in the south (Barber 2007). In the
north, efforts are underway to secure property in Quebradillas and Cambalache National
Forest, and in 2006 tadpoles were released at three newly constructed ponds in Arecibo
(Barber 2007). Due to the scarcity of P. lemur, Puerto Ricans have come to call the
introduced B. marinus by P. lemur's common name, sapo concho (Grant 1931; Rivero
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 13 -
Figure 1.2. Large costume character of P. lemur developed for public education in Puerto Rico. Photo taken at the Juan Rivero Zoo in Mayaguez with a group of school children. Photo© 2006 Eduardo Valdez. Used with permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 14 -
1978; pers. obs.). An island-wide program has since been developed to educate citizens
and instill a sense of pride and stewardship for their endemic toad. This has involved the
distribution of posters, bumper stickers, activity books for children, and the creation of
life-size models and a large costume character (Barber 2007) (Figure 1.2).
Biology and conservation ofAcris crepitans blanchardi
Acris are nonclimbing, semi-aquatic members of the treefrog family Hylidae.
This genus contains two species, northern (A. crepitans) and southern (A. gryllus) cricket
frogs, which are further subdivided into five currently recognised subspecies:
Blanchard's (A. c. blanchardi), northern (A. c. crepitans), coastal (A. c. paludicola),
southern (A. g. gryllus), and Florida (A. g. dorsalis) cricket frogs (Conant and Collins
1998) (Figure 1.3). A. c. blanchardi is the most western and northern form of the
complex, ranging throughout the south and central Great Plains and Midwest (Conant and
Collins 1998) (Figure 5.1). This small (1.6 to 3.8 cm SVL) anuranprimarily occupies
level banks or floating vegetation of slow-moving, permanent water bodies with low
canopy cover (Burkett 1984; Smith et al. 2003; Beasley et al. 2005; Lehtinen and Skinner
2006). Although it seldom ventures far from the water (Pyburn 1958; Blair 1961), it has
been found to disperse up to 1.3 km between ponds (Gray 1983). Calling may begin in
early February in southern areas (Pyburn 1958; Blair 1961) or April/May in northern
states, and lasts until June or July (Johnson and Christiansen 1976; Burkett 1984). Newly
metamorphosed frogs appear within five to ten weeks and are very abundant (Pyburn
1961; Burkett 1984 ). Typically, a single breeding event occurs and consists of one clutch
with up to 400 eggs (Gray et al. 2005). However, females may lay multiple clutches in
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 15 -
Figure 1.3. Currently accepted species and subspecies of Acris. Top left and right: A. c. blanchardi from Michigan(© 2005 Ariana Rickard); middle left: A. c. crepitans from Tennessee(© 2006 Liz Burton); middle right: A. c. paludicola (© Gary Nafis); bottom left: A. g. gryllus from South Carolina(© John Willson); bottom right: A. g. dorsalis from Florida(© 2006 James Harding). All photos used with permission.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 16 -
the south (Trauth et al. 2004), and a second breeding event by the young-of-the-year has
been observed in Texas (Pyburn 1961; Bayless 1969). Only about 5% of newly emerged
juveniles usually survive to the next breeding season, although evidence indicates that
much of the mortality occurs prior to overwintering (Gray 1983; Burkett 1984; but see
Irwin 2005). Activity declines towards the winter, and in some areas juveniles
overwinter in crayfish burrows and cracks in the pond bank (Gray 1971; Irwin et al.
1999). Adult life expectancy is four months, and most of the previous year's adults have
disappeared by October (Gray and Brown 2005). This results in complete population
turnover every 16 months (Burkett 1984; McCallum and Trauth 2004).
Acris c. blanchardi was once considered to be the most common amphibian in
many parts of the upper Midwest (Lannoo et al. 1994; Hay 1998; Mierzwa 1998; Gray
and Brown 2005f Although it continues to be abundant throughout much of the central
and southern Great Plains, populations have been in decline along the northern and
western edge of its range. It has disappeared from several historical sites in northern
Illinois (Mierzwa 1998) and Indiana (Minton 1998), Michigan (Lehtinen 2002), Iowa
(Lannoo et al. 1994; Hemesath 1998), Wisconsin (Mossman et al. 1998), Nebraska
(McLeod 2005), and eastern Ohio (Lehtinen and Skinner 2006). It is likely extirpated
from Minnesota (Moriarty 1998), Colorado (Hammerson and Livo 1999), and Ontario
(Kellar et al. 1997). A. c. blanchardi is now considered to be the "species of most
concern in the Midwest" (Lannoo 1998a, p. 430), and is listed as endangered or
threatened in several areas (e.g. Ontario, Kellar et al. 1997; Michigan, Eagle et al. 2005;
Wisconsin, WI DNR 2005). Declines in this subspecies are different from those of most
amphibians because it is relatively widespread and common in many areas. It has also
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 17 -
been considered somewhat of a habitat generalist (but see below), and is frequently found
in man-made habitats such as ditches, quarries, cattle tanks, and aquaculture ponds
(Bragg 1940; Lehtinen 2002; Lehtinen and Skinner 2006). Perhaps most disconcerting
about these declines is their lack of definitive causes. While habitat loss has likely
contributed, it does not appear sufficient to account for the magnitude and distribution of
the declines (Lannoo 1998b; Knutson et al. 2000). The conversion of the Midwest to
agriculture was complete by the early twentieth century, well before the reported declines
(Gray and Brown 2005). In fact, potential habitat has actually increased in many areas
due to the construction of rural ponds (Leja 1998). Habitat alteration, however, may have
greatly contributed to declines in some areas. The use of agricultural chemicals became
widespread after the 1950s, coinciding with the onset of A. c. blanchardi declines in the
Midwest (Knutson et al. 2000). The application of the herbicide copper sulfate extirpated
this amphibian from one pond in Illinois (Gray and Brown 2005), while levels of organic
pollutants, including PCBs and DDT, were found to be very high in frogs from the now
extirpated population on Pelee Island, Ontario (Campbell 1978). Intersex gonads and
masculinisation occur in high frequency where exposure to PCBs and DDT is greatest,
and likely contributed to the disappearance of this subspecies from northeastern Illinois
(Reeder et al. 2005). Other industrial contaminants such as mercury (Diana and Beasley
1998) and perchlorate (Theodorakis et al. 2006) may also negatively affect individuals.
Tadpoles of the related subspecies A. c. crepitans had the lowest tolerance to acidified
water among eleven species (Gosner and Black 1957), and were significantly less
abundant in acidified macrocosms (Sparling et al. 1995). However, numerous studies
have found little association between declines and such environmental issues. Organic
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 18 -
pollutants were below toxic levels in several Ohio (Russell et al. 2002) and Illinois
(Beasley et al. 2005) ponds where declines occurred, and high concentrations of the
pesticide chlorpyrifos had little effect on tadpoles (Widder and Bidwell 2008). Some A.
c. crepitans individuals were found to develop a tolerance to lethal concentrations of
DDT (Boyd et al. 1963), demonstrating the potential for adaptation. Furthermore,
Lehtinen and Skinner (2006) found no effect of pH or acid neutralising capacity of ponds
on the distribution of extant and extirpated populations of A. c. blanchardi in Ohio, and it
was actually significantly more abundant in agriculturally-intensive parts of the state.
A variety of other factors have been implicated in declines of northern A. c.
blanchardi populations. Bullfrogs [Rana (Lithobates) catesbeiana] have been observed
to prey heavily on this small frog (Burkett 1984), and introductions significantly affected
amphibian populations in Iowa (Gray and Brown 2005). However, Beasley et al. (2005)
found that reproductive success in A. c. blanchardi was only marginally affected by the
number of bullfrogs. Morphological deformities within this anuran are generally less
than the baseline rate of 2% documented for amphibians (Gray 2000; Ouellet 2000;
Rickard and Sonntag 2006), although rates as high as 14.6% have been observed from
some localities and may be on the rise (McCallum and Trauth 2003; but see Gray 2000).
Some evidence also suggests that the incidence of undetected skeletal abnormalities may
be relatively high (Maglia et al. 2007). This may not be a contributing factor in Illinois,
however, as several malformed individuals were captured multiple times, and at least two
survived through the winter to the following breeding season (Gray 2000). Individuals
have been found that carry trematode (McCallum and Trauth, unpublished) and
protozoan (Jirku et al. 2006) parasites, but these studies did not report on pathological
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 19 -
symptoms. Furthermore, parasites are a common affliction of wild amphibians and are
rarely associated with clinical disease (Crawshaw 2000), although larval renal trematodes
appeared to influence survival of individuals in Illinois (Beasley et al. 2005). Chytrid
fungus (Batrachochytrium dendrobatidis) was detected in up to 15% of A. c. blanchardi
individuals across the Midwest and Great Plains, although no geographic trend was
apparent and both populations and individuals seemed healthy overall (Steiner and
Lehtinen 2008). Finally, the eggs of this anuran may be significantly affected by UV
light, perhaps because they are unprotected by large egg masses, egg sheaths, or
pigments, and are more exposed to solar radiation than some frogs as they are laid closer
to the water surface and later in the year (Van Gorp 2001 ).
Clearly, investigation into the cause of A. c. blanchardi declines has produced
ambiguous or conflicting results. It is probable that various factors have had a greater
impact on populations at different times and in different locations (Gray and Brown
2005). It is also likely that, in addition to the direct effect of each factor, they are acting
indirectly and/or synergistically to cause declines. For example, ponds in Illinois treated
with herbicides had the lowest numbers of metamorphosing A. c. blanchardi individuals
(Beasley et al. 2005). Rather than direct kills from chemicals, however, this appeared to
be caused by damage to plants that reduced food, cover, and dissolved oxygen for
tadpoles, while juvenile frogs were heavily infested by renal parasites and showed signs
of stress. Modelling of A. c. blanchardi populations in Illinois found that biocides and
predation were the most likely factors to cause extirpation (Veldman 1997).
Immunologically-challenged male A. c. blanchardi displayed reduced investment in
reproduction, suggesting that pathogens or toxins may diminish male fertility and
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 20 -
contribute to population declines (McCallum and Trauth 2007).
Global climate change has likely resulted in various modifications to the habitat
of A. c. blanchardi that may not be immediately apparent as potential contributors to
declines. Lannoo (1998b) describes a combination of three factors as the likely cause of
declines in the Prairie Pothole region of Iowa. Prolonged droughts, which occur on a
roughly ten-year cycle and may increase in severity and/or frequency with climate
change, can eliminate many preferred breeding sites (seasonal and semi-permanent
wetlands) for several consecutive years. The short lifespan of this anuran means that
adults must breed each year to maintain the population,· and therefore must utilise
permanent wetlands during droughts. However, many such sites have been rendered
unsuitable for amphibian breeding by aquaculture, agriculture, and fish and bullfrog
introductions. As well, movement to alternate sites or recolonisation of extirpated sites is
likely limited during droughts (Greenwell et al. 1996; Hay 1998), as this anuran is very
susceptible to desiccation (Ralin and Rogers 1972) and mainly disperses following heavy
rains (Pyburn 1958). This problem is exacerbated by the isolated nature of many
wetlands in the Midwest and anthropogenic habitat fragmentation (Green 2003). A. c.
blanchardi is thus faced with a "catch-22" situation during droughts in the upper
Midwest: either forego breeding and risk zero recruitment, or breed in highly degraded
habitats that have been modified by human use (Pechmann et al. 1991; Lannoo 1998b).
Irwin (2005) describes a similar situation in which the behaviour and physiology of A. c.
blanchardi, combined with climate change, may be contributing to declines. This frog
has a limited tolerance for water loss (Ralin and Rogers 1972) and freezing (Irwin et al.
1999). Throughout much of the Midwest, A. c. blanchardi overwinters in existing cracks
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 21 -
or crayfish burrows in the pond banks, where the moisture content of the soil provides a
thermal refuge (Gray 1971; Irwin et al. 1999). Dry climatic conditions would reduce the
moisture content of the soil, thereby diminishing the soil's capacity to buffer against
freezing temperatures. Indeed, a severe drought in the autumn of 1976 and extremely
cold winters in 1976 and 1977 coincided with a drastic decline in A. c. blanchardi
populations in both Wisconsin and on Pelee Island, ON (Irwin 2005). Winter mortality
may have been increased in these instances by pond dredging and clearing of shoreline
vegetation and debris; furthermore, the exotic rusty crayfish ( Orconectes rusticus), which
does not burrow, has displaced native burrowing crayfish and may also prey on A. c.
blanchardi (Irwin 2005).
Overall, it appears that declines of A. c. blanchardi populations may generally be
due to habitat alteration and climate change. Other insults ( e.g. environmental
contaminants, parasites, deformities, introduced species) may occur synergistically with
or independently of these factors, but likely exacerbate declines to varying degrees in
different locations. One factor that cannot be ignored regarding these declines is that
they are primarily occurring across the northern and western edge of this anuran's range.
Such peripheral populations are more likely to be isolated from central populations and
inhabit less suitable environments, and therefore tend to be smaller and more prone to
extirpation (Lesica and Allendorf 1995). Midwestern A. c. blanchardi populations exist
in marginal habitat and at the limits of their ecological tolerance; any slight perturbation
to their environment is much more likely to trigger population declines than if it occurred
at the centre of the range. This is supported by the greater abundance and stability of
populations in the central and southern Great Plains, despite a likely similar onslaught of
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 22 -
environmental disturbances (Lannoo 1998b; Gray and Brown 2005). Another proposal is
that the return of forested landscapes to the Midwest following widespread abandonment
of agriculture may be pushing A. c. blanchardi, which prefers aquatic habitats with open
canopy, out of the area (Lehtinen and Skinner 2006). Similarly, trampling by cattle at
one farm pond in Wisconsin produced mud banks with low vegetation that appeared to
favour A. c. blanchardi (Hay 1998). This large population disappeared once cattle
activity ceased and the banks were revegetated by tall grass. These observations imply
that A. c. blanchardi was only able to colonise the Midwest recently, following the
conversion of forests into agricultural land, and that current range contractions are either
the result of inevitable fluctuations of unstable peripheral populations, or the gradual
return to native conditions as cricket may not have inhabited these areas prior to
anthropogenic modification of the landscape (Lehtinen 2002; Lehtinen and Skinner
2006). However, a much clearer understanding of these declines, and the history of A. c.
blanchardi in this region, must be obtained before they can be deemed "natural".
Thesis objectives and overview
It is my view that genetic information is a vital component to the proper,
effective, and efficient conservation of endangered species. The objective of my research
is therefore to examine the utility and importance of genetic information to the
development of recovery strategies, using two endangered amphibians as case studies.
These species differ substantially in their life histories, ecologies, levels of endangerment,
and extent of recovery efforts to date. P. lemur is a medium-sized, tropical, terrestrial
toad with a very restricted distribution, few populations, and small population size. It has
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 23 -
an adult lifespan of several years in the wild, and breeds sporadically and explosively in
temporary pools. The causes of population declines are well characterised, and are
primarily related to habitat destruction and alteration. Conservation efforts have been
extensive for over 20 years, with toads bred in captivity at several institutions and large
numbers released to the wild. In contrast, A. c. blanchardi is a small, temperate,
semiaquatic treefrog with an extensive distribution in North America and many large
populations in some areas. It has an adult lifespan of only 4 months in the wild, and
breeds each spring in small ponds and wetlands. The causes of declines are not well
understood, and likely involve multiple factors, both direct and indirect. Very limited
conservation activity has occurred thus far, and attempts to breed this anuran in captivity
have not been successful (B. Johnson, pers. comm.). The commonality between these
two species is the lack of genetic information that existed before my research was
conducted: although some studies had been performed (Dessauer and Nevo 1969; Salthe
and Nevo 1969; Lacy and Foster 1987; Gorman and Gaines 1987; Ward et al. 1987;
Goebel 1996; Moore 1997; Estep 2000), they primarily used very conservative genetic
markers and/or limited sample sizes of restricted geographic distribution.
In this dissertation, I have used mitochondrial control region sequences and
several highly polymorphic microsatellite loci to characterise genetic variation and
structure within P. lemur and all Acris taxa. Mitochondrial DNA (mtDNA) evolves
relatively slowly, at a rate of 0.5-1 % per lineage per million years in primates (Moritz et
al. 1987), and has been used extensively to examine relationships among species (i.e.
phylogeny) and among populations within species (i.e. phylogeography) (Avise 1994,
2000). The various genes within mtDNA evolve at different rates; the most rapid is the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 24 -
control region, as it does not code for a functional product and thus experiences less
selective pressure (Moritz et al. 1987). Few amphibian studies have utilised the control
region, as it can be extremely divergent within a single species, and may suffer from
multiple mutations at individual sites (i.e. saturation). However, preliminary analyses of
both P. lemur and A. c. blanchardi indicated that the more conservative cytochrome b
gene possessed very limited variation within each taxon, and that the control region was
3 more appropriate. Microsatellite markers evolve very rapidly, around 10- events per
locus per generation in humans (Weber and Wong 1993), and are typically highly
polymorphic even among recently diverged groups. This affords a high resolution suited
to very fine-scale studies; as such, they are commonly used for individual identification,
parentage, population structure, gene flow, dispersal, and landscape genetics (Jehle and
Arntzen 2002; Tennessen and Zamudio 2003; Bums et al. 2004; Funk et al. 2005;
Kraaijeveld-Smit et al. 2005; Zamudio and Wieczorek 2007). However, they are also
finding use in large-scale phylogeographic studies (Zeisset and Beebee 2001; Rowe et al.
2006; Knopp and Merila 2008), particularly since concordance between mitochondrial
and nuclear markers provides evidence that genetic structure reflects historical patterns of
isolation rather than selection or the vagaries of a single stretch of DNA (A vise 2000).
The information obtained using mtDNA and microsatellite markers will be used
to address several specific issues for both P. lemur and A. c. blanchardi: 1) levels of
genetic diversity in populations across the range; 2) degree of population structure and
genetic differentiation; 3) whether current taxonomy reflects genealogical relationships;
and 4) identification of distinct lineages or populations. These results will enable me to
assess whether detailed genetic information would have been valuable at the initiation of
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 25 -
P. lemur recovery activities, and how useful it will be to the development of future
recovery efforts for both P. lemur and A. c. blanchardi. I will also make specific
recovery recommendations for each species using the newly acquired genetic data.
The following chapters describe the genetic analyses of P. lemur and A. c.
blanchardi (and related Acris taxa). In Chapter 2, I profile three populations of P. lemur
at six newly developed microsatellite loci and a fragment of the mitochondrial control
region. This includes the two captive populations at the Toronto Zoo, representing the
extirpated northern population (Quebradillas) and the remaining wild population in the
south (Guanica), as well as wild tadpoles from the Tamarindo breeding pond in Guanica.
I use this information to determine levels of genetic variation in each group, the genetic
differentiation between them, assess the appropriateness of the current breeding strategy,
and provide recommendations for future activities to maximise the probability that
individuals reintroduced to the wild will establish viable populations. Chapter 3
describes the development of 17 microsatellite loci for A. c. blanchardi, and their utility
in related Acris taxa. Individuals from two widely separated populations (Texas and
Illinois) are profiled at 16 of these loci to evaluate differences in genetic diversity
between the two regions. Chapter 4 is a detailed study of the phylogeographic patterns
and spatial structure of A. c. blanchardi across its range using mitochondrial control
region sequences. It demonstrates the influence of Pleistocene glaciations on genetic
structure of this anuran, and provides evidence that northern populations are a distinct
clade from those to the south. They are therefore valuable for conservation and should be
managed separately. In Chapter 5, I use mitochondrial control region sequences to
examine phylogeographic patterns and the current taxonomy of all A eris species and
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 26 -
subspecies. Based on this information, A. c. blanchardi appears to be a distinct species
from A. c. crepitans, while A. c. crepitans and A. gryllus contain several divergent
lineages. Major biogeographic patterns of this complex are described, and indicate that a
number of adjustments to currently accepted distributions are required. In Chapter 6, I
synthesise the results of chapters 3, 4 and 5 to provide a comprehensive evaluation of
genetic structure in A eris. I also discuss the importance of the genetic data to the
conservation of P. lemur, A. c. blanchardi, and amphibians in general.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 27 -
Chapter 2
Genetic Rescue of an Inbred Captive Population of the Critically Endangered Puerto Rican Crested Toad (Pe/tophryne lemur) by Mixing Lineages
This chapter has been published exactly as it occurs here as:
Beauclerc KB, Johnson B, White BN (2009) Genetic rescue of an inbred captive population of the critically endangered Puerto Rican crested toad (Peltophryne lemur) by mixing lineages. Conservation Genetics in press. doi: 10.1007/s 10592-008-9782-z
KB Beauclerc performed all laboratory work, data analysis, and wrote the paper. B Johnson provided valuable input and funding for the work. BN White is the principal investigator responsible for the work.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 28 -
Abstract
The Puerto Rican crested toad (Peltophryne lemur) is currently composed of a single wild
population on the south coast of Puerto Rico and two captive populations founded by
animals from the northern and southern coasts. The main factors contributing to its
decline are habitat loss, inundation of breeding ponds during storms, and impacts of
invasive species. Recovery efforts have been extensive, involving captive breeding and
reintroductions, habitat restoration, construction of breeding ponds, and public education.
To guide future conservation efforts, genetic variation and differentiation were assessed
for the two captive colonies and the remaining wild population using the mitochondrial
control region and six novel microsatellite loci. Only two moderately divergent
mitochondrial haplotypes were found, with one fixed in each of the southern and northern
lineages. Moderate genetic variation exists for microsatellite loci in all three groups. The
captive southern population has not diverged substantially from the wild population at
microsatellite loci (Fsr = 0.03), whereas there is little allelic overlap between the northern
and southern lineages at five of six loci (Fsr > 0.3). Despite this differentiation, they are
no more divergent than many populations of other amphibian species. As the northern
breeding colony may not remain viable due to its small size and inbred nature, it is
recommended that a third breeding colony be established in which northern and southern
individuals are combined. This will preserve any northern adaptive traits that may exist,
and provide animals for release in the event that the pure northern lineage becomes
extirpated.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 29 -
Introduction
The evaluation of current taxonomy and identification of genetic lineages within
threatened species are vital to developing efficient and optimal recovery programs. For
example, the use of morphological traits to designate taxonomic entities often does not
reflect patterns of genetic variation (Burbrink et al. 2000; Culver et al. 2000; Nittinger et
al. 2007), which can waste limited resources on groups that are not distinct and have
limited value to the conservation of the species as a whole (Avise and Nelson 1989; Zink
et al. 2000). A lack of distinct lineages can also facilitate recovery, as it may increase the
number of source populations for efforts such as captive breeding or translocation
between isolated populations (Eizirik et al. 2001; Godoy et al. 2004). In contrast, early
detection of multiple lineages may enable intervention before an evolutionarily
significant lineage becomes irreversibly imperiled (Nielson et al. 2001; Shaffer et al.
2004a; Vredenburg et al. 2007), as occurred for the tuatara (Daugherty et al. 1990).
Knowledge of the genetic structure of a species can identify the most closely related
population or subspecies for use in reintroductions following extirpation (Drew et al.
2003; Kraaijeveld-Smit et al. 2005), while individuals from divergent populations may be
incorporated to maximise genetic variation (Madsen et al. 1999; Land et al. 2004).
Finally, assessment of the genetic composition of existing captive programs can
determine whether animals are suitable for further breeding (Brock and White 1992;
Ruokonen et al. 2000) or reintroduction (Garcia-Moreno et al. 1996; Wyner et al. 1999).
The Puerto Rican crested toad (Peltophryne lemur) is a highly endangered
bufonid for which two separate lineages are currently maintained in captivity. Captive
breeding was initiated prior to the frequent use of molecular markers to identify genetic
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 30 -
structure within species. In this study, mitochondrial DNA (mtDNA) sequences and six
novel microsatellite loci were used to investigate the genetic variation and differentiation
of the two P. lemur captive breeding colonies, as well as the sole remaining wild
population. This information will be used to determine the optimal future management
actions to ensure the persistence of P. lemur in the wild.
Biology and conservation history of Peltophryne lemur
The only toad endemic to Puerto Rico, P. lemur has been collected from at least
eight locations across Puerto Rico and one on Virgin Gorda of the British Virgin Islands
(Figure 2.1 ). It generally occupies low-elevation ( < 200m), arid or semi-arid coastal
regions and is often associated with limestone karst formations that provide fissures into
which it retreats during the day (Rivero et al. 1980; Miller 1985). Breeding is sporadic,
and occurs in temporary pools formed by heavy rains (USFWS 1992). P. lemur has not
been seen on Virgin Gorda for over 40 years, and was thought to be extinct on Puerto
Rico until 1965 (USFWS 1992). Populations have since been found on both the northern
(Quebradillas and Isabela) and southern (Guanica State Forest Reserve) coasts of Puerto
Rico (Rivero et al. 1980; USFWS 1992), although no toads have been seen in the north
since 1988 (Barber 2007). It is therefore probable that Guanica, which may have
numbered as few as 80 individuals in 2003 (Hedges et al. 2004 ), is the only remaining
wild population. P. lemur is listed as critically endangered by the International Union for
Conservation of Nature. The primary cause of decline is habitat loss and alteration,
including drainage of breeding sites and spraying of surrounding areas with pesticides
(Johnson 1990; USFWS 1992). Predation and/or competition by introduced species (e.g.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure regions (after captive Monroe 2.1. zoo of Puerto lsabela programs Map 1976). Rico of Puerto ( * are ). 0 indicated: San Rico Juan and Mountainous (@) the British the I' is karst the interior 50 belt capital Virgin in Coastal the of Islands Puerto northeast, plain showing Rico 100 the and mountainous historical is shown Atlantic Caribbean ~ locations for 150 interior, reference Kilometres Ocean ~~ of Sea and P. only. lemur the discontinuous The ( •) A N three and r:;p·ir sites ~;n\\s"'\J\~ main coastal represented Virgin physiographic ~~) Gorda plain by - 31 -
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 32 -
cane toad, Bufo marinus; mongoose, Herpestesjavanicus; feral dogs and cats) may have
contributed to declines (Rivero et al. 1980; USFWS 1992). The small size and isolation
of the remaining population in Guanica indicates that it is also vulnerable to stochastic
environmental ( e.g., hurricanes; Johnson 1990) and demographic events.
Recovery efforts for P. lemur have been extensive. The Guanica breeding pond is
closed for three weeks during the breeding season and is no longer drained for parking
(Johnson 1990). Toads have been radiotracked to monitor movements, and habitat
characteristics have been evaluated (Johnson 1990; Matos-Torres 2006). Wild
individuals were collected during the 1980s to establish two breeding colonies
representing the northern (four founders) and southern (32 founders) populations. To
date, more than 110 000 southern tadpoles and toads have been released into constructed
ponds in Guanica Forest, and releases of northern animals began at Arecibo in 2006
(Barber 2007). In 2003 and 2005, captive-born adult toads returned to the southern
release site to breed (PRCT SSP 2006). Additional property is being secured and several
ponds constructed in both regions, while public outreach and education are a continuing
component of the recovery program (Barber 2007).
In order to maintain the optimal recovery strategy for P. lemur, several important
issues must be resolved using genetic data. On average, a founding population of 20
individuals will capture> 95%ofheterozygosity and approximately 87% of allelic
diversity (Frankham et al. 2002). While the southern captive colony may have sampled
sufficient genetic variation from the wild to maintain a healthy population for many
generations, the northern colony likely had low variation from its initiation. The
potential for increased homozygosity due to inbreeding and loss of genetic variation
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 33 -
through drift are factors that must also be considered in the breeding populations. This is
especially applicable to the northern colony, as the 123 individuals currently in captivity
and used for breeding are the product of four siblings that themselves are descended from
two first cousins. In addition, the isolation of the captive colonies from each other and
the wild population may have led to genetic or morphological divergence between them
(Rowe et al. 1998; Shuster et al. 2005; Hakansson et al. 2007). The degree of genetic
differentiation between the northern and southern populations also requires assessment.
Fossil evidence suggests that P. lemur was widespread throughout Puerto Rico during its
history (Pre gill 1981 b ); however, it is currently restricted to low-elevation areas on
opposite coasts, separated by the Cordillera Central mountain range. Previous allozyme
assays suggested that the two populations may be divergent (Lacy and Foster 1987). It
thus remains unclear whether the northern and southern populations have been separated
throughout their history, or if population declines and habitat fragmentation have isolated
them more recently.
The genetic data obtained here will be used to address three main questions: (1)
do the captive populations suffer reduced genetic diversity relative to the wild population;
(2) has the captive southern population diverged genetically from the wild southern
population; and (3) what is the level of differentiation between the populations from the
northern and southern coasts? Given the precarious state of the northern breeding colony
and its probable extirpation in the near future, the long-term reintroduction of purely
northern individuals is not realistic: The information from this study will thus be used to
discriminate between the few remaining options for this lineage: ( 1) continue breeding
the northern and southern populations separately. If the northern colony becomes
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 34 -
extirpated, terminate reintroductions in this region; (2) continue breeding the northern
and southern populations separately. If the northern colony becomes extirpated,
reintroduce individuals from the southern lineage to the northern region; or (3) create an
additional breeding colony in which northern and southern individuals are mixed. If
adaptive differences exist between the northern and southern populations, this approach
will facilitate the preservation of these traits. In the event that the pure northern colony
becomes extirpated, these mixed individuals can be reintroduced to the north and may
experience greater survival over purely southern animals due to the presence of some
northern adaptations.
Materials and Methods
Sample collection and DNA extraction
Muscle or organs (heart, kidney, liver) were collected post-mortem from
individuals of the northern and southern breeding colonies at the Toronto Zoo and
Audubon Nature Institute in New Orleans. In total, four individuals from the northern
colony and 58 from the southern colony were sampled. During a breeding of wild toads
in 2003 at Tamarindo Pond in Guanica State Forest, Puerto Rico, an additional 43
tadpoles that had died were collected opportunistically. The southern breeding colony
was founded by individuals collected from several breeding ponds, including Tamarindo,
during the 1980s. Differential mortality of tadpoles may reflect the genotype at the major
histocompatibility complex (Barribeau et al. 2008), suggesting that the targeted collection
of dead individuals may not constitute a random genetic sample. However, the perilous
state of P. lemur in the wild mandates that sampling impacts be minimised. Furthermore,
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 35 -
the high mortality rate of amphibian larvae, particularly in temporary ponds such as those
used by P. lemur (Duellman and Trueb 1986), indicates that assumptions of genotype
interactions may be premature without supporting information. Hereafter, the southern
breeding colony will be called Guanica, the northern breeding colony will be called
Quebradillas, and the wild southern population will be called Tamarindo.
All 105 samples were genotyped at the six microsatellite loci to ensure that no
rare alleles were missed. However, maternal inheritance of the mitochondrial genome
means that all offspring of a female possess the same haplotype; thus, mtDNA was
sequenced for only a subset of samples from the breeding colonies. According to the P.
lemur studbook maintained by the Toronto Zoo, the 58 Guanica samples employed in this
study trace their lineage to six wild females and 14 wild males. Thirty captive-bred
individuals representing these six matrilineal lineages were sequenced, as were five male
founders that could potentially harbour different mitochondrial lineages. Due to the
small sample size for Quebradillas, all samples were sequenced. Because the genealogy
of the Tamarindo individuals is unknown, all 44 samples were sequenced.
Although the number of samples used for the northern colony is small, it must be
emphasised that a very limited gene pool is available for profiling. Only four wild
individuals (two male and two female) were used to establish the colony, and all current
breeding individuals are descendants of two cousins. Two of the samples profiled here
are direct offspring of these cousins, and the other two are the product of a mating
between two of these offspring (i.e. between full siblings). Tissue samples of earlier
generations are not available. Thus, a maximum of only one mitochondrial lineage and
four alleles for each microsatellite locus are possible in any combination of samples from
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 36 -
this population. Additional sampling would therefore not be informative, and the four
samples analysed here are representative of the variation present in the northern colony.
Samples were prepared for extraction by dissolving 10 mg of tissue in 500 µL of
1 X lysis buffer (2 M urea, 0.1 M NaCl, 0.25% n-lauroyl sarcosine, 5 mM CDTA, 0.05 M
Tris-HCl pH 8), and digesting with 50 µL of proteinase K. Total genomic DNA was
extracted with the DNeasy Tissue Kit (Qiagen Inc.) and quantified with the PicoGreen
Quantitation Kit (Molecular Probes) on a FLUOStar Galaxy (BMG Labtech).
Mitochondrial control region sequencing
A fragment of the control region was amplified with the primers CytbA-L and
ControlP-H (Goebel et al. 1999) in a 25 µL reaction containing 1-5 ng DNA, 1 X PCR
buffer, 2 mM MgCh, 0.2 mM dNTPs, 0.1 mg/mL BSA, 0.2 µM each primer, and 2 U
Taq polymerase (Invitrogen). Thermal cycling used an MJ Research PTC-225 thermal
cycler with the following conditions: denaturation at 94°C for 5 min, 30 cycles of
denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for
45 sec, with a final extension of 72°C for 10 min. PCR product was visualised with
ethidium bromide on 1 %agarose gels, and 5 µL was purified with ExoSAP-IT (USB).
Both strands were sequenced using the PCR primers with the DYEnamic ET-Terminator
cycle sequencing kit on a MegaBACE 1000 DNA Analysis System (GE Healthcare).
Microsatellite development and profiling
Tetranucleotide microsatellites were isolated according to the protocol of
Beauclerc et al. (2007) (see also Chapter 3). In total, 115 clones were sequenced, of
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 37 -
which 83 were positive for a tetranucleotide repeat, with five duplicate clones found.
Primer pairs were designed manually for 20 positive clones that possessed sufficient
flanking sequence. Individual loci were amplified in 10 µL volumes containing 5 ng
genomic DNA, 1 X PCR buffer, 1.5 mM MgCh, 0.2 mM each dNTP, 0.3 µMeach
primer, and 0.5 U Taq polymerase using the following thermal cycling conditions:
denaturation at 94°C for 5 min, 30 cycles of denaturation at 94°C for 30 sec, annealing at
the optimal temperature (see Table 2.1) for 1 min, and extension at 72°C for 1 min, with a
final extension of 60°C for 45 min. Nine and three individuals from Guanica and
Quebradillas, respectively, were screened for polymorphism by visualising PCR products
on 4% agarose gels stained with SYBR Green I (Molecular Probes). Six loci amplified
reliably and were polymorphic. To profile all samples, each locus was amplified
individually and pooled into two multiplex reactions prior to desalting (Table 2.1 ). All
PCR product was desalted using Sephadex G50, profiled on a MegaBACE 1000 DNA
Analysis System, and scored using GENETIC PROFILER v.2.0 (GE Healthcare).
Data analysis
Sequences were aligned in CLUSTALX v.1.81 (Thompson et al. 1997) and edited
by eye using BIOEDIT v.7.0.533 (Hall 1999). Pairwise sequence divergence was
calculated using MEGA v.3.1 (Kumar et al. 2004). Microsatellite diversity indices
(number and frequencies of alleles, observed and expected heterozygosity) were
calculated using GENEPOP v .3 .4 (Raymond and Rousset 1995), and conformation to
Hardy-Weinberg equilibrium was tested by estimation of exact P-values with a Markov
chain method (Guo and Thompson 1992). Allelic richness (number of alleles per
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table and
a
b c motif.
d
gels
Fluorescently
Annealing
Repeat
Primer
Multiplex
Multiplex
PleMs-14
PleMs-10 pooled
PleMs-11
PleMs-4
PleMs-8 PleMs-3
stained
Locus
2.1.
See
concentration
motif
into
Primers
GenBank
temperature
with
1 2
is
(I'a
(I'a
labeled
multiplexes
F: R:CCTGAAAAAAACTGAGAGATGG
R:CCCAGGGTACTGCAACTCG F: R: F: F: R: R:CAGGTTTTGAGAAGAGTTCC F:
F:
R:
based
SYBR
=
=
TGCCACTGAGAAAGATTTGG
ATGGGTGAATAAAGACCTCC
CGTACCAGAAACTAATCTCAACTGG
GACTATGTATGTGTGTGTAGC
GGGAAACTGGAGCAAATACC
TCCATTACCTTCTCAGTGTTGC
and
AGTTGTGACTGCTGTGACC TCAGTTCCT
TTCTGT
55°C)
55°C)
for
is
primers
on
amplification
Green
is
complete
for
sequence
the
prior
both
AAGGTCTGGCTGC
range
I.
are
~(_5'-3'l
Primer
to
the
ATGCACTGAGC
sequences.
indicated
from
desalting.
of
forward
conditions
sequence
temperatures
the
by
original
and reverse
the
for
letters
(H)
six
at
clone.
(H)
(H)
(F)
which
(H)
microsatellite
(F)
primers
Hand
"Imperfect"
the
F,
single
(GATA)
(GATA)13 (GATA)1s
(GATA) in
(GATA)12
imperfect
(GATA)9
imperfect
(CATA)
which
Repeat
motifb
the
loci
locus
reaction.
indicates
refer
isolated
36
12
3
amplified successfullyamplified
to
Ta
55-60
50-60
55-65 55-60
HEX 55-60
from
that
55
(°Ct
one
and
P.
lemur.
or
6-F
more
Primer
(µMt
AM,
0.6 0.2
0.3 0.3
0.6
0.3
Loci
base
respectively.
and
were
pairs interrupted
cleanly,
Pooling
volume
2.5
10
10
10
amplified
5
5
µL
µL
µL
µL
µL
µL
based
individually
accession#
on
EU149940
EU149942 EU149941 EU149944
EU149945
EU149943
GenBank
the
agarose
repeat
-
-
38
-
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 39 -
population) and private allelic richness were calculated by standardisation to the smallest
sample size (N = 4) using rarefaction in the program HP-RARE v.1.0 (Kalinowski 2005).
Population differentiation was estimated between all pairs of populations for all
loci with Nei's genetic distance Ds (1972) and the genotype likelihood ratio distance DLR
(Paetkau et al. 1997) using software from http://www2.biology.ualberta.ca/jbrzusto/ (J.
Brzustowski, unpublished). These distance measures are calculated in very different
manners, and Paetkau et al. ( 1997) recommended their use to provide independent
estimates of genetic distance between populations. Population structure was evaluated
with 0w (Weir and Cockerham 1984), the unbiased estimator of Wright's (1951) FsT,
using ARLEQUIN v.3.1 (Excoffier et al. 2005). Significance was determined by a
permutation test of 1000 iterations. Genetic differentiation was further evaluated using
the clustering program STRUCTURE v.2.0 (Pritchard et al. 2000). The likelihood that the
samples represented between one and five genetic clusters (K = 1 to K = 5) was
determined, using the following model: admixture, correlated allele frequencies, bum-in
of 500 000 steps, and 1 000 000 iterations of the Markov Chain Monte Carlo algorithm.
The model was run four times for each value of K to ensure consistency between runs.
The largest value of !::.K (Evanno et al. 2005) was used to determine the most likely
number of populations.
Results
Mitochondrial sequencing
Quality sequence was obtained for 963 bp of the mitochondrial control region,
yielding two haplotypes (GenBank accession numbers EU149946 and EU149947):
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 40 -
PleCR-1 occurred only in Guanica and Tamarindo, and PleCR-2 was exclusive to
Quebradillas. Sixteen variable sites were found: 13 transitions, one transversion, and two
indels of one base pair. Pairwise sequence divergence between the haplotypes was 0.015.
Microsatellite profiling
The total number of alleles for the six microsatellite loci was 46, with a range
from four to ten and an average of 7. 7 alleles per locus (Table 2.2). Guanica possessed
the largest number of alleles; however, the disparate sample size between groups clearly
contributed to this outcome. When standardised by rarefaction, allelic richness was
nearly equal for all three populations (Table 2.2). Each population also had several
private alleles (Figure 2.2, Table 2.2): Guanica possessed six, Tamarindo three, and
Quebradillas twelve. The sampling of amphibian tadpoles from a single location is
typically discouraged as it may consist of a group of siblings and yield biased data.
However, the observation of seven alleles at locus PleMs-3 in the Tamarindo samples
indicates that this group is descended from at least four parents, and individuals are
therefore not all full siblings.
Observed and expected heterozygosities ranged from 0.41 to 1.00 and 0.43 to
0.79, respectively (Table 2.3). Following sequential Bonferroni correction, all loci were
in Hardy-Weinberg equilibrium and linkage equilibrium in Quebradillas and Tamarindo.
