An Auxin Minimum Triggers the Developmental Switch from Cell Division to Cell Differentiation in the Arabidopsis Root

AN AUXIN MINIMUM TRIGGERS THE DEVELOPMENTAL

SWITCH FROM CELL DIVISION TO CELL DIFFERENTIATION

IN THE ARABIDOPSIS ROOT

Riccardo Di Mambro1,*,#, Micol De Ruvo1,6,7,*, Elena Pacifici1, Elena Salvi1, Ross

Sozzani2, Philip N. Benfey3, Wolfgang Busch4, Ondrej Novak5, Karin Ljung5, Luisa

Di Paola6, Athanasius F. M. Marée7, Paolo Costantino1, Verônica A. Grieneisen7,†,

Sabrina Sabatini1,8,†.

1: Dipartimento di Biologia e Biotecnologie, Laboratory of Functional Genomics and Proteomics of Model

Systems, Università di Roma, Sapienza - via dei Sardi, 70 - 00185 Rome, Italy.

2: Department of Plant and Microbial Biology, North Carolina State University, Raleigh, NC, United States.

3: Department of Biology and Howard Hughes Medical Institute, Duke University, Durham, North Carolina

27708, USA.

4: Gregor Mendel Institute (GMI), Austrian Academy of Sciences, Vienna Biocenter (VBC), Dr. Bohr-Gasse 3,

1030 Vienna, Austria.

5: Umeå Plant Science Centre, Department of Forest Genetics and Plant Physiology, Swedish University of

Agricultural Sciences, SE-901 83 Umeå, Sweden.

6: Unit of Chemical-physics Fundamentals in Chemical Engineering, Department of Engineering, Università

Campus Bio-Medico di Roma, via Álvaro del Portillo 21, 00128 Rome, Italy.

7: Computational and Systems Biology, John Innes Centre, Norwich Research Park, Norwich NR4 7UH, UK.

8: Istituto Pasteur-Fondazione Cenci Bolognetti.

* These authors contributed equally to this work

# Present address: Dipartimento di Biologia, Università di Pisa - via Ghini, 13 - 56126 Pisa, Italy.

† Authors for correspondence

Tel: 39-06-49917916

Fax: 39-06-49917594 e-mail: [email protected] e-mail: [email protected]

Supporting Information Appendix

Materials and methods

Root Length, Meristem Size and Cell Size Analysis

For root length measurements, plates were photographed and the resulting images were analysed using the image analysis software ImageJ 1.47v available online

(http://rsbweb.nih.gov/ij/). Root meristem size for each plant was measured based on the number of cortex cells in a file extending from the quiescent centre to the first elongated cortex cell excluded, as described previously (1, 2). The cortex is the most suitable tissue to count meristematic cells, as its single cell type composition shows a conserved number of cells among different roots. The boundary between dividing and differentiating cells for each tissue is called transition boundary (TB), while the region including the different transition boundaries is called transition zone (1) (TZ) (Fig. 1).

Cell-o-Tape (3), a Fiji (http://fiji.sc/Fiji) macro, was used to count and measure individual neighbouring cells along a defined file as well as to estimate the position of the last cortical cell at the TB (SI Appendix, Table S1). Images were obtained using a confocal laser scanning microscope (Zeiss LSM 780). For each experiment a minimum of 30 plants for two biological replicates were analysed. Chosen settings in

Cell-o-Tape: threshold = 10; stringency = 2.5. Student’s t test, P < 0.05, n=30

(http://graphpad.com/quickcalcs/ttest1/).

Differential Interference Contrast (DIC) with Nomarski technology microscopy (Zeiss

Axio Imager A2) was used to count meristem cell number. Plants were mounted in a chloral hydrate solution (8:3:1 mixture of chloral hydrate:water:glycerol).

2 pGH3.17:GH3.17-GFP plants were analysed by confocal laser scanning. The cell wall was stained with 10 μM propidium iodide. A minimum of 20 roots for 12 independent transgenic lines were analysed.

GUS Histochemical Assay

To visualize pARR1::ARR1:GUS lines, GUS histochemical assay was performed using the β-glucuronidase substrate X-gluc (5-bromo-4-chloro-3-indolyl glucuronide,

Duchefa) dissolved in N-N-dimethyl-formamide. X-gluc solution, composed of 100 mM Na2HPO4, 100 mM NaH2PO4, 0.5 mM K3 Fe(CN)6, 0.5 mM K4Fe(CN)6,

0.1% Triton X-100, and 1 mg/ml X-gluc, was prepared as previously described (2).

Five-day old seedlings were incubated for 20 hours at 37°C in the dark and imaged using the Axio Imager.A2 (Zeiss) microscope.

Generation and Characterization of Transgenic Plants

Standard molecular biology techniques and the Gateway system (Invitrogen) were used for the cloning procedures. Genomic DNA from Arabidopsis ecotype Columbia

(Col-0) was used as the template for amplification. For the translational fusion with the GFP, the promoter sequence of GH3.17 (AT1G28130) (2,128 base pairs (bp)) was amplified using the pGH3.17 primers (SI Appendix, Table S6) and the PCR product was then cloned into pENTR5’-TOPO TA vector. The genomic sequence of GH3.17

(2450 bp) was amplified using the gGH3.17 primers (SI Appendix, Table S6) and cloned in a pDONOR221. A LR reaction was then conducted by using the promoter and genomic sequence of GH3.17, and a c-term pDONORP2P3-GFP. For pUBQ10::GH3.17 transgenic plant, pDONORP4P1-pUBQ10 vector and genomic sequence of GH3.17 were used. The LR products were then sub cloned in the

Gateway pBm43GW destination vector. Plasmids were transformed into Col-0 plants by floral dipping (4). pGH3.17:GH3.17-GFP fusion was tested to be functional by rescuing the gh3.17-1 mutant phenotype.

RNA Isolation and qRT-PCR

Total RNA was isolated from root tissues of 5-day-old seedlings using RNeasy®

Micro Kit (Quiagen) and the first strand cDNA was synthesized using the

Superscript® III First Strand Synthesis System (Invitrogen). Transcript levels were monitored by qRT-PCR using gene-specific oligonucleotide primers (SI Appendix,

Table S6). qRT-PCR reactions were performed with Sensi Fast SYBR (Bioline) using a 7500 Fast Real-Time PCR system (Applied Biosystems), according to the manufacturer’s instructions.

Data were analysed using the ∆∆Ct (cycle threshold) method and normalized with the expression of the reference gene ACTIN2. For each analysis, three technical replicates of qRT-PCR were performed on two independent RNA batches. Results were comparable in all experiments. Student’s t-test was used for data significance

(http://graphpad.com/quickcalcs/ttest2.cfm).

Chromatin Immunoprecipitation, ChIP-chip and ChIP-qRT-PCR

For the genome-wide identification of ARR1 direct targets, we first conducted

Chromatin Immunoprecipitation and then hybridized the amplified precipitate to a custom Agilent microarray (ChIP-chip) that contains probes representing a large proportion of all Arabidopsis promoter regions (5). Two independent ChIP experiments were performed on the roots of either 5-day-old seedlings, expressing

ARR1 genomic sequence under the control of its own promoter fused to GFP

(pARR1::ARR1-GFP plants) (4), or Col-0 plants. ChIP was performed as described in

Sozzani et al. 2010 (6), except that DNA-free protein A agarose beads (Invitrogen) and a rabbit polyclonal antibody against GFP (ab290, Abcam) were used. DNA from these experiments was amplified using a random-primer-based genome amplification method described in http://cat.ucsf.edu/pdfs/22_Round_A_B_C_protocol.pdf, with minor modifications. After labelling with Cy3 and Cy5, respectively, following an amino-allyl-dye coupling protocol (http://camd.bio.indiana.edu/files/amino-allyl- protocol.pdf), DNA was cleaned up using the PCR purification kit (Qiagen) and 3 μg from the ChIP and from the mock samples were taken and mixed for hybridization to a custom long oligonucleotide (60 bases) Arabidopsis promoter microarray that has been described in Sozzani et al., 2010 (6). Two independent labeling reactions and subsequent hybridizations were performed from each biological replicate to perform dye-swaps. Hybridization was performed according to the Agilent ChIP-chip protocol, and images were obtained using an Agilent microarray scanner (model G2565BA) at a resolution of 5 μm. Signal extraction and initial data processing were done using the

Agilent feature extraction software.

For ChIP-chip analysis, to assess genome-wide binding for the processed signal ratio

(SR = signal of ARR1-GFP / signal Col-0) of each probe on the array, a Z-Score (ZS)

was calculated as follows: . These empirical ZS-values for each probe of

the independent ChIP-chip experiments were added. Enrichment was scored by: (1) the length of DNA regions that were covered by probes above a defined ZS-value threshold; (2) a local ZS maximum (seed) and (3) the number of nucleotides allowed as gaps within called regions. For each combination of parameters, the detected regions were registered. A gene was assigned to an enriched region if that region was

5 present within 4,000 bp upstream or 300 bp downstream of the transcription start site in an intron, or 300 bp downstream of the gene model. Each parameter combination produced a list of called regions and thus of assigned genes. The proportion of genes that were classified as regulated by ARR1 was recorded for each list. The optimal enrichment detection criteria were defined by those parameters that yielded the highest proportion of ARR1-regulated genes and a major fraction of the already described ARR1 direct genes. These settings were: probe ZS seed > 13; probe ZS > 6; minimum length of hybridization above probe ZS threshold, 175 nucleotides; maximum gap, 125 nucleotides.

Gene ontology enrichment categories were found using ChipEnrich software (6)

(http://www.arexdb.org/software.jsp) (SI Appendix, SI Appendix, Fig. S3B).

The enrichment of the GH3.17 target promoter-regions DNA was confirmed using

RT-qPCR (SI Appendix, SI Appendix, Fig. S3A). A qPCR efficiency of 2-fold amplifications per cycle was assumed, and sequences from UBIQUITIN 10 were used to normalize the results between samples.

Tiling along the GH3.17 (AT1G28130) was done using sets of adjacent specific amplified regions (SI Appendix, SI Appendix, Fig. S3A and SI Appendix, Table S6) along 2,1 Kb region of the GH3.17 promoter. Accession codes Gene Expression

Omnibus: GSE70595.

pGH3.17:GH3.17-GFP and DR5::GFP Fluorescence Quantification

The fluorescence intensity of plants carrying pGH3.17:GH3.17-GFP (SI Appendix,

SI Appendix, Fig. S3F – I) or DR5::GFP (SI Appendix, SI Appendix, Fig. S6) was quantified by the plugin MeasureRGB of the software ImageJ on confocal laser scanning microscope images taking as ROI the expression domain of GH3.17 and

DR5 respectively. pGH3.17:GH3.17-GFP and DR5::GFP expression was derived by normalizing the results for the chosen area. A total of 20 plants for two biological replicates were analysed (mean values and SD are plotted in SI Appendix, SI

Appendix, Fig. S3G – I and SI Appendix, SI Appendix, Fig. S6B). For pGH3.17:GH3.17-GFP upon cytokinin treatment experiment ∑ green pixels (Raw

Intensity Density - RawIntDen) was 12.38 ± 2.5 and 21.2 ± 2.3 (Student’s t test, P <

0.05). For pGH3.17:GH3.17-GFP upon auxin treatment experiment, no significant changes were found. For DR5::GFP experiment RawIntDen was 30.46 ± 3.71 and

44.65 ± 7.32. (Student’s t test, P < 0.05).

Analysis of PIN Expression

Confocal laser scanning microscope images of plants expressing PIN1:, PIN2:, PIN3: and PIN7:GFP translational fusions (10) were used to quantify PIN fluorescence in all root tissues and zones. To compute PIN expression, the GFP intensity was quantified using the plugin MeasureRGB of the software ImageJ. The resulting

RawIntDen value was normalized for the chosen area. The selected areas were: MZ

(from the staminal cell excluded to the cortex TB); DFZ subdivided - according to different cell length/morphology - into region 1 of a fixed height from cortex TB, region 2 of fixed height from the end of the region 1, and region 3 approximated as region 2 (Fig. 1). PIN expression in each tissue of the chosen area was then quantified. To compute relative PIN permeability values, for each PIN the maximum intensity of GFP (GFPi,max) was set to 2 μm/s (PINmax), in accordance with the average permeability value reported in Rutschow et al. 2014 (7). The minimum value of permeability was assumed to be 10 folds lower (PINmin) (i.e., comparable to passive efflux PIAA-, in accordance with Grieneisen et al. 2007 (8)). The total efflux results

7 from the sum of each member contribution: shootward efflux directed by PIN2; rootward efflux results from PIN1, 3, 7 along the entire length of the root and PIN2 in the cortex of MZ (SI Appendix, SI Appendix, Fig. S1A, SI Appendix, SI Appendix,

Fig. S2A and SI Appendix, Table S3), in accordance with experimental measurements and previous works (9, 10, 22). Reflecting cytokinin effect, the overall PIN strength was measured as weaker in the MZ than in the DFZ (as also reported in Laskowski et al. 2008 (9)) (SI Appendix, SI Appendix, Fig. S2A and SI Appendix, Table S3).

Differences in PIN expression in each zone and tissue were then translated into permeability values as follows:

N N

Where is the GFP intensity measured for each PIN in different tissues and zones, and N is the resulting value reported in SI

Appendix, Table S3. A total of 15 plants for each PIN were analysed (Student’s t test,

P < 0.05).

Hormonal Treatments

The 5-day-old seedlings were transferred to solid one-half MS medium containing mock conditions or a suitable concentration of hormone. For auxin treatment, we used indole-3-acetic acid (IAA, Duchefa) at a final concentration of 5 μM. For cytokinin treatment, we used trans-zeatin (tZ, Duchefa) at a final concentration of 5 μM (for the experiment reported in Fig. 3) and 10nM (for the experiment reported in Fig. 5). For dexamethasone (Dex, Sigma) treatment, a final concentration of 5 μM was used. For

NPA treatment, 10 μM NPA (Duchefa) was used.

Degradation Rate Measurement

To quantify degradation rate, DII-VENUS plants grown on MS media were transferred on media containing 10 µM of the transport inhibitor NPA and 5 µM of auxin IAA in order to saturate the system with auxin and to inhibit the polar auxin transport activity

(i.e. to only allow the molecule to be degraded). After 2 h of treatment (t0) plants were transferred on media containing 10 µM NPA to observe only the auxin degradation phenomena, as a recovery of DII-VENUS expression, given that auxin transport via

PINs was inhibited and passive auxin transport was assumed to be negligible. The recovery of DII-VENUS expression was analysed in a time lapse confocal microscopy experiment every 30 minutes (30 min, 1 h, and 1 h 30 min time points). A total of 15 plants for each time point were used. The auxin degradation rate (δGH3) was calculated assuming the process to occur with a first-order kinetics:

DII-VENUS expression was quantified on root confocal images at each time point via the software ImageJ (Student’s t test, P < 0.05). The fluorescence intensity measured for the untreated plants (grown on MS medium) was translated into auxin concentration values [IAA]. To derive auxin concentration values, we took into account the nonlinear inverse relationship between auxin levels and DII-VENUS expression (12, 13). The average auxin concentration value in untreated roots was derived from Ljung et al. 2005 (14).

The concentration values for each time point were obtained according to the following equality:

Auxin concentration data at each time point were interpolated using Matlab curve

−4 -1 fitting tool CFtool, obtaining a numerical value for δGH3 of 10 s (SI Appendix,

Table S2) (R= 0.998 with 95% interval of confidence).

Quantification of Endogenous Auxin Metabolites

For auxin quantification, WT and gh3.17-1 whole roots (10 mg fresh weight) and 1 mm root tips (100 pieces) were collected for each biological replicate. Extraction was performed following the procedure described in Novák et al. 2012 (15) with minor modifications. Frozen samples were homogenized using a MixerMill (Retsch GmbH,

Haan, Germany) and extracted in 1 ml 50 mM sodium phosphate buffer (pH 7.0)

13 containing 1% sodium diethyldithiocarbamate and the cocktail of deuterium and C6- labeled internal standards. The pH was adjusted to 2.7 with 1 M hydrochloric acid, and the extracts were purified on Oasis HLB columns (30 mg, Waters Corp., Milford,

USA). Quantification of IAA and IAA metabolites was performed by LC-MS/MS using a 1290 Infinity LC system and 6460 Triple Quad LC/MS system (15) (Agilent

Technologies, Santa Clara, USA).The samples were analyzed in 4-5 biological replicates.

