Cross-Species Antiviral Activity of Goose Interferons Against Duck

Article Cross-Species Antiviral Activity of Goose Interferons against Duck Plague Virus Is Related to Its Positive Self-Feedback Regulation and Subsequent Interferon Stimulated Genes Induction

Hao Zhou 1,†, Shun Chen 1,2,3,*,†, Qin Zhou 1, Yunan Wei 1, Mingshu Wang 1,2,3, Renyong Jia 1,2,3, Dekang Zhu 2,3, Mafeng Liu 1, Fei Liu 3, Qiao Yang 1,2,3, Ying Wu 1,2,3, Kunfeng Sun 1,2,3, Xiaoyue Chen 2,3 and Anchun Cheng 1,2,3,*

1 Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, No. 211 Huimin Road, Wenjiang District, Chengdu 611130, China; [email protected] (H.Z.); [email protected] (Q.Z.); [email protected] (Y.W.); [email protected] (M.W.); [email protected] (R.J.); [email protected] (M.L.); [email protected] (Q.Y.); [email protected] (Y.W.); [email protected] (K.S.) 2 Avian Disease Research Center, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, China; [email protected] (D.Z.); [email protected] (X.C.) 3 Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, China; [email protected] * Correspondence: [email protected] (S.C.); [email protected] (A.C.); Tel.: +86-028-86291482 † These authors contributed equally to this work.

Academic Editor: Curt Hagedorn Received: 23 May 2016; Accepted: 12 July 2016; Published: 18 July 2016

Abstract: Interferons are a group of antiviral cytokines acting as the first line of defense in the antiviral immunity. Here, we describe the antiviral activity of goose type I interferon (IFNα) and type II interferon (IFNγ) against duck plague virus (DPV). Recombinant goose IFNα and IFNγ proteins of approximately 20 kDa and 18 kDa, respectively, were expressed. Following DPV-enhanced green fluorescent protein (EGFP) infection of duck embryo fibroblast cells (DEFs) with IFNα and IFNγ pre-treatment, the number of viral gene copies decreased more than 100-fold, with viral titers dropping approximately 100-fold. Compared to the control, DPV-EGFP cell positivity was decreased by goose IFNα and IFNγ at 36 hpi (3.89%; 0.79%) and 48 hpi (17.05%; 5.58%). In accordance with interferon-stimulated genes being the “workhorse” of IFN activity, the expression of duck myxovirus resistance (Mx) and oligoadenylate synthetases-like (OASL) was significantly upregulated (p < 0.001) by IFN treatment for 24 h. Interestingly, duck cells and goose cells showed a similar trend of increased ISG expression after goose IFNα and IFNγ pretreatment. Another interesting observation is that the positive feedback regulation of type I IFN and type II IFN by goose IFNα and IFNγ was confirmed in waterfowl for the first time. These results suggest that the antiviral activities of goose IFNα and IFNγ can likely be attributed to the potency with which downstream genes are induced by interferon. These findings will contribute to our understanding of the functional significance of the interferon antiviral system in aquatic birds and to the development of interferon-based prophylactic and therapeutic approaches against viral disease.

Keywords: goose interferon; duck plague virus; feedback regulation; antiviral activity; interferon stimulated gene

Viruses 2016, 8, 195; doi:10.3390/v8070195 www.mdpi.com/journal/viruses Viruses 2016, 8, 195 2 of 12

1. Introduction Pattern recognition receptors (PRRs) senses foreign agents in response to pathogen-associated molecular patterns (PAMPs), inducing the production of interferons and proinflammatory cytokines. Interferons, secreted antiviral cytokines that induce a robust immune response, play an important role in both innate and adaptive immunity [1]. IFNs are classified into three classes based on the receptor complex through which signaling occurs: type I interferon (e.g., IFNα), type II interferon (IFNγ), and type III interferon (IFNλ1, 2, 3) [2]. The functions of interferons have recently been identified in several avian species. Chicken IFNα can suppress the replication of several viruses, such as infectious bronchitis virus (IBV) [3], infectious bursal disease virus (IBDV) [4], and Marek’s disease virus (MDV) [5]. Pretreatment of Vero cells with chicken IFNγ effectively inhibits vesicular stomatitis virus (VSV) infection [6]. In addition, duck IFNα [7] and IFNγ [8] exhibit a strong inhibitory effect against duck hepatitis B virus (DHBV) in primary duck hepatocytes. Recombinant goose IFNα produced by either E. coli or Sf9 has been shown to be a powerful antiviral agent [9]. Goose IFNγ has an antiviral effect against goose paramyxovirus (GPMV) in goose fibroblasts and inhibits vesicular stomatitis virus expressing enhanced green fluorescent protein (VSV-EGFP) replication in duck fibroblasts [10]. Previous research has also demonstrated the cross-species reactivity of turkey and chicken interferons [11,12]. How is the host cellular antiviral state achieved? Interferons bind to their cognate receptors, inducing the expression of interferons and a variety of IFN-stimulated genes (ISGs) [13] such as myxovirus resistance (Mx) protein [14], oligoadenylate synthetases-like (OASL) protein [15], and dsRNA-dependent protein kinase (PKR) [16] and resulting in the antiviral response [2]. Importantly, a positive feedback loop for interferon through autocrine and paracrine pathways via distinct IRF proteins (e.g., IRF3 and IRF7) has been extensively studied in mammals [17,18] and shown to further massively amplify responses by interferon and related ISGs. However, the mechanism of positive feedback regulation of IFNs in birds remains unclear. Considering that aquatic birds play a critical role in the transmission and dissemination of many important viral pathogens, it is important to study the IFN-mediated antiviral immunity in waterfowl. Duck and goose showed a recent phylogenetic relationship. The goose IFNα and duck IFNα is 93.7% [9], while the goose IFNγ and duck IFNγ is the 93.3% [10]. Furthermore, limited attention has been paid to the antiviral response of goose IFN proteins. Notably, most of these antiviral proteins, including Mx and OASL, are not well described in the geese, and their roles against viral infections is unknown. Duck plague virus (DPV) (also known as the etiological agent of duck virus enteritis), is a DNA virus detected in many species, including ducks, geese, swans, and other waterfowls, which leads to the obvious economic losses worldwide in avian industry as a result of high mortality [19–22]. Migratory aquatic birds (goose) and domestic aquatic birds (duck) may spread the virus infection from one species to another. In the present study, we examined the potential antiviral activity and explored some novel immune regulatory characteristics of goose IFNα (goIFNα) and IFNγ (goIFNγ) against DPV in duck embryo fibroblast cells. We observed significant inhibition of DPV replication by both goIFNα and goIFNγ in vitro. We then focused on an analysis of host ISG expression and viral replication during the infection phase. Here, evidence was obtained for the antiviral effect of goose interferon on the heterologous duck cells. The primary investigation of the cross-species antiviral activity of goose IFNs in duck-derived cells indicated that goose IFNs can be exploited into a library of small antiviral molecules that can be used in multiple animal viral disease treatment. The ultimate goal of the work is to develop a multi-function and multi-target antiviral reagents.

