Sulfoxaflor Degraded by Aminobacter Sp. CGMCC 1.17253 Through

pubs.acs.org/JAFC Article

Sulfoxaﬂor Degraded by Aminobacter sp. CGMCC 1.17253 through Hydration Pathway Mediated by Nitrile Hydratase Wen-Long Yang, Zhi-Ling Dai, Xi Cheng, Ling Guo, Zhi-Xia Fan, Feng Ge,* and Yi-Jun Dai*

Cite This: J. Agric. Food Chem. 2020, 68, 4579−4587 Read Online

ACCESS Metrics & More Article Recommendations *sı Supporting Information

ABSTRACT: Sulfoxaflor, a sulfoximine insecticide, could efficiently control many insect pests of sap-feeding. Microbial degradation of sulfoxaflor and the enzymatic mechanism involved have not been studied to date. A bacterial isolate JW2 that transforms sulfoxaflor to X11719474 was isolated and identified as Aminobacter sp. CGMCC 1.17253. Both the recombinant Escherichia coli strain harboring the Aminobacter sp. CGMCC 1.17253 nitrile hydratase (NHase) gene and the pure NHase acquired sulfoxaflor- degrading ability. Aminobacter sp. CGMCC 1.17253 NHase is a typical cobalt-containing NHase content of subunit α, subunit β, and an accessory protein, and the three-dimensional homology model of NHase was built. Substrate specificity tests showed that NHase catalyzed the conversion of acetamiprid, thiacloprid, indolyl-3-acetonitrile, 3-cyanopyridine, and benzonitrile into their corresponding amides, indicating its broad substrate specificity. This is the first report of the pure bacteria degradation of the sulfoxaflor residual in the environment and reveals the enzymatic mechanism mediated by Aminobacter sp. CGMCC 1.17253. KEYWORDS: insecticide, biodegradation, Aminobacter sp. CGMCC 1.17253, sulfoxaflor, nitrile hydratase

■ INTRODUCTION 3-yl]ethanol}, X11719474 [N-(methyl(oxido){1-[6- fl fl (trifluoromethyl)pyridin-3-yl]ethyl}-k4-sulfanylidene)urea], Sulfoxa or (SUL, X14422208, [N-[methyloxido[1-[6-(tri uor- fl omethyl)-3-pyridinyl] ethyl]-λ4-sulfanylidene] cyanamide]) is X11519540 {[5-(1-methylsulfonyl)ethyl]-2-(tri uoromethyl)- pyridine}, X11579457 ({5-[1-(S-methylsulfonimidoyl)ethyl]}- a novel sulfoximine insecticide. At the core of its structure, fl fl there are a 2-CF -pyridine fragment and a distinctive N- 2-(tri uoromethyl)pyridine), and 5-ethyl-2-(tri uoromethyl)- 3 pyridine, could be detected in the environment, thereby cyanosulfoximine moiety. Similar to the target site of presenting an environmental problem (Figure 1A).5,13,14 To neonicotinoids, nicotinic acetylcholine receptors (nAChRs) achieve successful integrated pest management in protected of insects are the target site of sulfoxaflor, and sulfoxaflor could 1 crops, the first evaluation of the compatibility with pesticides efficiently control many insect pests of sap-feeding. Sulfoxaflor and other nontarget organisms is required. However, despite has been used in the control of many pests such as Aphis the lack of cross-resistance between neonicotinoids, there are gossypii Glover, Philaenus spumarius, and Laodelphax striatel- 2−4 still reports that sulfoxaflor exerts toxicity against many non- lus as well as numerous crops such as brown rice and 5,6 target organisms, such as earthworms, bumblebees, and lettuce. − Amblyseius swirskii.15 17 Furthermore, reports that sulfoxaflor