Analysis of R2D2 Fluorescence Quantification

R2D2 combines RPS5A-driven DII fused to n3×Venus and RPS5A-driven mDII fused to ntdTomato on a single transgene (16). The analysis of fluorescence intensity of untreated (grown on MS medium) and cytokinin-treated plants was performed on

Maximum Intensity Projection of Z-stack of root tip acquired with a Zeiss LSM 780

10 laser-scanning microscope (EC Plan-Neofluar 40x/1.30 Oil, YFP - Ch1 : 513 – 541, tdTomato - ChS1 : 568 – 594, Propidium Iodide - Ch2 : 654 – 700).

To analyse the fluorescence signal in cell nuclei of selected root tissues (epidermis, cortex, endodermis), we used the ROI manager tool of the software Fiji, selecting nuclei area. The resulting signal was obtained by computing the ratio between DII signal and mDII signal for each cell nucleus. Auxin levels data in each cell per tissue were graphed after data interpolation using Matlab algorithm smoothing spline, with a smoothing parameter of 0.999.

Starting from the cortex tissue, we checked whether the maximum of signal intensity ratio (MSIR) matched the position of the last meristematic cell (LMC - identified as in paragraph Root Length, Meristem Size and Cell Size Analysis) ±1 cell. This correspondence occurred in 60% of the cases for R2D2 MS roots (n = 10, chi-square test, P < 0.05) and 67% for 20h cytokinin-treated R2D2 roots (n = 12, chi-square test,

P < 0.05) (Fig. 3A, C).

The analysis on epidermis and endodermis tissues were performed comparing the position of MSIR with the position of the cortex LMC. Along the longitudinal axis of the corresponding tissue, we considered as a positive match those cells lying ±4 cells from the cortex LMC, to include variations in the position of the TB of each tissue.

For the endodermis a match was detected in the 70% of the cases for R2D2 MS roots

(n = 10, chi-square test, P < 0.05) and 42% for 20h cytokinin-treated R2D2 roots (n =

12, chi-square test, P < 0.05). For the epidermis a match was detected in the 70% of the cases for MS roots (n = 10, chi-square test, P < 0.05) and 83% for 20h cytokinin- treated roots (n = 12, chi-square test, P < 0.05) (Fig. 3A, C).

The cortex MSIR for the 12h cytokinin-treated roots, where the position of the cortex

LMC is unchanged from untreated roots, was detected in the 77% of the roots (n = 17, chi-square test, P < 0.05) at an average of 6 cells below the cortex LMC (Fig. 3B).

For the 12h cytokinin-treated roots, we then checked if a shift in the MSIR occurred also in the epidermis and endodermis. A rootward shift of the MSIR was detected in the 53% (for the epidermis) and 71% (for the endodermis) of the roots (n = 17, chi- square test, P < 0.05) compared to the position of the cortex LMC in Fig. 3B.

A rootward shift in the auxin minimum (aligned MSIR for cortex, epidermis and endodermis) was found in the 47% of the roots (n = 17, chi-square test, P < 0.05) of the 12h cytokinin-treated roots. Notably, 82% of the analysed roots did not show an auxin minimum at the TZ, and none of the analysed tissues showed the auxin minimum shifted above the TZ (Fig. 3B).

Moreover, in the 12h cytokinin-treated roots the auxin minimum for all analysed tissues lays at the same position as in the 20h cytokinin-treated roots (compare Fig. 3B and C).

The correspondence between the R2D2 cortex MSIR and the position of the R2D2 cortex LMC in the experiment reported in figure 5 is equal to 60% (n = 15, chi-square test, P < 0.05) and 61% (n = 18, chi-square test, P < 0.05) for untreated and cytokinin treated roots respectively. For the endodermis a positive match (endodermis cells lying ±4 cells from the cortex LMC) was detected in the 75% of the cases for R2D2 untreated roots (n = 15, chi-square test, P < 0.05) and 80% for 20h cytokinin-treated

R2D2 roots (n = 18, chi-square test, P < 0.05). For the epidermis a match was detected in the 80% of the cases for MS roots (n = 15, chi-square test, P < 0.05) and 80% for

20h cytokinin-treated roots (n = 18, chi-square test, P < 0.05) (Fig. 5A and B).

The correspondence between the R2D2 cortex MSIR and the position of the R2D2 cortex LMC in the gh3.17-1 mutant (Fig. 5) is equal to 73% (n = 15, chi-square test, P

< 0.05) and 79% (n = 24, chi-square test, P < 0.05) for untreated and cytokinin treated roots respectively (Fig. 5C and D). The analysis of the gh3.17-1 endodermis revealed a positive match (endodermis cells lying ±4 cells from the cortex LMC) in the 79% of the cases for untreated roots (n = 15, chi-square test, P < 0.05) and 67% for 20h cytokinin-treated roots (n = 24, chi-square test, P < 0.05). For the gh3.17-1 epidermis a match was detected in the 67% of the cases for untreated roots (n = 15, chi-square test, P < 0.05) and 71% for 20h cytokinin-treated gh3.17-1 roots (n = 24, chi-square test, P < 0.05) (Fig. 5C and D).

The correspondence between the R2D2 cortex MSIR and the position of the R2D2 cortex LMC in the shy2-31 mutant (Fig. 5) is equal to 67% (n = 21, chi-square test, P

< 0.05) and 90% (n = 13, chi-square test, P < 0.05) for untreated and cytokinin treated roots respectively (Fig. 5E and F). The analysis of the shy2-31 endodermis revealed a positive match (endodermis cells lying ±4 cells from the cortex LMC) in the 62% of the cases for untreated roots (n = 21, chi-square test, P < 0.05) and 85% for 20h cytokinin-treated roots (n = 13, chi-square test, P < 0.05). For the shy2-31 epidermis a match was detected in the 57% of the cases for untreated roots (n = 21, chi-square test, P < 0.05) and 90% for 20h cytokinin-treated roots (n = 13, chi-square test, P <

0.05) (Fig. 5E and F).

The analysis of the auxin minimum on 20h cytokinin-treated roots revealed that a rootward shift of the MSIR and thus of the position of the TZ can be detected only in wild type plants carrying R2D2 reporter (compare Fig. 5A with Fig. 5B). This result suggests that both gh3.17-1 and shy2-31 mutants are cytokinin resistant (a rootward shift of the TZ position and thus a shrink of the meristem cannot be observed in

13 gh3.17-1 and shy2-31 mutants) and that the auxin minimum position is controlled by cytokinin via GH3.17 and SHY2 (a shift of the auxin minimum position cannot be observed in gh3.17-1 and shy2-31 mutants) (compare Fig. 5C with Fig. 5D and Fig.

5E with Fig. 5F).

Statistical analyses were carried out in R version 3.2.3 (http://www.r-project.org/).

Raw fluorescence intensity data were grouped by tissue and normalized to the MSIR fluorescence intensity. ANOVA analysis was conducted to determine if differences between the fluorescence detected in the MSIR and the other cells were significant (P

< 0.05, n = 22 for MS and 20h cytokinin-treated R2D2 roots (Fig. 3); P < 0.05, n = 17 for 12h cytokinin-treated roots (Fig. 3); P < 0.05, n = 33 for MS and 20h cytokinin- treated R2D2 roots (Fig. 5); P < 0.05, n = 39 for MS and 20h cytokinin-treated gh3.17-1xR2D2 roots (Fig. 5); P < 0.05, n = 34 for MS and 20h cytokinin-treated shy2-31xR2D2 roots (Fig. 5)). Adjust P-values for Multiple Comparisons was carried out with the Benjamini & Hochberg (FDR) method.

Statistical Analysis Criteria

For all the experiments, we performed the analysis with a large enough number of samples to ensure statistical significance, as reported in corresponding figure legends and paragraphs of SI Appendix Materials and methods. We excluded samples that showed growth defects that were confirmed genetically not to be related to the genotype.

Simulating the Root System

Auxin dynamics were simulated using a realistic, spatially explicit and multicellular layout of an Arabidopsis root, incorporating subcellular resolution as well as tissue- specific properties. Our general modelling strategy was to analyse the inputs of cytokinin on the auxin spatial distribution machinery, i.e., its regulation of auxin polar transport and catabolism. Given that the impact of the downstream effects of cytokinin were queried within a realistic root layout, it is important to realize how the tissue context and parameters interact.

We describe in this section all the equations used, the choices we made, as well as any specific details. We first describe how we capture and built the root layout (‘Building the 2D Root Layout’). Next we define the partial differential equations that govern the changes in concentration over space and time (‘Auxin Dynamics’); how the fluxes due to membrane and facilitated permeability are taken into account (‘Transport terms’); and how auxin degradation and production are treated (‘Reaction terms’).

These sections explain the full model setting, i.e., the layout, equations and boundary conditions.

The data analysis on which the modelling choices are based regarding where the transporters are positioned on the in silico cells as well as their relative expression levels to describe wild type behaviour, is discussed in the section ‘Analysis of PIN

Expression’. Values used are given in SI Appendix, Table S3. The changes that we applied to the assumptions and parameters in order to capture modified cytokinin action under different mutant and treatment conditions are explained in the section

‘Simulating Defects in Cytokinin Activity’. We thereby fully specify all equations, parameters and boundary conditions used in all the different simulations.

Furthermore, we provide an analysis on the impact of the different individual

15 assumptions in the section ‘Sensitivity and Robustness to Zonation and Inherent

Tissue Properties’, and we explain in the section ‘Numerical Framework’ how our

PDEs, which are continuous equations, are numerically solved, given the highly complex boundary conditions involving the shape of each individual cell.

Building the 2D Root Layout

Simulations of auxin dynamics were numerically solved on a two-dimensional (2D) lattice, which represents a cross-section through the root, capturing the bilateral symmetry of the root across the xylem axis (8). A high spatial resolution was used, to enable the description of a realistic cell wall (spatial resolution of each lattice point is

0.25x0.25 μm2).

For the specific purpose of this work we used a static tissue layout, since auxin distributions generated by a reflux-loop are robust to tissue dynamics (17), as a consequence of the timescale associated with the growth of the root being much slower (hours) than the PIN-driven characteristic time of the patterning due to transport (seconds to minutes). Since we are focusing on dissecting the problem when the balance between cell division and cell differentiation is achieved, we compared steady state profiles.

As we are interested in dissecting the processes occurring locally within the root, we refined the in silico root layout used in our previous studies and added further detailed observed tissue properties (8, 18, 19). Root longitudinal zonation was reproduced accounting for the Stem Cell Niche (SCN), Meristematic Zone (MZ) and

Differentiation Zone (DFZ) (Fig. 1). We assumed the same number of cells and cell length for different tissues belonging to each zone, taking as reference the cortex tissue. Therefore the boundary between the MZ and the DFZ (TZ) lies on a straight

16 horizontal line (Fig. 1). We provided the in silico root with a measured average meristem size (SI Appendix, Table S1). Notably, the resulting root layout is on the same scale as real roots, which allows for a realistic analysis of the processes involved.

According to in vivo observation, we incorporated differences in cell length between each zone, and the DFZ was further subdivided into three zones (DFZ 1, DFZ 2, DFZ

3) with different cell length (Fig. 1).

The current spatial setting allows for a more realistic shape and cellular organization of the root tip as well as for a detailed cell-type specification (Fig. 1), based on observation of typical roots (SI Appendix, Table S1).

Differences in width between cell files were also included, according to measurements of root images obtained using the software ImageJ. Measured cell width varies depending on cell type: 3 μm for lateral root cap cells, 13 μm for epidermal cells, 13 μm for cortical cells, 6 μm for endodermal cells, and 4 μm for vascular and pericycle cells.

Cells are represented as extended regions on a lattice. Given the peculiar features of auxin intercellular transport, cell sub-structure is taken into account. Thus, each cell consists of multiple square grid points as to distinguish between cytosol, cell wall or media. The interface between cytosol and cell wall represents the cell membrane, through which auxin may permeate thanks to transporters, or, to a lower degree, through passive permeation.

The modelled WT root layout consists of 3928 (longitudinal section) x 459

(transversal section) grid points. The diverse simulated mutant and treatment lines and control simulations have deviating lengths due to varying meristem size, while the width is conserved over all simulations. The spatial resolution of the grid was set to

0.25 μm, giving rise to a diameter of 114 μm and a root length of 600 μm, in accordance with experimental measurements (SI Appendix, Table S1).

Modelling Auxin Dynamics

The auxin dynamics in the root combines three distinct modes of gradient formation due to: (i) the reflux-loop caused by the PIN distributions the gradient at the tip (very robust to degradation and production); (ii) the vascular flow in the DFZ that causes a shootwards directed gradient (its steepness as well as the location and level of the dip is degradation dependent (17); and (iii) localized auxin production at the SCN that contributes to a more classical (i.e. source-decay) mode of gradient formation

(degradation plays an important role).

The changes in auxin concentration result from the contribution of transport terms

(simple and facilitated diffusion) and reaction terms (biosynthesis and breakdown), according to the conservation equation:

eq. 1

The left-hand side denotes time change in total amounts of auxin and the right-hand side describes changes in total amounts of auxin due to instantaneous influx and efflux and reaction R(c).

Transport Terms

Auxin distribution across cells requires the coordination between diffusion - within the cell wall and cytoplasm - and auxin transport, which directs influx and polar efflux of auxin between the cytoplasm and the cell wall - crossing the plasma membrane.

Diffusion and permeability were dealt with independently for grid points belonging to

18 cell cytoplasm, membrane or cell wall, using parameter values taken from literature and direct experimental measurements (SI Appendix, Table S2). Diffusion within cells and cell walls follows Fick’s laws, while transport across cell membranes includes both passive and cell-type specific carrier-mediated influx and efflux.

The role of apolar AUX1/LAX influx carriers on auxin distribution at the root tip was introduced in the model as a parameter (PAUX1/LAX) that accounts for the expression pattern of AUX1, LAX2 and LAX3 (SI Appendix, SI Appendix, Fig. S1B), set in accordance with Band et al. 2014 (22), while PIN permeability was set as a space- dependent parameter to include the effect of cytokinin. AUX1/LAX strength was set as a constant permeability value of 2 μm/s, in accordance with Rutschow et al. 2014

(7). Differential PIN strength was set as described above. A minor flux component across membrane arises from passive influx PIAAH and from background efflux permeability PIAA- (SI Appendix, Table S2).

To be able to embed in the model the specific PIN localization on the different sides on cell membrane (inner I, outer O, lower L, upper U) (SI Appendix, SI Appendix,

Fig. S1C), we used an algorithm that compartmentalizes each cell into four different zones, which were oriented upward, downward, inward, or outward, relative to the centroid of that cell (18), and in relation to the midline of the root tissue. In the model, the orientation of PINs is determined by positioning them on the membrane grid points of the different cell zones (SI Appendix, SI Appendix, Fig. S1C). Observed

PIN localization in different tissues and zones of the root was included in the model as indicated in SI Appendix, SI Appendix, Fig. S1A and in SI Appendix, Table S3.

Changes in auxin concentration result from modifications of local fluxes, which depend both on the influx rates along the membrane of the cell and of its close neighbours. Thus, auxin flux across each grid point was computed as:

D =

P = out in in out

D is the flux due to diffusion occurring in the cell wall and cytoplasm with diffusivity , and P is the flux due to auxin permeability across a cell membrane; is the inward directed unit vector, perpendicular to the membrane; cin stands for the auxin concentration in the cytosol at the grid point bordering the cell membrane and cout stands for the auxin concentration in the cell wall grid point immediately adjacent to the cell membrane.

The influx term Pin is given by the sum of the membrane permeability PIAAH, and the permeability PAUX1/LAX due to AUX1/LAX expression. The efflux term Pout is given by the sum of and PIAA-.

Reaction Terms

Together with transport terms, auxin reaction terms include a basal biosynthesis rate b and a basal decay δIAA (i.e. auxin half-life) inside all cells, following the framework used in Grieneisen et al. 2007. In addition, an auxin source in the SCN region (QC and columella stem cells) was introduced (bQC), as auxin produced in the QC both sustains SCN activity and maintenance and acts as a long-range signal to fine tune the level of the early cytokinin response regulator ARR1 in the TZ (20).

Besides introducing cytokinin-affected PIN expression, the derived GH3-mediated degradation rate δGH3 (as described above) was inserted in the model as a space-

20 dependent parameter. Therefore, the reaction terms R(c) were implemented as follows:

, -

Simulating Defects in Cytokinin Activity

To capture the defects in cytokinin regulation on auxin distribution, both the root layout and the auxin dynamics were modified according to experimental observation.

To reproduce the phenotype of gh3.17-1 (Fig. 4C, I – K and Fig. 6) and shy2-31 mutants (Fig. 6), the number of cells in the MZ was increased (Fig. 4D), to reflect the meristem size measurements (Fig. 4J and Fig. 6B). Conversely, to reproduce the phenotype of GH3.17 over-expressing line (pUBQ10::GH3.17) (Fig. 4F, I – K) the number of cells in the MZ was reduced (Fig. 4G), to reflect the meristem size measurements (Fig. 4J) (For parameter setting see SI Appendix, Table S4).