2. Materials and Methods

2.1. Cells and Virus Baby Hamster Syrian Kidney (BHK21) cells were provided by our lab. Duck plague virus strain (DPV-EGFP) was constructed and stored at ´80 ˝C until use. Unless otherwise stated, the virus tissue ´6.125 culture infectious dose 50 (TCID50) in duck embryo ﬁbroblast cells used was 10 /100 µL. Virus was Viruses 2016, 8, 195 3 of 12

4 4 6 seeded into 6-well (4 ˆ 10 TCID50) or 24-well plates (10 TCID50). 1 ˆ 10 primary duck embryo ﬁbroblast cells (DEF) or goose embryo ﬁbroblast cells (GEF) were seeded into 6-well tissue culture plates for 24 h in DMEM (Sigma, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS) 10%, v/v, (Gibco, Gaithersburg, MD, USA), penicillin 100 IU/mL and streptomycin 100 µg/mL. The cells were then treated with protein IFNα and IFNγ separately for 12 h. The DEFs were then inoculated with DPV-EGFP in DMEM supplemented with 3% FBS. Viral DNA was extracted using TIANamp Virus DNA/RNAKit (Tiangen, Beijing, China), and RT-qPCR was performed.

2.2. Plasmid Construction and Transfection The goIFNα (GenBank No. EU925650) and the goIFNγ (GenBank No. KP325480) sequences tagged with His at the N-terminus but without the secretion signal peptide coding region were cloned into a modiﬁed pcDNA3.1 (+) vector to generate the pcDNA3.1-IFNα-His plasmids. BHK21 cells were transiently transfected in T25 with 7 µg IFN recombinant plasmid using 21 µl of TransIT-X2 transfection reagent (Mirus Bio, Madison, WI, USA) according to the manufacturer’s guidelines. At 24 h after transfection, supernatant of the BHK21 cell lysates were collected and stored at ´80 ˝C until further use. The control group is the supernatant collected from the BHK21 cells transfected with the empty pcDNA3.1 plasmid. The goose IFNα and IFNγ sequences containing the secretion signal peptide region were also inserted into the pEGFP-N1 vector using a one-step cloning kit (Vazyme, Nanjing, China) to generate the recombinant pEGFP-IFNα and pEGFP-IFNγ plasmids, respectively. Transfection into the BKH21 cells in 6-well plates (2 µg plasmid/well) was performed according to the manufacturer’s guidelines. The expression levels of goIFNα and goIFNγ were conﬁrmed by Western Blotting. The primers are listed in Table1.

Table 1. List of primers used in this study and their sequences.

Species Primer Name Nucleotide Sequence Goose IFNα (F) CAGCACCACATCCACCAC IFNα (R) TACTTGTTGATGCCGAGGT IFNγ (F) TGAGCCAGATTGTTTCCC IFNγ (R) CAGGTCCACGAGGTCTTT IFNλ (F) GAGCTCTCGGTGCCCGACC IFNλ (R) CTCAGCGGCCACGCAGCCT Mx (F) TTCACAGCAATGGAAAGGGA Mx (R) ATTAGTGTCGGGTCTGGGA OASL (F) CAGCGTGTGGTGGTTCTC OASL (R) AACCAGACGATGACATACAC actin (F) CCGTGACATCAAGGAGAA actin (R) GAAGGATGGCTGGAAGAG Duck IFNα (F) TCCTCCAACACCTCTTCGAC IFNα (R) GGGCTGTAGGTGTGGTTCTG IFNγ (F) CATACTGAGCCAGATTGTTACCC IFNγ (R) TCACAGCCTTGCGTTGGA IFNλ (F) GTGCCTGACCGACTCCTCCT IFNλ (R) CCCAGAGGGCTGATGCGAAG Mx (F) TGCTGTCCTTCATGACTTCG Mx (R) GCTTTGCTGAGCCGATTAAC OASL (F) TCTTCCTCAGCTGCTTCTCC OASL (R) ACTTCGATGGACTCGCTGTT β-actin (F) GATCACAGCCCTGGCACC β-actin (R) CGGATTCATCATACTCCTGCTT DPV UL30 (F) TTTCCTCCTCCTCGCTGAGTG UL30 (R) CCAGAAACATACTGTGAGAGTG Plasmid construction pcDNA-IFNα (F) CTA GCTAGC GACATGGAC TGCAGCCCCCTGCGCCTCCACGACAG CGG GAATTC TTA GTGGTGGTGGTGGTGGTG pcDNA-IFNα (R) GCGCATGGCGCGGGTGAGGCG pcDNA-IFNγ (F) CTA GCTAGC GACATGGAC TGTTCTGGAAGTGCTCTATTTCTTAG CGG GAATTC TTA GTGGTGGTGGTGGTGGTG pcDNA-IFNγ (R) ACATCTGCATCTCTTTGGAGAC Plasmid construction pEGFP-IFNα (F) ATCTCGAGCTCAAGCTTC GAATTC ATGCCTGGGCCATCAGCCCCAC (one-step cloning) pEGFP-IFNα (R) GGTGGATCCCGGGCCCGC GGTACC AC GCGCATGGCGCGGGTGAGGCG ATCTCGAGCTCAAGCTTC GAATTC GCCACC pEGFP-IFNγ (F) ATGACTTGCCAGACCTACTGCTTG pEGFP-IFNγ (R) GGTGGATCCCGGGCCCGC GGTACC AC ACATCTGCATCTCTTTGGAGAC Viruses 2016, 8, 195 4 of 12

2.3. Viral TCID50 Detection Viral titers were determined by an endpoint dilution assay and the titers are expressed as the TCID50 per milliliter using the Reed-Muench method. Brieﬂy, serial 10-fold dilutions of DPV-EGFP were inoculated in eight replicates into 96-well tissue culture plates seeded with DEF cells. After absorption for 1 h at 37 ˝C, the supernatants in the wells were removed, and DMEM with 3% FBS was added. The plates were incubated for 120 h, and the virus titers were calculated based on the cytopathic effect.

2.4. RNA Isolation and Real-Time qPCR Total RNA was isolated from the DEFs or GEFs using TRIzol Reagent (Takara, Dalian, China) following the manufacturer’s instructions. cDNA was synthesized from 1 µg of RNA per sample using 5ˆ all-in-one master mix transcription reagents (Abm, Richmond, BC, Canada). Relative expression was then quantiﬁed using the SYBR Green qPCR kit (Abm, Richmond, BC, Canada) and a real-time Thermo cycler (CFX96 Bio-Rad, Hercules, CA, USA). qPCR was performed using primers (Table1) for duck genes (duIFNα, duIFNγ, duIFNλ, duMx, and duOASL) and goose genes (goIFNα, goIFNγ, goIFNλ, goMx, and goOASL). The relative expression of the target genes was normalized to β-actin and calculated using the 2´∆∆CT method [23].