Downloaded via NANJING NORMAL UNIV on April 23, 2020 at 02:38:16 (UTC). Sap-feeding insects cause considerable economic losses in residues exert toxicity in rats and mice, as animal models of terms of crop damage and several classes of insecticides have ff human disease, are of great concern. In rats, high-dose dietary been used to e ectively control many pests of sap-feeding. The fl See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles. exposure to sulfoxa or in the gestational period caused most commonly used insecticides in the world are reduced neonatal survival and fetal abnormalities (primarily neonicotinoids. However, there is increasing evidence that limb contractures).18 High dietary doses of sulfoxaflor induced neonicotinoids are poisonous to pollinators as well as other 19 − rodent hepatotoxicity in mice. Sulfoxaflor in the environ- nontarget organisms, such as wild bees and honeybees.7 9 It ment, therefore, presents a serious health threat. has led to several countries banning the usage of neonicotinoid Many insecticide residues are degraded by microorganisms insecticides, there for developing alternative pest control and therefore considered of moderate risk to the environ- products is necessary.10 Sulfoxaflor could effectively control ment.20,21 Many neonicotinoids insecticide environmental lots species of sap-feeding insects but lacks cross-resistance residual removed by microorganisms has been studied. with neonicotinoids; consequently, it is regarded as a potential Neonicotinoids insecticide imidacloprid could be degraded successor to neonicotinoid insecticides.11 However, despite being highly effective against sap-feeding insects, showing decreased toxicity compared with other Received: October 23, 2019 insecticides and lacking cross-resistance with neonicotinoids, Revised: January 31, 2020 sulfoxaflor residues remained detectable in brown rice, rice Accepted: March 31, 2020 straw, and paddy field water after field application.5,12 Published: March 31, 2020 Sulfoxaflor and its metabolites, X11596066 (5-ethyl-2-trifluor- omethylpyridine), X11721061 {1-[6-(trifluoromethyl)pyridin-

Figure 1. Metabolic pathways of sulfoxaflor and the molecular structures of the substrates used for specificity testing. (A) Various pathways for the metabolism of sulfoxaflor. (B) Molecular structures of the NHase substrates used for specificity testing. by Pseudomonas putida KT2440 through oxidation pathway of a novel bacteria-based method for sulfoxaflor bioremedia- into 5-hydroxy and olefin imidacloprid derivatives, and it also tion. could be degraded through nitroreduction pathway into nitroso, guanidine, and urea imidacloprid derivatives.22 ■ MATERIALS AND METHODS Neonicotinoid insecticide thiacloprid could be degraded into Chemicals and Media. Sulfoxaflor was purchased from Hubei thiacloprid amide by Ensifer meliloti CGMCC 7333 through Zhengxingyuan Fine Chemical Co. (Wuhan, China) and had a purity 21 of 95%. Other reagents were purchased from Sinopharm Chemical hydrolysis pathway. Neonicotinoid insecticide acetamiprid Reagent Co. (Shanghai, China) and were of analytical grade. could be degraded into (E)-1-(1-(((6-chloropyridin-3-yl)- Acetonitrile was of high-performance liquid chromatography methyl)(methyl)amino)ethylidene)urea by Streptomyces canus (HPLC) grade and purchased from Tedia Co. (Fairfield, OH). The 20 CGMCC 13662 through hydrolysis pathway.23 However, pure formula of mineral salt medium (MSM) was described previously. isolate of microbial degradation of sulfoxaflor has not been The lysogeny broth (LB) comprised of 10 g of NaCl, 10 g of tryptone, and 5 g of yeast extract and dissolved in 1 L of deionized water (pH reported before. 7.2). The LB agar medium had the same formula as that of LB but 2% This study aimed to isolate sulfoxaflor-degrading micro- agar was added. organisms out of soil source. Subsequently, the metabolic X11719474 was prepared as follows: sulfoxaflor was transformed by pathways as well as enzymes required for sulfoxaflor Escherichia coli Rosetta (DE3) resting cells overexpressing Amino- bacter sp. CGMCC 1.17253 NHase (see the Cloning of the biodegradation were characterized. The findings of this study fl Aminobacter sp. CGMCC 1.17253 NHase Gene in E. coli Rosetta will enhance the understanding of sulfoxa or degraded by (DE3) section). NHase was induced to express in the recombinant E. microbes in the environment and may aid in the development coli Rosetta (DE3) strains in 600 mL of LB following the method