To simulate the absence of cytokinin regulation on auxin degradation, the rate of auxin degradation in the GH3.17 domain (δGH3) was set to zero (Fig. 2A and Fig. 4D,

E). On the other hand, to simulate the cytokinin-dependent ectopic increase in auxin degradation, auxin GH3.17-mediated degradation rate (δGH3) was uniformly increased

(Fig. 2B and Fig. 4G, H) (For parameter setting see SI Appendix, Table S4).

To simulate the absence of cytokinin regulation on PIN expression, the strength of

PINs was set as two-fold higher than the wild type (WT) case (SI Appendix, SI

Appendix, Fig. S7) (For parameter setting see SI Appendix, Table S4).

The case of cytokinin depletion, which leads to defects in the regulation both of auxin transport and degradation, was simulated doubling PIN permeability values and setting δGH3 equal to δIAA (Fig. 7B, C). On the contrary, the case of cytokinin treatment was simulated halving PIN permeability and increasing of one order of magnitude the auxin degradation rate in the GH3.17 domain (Fig. 7D, E) (For parameter setting see

SI Appendix, Table S4).

The model in SI Appendix, SI Appendix, Fig. S2C was built assuming the absence of regulation both on auxin degradation and PIN transport. Therefore, longitudinal uniform PIN strength (SI Appendix, SI Appendix, Fig. S2B) and uniform decay rate

(δIAA) were assigned (For parameter setting see SI Appendix, Table S4).

The model in SI Appendix, SI Appendix, Fig. S2D was built assuming the absence of variation in cell size throughout the root layout, but including PINs as experimentally measured and uniform decay rate (δIAA) (For parameter setting see SI Appendix, Table

S4).

Sensitivity and Robustness to Zonation and Inherent Tissue Properties

Our results indicate that the effects of cytokinin regulation on auxin patterning, in specific, on the emergence of an auxin minimum, operate optimally when the root layout and the length of the zones are set to match experimental observations. This reflects some emergent property of the underlying root tissue. The interplay between optimal minimum formation and root zonation lengths continues to hold even under perturbations of the cytokinin-regulated effects: the minimum under these conditions

22 is only “rescued” when the zone corresponding to the meristem is reduced or extended according to the experimentally observed changes in meristem length. These consistent simulation results clearly indicate that the inherent zonation-dependent properties of the root interact with the cytokinin-regulated effects that we here explore. It is therefore important to understand and untangle which features within the root model underlie the formation of the auxin minimum. To this aim, we performed a series of simulations in which all zonation-dependent properties of the model were dissected independently and analysed in isolation.

As described earlier, our in silico root model is composed out of four different zones, a meristem zone and three differentiation zones. There are in total seven features in our in silico root that change according to this predefined zonation, and which could thus contribute in defining the location and shape of the auxin minimum:

(1) cell sizes vary according to the zonation, as shown in Fig. 1 and SI Appendix,

Table S1;

(2) the lateral root cap is a feature confined to the MZ (Fig. 1);

(3) cortical PIN2 has basal expression in the MZ, after which it becomes expressed apically in the cortex of the DFZ (SI Appendix, SI Appendix, Fig. S1A and SI

Appendix, Table S3);

(4) likewise, PIN2 in the epidermis, PIN1,3,7 in the endodermis undergoes polarity changes from the MZ and DFZ 1 to the DFZ 2 and DFZ 3 (SI Appendix, SI

Appendix, Fig. S1A and SI Appendix, Table S3);

(5) PIN expression levels vary across zones, as indicated in SI Appendix, SI

Appendix, Fig. S2A and SI Appendix, Table S3;

(6) AUX1/LAX is expressed apolarly (SI Appendix, SI Appendix, Fig. S1B);

(7) enhanced auxin degradation occurs following the expression pattern of GH3.17, as displayed in Fig. 2H and SI Appendix, SI Appendix, Fig. S4B, including the epidermis of the DFZ, but not of the MZ.

We first questioned how each of the above seven zonation-dependent attributes impact the auxin patterning on their own, i.e., in the absence of other zonation- dependent properties. We did this by considering a root with meristem-like properties conserved throughout its entire longitudinal extension (SI Appendix, SI Appendix,

Fig. S5A), and adding to this background each of the seven features independently (SI

Appendix, SI Appendix, Fig. S5D – K). The “bare” model, which has no changes regarding zonation at any level, generates only a single apical gradient (SI Appendix,

SI Appendix, Fig. S5D), which spans the entire typical meristem, but then reaching and preserving very low values further shootwards as previously described (8, 21).

Increasing cell sizes along the longitudinal axis (SI Appendix, SI Appendix, Fig. S5B) raises the very low proximal values, rendering the gradient less pronounced and shallower (SI Appendix, SI Appendix, Fig. S5E). This cell-size dependent auxin increase has been reported previously (9), and its mathematical basis is well understood; however, it cannot account for an auxin dip or minimum.

The sudden interruption of the lateral root cap on its own (SI Appendix, SI Appendix,

Fig. S5C) contributes little to the apical gradient (SI Appendix, SI Appendix, Fig.

S5F); likewise neither the cortical nor the epidermal PIN2 and the endodermal PIN1,

3, 7 polarity change at the TZ on their own affect much this gradient (SI Appendix, SI

Appendix, Fig. S5G, H). Changes were more perceptible, however, when PIN permeability was decreased according to the different zones (a process that is known to be directly cytokinin-regulated). The resulting auxin patterns display auxin rises at the more proximal tissues (SI Appendix, SI Appendix, Fig. S5I), a necessary

24 condition to generate a minimum, but presenting an auxin dip (not well pronounced) at the TZ in the vascular and pericycle cell files only. The observation that the profile does not present a significant dip in magnitude or extension, nor a dip in all radial tissues, illustrates that PIN permeability changes on their own are not sufficient to form the auxin minimum. In contrast, when AUX1/LAX expression was introduced into the epidermis from the TZ onwards (in accordance with the expression pattern), the most substantial changes in the auxin profile and a clear auxin dip at the TZ were instead observed only in the cortex cell file (SI Appendix, Fig. S5J). The observation that the tissue-dependent change in AUX1/LAX only marginally affects the vascular tissue illustrates that this feature on its own is not sufficient to generate the auxin minimum. Finally, adding to the “bare” model zonation-dependent auxin degradation

(SI Appendix, Fig. S5K) is again not able to give rise to an auxin dip. This analysis shows that, although some zonation-dependent tissue features cause slight alterations in the auxin pattern, not one of these features is individually responsible for the formation of the auxin minimum.

Realizing that the zonation-dependent root features, including the known direct cytokinin-regulated effects, must thus act synergistically, we next analysed the “full” root model SI Appendix, Fig. S5L), in which all seven zonation-dependent properties and cytokinin-regulated effects on auxin polar transport and auxin degradation are included (Fig. 2C and SI Appendix, Fig. S5O) and then compared it with simulations in which one of the zonation-dependent properties was removed (SI Appendix, Fig.

S5P – V). The full model presents the characteristic, well-formed and clearly established auxin minimum, corresponding to our wild type scenario (SI Appendix,

Fig. S5O). The overall pattern is robust to variations in cell size (SI Appendix, Fig.

S5M), only showing a reduction of the auxin levels within the root tip and the DFZ

(SI Appendix, Fig. S5P). We therefore can conclude that the cell expansion in DFZ contributes positively to the gradient formation, but should not be considered the pre- pattern for positional information itself.

Also allowing the lateral root cap to continue extending throughout all zones (SI

Appendix, Fig. S5N) had no noticeable effect on the patterning nor did PIN2 polarity changes in the epidermal cell files (SI Appendix, Fig. S5Q). Interestingly, removing the PIN2 polarity change either in the cortical or in the epidermal cell file and PIN1,

3, 7 in the endodermis causes auxin concentrations to decrease in the DFZ (SI

Appendix, Fig. S5R, S), whereas adding this features on their own (SI Appendix, Fig.

S5G – H) presented little to no effect (compare the differences between SI Appendix,

Fig. S5D, G and H, to the differences between SI Appendix, Fig. S5O, R and S). To conclude, the PIN2 polarity flip contributes positively to generate the expected auxin distribution as long as other zonation-dependent effects are included, but its independent action does not ensure positional information.

Neglecting the zonation-dependent variations in PIN expression resulted in an impaired auxin minimum (SI Appendix, Fig. S5T). We could therefore conclude that

PIN expression levels on their own, although being a key factor (as we know from the cytokinin-regulated effects on PIN expression), cannot solely account for the generation of the minimum (compare SI Appendix, Fig. S5I and SI Appendix, Fig.

S5T).

Remarkably, removal of the spatial variation in AUX1/LAX expression affected the auxin pattern in the root: the minimum was significantly impaired (SI Appendix, Fig.

S5U). Thus, the AUX1/LAX patterning is essential, although not sufficient, for the auxin minimum to be formed (compare SI Appendix, Fig. S5J and SI Appendix, Fig.

S5U). The prominent role that AUX1/LAX patterning plays within our model is in

26 accordance with previous data that postulated AUX1 as a regulator of auxin levels in the lateral root cap and in the elongating epidermis cells (22). Interestingly AUX1 came out as an ARR1 direct target gene from the ChIP-chip analysis (SI Appendix, SI

Appendix, Table S5) but how cytokinin regulates its expression is still controversial

(23, 24). Moreover the analysis of the root meristem of several aux1 mutants did not show any phenotype.

Interestingly, removing zonation-dependent auxin degradation does not affect the resulting auxin gradient, such as the auxin minimum is maintained (SI Appendix, Fig.

S5V). For parameter setting used in all simulations see SI Appendix, SI Appendix,

Table S4.

Taking together the analysis and dissection of the in silico zonation-dependent features, we can conclude that none of the tissue-inherent properties is sufficient to generate an auxin minimum, but that they act in conjunction with the known direct cytokinin-regulated effects in a positive manner to reinforce the minimum formation at the correct location.

Numerical Framework

The partial differential equation describing auxin dynamics (eq. 1) was solved numerically by means of discretizing it on the defined grid, and then concurrently solving for the diffusion, permeability, and production and decay of auxin, using the

Alternating Direction Implicit (ADI) method implemented in our previous works (8,

9, 19). A space step ∆x corresponding to 0.25 μm and a time step ∆t corresponding to

0.1 s were chosen. Boundary conditions were prescribed as in Grieneisen et al., 2007

(8), assuming no-flux along all root boundaries but allowing a constant influx at the uppermost cell row of the vasculature, pericycle and endodermis, prescribing a non-

27 zero value at the grid points which lie above these tissues (a0) (SI Appendix, SI

Appendix, Table S2) in order to mimic the connection between the root and the upper parts of the plant.

As initial condition for simulations, auxin concentration was set to zero within the whole root tissues. As soon as auxin from the medium started to diffuse in, a pattern in auxin distribution emerged. We ensured that all our results had reached steady state, as we are interested in 5 dag condition, when the system has reached a balance between dividing and differentiating cells thanks to cytokinin activity. Thus the auxin distribution profiles and heat maps were obtained letting each simulation to reach the steady state, i.e. negligible changes (10-7) both in the total amount of auxin (over the whole root tissue) and local auxin concentrations (between neighbouring cells) were calculated. All the simulations were performed using a layout accounting for 10 DFZ3 cells - 64 DFZ3 cells for simulations where cell length was not varied along the longitudinal axis - to exclude possible boundary condition effects. However to increase visibility, three cells of the DFZ3 are displayed in all heat maps and auxin concentration profiles shown. Static roots were used, as we can assume separation of time-scales between tissue growth and auxin-dynamics, the later much faster and in quasi-steady state with the much slower process of growth.

SI Appendix, Supplementary Figures

SI Appendix, Fig. S1. Auxin transporters in the in silico root. (A-B) Depiction of PIN1, 2, 3, 7 (A) (coloured lines as indicated in the figure) and AUX1, LAX2, LAX3 (B) (yellow lines) tissue localization and auxin transport orientation (white arrows) due to the localization of the exporters and importers along the cell membrane, as used in the model. (C) Section of the root tip layout and blow up of a modelled cell. Each cell was subdivided into different regions - upward (green), downward (purple), inward (cyan), and outward (red) - to instruct the corresponding transporter orientation on the cell membrane. In the root section the membranes of the other cells are highlighted in the corresponding colours. (D) Schematics of the subcellular-resolution flux calculations underlying the auxin dynamics within the model. Auxin diffuses freely within cells (cytoplasm represented in yellow and composed out of multiple lattice points), with diffusion coefficient Dcy, and throughout the cell wall (grey lattice sites), with diffusion coefficient Dcw. Diffusive flux is indicated by the flux equation on the top left and schematically represented on the bottom left, taking place between lattice points of the same colour. In between lattice sites that constitute cytoplasm (yellow) and cell wall (grey), fluxes due to membrane permeability as well as transporter activity operate, given by the

29 flux equation on the top right. The top cell shows the apolar distribution of AUX1/LAX transporters (red diamonds); the enlargement displays the fluxes over an interface resulting from background membrane permeability pIAAH (both outwards and inwards) as well as augmented by pAUX1/LAX . The bottom cell shows an example of a cell with basally located PIN transporters on one facet only (orange triangles) along the other facets only background membrane permeability is operating; the enlargements display the corresponding fluxes. Further details and parameters are provided in the Supporting Information.

SI Appendix, Fig. S2. Variation in PIN settings. (A) Heat map of the PIN measurements incorporated into the model as tissue- and zone-specific permeability values. The colour bar indicates minimum and maximum total PIN strength assigned (SI Appendix, SI Appendix, Table S3 and SI Appendix Materials and methods). (B) Heat map of PIN permeability values set at equal strength over all zones (SI Appendix Materials and methods). (C) Steady state auxin pattern resulting from PIN setting in (B), i.e., when cytokinin effects on PINs are removed while root layout zonation is maintained (SI Appendix, Table S4 and SI Appendix Materials and methods). (D) Steady state auxin pattern resulting from a case in which cell size variation over the root layout is removed, while PIN setting is set as in (A) (SI Appendix, SI Appendix, Table S4 and SI Appendix Materials and methods). Note that the formation of a dip is impaired in the absence of zone-specific PIN activity (C), while it is not affected by changes in the layout spatial properties (D) (For parameter setting see SI Appendix, Table S4). Colour coding represents auxin concentration levels. Piece-wise linear colour bar indicates absolute and relative log auxin concentration. Scale bar as indicated.

SI Appendix, Fig. S3. Cytokinin directly regulates the IAA-amido synthase GH3.17 via ARR1. (A) Schematic illustration of GH3.17 promoter sequence considered for ChIP-qPCR analysis (top). 14 sets of adjacent amplified regions along GH3.17 promoter were used. The resulting fold enrichment was plotted (bottom). (B) Gene ontology categories enriched in the ChIP-chip analysis of ARR1 direct target genes. (C-D) qRT-PCR analysis of GH3.17 (C) and GH3.3 (D) mRNA levels in the root tip of WT, arr1-3 mutant and WT plants upon 4 h of 5 µM cytokinin treatment (tZ). (E) qRT-

PCR analysis of GH3.17 mRNA levels in the root tip of ARR1 over-expressing plants (ARR1∆DDK) upon 4 h of 5 µM dexamethasone treatment (+Dex). The value for the control mock-treated WT was set to 1, and the relative values are reported. Experiments were performed on seedlings at 5 dag. A total of two biological replicates were performed for each experiment (A – E). (F, H) Confocal images of 5 dag root expressing the pGH3.17:GH3.17-GFP construct. In (F) roots were treated for 4 h with 5 µM of cytokinin (trans-Zeatin - tZ) while in (H) roots were treated for 4 h with 5 µM of auxin (indole 3 acetic acid – IAA). (G) Relative fluorescence quantification of roots depicted in (F) showing the cytokinin dependent pGH3.17:GH3.17-GFP induction. (I) Relative fluorescence quantification of roots depicted in (H) showing the absence of pGH3.17:GH3.17-GFP auxin induction. For all experiments, student t-test, * corresponds to P < 0.05; no significant differences in (I). Error bars indicate SD.

SI Appendix, Fig. S4. Analysis of auxin concentration profile. (A) Expression of ARR1 in pARR1:ARR1-GUS plant with a blow up highlighting the expression of ARR1 in the epidermis (EPI) and in the lateral root cap (LRC). Blue arrowheads point to the QC and white arrowheads indicate the cortex TB. (B) Spatial implementation of cytokinin-dependent auxin degradation (red) in the model, according to GH3.17 expression domain (see Fig. 2H). (C) Transversal auxin concentration profile showing the auxin minimum in the last MZ cell row of a wild type root simulation (see Fig. 2C).