2.5. Flow Cytometry Analysis DEFs were grown in 6 wells plates or 24-well plates for 12 h. Then, the DEF monolayers were pretreated with the indicated IFN protein (60 µg/well) and negative control (supernatants of cellular lysate from BHK21 transfected with empty vector); 12 h later, the cells were then infected by DPV-EGFP 4 (4 ˆ 10 TCID50/well). DPV-infected cells at the indicated time points (36 hpi and 48 hpi) were detached from the plate bottom and then washed with PBS. Then, these cells were harvested by using the trypsin and centrifuged at 1000 rpm for 5 min before being washed twice with PBS again and ﬁnally suspended in 0.5 mL PBS. The percentage of GFP-positive cells was determined by ﬂow cytometry (Becton Dickinson, San Jose, CA, USA). Uninfected cells were used as a negative control.

2.6. Detection of Viral Copies An absolute quantitative curve was built based on the DPV-UL30 plasmid. The plasmid was diluted 10-fold. Then, the temperature was optimized by the program and the standard curve of the DPV was generated from the 108 copies to 104 copies. Then, the viral DNA from the infected cells was extracted using a nucleic acid extraction kit (Tiangen, Beijing, China), and the samples were detected by the following program: 94 ˝C for 3 min, followed by 39 cycles of 95 ˝C for 10 s and 60 ˝C for 30 s. The primers are listed in Table1, and the targeted product was 106 bp.

2.7. Western Blotting The protein concentrations were calculated using the Bradford assay (Bio-Rad). Whole cell lysates of BHK21 cells were collected at 24 h or 48 h post-transfection by three rounds of freeze-thaw. Unless otherwise stated, a total of 20 µg of the total cellular protein was boiled in 6ˆ protein loading buffer before separation by 12% SDS-PAGE electrophoresis. Then, the proteins were transferred onto polyvinylidene ﬂuoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were blocked with 5% skim milk in TBST overnight at 4 ˝C, and subsequently incubated for 1 h with mouse anti-His (Proteintech, Shenzhen, China), Rabbit anti-actin monoclonal antibodies (Bioss, Beijing, China) or mouse anti-GAPDH monoclonal (Ruiying Biological, Suzhou, China) antibodies at a 1:2000 dilution. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit or goat anti-mouse IgG (Earthox, San Francisco, CA, USA) was used as the secondary antibody at 1:5000 dilution. Proteins were visualized by chemiluminescence using an ECL kit (Bio-Rad). Viruses 2016, 8, x 5 of 12

VirusesSan2016 Francisco,, 8, 195 CA, USA) was used as the secondary antibody at 1:5000 dilution. Proteins were5 of 12 visualized by chemiluminescence using an ECL kit (Bio-Rad). 2.8. Statistical Analysis 2.8. Statistical Analysis The statistical significance of differences between experimental groups was determined by a The statistical significance of differences between experimental groups was determined by a two-tailedtwo-tailed unpaired unpaired Student’s Student’st -testt-test (GraphPad(GraphPad Prism software). software). E Errorrror bars bars represent represent the the standard standard errorerror of of the the mean. mean. The The valuevalue pp << 0.050.05 waswas considered statistically statistically significant, significant, and and the the degree degree of of significancesignificance is is indicated indicated as as follows: follows: * *p p< < 0.05,0.05, ** p < 0.01, 0.01, *** *** pp << 0.001. 0.001.

3.3. Results Results 3.1. Characterization of Goose IFNα and IFNγ Expression 3.1. Characterization of Goose IFNα and IFNγ Expression α γ TheThe pcDNA3.1-IFN pcDNA3.1-IFNandα and pcDNA3.1-IFN pcDNA3.1-IFNplasmidsγ plasmids were successfullywere successfully constructed. constructed. After transfection After intotransfection the BHK21 into cells, the expression BHK21 cells, at 24expression h and 48 at h 24 post-transfection h and 48 h post-transfection was observed was for observed both, with for aboth, higher expressionwith a higher level expression of goose IFNs level observed of goose IFNs at 24 observed h post transfection at 24 h post (Figure transfection1A). To(Figure explore 1A). the To goose explore IFN expressionthe goose patternIFN expression in BHK21 pattern cells, in their BHK21 subcellular cells, their localization subcellular waslocalization assessed. was Western assessed. blot Western analysis showedblot analysis that the showed recombinant that the goIFNrecombinantα and goIFNαγ andproteins goIFN areγ proteins approximately are approximately 20 kDa and 20 18 kDa kDa, withand an 18 approximately kDa, with an 1 approximately kDa His tag, respectively 1 kDa His (Figuretag, respectively1B). Fluorescence (Figure was1B). observedFluorescence for thewas the gooseobserved IFNα -EGFPfor the andthe goose IFNγ -EGFPIFNα-EGFP proteins and (FigureIFNγ-EGFP S1). Morphologiesproteins (Figure of S1). IFN Morphologiesα appeared in of the IFN dots-,α strings-appeared and in rings-like the dots-, patterns strings- diffuselyand rings-like distributed patterns along diffusely the periphery distributed of al theong nucleus. the periphery Morphologies of the ofnucleus. IFNγ showed Morphologies patterns of of IFN dots,γ showed spots, stars patterns and cocoons,of dots, spots, located stars in and the cellcocoons, nucleus located and in perinuclear the cell compartment.nucleus and perinuclear Taking the compartmen results together,t. Taking the overexpressionthe results together, of goose the overexpression IFN proteins inof BHK21goose IFN cells wasproteins conﬁrmed. in BHK21 cells was confirmed.

FigureFigure 1. Western1. Western blot blot analysis analysis of goose of goose type Itype interferon I interferon (IFNα )(IFN andα type) and II interferontype II interferon (IFNγ) expression (IFNγ) inexpression Baby Hamster in Baby Syrian Hamster Kidney Syrian (BHK21) Kidney cells. (BHK21) (A) BHK21 cells. cells(A) BHK21 were transfected cells were withtransfected the empty with vectorthe orempty a pcDNA3.1-vector vector or a pcDNA3.1-v expressingector goose expressing IFNα gooseor IFN IFNγ.α Cell or IFN lysatesγ. Cell after lysates transfection after transfection for 24 h for and 24 h and 48 h, were examined by Western Blotting with anti-His tag antibodies and anti-GAPDH 48 h, were examined by Western Blotting with anti-His tag antibodies and anti-GAPDH antibodies as antibodies as a loading control; (B) Western Blotting analysis (24 hpi) showed approximate sizes for a loading control; (B) Western Blotting analysis (24 hpi) showed approximate sizes for recombinant recombinant goose IFNα and IFNγ of 20 kDa and 18 kDa, respectively. goose IFNα and IFNγ of 20 kDa and 18 kDa, respectively. 3.2. Antiviral Effect of Goose IFNα and IFNγ 3.2. Antiviral Effect of Goose IFNα and IFNγ To explore the antiviral effect, a DPV infection model was generated. The results showed cross- specificityTo explore for goose the antiviral interferons effect, in viral a DPV inhibition. infection Specifically, model wasthe DPV generated. seeded into The DEFs results replicated showed cross-speciﬁcityafter 24 hpi. At 12 for hpi goose and 24 interferons hpi, there were in viral no obvious inhibition. differences Speciﬁcally, between the the DPV IFN-treatment seeded into group DEFs replicatedand control after group. 24 hpi. However, At 12 dramatic hpi and antiviral 24 hpi, effects there werewere noobserved obvious at both differences 36 hpi and between 48 hpi the IFN-treatment group and control group. However, dramatic antiviral effects were observed at both