In Guanica, however, loci PleMs-8 and PleMs-14 continued to deviate significantly from
Hardy-Weinberg equilibrium due to heterozygote excess, and significant linkage
disequilibrium remained between loci PleMs-14/PleMs-l 0, PleMs-14/PleMs-3, PleMs-
10/PleMs-11 and PleMs-10/PleMs-3. It is probable that the disequilibrium in Guanica is
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. populations Table
PleMs-11
PleMs-10
PleMs-14
PleMs-3 PleMs-4
PleMs-8 Average
Locus
Total
2.2.
Number
of
Allele
P.
Min
282
311 143
129
147
87
lemur.
of
size
alleles,
Max
Corresponding
201 426
298
173 128
157
(bp)
allelic
richness
'fotal
7.67
46
10
3 6 3 4 9
8 9
indices
No.
when
alleles
Guanica
for
31
7
() 6(0) 7(1)
5(2) 6(1)
5.17
(2)
(0) (0)
private
(6)
rarefied
(no.
private
alleles
28
to
Tam.
4(1) 7 3
3
5(0)
4.67
(2) (0)
(0)
N
(3)
=
alleles)
are
4,
and
shown
.
17
Queb.
2(1)
3 4(3) 3 2 3(3)
2.83
(1)
(1) (3)
(12)
size
in
range
parentheses.
of
19.26
4.28 2.23
2.65 (0.92) 3.08 3.65 3.37
5.51
Allelic
Guanica
alleles
(1.73) (0.13)
(1.23) (0.07)
(0.89)
(1.42)
(4.97)
richness
for
six
17.37
3.48
2.11 2.59 2.76 3.14
3.29 4.96
microsatellite
(private
Tam.
(0.88) (0.49) (0.60)
(1.00) (0.03)
(1.00) (0.52)
(3.52)
allelic
loci
4.00 3.00 2.00 3.00 2.00 3.00
4.85
17
richness)
Queb.
(12.27)
in
(1.01) (3.00) (3.00) (3.00) (1.00) (1.26)
(3.51)
three
-
41
-
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 42 -
0.70 0.50 0.60 PleMs-3 0.40 0.50 0.40 0.30 0.30 0.20 0.20 0.10 0.10 0.00 0.00 143 145 147 149 155 159 163 167 171 173 311 315 319 323 327 398 402 406 426 * * * * * * * * * 0.80 0.80 0.70 PleMs-4 0.70 PleMs-11 >, (J 0.60 0.60 C 0.50 0.50 Q) ::J 0.40 0.40 C'" ....Q) 0.30 0.30 0.20 0.20 Q) - 0.10 0.10 Q) 0.00 0.00 <( 87 95 99 103 120 128 129 133 137 141 145 149 153 157 * * * * * 0.60 0.80 PleMs-8 0.70 PleMs-14 0.50 0.60 0.40 0.50 0.30 0.40 0.30 0.20 0.20 0.10 0.10 0.00 0.00 147 172 176 180 184 188 193 197 201 282 286 290 298 * * * * * * * Allele
Figure 2.2. Allele frequencies at six microsatellite loci for three populations of P. lemur: Guanica (shaded), Tamarindo (hatched) and Quebradillas (solid). Private alleles are indicated by *.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 43 -
Table 2.3. Observed heterozygosity (Ho), expected heterozygosity (HE), and exact P- values of Hardy-Weinberg equilibrium for six micro satellite loci in three populations of P. lemur.
Guanica Tamarindo Quebradillas Locus HE Ho p HE Ho p HE Ho p PleMs-3 0.79 0.81 0.13 0.73 0.84 0.44 0.61 0.50 0.43 PleMs-4 0.46 0.41 0.23 0.60 0.49 0.34 0.68 1.00 0.31 PleMs-8 0.66 0.71 0.0002 0.62 0.56 0.18 0.68 0.75 1.00 PleMs-10 0.73 0.72 0.06 0.69 0.67 0.94 0.79 1.00 1.00 PleMs-11 0.60 0.71 0.16 0.59 0.60 0.80 0.43 0.50 1.00 PleMs-14 0.59 0.78 0.02 0.43 0.51 0.25 0.54 0.75 1.00 Overall 0.64 0 0.62 0.57 0.61 0.98
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. -44 -
due to the managed breeding of this closed population. The fact that all loci are in
equilibrium in the wild population, which presumably experiences random mating,
suggests that the loci are not linked or under selection and are therefore suitable for use in
further analyses.
Guanica and Tamarindo shared the greatest number of microsatellite alleles, 25
out of 46 total alleles (54%; Figure 2.2). When excluding alleles found only in
Quebradillas, Guanica and Tamarindo shared 74% of their alleles (25 out of 34). Very
few alleles were common between Quebradillas and the southern populations: none were
shared for loci PleMs-4 and PleMs-8, and only one was shared at loci PleMs-10, PleMs-
11, and PleMs-14. In total, Quebradillas shared only five alleles (11 %) with both
Guanica and Tamarindo; its remaining 12 alleles were unique. Both Guanica and
Tamarindo are much more distant from Quebradillas than they are from each other based
on the pairwise genetic distance measures Ds and DLR (Table 2.4). FsT values were
significant at P = 0.0l between all pairs of populations, but values were much larger
between either of the southern populations and Quebradillas (Table 2.4).
The average log probability of K [ln Pr(XJK)] increased with the number of
clusters (data not shown). However, the rate of change of the log probability of K (t:J()
was largest for K= 3 (tiK2 = 2.6; M 3 = 551.5; M 4 = 117.1). This was-therefore chosen
as the number of groups most likely represented by the microsatellite data. Guanica and
Tamarindo individuals were both assigned in similar proportions and nearly equally to
clusters 1 and 2, with no individuals assigned to cluster 3 at> 2% of their genome ( data
not shown). All Quebradillas individuals were strongly assigned to cluster 3 (> 98% of
each genome).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 45 -
Table 2.4. Pairwise values of FsT (calculated as 0w), Nei's genetic distance (Ds), and the genotype likelihood ratio distance (DLR) using six rnicrosatellite loci for three populations of P. lemur. All 0w values were significant at P < 0.01.
Population pair 0w Ds Gminica/Tarnarindo 0.03 0.06 1.07 Guanica/Quebradillas 0.31 1.65 16.02 Tarnarindo/Quebradillas 0.34 1.76 16.16
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 46 -
Discussion
Genetic diversity within populations
The control region is the most variable section of the mitochondrial genome
(Moritz et al. 1987), making the very low haplotypic diversity of P. lemur somewhat
surprising. This bufonid has one of the lowest mitochondrial diversities among a number
of amphibian species: multiple haplotypes typically exist for this and less variable
regions (Bos and Sites 2001; Austin et al. 2002; Smith and Green 2004), and often over
relatively small scales (Shaffer et al. 2004b; Dever 2007). However, Rowe et al. (2006)
found that all British and Irish individuals of Bufo calamita possessed a single control
region haplotype.
Peltophryne lemur is moderately variable at the six microsatellite loci. Within
population genetic diversity (HE) is similar to or greater than that found for microsatellite
loci in several other amphibians (Rowe et al. 1998; Palo et al. 2003; Brede and Beebee
2004; Martinez-Solano et al. 2005; Arens et al. 2006), while only a few have been found
to have substantially greater HE (Austin et al. 2003a; Bums et al. 2004; Hoffman et al.
2004). Allelic diversity for P. lemur is comparable to several species examined over
similar and larger geographical scales, despite much larger sample sizes for some (Rowe
et al. 1998; Palo et al. 2003; Brede and Beebee 2004; Kraaijeveld-Smit et al. 2005; Arens
et al. 2006). This diversity is surprising, considering the small sample sizes, relatedness
of individuals, and limited variation in mtDNA. It thus appears that neither the captive
nor wild populations of P. lemur have suffered a severe reduction in heterozygosity due
to small population sizes and prolonged isolation. In fact, the Guanica captive colony
had greater heterozygosity than expected at two loci. This likely reflects the
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 47 -
minimisation of kinship management system used to designate pairs for breeding
(Johnson 1990; Ballou and Lacy 1995), which reduces the tendency to homozygosity via
inbreeding and the loss of alleles through genetic drift (Montgomery et al. 1997). By
comparison, random mating in the wild Tamarindo population, combined with a possible
bottleneck of 80 individuals (Hedges et al. 2004), has allowed these processes to reduce
heterozygosity below that of Guanica for several loci.
Comparison ofpopulations
There appears to be very little difference in the amount of genetic variation found
in Guanica and Tamarindo. Both populations possess similar numbers of alleles and HE
estimates for most loci. There is also little divergence between them: a single
mitochondrial haplotype exists in all individuals, there are very few unshared alleles, and
the measures of genetic distance and differentiation are very low. Comparable estimates
of these measures have been found over similar distances in several other amphibian
species (Newman and Squire 2001; Brede and Beebee 2004; Bums et al. 2004; Funk et
al. 2005; Arens et al. 2006). In addition, the STRUCTURE algorithm could not distinguish
individuals from these two groups. The genetic similarity of these populations is not
surprising, as the Guanica captive colony is recently descended from the wild Tamarindo
population. Although gene flow between captive-bred individuals released into Guanica
State Forest and wild individuals located at Tamarindo pond cannot be completely
excluded, it is highly unlikely as P. lemur has been shown to move only up to 2 km
(Johnson 1999) and these locations are separated by 20 km of migratory distance.
Despite the fact that only a small number of related, inbred individuals were
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 48 -
sampled, moderate genetic variability exists at nuclear loci in Quebradillas. It is probable
that most alleles present in the northern population were detected during this analysis, as
50-100% of the maximum number of possible alleles (four) was observed for all loci.
Thus, more extensive sampling would likely have revealed little additional variation.
Although it possesses fewer alleles than Gminica or Tamarindo based on direct counts, it
is nearly equal when all groups are standardised to N = 4. As well, HE is very similar to
both southern populations. Quebradillas is moderately divergent from the southern
populations at mtDNA, with 1.5% sequence divergence between the two haplotypes. A
comparison with other amphibian mitochondrial studies shows that many species possess
deeper divergences in the control region (Shaffer et al. 2004b) and more conserved
regions (Lougheed et al. 1999; Austin et al. 2002; Vredenburg et al. 2007). In contrast to
the mtDNA data, Quebradillas is quite differentiated from the southern populations at
nuclear microsatellite loci. It possesses far more private alleles than either Guanica or
Tamarindo, and shares more than a single allele with them at only one of the six loci.
This abundance of private alleles in Quebradillas is likely not an artifact of sample size,
as one would expect the populations with larger sample sizes (i.e. Guanica or Tamarindo)
to detect a greater number of rare or unique alleles. Furthermore, STRUCTURE clearly
distinguished the northern individuals, and the measures of genetic distance and
differentiation are much greater between Quebradillas and both southern populations than
between the two southern populations. These Fs1 values of> 0.3 are quite large
compared to some other amphibian microsatellite studies (Newman and Squire 2001;
Brede and Beebee 2004; Johansson et al. 2005), particularly given the small geographic
distance separating the two populations (approximately 55 km). However, some studies
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 49 -
have found similar or greater values over very short geographic distances (Kraaijeveld
Smit et al. 2005; Arens et al. 2006), and several report values> 0.4 across the distribution
of a single species (Rowe et al. 1998; Bums et al. 2004; Funk et al. 2005).
For small animals with low vagility such as amphibians, it is often not the
geographic distance that determines levels of gene flow between populations, but rather
the ecological and/or geographical barriers that separate them such as mountain ridges
(Funk et al. 2005; Kraaijeveld-Smit et al. 2005; Martinez-Solano et al. 2005), unsuitable
habitat (Johansson et al. 2005), or even ancient geological features that are no longer
apparent (Lougheed et al. 1999). The Cordillera Central mountain range, with a
maximum elevation> 1300 m (Pico 1974), extends across the interior of Puerto Rico in
an east-west direction (Figure 2.1). The strong differentiation between northern and
southern populations of P. lemur is thus not unexpected, as this species is restricted to
low-elevation coastal areas (Rivero et al. 1980). The genetic data, combined with P.
lemur's historical distribution and probable inability to traverse the mountainous interior,
suggests that northern and southern populations have likely not experienced gene flow for
a substantial time.
Conservation and management recommendations
An important finding of this study is that the breeding of P. lemur in AZA
(Association of Zoos and Aquariums) institutions has been very successful in terms of
genetic management: the captive Guanica population has not suffered reduced genetic
diversity relative to the wild Tamarindo population, nor has it diverged substantially
during its isolation. Although only neutral molecular markers were evaluated, this
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 50 -
suggests that adaptation to captivity has been minimal (e.g. Ford 2002) and that the
captive southern population is suitable for continued reintroduction to the south coast of
Puerto Rico. Additional supplementation of the captive colony by wild individuals does
not appear to be immediately necessary for genetic purposes.
The future of P. lemur in northern Puerto Rico, however, is in jeopardy.
Although the Quebradillas breeding colony possesses adequate variation at this time, it
likely cannot be sustained much longer as the 123 individuals currently in captivity are
descended from four inbred siblings. It was previously believed that the colony had
reached reproductive senility as no clutches had been obtained for some time (Bloxam
and Tonge 1995). While this is likely in part due to the age of the individuals, it is also
possible that inbreeding avoidance (Waldman et al. 1992) and/or depression have
contributed to lower fitness. Successful breeding of northern animals has occurred
recently, with releases of tadpoles on the north coast of Puerto Rico. However, it is
unlikely that individuals have become established since it required nearly 20 years and
over 100 000 released individuals before breeding animals were observed in the south.
This indicates that there will be limited opportunities to restock the captive northern
colony should it become depleted. The prospects for the northern lineage of P. lemur are
therefore dire and it is no longer sufficient to maintain separate populations in captivity;
in order to ensure the persistence of P. lemur in the north, less conventional management
options must be explored.
The presence of an exclusive mitochondrial haplotype and many unique
microsatellite alleles in Quebradillas suggests that the northern and southern populations
of P. lemur are quite distinct and have not experienced gene flow for some time. This
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 51 -
isolation may have enabled unique, adaptive characteristics to evolve in the north,
facilitated by differences in habitat and climatic conditions: Guanica is located in an arid
coastal plain, receiving ~ 3 0-3 5 inches of rainfall annually and possessing dry limestone
vegetation, while Quebradillas receives 40-60 inches of annual rainfall and consists of
limestone hills with humid limestone vegetation (Pico 1974). Any unique adaptations
that northern individuals may possess have the potential to greatly assist with the
establishment of reintroduced individuals to this region and should be preserved. It is
therefore recommended that whilst the Quebradillas breeding colony is successful in
producing offspring for release, the Guanica and Quebradillas colonies should continue to
be maintained separately and animals released into their respective regions. In order to
ensure the continuation of the northern lineage, however, a third breeding colony
consisting of both northern and southern individuals should be created. This will increase
the genetic diversity and number of breeding individuals for the Quebradillas colony,
thereby increasing its health and longevity. Initially, this would serve as an experimental
colony to determine whether mixed individuals possess greater or diminished fitness
prior to their release into the wild. In the event that the pure Quebradillas lineage
becomes extirpated, these animals- could then be used for release to the northern coast of
Puerto Rico. This strategy would preserve the most overall genetic diversity, including
any unique genetic adaptations that may be present in the northern lineage. The
alternative option to release pure Guanica individuals into the north should the
Quebradillas colony become extirpated is less desirable, as they would lack any
potentially adaptive traits that may increase their survival in the conditions found in
northern Puerto Rico.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 52 -
The mixing of distinct lineages is generally avoided because of the possibility of
reduced fitness due to outbreeding depression. However, it "should not be dismissed
lightly as a management option, especially where there is evidence that remnant
populations have reduced viability because of inbreeding depression" (Moritz 1999).
Inbreeding depression is generally considered a more serious problem than outbreeding
depression, and the negative impacts of outbreeding depression may be overemphasised
while the benefits of mixing lineages are overlooked (Frankham et al. 2002). "Genetic
rescue" (e.g., Tallmon et al. 2004) by mixing distinct lineages has successfully reduced
inbreeding depression and increased fitness for several threatened species (Westemeier et
al. 1998; Madsen et al. 1999; Land et al. 2004) and continues to be recommended (Soltis
and Gitzendanner 1999; Tarr and Fleischer 1999; Wyner et al. 1999; Godoy et al. 2004).
Experimentally inbred populations of plants (Richards 2000; Newman and Tallmon
2001) and animals (Bryant et al. 1999; Ball et al. 2000) also experienced increased fitness
when immigrants were introduced. Very low levels of migration (e.g., one individual per
generation) may be sufficient for successful genetic rescue, which minimises genetic
swamping and allows local adaptation to proceed (Hedrick 1995; Newman and Tallmon
2001; Palo et al. 2003; Vila et al. 2003 ). Despite the considerable divergence of northern
and southern P. lemur populations, they do not appear to warrant classification as
separate subspecies. Many other amphibian species are much more differentiated at
mtDNA, and the Fsr estimates fall within those for several other amphibians.
Furthermore, husbandry protocols are the same for the northern and southern captive
colonies, suggesting that critical reproductive and rearing aspects do not differ (Lentini
2000). Although the potential for reduced fitness due to outbreeding depression cannot
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 53 -
be completely excluded, these factors indicate that it should be minimal. In contrast, it is
known that the northern colony of P. lemur is highly inbred. While the extent of
inbreeding depression has not been thoroughly evaluated and can vary within a single
lineage (Pray and Goodnight 1995), it was suggested over a decade ago that the northern
colony may be suffering from reduced fitness (Bloxam and Tonge 1995). Given the
available evidence, inbreeding depression is a much greater concern for the future of the
northern lineage than should be outbreeding depression in a mixed population.
The establishment of a third breeding colony of mixed northern and southern P.
lemur lineages can be viewed as insurance for securing some northern traits, as it is
probable that the pure northern colony will become extirpated due to demographic
stochasticity or inbreeding depression. Because outbreeding depression is due primarily
to the breakup of coadapted gene complexes between divergent lineages, it is probable
that negative effects would not manifest until the F 3 generation when such complexes
have undergone recombination (Tallmon et al. 2004). The mixed colony should therefore
be created immediately so that the fitness of mixed individuals can be monitored for
several generations prior to release into the wild ( e.g. Moritz 1999). Although fitness in
captivity cannot necessarily be extrapolated to the wild, monitoring should provide an
indication of the overall health and reproductive capacity of the interbred colony relative
to the pure northern colony. Sufficient individuals are generally produced in captivity
that these efforts should not affect the existing breeding colonies or release efforts. Its
initiation would also not require a large investment of resources, as several facilities
currently house P. lemur and much is known about its husbandry (Miller 1985; Lentini
2000). Future work should develop models to determine the minimum number of
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 54 -
southern individuals necessary to effect genetic rescue of the northern population while
minimising genetic swamping, as was done for the Florida panther (Hedrick 1995).
Not only will a mixed breeding colony facilitate the establishment of P. lemur
populations in northern Puerto Rico by preserving adaptive traits, its experimental nature
enables these recovery efforts to contribute to the development of reintroduction biology
as a science (sensu Seddon et al. 2007). It can also provide insight into the actual
repercussions of outbreeding depression, allowing future conservation biologists to assess
the potential for adverse effects on a given species. Finally, this study demonstrates that
it is not always possible to follow generalised conservation guidelines for all species;
rather, each species must be evaluated individually and decisions made to maximise the
retention of genetic diversity, thereby maximising the species' prospects for recovery.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 55 -
Chapter 3
Characterisation, Multiplex Conditions, and Cross-Species Utility of Tetranucleotide Microsatellite Loci for Blanchard's Cricket Frog (Acris crepitans b/anchardt)
This chapter has been published with minor modifications as:
Beauclerc KB, Johnson B, White BN (2007) Characterization, multiplex conditions, and cross-species utility of tetranucleotide microsatellite loci for Blanchard's cricket frog (Acris crepitans blanchardi). Molecular Ecology Notes 7: 1338-1341. doi: 10.l 111/j.1471-8286.2007.01874.x
KB Beauclerc performed all laboratory work, data analysis, and wrote the paper. B Johnson provided valuable input and funding for the work. BN White is the principal investigator responsible for the work.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 56 -
Abstract
Seventeen tetranucleotide microsatellite were isolated and characterised for Blanchard's
cricket frog (Acris crepitans blanchardi), an anuran common to the central USA.
Conditions for four multiplex reactions, using 16 of the loci, are also described. These
loci were highly polymorphic when screened in two geographically distant populations,
with 11 to 48 alleles per locus (average= 24.8) and observed and expected
heterozygosities of 0.18-0.97 and 0.17-0.96, respectively. The population from Illinois
had significantly lower genetic diversity than the Texan population. Genetic
differentiation between the populations, as measured by FsT, was moderate, but several
private alleles were found in each. Nine loci were also polymorphic in the related taxon
A. c. crepitans, and seven were polymorphic in A. gryllus. Five loci amplified in all three
taxa. These genetic markers will be useful for population- and species-level
investigations of this widespread group.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 57 -
Introduction
Cricket frogs (genus Acris) are small, non-climbing, aquatic hylids that occur
throughout the central and eastern United States (Conant and Collins 1998). Two species
are recognised, the northern (A. crepitans) and southern (A. gryllus) cricket frog, with
these each further divi.ded into subspecies. Blanchard's cricket frog (A. c. blanchardi) is
the most widely distributed member, ranging from Texas through the central states and
into extreme southwestern Ontario (Conant and Collins 1998). Once extremely abundant
throughout its range, many northern populations of A. c. blanchardi are in decline and it
is now rare or extirpated from several localities (Kellar et al. 1997; Lannoo 1998b;
Hammerson and Livo 1999; Lehtinen 2002). As part of the recovery program for A. c.
blanchardi in Canada, I characterised 17 polymorphic tetranucleotide mircrosatellite loci
for A. c. blanchardi, developed multiplex conditions for them, and screened several
individuals from two widely separated populations. I also tested for cross-amplification
ability in related A eris subspecies and species. These genetic markers will be valuable
for future studies to investigate questions such as the evolutionary relationships among
Acris, hybridisation among sympatric species and subspecies, levels of genetic variation,
structure, and gene flow, and fine-scale landscape analyses.
Materials and Methods
Microsatellite sequence isolation utilised a biotin-enrichment protocol similar to
Hamilton et al. (1999). Briefly, DNA was extracted from two individuals by a standard
phenol-chloroform method. Five micrograms of genomic DNA from each individual
were pooled and digested with HaeIII, of which 500 ng was ligated to SNX linkers. One
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 58 -
hundred nanograms oflinker-ligated DNA was enriched with a biotin-labelled probe
containing the repeat motif (GATA)8 and isolated by binding to streptavidin-coated
magnetic beads (Dynal Biotech). Enriched DNA was amplified via the polymerase chain
reaction (PCR) using SNX linkers as primers to double strand the DNA and add an 'A'
overhang. This product was ligated into the pCR2.1-TOPO vector and transformed into
TOPl0 chemically competent cells following the manufacturer's instructions (TOPO TA
cloning kit, Invitrogen).
Colonies with an insert were isolated, amplified using the forward and reverse
M13 primers, and screened on 1 %agarose gels stained with ethidium bromide. Five
microlitres of amplified product was purified using ExoSAP-IT (USB) and sequenced in
the forward direction using the DYEnamic ET-Terminator cycle sequencing kit on a
MegaBACE 1000 DNA Analysis System (Amersham Biosciences). In total, 139 clones
were sequenced, of which 90 contained a tetranucleotide repeat, with only one duplicate.
Primer pairs were designed manually for 37 clones, and FASTPCR v.3.6.31
(Kalendar 2005) was used to check primer pairs for secondary structure and primer dimer
formation. PCR mixtures contained 5 ng genomic DNA, 1 X PCR buffer, 1.5 mM
MgCh, 0.2 mM each dNTP, 0.3 µMeach primer, and 0.5 U Taq polymerase (Invitrogen)
in 10 µL total volumes. Thermal cycling conditions consisted of 30 cycles of
denaturation at 94°C for 30 sec, annealing at the optimal temperature (see Table 3.1) for 1
min, and extension at 72°C for 1 min, with a final extension of 60°C for 45 min, using an
MJ Research PTC-225 thermal cycler. Loci were screened for polymorphism in 4
individuals from each of three regions (Ohio, Illinois and Texas) by visualising PCR
products on 4% agarose gels stained with SYBR Green I (Molecular Probes). Sixteen
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table concentration
Multiplex
Multiplex
AcrMs-28
AcrMs-14
AcrMs-34
AcrMs-29
AcrMs-36
AcrMs-17
AcrMs-3
AcrMs-2
Locus
3.1.
Characteristics
1
2
is
(Fa
(Fa=
for
F:GCGGTGCTCCCTGTGAG R:ATGCTGCTATTCTTGGATGAC(H)
R:AATGTTTCAGTGTGAGATGTTC F: R:CCGTAATATCCTAACACGCTGG F:ACATTGCCTGTGATATTTGG(H) R:CCCACTCTTCATGTATCCTAGG
F:AGAATAGTCATTGAGATCTCTTAGC(H) F: F: R:GGACGTCACAAGATATTTCCAGC
R:AGAAGAGCCAAATGATAACATCC
F: R:GGAGGACGTAACACATAACTTCC F: R:ATTTGGGTGCTCAGAACAATGG
=
TACAGTGCCAATGTGGGC
AAGTTGCCTGTCACTTTAAA
TCAGGCAGTTGTCAGAGTC
TGTTCCAGGA
GAGTGCTGCAGTGATTATTTGC
the
55
55
concentration
°C)
°C)
of
tetranucleotide
Primer
TCCCGTTCG
{5'-3't
of
sequence
both
microsatellite
forward
(F)
(N)
(H)
TGG
and
(F)
reverse
(F)
loci
and
primers
multiplex
(GATA)16(GACA)1s
(CAGA)s(GATA)10
(GACA)14(GATA)1 (CAGA)
(GACA)3(GATA)14
(GACA)7(GATA)29
(GGCA)2
Re~eat
(GATA)33
(GATA)16
imperfect (GATA)7
imperfect
imperfect
in
the
3
amplification
imperfect motif
imperfect
multiplex
b
reaction.
345-634
297-458 134-258
520-616 225-302
112-219
conditions 183-683
102-375
(bp)
Size
50-65
50-55
50-65 60-65
55-65
for 50-65
(°Ct
60
Ta
50
A.
c.
Primer
blanchardi.
(µM)
0.1
0.1
0.4
0.6 0.5
0.1
0.3
0.2
Accession EF450231
EF450240
EF450230
EF450236
EF450244
EF450241
EF450237
EF450246
GenBank
Primer
-
59
-
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.
-
60 60
-
agarose agarose
repeat repeat
EF450239 EF450239
EF450234 EF450234
EF450245 EF450245
EF450235 EF450235
EF450242 EF450242
EF450232 EF450232
EF450243 EF450243
EF450233 EF450233
EF450238 EF450238
on on
the the
respectively. respectively.
based based
0.5 0.5
0.4 0.4
0.2 0.2
0.6 0.6
0.6 0.6
0.2 0.2
0.3 0.3
0.25 0.25
NIA NIA
NED, NED,
interrupted interrupted
cleanly, cleanly,
and and
50 50
65 65
55-60 55-60
55-60 55-60
45-60 45-60
55-65 55-65
55-65 55-65
55-65 55-65
55-60 55-60
pairs pairs
and and
6-FAM 6-FAM
base base
148-249 148-249
245-259 245-259
228-522 228-522
282-506 282-506 194-590 194-590
178-248 178-248
206-299 206-299 154-228 154-228
308-361 308-361
HEX, HEX,
more more
successfully successfully
to to
or or
one one
refer refer
that that
amplified amplified
which which
A)11(GACA)z2 A)11(GACA)z2
im2erfect im2erfect
imperfect imperfect
(GATA)9 (GATA)9
imperfect imperfect
(GATA)9 (GATA)9
imperfect imperfect
imperfect imperfect
(GATA)22 (GATA)22
(GATA)3s (GATA)3s
(GATA)23 (GATA)23
(GATA)16 (GATA)16
(GATA)12 (GATA)12
(GATA)31 (GATA)31
locus locus
indicates indicates
(GATA)s(GACA)3 (GATA)s(GACA)3
(GAT (GAT
single single
parentheses, parentheses,
the the
(F) (F)
(F) (F)
(F) (F)
(F) (F)
Nin Nin
"Imperfect" "Imperfect"
(N) (N)
which which
(N) (N)
(N) (N)
and and
at at
F, F,
clone. clone.
H, H,
by by
ATCAATTGC ATCAATTGC
original original
temperatures temperatures
sequences. sequences.
TCATTCGCCC TCATTCGCCC
of of
from from
indicated indicated
TGTACATACAGTGC TGTACATACAGTGC
are are
I. I.
TCTGACACTTACGG TCTGACACTTACGG
range range
the the
sequence sequence
multiplexes multiplexes
Green Green
°C) °C)
°C) °C)
complete complete for
primers primers
on on
in in
55 55
55 55
TCCATCTCTA TCCATCTCTA
TCCTTACAA TCCTTACAA
TCAGTTGATCTGGTTGAATGTCG TCAGTTGATCTGGTTGAATGTCG
TCTCAGACAGACTTTGACTGG TCTCAGACAGACTTTGACTGG
CCCACAA CCCACAA
ACAAACAATAGGAGTCTATGGAGG ACAAACAATAGGAGTCTATGGAGG
= =
A A
TCTCATCGGACTTGT TCTCATCGGACTTGT
= =
not not
YBR YBR
S S
based based
R:AATTCAATAATGGGTGCATCATGC R:AATTCAATAATGGGTGCATCATGC
R:CTCAAATCACACCATACCTGCC R:CTCAAATCACACCATACCTGCC
F: F:
F: F:
F: F:
R:CCTGGATCTTACTAAGGAGTGC R:CCTGGATCTTACTAAGGAGTGC
R: R:
F:AATCCTGATGAGCAAGAACC(H) F:AATCCTGATGAGCAAGAACC(H)
R:ACTCTACAACCAGCAATCAG R:ACTCTACAACCAGCAATCAG F:GACAAAGTGAAGATGGTAAACTACC F:GACAAAGTGAAGATGGTAAACTACC
F: F: R:TAAGAAGACCTCCAGCCACC R:TAAGAAGACCTCCAGCCACC
R: R:
F:GAAGGTCAGTTGTGTAGACTAGC F:GAAGGTCAGTTGTGTAGACTAGC
R:TCCGTGGACTGGCTCATGG R:TCCGTGGACTGGCTCATGG
R:CGGGGCGATCATTGGATAAATAC R:CGGGGCGATCATTGGATAAATAC
F: F:
F:TCACCTTTCTTTTGGAGTTCTGC(H) F:TCACCTTTCTTTTGGAGTTCTGC(H)
labelled labelled
(Ta (Ta
(Ta (Ta
is is
loci loci
GenBank GenBank
4 4
3 3
with with
is is temperature
See See
motif motif
stained stained
AcrMs-9 AcrMs-9
AcrMs-4 AcrMs-4
AcrMs-8 AcrMs-8
AcrMs-26 AcrMs-26
AcrMs-12 AcrMs-12
AcrMs-35 AcrMs-35
AcrMs-31 AcrMs-31
AcrMs-32 AcrMs-32
Additional Additional
Multiplex Multiplex
AcrMs-24 AcrMs-24
Multiplex Multiplex
Repeat Repeat
Annealing Annealing
gels gels
c c
b b
aFluorescently aFluorescently motif(s). motif(s).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 61 -
loci amplified reliably and were found to be polymorphic (Table 3.2). One additional
locus (AcrMs-26) amplified well, but was not used in further analyses due to low
polymorphism and difficulty incorporating into multiplex reactions. Sequences for
clones are deposited in GenBank under accession numbers EF450230 to EF450246.
The 16 loci were organised into four multiplex reactions of four loci each (Table
3.1 ). Initial primer concentrations were 0.3 µM for all loci; these were subsequently
adjusted to balance peak heights. Interaction between primers for AcrMs-1 7 and AcrMs-
34 in Multiplex #2 produced strong nonspecific peaks that interfered with scoring; as
such, this multiplex was amplified as two separate reactions consisting of AcrMs-
29/AcrMs-17 / AcrMs-36 and AcrMs-34, which were pooled in the ratio 2:1 prior to
desalting. In Multiplex #3, AcrMs-32 and AcrMs-4 amplified weakly; this multiplex was
therefore also amplified as two reactions consisting of AcrMs-8/AcrMs-24 and AcrMs-
32/AcrMs-4, which were pooled in the ratio 1:2 prior to desalting. PCR products were
desalted using Sephadex G50 (Sigma Aldrich), profiled on a MegaBACE 1000 DNA
Analysis System, and analysed using GENETIC PROFILER v.2.2 (Amersham Biosciences).
Twenty-two individuals from a single pond in Champaign County, Illinois and 33
individuals from a single pond in Kendall County, Texas were screened at the 16 loci
using the multiplexes described in Table 3.1. All summary statistics and molecular
indices were calculated using GENEPOP v.3.4 (Raymond and Rousset 1995). Because of
the large geographic distance between the two populations and the likelihood that they
represent independent breeding populations, statistics were calculated for each region
separately. Genetic differentiation was assessed using the number of private alleles and
FsT according to Weir and Cockerham (1984) in GENEPOP.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 62 -
Table 3.2. Genetic diversity indices for 16 tetranucleotide microsatellite loci in two populations of A. c. blanchardi. Number of alleles (Na) and expected (HE) and observed heterozygosities (Ho) were determined using 22 individuals from Illinois and 33 from Texas. Deviation from Hardy-Weinberg equilibrium is indicated by P < 0 05. Allelic richness (ag) was determined for the Texas population by standardisation to N = 22 using rarefaction.
Illinois Texas Locus Na HE Ho p Na HE Ho p ag Total Na 3 7 0.73 0.73 0.67 19 0.93 0.91 0.35 16.63 20 28 13 0.91 0.91 0.02 23 0.96 0.94 0.19 23.34 34 2 11 0.86 0.77 0.79 17 0.94 0.52 0 16.00 20 14 8 0.81 0.77 0.44 33 0.96 0.79 0 25.12 32 34 4 0.40 0.41 1 10 0.81 0.36 0 9.31 11 29 8 0.83 0.36 0 16 0.92 0.81 0.06 14.99 18 17 13 0.87 0.91 0.94 30 0.96 0.85 0 24.23 37 36 8 0.77 0.86 1 24 0.96 0.88 0.27 21.03 27 8 3 0.41 0.41 0.58 15 0.92 0.91 0.77 14.22 15 24 3 0.50 0.36 0.08 18 0.91 0.94 0.85 15.78 18 32 7 0.77 0.59 0.03 19 0.92 0.55 0 16.58 21 4 20 0.95 1 1 29 0.96 0.94 0.67 23.71 48 31 10 0.85 0.86 0.15 17 0.93 0.94 0.37 15.19 20 35 8 0.76 0.82 0.50 16 0.90 0.91 0.6 14.02 16 9 12 0.87 0.37 0 31 0.96 0.97 0.63 24.91 38 12 2 0.17 0.18 1 22 0.93 0.52 0 18.38 22 Total 137 339 293.41 399 Average 8.56 0.72 0.65 21.19 0.93 0.79 18.34 24.81
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 63 -
Results and Discussion
For Illinois, 137 alleles were found (allelic diversity= 8.56) and the number of
alleles for each locus ranged from two to 20 (Table 3.2). Observed and expected
heterozygosities ranged from 0.18 to 0.91, and 0.17 to 0.95, respectively. Texas was
substantially more diverse, with 339 total alleles (allelic diversity= 21.19), and 10 to 33
alleles per locus (Table 3.2). Observed and expected heterozygosities were also generally
higher than Illinois, ranging from 0.52 to 0.94 and 0.82 to 0.96, respectively. Although
the discrepancy in sample size between these populations is not great, it could contribute
to the differences in diversity. To determine whether genetic diversity truly varied
between these populations, I calculated allelic richness (ag) for Texas using rarefaction in
the program HP-RARE v.1.0 (Kalinowski 2005). This value is the expected number of
alleles when the sample size is standardised to be equal to that of the Illinois population
(N = 22) (Kalinowski 2004). Results showed that Texas still possessed substantially
more alleles at each locus than Illinois (Table 3.2), and the null hypotheses that the
number of alleles (ag for Texas) and HE were equal between the two populations were
both rejected using a 2-tailed Wilcoxon signed-rank test in SPSS v.10 (P < 0.001).
Genetic differentiation, as measured by total FsT, was moderate between Texas
and Illinois (Table 3.3). However, all loci in the Texas population contained private
alleles, which is not surprising given its high polymorphism, and even the much less
diverse Illinois population possessed private alleles at 75% ofloci (Table 3.3). Private
allelic richness (ng) was also much greater in Texas following standardisation to N = 22
using rarefaction in HP-RARE (Table 3.3).
Fisher's exact test showed that loci AcrMs-9, AcrMs-28 and AcrMs-29 departed
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 64 -
Table 3.3. Number of private alleles [p(l)] and FsT values for 16 microsatellite loci in two populations of A. c. blanchardi. Private allelic richness (ng) was determined for the Texas population by standardisation to N = 22 using rarefaction.
Illinois Texas Locus p(l) p(l) 7l'g FsT 3 1 13 11.44 0.13 28 5 21 16.04 0.04 2 3 9 8.19 0.04 14 1 24 19.05 0.07 34 1 7 6.45 0.34 29 2 10 9.11 0.08 17 7 24 19.70 0.07 36 3 19 16.84 0.12 8 0 12 11.69 0.29 24 0 15 12.89 0.21 32 2 14 12.02 0.10 4 19 28 23.04 0.04 31 3 10 8.64 0.06 35 0 9 7.84 0.10 9 8 26 21.05 0.07 12 0 20 16.71 0.32 Total 55 261 Average 3.44 21.19 13.79 0.13
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 65 -
significantly from Hardy-Weinberg equilibrium in Illinois, as did loci AcrMs-2, AcrMs-
12, AcrMs-14, AcrMs-17, AcrMs-32 and AcrMs-34 in Texas (Table 3.2). All were due
to heterozygote deficiency. This may result from a number of factors, including
population substructure (Wahlund effect), inbreeding in small populations, selection
against heterozygotes, and null alleles (Frankham et al. 2002). Given that samples were
collected from single ponds, it seems unlikely that such large deficiencies could be the
result of substructure within each population; moreover, a deficiency of heterozygotes
would be expected at all loci. It is possible that highly related individuals (i.e. family
groups) were sampled, essentially creating very fine-scaled structure. However, the
occurrence of up to 20 alleles for a single locus in Illinois and 33 in Texas indicates that
at least 10 and 17 parents, respectively, are responsible for producing the samples
profiled here. This also argues against the effects of small population size, as does the
observation that populations in these regions can have > 1000 individuals at some ponds
(Pyburn 1958; Nevo 1973b; Gray 1983, 1984). It also seems unlikely that selection
against heterozygotes is causing the deficiency, as microsatellites are generally not
known to produce a functional protein product. While it is possible that the affected loci
are linked to genes that may be under selection, it seems improbable that this would be
the case for 25-38% ofloci (Table 3.2). The high variability of these markers and the
difficulty in designing primers that successfully amplified individuals from both regions
(K. Beauclerc, unpublished data) suggest that mutations in priming sites are very likely to
occur in some individuals, and that null alleles are therefore the probable cause of the
heterozygote deficiency. After the sequential Bonferroni correction was applied, locus
pairs AcrMs-31/AcrMs-35 and AcrMs-2/AcrMs-12 continued to show linkage
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 66 -
disequilibrium in Texas. While this may indicate that these loci are physically linked, the
fact that they were in equilibrium in Illinois suggests that they are not.
The loci developed for A. c. blanchardi were screened for amplification ability in
related species and subspecies: the northern cricket frog (A. c. crepitans), the southern
cricket frog (A. gryllus gryllus), and the Florida cricket frog (A. g. dorsalis). When
screened on agarose gels, the following loci either amplified poorly, not at all, or with
several nonspecific bands: AcrMs-2, AcrMs-9, AcrMs-12, AcrMs-14, AcrMs-31 (all
three taxa), and AcrMs-3, AcrMs-4, AcrMs-24, AcrMs-35 (A. gryllus). AcrMs-36
amplified very weakly in A. g. gryllus, and appeared to have null alleles in A. g. dorsalis.
AcrMs-4 and AcrMs-28 amplified well in A. c. crepitans, but had alleles> 900 bp and
thus were discarded from use. AcrMs-32 generally amplified well in A. c. crepitans, but
was also discarded due to suspected null alleles. In summary, only a subset of the loci
amplified reliably in each taxa (Table 3.4): nine loci in A. c. crepitans and seven loci in
A. gryllus. Five loci amplified in all four Acris subspecies examined here. All loci that
amplified were polymorphic in seven (A. c. crepitans) or nine (A. gryllus) individuals.