SI Appendix, Fig. S5. Analysis of tissue properties within a null (meristem-like) and a full (cytokinin- responsive) root model background. To understand the effect of the different root tissue properties, in particular those zonation-dependent and those directly cytokinin-regulated, we first simulated as a null model a root composed only of meristem-features equally maintained throughout its entire length. We modified the root layout accordingly (A – C). We introduced individually the different zonation-dependent properties onto a bare null model background (D) to assess their independent contributions to the auxin pattern formation (E – K). This generated patterns that highlighted the single contribution of (E) cell size variations according to zonation; (F) lateral root cap termination at the TZ; and zonation-dependent changes in: (G) PIN2 polarity in cortex; (H) PIN polarity strength in the external cell files; (I) PIN expression levels; (J) AUX1/LAX expression pattern in the epidermis and cortex; and (K) auxin degradation. We then simulated a full model composed by all root features. We modified the root layout

35 accordingly (L – N). We contrasted the wild type full model (O), in which all tissue properties are acting in conjunction, to conditions (P – V) in which one effect at the time has been knocked-out. This approach generated auxin patterns which highlight the effect of only missing (P) variations in cell size; (Q) lateral root cap termination; or zonation-dependent changes in: (R) PIN2 polarity in cortex; (S) PIN polarity strength in the external cell files; (T) PIN expression levels; (U) zonation-dependent AUX1/LAX expression patterning; or (V) zonation-dependent auxin degradation. (SI Appendix, Table S4 and SI Appendix Materials and methods).

SI Appendix, Fig. S6. DR5::GFP analysis in the gh3.17-1 mutant background. (A) Confocal analysis at 5 dag of WT and gh3.17-1 root expressing DR5::GFP. (B) Relative fluorescence quantification of roots depicted in (A) showing enhanced DR5::GFP expression in the gh3.17-1 mutant. A total of 20 plants for two biological replicates were analysed for each experiment. Student t-test, * corresponds to P < 0.05. Error bars indicate SD.

SI Appendix, Fig. S7. Simulation of shy2 mutant. (A – B) Defects of cytokinin regulation on PINs were simulated to mimic shy2-31 mutant (SI Appendix, Table S4). The steady state auxin pattern simulated on a WT root layout (A) does not show an auxin minimum in the last meristematic cells at the TZ, which is re-established only on a root layout with increased MZ cell number (B), according to the enlarged shy2-31 mutant phenotype (Fig. 5A, B). Colour coding represents auxin concentration levels. Piece-wise linear colour bar indicates absolute and relative auxin concentration for all simulations in figure. Scale bar as indicated.

SI Appendix, Fig. S8. SHY2 is necessary for the positioning of the auxin minimum. Maximum projection of confocal z-stack images of shy2-31xR2D2 roots (left panels) with quantification of relative levels of auxin in epidermal, cortex and endodermal tissues (right panels). The roots represent untreated (A) and cytokinin-treated (+CK) shy2-31xR2D2 plant (B). Auxin distribution plots (right panels) were derived by discrete data of measurements in each cell per tissue (blue, epidermis; green, cortex; orange, endodermis) (SI Appendix Materials and methods). A correspondence between the cortex lowest auxin value (cortex dip, white and black stars) and the last cortex meristematic cell was found (compare left and right panels). Epidermis and endodermis dips lay in the proximity of the cortex last meristematic cell defining the auxin minimum position (white and black stars) that coincides with the TZ (grey bar). Upon cytokinin treatment no rootward shift in the position of the cortex, epidermis and endodermis dip (white and black stars) can be observed in the shy2-31xR2D2 R2D2 roots (B). White stars indicate cells where the auxin lowest value (dip) (black stars) was quantified. White arrowhead indicates cortex TB. ANOVA analysis was conducted to determine if differences between the fluorescence detected in the last meristematic cells and the other cells were significant (P < 0.05, n = 34 for MS and 20h cytokinin-treated shy2-31xR2D2 roots). Adjust P-values for Multiple Comparisons was carried out with the Benjamini & Hochberg (FDR) method (P < 0.05). QC, quiescent center.

SI Appendix, Table S1. In vivo measurements of spatial root properties. Values measured for roots at 5 days after germination. Meristem size is defined as the distance between the cortex-endodermal initial (iCOR/END) and the transition boundary for the cortical cell file. MZ, meristem zone; DFZ, differentiation zone. ±SD as indicated; student t-test, P < 0.05.

SI Appendix, Supplementary Tables

SI Appendix, Table S2. Wild type parameter set used for simulations. Parameter values were assigned according to experimental and literature data.

SI Appendix, Table S3. Differential PIN localization and strength for each tissue and zone of the root layout according to measurements. PIN localization on the cell membrane: U, upper; L, lower; I, inner; O, outer (SI Appendix, Fig. S1A, C). PIN strength: a range of permeability values is assigned for each member of the PIN family, spanning from maximum of 2 μm/s (PIN1max,

PIN2max, PIN3max, PIN7max) to a minimum of 0.1 μm/s (PIN1min, PIN2min, PIN3min,

PIN7min). Zones and tissues of the root are set according to Fig. 1.

SI Appendix, Table S4. Variation in parameter setting. Auxin degradation rate, PIN permeability and orientation, AUX1/LAX expression domain parameters and root layout features used in simulations. (-) indicates that parameter is set as in the wild type simulation. Wild type parameter setting is reported in SI Appendix, Table S2 and SI Appendix, Table S3.

SI Appendix, Table S5. ChIP-chip Results. 2343425 unique parameter combinations and their overlap with the ARR1 regulated genes (ANOVA) were checked. The genes are ordered by the maximum ChIP-chip enrichment score (ZS) of probe located from 4000bp upstream to 300bp downstream of the gene model.

Maximum Locus Cumulative Gene Short Gene Model Description Identifier Score of any Description probe AT2G23170 41.91061878 Auxin- encodes an IAA-amido synthase that responsive GH3 conjugates Asp and other amino acids to family protein auxin in vitro. AT4G25490 37.28079891 C-repeat/DRE Transcriptional activator that binds to the binding factor 1 DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. AT4G25500 37.28079891 arginine/serine- encodes an arginine/serine-rich splicing rich splicing factor. transcript is alternatively spliced factor 35 and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. AT5G11740 36.63827801 arabinogalactan Encodes arabinogalactan protein (AGP15). protein 15 AT4G26690 36.57120752 PLC-like Glycerophosphoryl diester phosphodiestera phosphodiesterase-like protein involved in

se family cell wall cellulose accumulation and pectin protein linking. Impacts root hair, trichome and epidermal cell development. AT4G26700 36.57120752 fimbrin 1 fimbrin-like protein AT3G16810 35.50789213 pumilio 24 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. AT3G16830 35.50789213 TOPLESS- related 2 AT3G48090 34.59418249 alpha/beta- Component of R gene-mediated disease Hydrolases resistance in Arabidopsis thaliana with superfamily homology to eukaryotic lipases. protein AT3G48100 34.59418249 response Encodes a transcription repressor that regulator 5 mediates a negative feedback loop in cytokinin signalling. ARR5 expression is upregulated by Class I KNOX genes. Arr5 protein is stabilized by cytokinin in a two- component phosphorelay. AT3G48110 34.59418249 glycine-tRNA glycine-tRNA ligase ligases AT3G16810 33.68073988 pumilio 24 Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. AT3G16830 33.68073988 TOPLESS- related 2 AT1G19050 33.47881794 response Encodes a member of the Arabidopsis regulator 7 response regulator (ARR) family, most

closely related to ARR15. A two- component response regulator protein containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin. AT2G32930 32.11272001 zinc finger Encodes a zinc finger protein. nuclease 2 AT2G32940 32.11272001 Argonaute Encodes a nuclear localized 879-amino- family protein acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin- related siRNAs, and for DNA methylation and transcriptional gene silencing. AT5G09810 31.94259405 actin 7 Member of Actin gene family.Mutants are defective in germination and root growth. AT1G28040 30.58026266 RING/U-box superfamily protein AT1G28050 30.58026266 B-box type zinc finger protein with CCT domain AT1G28060 30.58026266 Pre-mRNA- splicing factor 3 AT2G20670 30.23485088 Protein of unknown function (DUF506) AT1G49490 30.21495056 Leucine-rich repeat (LRR) family protein AT1G49500 30.21495056 AT1G49510 30.21495056 embryo defective 1273 AT5G54490 29.76419592 pinoid-binding Encodes a PINOID (PID)-binding protein protein 1 containing putative EF-hand calcium-

binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. AT5G54500 29.76419592 flavodoxin-like Encodes a flavin mononucleotide-binding quinone flavodoxin-like quinone reductase that is a reductase 1 primary auxin-response gene. AT1G06400 29.56464148 Ras-related small GTP-binding protein (ara-2) small GTP- binding family protein AT1G06410 29.56464148 trehalose- Encodes an enzyme putatively involved in phosphatase/syn trehalose biosynthesis. Though the protein thase 7 has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. AT3G12920 28.81872702 SBP (S-ribonuclease binding protein) family protein AT3G12930 28.81872702 Lojap-related protein AT5G11740 28.49698448 arabinogalactan Encodes arabinogalactan protein (AGP15). protein 15 AT1G68360 27.99596286 C2H2 and C2HC zinc fingers superfamily protein AT4G17460 27.99095297 Homeobox- Encodes homeobox protein HAT1. leucine zipper protein 4 (HB-4) / HD-ZIP protein AT1G19020 27.87641048 AT1G19025 27.87641048 DNA repair metallo-beta-lactamase family protein AT1G19030 27.87641048 transposable

element gene AT4G25480 27.74794102 dehydration encodes a member of the DREB subfamily response A-1 of ERF/AP2 transcription factor element B1A family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. AT4G25500 27.74794102 arginine/serine- encodes an arginine/serine-rich splicing rich splicing factor. transcript is alternatively spliced factor 35 and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. AT4G25490 27.69794941 C-repeat/DRE Transcriptional activator that binds to the binding factor 1 DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. AT4G25500 27.69794941 arginine/serine- encodes an arginine/serine-rich splicing rich splicing factor. transcript is alternatively spliced factor 35 and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. AT5G41790 27.46488762 COP1- encodes a protein that physically interacts interactive specifically with the putative coiled-coil protein 1 region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root.

expression is not regulated by light. AT1G33250 27.17099667 Protein of unknown function (DUF604) AT1G33260 27.17099667 Protein kinase superfamily protein AT4G28230 27.11063957 AT4G28240 27.11063957 Wound- responsive family protein AT5G09810 26.96794605 actin 7 Member of Actin gene family.Mutants are defective in germination and root growth. AT1G15750 26.85475731 Transducin Encodes a protein with several WD40 family protein / repeats at the C-terminus and predicted WD-40 repeat protein-protein interaction domains at the family protein N-terminus. Together with the TOPLESS- RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. AT1G15750 26.85475731 Transducin Encodes a protein with several WD40 family protein / repeats at the C-terminus and predicted WD-40 repeat protein-protein interaction domains at the family protein N-terminus. Together with the TOPLESS- RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top help of the embryo during the transition stage of embryogenesis. The

ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. AT1G15750 26.85475731 Transducin Encodes a protein with several WD40 family protein / repeats at the C-terminus and predicted WD-40 repeat protein-protein interaction domains at the family protein N-terminus. Together with the TOPLESS- RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top help of the embryo during the transition stage of embryogenesis. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. AT4G25470 26.70795107 C-repeat/DRE Encodes a member of the DREB binding factor 2 subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. AT4G25480 26.70795107 dehydration encodes a member of the DREB subfamily response A-1 of ERF/AP2 transcription factor element B1A family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2,

and CBF3. This gene is involved in response to low temperature and abscisic acid. AT4G17460 26.63410521 Homeobox- Encodes homeobox protein HAT1. leucine zipper protein 4 (HB-4) / HD-ZIP protein AT1G58170 26.63343000 Disease resistance-responsive (dirigent-like protein) family protein AT3G16857 26.54254150 response Encodes an Arabidopsis response regulator regulator 1 (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. AT3G19020 26.31644869 Leucine-rich repeat (LRR) family protein AT3G19030 26.31644869 AT2G23170 25.80630398 Auxin- encodes an IAA-amido synthase that responsive GH3 conjugates Asp and other amino acids to family protein auxin in vitro. AT3G50790 25.68626070 esterase/lipase/t hioesterase family protein AT1G49490 25.68510628 Leucine-rich repeat (LRR) family protein AT1G49500 25.68510628 AT1G49510 25.68510628 embryo defective 1273 AT1G53170 25.64082241 ethylene encodes a member of the ERF (ethylene response factor response factor) subfamily B-1 of 8 ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4,

ATERF-7, and leafy petiole. AT3G30775 25.58348274 Methylenetetrah Encodes a proline oxidase that is predicted ydrofolate to localize to the inner mitochondrial reductase family membrane, its mRNA expression induced protein by high levels of Al and by osmotic stress. The promoter contains an L-proline- inducible element. AT5G01850 25.47581816 Protein kinase superfamily protein AT5G01860 25.47581816 C2H2 and C2HC zinc fingers superfamily protein AT1G28040 25.31863904 RING/U-box superfamily protein AT1G28050 25.31863904 B-box type zinc finger protein with CCT domain AT1G28060 25.31863904 Pre-mRNA- splicing factor 3 AT3G20330 25.29679155 PYRIMIDINE encodes aspartate carbamoyltransferase B catalyzing the second step in the de novo pyrimidine ribonucleotide biosynthesis AT3G20340 25.29679155 Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. AT3G16857 25.24501133 response Encodes an Arabidopsis response regulator regulator 1 (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. AT1G53170 25.16905069 ethylene encodes a member of the ERF (ethylene response factor response factor) subfamily B-1 of 8 ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. AT3G16857 25.08012295 response Encodes an Arabidopsis response regulator regulator 1 (ARR) protein that acts in concert with

other type-B ARRs in the cytokinin signaling pathway. AT3G24180 25.04056001 Beta- glucosidase, GBA2 type family protein AT3G24190 25.04056001 Protein kinase superfamily protein AT2G25490 25.03430843 EIN3-binding F Encodes an F-box protein involved in the box protein 1 ubiquitin/proteasome-dependent proteolysis of EIN3. AT5G57000 24.96826410 AT5G39580 24.95889807 Peroxidase superfamily protein AT5G39590 24.95889807 TLD-domain containing nucleolar protein AT2G25880 24.91030741 ataurora2 Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. AT2G25900 24.91030741 Zinc finger C- putative Cys3His zinc finger protein x8-C-x5-C-x3-H (ATCTH) mRNA, complete type family

protein AT5G25160 24.74638987 zinc finger Encodes a zinc finger protein containing protein 3 only a single zinc finger. AT3G62980 24.51821280 F-box/RNI-like Encodes an auxin receptor that mediates superfamily auxin-regulated transcription. It contains protein leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. AT4G32410 24.45761824 cellulose Encodes a cellulose synthase isomer. synthase 1 CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. AT4G36920 24.44151926 Integrase-type Encodes a floral homeotic gene, a member DNA-binding of the AP2/EREBP (ethylene responsive superfamily element binding protein) class of protein transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem

indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. AT1G49490 24.44071436 Leucine-rich repeat (LRR) family protein AT1G49500 24.44071436 AT1G49510 24.44071436 embryo defective 1273 AT1G58170 24.42801476 Disease resistance-responsive (dirigent-like protein) family protein AT2G24550 24.39117384 AT2G24560 24.39117384 GDSL-like Lipase/Acylhydrolase family protein AT1G07485 24.36986685 AT5G59730 24.33366966 exocyst subunit A member of EXO70 gene family, exo70 family putative exocyst subunits, conserved in protein H7 land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. AT2G18090 24.31737924 PHD finger family protein / SWIB complex BAF60b domain- containing protein / GYF domain-containing protein AT1G73390 23.95196724 Endosomal targeting BRO1-like domain-containing protein AT1G73400 23.95196724 Pentatricopeptide repeat (PPR) superfamily protein AT2G36880 23.74266052 methionine adenosyltransfer ase 3 AT1G19050 23.64603853 response Encodes a member of the Arabidopsis regulator 7 response regulator (ARR) family, most closely related to ARR15. A two- component response regulator protein

containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin. AT1G21060 23.63946676 Protein of unknown function, DUF547 AT5G63790 23.61369610 NAC domain Encodes a member of the NAC family of containing transcription factors. ANAC102 appears to protein 102 have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. AT5G63800 23.61369610 Glycosyl Involved in mucilage formation. Mutants hydrolase family form columella and outer cell wall 35 protein architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 AT3G16140 23.51371479 photosystem I Encodes subunit H of photosystem I subunit H-1 reaction center subunit VI. AT3G16150 23.51371479 N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein AT5G67180 23.50197077 target of early activation tagged (EAT) 3 AT2G25490 23.46667528 EIN3-binding F Encodes an F-box protein involved in the box protein 1 ubiquitin/proteasome-dependent proteolysis of EIN3. AT3G16857 23.44872856 response Encodes an Arabidopsis response regulator

regulator 1 (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. AT3G47340 23.35581684 glutamine- encodes a glutamine-dependent asparagine dependent synthetase, the predicted ASN1 peptide asparagine contains a purF-type glutamine-binding synthase 1 domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. AT4G25410 23.27580094 basic helix-loop-helix (bHLH) DNA-binding superfamily protein AT1G28130 23.16231823 Auxin- encodes an IAA-amido synthase that responsive GH3 conjugates Asp and other amino acids to family protein auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. AT5G67180 23.12212420 target of early activation tagged (EAT) 3 AT1G72500 23.04876924 AT4G25480 22.95752001 dehydration encodes a member of the DREB subfamily response A-1 of ERF/AP2 transcription factor element B1A family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. AT4G25500 22.95752001 arginine/serine- encodes an arginine/serine-rich splicing

rich splicing factor. transcript is alternatively spliced factor 35 and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. AT3G05490 22.86364985 ralf-like 22 Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. AT3G05500 22.86364985 Rubber elongation factor protein (REF) AT3G19020 22.85391235 Leucine-rich repeat (LRR) family protein AT3G19030 22.85391235 AT4G25490 22.75015497 C-repeat/DRE Transcriptional activator that binds to the binding factor 1 DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. AT4G25500 22.75015497 arginine/serine- encodes an arginine/serine-rich splicing rich splicing factor. transcript is alternatively spliced factor 35 and is differentially expressed in different tissues (flowers, roots, stems, and leaves)

examined. AT3G13310 22.73265076 Chaperone DnaJ-domain superfamily protein AT3G13320 22.73265076 cation low affinity calcium antiporter CAX2 exchanger 2 AT3G15200 22.71989250 Tetratricopeptide repeat (TPR)-like superfamily protein AT3G15210 22.71989250 ethylene Encodes a member of the ERF (ethylene responsive response factor) subfamily B-1 of element binding ERF/AP2 transcription factor family factor 4 (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. AT2G28510 22.69876194 Dof-type zinc finger DNA-binding family protein AT4G17230 22.63392711 SCARECROW- Encodes a scarecrow-like protein (SCL13). like 13 Member of GRAS gene family. AT1G17620 22.63052893 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family AT1G17630 22.63052893 Pentatricopeptide repeat (PPR-like) superfamily protein AT1G10090 22.60348082 Early-responsive to dehydration stress protein (ERD4) AT5G48000 22.58865499 cytochrome Encodes a member of the CYP708A P450, family family of cytochrome P450 enzymes. 708, subfamily THAH appears to add a hydroxyl group to A, polypeptide 2 the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant

phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation. AT5G60690 22.58533999 Homeobox- REVOLUTA regulates meristem initiation leucine zipper at lateral positions. a member of a small family protein / homeodomain-leucine zipper family. Has lipid-binding overlapping functions with PHAVOLUTA START domain- and PHABULOSA. containing protein AT4G40060 22.53036594 homeobox Encodes a homeodomain leucine zipper protein 16 class I (HD-Zip I) protein. AT4G40070 22.53036594 RING/U-box superfamily protein AT1G29220 22.49911261 transcriptional regulator family protein AT1G29230 22.49911261 CBL-interacting Encodes a member of the SNF1-related protein kinase kinase (SnRK) gene family (SnRK3.20), 18 which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). AT1G32610 22.44724751 hydroxyproline-rich glycoprotein family protein AT1G32640 22.44724751 Basic helix- Encodes a MYC-related transcriptional loop-helix activator with a typical DNA binding (bHLH) DNA- domain of a basic helix-loop-helix leucine binding family zipper motif. Binds to an extended G-Box protein promoter motif. Its transcription is induced by dehydration stress and ABA treatment. Negative regulator of blue lightñmediated photomorphogenic growth and blue and far-red-lightñregulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions.

Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. AT1G19110 22.32756090 inter-alpha-trypsin inhibitor heavy chain-related AT5G36140 22.30215812 cytochrome member of CYP716A P450, family 716, subfamily A, polypeptide 2 AT5G11970 22.26944923 Protein of unknown function (DUF3511) AT4G36920 22.15009260 Integrase-type Encodes a floral homeotic gene, a member DNA-binding of the AP2/EREBP (ethylene responsive superfamily element binding protein) class of protein transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. AT3G48090 22.09847784 alpha/beta- Component of R gene-mediated disease Hydrolases resistance in Arabidopsis thaliana with superfamily homology to eukaryotic lipases. protein AT3G48100 22.09847784 response Encodes a transcription repressor that

regulator 5 mediates a negative feedback loop in cytokinin signalling. ARR5 expression is upregulated by Class I KNOX genes. Arr5 protein is stabilized by cytokinin in a two- component phosphorelay. AT3G48110 22.09847784 glycine-tRNA glycine-tRNA ligase ligases AT5G42050 22.09616828 DCD (Development and Cell Death) domain protein AT1G28040 22.07945633 RING/U-box superfamily protein AT1G28050 22.07945633 B-box type zinc finger protein with CCT domain AT1G28060 22.07945633 Pre-mRNA- splicing factor 3 AT4G25480 22.00995064 dehydration encodes a member of the DREB subfamily response A-1 of ERF/AP2 transcription factor element B1A family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. AT4G25500 22.00995064 arginine/serine- encodes an arginine/serine-rich splicing rich splicing factor. transcript is alternatively spliced factor 35 and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. AT1G15100 21.99555492 RING-H2 finger Encodes a putative RING-H2 finger A2A protein RHA2a. AT1G15110 21.99555492 phosphatidyl serine synthase family protein AT2G25490 21.99513912 EIN3-binding F Encodes an F-box protein involved in the box protein 1 ubiquitin/proteasome-dependent proteolysis of EIN3. AT4G36920 21.98260498 Integrase-type Encodes a floral homeotic gene, a member

DNA-binding of the AP2/EREBP (ethylene responsive superfamily element binding protein) class of protein transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. AT4G27650 21.97858286 Eukaryotic Encodes Arabidopsis homolog of release factor 1 Drosophila pelota protein. (eRF1) family protein AT4G27654 21.97858286 AT4G27657 21.97858286 AT2G14900 21.94547987 Gibberellin- regulated family protein AT4G32020 21.93843651 AT4G32030 21.93843651 AT1G64380 21.89485645 Integrase-type encodes a member of the DREB subfamily DNA-binding A-6 of ERF/AP2 transcription factor superfamily family. The protein contains one AP2 protein domain. There are 8 members in this subfamily including RAP2.4. AT4G28230 21.89186668 AT4G28240 21.89186668 Wound- responsive family protein AT3G46530 21.87515974 NB-ARC Confers resistance to the biotrophic domain- oomycete, Peronospora parasitica.

containing Encodes an NBS-LRR type R protein with disease a putative amino-terminal leucine zipper. resistance Fungal protein ATR13 induces RPP13 protein gene expression and disease resistance. AT3G46540 21.87515974 ENTH/VHS family protein AT3G46560 21.87515974 Tim10/DDP Encodes a small zinc finger-like protein family zinc that is a component of the mitochondrial finger protein protein import apparatus. AT4G21450 21.83840394 PapD-like superfamily protein AT3G12020 21.80274868 P-loop containing nucleoside triphosphate hydrolases superfamily protein AT4G16770 21.75909948 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein AT1G68830 21.74577832 STT7 homolog STN7 protein kinase; required for state STN7 transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation AT1G68840 21.74577832 related to Rav2 is part of a complex that has been ABI3/VP1 2 named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) AT4G26690 21.71827841 PLC-like Glycerophosphoryl diester phosphodiestera phosphodiesterase-like protein involved in se family cell wall cellulose accumulation and pectin protein linking. Impacts root hair, trichome and epidermal cell development. AT4G26700 21.71827841 fimbrin 1 fimbrin-like protein AT4G21750 21.62504005 Homeobox- Encodes a homeobox protein similar to leucine zipper GL2. It is expressed in both the apical and family protein / basal daughter cells of the zygote as well lipid-binding as their progeny. Expression is detected START domain- starting the two-celled stage of embryo containing development and is later restricted to the

protein outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. AT4G21760 21.62504005 beta-glucosidase 47 AT3G18000 21.60261393 S-adenosyl-L- Arabidopsis thaliana N-methyltransferase- methionine- like protein mRNA. Reduce transmission dependent through pollen. methyltransferas es superfamily protein AT2G25880 21.57768440 ataurora2 Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. AT2G25900 21.57768440 Zinc finger C- putative Cys3His zinc finger protein x8-C-x5-C-x3-H (ATCTH) mRNA, complete type family protein AT5G47370 21.56476521 Homeobox- homeobox-leucine zipper genes induced leucine zipper by auxin, but not by other phytohormones.

protein 4 (HB-4) Plays opposite roles in the shoot and root / HD-ZIP tissues in regulating auxin-mediated protein morphogenesis. AT5G63790 21.56269217 NAC domain Encodes a member of the NAC family of containing transcription factors. ANAC102 appears to protein 102 have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. AT5G63800 21.56269217 Glycosyl Involved in mucilage formation. Mutants hydrolase family form columella and outer cell wall 35 protein architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 AT3G16857 21.55597925 response Encodes an Arabidopsis response regulator regulator 1 (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. AT5G07680 21.53738785 NAC domain containing protein 80 AT1G31750 21.52913094 proline-rich family protein AT1G31760 21.52913094 SWIB/MDM2 domain superfamily protein AT1G06400 21.52263355 Ras-related small GTP-binding protein (ara-2) small GTP- binding family protein AT1G06410 21.52263355 trehalose- Encodes an enzyme putatively involved in

phosphatase/syn trehalose biosynthesis. Though the protein thase 7 has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. AT1G49500 21.47970867 AT1G49510 21.47970867 embryo defective 1273 AT3G50300 21.40767527 HXXXD-type acyl-transferase family protein AT4G28240 21.40538001 Wound- responsive family protein AT4G28250 21.40538001 expansin B3 putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. AT4G28260 21.40538001 AT5G43130 21.24253225 TBP-associated factor 4 AT5G43150 21.24253225 AT2G34500 21.23714161 cytochrome Encodes a protein with C22-sterol P450, family desaturase activity. The enzyme was 710, subfamily shown to catalyze in the presence of A, polypeptide 1 NADPH the conversion of β- sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). AT5G24830 21.16151714 Tetratricopeptide repeat (TPR)-like superfamily protein AT4G01690 21.15135908 Flavin Encodes protoporphyrinogen oxidase containing (PPOX).

amine oxidoreductase family AT1G66730 21.11110163 DNA LIGASE 6 Encodes a novel plant specific DNA ligase that is involved in seed germination and DNA repair. AT4G28230 21.10290647 AT4G28240 21.10290647 Wound- responsive family protein AT2G27550 21.09763908 centroradialis encodes a protein similar to TFL1. overexpression leads to similar phenotype as TFL1 overexpression. expressed specifically in the hypocotyl and null mutation does not result in phenotypes exhibited by TFL1 null mutations. AT2G27570 21.09763908 P-loop containing nucleoside triphosphate hydrolases superfamily protein AT1G28570 21.08599806 SGNH hydrolase-type esterase superfamily protein AT1G28580 21.08599806 GDSL-like Lipase/Acylhydrolase superfamily protein AT3G16857 21.08534956 response Encodes an Arabidopsis response regulator regulator 1 (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. AT3G26440 21.08058763 Protein of unknown function (DUF707) AT4G30190 21.06924963 H(+)-ATPase 2 belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C- terminal dom AT4G01110 21.03910351

AT4G01120 21.03910351 G-box binding bZIP (basic leucine zipper) transcription factor 2 factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light AT4G01130 21.03910351 GDSL-like Lipase/Acylhydrolase superfamily protein AT1G66760 20.98321557 MATE efflux family protein AT3G30775 20.90331721 Methylenetetrah Encodes a proline oxidase that is predicted ydrofolate to localize to the inner mitochondrial reductase family membrane, its mRNA expression induced protein by high levels of Al and by osmotic stress. The promoter contains an L-proline- inducible element. AT1G30200 20.84714079 F-box family protein AT5G54500 20.78965282 flavodoxin-like Encodes a flavin mononucleotide-binding quinone flavodoxin-like quinone reductase that is a reductase 1 primary auxin-response gene. AT1G10470 20.78517342 response Encodes a two-component response regulator 4 regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. AT2G38120 20.68712521 Transmembrane Encodes an auxin influx transporter. amino acid AUX1 resides at the apical plasma transporter membrane of protophloem cells and at family protein highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. AT2G24550 20.64655972 AT2G24560 20.64655972 GDSL-like Lipase/Acylhydrolase family protein AT1G53170 20.61550760 ethylene encodes a member of the ERF (ethylene response factor response factor) subfamily B-1 of 8 ERF/AP2 transcription factor family

(ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. AT3G61060 20.61359239 phloem protein 2-A13 AT1G19050 20.55527925 response Encodes a member of the Arabidopsis regulator 7 response regulator (ARR) family, most closely related to ARR15. A two- component response regulator protein containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin. AT1G28100 20.52162695 AT4G27270 20.43097925 Quinone reductase family protein AT4G27290 20.43097925 S-locus lectin protein kinase family protein AT2G23170 20.41692638 Auxin- encodes an IAA-amido synthase that responsive GH3 conjugates Asp and other amino acids to family protein auxin in vitro. AT4G10380 20.40630412 NOD26-like Boric acid channel. Essential for efficient intrinsic protein boron uptake and plant development 5;1 under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. AT3G45710 20.39163113 Major facilitator superfamily protein AT3G45720 20.39163113 Major facilitator

superfamily protein AT2G40650 20.35369182 PRP38 family protein AT2G40670 20.35369182 response response regulator 16 regulator 16 AT3G10500 20.31478190 NAC domain containing protein 53 AT5G06320 20.30453730 NDR1/HIN1- encodes a protein whose sequence is like 3 similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. AT4G25450 20.27313018 non-intrinsic member of NAP subfamily ABC protein 8 AT4G25470 20.27313018 C-repeat/DRE Encodes a member of the DREB binding factor 2 subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved

in a negative regulatory or feedback circuit of the CBF pathway. AT1G19180 20.26464272 jasmonate-zim- JAZ1 is a nuclear-localized protein domain protein involved in jasmonate signaling. JAZ1 1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate- isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. AT1G19190 20.26464272 alpha/beta- Hydrolases superfamily protein AT3G13360 20.21690702 WPP domain interacting protein 3 AT3G13380 20.21690702 BRI1-like 3 Similar to BRI, brassinosteroid receptor protein. AT5G18170 20.20171738 glutamate Encodes the 43 kDa alpha-subunit of the dehydrogenase 1 glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation.

Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. AT3G18700 20.18843770 AT3G18710 20.18843770 plant U-box 29 Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. AT5G49680 20.18194532 Golgi-body Conserved among eukaryotes, similar to localisation Arabidopsis SABRE. The phenotype of protein domain the kip/sab double mutant suggests related ;RNA pol II functions for both genes, however, the KIP promoter Fmp27 protein is mostly required for tip-growth. protein domain Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. AT5G27910 20.16597199 nuclear factor Y, subunit C8 AT5G27920 20.16597199 F-box family protein AT2G43130 20.14227581 P-loop encodes a protein belonging to the containing Rab/Ypt family of small GTPases, which nucleoside are implicated in intracellular vesicular triphosphate traffic. hydrolases superfamily protein AT1G19110 20.08630371 inter-alpha-trypsin inhibitor heavy chain-related AT1G53170 20.08212090 ethylene encodes a member of the ERF (ethylene

response factor response factor) subfamily B-1 of 8 ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. AT2G34720 20.07484388 nuclear factor Y, subunit A4 AT2G34730 20.07484388 myosin heavy chain-related AT1G15750 20.06938314 Transducin Encodes a protein with several WD40 family protein / repeats at the C-terminus and predicted WD-40 repeat protein-protein interaction domains at the family protein N-terminus. Together with the TOPLESS- RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. AT1G15750 20.06938314 Transducin Encodes a protein with several WD40 family protein / repeats at the C-terminus and predicted WD-40 repeat protein-protein interaction domains at the family protein N-terminus. Together with the TOPLESS- RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top help of the embryo during the transition stage of embryogenesis. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. AT1G15750 20.06938314 Transducin Encodes a protein with several WD40 family protein / repeats at the C-terminus and predicted

WD-40 repeat protein-protein interaction domains at the family protein N-terminus. Together with the TOPLESS- RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top help of the embryo during the transition stage of embryogenesis. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. AT2G22970 20.00838828 serine carboxypeptidas e-like 11 AT3G15810 19.99601126 Protein of unknown function (DUF567) AT1G70300 19.94974899 K+ uptake potassium transporter permease 6 AT5G65660 19.92079973 hydroxyproline-rich glycoprotein family protein AT3G43430 19.85554433 RING/U-box superfamily protein AT3G47160 19.77241921 RING/U-box superfamily protein AT3G10920 19.74918103 manganese manganese superoxide dismutase (MSD1) superoxide dismutase 1 AT3G10930 19.74918103 AT3G10950 19.74918103 Zinc-binding ribosomal protein family protein AT3G11410 19.73179150 protein Encodes protein phosphatase 2C. Negative phosphatase regulator of ABA signalling. Expressed in 2CA seeds during germination. mRNA up-

regulated by drought and ABA. AT1G69490 19.72098517 NAC-like, Encodes a member of the NAC activated by transcription factor gene family. It is AP3/PI expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. AT1G69500 19.72098517 cytochrome Encodes a cytochrome P450, designated P450, family CYP704B1. Expressed in the developing 704, subfamily anthers. Essential for pollen exine B, polypeptide 1 development. Mutations in CYP704B1 result in impaired pollen walls that lack a normal exine layer and exhibit a characteristic striped surface, termed zebra phenotype. Heterologous expression of CYP704B1 in yeast cells demonstrated that it catalyzes omega-hydroxylation of long-chain fatty acids, implicating these molecules in sporopollenin synthesis. AT1G69510 19.72098517 cAMP-regulated phosphoprotein 19-related protein AT5G54520 19.68740654 Transducin/WD40 repeat-like superfamily protein AT5G54530 19.68740654 Protein of unknown function, DUF538 AT5G03310 19.67361259 SAUR-like auxin- responsive protein family AT5G03320 19.67361259 Protein kinase superfamily protein AT3G13310 19.66623545 Chaperone DnaJ-domain superfamily protein AT3G13320 19.66623545 cation low affinity calcium antiporter CAX2

exchanger 2 AT2G36930 19.66199827 zinc finger (C2H2 type) family protein AT2G36940 19.66199827 AT2G36950 19.66199827 Heavy metal transport/detoxification superfamily protein AT2G31100 19.65408015 alpha/beta- Hydrolases superfamily protein AT2G31110 19.65408015 Plant protein of Encodes a member of the TBL unknown (TRICHOME BIREFRINGENCE-LIKE) function gene family containing a plant-specific (DUF828) DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. AT2G02630 19.62040901 Cysteine/Histidine-rich C1 domain family protein AT3G47630 19.59894347 AT3G47640 19.59894347 basic helix-loop- Encodes POPEYE (PYE), a bHLH helix (bHLH) transcription factor regulating response to DNA-binding iron deficiency in Arabidopsis roots. superfamily protein AT3G47650 19.59894347 DnaJ/Hsp40 cysteine-rich domain superfamily protein AT3G47660 19.59894347 Regulator of chromosome condensation (RCC1) family protein AT1G17950 19.57233191 myb domain putative transcription factor: R2R3-MYB protein 52 transcription family AT1G02050 19.56427574 Chalcone and stilbene synthase family protein AT1G02060 19.56427574 Tetratricopeptide repeat (TPR)-like superfamily protein AT3G15200 19.55017304 Tetratricopeptide repeat (TPR)-like superfamily protein

AT3G15210 19.55017304 ethylene Encodes a member of the ERF (ethylene responsive response factor) subfamily B-1 of element binding ERF/AP2 transcription factor family factor 4 (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. AT1G15100 19.54606342 RING-H2 finger Encodes a putative RING-H2 finger A2A protein RHA2a. AT1G15110 19.54606342 phosphatidyl serine synthase family protein AT2G44940 19.53514099 Integrase-type encodes a member of the DREB subfamily DNA-binding A-4 of ERF/AP2 transcription factor superfamily family. The protein contains one AP2 protein domain. There are 17 members in this subfamily including TINY. AT4G36640 19.53206491 Sec14p-like phosphatidylinositol transfer family protein AT3G13310 19.51100922 Chaperone DnaJ-domain superfamily protein AT3G13320 19.51100922 cation low affinity calcium antiporter CAX2 exchanger 2 AT5G49660 19.50516987 Leucine-rich repeat transmembrane protein kinase family protein AT1G58270 19.48826814 TRAF-like ZW9 mRNA, complete cds family protein AT3G54720 19.46186399 Peptidase M28 Encodes glutamate carboxypeptidase. family protein Various alleles show-increased cotyledon number and rate of leaf initiation, show transformation of leaves to cotyledons, altered flowering time and

photomorphogenesis and an increased level of cytokinin biosynthesis. Involved in ethylene enhanced hypocotyl elongation in the light. Strong genetic interaction between TGH and AMP1. AT5G20870 19.42493987 O-Glycosyl hydrolases family 17 protein AT5G20885 19.42493987 RING/U-box superfamily protein AT2G14210 19.41669559 AGAMOUS- MADS box gene, transcription factor like 44 AT1G13740 19.41629767 ABI five Encodes a member of a small plant- binding protein specific gene family whose members 2 interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. AT3G46620 19.41596603 zinc finger (C3HC4-type RING finger) family protein AT3G46630 19.41596603 Protein of unknown function (DUF3223) AT3G15950 19.38682747 DNA Similar to TSK-associating protein 1 topoisomerase- (TSA1), contains 10 EFE repeats, a novel related repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. AT5G49480 19.38274145 Ca2+-binding AtCP1 encodes a novel Ca2+-binding

protein 1 protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. AT4G25450 19.37239385 non-intrinsic member of NAP subfamily ABC protein 8 AT4G25470 19.37239385 C-repeat/DRE Encodes a member of the DREB binding factor 2 subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. AT4G25480 19.37239385 dehydration encodes a member of the DREB subfamily response A-1 of ERF/AP2 transcription factor element B1A family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. AT5G43430 19.36863708 electron transfer Encodes the electron transfer flavoprotein flavoprotein ETF beta, a putative subunit of the beta mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of

the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation. AT2G44940 19.35743976 Integrase-type encodes a member of the DREB subfamily DNA-binding A-4 of ERF/AP2 transcription factor superfamily family. The protein contains one AP2 protein domain. There are 17 members in this subfamily including TINY. AT1G04240 19.29626846 AUX/IAA SHY2/IAA3 regulates multiple auxin transcriptional responses in roots. It is induced rapidly by regulator family IAA, and has been shown to be protein phosphorylated by oat phytochrome A in vitro. AT1G04250 19.29626846 AUX/IAA Transcription regulator acting as repressor transcriptional of auxin-inducible gene expression. regulator family Auxin-inducible AUX/IAA gene. Short- protein lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. AT3G50870 19.29607630 GATA type zinc Encodes a GATA factort transcriptional finger regulator required to position the

transcription proembryo boundary in the early embryo. factor family protein AT3G50880 19.29607630 DNA glycosylase superfamily protein AT5G60210 19.28571296 ROP interactive partner 5 AT5G38020 19.28349400 S-adenosyl-L- encodes a protein whose sequence is methionine- similar to SAM:salicylic acid carboxyl dependent methyltransferase (SAMT) methyltransferas (GI:6002712)(Clarkia breweri) and to es superfamily SAM:benzoic acid carboxyl protein methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus) AT4G25450 19.28282070 non-intrinsic member of NAP subfamily ABC protein 8 AT4G25470 19.28282070 C-repeat/DRE Encodes a member of the DREB binding factor 2 subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit

of the CBF pathway. AT3G60380 19.27349520 AT3G60390 19.27349520 homeobox- Encodes homeobox protein HAT3. leucine zipper protein 3 AT1G66230 19.24202228 myb domain Encodes a putative transcription factor protein 20 (MYB20). AT4G27270 19.23847103 Quinone reductase family protein AT4G27280 19.23847103 Calcium- binding EF-hand family protein AT4G27290 19.23847103 S-locus lectin protein kinase family protein AT1G22190 19.21738076 Integrase-type DNA-binding superfamily protein AT1G67020 19.21520519 AT1G67030 19.21520519 zinc finger Encodes a zinc finger protein containing protein 6 only a single zinc finger. AT5G03310 19.21328759 SAUR-like auxin- responsive protein family AT5G03320 19.21328759 Protein kinase superfamily protein AT3G19020 19.19736242 Leucine-rich repeat (LRR) family protein AT3G19030 19.19736242 AT3G45640 19.18268442 mitogen- Encodes a mitogen-activated kinase whose activated protein mRNA levels increase in response to kinase 3 touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3

mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. AT1G03850 19.18158865 Glutaredoxin family protein AT3G18780 19.15998983 actin 2 Encodes an actin that is constitutively expressed in vegetative structures but not pollen. ACT2 is involved in tip growth of root hairs. AT3G18790 19.15998983 AT1G19050 19.14715481 response Encodes a member of the Arabidopsis regulator 7 response regulator (ARR) family, most closely related to ARR15. A two- component response regulator protein containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin. AT5G10210 19.09639215 AT5G03680 19.08488345 Duplicated Recessive mutations are defective in organ homeodomain- initiation and orientation in the second like superfamily whorl. This gene encodes a trihelix protein transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. AT2G45430 19.06370687 AT-hook motif Encodes a nuclear localized AT hook nuclear- domain containing protein that can bind localized protein AT rich DNA in vitro. Overexpression of 22 the gene results in delayed flowering. Is likely to act redundantly with AHL18,

AHL27 and AHL29 in the regulation of flowering. It is also involved in both photo- and skotomorphogenesis. AT5G42050 19.03873396 DCD (Development and Cell Death) domain protein AT2G41370 19.03829432 Ankyrin repeat Encodes BOP2, a cytoplasmic and family protein / nuclear-localized NPR1 like protein with BTB/POZ BTB/POZ domain and ankyrin repeats. domain- Interacts with BOP1 and appears to be containing genetically redundant with protein BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abscission. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. AT1G13300 19.03766870 myb-like Overexpression confers hypersensitivity to transcription low phosphate-elicited inhibition of factor family primary root growth. protein AT3G49940 19.02963662 LOB domain- containing protein 38 AT5G19530 19.02554655 S-adenosyl-L- Encodes a spermine synthase. Required methionine- for internode elongation and vascular dependent development, specifically in the methyltransferas mechanism that defines the boundaries es superfamily between veins and nonvein regions. This protein mechanism may be mediated by polar auxin transport. Though ACL5 has been shown to function as a spermine synthase in E. coli, an ACL5 knockout has no effect on the endogenous levels of free and

conjugated polyamines in Arabidopsis, suggesting that ACL5 may have a very specific or altogether different in vivo function. AT5G19540 19.02554655 AT5G19550 19.02554655 aspartate Nitrogen metabolism. Major cytosolic aminotransferas isoenzyme controlling aspartate e 2 biosynthesis in the light. AT5G63790 19.01656008 NAC domain Encodes a member of the NAC family of containing transcription factors. ANAC102 appears to protein 102 have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. AT5G63800 19.01656008 Glycosyl Involved in mucilage formation. Mutants hydrolase family form columella and outer cell wall 35 protein architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 AT3G12020 19.00952721 P-loop containing nucleoside triphosphate hydrolases superfamily protein AT1G49200 19.00755262 RING/U-box superfamily protein AT1G49210 19.00755262 RING/U-box superfamily protein AT3G06500 18.99604750 Plant neutral invertase family protein AT3G06510 18.99604750 Glycosyl Encodes a protein with beta-glucosidase hydrolase activity, mutants show increased

superfamily sensitivity to freezing protein AT2G35940 18.97769547 BEL1-like Encodes a member of the BEL-like homeodomain 1 homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. AT3G46620 18.97392416 zinc finger (C3HC4-type RING finger) family protein AT2G39510 18.96922636 nodulin MtN21 /EamA-like transporter family protein AT4G21990 18.95906115 APS reductase 3 Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase- like (APRL) group. AT4G22000 18.95906115 AT4G22010 18.95906115 SKU5 similar 4 AT3G49750 18.93545127 receptor like protein 44 AT1G66760 18.93074059 MATE efflux family protein AT1G31750 18.92373490 proline-rich family protein AT1G31760 18.92373490 SWIB/MDM2 domain superfamily protein AT1G31770 18.92373490 ATP-binding cassette 14

AT1G20630 18.91287470 catalase 1 Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. AT5G13200 18.91248035 GRAM domain family protein AT4G25450 18.91243052 non-intrinsic member of NAP subfamily ABC protein 8 AT4G25470 18.91243052 C-repeat/DRE Encodes a member of the DREB binding factor 2 subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. AT1G20330 18.87879014 sterol Encodes a sterol-C24-methyltransferases methyltransferas involved in sterol biosynthesis. Mutants e 2 display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. AT3G49950 18.86985254 GRAS family

transcription factor AT1G68830 18.83606148 STT7 homolog STN7 protein kinase; required for state STN7 transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation AT1G68840 18.83606148 related to Rav2 is part of a complex that has been ABI3/VP1 2 named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) AT4G26210 18.83568692 Mitochondrial ATP synthase subunit G protein AT4G26220 18.83568692 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein AT1G56145 18.83317542 Leucine-rich repeat transmembrane protein kinase AT1G10470 18.83107972 response Encodes a two-component response regulator 4 regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. AT1G10480 18.83107972 zinc finger Encodes a zinc finger protein containing protein 5 only a single zinc finger. AT1G28130 18.82523632 Auxin- encodes an IAA-amido synthase that responsive GH3 conjugates Asp and other amino acids to family protein auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. AT4G23510 18.77546549 Disease resistance protein (TIR-NBS-LRR class) family AT1G30500 18.75877142 nuclear factor Y, subunit A7 AT1G50960 18.75138879 gibberellin 2- Encodes a protein with gibberellin 2- oxidase 7 oxidase activity which acts specifically on C-20 gibberellins. DDF1 binds to GA2OX7 and regulates its expression in response to salt stress. AT1G10470 18.73158836 response Encodes a two-component response regulator 4 regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner.

AT1G79680 18.73047304 WALL ASSOCIATED KINASE (WAK)-LIKE 10 AT1G79690 18.73047304 nudix hydrolase homolog 3 AT1G28570 18.72580433 SGNH hydrolase-type esterase superfamily protein AT1G28580 18.72580433 GDSL-like Lipase/Acylhydrolase superfamily protein AT1G16130 18.70879507 wall associated wall-associated kinase like kinase-like 2 AT3G63190 18.70756102 ribosome The gene encodes a chloroplast ribosome recycling factor, recycling factor homologue. Analysis of chloroplast mutants revealed its role in the chloroplast precursor development and eary stages of embryo development. AT3G63200 18.70756102 PATATIN-like protein 9 AT4G24960 18.69763374 HVA22 Homologous to a eukaryote specific ABA- homologue D and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. AT4G24970 18.69763374 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein AT4G05170 18.68727875 basic helix-loop-helix (bHLH) DNA-binding superfamily protein AT4G05190 18.68727875 kinesin 5 ATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts.

AT4G03110 18.67815685 RNA-binding Encodes a putative RNA-binding protein protein-defense that is located in the cytoplasm and is related 1 involved in the hypersensitive response and positively regulates salicylic acid- mediated immunity. AT4G03120 18.67815685 C2H2 and C2HC zinc fingers superfamily protein AT5G54490 18.67501473 pinoid-binding Encodes a PINOID (PID)-binding protein protein 1 containing putative EF-hand calcium- binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. AT5G54500 18.67501473 flavodoxin-like Encodes a flavin mononucleotide-binding quinone flavodoxin-like quinone reductase that is a reductase 1 primary auxin-response gene. AT5G20870 18.65559363 O-Glycosyl hydrolases family 17 protein AT5G20885 18.65559363 RING/U-box superfamily protein AT3G18700 18.64008451 AT3G18710 18.64008451 plant U-box 29 Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. AT3G17180 18.63845348 serine carboxypeptidas e-like 33 AT4G28640 18.63007951 indole-3-acetic Auxin induced gene, IAA11 (IAA11). acid inducible 11

AT1G13930 18.60608912 Involved in response to salt stress. Knockout mutants are hypersensitive to salt stress. AT4G01720 18.60547400 WRKY family member of WRKY Transcription Factor; transcription Group II-b factor AT4G14880 18.60023594 O-acetylserine Encodes a cytosolic isoform of cytosolic (thiol) lyase O-acetylserine(thiol)lyase, a key enzyme (OAS-TL) in cysteine biosynthesis and for the isoform A1 fixation of inorganic sulfide. It catalyzes the formation of cysteine from O- acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. Lines carrying semi- dominant mutations exhibit early senescence. AT4G14890 18.60023594 2Fe-2S ferredoxin-like superfamily protein AT4G29190 18.59658861 Zinc finger C-x8-C-x5-C-x3-H type family protein AT4G23870 18.56008172 AT1G70270 18.53723168 AT4G36030 18.52936196 armadillo repeat Armadillo repeat protein. One of a family only 3 of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. AT4G36040 18.52936196 Chaperone DnaJ-domain superfamily protein AT1G67020 18.52287269 AT1G67030 18.52287269 zinc finger Encodes a zinc finger protein containing protein 6 only a single zinc finger.