36 hpi and 48 hpi (Figure2A). Western blot analysis revealed that IFN α and IFNγ controlled the DPV-EGFP expression and proliferation (Figure2B). Furthermore, the virus titers in the presence Viruses 2016, 8, x 6 of 12

(FigureViruses 2016 2A)., 8 Western, 195 blot analysis revealed that IFNα and IFNγ controlled the DPV-EGFP expression6 of 12 and proliferation (Figure 2B). Furthermore, the virus titers in the presence of the interferons rapidly decreased to low levels (102.875 TCID50/0.1 mL in the IFNα group and 102.167 TCID50/0.1 mL in the IFNγ 2.875 α of the interferons rapidly decreased to low levels (10 TCID50/0.1 mL in the IFN group3.125 and group)2.167 at 36 hpi (Figure 2C); while at 48 hpi, the virus titer in the IFNα group dropped to 10 10 TCID50/0.1 mL in the IFNγ group) at 36 hpi (Figure2C); while at 48 hpi, the virus titer TCID50/0.1 mL and that in the IFNγ group declined to 102.542 TCID50/0.1 mL (Figure 2C). These results in the IFNα group dropped to 103.125 TCID /0.1 mL and that in the IFNγ group declined to indicate that both goIFNα and goIFNγ conferred50 the duck cells with resistance to the virus. Then, the 102.542 TCID /0.1 mL (Figure2C). These results indicate that both goIFN α and goIFNγ conferred viral gene copies50 were detected at 36 hpi (IFNα: 104.59 copies/200 µL, IFNγ: 103.82 copies/200 µL) and the duck cells with resistance to the virus. Then, the viral gene copies were detected at 36 hpi 48 hpi (IFNα: 105.37 copies/200 µL, IFNγ: 105.78 copies/200 µL) (Figure 3), when compared to the control (IFNα: 104.59 copies/200 µL, IFNγ: 103.82 copies/200 µL) and 48 hpi (IFNα: 105.37 copies/200 µL, group, a significant decrease for both IFNα (p < 0.001, p < 0.001) and IFNγ (p < 0.001, p < 0.001) were IFNγ: 105.78 copies/200 µL) (Figure3), when compared to the control group, a signiﬁcant decrease calculated. At 36 hpi, the EGFP-positive cells of the IFNα group accounted for 3.89% of the total, for both IFNα (p < 0.001, p < 0.001) and IFNγ (p < 0.001, p < 0.001) were calculated. At 36 hpi, followed by the IFNγ group (0.79%), both of which were lower than in the control group the EGFP-positive cells of the IFNα group accounted for 3.89% of the total, followed by the IFNγ (approximately 50%). At 48 hpi, the infected cells comprised 17.05% of the IFNα group and 5.58% of group (0.79%), both of which were lower than in the control group (approximately 50%). At 48 hpi, the IFNγ group, indicating that goose IFNγ protein conferred more resistance against viral infection. the infected cells comprised 17.05% of the IFNα group and 5.58% of the IFNγ group, indicating that The synergistic treatment of both IFNα and IFNγ proteins also have the significant inhibition effect goose IFNγ protein conferred more resistance against viral infection. The synergistic treatment of both on DPV (Figure S2). IFNα and IFNγ proteins also have the signiﬁcant inhibition effect on DPV (Figure S2).

FigureFigure 2. 2.DuckDuck plague plague virus virus (DPV) (DPV) was significantly was significantly inhibited inhibited by the goose by the IFN gooseα and IFNIFNαγ. and(A) duck IFNγ . embryo(A) duck fibroblast embryo (DEF) fibroblast cells (DEF) were cellspre-treated were pre-treated with indicated with indicatedinterferon interferon protein and protein negative and control negative (60control µg/well). (60 µTheg/well). the supernatant The the supernatant collected from collected the fromBHK21 the cells BHK21 transfected cells transfected with the withempty the pcDNA3.1empty pcDNA3.1 (+) plasmids (+) plasmidsis used to ispre-treat used to GEFs pre-treat as th GEFse negative as the control. negative 12 h control. later, the 12 cells h later, were the then cells 4 infectedwere then by DPV-EGFP infected by (4 DPV-EGFP × 104 TCID (450ˆ/well).10 TCID Enhanced50/well). green Enhanced fluoresce greennt protein fluorescent (EGFP) protein expression, (EGFP) anexpression, indication anof DPV indication replication, of DPV is replication,shown by green is shown fluorescence by green when fluorescence examined when by fluorescence examined by microscopy.fluorescence Magnification microscopy. 400×; Magnification (B) At 36 400hpiˆ and;(B )48 At hpi, 36 hpithe medium and 48 hpi, was the collected medium for was the collectedfurther Westernfor the Blotting further Westernanalysis. Blotting The primary analysis. antibodies The primary were rabbit-anti antibodies EGFP were (1:2000) rabbit-anti and EGFP mouse-anti (1:2000) actinand mouse-anti(1:2000); secondary actin (1:2000); antibodies secondary were antibodiesthe goat-anti were rabbit the goat-anti and goat-anti rabbit andmouse goat-anti antibodies mouse conjugatedantibodies to conjugated Horseradish to Horseradishperoxidase (HRP); peroxidase (C) Viral (HRP); titer (reductionC) Viral titer assay. reduction Cells were assay. treated Cells with were indicatedtreated with IFNα indicated, IFNγ, or IFN leftα ,control IFNγ, orfor left 12 control h before for infect 12 hion before with infection DPV. After with 36 DPV. h and After 48 36 h, h the and samples48 h, the in samplesthe four wells in the used four for wells each used treatment for each were treatment frozen and were thawed frozen ou andt repeatedly thawed out and repeatedly pooled, andand the pooled, viral andyield the in viralthe culture yield in medium the culture was medium determ wasineddetermined by the tissue by culture the tissue infectious culture infectiousdose 50 (TCIDdose 5050) (TCID method. 50) method.