The highly polymorphic nature of these microsatellite loci in A. c. blanchardi, and
their utility in related taxa, will make them valuable for a variety of applications. These
preliminary analyses have already demonstrated genetic differentiation between northern
and southern regions, as well as substantial differences in genetic diversity, which is
concordant with mitochondrial data (Chapter 4) and colour polymorphisms (Nevo 1973b;
Gray 1983; Gorman 1986). The presence and frequency of null alleles is an issue that
must be thoroughly investigated, as statistical adjustments may be required to account for
them (Chapuis and Estoup 2006; Van Oosterhout et al. 2006; Wagner et al. 2006).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table
and agarose
individuals.
species.
3.4.
gels
AcrMs-17 AcrMs-24
AcrMs-29
AcrMs-26 AcrMs-28
AcrMs-32 AcrMs-34
AcrMs-36
AcrMs-35
AcrMs-3
AcrMs-8
Cross-amplification
Locus
stained
Annealing
with
temperature
SYBR
Ta
45-60
45-55 55-60
45-50 55-65
50-60
50-60
50-60
50
(°C)
ability
Green
A.
c.
(Ta)
Size
crep_itans
245-260
375-591
229-262
171-217 180-281 120-690 119-158
132-225
165-193
of
I.
is
tetranucleotide
Number
(bQ)
the
range
of
Na
12
4
6 5 3 8
6 9
5
of
allele~
temperatures
microsatellite
(Na)
Ta
45-50 50-60 45-55
50-60 50-65 50-65 50-55
was
(°C)
at
calculated
A.
loci
which
g.
Size
243-500 245-258 506-606
224-360 302-382 111-206
154-209
isolated
gryllus
the
(bQ)
using
locus
from
nine
Na
amplified
11
11
12
11
6
2
5
A
(A.
c.
blanchardi
gryllus)
Ta
successfully
45-50
45-50
50-65 55-65 50-60 50-60
50
(°C)
and
A.
in
seven
related
g.
Size
244-258
232-615 225-686 520-600 308-399 102-260
122-202
dorsalis
and
(A. (bQ)
A
cleanly,
eris
c.
crepitans)
subspecies
Na
12
10
14
11 10
11
3 based
-
on
67
-
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 68 -
Chapter 4
Phylogeography and Spatial Structure of Blanchard's Cricket frog (Acris crepitans blanchardl): Conservation Issues at the Northern Edge of its Range
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 69 -
Abstract
Blanchard's cricket frog (Acris crepitans blanchardi) is relatively widespread and
abundant throughout the central and southern United States, but enigmatic declines across
the north of its range have stimulated much interest in this small treefrog. To determine
the distinctiveness and conservation value of the northern populations and evaluate
potential management actions, I investigated its spatial genetic structure and
phylogeography using mitochondrial control region sequences. Analysis of 479
individuals found 101 haplotypes, but relatively low nucleotide diversity. Two
moderately divergent clades were present. One was restricted to the southwest region,
which was likely a refugium during the Pleistocene as it has retained much genetic
diversity and appears to be at demographic equilibrium. The other occurred primarily
across the north, where low genetic diversity, unimodal mismatch distributions, starburst
genealogies, and significant neutrality tests provide evidence of recent postglacial
colonisation. Spatial autocorrelation showed that significant genetic structure occurs up
to a distance of 450 km. The divergence of northern populations indicates that
conservation efforts are warranted in this region, and, when combined with known life
history traits, suggests that adaptive differences may exist. For this reason, any future
supplementations or reintroductions should occur within the geographic boundaries of the
observed genetic structure.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 70 -
Introduction
Global declines in amphibian populations have been at the forefront of the
scientific and public media for almost two decades (Barinaga 1990; Houlahan et al. 2000;
Collins and Storfer 2003; Stuart et al. 2004; Sodhi et al. 2008). Causes of these declines
are numerous, and include obvious factors such as overexploitation, introduced species,
and habitat degradation, but also subtle ones such as climate change, UV radiation,
chemicals, and infectious diseases (Collins and Storfer 2003). It is probable that the
precise cause of declines varies between locations, and that multiple stressors are
interacting in most situations (Collins and Storfer 2003). Much attention has focused on
declines in tropical regions, where there is more amphibian biodiversity and species are
more narrowly distributed (Duellman and Trueb 1986; Myers et al. 2000), where there is
a greater variety and complexity of life histories (Duellman and Trueb 1986), and where
significantly more declining species exist and causes of declines have been particularly
enigmatic (Stuart et al. 2004).
Unlike many of these threatened amphibian species, Blarichard's cricket frog
(A eris crepitans blanchardi) has a broad North American distribution (Figures 4.1, 5 .1 ),
is abundant throughout much of the Great Plains, and has an unremarkable life history.
However, populations have been in decline along the northern and western edge of its
range (Lannoo et al. 1994; Hay 1998; Mierzwa 1998; Minton 1998; Lehtinen 2002;
McLeod 2005; Lehtinen and Skinner 2006), and it is likely extirpated from Canada and
several northern US states (Kellar et al. 1997; Moriarty 1998; Hammerson and Livo
1999). Once considered to be the most common amphibian in many parts of the upper
Midwest (Lannoo et al. 1994; Hay 1998; Mierzwa 1998; Gray and Brown 2005), it is
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 71 -
lu !!!I
!!II IC!
!ill • ll'l
O Clade I El Clade II A Clade I & II
N 0 500 1000 Kilometres A
Figure 4.1. Location of sampling sites for A. c. blanchardi. The generalised glacial limits for the pre-Illinoian (dotted line) and Wisconsinan glaciations (solid line) are also shown (Reed and Bush 2005).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 72 -
now the "species of most concern" (Lannoo 1998a, p. 430). Like many tropical species,
however, the specific causes of declines in this anuran are unclear. While habitat loss has
likely contributed, it does not appear sufficient to account for the magnitude and
distribution of the declines (Lannoo 1998b; Knutson et al. 2000; Gray and Brown 2005).
Several additional hypotheses have also been postulated, including agricultural chemicals
(Knutson et al. 2000; Gray and Brown 2005; Reeder et al. 2005), habitat acidification
(Gosner and Black 1957; Sparling et al. 1995), heavy metal contamination (Diana and
Beasley 1998), introduced bullfrogs [Rana (Lithobates) catesbeiana] (Burkett 1984; Gray
and Brown 2005), morphological deformities (Mccallum and Trauth 2003), and
infectious diseases or parasites (Beasley et al. 2005; Steiner and Lehtinen 2008).
However, other studies have found these individual factors to be relatively insignificant
and potentially conflicting (Boyd et al. 1963; Gray 2000; Russell et al. 2002; Beasley et
al. 2005; Lehtinen and Skinner 2006). It is probable that the precise cause of decline
differs among locations, and that multiple threats interact in a complex manner (for
details on such scenarios, see Lannoo 1998b; Beasley et al. 2005; Irwin 2005).
Concern for the fate of A. c. blanchardi has recently increased, and has prompted
a variety of ecological (McCallum and Trauth 2003; Gray and Brown 2005; Irwin 2005;
Lehtinen and Skinner 2006; Steiner and Lehtinen 2008) and taxonomic (McCallum and
Trauth 2006; Rose et al. 2006; Gamble et al. 2008) investigations. However, little is
known about the distinctiveness and conservation value of the declining northern
populations. The large range of A. c. blanchardi and highly structured nature of many
amphibian species (Shaffer et al. 2000; Palo et al. 2004; Zeisset and Beebee 2008)
suggest that cryptic genetic diversity is likely to be found for this anuran. Indeed, several
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 73 -
North American amphibians with similarly large ranges have been shown to contain
multiple genetic lineages (Austin et al. 2002; Church et al. 2003; Zamudio and Savage
2003; Hoffman and Blouin 2004; Lee-Yaw et al. 2008). Furthermore, peripheral
populations such as those at the northern edge may be a source for speciation, as isolation
and genetic drift can facilitate divergence from the core populations in response to local
selection pressures (Lesica and Allendorf 1995; Garcia-Ramos and Kirkpatrick 1997).
The fluctuating conditions to which they are subjected may also allow them to evolve
greater resistance to environmental extremes, enabling them to endure changing climates
(Lesica and Allendorf 1995; Volis et al. 1998). Molecular phylogenetic analyses have
also provided support for recognition of A. c. blanchardi as a distinct species (Chapter 5;
Gamble et al. 2008), which means these northern populations may be even more critical
to preserving the overall genetic diversity of this anuran.
In addition to evaluating the taxonomy and distinctiveness of endangered
populations or species (e.g. Wang et al. 1999, 2008; Shaffer et al. 2004a,b), genetic
information has been widely used in conservation. It can provide details on population
connectivity and structure that is crucial to proper management (Bums et al. 2007; Amato
et al. 2008). It may identify populations with limited genetic variation, and thus reduced
evolutionary potential, that are at greatest risk of extirpation from anthropogenic
disturbances (Bos and Sites 2001; Vianna et al. 2006). Genetic surveys can identify the
populations most suitable for use in translocation or reintroduction efforts (Shaffer et al.
2000, 2004a; Wilson et al. 2008). Source individuals should be genetically and
adaptively similar to reduce outbreeding depression and increase survival potential
(Frankham et al. 2002), yet genetically diverse to minimise swamping of native
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 74 -
individuals (Friar et al. 2000) and future inbreeding depression (Frankham et al. 2002).
The limited resources available for conservation means that actions to protect
globally common but locally rare species such as A. c. blanchardi are often questioned
(Hunter and Hutchison 1994). As part of the recovery program for A. c. blanchardi in
Canada, I have investigated the phylogeography and spatial genetic structure of this
subspecies across its range using mitochondrial DNA (mtDNA) sequences. I will use this
information to determine if the declining northern populations are sufficiently distinct to
warrant conservation efforts, identify potential factors that may be contributing to
declines, and provide a framework for recovery recommendations for populations in
Canada and other regions of concern across its northern periphery.
Materials and Methods
Sample collection and molecular methods
Samples were collected from across the entire range ofA. c. blanchardi. Counties
were considered to be sampling sites; the majority(> 75%) of sites consisted of a single
location, and nearly all (95%) comprised no more than two locations. In total, 479
individuals were sampled from 107 sites in 13 states (Figure 4.1; Table 4.1). The number
of samples per site ranged from one to 30, with an average of 4.5. Geographic locations
of the sites were taken as the latitude and longitude for the county in which the pond or
stream was located, and were obtained from the U.S. Census Bureau Census 2000
Gazeteer (http://www.census.gov/; Appendix 1). Tissue samples were collected from
adults between 2001 and 2007 except Roger Mills, Cherokee, Wagoner, Custer, Logan,
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 75 -
Table 4.1. Summary of sampling collection sites for A. c. blanchardi. Additional details on sampling sites and haplotypes can be found in Appendices 1 and 2.
State N No. sites No. haplotypes Arkansas 22 8 19 Illinois 65 5 15 Indiana 31 7 9 Iowa 31 7 4 Kansas 47 23 20 Kentucky 3 2 2 Michigan 27 2 1 Missouri 41 11 14 Nebraska 6 6 2 Ohio 91 14 3 Oklahoma 42 12 22 South Dakota 20 2 2 Texas 53 8 23
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 76 -
and Canadian, OK, which were collected in 1998 as part of a previous study. All tissue
samples consisted of either toe clips collected in the field or muscle from vouchered
specimens, and were preserved in 95% ethanol or IX lysis buffer (2 M urea, 0.1 M NaCl,
0.25% n-lauroyl sarcosine, 5 mM CDTA, 0.05 M Tris-HCl pH 8).
Approximately 10 mg of tissue were dissolved in 500 µL of IX lysis buffer and
digested with 50 µL of proteinase K. Total genomic DNA was extracted with the
DNeasy Tissue Kit (Qiagen Inc.) or an automated magnetic bead procedure, and
quantified with the PicoGreen Quantitation Kit (Molecular Probes) on a FLUOStar
Galaxy (BMG Labtech). A fragment of the mitochondrial control region was amplified
using the primers ControlWrev-L/ControlP-H (Goebel et al. 1999) in a 25 µL reaction
containing 1-5 ng DNA, IX PCR buffer, 2 mM MgCh, 0.2 mM dNTPs, 0.1 mg/mL BSA,
0.2 µM each primer, and 1.25 U Taq polymerase (Invitrogen). Thermal cycling used an
MJ Research PTC-225 thermal cycler with the following conditions: initial denaturation
at 94°C for 5min, 30 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30
sec, and extension at 72°C for 45 sec, with a final extension of 72°C for 1O min. PCR
product was visualised on 1 % agarose gels stained with ethidium bromide, and 5 µL of
product was purified with ExoSAP-IT (USB). Cycle sequencing was performed with the
primer ControlP-H using the DYEnamic ET-Terminator kit on a MegaBACE 1000 DNA
Analysis System (GE Healthcare).
Data analysis
Sequences were aligned with CLUSTALX v.1.81 (Thompson et al. 1997) and edited
in BIOEDITV.7.0.5.3 (Hall 1999). A comparison oflog likelihood scores using the Akaike
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 77 -
Information Criterion in MODEL TEST v .3. 7 (Posada and Crandall 1998) found the
Tamura-Nei model with invariable sites and gamma distribution (TN+I+f) to be the most
likely model of sequence evolution for the data (AIC = 3082.09, lnL = -1534.05). The
parameter estimates from this model were: base frequencies: A = 0.31, C = 0.12, G =
0.25, T = 0.33; substitution rate matrix: A-G = 13.75, C-T = 19.90, all others= 1; ratio of
transitions to transversions = 7.42; proportion of invariant sites (I)= 0.74; and gamma
distribution shape parameter (a)= 0.90. This model was used to calculate diversity
indices at the nucleotide level for the entire dataset and for all groups identified during
subsequent analyses. ARLEQUIN v.3.11 (Excoffier et al. 2005) was used to determine the
number of variable sites and haplotype frequencies, and to calculate pairwise sequence
divergences, nucleotide diversity (7rn; average number of pairwise differences), and
haplotype diversity (h; probability that two randomly chosen haplotypes are different).
Nucleotide diversity was calculated without a model of nucleotide substitution for each
site with> 2 samples, and was regressed against latitude and longitude in SPSS v.10 to
evaluate geographical patterns of genetic diversity. The significance of the slope of the
regression line was determined with analysis of variance.
Several features inherent to intraspecific genetic datasets frequently violate the
assumptions of traditional interspecific phylogenetic methods (Posada and Crandall 2001;
Huson and Bryant 2005); network methods are thus often preferred to incorporate the
additional information present in such datasets into meaningful genealogies. As such, a
median-joining network was created in the program NETWORK v. 4.5 (Bandelt et al. 1999)
using the default parameters to explore the relationship among A. c. blanchardi control
region haplotypes.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 78 -
The relatively continuous distribution of A. c. blanchardi and lack of distinct
phenotypic differences (McCall um and Trauth 2006) makes a priori separation of the
sample sites into populations somewhat arbitrary. The genetic data were therefore
analysed with spatial techniques to describe the genetic structure and identify the best
grouping of sites (Diniz-Filho and Telles 2002). Spatial analysis of molecular variance
(SAMOVA) groups geographically adjacent sites into a number of user-defined clusters (K)
for which the proportion of total genetic variance due to differences between groups (FCT
index) is maximised. All 107 sample sites were analysed in the program SAMOVA v.l
(Dupanloup et al. 2002) for clusters of K = 2 to K = 20 (the maximum number of clusters
possible in SAMOV A), with 10 000 iterations of the simulated annealing steps and 100
repetitions of the entire process. Significance of the FCT index was tested by comparison
with the null distribution produced by 1000 simulations. The extent of genetic structure
was also examined using spatial autocorrelation analyses in GENALEX v .6.1 (Peakall and
Smouse 2006). Squared genetic distances (calculated as sequence divergences) and
geographic distances between all samples were calculated, and the correlation coefficient
was determined for distance classes of 50 km. The significance of the correlation
coefficient for each distance class was evaluated using 9999 permutations of the data, and
95% confidence intervals were obtained using 9999 bootstraps. Correlograms were
generated for the entire sample set as well as Groups 1 through 5 identified during
SAMOVA analysis (Groups 6 and 7 consisted of only two locations each and were not
analysed; see Results). The entire correlogram was considered significant if at least one
coefficient remained significant following Bonferroni's correction based on the number
of distance classes (Oden 1984 ).
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 79 -
The demographic history of A. c. blanchardi was explored by examining the
frequency of pairwise differences between all samples (mismatch distribution) for the
entire sample set and each group identified by SAMOVA analysis using ARLEQUIN. The
null hypothesis that each observed data set conformed to the expected distribution under
the sudden expansion model was tested using 5000 bootstrap replications. Each group
was further evaluated for conformation to the neutral model of evolution using Tajima's
(1989) D and Fu's (1997) Fs statistics in ARLEQUIN, which are more powerful than
mismatch distributions for detecting population size changes (Ramos-Onsins and Rozas
2002). Coalescent simulations were used to generate 10 000 random samples of each
statistic under the hypothesis of selective neutrality and population equilibrium. The
proportion of random D or Fs statistics less than or equal to the observed value was taken
as the P-value of the statistic. Fu (1997) showed that for the empirical distribution of the
Fs statistic, the critical points at the 5% significance level correspond to the second
percentile; thus, Fs should only be considered significant when P < 0.02.
Results
Quality sequence was obtained for 485 bp of the control region in 4 79 individuals,
yielding 101 haplotypes (Appendix 2). Sequences are deposited in GenBank under
accession numbers EU828245 to EU828345. Seventy-three sites were variable, with 58
transitions, 17 transversions, and six indels. Maximum sequence divergence was 0.036,
and occurred between haplotypes AcrCR-75 (Texas) and AcrCR-95 (Oklahoma).
Nucleotide diversity (nn) for the entire sample set was 0.0089 (0-0.0247 for sample sites
with> 1 individual), and haplotype diversity (h) was 0.77. Nucleotide diversity for each
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 80 -
site decreased significantly in a south to north and west to east direction (Figure 4.2).
Haplotype frequencies ranged from to 0.0021 (singletons) to 0.47 in AcrCR-1. The next
most frequent haplotypes were AcrCR-19 (0.042) and AcrCR-22 (0.031). Many low
frequency haplotypes were present: 74% occurred once or twice in the sample set.
AcrCR-1 was the most widespread, and was found in ten of 13 states and 53 of 107 sites.
The median-joining network identified two clades that were separated by a
minimum of five mutations (Figure 4.3). These roughly corresponded to the northern
(Clade I) and southwestern (Clade II) portion of A. c. blanchardi' s range (Figure 4.1 ).
Clade I was more widespread, being found at 91 locations in every state sampled. It also
contained the majority of individuals (391) and haplotypes (72), but had relatively low
nucleotide (0.0042) and haplotype diversity (0.66). In contrast, Clade II occurred at 30
locations primarily in Kansas, Oklahoma, and Texas, contained far fewer individuals (88)
and haplotypes (29), but had much greater nucleotide (0.0113) and haplotype diversity
(0.93). The average sequence divergence between the groups was 0.021. Overlap of
haplotypes belonging to the two clades occurred at 14 locations primarily in Kansas and
Oklahoma, but also in Arkansas, Missouri and Texas (Figure 4.1 ). A large "starburst"
with haplotype AcrCR-1 as its centre was present in Clade I of the median joining
network. All but one of these haplotypes differed from AcrCR-1 by a single mutation.
Clustering of the 107 sample sites into 20 groups (K = 20) yielded the largest F CT
value during SAMOVA analysis (Figure 4.4). However, FcT is expected to increase with
increasing K (Dupanloup et al. 2002). F CT appeared to reach a plateau after K = 4,
suggesting that there is no apparent difference between greater values of K. As well, Fsc,
the variation within populations relative to the groups, declined abruptly until K = 7
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 81 -
0.030 y =-0.0013x + 0.0567 2 0.025 • R =0.31 • F =34.52, p < 0.01
0.020 • • • 0.015 - • ·- • • ••• • • • 0.010 • • 0.005 • • • _.>, • "cii.... 0.000 -~Q) 28 30 32 34 36 38 40 42 44 ""C Latitude Q) .::""C 0.030 0 Q) y =-0.0006x- 0.0527 u 2 :::, 0.025 • • R =0.23 z F =23.36, p < 0.01
0.020 • • • • • •• • 0.015 • • • •• •• • • • 0.010
0.005
0.000 +----,---...... ----.----~ .... --~----,--41>---,----_...,.-----r------t -102 -100 -98 -96 -94 -92 -90 -88 -86 -84 -82 Longitude
Figure 4.2. Linear regression of nucleotide diversity with latitude (top) and longitude (bottom) for 79 sample sites across the range A. c. blanchardi. Only sites where two or more samples were profiled are included.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 82 -
I' Clade I I I I I I' I I I I I ' I' ' I' I ' I' I Clade II
I I I I ' I' I I' I' I' I I I I I I'
Figure 4.3. Median joining network of 101 control region haplotypes found in A. c. blanchardi. Open circles are haplotypes, with size of the circle proportional to the frequency of the haplotype in 4 79 individuals. Small black circles are median vectors. All nodes are connected by single mutations, unless otherwise specified by the number of hatch marks. The groups ofhaplotypes comprising the two major clades, designated Clades I and II, are separated by the dashed line. For clarity, only haplotype AcrCR-1 is labelled.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 83 -
0.8
I I 0.7 ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ • 0.6 ■
A 0.5 (.) ~en ~ro 0.4 A -en A A A LL 0.3
A A A 0.2 I A I A A A A A A I A A A A 0.1
0 0 5 10 15 20 25 K
Figure 4.4. The variation observed among groups (FcT; squares) and variation among sample sites within groups (Fsc; triangles) when 107 A. c. blanchardi sample sites are partitioned into K = 2 to 20 groups using spatial analysis of molecular variance. The vertical dashed line indicates K = 7, the optimal number of groups for the data.
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 84 -
(Figure 4.4). This value was therefore chosen as the most likely number of groups, since
it maximises the variation among groups (FcT) while minimising the variation among
sites within groups (Fsc) (Dupanloup et al. 2002). Seventy-two of the 107 sample sites
were included in a single group, with the remaining 35 divided among six additional
groups (Table 4.2, Appendix 1). The FsT for K= 7 was 0.75 (P < 0.01), and 68.01% of
the variance was accounted for by the diversity among the seven groups ( 6.93% by the variation among sites within these groups ( variation within each of the sites ( widespread, but was the least diverse in terms of Jrn and h (Table 4.2). In contrast, Group 6 contained the fewest individuals and was localised to two counties in south-central Texas, but possessed the highest 7rn and second highest h. The sites that comprise SAMOVA Groups 1 and 2 consisted mainly of Clade I haplotypes, while sites belonging to Groups 3, 4, 6, and 7 were primarily composed of Clade II haplotypes. Group 5 contained a mixture of haplotypes from both Clades I and II, although Clade II haplotypes were slightly more numerous. A profile of declining spatial autocorrelation with distance class was obtained for the entire sample set and Group 1, with significant spatial autocorrelation up to a distance of approximately 750 km and 450 km, respectively (Figure 4.5). Both correlograms were significant overall using Bonferroni' s correction. Groups 2 through 5 appeared to have little overall pattern and the autocorrelation coefficients rarely differed significantly from random expectations (Figure 4.5). Significantly small values for neutrality tests in the entire data set are indicative of a population expansion in A. c. blanchardi' s demographic history (Table 4.3) (Tajima Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table diversity Group Group Group Group Group Grour_ Group 4.2. 4 2 3 6 5 1 7 (1rn) 350 Characteristics 20 30 23 31 12 13 N and locations haplotype No. 72 10 1 2 2 1 8 2 5 2 8 of diversity states o No. No. groups 12 3 9 1 haploty2es identified during (h). 48 22 10 15 9 6 OK: KS: Sebastian; AR: spatial KS: Gove, Canadian, Benton, Cowley, analysis Harvey, OK: Sequoyah; Columbia, Kiowa, Atoka, TX: TX: Wallace, Kiowa, All of Jefferson, McMullen, molecular Kendall, remaining Locations Logan, Leflore; TX: Pawnee; Franklin, Washington Hood, Morris, Menard Muskogee, variance sites Travis TX: OK: Garland, Wise Anderson, Osage, Custer, for Roger Lafayette, A. Shawnee, Ellis c. Bowie Mills, blanchardi, 0.0094 0.0029 0.0127 0.0064 0.0126 0.0157 0.0044 including 7l"n nucleotide 0.91 0.58 0.98 0.72 0.91 0.95 0.82 H - 85 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. permutations Figure blanchardi 4.5. ·u :.:; :E - (.) C Q) Q) 0 m 0 .__ .__ Q) 0 C 0 samples -0.2 -0.4 -0.1 -0.2 -0.2 -0.4 -0.6 -0.8 0.8 0.6 0.4 0.2 Correlograms 0.3 0.2 0.1 0.8 0.6 0.4 0.2 1.2 (dashed 0 0 1 0 25 25 25 ~ ·-- 225 and 75 lines), SAMOVA 425 75 ------ of 125 and 625 the 95% correlation 175 Groups 825 125 confidence 1025- 225 1 to 1225 coefficient 175 275 5. 45 1625 1425 Also intervals 325 shown All 225 for Group Group Distance samples 375 1825 around genetic .... 2 4 is - . -- 2025 the 425 275 .. class the and distribution correlation -0.1 -0.2 -0.2 -0.4 -0.6 -0.2 -0.3 -0.1 0.4 0.3 0.2 0.1 0.8 0.6 0.4 1.2 0.2 0.2 0.3 0.1 geographic (km) 0 0 0 25 ,------, 25 ,------, 25 _,__ -t.·• L ,------, -, 1=:i:::1::i::1::T:::1::~::!::=::::1::!:;:~::[::1:_:j r · • ______ ·, ·-. ______ .. 125 .. - ···,,. .... • _.,, of 75 75 225 coefficient - ... .. the •_• distance ..... 325 correlation 125 125 ,I 425 ...... at 175 based 525 distance 175 I · ...... 625 coefficient 225 ----··· on 725 225 .. 9999 classes 275 825 ---· bootstraps. based 925 275 2 375 325 of 1025 50 Group on Group Group .· 325 1125 km 9999 1 (error 3 5 1225 for ___. __, 425 375 all bars). A. - c. 86 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Table and of squared parameters 4.3. deviation) Measures Group Group Group Group Group GrouE Group of All the 4 3 2 7 5 6 1 values of mismatch selective -1.6656 -2.3030 -0.8969 -1.3321 -0.2639 -0.2696 -0.0902 .02 0.5889 0.1042 were D distribution neutrality significant 0.0127 0.0849 0.4385 0.2021 0.4398 0.5034 (Tajima's Neutrality for p 0 at P the = entire 0.05. D -24.8904 -27.7578 -11.3716 Tests -1.0866 -3.6179 -1.1808 -1.9933 0.7917 and A. Fs c. Fu's blanchardi Fs), 0.3129 0.6736 0.1468 0.0713 0.2426 their 0.002 p 0 0 data significance set and 4.7 4.7 3.4 6.6 7.1 2.1 5.9 1.5 x seven (var.) based (13.4) (17.4) (16.1) (15.6) (12.6) ( (5.7) (2.3) 4.7) Mismatch SAMOVA on 10 0.0202 0.0290 0.0015 0.0050 0.0097 0.0627 0.0359 0.0191 SSD 000 groups. Distribution simulations None 10.1621 10.0898 0.0801 6.3965 9.2188 9.9551 10.416 2.875 't of of the the SSD data (P), (sum - 87 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 88 - 1989; Fu 1997). The bimodal mismatch distribution of pairwise sequence differences suggests that at least two expansions have occurred, one very recently and one earlier (Rogers and Harpending 1992). The unimodal mismatch distributions for Groups 1 and 2 indicate these are the groups contributing the signature of demographic expansion to the entire data set (Figure 4.6). The expansion occurred more recently in Group 1, as indicated by the smaller mean number of pairwise differences and significant values for both Tajima's D and Fu's Fs, while the older expansion in Group 2 was detectable only by the more sensitive Fu's Fs test (Table 4.3). Mismatch distributions for Groups 3 to 7 were somewhat multimodal with little apparent trend and large variances (Figure 4.6; Table 4.3), suggesting demographic stability (Rogers and Harpending 1992). This was also supported by the neutrality tests, which were not significant (Table 4.3). None of the mismatch distributions were significantly different from a model of demographic expansion based on the sum of squared deviations (Table 4.3), which conflicts with the shape of the distributions and neutrality tests for Groups 3 to 7. However, a recent study with a similarly large number of haplotypes and relatively shallow population history also found discordant results among these parameters (Debes et al. 2008). Such discrepancies may reflect sensitivity to violation of the infinite sites model by a high frequency of multiple hits, which is especially common in the control region (Schneider and Excoffier 1999; Debes et al. 2008). Furthermore, statistics based on the mismatch distribution are less powerful than neutrality tests and may display some unexpected behaviour such as reduced power with larger sample sizes (Ramos-Onsins and Rozas 2002). Due to these potential issues, the results of the model of demographic expansion may be unreliable and only the neutrality tests and graphical mismatch distributions will be considered further. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 89 - 0.3 0.5 All samples 0.4 Group 1 0.2 0.3 0.1 0.2 0.1 0 0 0 2 4 6 8 10 12 14 16 0 2 4 6 8 10 12 14 0.2 0.2 Group 2 Group 3 0.1 0.1 0 0 >, (.) 0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 C: Q) ::::, 0.4 0.3 C" Q) Group 4 Group 5 .... 0.3 LL 0.2 0.2 0.1 0.1 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 14 0.3 0.3 Group 6 Group 7 0.2 0.2 0.1 0.1 0 0 0 2 4 6 8 10 12 0 2 3 4 5 6 7 Number of differences Figure 4.6. Pairwise mismatch distributions for all A. c. blanchardi samples and the groups identified using spatial analysis of molecular variance. Heavy lines are the observed distribution of pairwise differences, and light lines are simulated distributions using the same parameters. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 90 - Discussion Spatial genetic structure Acris c. blanchardi lacks the deep divergences characteristic of many North American amphibians (Shaffer et al. 2000; Austin et al. 2002; Monsen and Blouin 2003; Zamudio and Savage 2003; Hoffman and Blouin 2004; Lee-Yaw et al. 2008). Nonetheless, it appears to have significant genetic structure. The two clades identified by the median-joining network principally occur in the northern and southwestern portion of the range, with only limited overlap in the west-central and southern regions. Sixty-eight percent of the genetic variation was attributed to grouping of the sample sites into seven relatively geographically distinct clusters by spatial analysis of molecular variance. Finally, genetic and geographic distances are significantly and positively correlated up to a distance of approximately 750 km in the entire sample set, and up to approximately 450 km in Group 1. The correlograms showed that there is little genetic structure within the groups located in the southern portion of the range (Groups 2-5; Figure 4.5). This is in accordance with the limits of genetic structure found in Group 1, as these groups do not have samples separated by> 450 km. The absence of genetic structure at this spatial scale could be due to high migration rates within each group making them effectively a single genetic unit; however, this is not consistent with the widely held view that amphibians are highly structured over even small distances due to low dispersal capabilities (Shaffer et al. 2000; Palo et al. 2004; Zeisset and Beebee 2008; but see Austin et al. 2004; Smith and Green 2005; Bums et al. 2007). Mark-recapture studies suggest that A. c. blanchardi has limited dispersal capacity (Pyburn 1958; Burkett 1984), Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 91 - and Ward et al. (1987) found that sites along a single creek were strongly differentiated. This indicates that the lack of genetic structure may instead be due to very low migration rates isolating sites from one another, making random genetic drift the primary determinant of relationships between sites (Ward et al. 1987; Wilson et al. 2008). However, overlap ofhaplotypes between sites within groups, as well as between groups, may be evidence that gene flow is occurring to a much greater extent than expected ( e.g. Smith and Green 2006). Further studies using markers with greater resolution ( e.g. microsatellites) will help to clarify the extent of gene flow and the cause of limited genetic structure at these smaller distances. Phylogeography The large-scale pattern of mtDNA variation in A. c. blanchardi consists of two major groups: a northern clade that is characterised by low genetic diversity and a broad, relatively homogeneous distribution (Clade I), and a southwestern clade with high genetic diversity, restricted distribution, and finer subdivision (Clade II). Colour morphs (Nevo 1973b), some enzymes (Dessauer and Nevo 1969; Salthe and Nevo 1969), and nuclear microsatellite markers (Chapter 3) also reflect this pattern of "southern richness-northern purity", which is most likely the result of rapid colonisation of regions that were glaciated during the Pleistocene era. Simulations show that exponential reproduction by a few long-distance dispersants from the populations' edge can rapidly fill available habitat, while individuals behind the advancing front are limited to logistic growth and contribute little to the gene pool (Hewitt 1996). This form of colonisation entails a series of bottlenecks in the direction of the dispersion, generating a gradient of decreasing genetic Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 92 - variation such as that seen in A. c. blanchardi (Hewitt 1996). Numerous plants and animals in North America and Europe display similar patterns of genetic variation that have been shown to be primarily structured by climatic changes during the Pleistocene (Hewitt 1996, 2004; Lessa al. 2003), and leading-edge dispersal from refugia may be responsible for the north-south phylogeographic breaks seen near the southern edge of the ice sheets in some North American species (Hewitt 2000; Swenson and Howard 2005). Models of long-distance dispersal also show a clustering of genotypes and gradients of correlation coefficients with distance (Ibrahim et al. 1996), and similar profiles have been attributed to colonisation in other species (Easteal 1985; Bertorelle and Barbujani 1995; Williams et al. 2007). Multiple lines of evidence suggest that Clade II is an old, demographically stable group, and that the southwestern portion of the range (Texas, Oklahoma and Kansas) served as a refugium for A. c. blanchardi during the fluctuating climate of the Pleistocene. Greater genetic diversity and subdivision are generally characteristic of older, refugial populations (Hewitt 1996; Bernatchez and Wilson 1998; Hoffman and Blouin 2004; Lee-Yaw et al. 2008), and the observed mismatch distributions and neutrality tests indicate that no population expansions have occurred recently in Groups 3 to 7, which consist largely of Clade II haplotypes. The lack of spatial genetic structure in this region also suggests an absence of recent demographic events such as bottlenecks or expansions. In addition, A. crepitans fossils of various ages have been found from Texas to southern Kansas since 3.4 Ma (Chantell 1966; Holman 1995), demonstrating that this region has been continuously inhabited by cricket frogs (likely A. c. blanchardi) for a substantial time. This is also supported by habitat reconstructions showing that the Great Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 93 - Plains have consisted of essentially modern grasslands since ~ 1.6 Ma, even at the peak of climatic deteriorations (Graham 1999). Furthermore, the Great Plains has been identified as a putative Pleistocene refugium for several amphibian and reptiles (Masta et al. 2003; Austin et al. 2004; Hoffman and Blouin 2004; Howes et al. 2006; Fontanella et al. 2008). In contrast to the southwest, the northern region appears to be young and dominated by recent population expansions. Large "star phylogenies" or starbursts, such as that found in Clade I, occur when many low-frequency haplotypes differ from the central, ancestral haplotype (AcrCR-1) by only a single mutation, and are usually attributed to population expansions (Avise 2000). Significant neutrality tests and a wave like mismatch distribution with small mean for Group 1, which largely corresponds with this starburst, are also indicative of a very recent demographic expansion in this region (Rogers and Harpending 1992; Fu 1997). It likely required several hundred thousand years to generate the amount of variation seen in the starburst (maximum distance= 0.0043), suggesting that it was created prior to the last glaciation (the Wisconsinan, 122 Ka to 10 Ka BP; Richmond and Fullerton 1986). The most severe glaciations occurred in the pre-Illinoian stage (ca. 550 Ka to 860 Ka BP), during which the ice sheet extended as far south as northeastern Kansas and covered Iowa and Illinois, northern Missouri, and eastern Nebraska and South Dakota (Richmond and Fullerton 1986; Figure 4.1 ). This would have eliminated most or all populations north of southern Kansas, placing an upper age of~ 550 Ka on the starburst. A plausible scenario is that an expansion from the southwest into northern Kansas, western Missouri, and southern Iowa and Nebraska occurred during the interglacial preceding, or one within, the Illinoian stage (302 Ka to 132 Ka BP). Glacial ice covered nearly all of Illinois during this stage and would also Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 94 - have eliminated many populations, but it did not penetrate further west into Iowa and Missouri (Richmond and Fullerton 1986; Stiff and Hansel 2004). Thus, some of these newly established populations were likely not eliminated by subsequent glaciations, and generated the starburst pattern evident today. Group 2 also shows evidence of a population expansion based on neutrality tests and mismatch distributions. However, the greater mean of the distribution, greater nucleotide and haplotype diversity, and its southern distribution indicate that the expansion occurred much earlier in the history of this species. It is possible that this group reflects the remnants of a dispersal event that occurred in the early Pleistocene, but whose northern populations were later eliminated by the very severe glaciations that occurred during the pre-Illinoian stage. The most northeastern states have clearly been colonised recently, as Ohio possesses only three closely related haplotypes and Michigan is fixed for a single haplotype. In addition, no Pleistocene fossils of Acris exist north of central Kansas (Holman 1995). Although the Laurentide glacier began its major retreat 20 Ka BP, it experienced several minor advances and ice surges that could have prevented populations from expanding into the Great Lakes area (Richmond and Fullerton 1986). Holman (1995) classifies A. crepitans as a secondary invader, indicating that it would not have begun colonising southern Michigan until at least 10 600 BP. However, this anuran is primarily a grassland species that prefers open vegetation (Beasley et al. 2005; Lehtinen and Skinner 2006). At 10 Ka BP, temperatures were estimated to be 2-4 °C cooler than present and the southern Great Lakes area consisted of closed canopy, mixed conifer northern hardwoods forest (Delcourt and Delcourt 1980; Graham 1999). A. c. blanchardi Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 95 - may therefore have been excluded from this region due to habitat and perhaps temperature limitations. By 6000 BP, temperatures were near present values and an essentially contemporary distribution of vegetation had been established, with more open oak-hickory and mixed hardwood forest dominating the southern Great Lakes region (Delcourt and Delcourt 1980; Graham 1999). A. c. blanchardi would then have been able to penetrate further north and east to occupy western Ohio and southern Michigan, and therefore likely colonised this region only after ~6000 BP. Conservation implications Although the low mitochondrial variation in northern populations of A. c. blanchardi likely reflects recent colonisation of this region, it may have been exacerbated in recent years by declining populations and habitat fragmentation (Frankham et al. 2002). While it is not likely to be the primary cause of declines, this limited variation could be a contributing factor when combined with myriad other assaults on these populations. For example, amphibian populations have much natural variation in resistance to environmental contaminants (Bridges and Semlitsch 2001 ), and some southern populations of cricket frogs apparently have developed resistance to the lethal pesticide DDT (Boyd et al. 1963). However, the reduced genetic diversity present in northern A. c. blanchardi populations could prevent them from adapting to similar habitat alterations (Frankham et al. 2002). The data presented here suggest that the principal cause of the genetic discontinuity between the northeast and southwest regions is historical range adjustments in response to changing conditions during the Pleistocene. Initially, southern individuals Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 96 - were likely prevented from penetrating into the north simply due to carrying capacity (Hewitt 1996). They may also have been at a selective disadvantage, however, as the repeated bottlenecks experienced during colonisation can release additive genetic variation and enable rapid adaptation to novel environments (Hewitt and Ibrahim 2001 ). The peripheral nature of the most northern populations may further intensify adaptive differences, as the isolation and more variable environment they encounter may enable them to generate unique and potentially vital characteristics for survival (Lesica and Allendorf 1995; Garcia-Ramos and Kirkpatrick 1997). Indeed, southern populations of A. c. blanchardi may be active year round and experience two breeding peaks (Blair 1961; Pyburn 1961; Gray 1971; Burkett 1984 ), while northern populations have a single, short breeding season and have developed overwintering strategies ( Gray 1971; Irwin 2005). There may also be adaptive differences in size, colour, and resistance to desiccation (Nevo 1973a, b). Northern populations of the common frog Rana temporaria were found to have significantly faster development when examined over a similar latitudinal gradient in Europe (Palo et al. 2003). It is therefore possible that the phylogeographic break observed here is maintained by an extrinsic barrier to gene flow. The potential for adaptive differences in northern populations suggests that, despite its abundance in southern areas, conservation efforts are warranted for A. c. blanchardi in this region ( e.g. Lesica and Allendorf 1995). Furthermore, future climate changes may continue to negatively impact these peripheral populations (Mehlman 1997), which are already susceptible to declines. Future management actions for this species must take into account the observed spatial genetic structure and phylogeographic patterns, and the data presented here can provide guidelines. For example, the x-intercept Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 97 - of the correlograms for genetic and geographic distance (Figure 4.5) defines the geographic range of independent samples (Diniz-Filho and Telles 2002); that is, samples separated by less than this distance are statistically correlated and can be considered a single genetic unit, whereas samples at greater distances are genetically independent. It appears that for A. c. blanchardi, samples separated by< 450 km are genetically similar; movement of animals to extirpated or declining regions should therefore not occur between sites separated by greater distances. It might be argued that the cause of this uniformity in Group 1, located in the northern part of the range, is recent shared history due to postglacial expansion from the southern refuge. However, the fact that the southern groups did not show significant structure at smaller distances suggests that this may be the real limit to genetic structure in this anuran. Any movement of animals should also occur within the same clade, which will minimise the potential for outbreeding depression between adaptively divergent groups, maintain the evolutionary trajectory of the northern populations, and increase the survival potential oftranslocated animals as they are likely to be more genetically and behaviourally suited to the environment (Moritz 1999). However, source populations with the greatest genetic variation possible should be used for recovery efforts, which will minimise impacts from inbreeding and provide adaptive potential for the newly established populations (Moritz 1999). Future work should evaluate the concordance of the mtDNA data with both nuclear data and external factors ( e.g. elevation, climate, or habitat), as these three components are not necessarily correlated (Irwin 2002; McKay and Latta 2002; Monsen and Blouin 2003). Their congruence, however, would suggest the presence of adaptive differentiation mediated by extrinsic barriers to gene flow, and provide support for the Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 98 - possible taxonomic distinctiveness of northern populations. Conservation frequently consists of ad hoc, emergency efforts that are executed when few options are available, and amphibian reintroductions in particular have a relatively low success rate (Dodd and Seigel 1991; but see Germano and Bishop 2009). Genetic information is one element that may increase the success of reintroductions and translocations, and is increasingly being used to guide such activities ( e.g. Wilson et al. 2008). The fact that A. c. blanchardi is not yet perilously close to extinction provides the opportunity to execute a carefully planned program that can generate robust data regarding the causes of success or failure of certain approaches; it is essentially an experiment in conservation (Hunter and Hutchison 1994; Moritz 1999; Seddon et al. 2007). I therefore recommend that recovery efforts for this species proceed across the northern extent of its range, using the guidelines established by this study. In addition to preserving a potentially distinct taxonomic entity, these efforts will generate valuable data that can be applied to other species for which little time remains. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 99 - Chapter 5 Molecular Phylogenetics of the North American Cricket Frog Complex (Genus Acris) Across its Range Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 100 - Abstract The accurate delineation of species and their distributions is essential to the conservation and management of wildlife. Currently, the North American cricket frog complex (genus Acris) is considered to consist of two species and five subspecies. Although this group's taxonomy has been investigated using morphology, ecology, genetic compatibility, and molecular markers, several issues remain. To determine if genetic structure within Acris is concordant with existing taxonomy and distributions, I sequenced a segment of the mitochondrial control region in 843 individuals, encompassing the entire geographic distribution and all currently recognised species and subspecies. Three major clades were found, corresponding to A. blanchardi, a western grassland form, A. crepitans, an eastern upland form, and A. gryllus, a southern lowland form. The distributions of these clades were primarily defined by major rivers and the elevation change of the Fall Line. Large sequence divergences from other A. gryllus indicate that the subspecies A. g. dorsalis is valid, while A. c. paludicola was nested within A. blanchardi and is not. Few sympatric sites were observed which, when combined with differences in microhabitat use and vocalisation, suggests that hybridisation between species is likely infrequent. Moderate structure was found within the southern range of A. blanchardi, while A. crepitans and A. gryllus were strongly subdivided into two or more clades that likely reflect allopatric separation in glacial refugia during the Pleistocene. Overall, Acris conforms to the longitudinal pattern of diversity seen in many North American amphibians and reptiles. This revised classification of Acris taxa and their distributions is timely, as declining populations have been reported for all three species and the information can be used to develop efficient and relevant conservation recommendations. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 101 - Introduction Historically, species and subspecies designations were based primarily on morphological characteristics, with additional attributes such as vocalisation employed when relevant. However, many species are known to be highly polymorphic for traits such as colour or markings (Galeotti et al. 2003; Bond 2007; Forsman et al. 2008), and some morphometric measures may be influenced by the environment (Lynch et al. 1999; Lada et al. 2008; Teplitsky et al. 2008). Phylogenetic analyses using molecular markers can reconstruct the genealogical relationships of groups to uncover species boundaries without the influence of environmental plasticity or subjective interpretation of phenotypic traits (Hebert et al. 2003; Tautz et al. 2003). Although such analyses may be nearly concordant with traditional species classifications (Avise and Walker 1999), some groups have been artificially subdivided based on phenotypic traits that do not reflect genetic partitioning (Burbrink et al. 2000; Culver et al. 2000; Nittinger et al. 2007; Cullingham et al. 2008). In contrast, morphological conservatism can result in cryptic species being unidentified by traditional means (Bickford et al. 2007), a problem that may be particularly pervasive in amphibians (Stuart et al. 2006; Vredenburg et al. 2007; Angulo and Reichle 2008; Elmer and Cannatella 2008; Padial and de la Riva 2009). The delimitation of genetic lineages within a group, their distributions, and phylogenetic relationships is crucial to a variety of applications. It can identify the historical events that shaped the evolution of a particular group (Austin et al. 2003b; Noonan and Chippindale 2006; Lemmon et al. 2007a; Beamer and Lamb 2008; Koscinski et al. 2008), or ongoing contemporary processes such as hybridisation (Good et al. 2003; Schelly et al. 2006). Competing hypotheses regarding biogeography, taxonomic origin, Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 102 - and patterns of diversity can be tested explicitly within a robust phylogenetic framework (Evans et al. 2003; Pauly et al. 2004; Wiens et al. 2006; Lemmon et al. 2007a), and it may identify the key life history traits, historical events, or ecological changes that promoted adaptive radiations (Kozak et al. 2005; Vieites et al. 2007; Parent et al. 2008; Givnish et al. 2009). Perhaps most importantly in this era of rapid anthropogenic modification of the environment, phylogenetic analysis of taxa facilitates the management and conservation of wildlife. It can be used to identify hybrid populations that were created inadvertently and should be avoided for management purposes (Galbreath et al. 2001; Vianna et al. 2006), or demonstrate that a taxon is a valid species rather than a hybrid that formed as a result of anthropogenic modification of its habitat (Wilson et al. 2000). Invasive species (Darling et al. 2008; Dubey and Shine 2008; Rius et al. 2008) or diseases (Jancovich et al. 2005; Cullingham et al. 2008) may be more effectively controlled by determining the origin and dispersal dynamics of animals and/or pathogens using phylogenetics. It can also assist law enforcement through the forensic identification of harvested animals (Wu et al. 2005; Kyle and Wilson 2007; Petersen et al. 2007). A thorough understanding of taxonomy and phylogenetic relationships is crucial to the recovery of endangered species. It can identify cryptic species (Wang et al. 1999, 2008; Nielson et al. 2001) or genetically distinct populations (Tarr and Fleischer 1999; Shaffer et al. 2004a) that are at greater risk of extinction due to rarity. Conversely, it may determine that wild or captive populations are not distinct or consist of hybrids and are therefore of little conservation worth (Avise and Nelson 1989; Ruokonen et al. 2000; Zink et al. 2000). Numerous authors have advocated the incorporation of molecular markers to set conservation priorities, rather than focusing solely on phenotypic variants Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 103 - (Moritz 1999; Fraser and Bernatchez 2001). It can also be used to inform decisions regarding source populations for use in captive breeding, reintroduction, or translocation efforts (Wyner et al. 1999; Drew et al. 2003; Land et al. 2004; Beauclerc et al. in press). Taxonomic overview ofAcris The taxonomy of cricket frogs (genus A eris) has been repeatedly debated and altered. The first specimens described, from Georgia, were classified within the true frogs as Rana gryllus and R. nigrita (LeConte 1825). A distinct genus, Acris, was soon recognised (Dumeril and Bibron 1841 ), although A. nigrita was later considered to belong to the chorus frogs (Pseudacris; Fitzinger 1843). A northern form, A. crepitans, was described shortly thereafter (Baird 1854). Although many authors acknowledged the presence of two species (Viosca 1923, 1944; Bushnell et al. 1939), most western and northern specimens continued to be classified as A. gryllus (Harper 1947; Burger et al. 1949) and the validity of A. crepitans was revisited several times (Dunn 1938; Mittleman 1947; Neill 1950). By the mid-1950's, however, the existence of two distinct species was generally accepted (Blair 1958). Several subspecies were also distinguished during this time: A. c. blanchardi, primarily west of the Mississippi River (Harper 194 7); A. c. paludicola in coastal eastern Texas (Burger et al. 1949); and A. g. dorsalis from peninsular Florida (Netting and Goin 1945). The currently accepted classification for this genus includes three subspecies of northern cricket frog (northern cricket frog, A. c. crepitans; Blanchard's cricket frog, A. c. blanchardi; coastal cricket frog, A. c. paludicola), and two subspecies of southern cricket frog (southern cricket frog, A. g. gryllus; Florida cricket frog, A. g. dorsalis) (Figure 5 .1; Conant and Collins 1998). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 104 - ~ A. c. crepitans • A. c. blanchardi • A. c. pa/udicola - - - A. Q. gry//us • •...... • A Q. dorsalis Figure 5.1. Distribution of currently accepted Acris taxa. A. crepitans subspecies are indicated with shading and A. gryllus subspecies are bound by dashed lines. Modified from Conant and Collins (1998). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 105 - As with most classifications, Acris taxa were originally defined using phenotypic characters, including, among others: size and weight, colouration, foot length, extent of toe webbing, size of toe discs, and the presence or absence of warts, areola, and pectoral folds (LeConte 1825; Baird 1854; Netting and Goin 1945; Harper 1947; Burger et al. 1949). Call characteristics reportedly also distinguish species and subspecies (Nevo and Capranica 1985), and ecological (Viosca 1944; Blair 1958; Bayless 1969) and behavioural differences have been noted (Netting and Goin 1945; Neill 1950). A range wide survey of variation in several proteins was consistent with the reproductive isolation of A. crepitans and A. gryllus, and appeared to support three distinct subspecies within A. crepitans (Dessauer and Nevo 1969). However, Acris is the least differentiated osteologically of North American hylids (Chantell 1968), and morphologically the two species are highly variable and overlap at several characteristics. A number of specimens of an intermediate nature or possessing traits of one type but located well outside their accepted range have been reported (Netting and Goin 1945; Mittleman 1947; Neill 1950; Mecham 1964; Mount 1975; McCallum and Trauth 2006; J. Lee, pers. comm.). Several morphological traits, including size, appear to vary clinally across large areas rather than clearly defining species or subspecies (Nevo 1973a; McCallum and Trauth 2006). The colour of the vertebral stripe may reflect selection for cryptic colouration on local substrates, gradients in aridity, or random fluctua!ions, and these factors may differ in influence across the range (Pyburn 1961; Nevo 1973b; Gray 1983, 1984). It has also been observed to undergo metachrosis within a single individual in response to breeding activity, substrate, and moisture level (Pyburn 1961; Gray 1972). Furthermore, very little ecological divergence has been observed between A. crepitans and A. gryllus in some Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 106 - areas, and cross-fertilisation experiments found a high degree of developmental compatibility (Mecham 1964). One study using mitochondrial DNA sequences was unable to distinguish A. crepitans from A. gryllus and recommended that they be synonimised (Moore 1997). In addition, there are few obvious geographic boundaries that correspond to the current distributional limits of A. crepitans subspecies ( e.g. Rose et al. 2006; see Figure 5.1). The reliability of many of the phenotypic traits is therefore doubtful, and the validity of currently recognised taxa has been questioned repeatedly. Recently, several studies have investigated phylogenetic relationships within A eris. McCall um and Trauth (2006) conducted a detailed morphological investigation of A. c. blanchardi and A. c. crepitans. They found little support for A. c. blanchardi as a separate subspecies, and recommended that it be subsumed within A. crepitans. Rose et al. (2006) attempted to determine the phylogenetic affinity of A. c. paludicola. Although several morphological and behavioural traits were shared with A. gryllus, cytochrome b sequences placed it with A. c. blanchardi, but without strong support for subspecific status. Finally, a molecular analysis of all Acris species and subspecies indicated that the phylogenetic relationships of these taxa and their distributions require substantial revision (Gamble et al. 2008). Although this study provided strong evidence, it was based on a small number of samples (64) and did not cover the full geographic spread of all groups. My objective in this chapter is therefore to use mitochondrial DNA (mtDNA) sequences from all species and subspecies of Acris to determine their phylogenetic relationships, and to use this information to assess the validity of the currently recognised groups. I will use samples from across the entire geographic range of this complex and numerous samples per site. This detailed sampling will increase the likelihood of detecting Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 107 - geographically restricted lineages, provide clearer delineation of geographic boundaries for each lineage, and identify the biogeographic barriers that were important in shaping the genetic structure of this group. It will also provide information on the extent of sympatry between related forms, and thus the potential for hybridisation. In light of recent conservation concerns for A. c. blanchardi (Gray and Brown 2005; also see Chapter 4), A. c. crepitans (Gray and Brown 2005; NYSDEC 2007), and A. g. gryllus (Jensen 2005; Micancin 2008), it is imperative that the species and subspecies status of Acris taxa be clarified and their distributions described explicitly. The most appropriate philosophical framework through which species should be designated, known as a "species concept", continues to be debated among biologists. Two of the most common are the biological species concept (BSC), which states that a species is a group of naturally interbreeding populations that are reproductively isolated from other such groups (Mayr 1963), and the phylogenetic species concept (PSC), in which a species is defined as the smallest group of populations that is diagnosable by unique characters and shares a parental pattern of common ancestry and descent (Cracraft 1983). Numerous criticisms have been made of both these concepts (see Avise 2000 for a review). To incorporate the strengths of both the BSC and the PSC, Avise and Ball (1990) proposed the "principles of genealogical concordance" as a means of recognising species. In this concept, common patterns in the variation at two independent characters (such as multiple genetic loci, morphology, or biogeography) indicate shared evolutionary history and thus reflect true phylogenetic relationships. These principles can be used to identify both species ( a concordant group that can interbreed and is reproductively isolated from other such groups) and subspecies (phylogenetically distinct Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 108 - groups that are reproductively compatible but geographically isolated from other such groups) (Avise 1994). The inherent appeal of this concept is its incorporation of multiple lines of evidence that increase the likelihood that a given genealogical tree is representative of the true species phylogeny. This concept will be employed to the extent possible, given the available data, when reviewing the taxonomic status of Acris. Materials and Methods Sample collection and molecular methods Tissue samples of all subspecies of A. crepitans and A. gryllus were collected from several locations across their range (Figure 5 .2). Counties were considered to be sampling sites, and the majority (75%) consisted of a single pond. Geographical locations were taken as the latitude and longitude for the county in which a pond or stream was located, and were obtained from the U.S. Census Bureau Census 2000 Gazeteer (http:/ /www.census.gov/; Appendix 1). The number of samples per site ranged from one to 30, with an average of 4.6. In total, 843 samples were genetically profiled from 185 sites in 22 states (Table 5.1, Appendix 1). Tissue samples were collected from adults between 2001 and 2007 except the Oklahoma sites of Roger Mills, Cherokee, Wagoner, Custer, Logan, and Canadian, which were collected in 1998 as part of a previous study. All tissue samples consisted of either toe clips collected in the field or muscle from vouchered specimens, and were preserved in 95% ethanol or 1 X lysis buffer (2 M urea, 0.1 M NaCl, 0.25% n-lauroyl sarcosine, 5 mM CDTA, 0.05 M Tris-HCl pH 8). Samples were collected and identified to species by biologists located across the distribution of Acris. The highly variable morphology of these anurans means that the Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. ...... ® e ® @ --""_ 0 0 ® @ ... <0 .® , ..... -·' ~/ li':l1ll .'@ Ji @ Q (rf:•0 0 / I / \ 0 0 l ,' 0 ·' ,--~-- ,G \~ 0 0 0 0 0 @ J 0 ...... "' L ~0 O! ol 0 @\ _ 1 ---- 200 0 0 0 ..... A. G 02 0 195 00 , 0 0 - ..... 0 ,.,' 4 3 1 NoClade 0 blanchardi ' ,---' 0 0 400 ,, \ ,' ! )/ : 0 ., , 600 A. 1111 Western Eastern Oro crepitans 800 ~;c b,. A. .A A A A 1000 Western Florida NC-02 Noclade NC-01 gryl/us Kilometres A N "l, - 109 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Figure gryllus. phylogenetic rivers as Charles follows: that 5.2. City Different are A. Distribution VA reconstruction discussed blanchardi/A. (4); colours correspond A. crepitans/A. in of the Acris of gryllus text. control sample collection The in gryllus to region St. subclades dashed Tammany in haplotypes: Gates line identified sites. represents NC LA (1); (5), Symbols green within A. Wayne the blanchardi/A. circles, Fall correspond each NC Line A. major (6), blanchardi; (modified Durham crepitans to clade. the three NC Sites from orange in (7), major Henderson containing Fenneman and squares, clades Gadsden KY A. multiple and identified crepitans; (2), Johnson FL Adams (8). species during Dark blue 1946). OH are triangles, lines (3), numbered and are - 110 A. - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 111 - Table 5.1. Summary of samples collected for five A eris subspecies used in this study. Taxon State Site # sites N Benton, Franklin, Fulton, Garland, AR 6 18 Sebastian, Stone IL All 5 65 IN All 8 36 IA All 7 31 KS All 23 47 KY All 3 6 A. c. blanchardi MI All 2 27 MO All 11 41 NE All 6 6 OH All 14 92 OK All 12 42 SD All 2 20 TN Montgomery 1 2 TX Hood, Kendall, McMullen, Menard, Travis, Wise 6 45 AR Columbia, Lafayette 2 4 DE All 2 6 GA Greene, Monroe 2 6 all except Calcasieu, Cameron, East Feliciana, LA Livingston, St. Helena, St. Martin, St. Tammany, 20 66 Tangipahoa, Vermillion, Washington MD All 3 6 A. c. crepitans MS Carroll, Grenada, Tate 3 11 NC Gaston, Mecklenburg, Durham 3 10 NJ All 1 2 SC Pickens, Abbeville, Darlington 3 15 TN Cumberland, McNairy 2 6 VA All 1 8 TX Anderson, Bowie 2 8 A. c. paludicola LA Vermillion, Cameron, Calcasieu, St. Martin 4 16 AL Covington, Tuscaloosa 2 19 GA Taylor 1 4 Ascension, East Feliciana, Livingston, Pointe LA Coupee, St. Helena, St. Tammany, Tangipahoa, 8 39 A. g. gryllus Washington Forrest, Greene, Hancock, Harrison, Perry, MS 7 30 Tishomingo, Wilkinson NC Moore, New Hanover, Washington, Wayne 4 19 SC Barnwell, Berkeley, Darlington, Marion 4 23 FL All 5 39 A. g. dorsalis GA Liberty 1 10 Unknown AL Tallapoosa 1 3 crel!._itans/ gryllus NC Gates, Wayne 2 15 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 112 - characteristics used to diagnose subspecies are at best ambiguous, making further identification of specimens difficult and potentially unreliable (Mittleman 1947; Neill 1950; Chantell 1968; Nevo 1973a; McCallum and Trauth 2006; Rose et al. 2006; Micancin 2008). Subspecies designations were therefore determined based on the location of the specimen within the range distributions of Conant and Collins ( 1998). While this does not allow an evaluation of the suitability of the morphological traits, it does enable an approximate assessment of these currently accepted distributions relative to any genetic lineages that are found. In total, 478 samples were classified as A. c. blanchardi, 148 as A. c. crepitans, 16 as A. c. paludicola, 134 as A. g. gryllus, and 49 as A. g. dorsalis. Eighteen samples from an area where both A. crepitans and A. gryllus are believed to exist in sympatry were not identified to species (Table 5.1 ). The majority of A. c. blanchardi samples were previously described and profiled in Chapter 4. Approximately 10 mg of tissue was dissolved in 500 µL of IX lysis buffer and digested with 50 µL of proteinase K. Total genomic DNA was extracted with the DNeasy Tissue Kit (Qiagen Inc.) or an automated magnetic bead procedure, and quantified with the PicoGreen Quantitation Kit (Molecular Probes) on a FLUOStar Galaxy (BMG Labtech). A fragment of the control region was amplified using the primers ControlWrev-L/ControlP-H (Goebel et al. 1999) in a 25 µL reaction containing 1-5 ng DNA, 1 X PCR buffer, 2 mM MgCb, 0.2 mM dNTPs, 0.1 mg/mL BSA, 0.2 µM each primer, and 1.25 U Taq polymerase (Invitrogen). DNA amplification was performed in an MJ Research PTC-225 thermal cycler with the following conditions: initial denaturation at 94°C for 5min, 35 cycles of denaturation at 94°C for 30 sec, annealing at 40°C for 30 sec, and extension at 72°C for 45 sec, with a final extension of Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 113 - 72°C for 10 min. PCR product was visualised on 1% agarose gels stained with ethidium bromide, and 5 µL of product was purified with ExoSAP-IT (USB). Cycle sequencing was performed with the primer ControlP-H using the DYEnamic ET-Terminator kit on a MegaBACE 1000 DNA Analysis System (GE Healthcare). Phylogenetic analyses Sequences were aligned with CLUSTALX v.1.81 (Thompson et al. 1997) and edited in BIOEDIT v.7.0.5.3 (Hall 1999). ARLEQUIN v. 3.11 (Excoffier et al. 2005) was used to determine the number of variable sites and haplotype frequencies. A comparison of log likelihood scores for 56 models using the Akaike Information Criterion 2 in MODELGENERATOR V.0.85 (Keane et al. 2007) found the HKY model with a proportion of invariable sites and gamma distribution to be the most likely model of sequence evolution for the data (AIC = 13010.44, lnL = -4812.72). The parameter estimates from this model were: base frequencies: A= 0.33, C = 0.11, G = 0.21, T = 0.6; ratio of transitions to transversions = 5.23; proportion of invariant sites (I)= 0.37; and gamma distribution shape parameter (a)= 0.55. This model was used in ARLEQUIN to calculate pairwise sequence divergences, nucleotide diversity (7rn; average number of pairwise differences), and haplotype diversity (h; probability that two randomly chosen haplotypes are different) for the entire dataset and all major groups identified during phylogenetic analysis. However, ARELQUIN does not provide the option to use the HKY model, so the Tamura-Nei model was used instead, as it encompasses the same parameters (Tamura and Nei 1993). Nucleotide diversity was also calculated for each site with two or more samples without assuming a model of nucleotide substitution or gamma distribution. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 114 - Phylogenetic inference of all haplotypes employed two approaches: distance and Bayesian. An unrooted neighbour-joining tree was constructed in MEGA v.4.0 (Kumar et al. 2004). Since MEGA also does not support the HKY model, the Tamura-Nei model was used with a= 0.55. One thousand bootstrap replications were used to determine support for each node. Bayesian analysis was conducted in MRBAYES v.3.1 (Ronquist and Huelsenbeck 2003). MRBA YES uses a Markov chain-Monte Carlo algorithm to sample the posterior distribution of the parameters, and Metropolis coupling to accelerate the convergence of the Markov chain. Eight Markov chains were run simultaneously for two million generations, with two random chain swaps each generation. Sampling occurred every 100th generation with a bum-in of 5000. The heating parameter was reduced to 0.1 to enable the cold chain to swap states with heated chains more frequently, which increases the probability of finding isolated peaks in the data. Two independent runs were conducted simultaneously and used to generate a consensus tree. Parameters for the HKY+l+f model were estimated from the dataset. Evaluation ofcurrently recognised species and subspecies Analysis of molecular variance (AMOVA) examines the genetic variation at each of three levels of a hierarchical grouping: within individual sample sites, among sites within groups, and among groups (Excoffier et al. 1992). If grouping specimens into species and subspecies using currently accepted morphological criteria and distributions (Table 5.1) is concordant with the clades obtained during phylogenetic analysis, AMOVA should recover a similar amount of genetic variation within and between groups for both methods. Samples were grouped into all five recognised subspecies, as well as only three Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 115 - groups to enable direct comparison to the three main clades identified during phylogenetic analysis (see Results): A. c. blanchardi, A. c. crepitans/A. c. paludicola, and A. g. gryllus!A. g. dorsalis. The 18 unidentified samples were excluded from this analysis. AMOVA was carried out in ARLEQUIN using the Tamura-Nei model of sequence evolution with a= 0.55. Pairwise three-group system and the phylogenetic clades to determine which method accounted for a greater degree of structure. This analogue of FsT incorporates nucleotide variation as well as haplotype frequencies (Excoffier et al. 1992). Significance at a = 0.05 was determined using 1000 permutations of the data. Genetic structure within clades The presence of genetic structure among sample sites within each of the major clades identified during phylogenetic reconstruction was assessed using AMOV A. Due to the large number of haplotypes, individual phylogenetic trees were generated for each of the major clades. Both neighbour-joining and Bayesian methods were used, and settings were identical to those for the entire dataset, with the exception that Bayesian analysis used six chains instead of eight. To obtain outgroups for each tree, the most common haplotype of one or both other clades was used: AcrCR-1 (A. c. blanchardi) and AcrCR- 172 (A. c. crepitans) were used for A. gryllus, and AcrCR-172 and AcrCR-202 (A. g. gryllus) were used for A. c. blanchardi. Only AcrCR-1 was used as an outgroup for A. c. crepitans, as the very large divergences between A. c. blanchardi and A. gryllus sequences were problematic (data not shown). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 116 - Barriers to gene flow BARRIER v.2.2 (Manni et al. 2004) was employed to determine the existence of historical barriers to gene flow by defining zones of maximum genetic change among the 185 sample sites. BARRIER uses Delauney triangulation to connect a set of points (sample sites), and the genetic distance between the two points is associated with the edges of the triangles. A barrier is then constructed using Monmonier' s maximum difference algorithm, which identifies the edge with the largest genetic distance. A line is traced perpendicular to this edge, and is extended along adjacent edges of decreasing genetic distance until the boundary reaches a previously computed boundary, the limits of the map, or closes on itself. Multiple boundaries can be constructed by progressively locating the next largest genetic distance. Geographic coordinates of each sample site were used (Appendix 1), and genetic distances were computed in ARLEQUIN as the corrected average pairwise sequence difference between populations. All negative values were assumed to be 0. Ten barriers were constructed; however, the algorithm will generate as many barriers as requested regardless of their biological significance. Thus, all barriers that were initiated with a genetic distance of< 0.1, the maximum sequence divergence found within a single major clade (see Results), were disregarded. Results Phylogenetic reconstruction Analysis of 485 bp of sequence identified 337 haplotypes (Appendix 2), with 215 variable sites consisting of 182 transitions, 93 transversions, and 10 one base pair indels. Overall nucleotide diversity was 0.13 and haplotype diversity was 0.93. Maximum Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 117 - sequence divergence was 0.37 between two groups of haplotypes: AcrCR-24 (Kiowa/ Pawnee KS) vs. AgrCR-313 (Wayne NC); and AgrCR-277 (Livingston LA) vs. AcrCR- 173 (New Castle DE), AcrCR-184 (Gaston/Mecklenburg NC), and AcrCR-186 (Cape May NJ). For sample sites with two or more samples, nucleotide diversity ranged from 0 to 0.099 (Durham NC), and the number ofhaplotypes ranged from one to 17 (Gadsden FL). As with the detailed analysis of A. c. blanchardi (Chapter 4), a large number of low-frequency haplotypes were present: 86% occurred only once or twice in the sample set. The haplotypes that were most frequent also did not change when incorporating additional species: AcrCR-1 was most common (0.27), followed by AcrCR-19 (0.02) and AcrCR-22 (0.02). Of the new haplotypes described, two were relatively common: AcrCR-172 and AgrCR-202, both of which occurred at a frequency of 0.02 (Appendix 2). The unrooted phylogenetic trees generated using neighbour-joining and Bayesian methods produced concordant topologies: three well-supported clades that approximately correspond to the current distributions of A. c. blanchardi, A. c. crepitans, and A. gryllus (Figure 5.3). The majority of samples and haplotypes belonged to A. c. blanchardi (Table 5.2). However, nucleotide and haplotype diversity and maximum pairwise sequence divergence were lowest for this lineage, and greatest in A. gryllus (Tables 5.2 and 5.3). The A. c. blanchardi and A. c. crepitans clades clustered together at a large distance from the A. gryllus clade. Analysis of molecular variance showed that> 90% of the genetic variation was attributed to differences among the three clades, and very little was due to differences among sample sites within clades or within sites (Table 5.4). Pairwise with the largest value between A. c. blanchardi and A. gryllus, while A. c. crepitans was Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 118 - A. gryllus A. c. crepitans Eastern Western A. c. blanchardi 0.9 Figure 5.3. Unrooted Bayesian tree for 337 control region haplotypes from the Acris species complex. Major lineages and probability values (x 100) are indicated. Haplotype labels are omitted for clarity. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 119 - Table 5.2. Summary statistics of three clades identified during phylogenetic analysis of Acris haplotypes. Statistic A. c. blanchardi A. c. crepitans A. gryllus No. individuals 573 72 198 No. sample sites 135 25 34 No. haplotypes 171 30 136 Most frequent haplotype 1 (0.269) 172 (0.017) 202 (0.017) (frequency) ,r0 (average no. differences) 0.0109 (5.3) 0.0277 (13.3) 0.0414 (19.9) H 0.84 0.95 0.99 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 120 - Table 5.3. Average, maximum and minimum sequence divergences between several clades of A eris identified by phylogenetic analysis. The putative subspecies A. c. paludicola is also included, and was classified based on location of the samples according to Conant and Collins (1998). The putative subspecies A. g. dorsalis consists of the three divergent haplotypes identified as the Florida clade during phylogenetic analysis. Clade Average Min Max Max between A. crepitans 0.043 0 0.141 120 and 1851190 A. c. blanchardi 0.017 0 0.045 160 and 95 A. c. paludicola 0.018 0.002 0.035 103 and 149 blanchardi - paludicola 0.018 0 0.042 95 and 1451149 A. c. crepitans 0.036 0 0.091 183 and 1781180 1941195 and eastern 0.010 0.004 0.015 1781181 western 0.008 0 0.018 190 and 183 eastern - western 0.082 0.070 0.091 183 and 1781180 A. gryllus 0.042 0.002 0.102 276 and 245 A. g. gryllus 0.041 0.002 0.093 297 and 302 eastern 0.012 0.002 0.032 321 and 3351337 western 0.015 0.002 0.038 256 and 289 eastern - western 0.060 0.042 0.080 321 and 2151266 NC 01 0.007 0.002 0.013 313 and 3101315 NC02 0.018 NIA NIA NIA NC 01-NC 02 0.059 0.052 0.069 302 and 313 eastern - all NC 0.045 0.027 0.074 308 and 337 western - all NC 0.071 0.053 0.093 297 and 302 A. g. dorsalis 0.021 0.013 0.025 245 and 2241246 dorsalis - gryllus 0.075 0.050 0.102 276 and 245 dorsalis clade - traditional a 0.070 0.053 0.082 245 and 2051226 blanchardib - crepitans 0.118 0.097 0.141 120 and 1851190 blanchardl - gryllusc 0.294 0.24 0.370 313 and 24 277 and - gryllusc 0.322 0.278 0.370 crepitans 17311841186 a includes all A. g. dorsalis individuals classified according to Conant and Collins (1998) b includes putative A. c. paludicola individuals c includes both A. g. gryllus and A. g. dorsalis Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 121 - equally distant from A. c. blanchardi and A. gryllus (Table 5 .5). A comparison of pairwise sequence divergences between haplotypes among these clades suggested a slightly different pattern (Table 5.3): values were smallest between A. c. blanchardi and A. c. crepitans, while values were much larger and similar between A. gryllus and both A. c. blanchardi and A. c. crepitans. The distribution of the A. c. blanchardi clade was similar to that currently recognised for this subspecies (Conant and Collins 1998), consisting primarily of the Great Plains region. However, it was also found across Arkansas and Texas in their entirety, Louisiana west of the Mississippi River, and seven sites east of the Mississippi River in Louisiana and Mississippi, while no haplotypes were found in its previously recognised range of northern and western Tennessee (Figure 5.2). Two sites along the Ohio River in northern Kentucky harboured A. c. blanchardi haplotypes, although limited sampling prevents drawing conclusions about the remainder of the state. Several samples also occurred substantially outside this distribution in St. Mary's MD and Charles City VA. The A. c. crepitans clade occurred exclusively east of the Alabama and Coosa Rivers, with no haplotypes found in its previously recognised range in Texas, Louisiana, Mississippi, and western Alabama (Figure 5.2). Its northwestern distribution was bound by the Ohio River in Kentucky, although six samples occurred north of this in Washington IN and Adams OH. It also occurred throughout the southern Appalachian Highlands and into the Atlantic Coastal Plain from northern North Carolina to New Jersey. A single sample was also found in Gadsden FL. The distribution of the A. gryllus clade corresponded well with its previously recognised range: it occurred primarily throughout the Atlantic Coastal Plain, exclusively east of the Mississippi River and south Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Talble 5.4. a call b d Analysis classified A. original A. g. A. A. A. A. A. A. A. c. 5 dorsalis g. A. c. g. g. A. subspeciesb paludicola 3 g. g. 3 blanchardi of dorsalis 5 Group crepitans blanchardi groupsa gryllus gryllus clades according to gryllus dorsalii dorsalisc subspecies molecular individuals vs. vs. individuals vs. variance as Conant classified identified classified for and 650 644 438 644 183 190 438 181 133 164 163 134 164 df 48 32 33 23 33 2 4 2 1 1 1 several according Collins as a according distinct groupings (1998) Among Among to Among Among Among Among Variance Conant clade to but Among Among Among Among Among Among Conant Among Among Among Within Within Within Within Within Within Within Within Within of sites sites sites sites sites sites A. during Acris and components c. within within within within within within species species subsp. clades subsp. subsp. blanchardi, Collins sites and sites sites sites sites sites sites sites sites sites sites sites haplotypes. phylogenetic Collins species species clades subsp. subsp. subsp. (1998) A. (1998) c. analysis crepitans, % of 91.93 79.92 47.42 79.62 44.00 46.96 40.70 60.55 48.39 20.85 14.73 24.65 75.35 14.26 51.61 24.17 18.60 75.83 12.34 2.84 5.23 5.65 5.82 8.58 variation and A. gryllus < < < < < < < < < < < < < < < < < < < P-value 0.1154 0.0606 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 as separate groups - 122 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 123 - Table 5.5. Pairwise A. c. blanchardi A. c. crepitans A. gryllus A. c. blanchardi 0.50 0.83 A. c. crepitans 0.88 0.81 A. gryllus 0.93 0.88 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 124 - of the Tennessee River, throughout Florida and along the Atlantic coast to northeastern North Carolina (Figure 5.2). Of the 185 sites sampled, only eight harboured haplotypes belonging to two different clades: Adams OH, Henderson KY, and Charles City VA contained A. c. blanchardi and A. c. crepitans haplotypes; Gadsden FL, and Gates, Wayne, and Durham NC contained A. c. crepitans and A. gryllus haplotypes; and both A. c. blanchardi and A. gryllus haplotypes were found in St. Tammany LA (Figure 5.2). Testing existing species classification When samples were classified according to the currently accepted species and subspecies (as listed in Table 5.1), pairwise (Table 5.5). However, these values were substantially smaller than those obtained for groups based on the mitochondrial clades, particularly for the A. c. blanchardi-A. c. crepitans comparison. AMOV A also found that less variation was due to differences among these currently recognised forms, whether grouped into three or five taxa, than the clades identified here (Table 5.4). The subspecies A. c. paludicola and A. g. dorsalis, as defined by Conant and Collins ( 1998), did not appear as distinct clades within the phylogenetic trees and were therefore investigated further. Although both groups possessed some unique haplotypes, most were either unresolved or did not cluster together during phylogenetic analysis (Figures 5.4 and 5.5). There are a few exceptions: haplotypes AcrCR-141, 145, 146, 148 and 149 in putative A. c. paludicola from St. Martin and Cameron LA clustered together, but this group also included A. c. blanchardi haplotypes from throughout Louisiana as well as Mississippi, Virginia, and Maryland; and AgrCR-224, 225 and 226 in A. g. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 125 - dorsalis from Putnam and Collier, FL formed an exclusive, well-supported clade with long branch length. Additional individuals that would be classified as A. g. dorsalis based on Conant and Collins (1998) were nearly as divergent from this clade as were all other A. g. gryllus individuals (Table 5.3). AMOVA also found that very little variation could be accounted for by the separation of A. c. paludicola from A. c. blanchardi, and traditional A. g. dorsalis from A. g. gryllus (Table 5.4). However, the variation among these latter subspecies was much larger and significant when A. g. dorsalis was considered to be the clade of three haplotypes identified during phylogenetic analysis. Analysis ofclades Overall, there appears to be limited genetic structure within the A. c. blanchardi clade. Although significant, AMOV A showed that slightly more variation was found within sample sites than among them (Table 5.4). Accordingly, neighbour-joining did not identify any clades of more than two haplotypes with bootstrap support > 80 ( data not shown). Bayesian analysis, however, revealed five well-supported clades that were composed of at least four haplotypes (Figure 5.4). Nearly all individuals belonging to these clades were found south of the Missouri River (Figure 5.2). Clades 1 and 2 were found nearly exclusively south of the Arkansas River in Oklahoma, Arkansas, Texas and Louisiana. Clade 3 occurred primarily in Louisiana, south of the Red River, while Clade 4 was between the Missouri and Red Rivers. Clade 5 was the most widespread, ranging from Missouri to southern Texas and Louisiana. With the exception of eight small clusters containing two or three haplotypes, the remaining haplotypes were not resolved, and these were found across the entire distribution of the A. c. blanchardi clade. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 126 - ~------1 93 ------2 ------3 -----=- __J ------4 1----5 0.6 Figure 5.4. Bayesian phylogenetic tree of 171 A. c. blanchardi control region haplotypes. Lineages with probability values > 0.8 (x 100) and with more than three haplotypes are indicated at the base of the corresponding branch. Haplotype labels have been omitted for clarity. Asterisks indicate haplotypes belonging to individuals classified as A. c. paludicola based on geographical location, and arrows indicate haplotypes belonging to individuals found in St. Mary's MD and Charles City VA. Numbers of major clades correspond to Figure 5.2. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 127 - AMOVA showed that approximately 75% of the variation within A. c. crepitans was due to differences among sample sites, suggesting the presence of genetic structure within this group (Table 5.4). All A. c. crepitans haplotypes clustered into two well supported clades, which were apparent in the phylogenetic analysis of all Acris haplotypes (Figure 5.3). Individual neighbour-joining and Bayesian trees for A. c. crepitans are therefore not displayed, as they did not identify any additional structure. A western clade was found exclusively in Tennessee and Kentucky, between the Tennessee and Ohio Rivers, with several samples north of the Ohio River in Washington IN (Figure 5.2). An eastern clade occurred primarily throughout the southern Appalachian Highlands and the northern Atlantic Plain, but also included single individuals in Adams OH, Cumberland TN, and Gadsden FL. Sequence divergence between these two clades was large, while that within each clade was substantially smaller and of a similar magnitude to one another (Table 5.3). A similar amount of divergence exists between these two clades as between the subspecies A. g. gryllus and A. g. dorsalis, and it was only slightly less than the smallest divergence found between A. c. blanchardi and A. c. crepitans (Table 5.3). When sample sites were further subdivided into eastern and western clades, AMOV A demonstrated that > 90% of genetic variation is accounted for by these two clades (data not shown). Significant genetic structure was also present within A. gryllus, as AMOVA revealed that approximately 75% of the variation within this clade was due to differences among sample sites (Table 5.4). Neighbour-joining and Bayesian analysis of A. gryllus found several well-supported lineages that were consistent between analyses, although their exact placement relative to other poorly-supported branches varied among the two Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 128 - methods. Thus, only the Bayesian results are presented (Figure 5.5). A well-supported clade contained all haplotypes located west of the Mobile, Alabama and Coosa Rivers (Figure 5.2). Structure among the haplotypes located east of the Mobile/Alabama/Coosa system was more complex and overall poorly resolved. A well-supported Florida clade contained three haplotypes from sites in peninsular Florida (Collier and Putnam). These were grouped with the western haplotypes with high probability by the Bayesian analysis (1.00), but with weak bootstrap support in the neighbour-joining analysis ( 47). The majority ofhaplotypes in North Carolina formed two well-supported clades, although they did not cluster together with strong support. The remaining eastern haplotypes represented a large, polytomous group with very short branch lengths and little support for most clades containing three or more haplotypes. Sequence divergence within each of these five clades was generally low, while divergences between them were substantially greater (Table 5.3). Separation of sample sites into these five clades demonstrated that more than 80% of the variation was due to this arrangement (data not shown). Barriers to gene flow Monmonier' s maximum difference algorithm identified four genetic boundaries that were constructed with an initial genetic distance of> 0.1 (Figure 5.6). Additional barriers were mainly small, separating only two to four sample sites, suggesting that the first four are likely the only biologically relevant barriers at this scale. The first barrier constructed, representing the largest genetic distances, began in a north-south direction along the Mississippi River. This separated sites containing A. c. blanchardi haplotypes in Arkansas, Missouri, and western Louisiana from sites harbouring A. gryllus haplotypes Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 129 - a2~-//------i= E==-- 100 100 ] North Carolina 86 100 =:J---Florida 100 92 Western 100 ~--//------c======.!:.A~cr.!..._1 -Acr172 0.6 Figure 5.5. Bayesian analysis of 136 A. gryllus control region haplotypes. Lineages with probability values > 0.8 (x 100) and with more than three haplotypes are indicated at the base of the corresponding branch. Approximate geographic location of significant clades is indicated. Haplotype labels have been omitted for clarity. Asterisks indicate haplotypes belonging to samples classified as A. g. dorsalis based on geographic location, with the exception of three strongly supported haplotypes that are designated as the Florida clade. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 130 - u . .. Figure 5.6. Genetic boundaries (heavy lines) identified for Acris control region haplotypes with Monmonier's maximum difference algorithm in the program BARRIER. Boundaries are numbered in order of decreasing initial genetic distance. Points are sample sites. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 131 - in Mississippi and eastern Louisiana. One exception to this was Carroll MS, which was found on the western side of the barrier, and contains exclusively A. c. blanchardi haplotypes. The barrier continued east along the bottom of the Ohio River and then south along the Tennessee River, separating A. c. crepitans and A. gryllus haplotypes in Tennessee. As it continued east, it approximately followed the Fall Line, separating A. c. crepitans haplotypes in northern Alabama and Georgia and western South Carolina and North Carolina from A. gryllus haplotypes in the south and east of these states. The remaining barriers were much shorter. The second barrier separated Durham NC, which contained primarily A. c. crepitans individuals, from five sites in eastern North Carolina that were predominantly A. gryllus. The third barrier separated St. Mary's MD from adjacent sites in Virginia, Maryland and Delaware. The fourth barrier corresponded approximately with the Ohio River, separating A. c. blanchardi haplotypes to the north and A. c. crepitans haplotypes to the south. Discussion Validity ofcurrently recognized species and subspecies The frequent adjustment of Acris taxonomy and repeated reports of individuals with intermediate or ambiguous characters indicate that a comprehensive evaluation of phylogenetic relationships within this complex is long overdue. As stated by Rose et al. (2006, p. 433), "the lack of interest in elucidating clearly the interspecific and intraspecific relationships of these two frogs is perplexing because the two species occupy a major geographical segment...of the continental United States". Several studies have noted the poor capacity of most morphological traits to clearly differentiate these Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 132 - groups (Mittleman 1947; Neill 1950; Mccallum and Trauth 2006; Rose et al. 2006; Micancin 2008). For taxa with extensive phenotypic variation, such as Acris, molecular genetic markers are much more suitable for resolving phylogenetic relationships as they are less subjective and not affected by the environment. The results presented here demonstrate that the distribution of mitochondrial variation in cricket frogs does not correspond exactly to the distribution of species or subspecies as defined by morphology or in Conant and Collins (1998) (Figure 5 .1 ). Rather than two widely-ranging species, the control region haplotypes formed three well supported clades that correspond to the current forms of A. c. blanchardi, A. c. crepitans, and A. gryllus. The relationship among these three groups varied slightly when using different indices: phylogenetic analyses and sequence divergences indicated that A. c. blanchardi and A. c. crepitans are most closely related, and both are equally distant from A. gryllus. However, a measure of genetic distance ( and A. gryllus are the most distant taxa, with A. c. crepitans equidistant from both. incorporates both nucleotide sequence and haplotype frequency, so the very different sample sizes used for each taxon may have affected estimates of genetic distance. The independence of sequence divergence from sample size suggests that this is the more reliable measurement for this study. Although A. c. blanchardi and A. c. crepitans are closely related, they represent independent, monophyletic groups (the few disjunct samples will be addressed later). Few amphibian studies have employed the mitochondrial control region for phylogenetic analysis, but those that have typically observed < 6% sequence divergence within species (Shaffer and McKnight 1996; Church et al. 2003; Shaffer et al. 2004b; Smith and Green Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 133 - 2004; Rowe et al. 2006; Pauly et al. 2007). The range of divergences between A. c. blanchardi and A. c. crepitans substantially exceeds this, suggesting that these two taxa do not represent a single species. This supports the recent recommendation by Gamble et al. (2008) that the western form be considered a distinct species, A. blanchardi, while the eastern form remains A. crepitans. Two additional subspecies are currently recognised, A. c. paludicola and A. g. dorsalis. Although Rose et al. (2006) found that there was no molecular support for recognising A. c. paludicola, they recommended that it be maintained as a distinct subspecies based on a series of morphological and behavioural characteristics. Gamble et al. (2008) also found that A. c. paludicola was nested within A. blanchardi, and suggested that it does not warrant subspecific status. Results presented here support this view. Haplotypes belonging to this subspecies were located within the A. blanchardi clade, with little resolution or clustering for most, and the variation accounted for by separation into these groups was not significant. This subspecies was- diagnosed from specimens located at a single site, and based principally on its "decidedly pink" colour, particularly of the vocal pouches in calling males (Burger et al. 1949). However, the colour of the vocal pouch appears to be due to blood flow (Rose et al. 2006) and has been observed in frogs as far away as Michigan (pers. obs.). Moreover, red vertebral stripes are known to occur in all Acris taxa and across the entire distribution (Nevo 1973b ). It may increase in frequency on red substrates or in more humid conditions, such as that found in coastal Louisiana and Texas where this subspecies occurs, as abundant vegetation can enable red individuals to remain hidden from predators (Pyburn 1961; Nevo 1973b). The very short adult lifespan and rapid turnover of populations in A eris (Burkett 1984) means that Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 134 - locally optimal phenotypes could rapidly attain high frequencies, rather than reflecting long-term isolation. Thus, the primary diagnostic characteristic of this subspecies (colour) is ambiguous and not distinctive, and, when combined with the genetic data, provides little support for the recognition of A. c. paludicola. The validity of A. g. dorsalis has not been previously evaluated. When all individuals that could be classified as A. g. dorsalis according to Conant and Collins (1998) were considered, results were similar to A. c. paludicola: haplotypes were distributed throughout the A. gryllus tree, with little resolution or pattern, and no significant variation was attributed to this arrangement of groups. However, three haplotypes (AgrCR-224, 245,246) from peninsular Florida formed a strongly supported clade separate from non-peninsular A. g. dorsalis haplotypes, and were nearly as different from these (0.05-0.08 divergence) as they were from all other A. g. gryllus haplotypes (0.05-0.10 divergence). Thus, the peninsular Florida haplotypes appear to represent a distinct lineage, but remaining non-peninsular A. g. dorsalis individuals are not distinguishable from A. g. gryllus based on mtDNA. The presence of a divergent Florida clade is not surprising, as the Floridian peninsula has a distinct climate, physiography, and ecology, particularly at its southern extreme (Avise 2000). A disproportionately large number of endemic species are found in this region (Remington 1968; Delcourt and Delcourt 1991; Trapnell et al. 2007), and molecular phylogeographic studies have repeatedly uncovered distinct lineages from here (Avise 2000; Soltis et al. 2006; Burbrink et al. 2008; Cullingham et al. 2008; Fontanella et al. 2008; Guiher and Burbrink 2008; Morris et al. 2008). Florida likely served as an important refugium for more temperate species during the glacial episodes of the Pleistocene, when sea levels were Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 135 - lower and the exposed land mass was more than twice as large (Webb 1990). Furthermore, although Florida was not likely recently separated from the mainland by a sea channel, the presence of boreal spruce/pine vegetation at the base of the peninsula may have served as an effective barrier to peninsular forms during the Pleistocene (Webb 1990). Northern Florida, southern Georgia, and Alabama appear to be regions of secondary contact between lineages located in refugia in Florida and east Texas Louisiana (Remington 1968; Swenson and Howard 2005). A. g. dorsalis conforms to this pattern: the only two individuals sampled from Collier in the lower peninsula bore very distinct haplotypes, while Putnam, located within the zone of secondary contact in the northern peninsula, contained haplotypes from both groups. In spite of relatively comprehensive sampling, no A. g. dorsalis haplotypes were found elsewhere; it is thus probable that this lineage is restricted to the Florida peninsula, a pattern similar to that of the ringneck snake Diadophis punctatus (Fontanella et al. 2008). It therefore appears likely that A. g. dorsalis represents a divergent lineage that was isolated in Florida throughout the Pleistocene and perhaps earlier, while the A. g. gryllus lineage survived in a separate refugium, likely the Gulf and/or Atlantic Coastal Plains (Church et al. 2003; Zamudio and Savage 2003; Austin et al. 2004). Although A. g. dorsalis may not be distinct from A. g. gryllus in call characteristics (Nevo and Capranica 1985) or allozymes (Dessauer and Neva 1969), the mitochondrial data, combined with its distinctive morphology and behaviour (Netting and Goin 1945; Neill 1950) and the unique biogeography of the Florida peninsula, indicate that A. g. dorsalis should remain a separate subspecies until additional information becomes available. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 136 - Species distributions and biogeographic patterns 1. Acris blanchardi Substantial adjustment to the distribution of Acris species are suggested by the mitochondrial data. As proposed here, A. blanchardi is the only species west of the Mississippi River, and its northeastern range is bordered by the Ohio River to the south. This species is found ubiquitously throughout this region, but does not appear to extend much into Kentucky and was not found at all in Tennessee, as described by Conant and Collins (1998). The lower Mississippi and Ohio Rivers appear to be major barriers to gene flow in this species. A. blanchardi is a relatively small (maximum SVL = 3.8 cm), terrestrial/semi-aquatic anuran that preferentially occupies the shorelines of nearly any type of fresh water, with the exception oflarge lakes and wide rivers (Gray et al. 2005). It is therefore likely that large rivers such as these prevent extensive dispersal in this species. The Mississippi River has been considered a major force in the speciation and/or restriction of gene flow in numerous taxa, including amphibians (Soltis et al. 2006; Zeisset and Beebee 2008). As was found by Burbrink et al. (2008) for the snake Coluber constrictor, however, the upper Mississippi River does not appear to be a significant barrier to gene flow (see also Chapter 4). Though it is less frequently reported as a barrier, the Ohio River does correspond to phylogenetic breaks in several amphibians and reptiles (Starkey et al. 2003; Lemmon et al. 2007b; Burbrink et al. 2008). Although major rivers are considered to be significant barriers to gene flow in many species, they are often not impermeable (Burbrink et al. 2000; Zamudio and Savage 2003). This appears to be true for A. blanchardi, as individuals were found on opposing sides of both the Mississippi and Ohio Rivers. The observation of nearly 30 A. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 137 - blanchardi individuals at seven sites east of the Mississippi River in Louisiana and Mississippi (see also Gamble et al. 2008) suggests that it is well-established here. How has such a small vertebrate been able to cross this formidable barrier? Repeated dispersal via rafting is one possibility (Schiesari et al. 2003), and is supported by reports of A. blanchardi calling from floating vegetation over deep water some distance from the shore (Gray et al. 2005). However, it is striking that the eastern extent of A. blanchardi corresponds to the boundary of the Mississippi Delta (Figure 5.7), the western portion of the alluvial floodplain of the lower Mississippi River. The lower Mississippi Valley has experienced repeated flooding, variation in sediment load, and shifting of channels throughout the Pleistocene due to outwash from melting glaciers (Saucier 1994), and may be responsible for A. blanchardi' s presence on both sides of the river. A similar scenario was proposed for a lineage of the snake Diadophis punctatus (Fontanella et al. 2008). Furthermore, on the basis of earlier morphological studies (Viosca 1944; Boyd 1964) and its absence from the Delta during this study (Figure 5.7), A. gryllus may be excluded from this region (although more detailed sampling may indicate otherwise). It is possible that the transition from alkaline alluvial soils in the Delta to the more acidic sedimentary rocks of the Coastal Plain to the east (Viosca 1944; Miller and White 1998) maintains the separation of these two species, as preferences for acidic and alkaline conditions have been shown to partition them within individual sites (Viosca 1944; Blair 1958; but see Mecham 1964). The central lineage of the snake Agkistrodon controtrix spanned the Mississippi River and was limited by the ecological transition from forest to prairie (Guiher and Burbrink 2008), suggesting that features other than the Mississippi River may be important in defining biogeographic boundaries for some species. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 138 - • • • • • • • • ... • • • • • • • • ...... • • N 0 100 200 300 400 Kilometres A Figure 5.7. The Mississippi River Alluvial Plain (shading). The Mississippi Delta is the section of the alluvial plain that extends into western Mississippi. Localities containing A. blanchardi specimens are identified as circles and A. gryllus specimens as triangles. Open circles are samples identified by Gamble et al. (2008) as A. blanchardi using the cytochrome b gene. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 139 - The distribution of A. blanchardi haplotypes predominantly throughout the Interior Plains (Figure 5.8) is consistent with the identity of this anuran as a grasslands species that prefers open vegetation (Beasley et al. 2005; Lehtinen and Skinner 2006). However, it was also found in the more heavily forested areas of the Ozark Plateau and Ouachita Mountains, as well as the Coastal Plain. Overall, A. blanchardi appears to be a generalist in its requirements and is able to survive in a variety of habitats. Its distribution does not seem to be substantially limited by physiography or ecology, and large rivers are not always barriers to dispersal, as discussed previously. It may be that a specific combination of geological and ecological features, which is beyond the scope of my study, is the primary determinant of this species' distribution. Within A. blanchardi, the relationship between many haplotypes was unresolved, with low sequence divergences and short branch lengths compared to those found within A. crepitans and A. gryllus. This pattern of broadly distributed lineages with shallow divergence west of the Mississippi River has been found in other amphibians and reptiles (Shaffer and McKnight 1996; Burbrink et al. 2008; Fontanella et al. 2008). There are two possible causes of this. A. blanchardi may have diverged only recently from its common ancestor with A. crepitans, and is thus a very young species. It is also possible that A. blanchardi recently experienced a bottleneck to one or a few small populations, which would have eliminated much of its genetic variation (Hoelzel et al. 1993; Frankham et al. 2002; Waldick et al. 2002; England et al. 2003). The lack of genetic structure north of the Missouri River, combined with detailed analyses of the mitochondrial data (Chapter 4), demonstrate that the Midwest has indeed experienced multiple bottlenecks, likely caused by repeated elimination of populations by Pleistocene glaciations. In contrast, the Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 140 - D Valley and Ridge D Appalachian Plateau Ill BlueRidge CJ Central Lowland D Great Plains D Interior Low Plateau D Ouachita Mountains D Ozark Plateau D Piedmont D Coastal Plain N 0 200 400 600 800 Kilometres A Figure 5.8. Major physiographic divisions of the United States. Localities of Acris specimens are identified as follows: A. blanchardi = circles; A. crepitans = squares; A. gryllus = triangles. The generalised glacial limits for the pre-Illinoian (dashed line) and Wisconsinan glaciations (solid line) are also shown (Reed and Bush 2005). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 141 - presence of several clades south of the Missouri River, the likely use of this area as a refugium during the Pleistocene (Chapter 4), and the climatic and habitat stability of the southern Great Plains for the past -1.6 Ma (Graham 1999), make it probable that this region has had relatively large, stable populations for some time. It therefore seems likely that the shallow genetic structure in A. blanchardi is primarily the result of recent population expansion in the Midwest, but that this pattern may be superimposed on a short evolutionary history in the southern Great Plains. Four individuals possessing A. blanchardi haplotypes were found substantially outside the distribution of this species, in St. Mary's MD and Charles City VA. One possible explanation for these disjunct individuals is that A. blanchardi once had a continuous distribution from Ohio through the Appalachians, and a relict population remained along the northeast coast following range contraction. However, three of the haplotypes clustered strongly with Louisiana haplotypes in the phylogenetic tree (Figure 5.4), which is not consistent with this hypothesis. A similar scenario was proposed to explain speciation patterns in trilling frogs (Pseudacris), but was also rejected by phylogenetic analysis (Lemmon et al. 2007a). Incomplete lineage sorting can cause the retention of shared polymorphisms from a common ancestor in closely related species, usually due to random chance and/or insufficient time to achieve reciprocal monophyly. Under this scenario, the lineages will necessarily coalesce to a time before the species diverged, and thus will usually cluster together to the exclusion of other existing lineages (A vise 2000; Cullingham et al. 2008). The lack of clustering of these disjunct haplotypes and their high similarity to haplotypes in Louisiana (0-0.0021 sequence divergence) makes incomplete lineage sorting unlikely and is more consistent with recent gene flow Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 142 - (A vise 2000), but A. blanchardi' s low dispersal capacity (Pyburn 1958; Burkett 1984) renders this also improbable. A previously continuous distribution from Louisiana or natural introgression with another species may have enabled these haplotypes to become established in the northeast. However, these scenarios would require extensive extinction of all intervening individuals and populations, as no A. blanchardi haplotypes were found in any other A. crepitans or A. gryllus. Furthermore, only A. gryllus has a nearly continuous distribution between Louisiana and these individuals, and it is less probable that A. blanchardi would hybridise extensively with this more distantly related species than A. crepitans. Given that so few disjunct individuals were observed here, the simplest and most likely explanation is that these haplotypes became introduced to the northeast coast via human-mediated translocations. Small frogs are commonly used as fishing bait in North America, and this has been cited as a potential contributor to the extirpation of A. blanchardi populations in Canada (Oldham 1992). It is unknown whether the haplotypes are from translocated individuals, or are the descendants of earlier translocations. The fact that A. blanchardi occurs at the same latitude and occupies a wide range of physiographic regions, including the Coastal Plain, implies that individuals are likely able to survive here. If the translocation occurred some time ago, it is possible that these haplotypes have become introgressed into the resident A. crepitans population. A. crepitans and A. gryllus are known to be compatible (Mecham 1964), and the closer phylogenetic relationship of A. crepitans and A. blanchardi suggests that they are likely also interfertile. If it occurred very recently, however, it is possible that these individuals are pure A. blanchardi. Assessment of these disjunct individuals at nuclear loci will determine whether they are hybrids, and thus clarify the relative timing of the event. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 143 - 2. Acris crepitans Along the Atlantic coast, the distribution of A. crepitans is similar to that given by Conant and Collins (1998). In contrast, the western portion of its range deviates substantially from its currently accepted distribution. No individuals were found west of the Alabama/Coosa Rivers or in southern Alabama. Although the latter area is represented by a small sample size at one site, only a single individual was observed in the Florida panhandle despite profiling nearly 25 samples from several sites. Similar results have been found in other studies (Gamble et al. 2008), indicating that if A. crepitans does exist throughout the Gulf Coastal Plain, it is indeed rare. In contrast with its currently accepted range, this species occurred entirely throughout Kentucky and Tennessee, with the exception of extreme western Tennessee. The limit of A. crepitans at the Ohio and Alabama/Coosa Rivers suggests that large rivers are significant barriers to dispersal for this species. However, similar to A. blanchardi, the Ohio River has not been completely impassable, and several individuals were found in Indiana and Ohio. Acris crepitans is generally considered to be an upland species (Neill 1950; Conant and Collins 1998), and the distribution of haplotypes primarily throughout the Piedmont and Interior Low Plateau confirms this (Figure 5.8). It was also found in the lowlands of the Atlantic Coastal Plain from eastern South Carolina to New Jersey, although it may simply be filling the Coastal Plain niche occupied by A. gryllus further south (see below) rather than being particularly well-suited for this region. Overall, A. crepitans occurs only rarely below the Fall Line, the transition zone between the upland Piedmont region and the lowland Coastal Plain (Figures 5.2 and 5.8). The Fall Line is considered a major barrier to dispersal for many small aquatic and terrestrial vertebrates Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 144 - (Aresco 1996; Pauly et al. 2007; Rahel 2007) and marks phylogenetic discontinuities in some species (Lemmon et al. 2007b; Fontanella et al. 2008). It thus appears that this is a major biogeographic boundary for A eris, separating upland A. crepitans from lowland A. gryllus. A. crepitans may be limited by very high elevations, however, as it does not occur extensively within the highest parts of the Appalachians (Conant and Collins 1998; Gray and Brown 2005): the Blue Ridge, Valley and Ridge, and Appalachian Plateaus (Figure 5.8), all of which have elevations in excess of 1200 m (Thornbury 1965). Rather, it is limited to the lower elevation Piedmont (foothills) in the east and parts of the Cumberland Plateau (eastern Tennessee/Kentucky) in the west. Two divergent, well-supported clades were found within A. crepitans, corresponding to the east and west of its distribution. The western group occurred primarily in the Interior Low Plateau and western Appalachian Plateau (Figure 5.8), where it was bounded to the north by the Ohio River and to the west, south and east by the Tennessee River. The eastern group ranged across the Piedmont and Atlantic Coastal Plain, east of the Alabama/Coosa and Tennessee Rivers. There is very little divergence within each clade, and little exchange between them, with the exception of single eastern individuals found at two western sites (Cumberland TN and Adams OH). Divergence between the two clades is greater than is typically found within amphibian species ( e.g. A. blanchardi; Shaffer et al. 2004b; Smith and Green 2004; Rowe et al. 2006), but is similar to the currently recognised subspecies A. g. gryllus and A. g. dorsalis. Given the strong phylogenetic clustering, large contrast of within- and between-clade variation, nearly complete geographic separation, concordance with potential geographic barriers to gene flow, and comparable divergence to subspecies of the closely related A. gryllus, I Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 145 - recommend that the eastern and western groups be considered distinct subspecies. The presence of an eastern and western lineage in A. crepitans is concordant with the pattern observed in a number of eastern North American amphibians. This is often attributed to fragmentation in isolated refugia during Pleistocene glaciations, most commonly within the Appalachian Mountains, Coastal Plain, and Interior Low Plateau (Austin et al. 2002, 2004; Church et al. 2003; Zamudio and Savage 2003; Hoffman and Blouin 2004; Lee-Yaw et al. 2008). Glacial refugia are typically identified as unglaciated regions possessing high diversity relative to other areas (Hewitt 1996; Bernatchez and Wilson 1998; Hoffman and Blouin 2004; Lee-Yaw et al. 2008). Given its limited contemporary distribution, the western lineage of A. crepitans was likely isolated within the Interior Low Plateau, which was beyond the limits of the Pleistocene ice sheets (Figure 5.8; Mickelson and Colgan 2004), and the Appalachian Mountains and Ohio/Tennessee Rivers probably continue to be significant barriers to dispersal today. Based on existing data, it is not possible to determine a specific refugial location for the more wide-ranging eastern lineage. It is presently found only in unglaciated areas, and small sample sizes preclude identification of the most diverse area. It is probable that this lineage survived the Pleistocene glaciations in the southern Appalachians (e.g. North Carolina, South Carolina, Georgia), for which nucleotide diversity appears to be highest, and which is frequently considered to be a refugium for amphibians. The presence of multiple divergent lineages in some amphibians has been attributed to isolation in several refugia during the Pleistocene (Austin et al. 2002; Church et al. 2003; Hoffman and Blouin 2004; Lee-Yaw et al. 2008), but the low diversity within each A. crepitans lineage implies that only a single refugium was likely used for each. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 146 - 3. Acris gryllus The distribution of A. gryllus corresponded well with its previously recognised range. It occurred throughout the entire Gulf and Atlantic Coastal Plains east of the Mississippi River (Figure 5.8) and as far north as the North Carolina/Virginia border. This is consistent with its recognition as a lowland species (Neill 1950; Conant and Collins 1998). As discussed previously, the Mississippi River and Fall Line appear to be significant barriers to gene flow in A. gryllus. These features may have a greater impact on A. gryllus than on A. blanchardi or A. crepitans: several individuals of this latter species were found on the opposing sides of both riverine and geological barriers, whereas A. gryllus was found at only two sites just above the Fall Line (Moore and Durham NC), and appears to be excluded from sites within 30 km of the Mississippi River. A. gryllus may be more restricted to a narrow habitat zone, and/or its smaller size (particularly relative to A. blanchardi; Nevo 1973a; Conant and Collins 1998) may render it less able to compete with closely related species. In addition to a distinct Florida clade (A. g. dorsalis), eastern and western clades were found within A. g. gryllus, completely separated by the Alabama and Coosa Rivers. This contrasts with the east-west discontinuity corresponding to the Apalachiola or Tombigbee Rivers seen in other Gulf Coastal Plain taxa (Soltis et al. 2006). Although only a few sites were sampled on both sides of these rivers, a relatively large number of individuals ( 14-23) were profiled, suggesting that this proposed boundary is robust. The western group is monophyletic and contains several well-supported clades, while the east primarily consists of shallow lineages with little overall structure. Two highly divergent clades were present in North Carolina, although low bootstrap support and large sequence Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 147 - divergence between them mean that they may be no more closely related to one another than either is to other A. g. gryllus haplotypes. Other amphibians and reptiles have also been shown to possess distinct lineages in the Carolinas (Howes et al. 2006; Lee-Yaw et al. 2008). This phylogeographic pattern of multiple, divergent lineages is likely the result of allopatric fragmentation in several refugia during Pleistocene glaciations, as has been suggested for numerous eastern North American amphibians (Austin et al. 2002; Church et al. 2003; Hoffman and Blouin 2004; Lee-Yaw et al. 2008). There may have been five separate refugia for A. gryllus during the Pleistocene: the Florida peninsula (A. g. dorsalis), the Gulf Coastal Plain in Mississippi (western A. g. gryllus), southern Alabama/Georgia and the Florida panhandle (most eastern A. g. gryllus), and two separate areas north of the Pee Dee River (North Carolina clades). There has been little secondary contact with the western group following deglaciation, suggesting that the Alabama/Coosa Rivers continue to act as a barrier to gene flow today. In contrast, the North Carolina clades overlap at several sites and other eastern haplotypes are distributed widely throughout the Coastal Plain, indicating that barriers no longer exist in this area. The monophyly, genetic divergence, and geographic separation of western A. g. gryllus suggest that this group should be treated as a distinct unit for management. In contrast, the shallow genetic structure in the east, combined with little geographic separation, does not presently permit identification of discrete population segments here. The placement of A. g. dorsalis relative to eastern and western A. g. gryllus clades is also ambiguous (see also Gamble et al. 2008). More comprehensive sampling and the use of additional genetic markers may clarify the relationship among these groups, after which it may be possible to recognise additional subspecies within A. gryllus. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 148 - Comparison with patterns in previous studies A number of studies have investigated the geographic variation in several characteristics across the distribution of Acris. It is therefore worthwhile to evaluate the concordance of the phylogeographic patterns observed here using mitochondrial data with those seen in other traits. The recent study by Gamble et al. (2008) was largely consistent with the results presented here, with some differences likely reflecting the more comprehensive sampling employed in my study. As these differences have already been discussed in relation to biogeographic patterns and species delimitation, I will not address them further. In 1969, Dessauer and N evo conducted an extensive survey of a number of blood and liver proteins across the entire range of Acris. Based on the distribution of alleles, they confirmed the reproductive isolation of A. gryllus from A. crepitans/blanchardi, a pattern that is also supported by call characteristics (Blair 1958; Nevo and Capranica 1985; Micancin 2008), morphology (Neill 1950; Nevo 1973a; Micancin 2008), behaviour (Neill 1950), ecology (Viosca 1944; Boyd·1964 Bayless 1969; Micancin 2008; but see Neill 1950; Mecham 1964), and the current mitochondrial data. Dessauer and Nevo (1969) also found that A. gryllus was nearly monomorphic, with no distinction between A. g. gryllus and A. g. dorsalis or any of the additional lineages identified here. However, this is not surprising, as sampling of A. gryllus was limited, and the slow evolutionary rate of proteins can result in little diversity within species (Murphy et al. 1996). Within A. crepitans, several allozymes defined a Plains, Delta, and Appalachian group (Figure 5.9; Dessauer and Nevo 1969) that approximately corresponded to the subspecies designations of A. crepitans sensu Conant and Collins ( 1998) (compare to Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 149 - Figure 5.1 ). This is consistent with the distinctiveness of A. blanchardi (Plains group) relative to eastern A. crepitans (Appalachian group) based on mtDNA data. Allelic overlap between these groups at some loci is likely due to shared ancestry, which is also demonstrated by the mitochondrial data, rather than contemporary gene flow. Even greater allelic overlap between the Delta (A. c. paludicola) and Plains group (Figure 5.9; Dessauer and Nevo 1969) supports the mitochondrial data in demonstrating that A. c. paludicola is not different from A. blanchardi. However, the presence of a number of unique alleles in the Delta group indicates that they are somewhat distinct, perhaps reflecting rapid selection or isolation from other populations. Although the study by Dessauer and N evo ( 1969) supports the recognition of three distinct species as proposed here, it cannot be used to corroborate distribution adjustments as it did not sample many of the relevant locations. Acris are known to be highly polymorphic for the colour of both the vertebral stripe (grey, green, red, red-green, or brown) and dorsum (grey, green, brown, or black) (Pyburn 1961; Nevo 1973b; Burkett 1984; Gray 1995). At very small geographic scales, the pattern of colour morphs may primarily reflect selection for cryptic colouration on local substrates (which can also vary seasonally; Pyburn 1961; Nevo 1973b), apostatic selection (Milstead et al. 197 4 ), or genetic drift in small populations (Pyburn 1961; Gray 1983, 1984; Gorman 1986). The vertebral stripe has also been observed to vary with breeding activity, substrate, and moisture level in a single individual (metachrosis; Pyburn 1961; Gray 1972). Over the entire distribution of Acris, Nevo (1973a) observed that the frequency of colour morphs differed significantly between A. gryllus and A. crepitans/blanchardi. Rather than fixed differences between species, however, this Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 150 - --1·~~"""' ~<..:C:j l v;;,._::- !Tr-.nw.