AT5G65280 18.52051902 GCR2-like 1 Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. AT5G65290 18.52051902 LMBR1-like membrane protein AT3G23090 18.49482250 TPX2 (targeting protein for Xklp2) protein family AT2G25150 18.45453787 HXXXD-type acyl-transferase family protein AT2G15480 18.45360470 UDP-glucosyl transferase 73B5 AT2G15490 18.45360470 UDP- glycosyltransfer ase 73B4 AT3G48090 18.44953084 alpha/beta- Component of R gene-mediated disease Hydrolases resistance in Arabidopsis thaliana with superfamily homology to eukaryotic lipases. protein AT3G48100 18.44953084 response Encodes a transcription repressor that regulator 5 mediates a negative feedback loop in cytokinin signalling. ARR5 expression is upregulated by Class I KNOX genes. Arr5 protein is stabilized by cytokinin in a two- component phosphorelay. AT3G48110 18.44953084 glycine-tRNA glycine-tRNA ligase ligases AT3G20015 18.42398739 Eukaryotic aspartyl protease family protein

AT5G45110 18.41901898 NPR1-like Encodes a paralog of NPR1. Involved in protein 3 negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. AT5G62390 18.41229177 BCL-2- A member of Arabidopsis BAG (Bcl-2- associated associated athanogene) proteins, plant athanogene 7 homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi- functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. Localized to the ER. Necessary for the proper maintenance of the unfolded protein response during heat and cold tolerance. AT5G62410 18.41229177 structural SMC2-1 (SMC2) maintenance of chromosomes 2 AT5G65670 18.40161848 indole-3-acetic auxin (indole-3-acetic acid) induced gene acid inducible 9 AT4G01026 18.40007401 PYR1-like 7 Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA- dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA- dependent regulation of ABI1 and ABI2. AT3G24480 18.38156796 Leucine-rich

repeat (LRR) family protein AT5G03310 18.38146496 SAUR-like auxin- responsive protein family AT5G03320 18.38146496 Protein kinase superfamily protein AT3G24515 18.37839866 ubiquitin- conjugating enzyme 37 AT3G24520 18.37839866 heat shock member of Heat Stress Transcription transcription Factor (Hsf) family factor C1 AT1G25560 18.37331510 AP2/B3 Encodes a member of the RAV transcription transcription factor family that contains factor family AP2 and B3 binding domains. Involved in protein the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. AT5G06970 18.34750175 Protein of unknown function (DUF810) AT5G06980 18.34750175 AT4G01250 18.34466720 WRKY family member of WRKY Transcription Factor; transcription Group II-e factor AT4G05100 18.33995175 myb domain Member of the R2R3 factor gene family.

protein 74 AT5G42580 18.33821058 cytochrome a member of the cytochrome P450 family P450, family 705, subfamily A, polypeptide 12 AT5G47820 18.33003616 P-loop encodes a kinesin-like protein with an N- containing terminal microtubule binding motor nucleoside domain. Protein is localized to the triphosphate periphery of the cytoplasm and mutants in hydrolases the gene exhibit altered orientation of superfamily cellulose microfibrils and reduced protein mechanical strength of fibers. AT2G20670 18.32746410 Protein of unknown function (DUF506) AT5G46710 18.32350206 PLATZ transcription factor family protein AT1G49490 18.30557775 Leucine-rich repeat (LRR) family protein AT1G49500 18.30557775 AT1G49510 18.30557775 embryo defective 1273 AT2G45220 18.29190350 Plant invertase/pectin methylesterase inhibitor superfamily AT1G69790 18.29116297 Protein kinase superfamily protein AT3G20290 18.27943277 EPS15 Encodes AtEHD1, one of the Arabidopsis homology Eps15 homology domain proteins involved domain 1 in endocytosis (AtEHD2, At4g05520). AT3G20300 18.27943277 Protein of unknown

function (DUF3537) AT4G11330 18.27006340 MAP kinase 5 MAP kinase AT3G15810 18.26297307 Protein of unknown function (DUF567) AT2G30920 18.25420713 coenzyme Q 3 The enzyme encoded by this gene has been shown to complement the Saccharomyces cerevisiae coq3 mutation and, therefore, to have hexaprenyldihydroxybenzoate methyltransferase activity. It is however likely that, in Arabidopsis, the enzyme catalyzes the methylation of nonaprenyldihydroxybenzoate as it is the prevalent polyprenoid in this plant species. The enzyme is a mitochondrial-localized methyltransferase involved in ubiquinone biosynthesis. AT2G30925 18.25420713 AT2G30930 18.25420713 AT2G33710 18.25215435 Integrase-type encodes a member of the ERF (ethylene DNA-binding response factor) subfamily B-4 of superfamily ERF/AP2 transcription factor family. The protein protein contains one AP2 domain. There are 7 members in this subfamily. AT2G33720 18.25215435 AP2/B3-like transcriptional factor family protein AT4G27650 18.25148249 Eukaryotic Encodes Arabidopsis homolog of release factor 1 Drosophila pelota protein. (eRF1) family protein AT4G27654 18.25148249 AT4G27657 18.25148249 AT1G09380 18.23595619 nodulin MtN21 /EamA-like transporter family protein AT1G09410 18.23595619 pentatricopeptide (PPR) repeat-containing protein AT1G67920 18.23361015

AT3G25730 18.20407963 ethylene response DNA binding factor 3 AT3G25740 18.20407963 methionine Encodes a plastid localized methionine aminopeptidase aminopeptidase. Formerly called MAP1C, 1C now called MAP1B. AT3G18000 18.19892764 S-adenosyl-L- Arabidopsis thaliana N-methyltransferase- methionine- like protein mRNA. Reduce transmission dependent through pollen. methyltransferas es superfamily protein AT2G32270 18.19160604 zinc transporter A member of Zrt- and Irt-related protein 3 precursor (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. AT3G06500 18.18539810 Plant neutral invertase family protein AT5G08330 18.18398070 TCP family transcription factor AT5G08335 18.18398070 Isoprenylcystein Encodes an isoprenyl cysteine e carboxyl methylatransferase (ICMT) involved in the methyltransferas post-translational processing of proteins e (ICMT) family that have a C-terminal CaaX box. This protein appears to have higher catalytic activity and a higher transcript expression level than the other ICMT present in Arabidopsis (At5g23320). Analysis of ICMT RNAi lines suggests that this protein is involved in flower and stem development. AT5G08340 18.18398070 Nucleotidylyl transferase superfamily

protein AT4G23100 18.16310453 glutamate- Encodes the enzyme glutamate-cysteine cysteine ligase ligase catalyzing the first, and rate- limiting, step of glutathione biosynthesis. Required for cell proliferation at the root tip. Involved in susceptibility to the bacterial pathogen Pseudomonas syringae. Mutants are phytoalexin defective. AT4G23110 18.16310453 insulin-like growth factor binding AT5G25160 18.16186428 zinc finger Encodes a zinc finger protein containing protein 3 only a single zinc finger. AT1G67800 18.14963675 Copine (Calcium-dependent phospholipid-binding protein) family AT1G67810 18.14963675 sulfur E2 Encodes a protein capable of stimulating the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. SufE2:GFP localizes to the chloroplasts where it is likely to play a role in iron-sulfur cluster assembly. Transcript levels for this gene are high in the pollen relative to other organs based on RT-PCR analysis. AT2G30350 18.13855028 Excinuclease ABC, C subunit, N-terminal AT2G30360 18.13855028 SOS3- Encodes a SOS2-like protein kinase that is interacting a member of the CBL-interacting protein protein 4 kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. AT5G10550 18.13756275 global This gene is predicted to encode a transcription bromodomain-containing protein. A plant

factor group E2 line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. AT5G10560 18.13756275 Glycosyl hydrolase family protein AT2G40650 18.13701987 PRP38 family protein AT2G40670 18.13701987 response response regulator 16 regulator 16 AT4G05100 18.13285756 myb domain Member of the R2R3 factor gene family. protein 74 AT3G02540 18.08367705 Rad23 UV Encodes a member of the RADIATION excision repair SENSITIVE23 (RAD23) family: protein family AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. AT3G02550 18.08367705 LOB domain- containing protein 41 AT3G02560 18.08367705 Ribosomal protein S7e family protein AT5G07440 18.08277225 glutamate Encodes the beta-subunit of the glutamate dehydrogenase 2 dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. AT5G07440 18.08277225 glutamate Encodes the alpha-subunit of the glutamate dehydrogenase 2 dehydrogenase. The enzyme is almost

100

exclusively found in the mitochondria of stem and leaf companion cells. AT4G37330 18.07623148 cytochrome member of CYP81D P450, family 81, subfamily D, polypeptide 4 AT4G37340 18.07623148 cytochrome member of CYP81D P450, family 81, subfamily D, polypeptide 3 AT4G37360 18.07623148 cytochrome member of CYP81D P450, family 81, subfamily D, polypeptide 2 AT1G32640 18.07473159 Basic helix- Encodes a MYC-related transcriptional loop-helix activator with a typical DNA binding (bHLH) DNA- domain of a basic helix-loop-helix leucine binding family zipper motif. Binds to an extended G-Box protein promoter motif. Its transcription is induced by dehydration stress and ABA treatment. Negative regulator of blue lightñmediated photomorphogenic growth and blue and far-red-lightñregulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. AT5G23380 18.06997705 Protein of unknown function (DUF789)

101

AT3G30775 18.04565406 Methylenetetrah Encodes a proline oxidase that is predicted ydrofolate to localize to the inner mitochondrial reductase family membrane, its mRNA expression induced protein by high levels of Al and by osmotic stress. The promoter contains an L-proline- inducible element. AT5G03310 18.03544450 SAUR-like auxin- responsive protein family AT5G03320 18.03544450 Protein kinase superfamily protein AT5G43810 18.03157568 Stabilizer of Encodes a member of the EIF2C iron transporter (elongation initiation factor 2c)/ SufD / Argonaute class of proteins. Required to Polynucleotidyl establish the central-peripheral transferase organization of the embryo apex. Along with WUS and CLV genes, controls the relative organization of central zone and peripheral zone cells in meristems. Acts in embryonic provascular tissue potentiating WUSCHEL function during meristem development in the embryo. AT2G30040 18.02813017 mitogen- member of MEKK subfamily activated protein kinase kinase kinase 14 AT5G09620 18.02526522 Octicosapeptide/ Phox/Bem1p family protein AT5G09630 18.02526522 LisH/CRA/RING-U-box domains-containing protein AT5G09640 18.02526522 serine encodes a serine carboxypeptidase-like carboxypeptidas (SCPL) protein. Mutants accumulate e-like 19 sinapoylglucose instead of sinapoylcholine, and have increased levels

102

of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase. AT2G14210 18.02402663 AGAMOUS- MADS box gene, transcription factor like 44 AT2G22430 18.01650906 homeobox Encodes a homeodomain leucine zipper protein 6 class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. AT2G22440 18.01650906 AT2G22450 18.01650906 riboflavin biosynthesis protein, putative AT1G02220 17.99396920 NAC domain containing protein 3 AT1G67020 17.99047041 AT1G67030 17.99047041 zinc finger Encodes a zinc finger protein containing protein 6 only a single zinc finger. AT1G59740 17.97379947 Major facilitator superfamily protein AT3G61060 17.96706367 phloem protein 2-A13 AT3G12300 17.96526647 AT3G12320 17.96526647 AT3G46620 17.94766808 zinc finger (C3HC4-type RING finger) family protein AT3G46630 17.94766808 Protein of unknown function (DUF3223) AT1G08100 17.94520736 nitrate Encodes a high-affinity nitrate transporter. transporter 2.2 AT5G04110 17.94453144 DNA GYRASE B3

103

AT5G04120 17.94453144 Phosphoglycerat e mutase family protein AT5G37990 17.94261456 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein AT5G25810 17.91958427 Integrase-type encodes a member of the DREB subfamily DNA-binding A-4 of ERF/AP2 transcription factor superfamily family (TINY). The protein contains one protein AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis. AT3G13310 17.91957927 Chaperone DnaJ-domain superfamily protein AT3G13320 17.91957927 cation low affinity calcium antiporter CAX2 exchanger 2 AT5G46710 17.90771723 PLATZ transcription factor family protein AT3G02140 17.87773347 AFP2 (ABI Encodes a protein that acts in the nucleus five-binding and is an important negative regulator of protein 2) ABA and salt stress responses, and could family protein play a critical role in controlling root elongation, floral initiation and starch degradation. AT1G68660 17.87444973 Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein AT1G68670 17.87444973 myb-like transcription factor family

104

protein AT1G68680 17.87444973 AT1G31750 17.87407684 proline-rich family protein AT1G31760 17.87407684 SWIB/MDM2 domain superfamily protein AT1G31770 17.87407684 ATP-binding cassette 14 AT3G14430 17.85889268 AT4G01860 17.81750298 Transducin family protein / WD-40 repeat family protein AT4G01870 17.81750298 tolB protein- related AT4G01880 17.81750298 methyltransferas es AT4G24960 17.80153608 HVA22 Homologous to a eukaryote specific ABA- homologue D and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. AT4G24970 17.80153608 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein AT5G08139 17.78754067 RING/U-box superfamily protein AT5G03370 17.77095938 acylphosphatase family AT2G18700 17.75841331 trehalose Encodes an enzyme putatively involved in phosphatase/syn trehalose biosynthesis. The protein has a thase 11 trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. AT4G24560 17.74855828 ubiquitin- Encodes a ubiquitin-specific protease.

105

specific protease There is no evidence for a phenotype in 16 ubp16-1 mutants, however, double mutant analysis with ubp15 mutants reveals a role for UBP16 in plant development and cell proliferation. AT4G24570 17.74855828 dicarboxylate Encodes one of the mitochondrial carrier 2 dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). AT4G24580 17.74855828 Rho GTPase Encodes a Rho GTPase-activating protein activation that interacts with ROP1 (a Rho GTPase) protein and regulates pollen tube development. (RhoGAP) with This protein can be observed at the apical PH domain tip of growing pollen tubes and on endocytic vesicles traveling to this region of the pollen tube. AT1G10900 17.73414516 Phosphatidylinositol-4-phosphate 5-kinase family protein AT1G10910 17.73414516 Pentatricopeptide repeat (PPR) superfamily protein AT1G01490 17.73364353 Heavy metal transport/detoxification superfamily protein AT1G01500 17.73364353 Erythronate-4-phosphate dehydrogenase family protein AT1G01510 17.73364353 NAD(P)- Encodes a homolog of human CtBP. binding Mutant has longer and thicker leaves than Rossmann-fold wild type. Involved in controlling polar superfamily cell expansion in the leaf width direction. protein AT3G44330 17.71183705 AT5G59810 17.69999361 Subtilase family protein AT5G59820 17.69999361 C2H2-type zinc Encodes a zinc finger protein involved in finger family high light and cold acclimation. protein Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene

106

exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. AT5G59830 17.69999361 AT4G05100 17.69827223 myb domain Member of the R2R3 factor gene family. protein 74 AT2G29760 17.69147968 Tetratricopeptid Encodes a chloroplast RNA editing factor. e repeat (TPR)- like superfamily protein AT5G01750 17.64751482 Protein of unknown function (DUF567) AT1G68360 17.62585044 C2H2 and C2HC zinc fingers superfamily protein AT1G10470 17.62190628 response Encodes a two-component response regulator 4 regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. AT1G76670 17.61627078 Nucleotide- sugar transporter family protein AT5G59730 17.60964489 exocyst subunit A member of EXO70 gene family, exo70 family putative exocyst subunits, conserved in protein H7 land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. AT1G44170 17.59434223 aldehyde Encodes a protein similar to the aldehyde dehydrogenase dehydrogenase cp-ADH from 3H1 C.plantagineum. Constitutively expressed at low levels.