Then,Then, the the dose-dependent dose-dependent antiviral antiviral effect effect induced induced by by interferons interferons was was then then assessed. assessed. As As shown shown inin Figure Figure 4,4 the, the suppression suppression effect effect was was not not apparent apparent at 12 at hpi 12 with hpi withincreased increased interferon interferon protein protein dose. However,dose. However, at 36 hpi, at 36the hpi, DEFs the were DEFs protected were protected by the incubation by the incubation with a low with dose a low of doseIFNα of or IFN IFNαγor protein,IFNγ protein, and the and DPV the infection DPV infection was efficiently was efficiently controlled. controlled. As shown As shownin Figure in Figure5A, viral5A, gene viral copy gene numberscopy numbers were lower were than lower in thanthe control in the group control afte groupr pretreatment after pretreatment with the withindicated the indicatedIFN protein. IFN protein. Furthermore, flow cytometry analysis showed that this inhibitory effect was dose dependent (Figure5B), consistent with the results of the indirect fluorescence assay. Viruses 2016, 8, x 7 of 12

Furthermore,Viruses 2016, 8, 195flow cytometry analysis showed that this inhibitory effect was dose dependent7 (Figure of 12 5B),Viruses consistent 2016, 8, x with the results of the indirect fluorescence assay. 7 of 12

Furthermore, flow cytometry analysis showed that this inhibitory effect was dose dependent (Figure 5B), consistent with the results of the indirect fluorescence assay.

FigureFigure 3.3. EffectsEffects of ofIFN IFNα andα and IFN IFNγ onγ on DPV DPV DNA DNA copy copy numbers numbers and and viral viral replication. replication. (A) ( ADPV) DPV UL30

DNAUL30 copies DNA were copies detected were detected by RT-qPCR by RT-qPCR in DEF incells DEF infected cells infected with the with DPV the strain DPV at strain 36 hpi at and 36 hpi48 hpi afterFigureand pretreatment 48 3. hpi Effects after of pretreatment ofIFN gooseα and proteinsIFN of gooseγ on DPV(60 proteins µg/weDNA (60 copyll)µ g/well)from numbers BHK21 from and BHK21 cellsviral replication.transfected cells transfected (Awith) DPV withthe UL30 empty the α γ (negativeDNAempty copies (negative control), were control),or detected IFNα or by IFN RT-qPCRγ plasmid.or IFN in DEFplasmid. The cellsnumbers Theinfected numbers of DPV with UL30 ofthe DPV DPV gene UL30 strain copies gene at was36 copies hpi were and was calculated 48 were hpi p accordingaftercalculated pretreatment to according the standard of to goose the curve. standard proteins The curve. assa (60ys µg/we The were assaysll) performed from were BHK21 performed in triplicate cells in transfected triplicate wells, *** wells, with p < 0.001;*** the

Figure 4. Dose-dependent inhibition of DPV replication by IFNα and IFNγ is shown by green Figure 4. Dose-dependent inhibition of DPV replication by IFNαα and IFNγγ is shown by green fluorescenceDose-dependent (Magnification 400×). inhibition To study of DPV the replicationinhibitory effect by IFN of IFNsand against IFN is DPV, shown DEF by cells green were fluorescencefluorescence (Magnification (Magnification 400×). 400ˆ ).To Tostudy study the theinhibito inhibitoryry effect effect of IFNs of IFNs against against DPV, DPV,DEF cells DEF were cells seeded in 24-well plates at 105 cells/well, treated with indicated IFNα or IFNγ, at 5, 10, 15, 20, 25 and seededwere seeded in 24-well in 24-well plates platesat 105 atcells/well, 105 cells/well, treated treatedwith indicated with indicated IFNα or IFN IFNαγor, at IFN 5, 10,γ, at15, 5, 20, 10, 25 15, and 20, 30 µg or left untreated (control); 12 h later, the cells were infected with DPV (104 TCID50/well). At 12 4 4 3025 µg and or 30 leftµg untreated or left untreated (control); (control); 12 h late 12r, h the later, cells the were cells infected were infected with DPV with (10 DPV TCID (10 50TCID/well).50/well). At 12 hpi and 36 hpi, green fluorescence was examined via fluorescence microscopy, respectively (original hpiAt 12and hpi 36 andhpi, 36green hpi, fluorescence green fluorescence was examined was examined via fluorescence via fluorescence microscopy, microscopy, respectively respectively (original magnification × 400). magnification(original magnification × 400). ˆ 400).

Viruses 2016, 8, 195 8 of 12 Viruses 2016, 8, x 8 of 12

FigureFigure 5. 5. Dose-dependentDose-dependent inhibition inhibition of DPV of DPV replication replication by IFN by IFNα andα andIFNγ IFN as examinedγ as examined by viral by copy viral numbercopy number detection detection (A) and ( Aflow) and cytometry flow cytometry analysis analysis(B). Effects (B ).of Effectsdifferent of concentrations different concentrations of IFNα and of IFNIFNγα onand DPV IFN DNAγ on DPVcopy DNAnumbers. copy DPV numbers. UL30 DNA DPV co UL30pies DNAin DEF copies cells inof DEFcontrol cells groups of control and experimentalgroups and experimentalgroups were detected groups were by RT-qPCR detected at by 36 RT-qPCR hpi after atprotein 36 hpi pretreatment after protein as pretreatment above. The numberas above. of UL30 The DNA number copies of UL30was assessed DNA copies in triplic wasate assessed wells. Flow in triplicatecytometry wells. analysis Flow of DPV-EGFP cytometry positiveanalysis cells of DPV-EGFP with different positive concentrations cells with differentof IFN were concentrations also analyzed of IFN by were flow alsocytometry. analyzed The by percentageflow cytometry. of EGFP-positive The percentage cells automatically of EGFP-positive calculated cells automaticallyby the CellQuest calculated software. by Flow the cytometry CellQuest wassoftware. used to Flow analyze cytometry cells with was usedGFP tofluorescence. analyze cells Pl withots of GFP the fluorescence.data indicate Plots the percentage of the data indicateof cells expressingthe percentage GFP of(right cells quadrant) expressing above GFP (right the backgrou quadrant)nd above level theof fluorescence background levelassociated of fluorescence with the uninfectedassociated control with the cells. uninfected control cells.