4580 https://dx.doi.org/10.1021/acs.jafc.9b06668 J. Agric. Food Chem. 2020, 68, 4579−4587 Journal of Agricultural and Food Chemistry pubs.acs.org/JAFC Article described in the Overexpression of Aminobacter sp. CGMCC High-Performance Liquid Chromatography (HPLC) Anal- 1.17253 NHase and Enzymatic Activity Assay section. Five hundred yses Method. To analyze sulfoxaflor and its metabolites, an HC-C18 milligrams per liter sulfoxaflor solution (dissolve in 50 mmol/L column (4.6 mm × 250 mm, 5 μm; Agilent, Santa Clara, CA) phosphate-buffered saline (PBS), pH 7.0) was transformed by E. coli mounted on an Agilent 1200 HPLC system was used. The flow rate of Rosetta (DE3) resting cells overexpressing Aminobacter sp. CGMCC elution was 1 mL/min. The mobile phase was water (containing 1.17253 NHase following the method described in the Isolation and 0.01% acetic acid) and acetonitrile, and the ratio of water (containing Identification of Sulfoxaflor-Degrading Bacterial Strain JW2 section 0.01% acetic acid) to acetonitrile was 70:30. The wavelength of the until sulfoxaflor had been thoroughly transformed. To remove the Agilent G1314A UV detector was 220 nm. cells, the transformation broth containing X11719474 was centrifuged Liquid Chromatography−Mass Spectrometry (LC−MS) − fi at 8000×g, 5 min. Then, the supernatant was collected and dried to a Analyses. An Agilent LC MS system (1290 In nity LC/6460 powder by freeze-drying. The powder was then extracted by ethyl Triple Quad MS; Agilent, Santa Clara, CA) in tandem with an acetate. Then, the ethyl acetate extraction contained X11719474 was electrospray ion source used in both positive- and negative-ion modes fi μ fi were used to analyze the sulfoxaflor-transformed sample by JW2 to concentrated after ltering with a 0.22 m ultra ltration membrane. fl When the crystals of X11719474 had formed and accumulated to a identify the metabolite of sulfoxa or. The HPLC analysis conditions were the same as described above. certain quantity in a vacuum rotary evaporator, the extra ethyl acetate fl was removed, and the crystals were vacuum-dried. X11719474 was Biodegradation of Sulfoxa or in Soil. To investigate whether fi Aminobacter sp. CGMCC 1.17253 could degrade sulfoxaflor in soil, puri ed to a purity of 96.9%. fl Isolation and Identification of Sulfoxaflor-Degrading experiment with the degradation of sulfoxa or by Aminobacter sp. Bacterial Strain JW2. Soil samples for microbe isolation were CGMCC 1.17253 in sterilized soil was practiced. The soil samples collected from Kunming, Yunnan Province, China. In detail, in a 100 collected in Nanjing, China, were without insecticides. The mL flask, 1.0 g of soil sample was added into 20 mL of sterilized MSM physicochemical properties of the soil samples were tested by the broth and five glass beads (∼5 mm in diameter) were added to the Institute of Soil Science of the Chinese Academy of Sciences. The flask. The flask was then shaken for 2 h at 220 rpm. One milliliter of cation-exchange capacity was 21.61 cmol/kg, the organic matter was 17.24 g/kg, and the pH was 6.0. Dry heat sterilization was used to the mixture mentioned above was then inoculated into 80 mL of ° sterilized 200 mg/L sulfoxaflor containing MSM broth, contained in a sterilize the soil sample, 150 C, 5 h. After being ground and sieved fl through a 0.55 mm sieve. Next, 10 g of the soil sample was put in 100 250 mL ask. The culture mentioned above was then incubated at 30 fl fl °C with shaking at 220 rpm for 2 weeks. One milliliter of the sample mL asks and 2 mL of sterilized sulfoxa or solution (400 mg/L sulfoxaflor dissolved in PBS, 50 mmol, pH 7.0) was added to the flask. was inoculated into 80 mL of sterilized MSM broth containing 500 ° mg/L sulfoxaflor, contained in a new 250 mL flask containing, and Bacterial cells were precultured in LB broth (cultured at 30 C, 220 was incubated under the same conditions mentioned above for 2 rpm, for 24 h, with 0.1 mmol/L CoCl2 added) were centrifuged for collection and resuspended in 50 mmol PBS (pH 7.0) to an OD of weeks. The culture broth was then spread on LB agar plates after 600 10, and aliquots of 2 mL of the bacterial suspension were added to the being diluted to 10 000- and 100 000-fold and the plates were soil sample, the final sulfoxaflor concentration was 80 mg/kg soil. As a incubated at 30 °C. Single colonies with different morphologies were control group, 4 mL of the sterilized sulfoxaflor solution (200 mg/L picked and streaked onto LB agar plates, then the plates were sulfoxaflor dissolved in PBS, 50 mmol, pH 7.0) was added to the soil incubated at 30 °C. The sulfoxaflor-degrading ability of these purified sample. Subsequently, the flasks were incubated at 30 °C with a microbes was tested by resting cells. An isolate was inoculated into 20 humidity of 35% in the dark for a definite time. The flasks were sealed mL of LB contained in a 100 mL flask, and the flask was incubated at and shaken at 220 rpm for 2 h after adding 12 mL of acetonitrile. 