-•-1--,c:;__--. . -o·· I ') ;. ')..,_ ~ _, Figure 5.9. Geographic distribution of transferrins (A) and globin peptides (B) in populations of A eris. Pie graphs are centred over collecting sites, except for certain populations of A. gryllus. Total area of circle is proportional to the sample size. Shading depicts different allozyme variants. Lines delimit the geographic distribution of A. crepitans as recognised at the time of publication (from Dessauer and Nevo 1969). Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 151 - appeared to be a clinal trait: southern and central populations of all species were di- or trimorphic, while northern and western populations, to which only A. crepitans and A. blanchardi belong, were monomorphic grey. The greater frequency of green and red morphs in A. gryllus may be due to the more variable and vegetated habitats in the south, while the large grey morph appears to be adaptively superior in the arid environment of the northern and western periphery as it is more resistant to desiccation and disease (Nevo 1973a,b ). Random fixation was regarded as an unlikely cause for the prevalence of grey in the north because of the large size of some populations (Nevo 1973b ). However, it is probable that the founder effect associated with colonisation of this area at the end of the Pleistocene is largely responsible for this monomorphism, which is also evident in nuclear (Chapter 3) and mitochondrial (Chapter 4) DNA. This is supported by the fact that the likely source of colonising animals, Kansas (Chapter 4), is also predominantly grey (Nevo 1973b; Gorman 1986). Overall, it appears that colour patterns in all A eris are influenced primarily by selection for both climatic variation and predation, as well as the effects of colonisation, and do not reliably distinguish species. Morphological investigation of the A eris complex has been extensive, with species and range designations largely based on these characteristics. However, numerous studies have documented inconsistencies in diagnostic features (Neill 1950; Nevo 1973a; McCallum and Trauth 2006; Rose et al. 2006; Micancin 2008), with many traits varying clinally (Nevo 1973a; McClelland et al. 1998; McCallum and Trauth 2006; but see Ryan and Wilczynski 1991) and possibly reflecting adaptation to local climates or habitats (Nevo 1973a). Overall, there appears to be much morphological variation within taxa, which are also poorly differentiated from one another relative to other North Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 152 - American hylids (Chantell 1968). These issues have resulted in much uncertainty in specimen identification, reporting of potential hybrids, and proposed taxonomic revisions. The mtDNA data described here indicate that one source of confusion is the incorrect delimitation of each taxon's range; consequently, any conclusions based on morphology using the previous distributions may be erroneous. For example, McCallum and Trauth (2006) recommended that A. c. blanchardi be subsumed into A. c. crepitans, as an extensive survey of morphological characters could not reliably distinguish the subspecies in Arkansas. According to the distributions presented here, however, this study actually illustrated that A. blanchardi is quite morphologically uniform, with Arkansas individuals indistinguishable from those in South Dakota and Nebraska. Neill (1950) also noted discrepancies in the defining characteristics of A. g. dorsalis, but the source of these specimens in northern Florida indicates that they may have been A. g. gryllus. Using phylogenetic analyses, Lemmon et al. (2007b) demonstrated that hybridisation studies of chorus frogs (Pseudacris), the sister genus to Acris, yielded similarly ambiguous or erroneous conclusions due to the presence of cryptic species. Hence, the morphology of each group in the Acris complex should be re-evaluated in the context of the updated distributions to clarify their diagnostic characteristics (e.g. Stuart et al. 2006; Padial and de la Riva 2009). Variation of call characteristics within and among species of Acris has been investigated extensively. Cluster analysis of a number of temporal and spectral variables grouped calls according to the three biomes occupied by Acris: grasslands (A. blanchardi), deciduous woodlands (A. crepitans), and subptropical pineries (A. gryllus) (Nevo and Capranica 1985). This supports the mitochondrial data presented here, and the Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 153 - recognition of three distinct species. However, calls of A. blanchardi in eastern Texas, which is dominated by pine forest, are distinct from grassland populations to the west: they possess a number of characteristics to increase transmission, as the forests cause severe degradation of sound (Nevo and Capranica 1985; Ryan et al. 1990; Ryan and Wilczynski 1991). Furthermore, a population located in an isolated pine forest relict (the "Lost Pines") had calls more similar to the geographically distant eastern populations than to a grassland population only 65 km away (Ryan and Wilczynski 1988). It therefore appears that the call of A. blanchardi (and possibly all Acris) can adapt quickly for increased transmission efficiency in different habitats, which is likely responsible for some of the documented variation in A. blanchardi calls. Intraspecific variation in call characters has been shown to occur in other anuran species (Littlejohn and Roberts 1975; Ryan et al. 1996; Wycherley et al. 2002), although no studies are known in which this has been attributed to habitat differences. The convergence of advertisement calls among widely separated anuran communities (Duellman and Trueb 1986) suggests that habitat plays a significant role in shaping call characteristics among species, and there is little reason to doubt that it is also important within species. The definition of anuran species boundaries purely by call characteristics may therefore be unreliable, particularly across broad distributions and when large habitat changes exist, as exemplified by Acris (but see Wycherley et al. 2002). Although samples from within the pine forest of eastern Texas were not profiled here, two well-supported clades exist from this region (Figure 5.2): Clade 5.2, entirely from Louisiana, and Clade 3, from Louisiana and eastern Texas (Anderson and Bowie). When combined with the presence of a distinct call, this may be indicative of a Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 154 - genetically distinct population. However, a number of haplotypes from this region clustered with haplotypes from diverse areas or were poorly resolved, suggesting that it is not isolated. Furthermore, evidence indicates that A. blanchardi females prefer calls with low dominant frequencies regardless of whether they are from a local or foreign population, and that this may increase gene flow in an east-west direction (Ryan et al. 1992; Wilczynski et al. 1992). It is therefore probable that the older, refugial nature of populations in this region (Chapter 4) has simply resulted in greater genetic structure, with geographically proximal populations clustering together. More detailed sampling of this region and the use of higher resolution genetic markers (e.g. microsatellites) should clarify whether habitat and call differences have generated genetic differences here. The existence of potential hybrids and individuals with intermediate phenotypes has been repeatedly reported (Netting and Goin 1945; Neill 1950; Mount 1975; McCallum and Trauth 2006; J Lee, pers. comm.), and artificial crosses between sympatric A. crepitans and A. gryllus demonstrated that these species are relatively interfertile (Mecham 1964). However, it seems probable that hybridisation is actually quite rare between A eris species. In spite of overlapping distributions between all pairs of species (Figure 5.2), few sympatric sites were observed in this and other (Micancin 2008) studies. Furthermore, neither hybrid protein patterns (Dessauer and Nevo 1969) nor intermediate vocalisations (Micancin 2008) have been observed. It is likely that the general similarity and extensive morphological variability of this group has caused both the misidentification of pure individuals, and the reporting of intermediates (Mecham 1964; Micancin 2008). Indeed, the use of morphology to identify hybrids of hylid anurans such as Acris has been shown to be unreliable (Lamb and A vise 1987). A. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 155 - crepitans and A. blanchardi also appear to be ecologically isolated from A. gryllus in areas of overlap such as Louisiana, Mississippi, and Alabama, with discrete usage of food items and microhabitat (Viosca 1944; Blair 1958; Boyd 1964; Bayless 1969; but see Mecham 1964; Neill 1950). A number of studies also suggest that vocalisation is an important pre-mating reproductive isolating mechanism in maintaining the identity of A. gryllus and A. crepitans at sympatric sites (Blair 1958; Nevo and Capranica 1985; Micancin 2008). Thus, although hybrids may form occasionally under certain circumstances, this is not likely a major threat to the integrity of these species. Conclusions The mitochondrial data provide evidence for three species of Acris, but adjustments to their currently accepted distributions are required. The distributions of these species broadly agree with several potential biogeographic barriers, and are concordant with patterns observed in other species. Furthermore, the limited nuclear genetic data available supports these divisions (Dessauer and Nevo 1969; see Chapter 6 for more details). The existence of three species is therefore consistent with the principles of genealogical concordance described by A vise and Ball (1990). Substructure occurs within each species, particularly A. crepitans and A. gryllus, and some lineages may be distinct subspecies. These putative subspecies also conform to the principles of genealogical concordance; for example, the eastern and western lineages of A. crepitans appear to be phylogenetically distinct units that are largely separated by the Appalachian Mountains (i.e. allopatric ). In contrast, A. c. paludicola is neither phylogenetically distinct nor allopatric from A. blanchardi and is thus not supported as a distinct Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 156 - subspecies. More detailed information from nuclear genetic markers, morphology, and the degree of reproductive compatibility between groups should be obtained to further clarify the species or subspecies status of these taxa. Phylogeographic patterns within this complex are primarily, but not exclusively, influenced by large rivers and the elevation change at the Fall Line, and are corroborated by several morphological, ecological, and enzyme studies. However, colour and call characteristics may be strongly influenced by the environment and therefore are unreliable as tools for species designation. Overall, Acris conforms to the "longitudinal" pattern of genetic diversity seen in numerous amphibians and reptiles in North America ( e.g. Howes et al. 2006), supporting the existence of common barriers to gene flow for small non-volant vertebrates. Although hybridisation between species cannot be excluded where ranges overlap, it is likely rare owing to the observation of few sympatric sites, differential habitat utilisation, and distinct call characteristics. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 157 - Chapter 6 General Discussion The genetic information obtained during the course of this study provided insight into the systematics, biogeography, and genetic structure of P. lemur and the genus Acris, which previously had been unclear when assessed using traditional characters such as morphology, ecology, and call characteristics. In addition to contributing to the understanding of regional biogeography and amphibian biology in general, this information will greatly assist in directing future conservation activities for these threatened anurans. Conservation genetics of Peltophryne lemur Conservation efforts for P. lemur began nearly 30 years ago, with only minimal genetic data (Lacy and Foster 1987). It is not likely that initial recovery efforts for this species would have been different had the genetic data presented here been available: northern and southern populations were kept separate because they were considered divergent, and the results of this study confirm this to some degree. However, it is this divergence that suggests the presence of potentially vital adaptive variation in northern individuals. Given the very small population size and highly inbred nature of the remaining northern individuals, it is evident that their future in captivity or the wild is precarious. The genetic information obtained during this study therefore provides the rationale for the controversial recommendation of mixing divergent lineages in an Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 158 - attempt to preserve the maximum amount of diversity, and thereby increase the survival probability of P. lemur in northern Puerto Rico. Synthesis ofAcris data and conservation genetics ofA. blanchardi The abundant morphological variability within Acris, combined with ambiguity in the definitive characteristics of each species, means that genetic data were essential to determining the divergence among species and their distributions. Mitochondrial sequences identified a number of inconsistencies in the currently accepted classification and distribution of taxa, including recognition of A. blanchardi as a distinct species. Although a small number of samples were profiled, nuclear genetic data supported this revised taxonomy of Acris. The generally poor amplification of microsatellite loci in A. crepitans (56%) implies that it is more divergent from A. blanchardi than a subspecies. The closer relationship of A. blanchardi to A. crepitans than to A. gryllus is apparent in the even weaker amplification of loci in A. gryllus (44%). Primmer and Merila (2002) also found very poor amplification of microsatellite loci across several species of Rana (13-31 %), particularly compared to birds, mammals and reptiles (Primmer and Merila 2002; Barbara et al. 2007). The greater success of cross-species amplification seen in this study implies that Acris species are more recently diverged than the species of Rana studied by Primmer and Merila (2002). A striking difference of A. blanchardi relative to A. crepitans and A. gryllus is its shallow genetic structure, despite occurring across a much larger area. This pattern of limited divergence west of the Mississippi River relative to the east has been seen in a number of amphibians and reptiles (Austin et al. 2002; Starkey et al. 2003; Hoffman and Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 159 - Blouin 2004; Lemmon et al. 2007b; Burbrink et al. 2008; Fontanella et al. 2008), and is likely due to a combination of factors. The less topographically varied terrain of the Great Plains region, in contrast to the more dissected east, means that there are probably fewer barriers to gene flow such as elevation or habitat transitions; as a consequence, gene flow can occur to a greater degree and there are fewer opportunities for isolation and divergence of populations. This same argument can be invoked in terms of the Pleistocene glaciations: it is probable that populations existed in a single, broad refugium in the southern Great Plains, rather than the multiple refugia that are frequently proposed for amphibians and reptiles in the Coastal Plains and Appalachian Mountains (Austin et al. 2002; Church et al. 2003; Zamudio and Savage 2003; Hoffman and Blouin 2004; Pauly et al. 2007; Burbrink et al. 2008; Fontanella et al. 2008). Finally, the greater southward extent of the Pleistocene ice sheets west of the Mississippi River (Richmond and Fullerton 1986; Figure 5.8) means that populations would have contracted further south, potentially compressed into a much smaller area. As a corollary, a greater portion of the Great Plains would have been colonised more recently than eastern North America, which would further reduce the extent of genetic structure within A. blanchardi relative to A. crepitans and A. gryllus. Genetic profiling of A eris identified a number of issues that can contribute to the efficient conservation of A. blanchardi at the northern edge of its range. Above all, the elevation of this anuran to species status makes population declines more alarming and increases the urgency of conservation efforts, as the number of populations, geographical distribution, and genetic diversity have been considerably reduced. It may also assist in understanding the causes of declines. The abundance and apparent stability of this Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 160 - species in southern regions indicates that factors such as habitat loss and alteration, environmental contaminants, introduced species, and climate change, which are problems common to all areas, cannot fully explain the declines. The significantly lower genetic diversity at both nuclear and mitochondrial markers in northern populations suggests that this may be interacting with external agents to cause declines. Populations of A. blanchardi were resistant to pesticides in the Mississippi Delta (Boyd et al. 1963; Ferguson 1963) and Texas (Flickinger et al. 1980), and were relatively unaffected by high levels of metal accumulation in Texas (Clark et al. 1998). In contrast, persistent organic pollutants were implicated in morphological abnormalities and population declines in Illinois and Ohio (Reeder et al. 1998, 2005; Russell et al. 2002). Genetic composition may affect resistance to environmental contaminants in amphibians (Bridges and Semlitsch 2001 ), which suggests that the greater genetic variation of southern A. blanchardi populations may have enabled them to adapt to such stressors, whereas genetically depauperate northern populations have been unable to cope. Mitochondrial sequences provided evidence of a distinct northern clade that largely coincides with the region of decline, and nuclear DNA data support this. Primers designed for at least two microsatellite loci, which were isolated from Texas animals, amplified successfully and were polymorphic in Texas individuals. However, they failed to amplify individuals from Ohio and Illinois ( data not shown), evidence that these regions have been separated for sufficient time for mutations to have occurred in at least one priming site ( e.g. Primmer and Merila 2002). In addition, a number of unique microsatellite alleles were found in both Texas and Illinois, despite much less diversity in the north. The location of the declining populations at the range margin makes it Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 161 - probable that they experience highly variable conditions and therefore may be a source for speciation (Lesica and Allendorf 1995; Garcia-Ramos and Kirkpatrick 1997). Furthermore, the likelihood of adaptive variation in the north is substantial owing to the different climate of the region and known differences in life history (e.g. overwintering, breeding season, drought tolerance). These populations may therefore be vital to the long-term evolutionary potential of the species as a whole, and are worthy of conservation efforts (Hunter and Hutchinson 1994; Lesica and Allendorf 1995). The genetic information for Acris presented here can be used to establish specific guidelines for conservation efforts. For example, translocations are frequently used to restore extirpated populations or augment existing ones, and the most appropriate source populations can be identified using genetic data. Movement of animals should occur between populations from within the same phylogenetic clade, where possible. This will minimise the potential for outbreeding depression that may occur if animals with very different life histories are used (Frankham et al. 2002), as well as maintain any adaptive variation that may be necessary for survival at the northern edge of the range. Thus, despite the much greater abundance of A. blanchardi in southern areas such as Texas, animals should not be taken from here and used for supplementation in the Upper Midwest. Spatial analysis also indicated that individuals separated by more than 450 km within Group 1, which encompasses the declining northern populations, were not correlated at mitochondrial haplotypes. The most conservative recommendation would therefore be to use populations from within 450 km of the intended recipient population. Another desirable attribute of source animals is that they be genetically diverse to increase variation in the recipient populations, which will render populations more Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 162 - resistant to environmental changes as well as minimise the deleterious effects of inbreeding and random genetic drift (Frankham et al. 2002). Again, the genetic data presented here can identify the most diverse region within 450 km of a potential release site from which source animals could be obtained. Phylogeographic analysis also demonstrated that major rivers and large changes in elevation are barriers to gene flow, to various degrees, within and among all species of Acris. This is another issue that should be addressed when evaluating potential source populations for translocations, as individuals located on opposing sides of such features are likely to be more differentiated than those on the same side. A hypothetical scenario will best illustrate this in practice. If the population in Lenawee Co. in southeast Michigan was to be augmented, sites within 450 km from this location range west to north-central Illinois and south to the Ohio River. The most diverse population from this region is Greene Co., IN, with a nucleotide diversity of 0.0025 (Appendix 1). However, this is still not a very diverse site. It may be decided that using the greatest genetic diversity possible is more important than precisely maintaining population structure at this scale. The potential source region could therefore be extended to incorporate all of phylogenetic Clade I or SAMOVA Group 1, which includes Missouri, Illinois, Iowa, Nebraska, and eastern Kansas. Although only a few sample sites within this region are similar in diversity to southern sites ( e.g. Anderson KS; Appendix 1), most possess different haplotypes that would collectively increase the genetic variation if multiple sites were incorporated. An approach such as this also uses animals from a similar climate and environment, therefore ensuring that animals are likely to be ecologically exchangeable with the recipient population (Crandall Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 163 - et al. 2000). It would also minimise the potential for transfer of locally endemic diseases between geographically distant regions. The recognition of A. blanchardi as a species, and the presence of a distinct northern clade, suggests that this species should be reevaluated under the Endangered Species Act in the US (it is already listed as endangered in Canada; Kellar et al. 1997). The status of A. crepitans and A. gryllus may also need adjustment, as some concern exists over declining populations in these species as well (Gray and Brown 2005; Jensen 2005; Micancin 2008) and their highly structured nature may increase the urgency of conservation efforts for certain lineages. This study also demonstrates the importance of using a large number of samples and populations, if possible, to establish guidelines for conservation efforts. In addition to more precisely and robustly defining species boundaries and biogeographic barriers to gene flow, a number of locations were identified where caution should be exerted during management. For example, the observation that A. blanchardi is the dominant species throughout the Mississippi Delta was unexpected, as other phylogeographic studies have shown the Mississippi River to be a major barrier to dispersal for small vertebrates (Soltis et al. 2006). The Ohio River also appears to be a clearly defined boundary between A. blanchardi and A. crepitans; however, both species were observed at sites on opposite sides, something that less complete sampling probably would have missed. This means that populations adjacent to biogeographic barriers between closely related species should be avoided for management purposes, as it is possible that the barriers are not absolute and populations have become established outside their expected distributions. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 164 - Value ofgenetics to conservation biology Molecular methods have been used to uncover genetic structure and resolve phylogenetic uncertainties in many species, but may be a particularly important tool for morphologically conservative groups such as amphibians (A vise 1994; Zamudio and Savage 2003; Stuart et al. 2006; Lemmon et al. 2007b; Vredenburg et al. 2007; Angulo and Reichle 2008; Elmer and Cannatella 2008; Padial and de la Riva 2009). The genetic data obtained during this study have been essential to clarifying a number of important details regarding the biology, life history, and evolution of both P. lemur and Acris. In tum, this information has provided the foundation to develop comprehensive restoration programs for each species, including specific guidelines for future activities and the justification of recommendations that may be viewed as controversial. The data described in this study represent only a fraction of the information that can be obtained with genetic markers and used to assist future conservation activities. The highly polymorphic microsatellites developed here are particularly amenable to an array of studies that can further elucidate the biology of these species. For example, powerful statistical methods such as assignment tests can be used with microsatellite data to determine fine-scale population structure, patterns of dispersal, and hybridisation (Berry et al. 2004; Mane! et al. 2005). The effective size of a population, a more biologically relevant measure of a population's stability and future potential than its census population size, can be estimated using genetic markers (Frankham 1995; Schwartz et al. 1998). Incorporating detailed maps of landscape features can reveal the variables that are critical to the species for feeding, reproduction, dispersal, etc. (Mane! et al. 2003; Storfer et al. 2007). These molecular markers also have immediate, practical Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 165 - applications for species conservation. I recently assisted with such a situation, in which I used two of the population-specific P. lemur micro satellite loci described here to determine the population of origin of several captive individuals that had become misplaced during handling. Multilocus microsatellite profiles could also be used as individual genetic "tags" in mark-recapture studies or to monitor the reproductive success of individuals translocated to a population (Schwartz et al. 2007). At the broadest scale, such information could be used to design protected reserves or corridors in a fragmented landscape (Bell and Okamura 2005; Beier et al. 2008; Vandergast et al. 2008; Cushman et al. 2009), efforts that would benefit multiple species. Although much information can be gleaned from neutral molecular markers such as mitochondrial DNA and microsatellite loci, it is the adaptive variation and fitness attributes that are important to both the evolutionary potential and conservation of a species. Some studies have shown that variation and/or divergence at quantitative traits is very poorly correlated with that for neutral molecular markers (Reed and Frankham 2001; McKay and Latta 2002; Holdregger et al. 2006; Knopp et al. 2007), some have found a good relationship between these (Merila and Cmokrak 2001; Cmokrak and Merila 2002), and others show that microsatellite heterozygosity and fitness measures are positively related (Rowe et al. 1999; Reed and Frankham 2002; Lesbarreres et al. 2005; Charpentier et al. 2005; Hensen and Wesche 2006; Vandewoestijne et al. 2008). Future work in P. lemur and A eris should evaluate whether populations that are distinct at neutral markers are also adaptively different from other populations, and whether the low genetic diversity seen in some populations is indeed manifested as reduced fitness. Both species represent excellent opportunities for such studies. The highly controlled nature of Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 166 - P. lemur in captivity could enable controlled experiments to measure the influence of various environmental factors, such as temperature and precipitation, on individual fitness. In contrast, the large distribution and abundance of Acris is suitable to evaluating the fitness of these anurans in response to variables such as environmental gradients, distance from core populations, habitat alteration, or interaction with other species. Conclusion Conservation biology is often crisis discipline, with restoration activities initiated only after a critical point has been reached and few options remain. In addition, most conservation decisions must address not only the biological aspects of the species in question, but also legal, political and economic criteria. At the heart of all conservation decisions, therefore, is a trade-off between these factors (Shogren et al. 1999; Song and M'Gonigle 2001; Lundquist and Granek 2005). Genetic data can provide insight into many unknown biological aspects of a species that may be essential for understanding causes of declines, and can aid in designing the most appropriate recovery plan. Furthermore, once molecular markers are developed, they can be used to continue monitoring populations and the success of an implemented plan (Schwartz et al. 2007). Incorporating genetic data at the earliest possible stage therefore allows the execution of a carefully planned, comprehensive program that can evaluate the success or failure of certain activities within an experimental framework (Hunter and Hutchinson 1994; Moritz 1999; Trenham and Marsh 2002; McCarthy and Possingham 2007; Seddon et al. 2007). This will provide valuable data that can be applied to other endangered species, particularly those for which few individuals and little time remains. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 167 - Literature Cited Alford RA, Richards SJ (1999) Global amphibian declines: a problem in applied ecology. Annual Review of Ecology and Systematics 30:133-165. Amato ML, Brooks RJ, Fu J (2008) A phylogeographic analysis of populations of the wood turtle (Glyptemys insculpta) throughout its range. Molecular Ecology 17:570- 581. Angulo A, Reichle S (2008) Acoustic signals, species diagnosis, and species concepts: the case of a new cryptic species of Leptodactylus (Anura, Leptodactylidae) from the Chapare region, Bolivia. Zoological Journal of the Linnean Society 152:59-77. Arens P, Bugter R, van't Westende W et al. (2006) Microsatellite variation and population structure of a recovering tree frog (Hyla arborea L.) metapopulation. Conservation Genetics 7:825-835. Aresco MJ (1996) Geographic variation in the morphology and lateral stripe of the green treefrog (Hyla cinerea) in the southeastern United States. American Midland Naturalist 135:293-298. Austin JD, Lougheed SC, Neidrauer L, Chek AA, Boag PT (2002) Cryptic lineages in a small frog: the post-glacial history of the spring peeper, Pseudacris crucifer (Anura: Hylidae). Molecular Phylogenetics and Evolution 25:316-329. Austin JD, Davila JA, Lougheed SC, Boag PT (2003a) Genetic evidence for female biased dispersal in the bullfrog, Rana catesbeiana (Ranidae ). Molecular Ecology 12:3165-3172. Austin JD, Lougheed SC, Moler PE, Boag PT (2003b) Phylogenetics, zoogeography, and the role of dispersal and vicariance in the evolution of the Rana catesbeiana (Anura: Ranidae) species group. Biological Journal of the Linnean Society 80:601-624. Austin JD, Lougheed SC, Boag PT (2004) Discordant temporal and geographic patterns in maternal lineages of eastern North American frogs, Rana catesbeiana (Ranidae) and Pseudacris crucifer (Hylidae). Molecular Phylogenetics and Evolution 32:799-816. Avise JC, Nelson WS (1989) Molecular genetic relationships of the extinct dusky seaside sparrow. Science 243:646-648. A vise JC (1989) A role for molecular genetics in the recognition and conservation of endangered species. Trends in Ecology and Evolution 4:279-281. A vise JC, Ball RM Jr. (1990) Principles of genealogical concordance in species concepts and biological taxonomy. Oxford Surveys in Evolutionary Biology 7:45-67. Avise JC (1994) Molecular Markers, Natural History and Evolution. Kluwer Academic Publishers, Boston. 511 pp. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 168 - Avise JC, Walker D (1999) Species realities and numbers in sexual vertebrates: Perspectives from an asexually transmitted genome. Proceedings of the National Academy of Sciences 96:992-995. A vise JC (2000) Phylogeography: The History and Formation of Species. Harvard University Press, Cambridge, MA. 447 pp. Baird SF (1854) Descriptions of new genera and species of North American frogs. Proceedings of the Academy of Natural Sciences of Philadelphia 7:59-62. Ball SJ, Adams M, Possingham HP, Keller MA (2000) The genetic contribution of single male immigrants to small, inbred populations: a laboratory study using Drosophila melanogaster. Heredity 84:677-684. Ballou JD, Lacy RC (1995) Identifying genetically important individuals for management of genetic diversity in pedigreed populations. Pp. 76-111 in: Population Management for Survival and Recovery: Analytical Methods and Strategies in Small Population Conservation (eds. Ballou JD, Gilpin M, Foose TJ). Columbia University Press, New York. Bandelt HJ, Forster P, Rohl A (1999) Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16:37-48. Barbara T, Palma-Silva C, Paggi GM et al. (2007) Cross-species transfer of nuclear microsatellite markers: potential and limitations. Molecular Ecology 16:3759-3767. Barber D (2007) Cooperative Amphibian Programs in AZA: Puerto Rican Crested Toad SSP. Connect February: 13. Barbour T (1917) Notes on the herpetology of the Virgin Islands. Proceedings of the Biological Society of Washington 30:97-104. Barinaga M (1990) Where have all the froggies gone? Science 247:1033-1034. Barribeau SM, Villinger J, Waldman B (2008) Major histocompatibility complex based resistance to a common bacterial pathogen of amphibians. PLoS ONE 3: 1-9. Bayless LE ( 1969) Ecological divergence and distribution of sympatric A eris populations (Anura: Hylidae). Herpetologica25:181-187. Beamer DA, Lamb T (2008) Dusky salamanders (Desmognathus, Plethodontidae) from the Coastal Plain: Multiple independent lineages and their bearing on the molecular phylogeny of the genus. Molecular Phylogenetics and Evolution 47:143-153. Beasley VR, Faeh SA, Wikoff B et al. (2005) Risk factors and declines in northern cricket frogs (Acris crepitans). Pp. 75-86 in: Amphibian Declines: The Conservation Status of United States Species ( ed. Lannoo MJ). University of California Press, Berkeley, CA. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 169 - Beauclerc KB, Johnson B, White BN (2007) Characterization, multiplex conditions, and cross-species utility of tetranucleotide microsatellite loci for Blanchard's cricket frog (A eris crepitans blanchardi). Molecular Ecology Notes 7: 13 3 8-1341. Beauclerc KB, Johnson B, White BN (in press) Genetic rescue of an inbred captive population of the critically endangered Puerto Rican crested toad (Peltophryne lemur) by mixing lineages. Conservation Genetics. Beier P, Majka DR, Spencer WD (2008) Forks in the road: Choices in procedures for designing wildland linkages. Conservation Biology 22:836-851. Bell JJ, Okamura B (2005) Low genetic diversity in a marine nature reserve: re evaluating diversity criteria in reserve design. Proceedings of the Royal Society B 272:1067-1074. Bernatchez L, Wilson CC (1998) Comparative phylogeography ofNearctic and Palearctic fishes. Molecular Ecology 7 :431-452. Berry 0, Tocher MD, Sarre SD (2004) Can assignment tests measure dispersal? Molecular Ecology 13:551-561. Bertorelle G, Barbujani G (1995) Analysis of DNA diversity by spatial autocorrelation. Genetics 140:811-819. Bickford D, Lohman DJ, Sodhi NS et al. (2006) Cryptic species as a window on diversity and conservation. Trends in Ecology and Evolution 22:149-155. Blair WF (1958) Mating call in the speciation of anuran amphibians. American Naturalist 42:27-51. Blair WF (1961) Calling and spawning seasons in a mixed population of anurans. Ecology 42:99-110. Blaustein AR, Wake DB, Sousa WP (1994) Amphibian declines: judging stability, persistence, and susceptibility of populations to local and global extinctions. Conservation Biology 8:60-71. Bloxam QMC, Tonge SJ (1995) Amphibians: Suitable candidates for breeding-release programmes. Biodiversity and Conservation 4:634-644. Bohme MU, Schneeweib N, Fritz U, Schlegel M, Berendonk TU (2007) Small edge populations at risk: genetic diversity of the green lizard (Lace rta viridis viridis) in Germany and implications for conservation management. Conservation Genetics 8:555-563. Bond AB (2007) The evolution of color polymorphism: Crypticity searching images, and apostatic selection. Annual Review of Ecology Evolution and Systematics 38:489-514. Bos DH, Sites JW (2001) Phylogeography and conservation genetics of the Columbia spotted frog (Rana luteiventris; Amphibia, Ranidae). Molecular Ecology 10:1499- 1513. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 170 - Boyd CE, Vinson SB, Ferguson DE (1963) Possible DDT resistance in two species of frogs. Copeia 1963:426-429. Boyd CE ( 1964) The distribution of cricket frogs in Mississippi. Herpetologica 20:201- 202. Bragg AN (1940) Observations on the ecology and natural history of Anura. III. American Midland Naturalist 24:322-335. Brede EG, Beebee TJC (2004) Contrasting population structures in two sympatric anurans: implications for species conservation. Heredity 92: 110-117. Bridges CM, Semlitsch RD (2001) Genetic variation in insecticide tolerance in a population of southern leopard frogs (Rana sphenocephala): implications for amphibian conservation. Copeia 2001:7-13. Brock MK, White BN (1992) Application of DNA fingerprinting to the recovery program of the endangered Puerto Rican parrot. Proceedings of the National Academy of Sciences 89: 11121-11125. Bryant EH, Backus VL, Clark ME, Reed DH (1999) Experimental tests of captive breeding for endangered species. Conservation Biology 13: 1487-1496. Burbrink FT, Lawson R, Slowinski JB (2000) Mitochondrial DNA phylogeography of the polytypic North American rat snake (Elaphe obsoleta): A critique of the subspecies concept. Evolution 54:2107-2118. Burbrink FT, Fontanella F, Pyron RA, Guiher TJ, Jimenez C (2008) Phylogeography across a continent: The evolutionary and demographic history of the North American racer (Serpentes: Colubridae: Coluber constrictor). Molecular Phylogenetics and Evolution 47:274-288. Burger WL, Smith PW, Smith HM (1949) Notable records of reptiles and amphibians in Oklahoma, Arkansas, and Texas. Journal of the Tennessee Academy of Science 24: 130-134. Burke RL ( 1991) Relocations, repatriations, and translocations of amphibians and reptiles: Taking a broader view. Herpetologica 47:350-357. Burkett RD (1984) An ecological study of the cricket frog, Acris crepitans. Pp. 89-103 in: Vertebrate Ecology and Systematics: A Tribute to Henry S. Fitch ( eds. Seigel RA, Hunt LE, Knight JL, Malaret L, Zuschlag NL). Museum of Natural History, University of Kansas, Lawrence, KS. Bums EL, Eldridge MDB, Houlden BA (2004) Microsatellite variation and population structure in a declining Australian Hylid. Molecular Ecology 13:1745-1757. Bums EL, Eldridge MDB, Crayn DM, Houlden BA (2007) Low phylogeographic structure in a wide spread endangered Australian frog Litoria aurea (Anura: Hylidae). Conservation Genetics 8: 17-32. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 171 - Burrowes PA, Joglar RL, Green DE (2004) Potential causes for amphibian declines in Puerto Rico. Herpetologica 60:141-154. Bushnell RJ, Bushnell EP, Parker MV (1939) A chromosome study of five members of the family Hylidae. Journal of the Tennessee Academy of Science 14:209-215. Campbell C (1978) Reproduction and ecology of turtles and other reptiles and amphibians of Lakes Erie and St. Clair in relation to toxic chemicals. CWS No. 7475/022, Canadian Wildlife Services. Carpenter DW, Jung RE, Sites JJ (2001) Conservation genetics of the endangered Shenandoah salamander (Plethodon shenandoah, Plethodontidae ). Animal Conservation 4: 111-119. Chantell CJ (1966) Late Cenozoic hylids from the Great Plains. Herpetologica 22:259- 264. Chantell CJ (1968) The osteology of A eris and Limnaoedus (Amphibia: Hylidae ). American Midland Naturalist 79:169-182. Chapuis MP, Estoup A (2007) Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24:621-631. Charpentier M, Setchell JM, Prugnolle F et al. (2005) Genetic diversity and reproductive success in mandrills (Mandrillus sphinx). Proceedings of the National Academy of Sciences 102:16723-16728. Chek AA, Lougheed SC, Bogart JP, Boag PT (2001) Perception and history: molecular phylogeny of a diverse group of neotropical frogs, the 30-chromosome Hyla (Anura: Hylidae). Molecular Phylogenetics and Evolution 18:370-385. Church SA, Kraus JM, Mitchell JC, Church DR, Taylor DR (2003) Evidence for multiple Pleistocene refugia in the postglacial expansion of the eastern tiger salamander, Ambystoma tigrinum tigrinum. Evolution 57:372-383. Clark DJ, Cantu R, Cowman DF, Maxson DJ (1998) Uptake of arsenic and metals by tadpoles at an historically contaminated Texas site. Ecotoxicology 7:61-67. Collins JP, Storfer A (2003) Global amphibian declines: sorting the hypotheses. Diversity and Distributions 9:89-98. Conant R, Collins JT (1998) A Field Guide to Reptiles and Amphibians of Eastern and Central North America, 3rd ed. Houghton Mifflin, New York, NY. Cope ED (1868) Sixth contribution to the herpetology of Tropical America. Proceedings of the Academy of Natural Sciences of Philadelphia 20:305-313. Cracraft J (1983) Species concepts and speciation analysis. Pp. 159-187 in: Current Ornithology (ed. Johnston RF). Plenum Press, New York. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 172 - Crandall KA, Bininda-Emonds ORP, Mace GM, Wayne RK (2000) Considering evolutionary processes in conservation biology. Trends in Ecology and Evolution 15:290-295. Crawshaw GJ (2000) Diseases and Pathology of Amphibians and Reptiles. Pp. 199-231 in: Ecotoxicology of Amphibians and Reptiles (eds. Sparling DW, Linder G, Bishop CA). SETAC Press, Pensacola, FL. Crump ML, Hensley FR, Clark KL (1992) Apparent decline of the golden toad: Underground or extinct? Copeia 1992:413-420. Cullingam Cl, Kyle CJ, Pond BA, White BN (2008) Genetic structure of raccoons in eastern North America based on mtDNA: implications for subspecies designation and rabies disease dynamics. Canadian Journal of Zoology 86:947-958. Culver M, Johnson WE, Pecon-Slattery J, O'Brien SJ (2000) Genomic ancestry of the American puma (Puma concolor). Journal of Heredity 91:186-197. Cushman SA, McKelvey KS, Schwartz MK (2009) Use of empirically derived source destination models to map regional conservation corridors. Conservation Biology 23:369-376. Darling JA, Bagley MJ, Roman J, Tepolt CK, Geller JB (2008) Genetic patterns across multiple introductions of the globally invasive crab genus Carcinus. Molecular Ecology 17:4992-5007. Daugherty CH, Cree A, Hay JM, Thompson MB (1990) Neglected taxonomy and continuing extinctions oftuatara (Sphenodon). Nature 347:177-179. Debes PV, Zachos FE, Hanel R (2008) Mitochondrial phylogeography of the European sprat (Sprattus sprattus L., Clupeidae) reveals isolated climatically vulnerable populations in the Mediterranean Sea and range expansion in the northeast Atlantic. Molecular Ecology 17:3873-3888. Delcourt HR, Delcourt PA (1991) Quaternary Ecology: A Paleoecological Perspective. Chapman and Hall, New York. Delcourt PA, Delcourt HR (1980) Vegetation maps for eastern North America: 40 000 yr BP to the present. Pp. 123-165 in: Geobotany II (ed. Romans RC). Plenum Press, NY. Denton JS, Hitchings SP, Beebee TJC, Gent A (1997) A recovery program for the natterjack toad (Bufo calamita) in Britain. Conservation Biology 11:1329-1338. Descimon H, Napolitano M (1993) Enzyme polymorphism, wing pattern variability, and geographical isolation in an endangered butterfly species. Biological Conservation 66: 117-123. Dessauer HC, Nevo E (1969) Geographic variation of blood and liver proteins in cricket frogs. Biochemical Genetics 3: 171-188. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 173 - Dever JA (2007) Fine-scale genetic structure in the threatened foothill yellow-legged frog (Rana boylii). Journal of Herpetology 41:168-173. Diana SG, Beasley VR (1998) Amphibian toxicology. Pp. 266-277 in: Status and Conservation of Midwestern Amphibians (ed. Lannoo MJ). University oflowa Press, Iowa City. Diniz-Filho JAF, Telles MPDC (2002) Spatial autocorrelation analysis and the identification of operational units for conservation in continuous populations. Conservation Biology 16:924-935. Dodd CK, Jr., Seigel RA (1991) Relocation, repatriation, and translocation of amphibians and reptiles: Are they conservation strategies that work? Herpetologica 47:336-350. Drew RE, Hallett JG, Aubry KB et al. (2003) Conservation genetics of the fisher (Martes pennanti) based on mitochondrial DNA sequencing. Molecular Ecology 12:51-62. Dubey S, Shine R (2008) Origin of the parasites of an invading species, the Australian cane toad (Bufo marinus): are the lungworms Australian or American? Molecular Ecology 17:4418-4424. Duellman WE, Trueb L (1986) Biology of Amphibians. The Johns Hopkins University Press, Baltimore, MD. Dumeril AMC, Bibron G (1841) Erpetologie generale ou histoire naturelle des reptiles. Libraire Encyclopedique de Roret, Paris. Dunn ER (1938) Notes on frogs of the genus Acris. Proceedings of the Academy of Natural Sciences of Philadelphia 90: 153-154. Dupanloup I, Schneider S, Excoffier L (2002) A simulated annealing approach to define the genetic structure of populations. Molecular Ecology 11:2571-2581. Eagle AC, Hay-Chmielewski EM, Cleveland KT et al. (2005) Michigan's Wildlife Action Plan. Michigan Department of Natural Resources, Lansing, ML Easteal S ( 1985) The ecological genetics of introduced populations of the giant toad, Bufo marinus. Ill. Geographical patterns of variation. Evolution 39:1065-1075. Eckert CG, Samis KE, Lougheed SC (2008) Genetic variation across species' geographical ranges: the central-marginal hypothesis and beyond. Molecular Ecology 17:1170-1188. Eckstein RL, O'Neill RA, Danihelka J, Otte A, Kohler W (2006) Genetic structure among and within peripheral and central populations of three endangered floodplain violets. Molecular Ecology 15:2367-2379. Eizirik E, Kim J, Menotti-Raymond Met al. (2001) Phylogeography, population history and conservation genetics ofjaguars (Panthera onca, Mammalia, Felidae). Molecular Ecology 10:65-79. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 174 - Elmer KR, Cannatella DC (2008) Three new species of leaflitter frogs from the upper Amazon forests: cryptic diversity within Pristimantis "ockendeni" (Anura: Strabomantidae) in Ecuador. Zootaxa 11-38. England PR, Osler GHR, Woodworth LM et al. (2003) Effects of intense versus diffuse population bottlenecks on microsatellite genetic diversity and evolutionary potential. Conservation Genetics 4:595-604. Estep AD (2000) Geographic variation in wariness, morphology and genetics of the cricket frog, Acris crepitans, in Oklahoma. Unpublished M.Sc. dissertation. University of Central Oklahoma. Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology 14:2611-2620. Evans BJ, Brown RM, McGuire JA et al. (2003) Phylogenetics of fanged frogs: Testing biogeographical hypotheses at the interface of the Asian and Australian faunal zones. Systematic Biology 52:794-819. Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 131:479-491. Excoffier L, Laval G, Schneider S (2005) Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics 1:47-50. Fenneman NM, Johnson DW (1946) Physiographic divisions of the conterminous U.S. USGS, Washington, DC. Ferguson DE (1963) Mississippi Delta wildlife developing resistance to pesticides. Agricultural Chemicals September:32-34. Fitzinger L (1843) Systema Reptilium. Society for the Study of Amphibians and Reptiles. 106 pp. Flickinger EL, King KA, Stout WF, Mohn MM (1980) Wildlife hazards from Furadan 3G applications to rice in Texas. Journal of Wildlife Management 44:190-197. Fontanella F, Feldman CR, Siddall ME, Burbrink FT (2008) Phylogeography of Diadophis punctatus: Extensive lineage diversity and repeated patterns of historical demography in a trans-continental snake. Molecular Phylogenetics and Evolution 46: 1049-1070. Ford MJ (2002) Selection in captivity during supportive breeding may reduce fitness in the wild. Conservation Biology 16:815-825. Forsman A, Ahnesjo J, Caesar S, Karlsson M (2008) A model of ecological and evolutionary consequences of color polymorphism. Ecology 89:34-40. Frankham R (1995) Effective population size/adult population size ratio in wildlife: a review. Genetical Research 66:95-107. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 175 - Frankham R, Ballou JD, Briscoe DA (2002) Introduction to Conservation Genetics. Cambridge University Press, Cambridge, United Kingdom. Fraser DJ, Bernatchez L (2001) Adaptive evolutionary conservation: towards a unified concept for defining conservation units. Molecular Ecology 10:2741-2752. Friar EA, Ladoux T, Roalson HE, Robichaux HR (2000) Microsatellite analysis of a population crash and bottleneck in the Mauna Kea silversword, Argyroxiphium sandwicense ssp. sandwicense (Asteraceae), and its implications for reintroduction. Molecular Ecology 9:2027-2034. Frost DR, Grant T, Faivovich Jet al. (2006) The amphibian tree oflife. Bulletin of the American Museum of Natural History 297:1-370. Fu YX ( 1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147:915-925. Funk WC, Blouin MS, Corn PS et al. (2005) Population structure of Columbia spotted frogs (Rana luteiventris) is strongly affected by the landscape. Molecular Ecology 14:483-496. Galbreath PF, Adams ND, Guffey SZ, Moore CJ, West JL (2001) Persistence of native southern Appalachian brook trout populations in the Pigeon River system, North Carolina. North American Journal of Fisheries Management 21:927-934. Galeotti P, Rubolini D, Dunn PO, Fasola M (2003) Colour polymorphism in birds: causes and functions. Journal of Evolutionary Biology 16:635-646. Gamble T, Berendzen PB, Shaffer HB, Starkey DE, Simons AM (2008) Species limits and phylogeography of North American cricket frogs (Acris: Hylidae). Molecular Phylogenetics and Evolution 48:112-125. Garcia-Diaz J (1967) Rediscovery of Buja lemur (Cope) and additional records ofreptiles from Puerto Rico. Stahlia 10: 1-6. Garcia-Moreno J, Matocq MD, Roy MS, Geffen E, Wayne RK (1996) Relationships and genetic purity of the endangered Mexican wolf based on analysis of microsatellite loci. Conservation Biology 10:376-389. Garcia-Ramos G, Kirkpatrick M (1997) Genetic models of adaptation and gene flow in peripheral populations. Evolution 51 :21-28. Germano JM, Bishop P J (2009) Suitability of amphibians and reptiles for translocation. Conservation Biology 23:7-15. Givnish TJ, Millam KC, Mast AR et al. (2009) Origin, adaptive radiation and diversification of the Hawaiian lobeliads (Asterales: Campanulaceae). Proceedings of the Royal Society B 276:407-416. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 176 - Godoy JA, Negro JJ, Hiraldo F, Donazar JA (2004) Phylogeography, genetic structure and diversity in the endangered bearded vulture (Gypaetus barbatus, L.) as revealed by mitochondrial DNA. Molecular Ecology 13:371-390. Goebel AM (1996) Systematics and conservation ofbufonids in North America and in the Bufo boreas species group. Unpublished Ph.D. dissertation. University of Colorado. Goebel AM, Donnelly JM, Atz ME ( 1999) PCR primers and amplification methods for l 2S ribosomal DNA, the control region, cytochrome oxidase I, and cytochrome b in bufonids and other frogs, and an overview of PCR primers which have amplified DNA in amphibians successfully. Molecular Phylogenetics and Evolution 11:163-199. Good JM, Demboski JR, Nagorsen DW, Sullivan J (2003) Phylogeography and introgressive hybridization: chipmunks (genus Tamias) in the northern Rocky Mountains. Evolution 57:1900-1916. Goodman SJ, Tamate HB, Wilson R et al. (2001) Bottlenecks, drift and differentiation: The population structure and demographic history of sika deer (Cervus nippon) in the Japanese archipelago. Molecular Ecology 10:1357-1370. Gorman WL ( 1986) Patterns of color polymorphism in the cricket frog, A eris crepitans, in Kansas. Copeia 1986:995-999. Gorman WL, Gaines MS (1987) Patterns of genetic variation in the cricket frog, Acris crepitans, in Kansas. Copeia 1987:352-360. Gasner KL, Black IH (1957) The effects of acidity on the development and hatching of New Jersey frogs. Ecology 38:256-262. Graham A (1999) Late Cretaceous and Cenozoic History of North American Vegetation North of Mexico. Oxford University Press, Oxford. 350 pp. Grant C (1931) Notes on Bufo marinus (Linnaeus). Copeia 1931:62. Gray RH (1971) Fall activity and overwintering of the cricket frog (Acris crepitans) in central Illinois. Copeia 1971:748-750. Gray RH (1972) Metachrosis of the vertebral stripe in the cricket frog, Acris crepitans. The American Midland Naturalist 87:549-551. Gray RH (1983) Seasonal, annual and geographic variation in color morph frequencies of the cricket frog, Acris crepitans, in Illinois. Copeia 1983:300-311. Gray RH ( 1984) Effective breeding size and the adaptive significance of color polymorphism in the cricket frog (Acris crepitans) in Illinois, USA. Amphibia-Reptilia 5:101-107. Gray RH (1995) An unusual color pattern variant in cricket frogs (Acris crepitans) from southern Illinois. Transactions of the Illinois State Academy of Science 88: 13 7-13 8. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 177 - Gray RH (2000) Historical occurrence of malformations in the cricket frog, Acris crepitans, in Illinois. Transactions of the Illinois State Academy of Science 93:279- 284. Gray RH, Brown LE (2005) Decline of northern cricket frogs (Acris crepitans). Pp. 47-54 in: Amphibian Declines: The Conservation Status of United States Species (ed. Lannoo MJ). University of California Press, Berkeley, CA. Gray RH, Brown LE, Blackbum L (2005) A eris crepitans Baird, 1854. Pp. 441-443 in: Amphibian Declines: The Conservation Status of United States Species (ed. Lannoo MJ). University of California Press, Berkeley, CA. Graybeal A ( 1997) Phylogenetic relationships of bufonid frogs and tests of alternate macroevolutionary hypotheses characterizing their radiation. Zoological Journal of the Linnean Society 119:297-338. Green DM (2003) The ecology of extinction: population fluctuation and decline in amphibians. Biological Conservation 111:331-343. Greenwell M, Beasley VR, Brown LE (1996) The mysterious decline of the cricket frog. Aquaticus 26:48-54. Guiher TJ, Burbrink FT (2008) Demographic and phylogeographic histories of two venomous North American snakes of the genus Agkistrodon. Molecular Phylogenetics and Evolution 48:543-553. Guo SW, Thompson EA (1992) Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48:361-372. Gunther A (1858) Catalogue of the Batrachia Salientia in the Collection of the British Museum. Francis and Collins, London. Hakansson J, Bratt C, Jensen P (2007) Behavioural differences between two captive populations of red jungle fowl (Gallus gallus) with different genetic background, raised under identical conditions. Applied Animal Behaviour Science 102:24-38. Hall TA (1999) BIOEDIT: a user-friendly biological sequence alignment editor and analysis program for Windows 95-98-NT. Nucleic Acids Symposium Series 41:95-98. Halverson MA, Skelly DK, Caccone A (2006) Inbreeding linked to amphibian survival in the wild but not in the laboratory. Journal of Heredity 97:499-507. Hamilton MB, Pincus EL, Di Fiore A, Fleischer RC (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 27:500-507. Hammerson GA, Livo LJ (1999) Conservation status of the northern cricket frog (Acris crepitans) in Colorado and adjacent areas at the northwestern extent of the range. Herpetological Review 30:78-80. Hanski I (1998) Metapopulation dynamics. Nature 396:41-49. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 178 - Harper F (1947) A new cricket frog (Acris) from the middle western states. Proceedings of the Biological Society of Washington 60:39-40. Hass CA, Maxson LR, Hedges SB (2001) Relationships and divergence times of West Indian amphibians and reptiles: insights from albumin immunology. Pp. 157-174 in: Biogeography of the West Indies: Patterns and Perspectives (eds. Woods CA, Sergile FE). CRC Press, Boca Raton, FL. Hay RM (1998) Blanchard's cricket frogs in Wisconsin: a status report. Pp. 79-82 in: Status and Conservation of Midwestern Amphibians ( ed. Lannoo MJ). University of Iowa Press, Iowa City. Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B 270:313-321. Hedges SB, Hass CA, Maxson LR (1992) Caribbean biogeography: Molecular evidence for dispersal in West Indian terrestrial vertebrates. Proceedings of the National Academy of Sciences 89:1909-1913. Hedges SB (1996) The origin of West Indian amphibians and reptiles. Pp. 95-128 in: Contributions to West Indian Herpetology: A Tribute to Albert Schwartz (eds. Powell R, Henderson RW). Society for the Study of Amphibians and Reptiles, Ithaca, NY. Hedges SB, Joglar RL, Thomas R (2004) Bufo lemur. 2006 IUCN Red List of Threatened Species, IUCN 2006. www.iucnredlist.org. Accessed 6-11-2008. Hedrick PW (1995) Gene flow and genetic restoration: The Florida panther as a case study. Conservation Biology 9:996-1007. Hedrick PW, Kalinowski ST (2000) Inbreeding depression in conservation biology. Annual Review of Ecology and Systematics 31: 139-162. Hedrick PW (2001) Conservation genetics: where are we now? Trends in Ecology and Evolution 16:629-636. Hemesath LM (1998) Iowa's frog and toad survey, 1991-1994. Pp. 206-216 in: Status and Conservation of Midwestern Amphibians (ed. Lannoo MJ). University of Iowa Press, Iowa City. Hensen I, Wesche K (2006) Relationships between population size, genetic diversity and fitness components in the rare plant Dictamnus albus in central Germany. Biodiversity and Conservation 15:2249-2261. Hewitt GM (1996) Some genetic consequences of ice ages, and their role in divergence and speciation. Biological Journal of the Linnean Society 58:247-276. Hewitt GM (2000) The genetic legacy of the Quaternary ice ages. Nature 405:907-913. Hewitt GM, Ibrahim KM (2001) Inferring glacial refugia and historical migrations with molecular phylogenies. Pp. 271-294 in: Integrating Ecology and Evolution in a Spatial Context (eds. Silvertown J, Antonovics J). Cambridge University Press, Cambridge. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 179 - Hewitt GM (2004) Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Society of London B 359: 183-195. Hoelzel AR, Halley J, Campagna C et al. ( 1993) Elephant seal genetic differentiation and the use of simulation models to investigate historical population bottlenecks. Journal of Heredity 84:443-449. Hoffman EA, Blouin MS (2004) Evolutionary history of the northern leopard frog: Reconstruction of phylogeny, phylogeography, and historical changes in population demography from mitochondrial DNA. Evolution 58: 145-159. Hoffman EA, Schueler FW, Blouin MS (2004) Effective population sizes and temporal stability of genetic structure in Rana pipiens, the northern leopard frog. Evolution 58:2536-2545. Holderegger R, Kamm U, Gugerli F (2006) Adaptive vs. neutral genetic diversity: implications for landscape genetics. Landscape Ecology 21:797-807. Holman JA (1995) Pleistocene Amphibians and Reptiles in North America, Oxford University Press, Oxford. Houlahan JE, Findlay CS, Schmidt BR, Meyer AH, Kuzmin SL (2000) Quantitative evidence for global amphibian population declines. Nature 404:752-755. Howes BJ, Lindsay B, Lougheed SC (2006) Range-wide phylogeography of a temperate lizard, the five-lined skink (Eumeces fasciatus). Molecular Phylogenetics and Evolution 40: 183-194. Hunter MLJ, Hutchinson A (1994) The virtues and shortcomings of parochialism: Conserving species that are locally rare, but globally common. Conservation Biology 8:1163-1165. Huson DH, Bryant D (2005) Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23:254-267. Hutchison DW (2003) Testing the central/peripheral model: Analyses of microsatellite variability in the collared lizard (Crotaphytus collaris collaris). American Midland Naturalist 149:148-162. Ibrahim KM, Nichols RA, Hewitt GM (1996) Spatial patterns of genetic variation generated by different forms of dispersal during range expansion. Heredity 77:282- 291. Irwin DE (2002) Phylogeographic breaks without geographic barriers to gene flow. Evolution 56:2383-2394. Irwin JT, Costanzo JP, Lee RE (1999) Terrestrial hibernation in the northern cricket frog, A eris crepitans. Canadian Journal of Zoology 77: 1240-1246. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 180 - Irwin JT (2005) Overwintering in northern cricket frogs (Acris crepitans). Pp. 55-58 in: Amphibian Declines: The Conservation Status of United States Species (ed. Lannoo MJ). University of California Press, Berkeley, CA. James CH, Moritz C (2000) Intraspecific phylogeography in the sedge frog Litoria fallax (Hylidae) indicates pre-Pleistocene vicariance of an open forest species from eastern Australia. Molecular Ecology 9:349-358. Jancovich JK, Davidson EW, Parameswaran N et al. (2005) Evidence for emergence of an amphibian iridoviral disease because of human-enhanced spread. Molecular Ecology 14:213-224. Jehle R, Arntzen JW (2002) Microsatellite markers in amphibian conservation genetics. Herpetological Journal 12:1-9. Jensen JB (2005) Acris gryllus (LeConte, 1825). p.443 in: Amphibian Declines: The Conservation Status of United States Species (ed. Lannoo MJ). University of California Press, Berkeley, CA. Jirku M, Bolek MG, Whipps CM et al. (2006) A new species of Myxidium (Myxosporea: Myxidiidae ), from the western chorus frog, Pseudacris triseriata triseriata, and Blanchard's cricket frog, Acris crepitans blanchardi (Hylidae), from eastern Nebraska: morphology, phylogeny, and critical comments on amphibian Myxidium taxonomy. Journal of Parasitology 92:611-619. Johansson M, Primmer CR, Sahlsten J, Merila J (2005) The influence of landscape structure on occurrence, abundance and genetic diversity of the common frog, Rana temporaria. Global Change Biology 11:1664-1679. Johnson B (1999) Recovery of the Puerto Rican Crested Toad. Endangered Species Bulletin 24:8-9. Johnson BK, Christiansen JL (1976) The food and food habits of Blanchard's cricket frog, Acris crepitans blanchardi (Amphibia, Anura, Hylidae ), in Iowa. Journal of Herpetology 10:63-74. Johnson RR (1990) Release and translocation strategies for the Puerto Rican crested toad, Peltophryne lemur. Endangered Species Update 8:54-57. Kalendar R (2005) F ASTPCR: A PCR primer design and repeat sequence searching software with additional tools for the manipulation and analysis of DNA and proteins. Helsinki, Finland. Kalinowski ST (2004) Counting alleles with rarefaction: Private alleles and hierarchical design. Conservation Genetics 5:539-543. Kalinowski ST (2005) HP-RARE 1.0: a computer program for performing rarefaction on measures of allelic richness. Molecular Ecology Notes 5: 187-189. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 181 - Keane TM, Creevey CJ, Pentony MM, Naughton TJ, Mclnerney JO (2006) Assessment of methods for amino acid matrix selection and their use on empirical data shows that ad hoc assumptions for choice of matrix are not justified. BMC Evolutionary Biology 6:29. Kellar TC, Waldron G, Bishop C et al. (1997) National Recovery Plan for Blanchard's Cricket Frog. Recovery of Nationally Endangered Wildlife Committee, Ottawa. Kiesecker JM, Blaustein AR, Belden LK (2001) Complex causes of amphibian population declines. Nature 410:681-684. Knopp T, Cano JM, Crochet P-A, Merila J (2007) Contrasting levels of variation in neutral and quantitative genetic loci on island populations of moor frogs (Rana arvalis). Conservation Genetics 8:45-56. Knopp T, Merila J (2008) The postglacial recolonization of Northern Europe by Rana arvalis as revealed by microsatellite and mitochondrial DNA analyses. Heredity 102: 174-181. Knutson MG, Sauer JR, Olsen DA et al. (2000) Landscape associations of frog and toad species in Iowa and Wisconsin, U.S.A. Journal of the Iowa Academy of Science 107: 134-145. Koscinski D, Handford P, Tubaro PL, Sharp S, Lougheed SC (2008) Pleistocene climatic cycling and diversification of the Andean treefrog, Hypsiboas andinus. Molecular Ecology 17:2012-2025. Kozak KH, Larson A, Bonett RM, Harmon LJ (2005) Phylogenetic analysis of ecomorphological divergence, community structure, and diversification rates in dusky salamanders (Plethodontidae: Desmognathus). Evolution 59:2000-2016. Kraaijeveld-Smit FJL, Beebee TJC, Griffiths RA, Moore RD, Schley L (2005) Low gene flow but high genetic diversity in the threatened Mallorcan midwife toad Alytes muletensis. Molecular Ecology 14:3307-3315. Kumar S,Tamura K, Nei M (2004) MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5:150-163. Kyle CJ, Wilson CC (2007) Mitochondrial DNA identification of game and harvested freshwater fish species. Forensic Science International 166:68-76. Lacy R, Foster M (1987) Summary of electrophoretic analyses for Puerto Rican crested toad, Chicago Zoological Society. Lada H, Mac Nally R, Taylor AC (2008) Phenotype and gene flow in a marsupial (Antechinus jlavipes) in contrasting habitats. Biological Journal of the Linnean Society 94:303-314. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 182 - Lamb T, Avise JC (1987) Morphological variability in genetically defined categories of anuran hybrids. Evolution 41:157-165. Land D, Shindle D, Cunningham M, Lotz M, Ferree B (2004) Florida panther genetic restoration and management annual report 2003-04. Florida Fish and Wildlife Conservation Commission, Tallahassee, FL. Lannoo MJ, Lang K, Waltz T, Phillips GS (1994) An altered amphibian assemblage: Dickinson County, Iowa, 70 years after Frank Blanchard's survey. American Midland Naturalist 131:311-319. Lannoo MJ (1998a) Conclusion. Pp. 429-432 in: Status and Conservation of Midwestern Amphibians ( ed. Lannoo MJ). University of Iowa Press, Iowa City. Lannoo MJ (1998b) Amphibian conservation and wetland management in the upper Midwest: a catch-22 for the cricket frog? Pp. 330-339 in: Status and Conservation of Midwestern Amphibians (ed. Lannoo MJ). University oflowa Press, Iowa City. Larson S, Jameson R, Etnier M, Fleming M, Bentzen P (2002) Loss of genetic diversity in sea otters (Enhydra lutris) associated with the fur trade of the 18th and 19th centuries. Molecular Ecology 11: 1899-1903. LeConte J ( 1825) Remarks on the American species of the Genera Hyla and Rana. Annals of the Lyceum of Natural History of New York 1:278-282. Lee-Yaw JA, Irwin JT, Green DM (2008) Postglacial range expansion from northern refugia by the wood frog, Rana sylvatica. Molecular Ecology 17:867-884. Lehtinen RM (2002) A historical study of the distribution of Blanchard's cricket frog (Acris crepitans blanchardi) in southeastern Michigan. Herpetological Review 33:194-197. Lehtinen RM, Skinner AA (2006) The enigmatic decline of Blanchard's cricket frog (A eris crepitans blanchardi): A test of the habitat acidification hypothesis. Copeia 2006:159-167. Leja WT (1998) Aquatic Habitats in the Midwest: Waiting for Amphibian Conservation Initiatives. Pp. 345-353 in: Status and Conservation of Midwestern Amphibians (ed. Lannoo MJ). University of Iowa Press, Iowa City. Lemmon EM, Lemmon AR, Cannatella DC (2007a) Geological and climatic forces driving speciation in the continentally distributed trilling chorus frogs (Pseudacris). Evolution 61:2086-2103. Lemmon EM, Lemmon AR, Collins JT, Lee-Yaw JA, Cannatella DC (2007b) Phylogeny-based delimitation of species boundaries and contact zones in the trilling chorus frogs (Pseudacris). Molecular Phy lo genetics and Evolution 44: 1068-1082. Lentini A (2000) Puerto Rican Crested Toad (Peltophryne lemur) SSP Husbandry Manual, Keeper and Curator Edition. Toronto Zoo, Scarborough, ON. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 183 - Lesbarreres D, Primmer CR, Laurila A, Merila J (2005) Environmental and population dependency of genetic variability-fitness correlations in Rana temporaria. Molecular Ecology 14:311-323. Lesica P, Allendorf FW ( 1995) When are peripheral populations valuable for conservation? Conservation Biology 9:753-760. Lessa EP, Cook JA, Patton JL (2003) Genetic footprints of demographic expansion in North America, but not Amazonia, during the Late Quaternary. Proceedings of the National Academy of Sciences 100:10331-10334. Lips KR, Brem F, Brenes R et al. (2006) Emerging infectious disease and the loss of biodiversity in a Neotropical amphibian community. Proceedings of the National Academy of Sciences 103:3165-3170. Littlejohn MJ, Roberts JD (1975) Acoustic analysis of an intergrade zones between two call races of the Limnodynastes tasmaniensis complex (Anura: Leptodactylidae) in south-eastern Australia. Australian Journal of Zoology 23: 113-122. Lo mo lino MV, Channell R ( 1995) Splendid isolation: patterns of geographic range collapse in endangered mammals. Journal ofMammalogy 76:335-347. Lougheed SC, Gascon C, Jones DA, Bogart JP, Boag PT (1999) Ridges and rivers: a test of competing hypotheses of Amazonian diversification using a dart-poison frog (Epipedobatesfemoralis). Proceedings of the Royal Society of London B 266:1829- 1835. Lundquist CJ, Granek EF (2005) Strategies for successful marine conservation: integrating socioeconomic, political, and scientific factors. Conservation Biology 19: 1771-1778. Lynch M, Pfrender M, Spitze Ket al. (1999) The quantitative and molecular genetic architecture of a subdivided species. Evolution 53: 100-110. Mace GM, Smith TB, Bruford MW, Wayne RK (1996) An Overview of the Issues. Pp. 1- 21 in: Molecular Genetic Approaches in Conservation (eds. Smith TB, Wayne RK). Oxford University Press, New York. Madsen T, Shine R, Olsson M, Wittzell H (1999) Restoration of an inbred adder population. Nature 402:34-35. Maglia AM, Pugener LA, Mueller JM (2007) Skeletal morphology and postmetamorphic ontogeny of A eris crepitans (Anura: Hylidae ): a case of miniaturization in frogs. Journal ofMorphofogy 268:194-223. Manel S, Schwartz MK, Luikart G, Taberlet P (2003) Landscape genetics: combining landscape ecology and population genetics. Trends in Ecology and Evolution 18: 189- 197. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 184 - Manel S, Gaggiotti OE, Waples RS (2005) Assignment methods: matching biological questions with appropriate techniques. Trends in Ecology and Evolution 20: 136-142. Manni F, Guerard E, Heyer E (2004) Geographic patterns of (genetic, morphologic, linguistic) variation: How barriers can be detected by using Monmonier's algorithm. Human Biology 76:173-190. Marsh DM, Trenham PC (2001) Metapopulation dynamics and amphibian conservation. Conservation Biology 15:40-49. Martinez-Solano I, Rey I, Garcia-Paris M (2005) The impact of historical and recent factors on genetic variability in a mountain frog: the case of Rana iberica (Anura: Ranidae). Animal Conservation 8:431-441. Maruska EJ (1986) Amphibians: review of zoo breeding programmes. International Zoo Yearbook 24/25:56-65. Masta SE, Laurent NM, Routman EJ (2003) Population genetic structure of the toad Bufo woodhousii: an empirical assessment of the effects of haplotype extinction on nested cladistic analysis. Molecular Ecology 12:1541-1554. Matos-Torres JJ (2006) Habitat characterization for the Puerto Rican crested toad (Peltophryne lemur) at Guanica State Forest, Puerto Rico. Unpublished M.Sc. dissertation. University of Puerto Rico - Mayaguez. Mayr E (1963) Animal Species and Evolution. Harvard University Press, Cambridge. McCallum ML (2007) Amphibian decline or extinction? Current declines dwarf background extinction rate. Journal of Herpetology 41:486-491. McCallum ML, Trauth SE (2003) A forty-three year museum study of northern cricket frog (Acris crepitans) abnormalities in Arkansas: Upward trends and distributions. Journal of Wildlife Diseases 39:522-528. McCallum ML, Trauth SE (2004) Blanchard's cricket frog in Nebraska and South Dakota. Prairie Naturalist 36: 129-135. McCallum ML, Trauth SE (2006) An evaluation of the subspecies Acris crepitans blanchardi (Anura, Hylidae). Zootaxa 1104:1-21. McCallum ML, Trauth SE (2007) Physiological trade-offs between immunity and reproduction in the northern cricket frog (Acris crepitans). Herpetologica 63:269-274. McCarthy MA, Possingham HP (2007) Active adaptive management for conservation. Conservation Biology 21:956-953. McClelland BE, Wilczynski W, Ryan MJ (1998) Intraspecific variation in laryngeal and ear morphology in male cricket frogs (Acris crepitans). Biological Journal of the Linnean Society 63:51-67. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 185 - McKay JK, Latta RG (2002) Adaptive population divergence: markers, QTL and traits. Trends in Ecology and Evolution 17:285-291. McLeod DS (2005) Nebraska's declining amphibians. Pp. 292-294 in: Amphibian Declines: The Conservation Status of United States Species (ed. Lannoo MJ). University of California Press, Berkeley, CA. Mecham JS ( 1964) Ecological and genetic relationships of the two cricket frogs, genus Acris, in Alabama. Herpetologica 20:80-91. Mehlman DW (1997). Change in avian abundance across the geographic range in response to environmental change. Ecological Applications 7:614-624. Meyer E, Newell D, Hines H et al. (2004) Rheobatrachus situs. 2006 IUCN Red List of Threatened Species, IUCN 2006. www.iucnredlist.org. Accessed 14-04-2007. Micancin JP (2008) Acoustic variation and species discrimination in southeastern sibling species, the cricket frogs Acris crepitans and Acris gryllus. Unpublished Ph.D. dissertation. University of North Carolina-Chapel Hill. Mickelson DM, Colgan PM (2004) The southern Laurentide Ice Sheet. Pp. 1-16 in: The Quaternary Period in the United States (eds. Gillespie AR, Porter SC, Atwater BF). Elsevier, Amsterdam. Mierzwa KS ( 1998) Status of northeastern Illinois amphibians. Pp. 115-124 in: Status and Conservation of Midwestern Amphibians ( ed. Lannoo MJ). University of Iowa Press, Iowa City. Miller DA, White RA (1998) A conterminous United States multi-layer soil characteristics data set for regional climate and hydrology modeling. Earth Interactions 2:1-26. Miller TJ (1985) Husbandry and breeding of the Puerto Rican toad (Peltophryne lemur) with comments on its natural history. Zoo Biology 4:281-286. Milstead WW, Rand AS, Steward MM (1974) Polymorphism in cricket frogs: An hypothesis. Evolution 28:489-491. Minton SA (1998) Observations on Indiana amphibian populations: a forty-five-year overview. Pp. 217-220 in: Status and Conservation of Midwestern Amphibians (ed. Lannoo MJ). University of Iowa Press, Iowa City. Mittleman MB (1947) Miscellaneous notes on Indiana amphibians and reptiles. American Midland Naturalist 38:466-484. Monroe WH (1976) The karst landforms of Puerto Rico, 899 ed. USGS Professional Paper. US Government Printing Office, Washington, DC. Monsen KJ, Blouin MS (2003) Genetic structure in a montane ranid frog: restricted gene flow and nuclear-mitochondrial discordance. Molecular Ecology 12:3275-3286. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 186 - Montgomery ME, Ballou JD, Nurthen RK et al. (1997) Minimizing kinship in captive breeding programs. Zoo Biology 16:377-389. Moore DS (1997) Molecular Analyses of Temperate Hylid Frogs using the Mitochondrial Cytochrome b Gene. Unpublished Ph.D. dissertation. University of Alabama at Birmingham. Moreno JA. Unpublished notes on Peltophryne lemur Cope. 1985. Internal document for the Puerto Rico Department of Natural Resources. Moriarty JJ (1998) Status of amphibians in Minnesota. Pp. 166-168 in: Status and Conservation of Midwestern Amphibians ( ed. Lannoo MJ). University of Iowa Press, Iowa City. Moritz C, Dowling TE, Brown WM (1987) Evolution of animal mitochondrial DNA: relevance for population biology and systematics. Annual Review of Ecology and Systematics 18:269-292. Moritz C (1999) Conservation units and translocations: strategies for conserving evolutionary processes. Hereditas 130:217-228. Morris AB, Ickert-Bond SM, Brunson DB, Soltis DE, Soltis PS (2008) Phylogeographical structure and temporal complexity in American sweetgum (Liquidambar styraciflua; Altingiaceae). Molecular Ecology 17:3889-3900. Mossman MJ, Hartman LM, Hay RM, Sauer JR, Dhuey BJ (1998) Monitoring long-term trends in Wisconsin frog and toad populations. Pp. 169-198 in: Status and Conservation of Midwestern Amphibians ( ed. Lannoo MJ). University of Iowa Press, Iowa City. Mount RH (1975) The Reptiles and Amphibians of Alabama, Auburn University Agricultural Experiment Station, Auburn, AL. Murphy RW, Sites JW, Buth DG, Haufler CH (1996) Proteins: Isozyme Electrophoresis. Pp. 51-120 in: Molecular Systematics (eds. Hillis DM, Moritz C, Mable BK). Sinauer Associates Inc., Sunderland, MA. · Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J (2000) Biodiversity hotspots for conservation priorities. Nature 403:853-858. Nei M (1972) Genetic distance between populations. American Naturalist 106:283-292. Neill WT (1950) Taxonomy, nomenclature, and distribution of southeastern cricket frogs, genus Acris. American Midland Naturalist 43:152-156. Netting MG, Goin CJ (1945) The cricket-frog of peninsular Florida. Quarterly Journal of the Florida Academy of Sciences 8:304-310. Nevo E (1973a) Adaptive variation in size of cricket frogs. Ecology 54:1271-1281. Nevo E (1973b) Adaptive color polymorphism in cricket frogs. Evolution 27:353-367. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 187 - Nevo E, Capranica RR (1985) Evolutionary origin of ethological reproductive isolation in cricket frogs, Acris. Pp. 147-214 in: Evolutionary Biology, vol. 19 (eds. Hecht MK, Wallace B, Prance GT). Plenum Press, New York. NYSDEC (2007) Checklist of Amphibians, Reptiles, Birds and Mammals of New York State. New York State Department of Environmental Conservation, Division of Fish, Wildlife and Marine Resources, Wildlife Diversity Group. Newman D, Tallmon DA (2001) Experimental evidence for beneficial fitness effects of gene flow in recently isolated populations. Conservation Biology 15: 1054-1063. Newman RA, Squire T (2001) Microsatellite variation and fine-scale population structure in the wood frog (Rana sylvatica). Molecular Ecology 10:1087-1100. Nielson M, Lohman K, Sullivan J (2001) Phylogeography of the tailed frog (Ascaphus truei): Implications for the biogeography of the Pacific Northwest. Evolution 55:147- 160. Nittinger F, Gamauf A, Pinsker W, Wink M, Haring E (2007) Phylogeography and population structure of the saker falcon and the influence of hybridization: mitochondrial and microsatellite data. Molecular Ecology 16:1497-1517. Noonan BP, Chippindale PT (2006) Dispersal and vicariance: The complex evolutionary history of boid snakes. Molecular Phylogenetics and Evolution 40:347-358. Oden NL (1984) Assessing the significance of a spatial correlogram. Geographical Analysis 16: 1-16. Oldham MJ (1992) Declines in Blanchard's cricket frog in Ontario. Pp. 30-31 in: Declines in Canadian amphibian populations: designing a national monitoring strategy ( eds. Bishop CA, Pettit KE). Canadian Wildlife Service, Occasional Paper No. 76. Ouellet M (2000) Amphibian Deformities: Current State of Knowledge. Pp. 617-661 in: Ecotoxicology of Amphibians and Reptiles (eds. Sparling DW, Linder G, Bishop CA). SETAC Press, Pensacola, FL. Padial JM, de la Riva I (2009) Integrative taxonomy reveals cryptic Amazonian species of Pristimantis (Anura: Strabomantidae). Zoological Journal of the Linnean Society 155:97-122. Paetkau D, Waits LP, Clarkson PL, Craighead L, Strobeck C (1997) An empirical evaluation of genetic distance statistics using microsatellite data from bear (Ursidae) populations. Genetics 14 7: 194 3-19 5 7. Palo JU, O'Hara RB, Laugen AT et al. (2003) Latitudinal divergence of common frog (Rana temporaria) life history traits by natural selection: evidence from a comparison of molecular and quantitative genetic data. Molecular Ecology 12: 1963-1978. Palo JU, Schmeller DS, Laurila A et al. (2004) High degree of population subdivision in a widespread amphibian. Molecular Ecology 13:2631-2644. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 188 - Parent CE, Caccone A, Petren K (2008) Colonization and diversification of Galapagos terrestrial fauna: a phylogenetic and biogeographical synthesis. Philosophical Transactions of the Royal Society B 363:3347-3361. Patenaude NJ, Quinn JS, Beland P, Kingsley M, White BN (1994) Genetic variation of the St. Lawrence beluga whale population assessed by DNA fingerprinting. Molecular Ecology 3:375-381. Pauly GB, Hillis DM, Cannatella DC (2004) The history of a nearctic colonization: Molecular phylogenetics and biogeography of the nearctic toads (Bufo ). Evolution 58:2514-2535. Pauly GB, Piskurek 0, Shaffer HB (2007) Phylogeographic concordance in the southeastern United States: the flatwoods salamander, Ambystoma cingulatum, as a test case. Molecular Ecology 16:415-429. Peakall R, Smouse PE (2006) GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6:288-295. Pechmann JHK, Scott DE, Semlitsch RD et al. (1991) Declining amphibian populations: The problem of separating human impacts from natural fluctuations. Science 253:892- 895. Pechmann JHK, Wilbur HM (1994) Putting declining amphibian populations in perspective: natural fluctuations and human impacts. Herpetologica 50:65-84. Petersen SD, Mason T, Akber Set al. (2007) Species identification of tarantulas using exuviae for international wildlife law enforcement. Conservation Genetics 8:497-502. Phillips K (1990) Where Have All the Frogs and Toads Gone? Bioscience 40:422. Pico R (1974) The Geography of Puerto Rico. Aldine Publishing Co., Chicago. 439 pp. Posada D, Crandall KA (1998) MODEL TEST: testing the model of DNA substitution. Bioinformatics 14:817-818. Posada D, Crandall KA (2001) Intraspecific gene genealogies: trees grafting into networks. Trends in Ecology and Evolution 16: 37-45. Pounds JA, Crump ML (1994) Amphibian declines and climate disturbance: the case of the golden toad and the harlequin frog. Conservation Biology 8:72-85. Pounds A, Savage J (2004) Bufo periglenes. 2006 IUCN Red List of Threatened Species, IUCN 2006. www.iucnredlist.org. Accessed 14-04-2007. Pounds JA, Bustamante MR, Coloma LA et al. (2006) Widespread amphibian extinctions from epidemic disease driven by global warming. Nature 439:161-167. Pounds JA, Fogden MPL, Savage JM, Gorman GC (1997) Tests of null models for amphibian declines on a tropical mountain. Conservation Biology 11:1307-1322. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 189 - Pounds JA, Fogden MPL, Campbell JH (1999) Biological response to climate change on a tropical mountain. Nature 398:611-615. Pramuk JB, Hass CA, Hedges SB (2001) Molecular phylogeny and biogeography of West Indian toads (Anura: Bufonidae). Molecular Phylogenetics and Evolution 20:294-301. Pramuk JB (2002) Combined evidence and cladistic relationships of West Indian toads (Anura:Bufonidae). Herpetological Monographs 16:121-151. Pray LA, Goodnight CJ (1995) Genetic variation in inbreeding depression in the red flour beetle Tribolium castaneum. Evolution 49: 176-188. PRCT SSP (2006) The Puerto Rican Crested Toad Species Survival Plan Website. www.crestedtoadssp.org. Accessed 04-06-2008. Pregill G (1981a) Cranial morphology and the evolution of West Indian toads (Salientia: Bufonidae): Resurrection of the genus Peltophryne Fitzinger. Copeia 1981:273-285. Pregill G ( 1981 b) Late Pleistocene herpetofaunas from Puerto Rico. University of Kansas Miscellaneous Publications No. 71. University of Kansas, Lawrence, KS. Primmer CR, Merila J (2002) A low rate of cross-species microsatellite amplification success in Ranid frogs. Conservation Genetics 3:445-449. Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945-959. Pyburn WF (1958) Size and movements of a local population of cricket frogs (A eris crepitans). Texas Journal of Science 10:325-342. Pyburn WF (1961) The inheritance and distribution of vertebral stripe color in the cricket frog. Pp. 235-261 in: Vertebrate Speciation (ed. Blair WF). Univ. of Texas, Austin. Rahel FJ (2007) Biogeographic barriers, connectivity and homogenization of freshwater faunas: it's a small world after all. Freshwater Biology 52:696-710. Ralin DB, Rogers JS (1972) Aspects of tolerance to desiccation inAcris crepitans and Pseudacris streckeri. Copeia 1972:519-525. Ramos-Onsins SE, Rozas J (2002) Statistical properties of new neutrality tests against population growth. Molecular Biology and Evolution 19:2092-2100. Raymond M, Rousset F (1995) GENEPOP (Version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity 86:248-249. Reed DH, Frankham R (2001) How closely correlated are molecular and quantitative measures of genetic variation? A meta-analysis. Evolution 55: 1095-1103. Reed DH, Frankham R (2002) Correlation between fitness and genetic diversity. Conservation Biology 17:230-237. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 190 - Reed JC Jr., Bush CA (2005) Generalized Geologic Map of the Conterminous United States ver. 1.2. USGS, Denver, CO. http://pubs.usgs.gov/atlas/geologic/48States/. Reeder AL, Foley GL, Nichols DK et al. (1998) Forms and prevalence of intersexuality and effects of environmental contaminants on sexuality in cricket frogs (Acris crepitans). Environmental Health Perspectives 106:261-266. Reeder AL, Ruiz MO, Pessier A et al. (2005) Intersexuality and the cricket frog decline: historic and geographic trends. Environmental Health Perspectives 113:261-265. Remington CL (1968) Suture-zones of hybrid interaction between recently joined biotas. Evolutionary Biology 2:321-428. Richards CM (2000) Inbreeding depression and genetic rescue in a plant metapopulation. American Naturalist 155:383-394. Richmond GM, Fullerton DS (1986) Summation of Quaternary glaciations in the United States of America. Pp. 183-196 in: Quaternary Glaciations in the Northern Hemisphere (eds. Sibrava V, Bowen DQ, Richmond GM). Pergamon Press, Oxford. Rickard A, Sonntag E (2006) Blanchard's cricket frog (Acris crepitans blanchardi) morphological abnormalities in southeast Michigan. Endangered Species Update Oct Dec: 131-135. Rius M, Pascual M, Turon X (2008) Phylogeography of the widespread marine invader Microcosmus squamiger reveals high genetic diversity of introduced populations and non-independent colonizations. Diversity and Distributions 14:818-828. Rivero JA (1978) The Amphibians and Reptiles of Puerto Rico. Editorial Universitaria, Universidad de Puerto Rico, Mayaguez. 152 pp. Rivero JA, Mayorga H, Estremera E, Izquierdo I (1980) Sohre el Bufo lemur (Cope) (Amphibia, Bufonidae). Caribbean Journal of Science 15:33-40. Rogers AR, Harpending H (1992) Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution 9:552-569. Rohr JR, Raffel TR, Romansic JM, McCallum H, Hudson PJ (2008) Evaluating the links between climate, disease spread, and amphibian declines. Proceedings of the National Academy of Sciences 105:17436-17441. Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572-1574. Rose FL, Simpson TR, Forstner MRJ, McHenry DJ, Williams J (2006) Taxonomic status of Acris gryllus paludicola: in search of the pink frog. Journal of Herpetology 40:428- 434. Rowe G, Beebee TJC, Burke T (1998) Phylogeography of the natterjack toad Bufo calamita in Britain: genetic differentiation of native and translocated populations. Molecular Ecology 7:751-760. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 191 - Rowe G, Beebee TJC, Burke T (1999) Microsatellite heterozygosity, fitness and demography in natterjack toads Bufo calamita. Animal Conservation 2:85-92. Rowe G, Harris DJ, Beebee TJC (2006) Lusitania revisited: A phylogeographic analysis of the natterjack toad Bufo calamita across its entire biogeographical range. Molecular Phylogenetics and Evolution 39:335-346. Ruokonen M, Kvist L, Tegelstroem H, Lumme J (2000) Goose hybrids, captive breeding and restocking of the Fennoscandian populations of the lesser white-fronted goose (Anser erythropus). Conservation Genetics 1:277-283. Russell RW, Lipps GJ, Hecnar SJ, Haffner GD (2002) Persistent organic pollutants in Blanchard's cricket frogs (Acris crepitans blanchardi) from Ohio. Ohio Journal of Science 102: 119-122. Ryan MJ, Wilczynski W (1988) Coevolution of sender and receiver: Effect on local mate preference in cricket frogs. Science 240: 1786-1788. Ryan MJ, Cocroft RB, Wilczynski W (1990) The role of environmental selection in intraspecific divergence of mate recognition signals in the cricket frog, A eris crepitans. Evolution 44: 1869-1872. Ryan MJ, Wilczynski W (1991) Evolution of intraspecific variation in the advertisement call of a cricket frog (Acris crepitans, Hylidae). Biological Journal of the Linnean Society 44:249-271. Ryan MJ, Perrill SA, Wilczynski W (1992) Auditory tuning and call frequency predict population-based mating preferences in the cricket frog, Acris crepitans. American Naturalist 139:1370-1383. Ryan MJ, Rand AS, Weight LA (1996) Allozyme and advertisement call variation in the tungara frog, Physalaemus pustulosus. Evolution 50:2435-2453. Salthe SN, Nevo E (1969) Geographic variation oflactate dehydrogenase in the cricket frog, Acris crepitans. Biochemical Genetics 3:335-341. Saucier RT (1994) Geomorphology and quaternary geologic history of the lower Mississippi Valley. Mississippi River Commission, US Army Corps of Engineers, Vicksburg, MS. Schelly R, Salzburger W, Koblmuller S, Duftner N, Sturmbauer C (2006) Phylogenetic relationships ofthe lamprologine cichlid genus Lepidiolamprologus (Teleostei: Perciformes) based on mitochondrial and nuclear sequences, suggesting introgressive hybridization. Molecular Phylogenetics and Evolution 38:426-438. Schiesari L, Zuanon J, Azevedo-Ramos C et al. (2003) Macrophyte rafts as dispersal vectors for fishes and amphibians in the Lower Solimoes River, Central Amazon. Journal of Tropical Ecology 19:333-336. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 192 - Schmidt KP (1928) Scientific Survey of Porto Rico and the Virgin Islands. New York Academy of Sciences, New York. Schneider S, Excoffier L (1999) Estimation of past demographic parameters from the distribution of pairwise differences when the mutation rates vary among sites: application to human mitochondrial DNA. Genetics 152: 1079-1089. Schwartz A, Thomas R (1975) A Check-List of West Indian Amphibian and Reptiles. Carnegie Museum of natural History, Pittsburgh. 216 pp. Schwartz A, Henderson RW (1991) Amphibians and reptiles of the West Indies: Descriptions, distributions, and natural history. University of Florida Press, Gainesville, FL. 720 pp. Schwartz MK, Tallmon DA, Luikart G (1998) Review of DNA-based census and effective population size estimators. Animal Conservation 1:293-299. Schwartz MK, Luikart G, Waples RS (2007) Genetic monitoring as a promising tool for conservation and management. Trends in Ecology and Evolution 22:25-33. Seddon PJ, Armstrong DP, Maloney RF (2007) Developing the science ofreintroduction biology. Conservation Biology 21:303-312. Seibert EA, Lillywhite HB, Wassersug RJ (1974) Cranial coossification in frogs: relationship to rate of evaporative water loss. Physiological Zoology 47:261-265. Seigel RA, Dodd CK (2002) Translocations of amphibians: Proven management method or experimental technique? Conservation Biology 16:552-554. Shaffer HB, McKnight ML (1996) The polytypic species revisited: genetic differentiation and molecular phylogenetics of the tiger salamander Ambystoma tigrinum (Amphibia: Caudata) complex. Evolution 50:417-433. Shaffer HB, Fellers GM, Magee A, Voss SR (2000) The genetics of amphibian declines: population substructure and molecular differentiation in the Yosemite Toad, Bufo canorus (Anura, Bufonidae) based on single-strand conformation polymorphism analysis (SSCP) and mitochondrial DNA sequence data. Molecular Ecology 9:245- 257. Shaffer HB, Fellers GM, Voss SR, Oliver JC, Pauly GB (2004a) Species boundaries, phylogeography and conservation genetics of the red-legged frog (Rana aurora/draytonii) complex. Molecular Ecology 13:2667-2677. Shaffer HB, Pauly GB, Oliver JC, Trenham PC (2004b) The molecular phylogenetics of endangerment: cryptic variation and historical phylogeography of the California tiger salamander, Ambystoma californiense. Molecular Ecology 13:3033-3049. Shogren JF, Tschirhart J, Anderson T, et al. (2001) Why economics matters for endangered species protection. Conservation Biology 13:1257-1261. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 193 - Shuster SM, Miller MP, Lang BK et al. (2005) The effects of controlled propagation on an endangered species: genetic differentiation and divergence in body size among native and captive populations of the Socorro Isopod (Crustacea: Flabellifera). Conservation Genetics 6:355-368. Siddle HV, Kreiss A, Eldridge MOB et al. (2007) Transmission of a fatal clonal tumor by biting occurs due to depleted MHC diversity in a threatened carnivorous marsupial. Proceedings of the National Academy of Sciences 104:16221-16226. Skelly DK, Yurewicz KL, Werner EE, Relyea RA (2003) Estimating decline and distributional change in amphibians. Conservation Biology 17:744-751. Smith GR, Todd A, Rettig JE, Nelson F (2003) Microhabitat selection by northern cricket frogs (Acris crepitans) along a west-central Missouri creek: Field and experimental observations. Journal of Herpetology 37:383-385. Smith HM, Goebel AM (1994) The proper spelling and dates for certain names associated with the endemic West Indian genus of toads (Amphibia: Bufonidae). Herpetological Review 25:49-50. Smith MA, Green DM (2004) Phylogeography of Bufo fowleri at its northern range limit. Molecular Ecology 13:3723-3733. Smith MA, Green DM (2005) Dispersal and the metapopulation paradigm in amphibian ecology and conservation: are all amphibian populations metapopulations? Ecography 28:110-128. Smith MA, Green DM (2006) Sex, isolation and fidelity: unbiased long-distance dispersal in a terrestrial amphibian. Ecography 29:649-658. Sodhi NS, Bickford D, Diesmos AC et al. (2008) Measuring the meltdown: drivers of global amphibian extinction and decline. PLoS ONE 3:e1636. Soltis DE, Morris AB, McLachlan JS, Mano PS, Soltis PS (2006) Comparative phylogeography ofunglaciated eastern North America. Molecular Ecology 15:4261- 4293. Soltis PS, Gitzendanner MA ( 1999) Molecular systematics and the conservation of rare species. Conservation Biology 13:471-483. Song SJ, M'Gonigle RM (2002) Science, power, and system dynamics: the political economy of conservation biology. Conservation Biology 15:980-989. Sparling DW, Lowe TP, Day D, Dolan K (1995) Responses of amphibian populations to water and soil factors in experimentally-treated aquatic macrocosms. Archives of Environmental Contamination and Toxicology 29:455-461. Starkey DE, Shaffer HB, Burke RL et al. (2003) Molecular systematics, phylogeography, and the effects of Pleistocene glaciation in the painted turtle (Chrysemys picta) complex. Evolution 57:119-128. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 194 - Steiner S, Lehtinen RM (2008) Occurrence of the amphibian pathogen Batrachochytrium dendrobatidis in Blanchard's cricket frog (Acris crepitans blanchardi) in the U.S. Midwest. Herpetological Review 39: 193-196. Stejneger L ( 1902) The herpetology of Porto Rico. Pp. 549-724 in: Report of US National Museum. Stiff BJ, Hansel AK (2004) Quaternary glaciations in Illinois. Pp. 71-81 in: Quaternary Glaciations - Extent and Chronology, Part II: North America (eds. Ehlers J, Gibbard PL). Elsevier, Amsterdam. Storfer A, Murphy MA, Evans JS et al. (2007) Putting the "landscape" in landscape genetics. Heredity 98: 128-142. Stuart BL, Inger RF, Voris HK (2006) High level of cryptic species diversity revealed by sympatric lineages of Southeast Asian forest frogs. Biology Letters 2:470-474. Stuart SN, Chanson JS, Cox NA et al. (2004) Status and trends of amphibian declines and extinctions worldwide. Science 306: 1783-1786. Swenson NG, Howard DJ (2005) Clustering of contact zones, hybrid zones, and phylogeographic breaks in North America. American Naturalist 166:581-591. Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595. Tallmon DA, Luikart G, Waples RS (2004) The alluring simplicity and complex reality of genetic rescue. Trends in Ecology and Evolution 19:489-496. Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10:512-526. Tarr CL, Fleischer RC (1999) Population boundaries and genetic diversity in the endangered Mariana crow (Corvus kubaryi). Molecular Ecology 8:941-949. Tautz D, Arctander P, Minelli A, Thomas RH, Vogler AP (2003) A plea for DNA taxonomy. Trends in Ecology and Evolution 18:70-74. Tennessen JA, Zamudio KR (2003) Early male reproductive advantage, multiple paternity and sperm storage in an amphibian aggregate breeder. Molecular Ecology 12:1567-1576. Teplitsky C, Mills JA, Alho JS, Yarrall JW, Merila J (2008) Bergmann's rule and climate change revisited: Disentangling environmental and genetic responses in a wild bird population. Proceedings of the National Academy of Sciences 105: 13492-13496. Theodorakis CW, Rinchard J, Carr JA et al. (2006) Thyroid endocrine disruption in stonerollers and cricket frogs from perchlorate-contaminated streams in east-central Texas. Ecotoxicology 15:31-50. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 195 - Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CL UST AL_x windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25:4876-4882. Thornbury WD (1965) Regional Geomorphology of the United States. John Wiley and Sons, Inc, New York. Trapnell DW, Schmidt JP, Quintana-Ascencio PF, Hamrick JL (2007) Genetic insights into the biogeography of the southeastern North American endemic, Ceratiola ericoides (Empetraceae). Journal of Heredity 98:587-593. Trauth SE, Robison HW, Plummer MV (2004) The Amphibians and Reptiles of Arkansas. University of Arkansas Press, Fayetville, AR. 440 pp. Trenham PC, Marsh DM (2002) Amphibian translocation programs: Reply to Seigel and Dodd. Conservation Biology 16:555-556. USFWS (1992) Recovery plan for the Puerto Rican crested toad (Peltophryne lemur). U.S. Fish and Wildlife Service, Southeast Region, Atlanta, Georgia. Van Gorp CD (2001) Changes in the distribution of A eris crepitans blanchardi, with studies of nesting microhabitat and the possible impact ofultraviolet-B radiation. Unpublished M.A. dissertation. Drake University. Van Oosterhout C, Weetman D, Hutchinson WF (2006) Estimation and adjustment of microsatellite null alleles in nonequilibrium populations. Molecular Ecology Notes 6:255-256. Vandergast AG, Bohonak AJ, Hathaway SA, Boys J, Fisher RN (2008) Are hotspots of evolutionary potential adequately protected in southern California? Biological Conservation 141: 1648-1664. Vandewoestijne S, Schtickzelle N, Baguette M (2008) Positive correlation between genetic diversity and fitness in a large, well-connected metapopulation. BMC Biology 6:46. Veldman RB (1997) Trend toward extinction of the cricket frog (Acris crepitans): prediction of declines using field data and the Vortex simulation program. Unpublished M.Sc. dissertation. Illinois State University. Vianna JA, Bonde RK, Caballero S et al. (2006) Phylogeography, phylogeny and hybridization in trichechid sirenians: implications for manatee conservation. Molecular Ecology 15:433-447. Vieites DR, Min MS, Wake DB (2007) Rapid diversification and dispersal during periods of global warming by plethodontid salamanders. Proceedings of the National Academy of Sciences 104: 19903-19907. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 196 - Vila C, Sundqvist A-K, Flagstad O et al. (2003) Rescue of a severely bottlenecked wolf (Canis lupus) population by a single immigrant. Proceedings of the Royal Society of London B 270:91-97. Viosca PA (1923) An ecological study of the cold-blooded vertebrates of southeastern Louisiana. Copeia 1923:35-44. Viosca PA ( 1944) Distribution of certain cold-blooded animals in Louisiana in relationship to the geology and physiography of the state. Proceedings of the Louisiana Academy of Sciences 8:4 7-62. Volis S, Mendlinger S, Olsvig-Whittaker L, Safriel UN, Orlovsky N (1998) Phenotypic variation and stress resistance in core and peripheral populations of Hordeum spontaneum. Biodiversity and Conservation 7:799-813. Vredenburg VT, Bingham R, Knapp R et al. (2007) Concordant molecular and phenotypic data delineate new taxonomy and conservation priorities for the endangered mountain yellow-legged frog. Journal of Zoology 271:361-374. Wake DB, Vredenburg V (2008) Are we in the midst of the sixth mass extinction? A view from the world of amphibians. Proceedings of the National Academy of Sciences 105:11466-11473. Wagner AP, Creel S, Kalinowski ST (2006) Estimating relatedness and relationships using microsatellite loci with null alleles. Heredity 97:336-345. Waldick RC, Kraus S, Brown M, White BN (2002) Evaluating the effects of historic bottleneck events: an assessment of microsatellite variability in the endangered, North Atlantic right whale. Molecular Ecology 11:2241-2249. Waldman B, Rice JE, Honeycutt RL (1992) Kin recognition and incest avoidance in toads. American Zoologist 32: 18-30. Wang JY, Chou LS, White BN (1999) Mitochondrial DNA analysis of sympatric morphotypes ofbottlenose dolphins (genus: Tursiops) in Chinese waters. Molecular Ecology 8:1603-1612. Wang JY, Frasier TR, Yang SC, White BN (2008) Detecting recent speciation events: the case of the finless porpoise (genus Neophocaena). Heredity 101:145-155. Ward R, Rutledge CJ, Zimmerman EG (1987) Genetic variation and population subdivision in the cricket frog Acris crepitans. Biochemical Systematics and Ecology 15:377-384. Webb SD (1990) Historical Biogeography. Pp. 70-100 in: Ecosystems of Florida (eds. Myers RL, Ewel JJ). University of Central Florida Press, Orlando. Weber JL, Wong C (1993) Mutation of human short tandem repeats. Human Molecular Genetics 2:1123-1128. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 197 - Weir BS, Cockerham CC (1984) Estimating F-statistics for the analysis of population structure. Evolution 38:1358-1370. Westemeier RL, Brawn JD, Simpson SA et al. (1998) Tracking the long-term decline and recovery of an isolated population. Science 282: 1695-1698. Whitehouse AM, Harley EH (2001) Post-bottleneck genetic diversity of elephant populations in South Africa, revealed using microsatellite analysis. Molecular Ecology 10:2139-2149. WI DNR (2005) Wisconsin's Strategy for Wildlife Species of Greatest Conservation Need. Wisconsin Department of Natural Resources, Madison, WI. Widder PD, Bidwell JR (2008) Tadpole size, cholinesterase activity, and swim speed in four frog species after exposure to sub-lethal concentrations of chlorpyrifos. Aquatic Toxicology 88:9-18. Wiens JJ, Graham CH, Moen DS, Smith SA, Reeder TW (2006) Evolutionary and ecological causes of the latitudinal diversity gradient in hylid frogs: treefrog trees unearth the roots of high tropical diversity. The American Naturalist 168:579-596. Wilczynski W, Keddy-Hector AC, Ryan MJ (1992) Call patterns and basilar papilla tuning in cricket frogs. 1. Differences among populations and between sexes. Brain, Behavior and Evolution 39:229-237. Williams DA, Muchugu E, Overholt WA, Cuda JP (2007) Colonization patterns of the invasive Brazilian peppertree, Schinus terebinthifolius, in Florida. Heredity 98:284- 293. Wilson GA, Fulton TL, Kendell Ket al. (2008) Genetic diversity and structure in Canadian northern leopard frog (Rana pipiens) populations: implications for reintroduction programs. Canadian Journal of Zoology 86:863-874. Wilson PJ, Grewal S, Lawford ID, et al. (2000) DNA profiles of the eastern Canadian wolf and the red wolf provide evidence for a common evolutionary history independent of the gray wolf. Canadian Journal of Zoology 78:2156-2166. Wright S (1951) The genetical structure of populations. Annals of Eugenics 15:323-354. Wu H, Wan QH, Fang SG, Zhang SY (2005) Application of mitochondrial DNA sequence analysis in the forensic identification of Chinese sika deer subspecies. Forensic Science International 148:101-105. Wycherley J, Doran S, Beebee TJC (2002) Frog calls echo microsatellite phylogeography in the European pool frog (Rana lessonae). Journal of Zoology 258:479-484. Wyman RL (1990) What's happening to the amphibians? Conservation Biology 4:350- 352. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 198 - Wyner YM, Amato G, Desalle R (1999) Captive breeding, reintroduction, and the conservation genetics of black and white ruffed lemurs, Varecia variegata variegata. Molecular Ecology 8:S107-Sl 15. Zamudio KR, Savage WK (2003) Historical isolation, range expansion, and secondary contact of two highly divergent mitochondrial lineages in spotted salamanders (Ambystoma maculatum ). Evolution 57: 1631-1652. Zamudio KR, Wieczorek AM (2007) Fine-scale spatial genetic structure and dispersal among spotted salamander (Ambystoma maculatum) breeding populations. Molecular Ecology 16:257-274. Zeisset I, Beebee T (2001) Determination of biogeographical range: an application of molecular phylogeography to the European pool frog Rana lessonae. Proceedings of the National Academy of Sciences 268:933-938. Zeisset I, Beebee TJC (2008) Amphibian phylogeography: a model for understanding historical aspects of species distributions. Heredity 101: 101-119. Zink RM, Barrowclough GF, Atwood JL, Blackwell-Rago RC (2000) Genetics, taxonomy, and conservation of the threatened California gnatcatcher. Conservation Biology 14:1394-1405. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. haplotype(s) Appendix mitochondrial Delaware Arkansas Arkansas Arkansas Arkansas Delaware Arkansas Arkansas Alabama Alabama Alabama Arkansas Arkansas Georgia Georgia Georgia Georgia Florida Florida Florida Florida Florida Illinois Illinois Illinois State 1. observed, Details DNA (Abl of nucleotide sample New Tuscaloosa Tallapoosa Champaign Santa Covington = Effingham Columbia Lafayette Sebastian Franklin Gadsden Garland County Monroe Putnam Benton Liberty Greene Collier Fulton A. Brown Taylor Baker Stone Kent blanchardi; Castle Rosa collection diversity sites Acr (nn; 14 20 N 22 10 5 3 2 2 3 2 6 5 3 1 5 2 9 4 1 4 5 2 1 8 5 = (counties) for A. sites crepitans; with> 221,223,224,225,226 207,242-244,247,248 for 207,208,209,210 175,207, 54,59,63,81,94 205,221,222 89,90,91,92 A 202, 207,249,250 225, 25, Ha£lotypes Agr eris 1 174,200 245,246 174, 176, 1, 98,99 96,97 73,99 individual), 100, 1, 211-220 172 173 251-253 66-69 = 93 36 specimens. 1 45 A. 227-241 175 177 101 gryllus), species The and number coordinates present 0.0033 0.0028 0.0063 0.0064 0.0125 0.0106 0.0042 0.0159 0.0042 0.0059 0.0229 0.0273 0.0014 0.0041 0.0063 0.0031 0.0013 0.007 0.027 0.004 n/a n/a n/a 7l"n of 0 based 0 individuals in on Acr/Agr decimal Species Agr Agr Acr Abl Abl Abl Abl Agr Abl Abl Abl Agr Abl Acr Acr Agr Agr Agr Agr Acr Acr Abl Abl Abl phylogenetic (N), degrees Latitude 32.8501 33.2356 36.3542 33.2494 35.4776 33.2723 35.2939 35.8741 34.5453 30.2875 26.1551 39.0927 39.6956 30.6141 33.5623 31.8095 30.6033 40.1368 32.5499 33.0324 39.9503 39.0697 31.251 36.355 29.598 mitochondrial analysis are provided. Longitude -85.83501 -87.51169 -75.56027 -82.23627 -75.61171 -81.67131 -84.61833 -87.02181 -83.15764 -81.75851 -84.22702 -83.91935 -86.4162 -93.2298 -93.8845 -91.7293 -94.2468 -93.5631 -94.3518 -92.1699 -93.0759 -81.5388 -90.7402 -88.2168 -88.5923 of - 199 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Indiana Indiana Indiana Indiana Indiana Indiana Indiana Indiana Illinois Illinois Kansas Kansas Kansas Kansas Kansas Kansas Kansas Kansas Kansas Kansas Kansas Kansas Kansas Iowa Iowa Iowa Iowa Iowa Iowa Iowa Leavenworth Washington Woodbury Anderson Cherokee Jennings Madison Atchison Jefferson Bourbon Monona Douglas Marion Greene Marion Cowley Harvey Marion Brown Henry White Kiowa Posey Parke Lake Story Gove Linn Pike Polk 21 9 5 5 3 5 5 4 5 5 9 4 3 3 2 3 7 2 2 1 3 2 3 1 1 1 1 1 1 1 1, 1, 1,5,6,45 178, 36, 12, 50, 25,36 1, 20,21 1, 1, 1, 1, 1, 1, 22 23 23 24 25 54 6, 1 3-7 1 1 1 1 1 1 1 1 1 42 41 14 70-72 83 13, 20 51 179 7 14 0.0022 0.0025 0.0049 0.0013 0.0013 0.0014 0.0017 0.0038 0.0028 0.0035 0.0021 0.0167 0.0063 0.025 n/a n/a n/a n/a n/a n/a n/a n/a 0 0 0 0 0 0 0 0 Abl Abl Abl Abl Abl Abl Abl Abl Abl Acr Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl 38.1041 41.5296 39.0008 38.8125 39.0515 39.7638 39.7928 38.5896 42.0504 40.9824 38.0259 42.0242 41.3256 42.4385 41.6279 39.5431 39.8131 38.2148 37.8561 37.1421 37.2362 39.2344 38.9907 38.0428 37.5793 39.2267 38.3385 38.412 38.927 42.03 -86.09681 -85.6268 -90.0188 -88.1801 -87.0374 -87.2192 -87.3953 -86.1418 -87.2371 -87.8488 -91.5428 -93.0692 -95.9537 -93.6309 -91.6306 -95.2527 -93.5287 -96.2331 -95.5627 -95.2833 -94.7869 -94.7874 -97.4085 -96.9436 -99.2578 -100.475 -94.9798 -97.0861 -95.256 -95.391 - 200 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Louisiana Louisiana Louisiana Kentucky Kentucky Kentucky Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana oiin Jefferson Louisiana Louisiana Louisiana Kansas Kansas Kansas Kansas Kansas Kansas Kansas Kansas Kansas Kansas East Pointe Pottawatomie East Montgomery Natchitoches Washington Wabaunsee Evangeline Henderson Ascension Livingston Avoyelles Calcasieu Shawnee Bienville Cameron Bracken Wallace Pawnee Iberville Baton La Bossier Morris Miami Meade Osage Allen Grant Feliciana Salle Coupee Rouge 3 3 5 5 1 1 4 5 2 2 7 1 1 1 9 1 3 1 5 2 7 5 1 4 1 8 1 5 1 1 114, 114, 127, 202,251,255-257,274 107-10~ 119, 3,15 4,16 160, 156, 143, 135, 134, 129,149,152,153 18, 118, 132, 157, 158, 157, 132, 263, 25,46,47 25,28,53 19, 1, 1,27,28 104, 129, 147, 112, 145-149 120-122, 22,24 15, 127,128,162 181 119 112 133 113 106 26 275-277 54 23, 55 27 1 1 130 105 151 142 180 52, 131 54 159, 164 161 0.0167 0.0013 0.0167 0.0117 0.0608 0.0063 0.0165 0.0356 0.0201 0.0196 0.0158 0.0188 0.0176 0.0133 0.0159 0.013 0.007 0.02 n/a n/a n/a n/a n/a n/a n/a n/a n/a n/a n/a n/a Abl/Acr Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Abl Acr Ahl Ahl Ahl Ahl Agr Ahl Ahl Ahl Ahl Ahl Ahl Agr Ahl Ahl Ahl Ahl Ahl 38.5685 37.1481 38.7032 38.6398 38.1754 39.3366 39.0392 38.9747 38.8998 39.7771 37.8026 37.9489 31.0541 32.3934 30.6537 29.8732 30.4801 32.5946 30.2038 30.2374 31.5832 30.8382 30.6873 30.2752 31.7298 29.9352 30.4739 31.7298 30.6472 38.731 -86.13037 -93.29176 -92.05937 -93.04347 -91.11965 -93.65335 -90.94097 -91.07849 -93.21489 -92.56922 -92.37796 -91.28719 -92.18556 -90.80364 -93.09522 -91.53067 -95.7011 -95.7274 -94.8513 -99.2075 -96.3059 -96.6403 -95.7103 -96.2024 -101.758 -97.0772 -84.0809 -87.5681 -92.8218 -90.1514 - 201 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Mississippi Mississippi Mississippi Mississippi Mississippi Mississippi Mississippi Mississippi Mississippi Mississippi Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Louisiana Maryland Maryland Maryland Michigan Michigan Missouri Missouri St. West St. John Washington Tangipahoa St. Tishomingo Washtenaw Vermillion St. St. St. St. Wilkinson Lenawee Rapides Hancock Fredrick Webster Caldwell Harrison Grenada Charles Tammany Carroll Greene Forrest Union Perry Charles Helena Cole Martin Tate Feliciana Mary's James the Baptist 14 20 3 3 6 2 1 2 1 9 3 1 6 6 4 7 1 5 9 1 5 2 6 4 3 5 1 3 1 1 255,258,261,265-267,278,279,281 163,202,259,260,264,268-273 111, 105,123,124,137,150,155 110,111,112,116,117 260,262,284,296-298 141, 1, 107, 202,282,283 262, 256,300,301 278, 41, 262,268 136, 143, 125,126 102, 172, 202,282 202-204 280 115 138, 140 183 202 165 299 289-295 285-288 166-168 13 1 1 1 137 144, 154, 144, 103 182 139 155 0.0237 0.0167 0.0143 0.0083 0.0125 0.0347 0.0105 0.0109 0.0129 0.0191 0.0014 0.0158 0.0094 0.0125 0.0094 0.0042 0.009 0.018 0.01 n/a n/a n/a n/a n/a n/a n/a n/a 0 0 0 Abl/Agr Agr Ahl Ahl Agr Ahl Ahl Ahl Agr Ahl Ahl Acr Ahl Ahl Acr Agr Ahl Agr Ahl Agr Ahl Agr Ahl Agr Agr Agr Agr Agr Ahl Ahl 29.9424 31.2621 30.8136 30.0247 30.0652 30.6074 30.1863 30.3984 32.8074 32.7292 30.8297 38.5221 30.8675 41.9176 39.4637 42.2603 38.2939 33.4598 31.2171 30.3581 30.4279 34.7289 31.2146 34.6447 31.1756 39.6593 29.962 31.263 33.775 38.54 -92.47659 -90.39639 -90.72945 -90.75803 -91.78212 -90.53133 -90.46295 -92.38723 -89.93062 -92.22191 -91.38578 -89.97935 -76.97227 -77.41393 -76.59763 -88.63965 -89.90714 -89.27621 -89.46246 -89.80345 -88.99095 -89.07954 -88.24274 -89.96467 -91.26623 -93.3432 -84.0659 -83.7595 -92.2407 -93.979 - 202 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. North North North North North North North North New Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Missouri Missouri Missouri Missouri Missouri Missouri Missouri Missouri Missouri Ohio Ohio Ohio Ohio Ohio Ohio Carolina Carolina Carolina Carolina Carolina Carolina Carolina Carolina Jersey New Mecklenburg Washington Cape Nodaway Crawford Reynolds Jefferson Auglaize Johnson Jackson Durham Pawnee Pulaski Greene Clinton Gaston Wayne Adams Greene Moore Fulton Cedar Butler Gates Knox Rock Linn Cass Ray Hanover May 13 17 4 4 5 4 2 5 3 5 5 2 4 2 4 1 4 7 1 1 1 5 1 5 1 5 5 3 5 5 172,187,310,311,312,313,316 188,311,314,316, 311,314,315 1,20,36,80 33,36,44 25,33,34 25,37,38 1, 186,187 172,205 184, 302-305 306-309 1, 1, 1, 1, 35, 184 18 18 18 18 1 1 1 1 1 188 1 1 1 23 39 40 185 36 · 317,318 0.0054 0.0042 0.0033 0.0153 0.0021 0.0113 0.0125 0.0042 0.0618 0.0985 0.0084 0.0038 0.0426 0.0241 0.0834 0.0358 0.0012 n/a n/a n/a n/a n/a n/a 0 0 0 0 0 0 0 Acr/Agr Acr/Agr Acr/Agr Abl/Acr Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Abl Acr Agr Acr Agr Acr Agr Abl Abl Abl Abl Abl 37.2163 40.3597 38.0252 40.9365 42.6053 38.7455 39.8331 40.1386 37.8465 42.5071 39.3211 37.3658 42.6292 39.0881 35.9983 35.2845 36.4499 35.2318 35.2378 40.5472 35.8553 35.3647 38.8464 41.5966 34.2024 39.4279 39.4191 39.7126 39.024 40.162 -81.16645 -78.90036 -80.83086 -79.45015 -76.61634 -77.99534 -77.89504 -91.3263 -93.3161 -94.8779 -94.4632 -93.7963 -93.0869 -92.1989 -94.0232 -96.2086 -96.0934 -97.2399 -97.1451 -97.8545 -90.9778 -99.4701 -74.7991 -84.5132 -83.8286 -83.5022 -84.2546 -84.1245 -83.9494 -76.743 - 203 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. South South South South South South South South Oklahoma Oklahoma Oklahoma Oklahoma Oklahoma Oklahoma Oklahoma Oklahoma Oklahoma Oklahoma Oklahoma Oklahoma Tennessee Tennessee Ohio Ohio Ohio Ohio Ohio Ohio Ohio Ohio Carolina Carolina Carolina Carolina Carolina Carolina Dakota Dakota Montgomery Cumberland Darlington Muskogee Hamilton Abbeville Cherokee Sequoyah Canadian Paulding Barnwell Wagoner Berkeley McNairy Yankton Leflore Warren Pickens Miami Marion Kiowa Custer Preble Lucas Logan Atoka Wood Roger Union Ellis 16 18 10 4 10 5 5 5 5 7 5 4 5 2 2 6 3 5 4 2 2 6 5 6 2 1 2 4 2 5 20,25,28,36,60,61 207,221, 22,22,57,64,65 174,176,192 172,193,201 22,62,63 57,58,86 20,36,59 334,335 203,206 336,337 194,197 188-191 22,87 59,95 20,22 23,32 54,56 1, 1, 22 81 19 1 1 1 1 1 1 1 19 2 319-335 0.0008 0.0167 0.0176 0.0251 0.0021 0.0125 0.0121 0.0125 0.0058 0.0167 0.0208 0.0101 0.0085 0.0146 0.0056 0.0004 0.0088 0.0104 0.0487 0.027 n/a 0 0 0 0 0 0 0 0 0 Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Ahl Agr Agr Ahl Acr Ahl Ahl Ahl Agr Agr Acr Acr Ahl Ahl Acr 41.6493 40.0593 41.1184 39.7503 39.1795 41.4051 39.4402 39.7439 35.5223 34.3821 35.8872 35.6015 35.8933 36.2681 34.9307 34.9764 35.4844 35.6866 34.2376 35.6702 33.3038 35.9705 42.8246 42.9604 33.1271 34.3295 34.1554 34.8288 35.1799 35.9462 -82.45252 -81.35233 -79.98064 -79.33633 -88.55074 -84.99825 -84.2186 -84.4938 -83.6085 -84.2426 -84.2218 -84.5863 -84.6372 -97.8963 -83.6104 -96.0861 -99.7953 -98.9964 -94.6778 -98.9202 -94.7889 -97.4429 -95.3671 -99.6673 -95.5448 -96.6576 -97.3853 -82.7015 -95.001 -79.978 - 204 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Tennessee Virginia Texas Texas Texas Texas Texas Texas Texas Texas Montgomery Charles McMullen Anderson Kendall Menard Bowie Travis Hood Wise City 30 11 4 4 2 1 8 1 1 1 8-11,30,48,84,85,88 169-171, 10, 49, 6 17, 16, 11,30, 195, 183, 43 79,82 30 29 31 196 73 74-78 198, 199 0.0059 0.0042 0.0042 0.0538 0.0144 0.013 n/a n/a n/a n/a Abl/Acr Acr Abl Abl Abl Abl Abl Abl Abl Abl 36.5106 31.7975 33.4381 28.3561 32.4323 30.8973 30.3218 33.2059 37.3449 29.898 -87.37043 -77.07161 -95.6299 -97.7962 -98.7308 -98.5378 -94.2502 -99.8102 -97.7698 -97.6743 - 205 - Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 206 - Appendix 2. Details of mitochondrial control region haplotypes found for A eris species. The number of occurrences, states in which they were found, and GenBank accession numbers are provided. Haplotype Number States GenBankNo. Acris blanchardi OH, IA, IL, IN, KS, AcrCR-1 226 EU828245 KY, MI, MO, NE, SD AcrCR-2 1 OH EU828246 AcrCR-3 1 IL EU828247 AcrCR-4 1 IL EU828248 AcrCR-5 6 IL,IN EU828249 AcrCR-6 6 IL,IN EU828250 AcrCR-7 3 IL,IN EU828251 AcrCR-8 2 TX EU828252 AcrCR-9 1 TX EU828253 AcrCR-10 7 TX EU828254 AcrCR-11 8 TX EU828255 AcrCR-12 1 IA EU828256 AcrCR-13 4 IA,MO EU828257 AcrCR-14 5 IA, IN EU828258 AcrCR-15 1 KY EU828259 AcrCR-16 2 TX EU828260 AcrCR-17 1 TX EU828261 AcrCR-18 5 KS,NE EU828262 AcrCR-19 20 KS,SD EU828263 AcrCR-20 9 KS,MO, OK EU828264 AcrCR-21 1 KS EU828265 AcrCR-22 15 KS,OK EU828266 AcrCR-23 8 KS,MO,OK EU828267 AcrCR-24 4 KS EU828268 AcrCR-25 8 KS, MO, OK, AR EU828269 AcrCR-26 1 KS EU828270 AcrCR-27 3 KS EU828271 AcrCR-28 3 KS,OK EU828272 AcrCR-29 1 TX EU828273 AcrCR-30 4 TX EU828274 AcrCR-31 1 TX EU828275 AcrCR-32 1 OK EU828276 AcrCR-33 3 MO EU828277 AcrCR-34 1 MO EU828278 AcrCR-35 1 MO EU828279 AcrCR-36 11 IL, KS, MO, OK, AR EU828280 AcrCR-37 1 MO EU828281 AcrCR-38 2 MO EU828282 AcrCR-39 1 MO EU828283 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 207 - AcrCR-40 3 OH EU828284 AcrCR-41 1 IN EU828285 AcrCR-42 1 IN EU828286 AcrCR-43 1 TX EU828287 AcrCR-44 2 MO EU828288 AcrCR-45 4 IN, IL EU828289 AcrCR-46 1 KS EU828290 AcrCR-47 1 KS EU828291 AcrCR-48 11 TX EU828292 AcrCR-49 2 TX EU828293 AcrCR-50 3 IN EU828294 AcrCR-51 2 IN EU828295 AcrCR-52 1 KS EU828296 AcrCR-53 1 KS EU828297 AcrCR-54 5 KS,OK,AR EU828298 AcrCR-55 1 KS EU828299 AcrCR-56 1 OK EU828300 AcrCR-57 2 OK EU828301 AcrCR-58 1 OK EU828302 AcrCR-59 4 OK,AR EU828303 AcrCR-60 1 OK EU828304 AcrCR-61 1 OK EU828305 AcrCR-62 1 OK EU828306 AcrCR-63 2 OK,AR EU828307 AcrCR-64 1 OK EU828308 AcrCR-65 1 OK EU828309 AcrCR-66 1 IL EU828310 AcrCR-67 1 IL EU828311 AcrCR-68 1 IL EU828312 AcrCR-69 1 IL EU828313 AcrCR-70 2 IL EU828314 AcrCR-71 2 IL EU828315 AcrCR-72 1 IL EU828316 AcrCR-73 2 TX,AR EU828317 AcrCR-74 1 TX EU828318 AcrCR-75 1 TX EU828319 AcrCR-76 2 TX EU828320 AcrCR-77 1 TX EU828321 AcrCR-78 1 TX EU828322 AcrCR-79 1 TX EU828323 AcrCR-80 1 MO EU828324 AcrCR-81 2 OK,AR EU828325 AcrCR-82 1 TX EU828326 AcrCR-83 1 KS EU828327 AcrCR-84 1 TX EU828328 AcrCR-85 1 TX EU828329 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 208 - AcrCR-86 1 OK EU828330 AcrCR-87 1 OK EU828331 AcrCR-88 1 TX EU828332 AcrCR-89 1 AR EU828333 AcrCR-90 2 AR EU828334 AcrCR-91 2 AR EU828335 AcrCR-92 1 AR EU828336 AcrCR-93 1 AR EU828337 AcrCR-94 1 AR EU828338 AcrCR-95 1 OK EU828339 AcrCR-96 1 AR EU828340 AcrCR-97 1 AR EU828341 AcrCR-98 1 AR EU828342 AcrCR-99 2 AR EU828343 AcrCR-100 1 AR EU828344 AcrCR-101 1 AR EU828345 AcrCR-102 1 LA FJ829506 AcrCR-103 1 LA FJ829507 AcrCR-104 1 LA FJ829508 AcrCR-105 2 LA FJ829509 AcrCR-106 1 LA FJ829510 AcrCR-107 2 LA FJ829511 AcrCR-108 1 LA FJ829512 AcrCR-109 2 LA FJ829513 AcrCR-110 2 LA FJ829514 AcrCR-111 2 LA FJ829515 AcrCR-112 3 LA FJ829516 AcrCR-113 1 LA FJ829517 AcrCR-114 2 LA FJ829518 AcrCR-115 1 LA FJ829519 AcrCR-116 1 LA FJ829520 AcrCR-117 1 LA FJ829521 AcrCR-118 1 LA FJ829522 AcrCR-119 2 LA FJ829523 AcrCR-120 1 LA FJ829524 AcrCR-121 1 LA FJ829525 AcrCR-122 1 LA FJ829526 AcrCR-123 1 LA FJ829527 AcrCR-124 1 LA FJ829528 AcrCR-125 2 LA FJ829529 AcrCR-126 1 LA FJ829530 AcrCR-127 2 LA FJ829531 AcrCR-128 1 LA FJ829532 AcrCR-129 2 LA FJ829533 AcrCR-130 1 LA FJ829534 AcrCR-131 1 LA FJ829535 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 209 - AcrCR-132 1 LA FJ829536 AcrCR-133 1 LA FJ829537 AcrCR-134 1 LA FJ829538 AcrCR-135 1 LA FJ829539 AcrCR-136 2 LA FJ829540 AcrCR-137 2 LA FJ829541 AcrCR-138 1 LA FJ829542 AcrCR-139 1 LA FJ829543 AcrCR-140 1 LA FJ829544 AcrCR-141 1 LA FJ829545 AcrCR-142 1 LA FJ829546 AcrCR-143 2 LA FJ829547 AcrCR-144 1 LA FJ829548 AcrCR-145 1 LA FJ829549 AcrCR-146 1 LA FJ829550 AcrCR-147 2 LA FJ829551 AcrCR-148 1 LA FJ829552 AcrCR-149 3 LA FJ829553 AcrCR-150 1 LA FJ829554 AcrCR-151 2 LA FJ829555 AcrCR-152 1 LA FJ829556 AcrCR-153 1 LA FJ829557 AcrCR-154 1 LA FJ829558 AcrCR-155 2 LA FJ829559 AcrCR-156 1 LA FJ829560 AcrCR-157 1 LA FJ829561 AcrCR-158 1 LA FJ829562 AcrCR-159 2 LA FJ829563 AcrCR-160 2 LA FJ829564 AcrCR-161 1 LA FJ829565 AcrCR-162 1 LA FJ829566 AcrCR-163 1 LA FJ829567 AcrCR-164 1 LA FJ829568 Acris crepitans AcrCR-165 1 MD FJ829569 AcrCR-166 1 MS FJ829570 AcrCR-167 1 MS FJ829571 AcrCR-168 1 MS FJ829572 AcrCR-169 1 VA FJ829573 AcrCR-170 1 VA FJ829574 AcrCR-171 1 VA FJ829575 AcrCR-172 14 SC, DE, NC, MD FJ829576 AcrCR-173 1 DE FJ829577 AcrCR-174 5 SC,GA,AL FJ829578 AcrCR-175 3 FL,GA FJ829579 AcrCR-176 2 GA,SC FJ829580 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 210 - AcrCR-177 1 GA FJ829581 AcrCR-178 3 IN FJ829582 AcrCR-179 2 IN FJ829583 AcrCR-180 2 KY FJ829584 AcrCR-181 1 KY FJ829585 AcrCR-182 2 MD FJ829586 AcrCR-183 2 MD,VA FJ829587 AcrCR-184 5 NC FJ829588 AcrCR-185 1 NC FJ829589 AcrCR-186 1 NJ FJ829590 AcrCR-187 2 NJ,NC FJ829591 AcrCR-188 4 OH,SC,NC FJ829592 AcrCR-189 1 SC FJ829593 AcrCR-190 1 SC FJ829594 AcrCR-191 1 SC FJ829595 AcrCR-192 2 SC FJ829596 AcrCR-193 2 SC FJ829597 AcrCR-194 2 TN FJ829598 AcrCR-195 1 TN FJ829599 AcrCR-196 1 TN FJ829600 AcrCR-197 2 TN FJ829601 AcrCR-198 3 VA FJ829602 AcrCR-199 1 VA FJ829603 AcrCR-200 2 AL FJ829604 AcrCR-201 2 SC FJ829605 Acris gryllus AcrCR-202 14 MS,AL,LA FJ829606 AcrCR-203 2 MS,TN FJ829607 AcrCR-204 1 MS FJ829608 AcrCR-205 2 NC,FL FJ829609 AcrCR-206 1 TN FJ829610 AcrCR-207 11 AL, FL, GA, SC FJ829611 AcrCR-208 1 AL FJ829612 AcrCR-209 1 AL FJ829613 AcrCR-210 1 AL FJ829614 AcrCR-211 1 AL FJ829615 AcrCR-212 1 AL FJ829616 AcrCR-213 2 AL FJ829617 AcrCR-214 1 AL FJ829618 AcrCR-215 1 AL FJ829619 AcrCR-216 1 AL FJ829620 AcrCR-217 1 AL FJ829621 AcrCR-218 1 AL FJ829622 AcrCR-219 1 AL FJ829623 AcrCR-220 1 AL FJ829624 AcrCR-221 4 FL,SC FJ829625 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 211 - AcrCR-222 1 FL FJ829626 AcrCR-223 1 FL FJ829627 AcrCR-224 1 FL FJ829628 AcrCR-225 6 FL,GA FJ829629 AcrCR-226 1 FL FJ829630 AcrCR-227 1 FL FJ829631 AcrCR-228 2 FL FJ829632 AcrCR-229 1 FL FJ829633 AcrCR-230 1 FL FJ829634 AcrCR-231 1 FL FJ829635 AcrCR-232 1 FL FJ829636 AcrCR-233 1 FL FJ829637 AcrCR-234 1 FL FJ829638 AcrCR-235 1 FL FJ829639 AcrCR-236 1 FL FJ829640 AcrCR-237 1 FL FJ829641 AcrCR-238 1 FL FJ829642 AcrCR-239 1 FL FJ829643 AcrCR-240 1 FL FJ829644 AcrCR-241 1 FL FJ829645 AcrCR-242 1 FL FJ829646 AcrCR-243 1 FL FJ829647 AcrCR-244 2 FL FJ829648 AcrCR-245 1 FL FJ829649 AcrCR-246 1 FL FJ829650 AcrCR-247 1 FL FJ829651 AcrCR-248 1 FL FJ829652 AcrCR-249 1 GA FJ829653 AcrCR-250 1 GA FJ829654 AcrCR-251 3 GA FJ829655 AcrCR-252 1 GA FJ829656 AcrCR-253 1 GA FJ829657 AcrCR-254 1 LA FJ829658 AcrCR-255 3 LA FJ829659 AcrCR-256 2 LA,MS FJ829660 AcrCR-257 1 LA FJ829661 AcrCR-258 1 LA FJ829662 AcrCR-259 2 LA FJ829663 AcrCR-260 2 LA,MS FJ829664 AcrCR-261 1 LA FJ829665 AcrCR-262 3 LA,MS FJ829666 AcrCR-263 1 LA FJ829667 AcrCR-264 1 LA FJ829668 AcrCR-265 1 LA FJ829669 AcrCR-266 1 LA FJ829670 AcrCR-267 1 LA FJ829671 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 212 - AcrCR-268 2 LA FJ829672 AcrCR-269 1 LA FJ829673 AcrCR-270 1 LA FJ829674 AcrCR-271 1 LA FJ829675 AcrCR-272 1 LA FJ829676 AcrCR-273 1 LA FJ829677 AcrCR-274 1 LA FJ829678 AcrCR-275 1 LA FJ829679 AcrCR-276 1 LA FJ829680 AcrCR-277 1 LA FJ829681 AcrCR-278 3 LA,MS FJ829682 AcrCR-279 1 LA FJ829683 AcrCR-280 1 LA FJ829684 AcrCR-281 1 LA FJ829685 AcrCR-282 2 MS FJ829686 AcrCR-283 1 MS FJ829687 AcrCR-284 1 MS FJ829688 AcrCR-285 1 MS FJ829689 AcrCR-286 1 MS FJ829690 AcrCR-287 1 MS FJ829691 AcrCR-288 1 MS FJ829692 AcrCR-289 1 MS FJ829693 AcrCR-290 1 MS FJ829694 AcrCR-291 1 MS FJ829695 AcrCR-292 1 MS FJ829696 AcrCR-293 1 MS FJ829697 AcrCR-294 1 MS FJ829698 AcrCR-295 1 MS FJ829699 AcrCR-296 1 MS FJ829700 AcrCR-297 1 MS FJ829701 AcrCR-298 1 MS FJ829702 AcrCR-299 1 MS FJ829703 AcrCR-300 1 MS FJ829704 AcrCR-301 1 MS FJ829705 AcrCR-302 1 NC FJ829706 AcrCR-303 1 NC FJ829707 AcrCR-304 1 NC FJ829708 AcrCR-305 1 NC FJ829709 AcrCR-306 2 NC FJ829710 AcrCR-307 1 NC FJ829711 AcrCR-308 1 NC FJ829712 AcrCR-309 1 NC FJ829713 AcrCR-310 1 NC FJ829714 AcrCR-311 8 NC FJ829715 AcrCR-312 1 NC FJ829716 AcrCR-313 2 NC FJ829717 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. - 213 - AcrCR-314 3 NC FJ829718 AcrCR-315 1 NC FJ829719 AcrCR-316 3 NC FJ829720 AcrCR-317 1 NC FJ829721 AcrCR-318 1 NC FJ829722 AcrCR-319 1 SC FJ829723 AcrCR-320 1 SC FJ829724 AcrCR-321 1 SC FJ829725 AcrCR-322 1 SC FJ829726 AcrCR-323 1 SC FJ829727 AcrCR-324 1 SC FJ829728 AcrCR-325 1 SC FJ829729 AcrCR-326 1 SC FJ829730 AcrCR-327 1 SC FJ829731 AcrCR-328 1 SC FJ829732 AcrCR-329 1 SC FJ829733 AcrCR-330 1 SC FJ829734 AcrCR-331 1 SC FJ829735 AcrCR-332 1 SC FJ829736 AcrCR-333 1 SC FJ829737 AcrCR-334 1 SC FJ829738 AcrCR-335 1 SC FJ829739 AcrCR-336 1 SC FJ829740 AcrCR-337 1 SC FJ829741 Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.