3.3.3.3. GEFs GEFs and and DEFs DEFs Display Display Similar Similar Positive Positive Feed Feedbackback Regulation Regulation by by Goose Goose IFN IFN and and Subsequent Subsequent ISG InductionISG Induction ToTo understand understand the the mechanism mechanism by by which which interferon interferon inhibits inhibits DPV DPV replication, replication, we we further further investigatedinvestigated the the expression expression of of Mx, Mx, OASL, OASL, and and three three types types of of duck duck IFNs. IFNs. The The results results showed showed that that the the selectedselected duck duck ISGs ISGs (Mx (Mx and and OASL), OASL), duIFN duIFNαα,, and and duIFN duIFNγγ werewere significantly significantly upregulated upregulated in in DEF DEF afterafter the the pretreatment pretreatment with with goose goose IFN IFNαα andand IFN IFNγγ proteinsproteins for for 24 24 h h (Figur (Figuree 66).). Thus, the duck IFN systemsystem in in the the duck embryo fibroblastfibroblast cellscells couldcould be be highly highly induced induced by by goose goose IFN IFN proteins. proteins. The The level level of ofduIFN duIFNα wasα was more more than than 100 100 times times lower lower than than that that of duIFN of duIFNγ (Figureγ (Figure6). Significant 6). Significant upregulation upregulation in the inexpression the expression of duMx ofand duMx duOASL and duOASL gene expression gene expression was observed. was Weobserved. also compared We also the compared expression the of expressionIFNα, IFNγ ofand IFN theirα, IFN targetγ and genes their in target goose embryonicgenes in goose fibroblasts embryonic (GEFs) fibroblasts and DEFs (GEFs) in response and DEFs to goose in responseinterferon to stimulation goose interferon (Figure stimulation6 and Figure (Figure S3). In 6 gooseand Figure primary S3). cells In goose (Figure primary S3), similar cells (Figure patterns S3), in similarISGs and patterns the self-feedback in ISGs and loop the self-feedback of IFN were observed loop of IFN for were goose observed type I and for type goose II IFNs. type I and type II IFNs.

Viruses 2016, 8, 195 9 of 12 Viruses 2016, 8, x 9 of 12

Figure 6. Detection of duck Mx (duMx), duck OASL (duOASL), duck IFNα (duIFN(duIFNα), duck IFNγ (duIFNγγ),), andand duckduck IFN IFNλλ(duIFN (duIFNλ)λ gene) gene expression expression levels levels in DEFs.in DEFs. Cells Cells were were collected collected at 24 at h 24 and h 48and h after48 h after the goose the goose IFNα IFN(goIFNα (goIFNα) andα goose) and goose IFNγ (goIFN IFNγ (goIFNγ) proteinγ) protein pretreatment pretreatment (60 µg/well). (60 µg/well). The mRNA The levelsmRNA were levels measured were measured by real timeby real PCR time and PCR are expressedand are expressed relative torelativeβ-actin to mRNA.β-actin DuckmRNA. embryo Duck ﬁbroblastembryo fibroblast (DEF) cells (DEF) were cells seeded were in seeded 6-well platesin 6-well and plates then pretreatedand then pretreated with by IFN withα or by IFN IFNγ proteinα or IFN forγ 12protein h. Symbols for 12 showh. Symbols four replicate show four experiments. replicate experiments. The results shown The results are the shownmean ˘areSEM the ofmean four ± samples. SEM of Signiﬁcantfour samples. differences Significant compared differences with cellscompared without wi IFNth cells treatment without are denotedIFN treatment by * p

4. Discussion Discussion Interferons, which which function function as as regulators regulators of ofthe the antiviral antiviral immune immune response response by interacting by interacting with withcognate cognate receptors receptors on the onsurface the surfaceof cells, of have cells, been have intensively been intensively studied for studied a long for time. a longAlthough time. Althoughinterferons interferons have been haveidentified been in identified avian species, in avian the species, research the into research their antiviral into their activity antiviral has activitylagged hasbehind lagged research behind in researchmammals. in Nonetheless, mammals. Nonetheless, interferons interferonshave key function have key in functionthe first line in the of firstdefense line ofagainst defense virus against infection, virus bridging infection, the bridging innate and the ad innateaptive and immune adaptive responses. immune As responses. reported Aspreviously, reported previously,aquatic birds aquatic (e.g., birdsthe geese) (e.g., thehave geese) a critical have arole critical in the role transmission in the transmission and dissemination and dissemination of a wide of a widerange rangeof important of important human human and and animal animal pathogens pathogens (e.g., (e.g., avian avian influenza influenza virus). virus). Sequence Sequence and phylogenetic analyses have indicated that goose IFN α shared its highest identity with with duck duck IFN IFNαα [9].[9]. In addition, evolutionary and structural analyses demonstrated a remarkable degree of structuralstructural conservation for IFNγ among vertebrates during the evolutionevolution of immune genes [[24].24]. Goose IFNα is reported toto significantly significantly reduce reduce goose goose paramyxovirus paramyxovirus (GPMV) (GPMV) plaques plaques significantly significantly in goose fibroblastsin goose andfibroblasts restrict and the VSV-EGFPrestrict the inVSV-EGFP duck fibroblasts in duck [ 9fibroblasts]. Goose IFN [9].γ Goosealso induced IFNγ also an antiviral inducedstate an antiviral against GPMVstate against in goose GPMV fibroblasts in goose and fibroblasts inhibited and VSV-GEFP inhibited replication VSV-GEFP in replication duck fibroblasts in duck [10 fibroblasts]. Based on [10]. the similarBased on genomic the similar structure genomic and structure previous and studies, previous we suspected studies, we that suspected goose IFN thatα gooseand IFN IFNγ αmay and confer IFNγ cross-speciesmay confer cross-species antiviral activity antiviral in heterologous activity in heterologous cells. cells. In our study, goosegoose IFNIFNα and IFNγ were shown to possess an ability to inhibit DPV replication during latelate stage stage in duckin duck cells cellsin vitro in .vitro. Conventionally, Conventionally, the type the I interferons type I interferons are the major are components the major ofcomponents the innate of immune the innate response immune of re hosts.sponse In of the hosts. present In the study, present the study, type the II interferon, type II interferon, also known also asknown IFNγ as, was IFN identifiedγ, was identified as possessing as possessing considerable considerable antiviral antiviral activity uponactivity DPV upon infection. DPV infection. Indeed, duringIndeed, infection during infection with DPV-EGFP, with DPV-EGFP, the viral genethe viral copies gene decreased copies decreased markedly uponmarkedly addition upon of addition goIFNα andof goIFN goIFNα γand. Therefore, goIFNγ. Therefore, it can be simply it can be inferred simply that inferred type Ithat interferons type I interferons induce an induce antiviral an responseantiviral andresponse provide and the provide protection the againstprotection DPV-EGFP. against Interestingly,DPV-EGFP. theInterestingly, functional typethe functional II IFN antiviral type systemII IFN alsoantiviral appeared system to also be involved appeared in to this be process. involved Both in this duck process. type I IFNBoth and duck type type II IFNI IFN system and type contribute II IFN tosystem the host contribute antiviral to effect the host on DPV. antiviral Furthermore, effect on DEFDPV. pretreatment Furthermore, with DEF IFN pretreatment protein resulted with IFN in a dose-dependentprotein resulted in inhibition a dose-dependent of DPV-EGFP inhibiti comparedon of DPV-EGFP to the control. compared to the control. One possible explanation is that the interferons might modulate IFN antiviral proteins signaling transduction via expression of interferon-stimulated genes [25]. To fully understand the role of interferons in the primary immune response following interferon activation, we sought to determine