30 °C, 220 rpm. After being incubated for 24 h, 2 mL of the culture After centrifuging for 10 min at 10 000×g, the supernatants were was inoculated into 100 mL of LB containing 0.1 mmol/L CoCl2 fl fl ° sampled and analyzed by HPLC. The HPLC method was the same as contained in a 500 mL ask. The ask was then incubated at 30 C, described above. 220 rpm, 24 h. The cultured cells were collected by centrifugation, Aminobacter × Cloning of sp. CGMCC 1.17253 NHase Gene in 7000 g, 5 min. After being washed twice by sterilized phosphate- E. coli Rosetta (DE3). The genomic sequencing of Aminobacter sp. ff bu ered saline (PBS) (50 mmol/L, pH 7.0), the cell sediments were CGMCC 1.17253 was performed by the Beijing Genomics Institute fl resuspended in 200 mg/L sulfoxa or solution dissolved in PBS (50 (Beijing, China) and showed that there is only one NHase gene in the mmol/L, pH 7.0); the cell density at an optical density of 600 nm genome. The total genomic DNA of Aminobacter sp. CGMCC (OD600) was adjusted to 5. 1.17253 was extracted following the instructions of the DNA Thecellsuspensionwasdividedintoasterilized50mL extraction kit (MiniBEST Bacterial Genomic DNA Extraction Kit, centrifugation tube at 2 mL per tube. After being sealed by a TaKaRa, Dalian, China). The primers for NHase gene amplification fi ° breathable lm, the tubes were incubated at 30 C, 220 rpm for the containing EcoRI and XhoI restriction enzyme sites were primer-F × indicated time. The solution was centrifuged at 10 000 g for 5 min to (ACAGCAAATGGGTCGCGGATCCGAATTCATGTCGCAC- remove the cells. Seven hundred microliters of the supernatant was GATCACCATCACGAC) and primer-R (ATCT- sampled and 300 μL of acetonitrile was added to the sample. After CAGTGGTGGTGGTGGTGGTGCTCGAGT- being filtered by 0.22 μm pore size membrane, the sample was CAGCGTTTTGCCGGATCGTTC). The primers were synthesized analyzed by HPLC. by the same method as that used for 16S rRNA gene amplification. Morphological analysis and 16S rRNA gene sequencing were used The PCR reaction mixtures contained 1 mmol/L primer-F and to identify sulfoxaflor-degrading isolates. An optical microscope was primer-R, 1 ng of genomic DNA, 1× PrimeSTAR Max Premix used to observe the cell morphology after Gram staining. The colony (TaKaRa, Dalian, China), and a certain amount of double-distilled polymerase chain reaction (PCR) was used to amplify the 16S rRNA water; the total volume was 20 μL. Bio-Rad Thermal Cycler (Bio-Rad, gene of selected clones. The amplification primers were K1 (5′- Hercules, CA) was used for gene amplification. The amplification AACTGAAGAGTTTGATCCTGGCTC-3′) and K2 (5′-TACGGT- program was the same as described below: predenaturing for 5 min at TACCTTGTTACGACTT-3′). The amplicons were then sequenced 95 °C; subsequently, 30 cycles of denaturing for 50 s at 95 °C, by Springen Co. (Nanjing, China). The 16S rRNA gene sequence of annealing for 60 s at 60 °C, and extension for 60 s at 72 °C; finally, the sulfoxaflor-degrading isolates were deposited in the GenBank with a final extension for 10 min at 72 °C. The amplicons were tested database. Basic Local Alignment Search Tool for nucleotides by electrophoresis on ethidium bromide-stained 1% agarose gels in 1× (BLASTn) was used to compare the 16S rRNA gene sequence of TAE buffer. the isolate JW2 with the 16S rRNA gene sequence already present in The recombination of the PCR amplicons and EcoRI/XhoI- the GenBank database. MEGA 6 was used to generate a neighbor- digested expression vector pET28a was practiced following the joining phylogenetic tree based on the 16S rRNA gene sequences for instructions of ClonExpress MultiS One Step Cloning Kit (Vazyme the isolate JW2. Biotech Co., Nanjing, China). The recombinant plasmids containing

