JAKO201811562301979.Pdf
Total Page：16
File Type：pdf, Size：1020Kb
MYCOBIOLOGY 2018, VOL. 46, NO. 4, 370–381 https://doi.org/10.1080/12298093.2018.1538068 RESEARCH ARTICLE Diversity and Bioactive Potential of Culturable Fungal Endophytes of Medicinal Shrub Berberis aristata DC.: A First Report Supriya Sharma, Suruchi Gupta, Manoj K. Dhar and Sanjana Kaul School of Biotechnology, University of Jammu, Jammu, J&K, India ABSTRACT ARTICLE HISTORY Bioactive natural compounds, isolated from fungal endophytes, play a promising role in the Received 10 August 2017 search for novel drugs. They are an inspiring source for researchers due to their enormous Revised 26 December 2017 structural diversity and complexity. During the present study fungal endophytes were iso- Accepted 19 February 2018 lated from a well-known medicinal shrub, Berberis aristata DC. and were explored for their KEYWORDS antagonistic and antioxidant potential. B. aristata, an important medicinal shrub with remark- Antagonistic; bioactive; able pharmacological properties, is native to Northern Himalayan region. A total of 131 diversity; novel; endophytic fungal isolates belonging to eighteen species and nine genera were obtained therapeutic agents from three hundred and thirty surface sterilized segments of different tissues of B. aristata. The isolated fungi were classified on the basis of morphological and molecular analysis. Diversity and species richness was found to be higher in leaf tissues as compared to root and stem. Antibacterial activity demonstrated that the crude ethyl acetate extract of 80% isolates exhibited significant results against one or more bacterial pathogens. Ethyl acetate extract of Alternaria macrospora was found to have potential antibacterial activity. Significant antioxidant activity was also found in crude ethyl acetate extracts of Alternaria alternata and Aspergillus flavus. Similarly, antagonistic activity of the fungal endophytes revealed that all antagonists possessed inhibition potential against more than one fungal pathogen. This study is an important step towards tapping endophytic fungal diversity for bioactive metab- olites which could be a step forward towards development of novel therapeutic agents. 1. Introduction secondary metabolites produced by fungal endo- phytes is larger than that of any other endophytic Endophytes constitute a remarkably multifarious microorganism class. group of microorganisms ubiquitous in plants and Berberis aristata DC. is one of the most import- maintain an imperceptible association with their ant medicinal shrub native to Northern Himalayan host for at least a part of their life cycle. Their enor- region. It is also known as Indian barberry or tree mous biological diversity coupled with their capabil- turmeric. The plant is widely distributed from ity to biosynthesize bioactive secondary metabolites Himalayas to Srilanka (altitude 6–10,000 ft), Bhutan has provided the impetus for a number of investiga- (altitude 6–10,000 ft) and hilly areas of Nepal in tions. Among the microbial group the most fre- Himalayan regions. It is also found in Nilgiri hills quently isolated endophytes are the fungi. First (altitude 6–7000 ft) in South India. It is known endophytic fungi was identified and isolated from locally as Chitra, Daruharidra in Sanskrit, Dar-hald Lolium persicum (Persian darnel) [1]. Endophytic in Hindi, Dar - e - hald in Urdu [3]. B. aristata has fungi are considered as an outstanding source of remarkable pharmacological properties [4]. bioactive natural products because there are so Almost every part of B. aristata has medicinal many of them occupying millions of unique bio- value for various ailments. B. aristata extracts and logical niches growing in different types of environ- formulations are useful in the treatment of gynaeco- ment. Plants harbouring fungal endophytes are logical disorders, HIV-AIDS, mitochondrial dysfunc- often healthier than endophyte free ones. Bioactive tion, pharyngitis and various other infections [5,6]. natural compounds isolated from endophytes have Decoctions of B. aristata have also been demon- been playing a promising role in the search for strated to have antimicrobial activity against a var- novel drugs and have become an inspiring source iety of organisms including bacteria, viruses, fungi, for researchers due to their enormous structural protozoans, helminths and Chlamydia [7]. Root and diversity and complexity [2]. The number of stem of B. aristata is used in Indian medical CONTACT Sanjana Kaul [email protected] ß The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group on behalf of the Korean Society of Mycology. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. MYCOBIOLOGY 371 preparations, as a hepatoprotector [8,9]. Stem, bark 2.3. Identification of endophytic fungi and root extracts have been reported to possess anti- The endophytic fungi were identified on the basis of oxidant, antidiabetic and anti inflammatory activity morphological and molecular analysis. Molecular [10]. Pharmacological studies on the plant show identification was done using ITS primers. DNA other activities including, anticancer, analgesic and was isolated using CTAB method [14]. The isolated anti-pyretic [11]. DNA was air dried, dissolved in TE buffer and Based on the scientific investigations on B. aris- stored at À20 C for further use. tata, we postulate that these properties may be due PCR was performed using the primers ITS1 to the production of various metabolites by endo- (50TCCGTAGGTGAACCTGCGG30) and ITS-4 phytes residing inside the plant. Endophytes have a (50TCCTCCGCTTATTGATATGC30). One micro significant potential as a source of novel bioactive liter of each purified DNA sample (50 ng/ll) was metabolites. Keeping in view the medicinal import- used as a template and added to the PCR master ance of the host, the present study was carried out to mixture which consisted of 1X PCR buffer, 2 mM l isolate fungal endophytes from various tissues of MgCl2, 10 mM dNTPs, 1 U/ l Taq polymerase, and B. aristata and assess their bioactive potential. The 0.1 pM of each primer. The PCR thermal cycle present work, to the best of our knowledge is the first parameters used were 94 C for 5 min, 30 cycles of report on the isolation of fungal endophytes from 1 min at 94 C annealing at 55 C, 1 min at 72 C, B. aristata and assessment of their bioactive potential. and a final extension at 72 C for 10 min. PCR reac- tion was carried out in Mastercycler gradient 2. Materials and methods machine (Eppendorf, Hamburg, Germany). The amplified products were checked on 2% agarose gel, 2.1. Plant material eluted and sequenced. The obtained sequences were The plant material was collected from symptomless compared with NCBI databases using the BLAST plants growing in the fields located at Sial Sui, algorithm. Sequences were submitted to GenBank District Rajouri, J&K, India; Geographical position and accession numbers were obtained. Phylogenetic 33.23 latitude and 74.35 longitude; altitude 2275 feet analysis were conducted using MEGA version 6. above sea level. Various plant parts like stem, leaves and roots were collected from healthy and symp- 2.4. Fermentation and extraction of secondary tomless plants and kept in zip lock bags at 4 C metabolites from fungal endophytes until further use. Submerged fermentation of the endophytic fungi was done for the production of secondary metabo- 2.2. Isolation of endophytic fungi from the lites [15]. Four agar plugs (8 mm diameter) of different plant parts of B. aristata actively growing fungal culture were inoculated into 200 ml of autoclaved potato dextrose broth in The isolation of endophytes from B. aristata was 1000 ml of Erlenmeyer flasks. The flasks were then done by using surface sterilization technique [12]. incubated at 28 C under continuous shaking for Sterilization involved washing of selected plant parts 14 days at 120 rpm. Flasks were taken out on the in running water for 10 min followed by washing 15th day from the incubator shaker. The fungal bio- twice in distilled water for 1 min and then giving mass was filtered using autoclaved glass funnel, filter treatment with 70% ethanol for 1 min. Leaves were paper and muslin cloth. Fungal metabolites were then treated with 0.5% sodium hypochlorite for 30 s extracted by solvent fractionation and Soxhlet while stem and roots were treated with 0.5% sodium extraction methods using ethyl acetate and 80% hypochlorite for 1 min. The samples were again ethanol respectively. treated with 70% ethanol for 1 min. Each step was followed by washing with autoclaved distilled water for 2 min. Surface sterilized plant parts were then 2.5. Antibacterial activity dried by pressing them inbetween the folds of sterile Crude ethyl acetate and ethanolic extracts of the filter paper. After proper sterilization, the samples fungal isolates were evaluated for their antibacterial were cut into small segments (0.5–1 cm). The seg- potential against some common human pathogenic ments were placed on potato dextrose agar plates at microorganisms. The bacterial cultures were 28 ± 2 C for isolation of the fungal endophytes. Last obtained from MTCC: Pseudomonas aeruginosa washing of the surface sterilized segments spread on (MTCC-1934), Bacillus subtilis (MTCC-441), potato dextrose agar plates served as control. Klebsiella pneumonia (MTCC-109), Pseudomonas Effectiveness of the surface sterilization method was alkaligenes (MTCC-493), Staphylococcus aureus, also validated by Schultz imprinting method [13]. Enterococcus faecalis (MTCC-439), Bacillus cereus 372 S. SHARMA ET AL. (MTCC-430), and Escherichia coli (MTCC-40). PGI ¼½ðR1 À R2Þ=R1Â100 Antibacterial potential of the extracts was assessed where “R ” is the radial growth of fungal pathogen using well diffusion method [16]. Specific number 1 in the absence of antagonist; “R ” is the radial of wells were punched with a sterile cork borer 2 growth of fungal pathogen in the presence of antag- (6 mm diameter) in each plate. 100 ml of various onist.