107

AT5G56980 17.59151649 AT3G11900 17.58843040 aromatic and encodes an amino acid transporter that neutral transports aromatic and neutral amino transporter 1 acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. AT5G03310 17.56501317 SAUR-like auxin- responsive protein family AT5G03320 17.56501317 Protein kinase superfamily protein AT5G26330 17.55723095 Cupredoxin superfamily protein AT4G32020 17.54512930 AT4G32030 17.54512930 AT1G20640 17.52143145 Plant regulator RWP-RK family protein AT1G31360 17.51458955 RECQ helicase Encodes a (d)NTP-dependent 3'->5' DNA L2 helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro. AT1G62290 17.51368070 Saposin-like aspartyl protease

108

family protein AT1G62300 17.51368070 WRKY family Encodes a transcription factor WRKY6. transcription Regulates Phosphate1 (Pho1) expression factor in response to low phosphate (Pi) stress. AT3G50870 17.50986481 GATA type zinc Encodes a GATA factort transcriptional finger regulator required to position the transcription proembryo boundary in the early embryo. factor family protein AT3G50880 17.50986481 DNA glycosylase superfamily protein AT1G35250 17.50951338 Thioesterase superfamily protein AT1G35260 17.50951338 MLP-like protein 165 AT3G01290 17.49992204 SPFH/Band 7/PHB domain-containing membrane-associated protein family AT1G24170 17.47240973 Nucleotide- Encodes a protein with putative diphospho-sugar galacturonosyltransferase activity. transferases superfamily protein AT1G24180 17.47240973 Thiamin Arabidopsis thaliana pyruvate diphosphate- dehydrogenase E1a-like subunit. 81% binding fold identical to a previously characterized (THDP-binding) Arabidopsis mitochondrial PDH E1a- superfamily subunit, At1g59900 protein AT4G10380 17.46170378 NOD26-like Boric acid channel. Essential for efficient intrinsic protein boron uptake and plant development 5;1 under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains

109

of root cells. AT1G30825 17.46030641 Arp2/3 Involved in trichome maturation. mutant complex, 34 kD displays enlarged trichomes subunit p34-Arc AT5G09810 17.45371175 actin 7 Member of Actin gene family.Mutants are defective in germination and root growth. AT5G40460 17.43979073 AT4G05100 17.42976356 myb domain Member of the R2R3 factor gene family. protein 74 AT2G38750 17.42019701 annexin 4 Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. AT2G38760 17.42019701 annexin 3 Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. AT5G05250 17.41972852 AT4G03550 17.41966295 glucan synthase- Encodes a callose synthase that is required like 5 for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. AT3G47833 17.41058874 AT3G52470 17.39274478 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family AT5G51340 17.37219000 Tetratricopeptide repeat (TPR)-like superfamily protein AT1G02220 17.37063551 NAC domain containing protein 3 AT3G27260 17.37055159 global Kinase like protein with similarity to yeast transcription BDF1 and human RING3 protein, which factor group E8 have two bromodomains GTE8 has a

110

single bromodomain AT1G13300 17.34287357 myb-like Overexpression confers hypersensitivity to transcription low phosphate-elicited inhibition of factor family primary root growth. protein AT4G16780 17.33455253 homeobox Encodes a homeodomain-leucine zipper protein 2 protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. AT3G14840 17.33158708 Leucine-rich repeat transmembrane protein kinase AT1G60140 17.32467318 trehalose Encodes an enzyme putatively involved in phosphate trehalose biosynthesis. The protein has a synthase trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. AT5G37260 17.32460237 Homeodomain- Encodes a MYB family transcription like superfamily factor Circadian 1 (CIR1). Involved in protein circadian regulation in Arabidopsis. AT4G17460 17.32434416 Homeobox- Encodes homeobox protein HAT1. leucine zipper protein 4 (HB-4) / HD-ZIP protein AT4G27650 17.32390285 Eukaryotic Encodes Arabidopsis homolog of release factor 1 Drosophila pelota protein. (eRF1) family protein AT4G27652 17.32390285 AT4G27654 17.32390285 AT4G27657 17.32390285 AT4G37610 17.32230759 BTB and TAZ BTB and TAZ domain protein. Located in domain protein cytoplasm and expressed in fruit, flower 5 and leaves. AT1G18720 17.29929447 Protein of

111

unknown function (DUF962) AT1G18740 17.29929447 Protein of unknown function (DUF793) AT1G18750 17.29929447 AGAMOUS- Encodes a member of the MIKC (MADS like 65 box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL65 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. AT4G01720 17.29758072 WRKY family member of WRKY Transcription Factor; transcription Group II-b factor AT1G51940 17.28985333 protein kinase family protein / peptidoglycan-binding LysM domain-containing protein AT3G46280 17.27016115 protein kinase- related AT5G04330 17.24447513 Cytochrome P450 superfamily protein AT1G50740 17.21647859 Transmembrane proteins 14C AT1G50750 17.21647859 Plant mobile domain protein family AT5G52830 17.21570873 WRKY DNA- Encodes a WRKY transcription factor binding protein WRKY27. Mutation in Arabidopsis 27 WRKY27 results in delayed symptom development in response to the bacterial

112

wilt pathogen Ralstonia solanacearum. AT3G15810 17.19218755 Protein of unknown function (DUF567) AT2G28910 17.17929363 CAX interacting Encodes a CAX-interacting protein protein 4 (CXIP4). The gene product is located in the nucleus of GFP-CXIP4-expressing yeast cells. When transiently expressed in the tobacco leaves, GFP-CXIP4 locates to the nucleus as well as in discrete areas of the cytoplasm (which do not overlap with mitochondria). AT2G34720 17.17806315 nuclear factor Y, subunit A4 AT2G34730 17.17806315 myosin heavy chain-related AT1G09350 17.16683197 galactinol synthase 3 AT1G09360 17.16683197 Plant invertase/pectin methylesterase inhibitor superfamily protein AT1G69610 17.15743804 Protein of unknown function (DUF1666)

113

SI Appendix, Table S6. Primers used.

Gene Name (ID) Primer Name Primer Sequence SHY2 (AT1G04240) shy2-31 fw TGCAATTCTTGAAGAAATGGATGAG shy2-31 rev AGCAAGAAACTCTCTCTTTTG ACTIN2 ACTIN qPCR-FW GACCAGCTCTTCCATCGAGAA (AT3G18780) ACTIN qPCR-REV CAAACGAGGGCTGGAACAAG GH3.3 (AT2G23170) GH3.3 qPCR-FW GGTGCTGCTTGGAAATGGAG GH3.3 qPCR-REV GCAAAGCTGGGCTGAAGTGT GH3.17 (AT1G28130) pGH3.17 FW GGGCGTTACGTATCAGGAAA pGH3.17 REV TGTCTGAAAGCAGACACAAACA gGH3.17 FW ATGATACCAAGTTACGACCCAAAT gGH3.17 REV AGAATCTAAACCAAGTGGTTCCC GH3.17 qPCR-FW CGCTGAAAAGTCGTGGGAAG GH3.17 qPCR-REV AGGAAACATCGGCAGGATCA GH3.17 qPCRa-FW ATTCACAGGTTTGTACAGATACAGAGT GH3.17 qPCRa-REV AACGTTTCTTCGCTGCAC GH3.17#1-F TTATCACAAAACAACATTTCAAGAAT GH3.17#1-R CCCATCAACTTTAAAAGACATGC GH3.17#2-F TGTCCTGTATCTCTCCCAAACA GH3.17#2-R TCACACACATGCGAGAGAGA GH3.17#3-F GGGATTAAGACCATTAACGTGTG GH3.17#3-R TCCTTTTGGTCCCTGAAAAA GH3.17#4-F TTGGGTTGTTACGTTTCAAAAA GH3.17#4-R TGGTGAGAATCTCGTTTCAGA GH3.17#5-F TCAACTTAATTGTCAAGGAAAAGA GH3.17#5-R TTCCTTTGCTTTAGGCTTTTT GH3.17#6-F CATCTGTTTCCTCGTCACACA GH3.17#6-R TGCATCAGCTTAATTCCATCA GH3.17#7-F CCAAGATGATGACTTTATAATATCCAA GH3.17#7-R TGACTTATGGCAATCAAGATTAAGA GH3.17#8-F GAGCCCAATTATCGCATGTAA GH3.17#8-R TCTTAGTTATTCAAATTCCATTGACA GH3.17#9-F TCACAGCAATGCAAATATACAGG

114

GH3.17#9-R ATATGTGGCTATGGAATTTTCTTT GH3.17#10-F CTTAAAGAAAATTCCATAGCCACA GH3.17#10-R CACATGCAAATTTTTCAAATAAAG GH3.17#11-F AAAGGTTTCAACGAGTTCCTAAA GH3.17#11-R TTGCATATGTCTGCCAAAAGA GH3.17#12-F GCAGACATATGCAAATCTTGTGA GH3.17#12-R TGCTGTTTAATCCTCCAATCAA GH3.17#13-F TTGATTGGAGGATTAAACAGCA GH3.17#13-R ATTACCTGTGCAGGCTTTCC GH3.17#14-F GGAAAGCCTGCACAGGTAAT GH3.17#14-R TTGGGAGGTCCTACAACACA GH3.17 NEG#1-F TGCTCACGGAGTACACAAGC GH3.17 NEG#1-R TTGCTGTGACGTGGCTTTAG GH3.17 NEG#2-F GTCGTGGGAAGGAATCTTGA GH3.17 NEG#2-R ATTGAGCCATCGAACCAGTC GH3.17 NEG#3-F ATGACCCACCAAAGCTTGAC GH3.17 NEG#3-R AATCAAACGTGCCCAAACTC UBQ10 (AT4G05320) UBQ10-F GGCCTTGTATAATCCCTGATGAATAAG UBQ10-R AAAGAGATAACAGGAACGGAAACATA GT

115

SI Appendix References

1. Dello Ioio R., Scaglia Linhares F., Scacchi E., Casamitjana-Martinez E., Heidstra R., Costantino P., and Sabatini S. (2007). Cytokinins determine Arabidopsis root- meristem size by controlling cell differentiation. Curr. Biol. 17, 678–682.

2. Perilli S., Sabatini S. (2010). Analysis of root meristem size development. Methods Mol. Biol. 655, 177-187.

3. French A. P., Wilson M. H., Kenobi K., Dietrich D., Voss U., Ubeda-Tomas S., Pridmore T. P., Wells D. M. (2012). Identifying biological landmarks using a novel cell measuring image analysis tool: Cell-o-Tape. Plant Methods 8, 7.

4. Clough S. J., Bent A. F. (1998). Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J 16, 735-743.

5. Orlando D. A., Brady S. M., Koch J. D., Dinneny J. R., Benfey P. N. (2009). Manipulating large-scale Arabidopsis microarray expression data: identifying dominant expression patterns and biological process enrichment. Methods Mol Biol 553, 57-77.

6. Sozzani R., Cui H., Moreno-Risueno M. A., Busch W., Van Norman J. M., Vernoux T., Brady S.M., Dewitte W., Murray J.A., Benfey P. N. (2010). Spatiotemporal regulation of cell-cycle genes by SHORTROOT links patterning and growth. Nature 466, 128-32.

7. Rutschow H. L., Baskin T. I., Kramer E. M. (2014). The carrier AUXIN RESISTANT (AUX1) dominates auxin flux into Arabidopsis protoplasts. New Phytol. 204, 536-44.

8. rieneisen V.A., u ., Mar e A. F. M., Hogeweg P., Scheres B. (2007). Auxin transport is sufficient to generate a maximum and gradient guiding root growth. Nature 449, 1008–1013.

9. Laskowski, M., Grieneisen V. A., Hofhuis H., Ten Hove C. A., Hogeweg P., Marée A. F. M., Scheres B. (2008). Root system architecture from coupling cell shape to auxin transport. PLoS Biol. 6:e307.

10. Blilou I., Xu J., Wildwater M., Willemsen V., Paponov I., Friml J., Heidstra R., Aida M., Palme K., Scheres B. (2005). The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature 433, 39-44.

116

11. Lewis D. R., Muday G. K. (2009). Measurement of auxin transport in Arabidopsis thaliana. Nat Protoc. 4, 437-51.

12. Brunoud G., Wells D. M., Oliva M., Larrieu A., Mirabet V., Burrow A. H., Beeckman T., Kepinski S., Traas T., Bennett M. J., Vernoux T. (2012). A novel sensor to map auxin response and distribution at high spatio-temporal resolution. Nature, 482, 103–106.

13. Band L. R., Wells D. M., Larrieu A., Sun J., Middleton A. M., French A. P., Brunoud G., Sato E. M., Wilson M. H., Péret B., Oliva M., Swarup R., Sairanen I., Parry G., Ljung K., Beeckman T., Garibaldi J. M., Estelle M., Owen M. R., Vissenberg K., Hodgman T. C., Pridmore T. P., King J. R., Vernoux T., Bennett M. J. (2012). Root gravitropism is regulated by a transient lateral auxin gradient controlled by a tipping-point mechanism. Proc. Natl. Acad. Sci. U.S.A. 109, 4668-4673.

14. Ljung K. (2005). Sites and Regulation of Auxin Biosynthesis in Arabidopsis Roots. Plant Cell 17, 1090-1104.

15. Novák O., H nyková E., Sairanen I., Kowalczyk M., Pospíšil T., Ljung K. (2012). Tissue-specific profiling of the Arabidopsis thaliana auxin metabolome. Plant J. 72, 523-536.

16. Liao C. Y., Smet W., Brunoud G., Yoshida S., Vernoux T., Weijers D. (2015). Reporters for sensitive and quantitative measurement of auxin response. Nat. Methods 12, 207– 210.

17. Grieneisen V. A. and Scheres B. (2012). Morphogengineering roots: comparing mechanisms of morphogen gradient formation. BMC Syst. Biol. 6:37.

18. Cruz-ramírez A., Díaz-Triviño S., Blilou I., Grieneisen V. A., Sozzani R., Zamioudis C., Miskolczi P., Nieuwland J., Benjamins R., Dhonukshe P., Caballero- Pérez J., Horvath B., Long Y., Mähönen A. P., Zhang H., Xu J., Murray J.A., Benfey P. N., Bako L., Marée A. F., Scheres B. (2013). A Bistable Circuit Involving SCARECROW- RETINOBLASTOMA Integrates Cues to Inform Asymmetric Stem Cell Division. Cell 150, 1002-1015.

19. Shimotohno A., Sotta N., Sato T., De Ruvo M., Marèe A. F. M, Grieneisen V. A., Fujiwara T. (2015). Mathematical modelling and experimental validation of spatial distribution of boron in the root of Arabidopsis thaliana identify high boron accumulation in the tip and predict a distinct root tip uptake function. Plant Cell Physiol. 56, 620-630.

117

20. Moubayidin L., Di Mambro R., Sozzani R., Pacifici E., Salvi E., Terpstra I., Bao D., van Dijken A., Dello Ioio R., Perilli S., Ljung K., Benfey P. N., Heidstra R., Costantino P., and Sabatini S. (2013). Spatial coordination between stem cell activity and cell differentiation in the root meristem. Dev. Cell 26, 405-415.

21. Moore S., Zhang X., Mudge A., Rowe J. H., Topping J. F., Liu J., Lindsey K. (2015). Spatiotemporal modelling of hormonal crosstalk explains the level and patterning of hormones and gene expression in Arabidopsis thaliana wild-type and mutant roots. New Phytol. 207, 1110-22.

22. Band L. R., Wells D. M., Fozard J. A., Ghetiu T., French A. P., Pound M. P., Wilson M. H., Yu L., Li W., Hijazi H. I., Oh J., Pearce S. P., Perez-Amador M. A., Yun J., Kramer E., Alonso J. M., Godin C., Vernoux T., Hodgman T. C., Pridmore T. P., Swarup R., King J. R., Bennett M. J. (2014). Systems Analysis of Auxin Transport in the Arabidopsis Root Apex. Plant Cell 26, 862-875.

23. Kakani A., Li G., Peng Z. (2009). Role of AUX1 in the control of organ identity during in vitro organogenesis and in mediating tissue specific auxin and cytokinin interaction in Arabidopsis. Planta 229, 645-657.

24. Zhang W., Swarup R., Bennett M., Schaller G. E., Kieber J. J. (2013). Cytokinin induces cell division in the quiescent center of the Arabidopsis root apical meristem. Curr Biol. 23, 1979-1989.

118