Viruses 2016, 8, 195 10 of 12

One possible explanation is that the interferons might modulate IFN antiviral proteins signaling transduction via expression of interferon-stimulated genes [25]. To fully understand the role of interferons in the primary immune response following interferon activation, we sought to determine the expression level of interferon-stimulated genes in cells activated by interferons. We speculated that the transcriptional levels of ISGs may contribute to the duck cellular antiviral state triggered by goose IFNα and IFNγ. ISGs encode specific proteins that have antiviral properties, interfering with viruses at different stages of their replication cycle. Although IFNα and IFNγ share no obvious sequence or structural homology, there do exhibit functional similarities, such as overlap in the ISGs they induce. Interestingly, IFNs have been reported to have strong antiviral activity in heterologous cells of different types. For example, the human interferons were less active in heterologous rabbit cells than in homologous human fibroblasts [26]. Additionally, a greater activity was observed in bovine and porcine cells treated with human interferons than that in homologous human cells [27]. Heterologous activity of mouse interferons was also reported [28], and pigeon IFNγ has been reported to be active in a chicken macrophage cell line [29]. Therefore, it appears that goose interferons induce the expression of a series of interferon-stimulated genes in duck cells, as the selected duck ISGs, including Mx and OASL, were all upregulated with the goose IFNs activation. Taken together, these results indicate that interferons can enhance an effective host immune response to protect against infection. The antiviral effect of goose IFNs in heterogeneous duck cells may be related to a higher production of ISGs, such as Mx and OASL. The Mx protein, a potent antiviral restriction factor, inhibits a diverse range of viruses at unique steps in their life cycle, including inhibition of RNA polymerase, viral nucleocapsids production, genome replication and chromosomal integration [14,30]. Both duMx and goMx can be induced by goose IFNα and IFNγ. In addition, the OAS gene family can be induced by both IFNs, then the OAS enzymes expressed participate in the synthesis of 21-51-linked oligoadenylates from ATP, which can subsequently stimulate the RNase L for the degradation of viral and cellular RNAs [31–33]. In this study, the goose OASL and duck OASL were likely induced, suggesting that duOASL may assist in this antiviral process. During the early phase of viral infection in mammals, IFNs recognize IFNR via autocrine and paracrine pathways and induce the phosphorylation of IRF7 [34], a key regulator of the high production of IFNs in the late stage [35]. At both the early and late stages, interferons contribute to the host’s strong antiviral defense. However, in birds, some immune defense genes and regulatory cytokines have been lost during evolution [36], and self-regulation in avian has not been reported to date. Even more interesting is our observation that the goose IFN can activate the feedback loop in duck cells. The expression of three types of goose IFNs in GEFs have been examined thus far, and the positive feedback loop of type I IFN and type II IFN has been confirmed in both homologous (goose) and heterogeneous (duck) cells (Figure6 and Figure S3). These similarities may also partly explain the self-feedback of interferons, which was also activated in two species. This type of the positive feedback provides the host cells with long-lasting and strong antiviral responses. Further investigation confirmed that the auto-amplification loop of IFNs was also involved in the defense against viral infection.

5. Conclusions In conclusion, this study highlights the antiviral activity of goose interferons and their cross-species activity. These functions appear to be related to the modulation of the IFN-induced antiviral proteins, such as Mx and OASL. It is important to elucidate the detailed mechanisms of the goose antiviral immune system, as such details may provide invaluable insights for the development of animal antiviral therapeutics. Overall, studies of interferons will help in the development of prophylactic and therapeutic approaches against viral disease, and the functional signiﬁcance of interferons deserves further investigation. Viruses 2016, 8, 195 11 of 12

Acknowledgments: This work was funded by grants from the Ph.D. Programs Foundation of Ministry of Education of China (20125103120012), the Innovative Research Team Program in Education Department of Sichuan Province (No. 2013TD0015), the National Science and Technology Support Program (2015BAD12B05), the Integration and Demonstration of Key Technologies for the Duck Industry in Sichuan Province (2014NZ0030), and China Agricultural Research System (CARS-43-8). Author Contributions: Hao Zhou performed most of the experiments with the help of Yunan Wei and Shun Chen; Hao Zhou and Shun Chen performed the data analysis and wrote the paper. Hao Zhou, Shun Chen and Anchun Cheng designed the study; Mingshu Wang, Renyong Jia, Dekang Zhu, Mafeng Liu, Fei Liu, Qiao Yang, Ying Wu, Kunfeng Sun, Shun Chen; Anchun Cheng supervised the study and provide the materials. Xiaoyue Chen and Qin Zhou gave the experimental support. Conﬂicts of Interest: The authors declare no conﬂict of interest.

Abbreviations The following abbreviations are used in this manuscript: PRRs pattern recognition receptors PAMPs pathogen-associated molecular patterns IFN interferon Mx myxovirus resistance OASL oligoadenylate synthetases-like ISGs IFN-stimulated genes DPV duck plague virus IBV infectious bronchitis virus IBDV infectious bursal disease virus MDV Marek’s disease virus

References

1. Samuel, C.E. Antiviral actions of interferons. Clin. Microbiol. Rev. 2001, 14, 778–809. [CrossRef][PubMed] 2. Sadler, A.J.; Williams, B.R. Interferon-inducible antiviral effectors. Nat. Rev. Immunol. 2008, 8, 559–568. [CrossRef][PubMed] 3. Pei, J.; Sekellick, M.J.; Marcus, P.I.; Choi, I.S.; Collisson, E.W. Chicken interferon type I inhibits infectious bronchitis virus replication and associated respiratory illness. J. Interferon Cytokine Res. 2001, 21, 1071–1077. [CrossRef][PubMed] 4. Mo, C.W.; Cao, Y.C.; Lim, B.L. The in vivo and in vitro effects of chicken interferon α on infectious bursal disease virus and newcastle disease virus infection. Avian Dis. 2001, 45, 389–399. [CrossRef][PubMed] 5. Levy, A.M.; Heller, E.D.; Leitner, G.; Davidson, I. Effect of native chicken interferon on MDV replication. Acta Virol. 1999, 43, 121–127. [PubMed] 6. Li, G.; Zeng, Y.; Yin, J.; Lillehoj, H.S.; Ren, X. Cloning, prokaryotic expression, and biological analysis of recombinant chicken IFN-gamma. Hybridoma 2010, 29, 1–6. [CrossRef][PubMed] 7. Schultz, U.; Kock, J.; Schlicht, H.J.; Staeheli, P. Recombinant duck interferon: A new reagent for studying the mode of interferon action against hepatitis B virus. Virology 1995, 212, 641–649. [CrossRef][PubMed] 8. Schultz, U.; Chisari, F.V. Recombinant duck interferon gamma inhibits duck hepatitis B virus replication in primary hepatocytes. J. Virol. 1999, 73, 3162–3168. [PubMed] 9. Li, H.T.; Ma, B.; Mi, J.W.; Jin, H.Y.; Xu, L.N.; Wang, J.W. Cloning, in vitro expression and bioactivity of goose interferon α. Cytokine 2006, 34, 177–183. [CrossRef][PubMed] 10. Li, H.T.; Ma, B.; Mi, J.W.; Jin, H.Y.; Xu, L.N.; Wang, J.W. Molecular cloning and functional analysis of goose interferon γ. Vet. Immunol. Immunopathol. 2007, 117, 67–74. [CrossRef][PubMed] 11. Suresh, M.; Karaca, K.; Foster, D.; Sharma, J.M. Molecular and functional characterization of turkey interferon. J. Virol. 1995, 69, 8159–8163. [PubMed] 12. Kaiser, P.; Sonnemans, D.; Smith, L.M. Avian IFN-γ genes: Sequence analysis suggests probable cross-species reactivity among galliforms. J. Interferon Cytokine Res. 1998, 18, 711–719. [CrossRef][PubMed] 13. Schneider, W.M.; Chevillotte, M.D.; Rice, C.M. Interferon-stimulated genes: A complex web of host defenses. Annu. Rev. Immunol. 2014, 32, 513–545. [CrossRef][PubMed] 14. Haller, O.; Staeheli, P.; Schwemmle, M.; Kochs, G. Mx GTPases: Dynamin-like antiviral machines of innate immunity. Trends Microbiol. 2015, 23, 154–163. [CrossRef][PubMed] 15. Zhu, J.; Ghosh, A.; Sarkar, S.N. OASL—A new player in controlling antiviral innate immunity. Curr. Opin. Virol. 2015, 12, 15–19. [CrossRef][PubMed] Viruses 2016, 8, 195 12 of 12

16. Balachandran, S.; Roberts, P.C.; Brown, L.E.; Truong, H.; Pattnaik, A.K.; Archer, D.R.; Barber, G.N. Essential role for the dsRNA-dependent protein kinase PKR in innate immunity to viral infection. Immunity 2000, 13, 129–141. [CrossRef] 17. Honda, K.; Takaoka, A.; Taniguchi, T. Type I interferon gene induction by the interferon regulatory factor family of transcription factors. Immunity 2006, 25, 349–360. [CrossRef][PubMed] 18. Takaoka, A.; Yanai, H. Interferon signalling network in innate defence. Cell. Microbiol. 2006, 8, 907–922. [CrossRef][PubMed] 19. Spieker, J.O.; Yuill, T.M.; Burgess, E.C. Virulence of six strains of duck plague virus in eight waterfowl species. J. Wildl. Dis. 1996, 32, 453–460. [CrossRef][PubMed] 20. Keel, M.K.; Stallknecht, D.; Cobb, D.; Cunningham, M.; Goekjian, V.; Gordon-Akhvlediani, S.; Fischer, J.R. The epizootiology of anatid herpesvirus 1 infection in free-ﬂying waterfowl: A comparison of latent and active infections among native waterfowl, captive-reared released ducks, and peridomestic or feral ducks. J. Wildl. Dis. 2013, 49, 486–491. [CrossRef][PubMed] 21. Wang, G.; Qu, Y.; Wang, F.; Hu, D.; Liu, L.; Li, N.; Yue, R.; Li, C.; Liu, S. The comprehensive diagnosis and prevention of duck plague in northwest Shandong Province of China. Poult. Sci. 2013, 92, 2892–2898. [CrossRef][PubMed] 22. Wozniakowski, G.; Samorek-Salamonowicz, E. First survey of the occurrence of duck enteritis virus (DEV) in free-ranging Polish water birds. Arch. Virol. 2014, 159, 1439–1444. [CrossRef][PubMed] 23. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2´∆∆CT method. Methods 2001, 25, 402–408. [CrossRef][PubMed] 24. Savan, R.; Ravichandran, S.; Collins, J.R.; Sakai, M.; Young, H.A. Structural conservation of interferon gamma among vertebrates. Cytokine Growth Factor Rev. 2009, 20, 115–124. [CrossRef][PubMed] 25. Schoggins, J.W.; Wilson, S.J.; Panis, M.; Murphy, M.Y.; Jones, C.T.; Bieniasz, P.; Rice, C.M. A diverse range of gene products are effectors of the type I interferon antiviral response. Nature 2011, 472, 481–485. [CrossRef] [PubMed] 26. Desmyter, J.; Rawls, W.E.; Melnick, J.L. A human interferon that crosses the species line. Proc. Natl. Acad. Sci. USA 1968, 59, 69–76. [CrossRef][PubMed] 27. Gresser, I.; Bandu, M.T.; Brouty-boye, D.; Tovey, M. Pronounced antiviral activity of human interferon on bovine and porcine cells. Nature 1974, 251, 543–545. [CrossRef][PubMed] 28. Buckler, C.E.; Baron, S. Antiviral action of mouse interferon in heterologous cells. J. Bacteriol. 1966, 91, 231–235. [PubMed] 29. Fringuelli, E.; Urbanelli, L.; Tharuni, O.; Proietti, P.C.; Bietta, A.; Davidson, I.; Franciosini, M.P. Cloning and expression of pigeon IFN-γ gene. Res. Vet. Sci. 2010, 89, 367–372. [CrossRef][PubMed] 30. Verhelst, J.; Hulpiau, P.; Saelens, X. Mx proteins: Antiviral gatekeepers that restrain the uninvited. Microbiol. Mol. Biol. Rev. 2013, 77, 551–566. [CrossRef][PubMed] 31. Dong, B.; Silverman, R.H. 2-5A-dependent RNase molecules dimerize during activation by 2-5A. J. Biol. Chem. 1995, 270, 4133–4137. [PubMed] 32. Justesen, J.; Hartmann, R.; Kjeldgaard, N.O. Gene structure and function of the 2’-5’-oligoadenylate synthetase family. Cell. Mol. Life Sci. 2000, 57, 1593–1612. [CrossRef][PubMed] 33. Silverman, R.H. Viral encounters with 2’,5’-oligoadenylate synthetase and RNase L during the interferon antiviral response. J. Virol. 2007, 81, 12720–12729. [CrossRef][PubMed] 34. Au, W.C.; Moore, P.A.; LaFleur, D.W.; Tombal, B.; Pitha, P.M. Characterization of the interferon regulatory factor-7 and its potential role in the transcription activation of interferon a genes. J. Biol. Chem. 1998, 273, 29210–29217. [CrossRef][PubMed] 35. Marie, I.; Durbin, J.E.; Levy, D.E. Differential viral induction of distinct interferon-α genes by positive feedback through interferon regulatory factor-7. EMBO J. 1998, 17, 6660–6669. [CrossRef][PubMed] 36. Magor, K.E.; Miranzo Navarro, D.; Barber, M.R.; Petkau, K.; Fleming-Canepa, X.; Blyth, G.A.; Blaine, A.H. Defense genes missing from the ﬂight division. Dev. Comp. Immunol. 2013, 41, 377–388. [CrossRef][PubMed]

© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).