4581 https://dx.doi.org/10.1021/acs.jafc.9b06668 J. Agric. Food Chem. 2020, 68, 4579−4587 Journal of Agricultural and Food Chemistry pubs.acs.org/JAFC Article the NHase gene were then transformed into competent E. coli Rosetta To examine the substrate specificity of NHase, 10 μL of NHase cells following the method of Sun et al.24 The transformants were (958 μg/mL) was added to 990 μL of 200 mg/L benzonitrile (BN), sequenced by Springen Co., and a neighbor-joining phylogenetic tree 3-cyanopyridine (3-CP), indolyl-3-acetonitrile (IAN), thiacloprid of Aminobacter sp. CGMCC 1.17253 NHase was then generated (THI), or acetamiprid (ACE) dissolved in 50 mmol/L PBS (pH based on the subunit α of NHase sequences by MEGA 6. 7.0). The reaction solution was incubated for 20 min at 30 °C, 800 Overexpression of Aminobacter sp. CGMCC 1.17253 NHase rpm. All of the reactions were analyzed by HPLC, with a ratio of water and Enzymatic Activity Assay. NHase was expressed in E. coli (containing 0.01% acetic acid) to acetonitrile of ACE, THI, IAN, BN, Rosetta in LB broth (containing 0.2 mmol/L CoCl2 and 0.2 mmol/L and 3-CP of 70:30, 65:35, 60:40, 55:45, and 70:30, respectively. The isopropyl β-D-thiogalactoside) by incubating at 30 °C for 6 h. The wavelengths of the UV detector was 235, 242, 230, 231, and 230 nm, protein expression was assessed by sodium dodecyl sulfate and all other test parameters were the same as those used for polyacrylamide gel electrophoresis (SDS-PAGE) and then Coomassie sulfoxaflor. Brilliant Blue was used to stain the gel. To examine the activity of the Homology Modeling of Aminobacter sp. CGMCC 1.17253 expressed Aminobacter sp. CGMCC 1.17253 NHase to sulfoxaflor, the NHase. SWISS-MODEL workspace (https://swissmodel.expasy.org/ induced recombinant E. coli Rosetta (DE3) strain was examined by interactive) was used to build the three-dimensional homology model the same method as that use for resting cell degradation assay except of NHase. The homology model of Aminobacter sp. CGMCC 1.17253 that the reaction time was 10 min. After centrifuging, the culture NHase was constructed following the crystal structure of P. putida NHase (PDB: 3QXE, X-ray diffraction resolution 2.10 Å).25 GMQE26 supernatants were sampled and analyzed by HPLC according to the 27 method described above. and QMEAN were used to evaluate the homology model of Biochemical Characterization of Aminobacter sp. CGMCC Aminobacter sp. CGMCC 1.17253 NHase. The amino acids involved 1.17253 NHase. NHase with 6× His-tag at N-terminal overex- in cobalt ion binding and the activity site were determined by fi sequence alignment with the reference proteins (PDB accession pressed in E. coli Rosetta (DE3) and was puri ed following the 28 25 29 30 31 instructions of the affinity chromatography kit (Novagen, Madison, codes: 1UGQ, 3QXE, 1V29, 3A8M, and 4OB3 ). WI). To assess protein expression, Coomassie Brilliant Blue stained SDS-PAGE was performed. The activity of NHase was tested by ■ RESULTS AND DISCUSSION HPLC under the conditions described above. The amount of enzyme Isolation and Identification of Sulfoxaflor-Degrading needed to catalyze the production of 1 μmol of X11719474 in 1 min Microbes. After diluting and spreading on LB agar, 10 was defined as one unit (U) of enzyme activity. To determine the optimal temperature of sulfoxaflor degraded by NHase, 10 μLof purified protein (1581 μg/mL) was added to 990 μL of sulfoxaflor solution (200 mg/L sulfoxaflor dissolved in 50 mmol PBS, pH 7.0) and then incubated for 1 h at 20, 30, 40, 50, 60, or 70 °C, respectively. To determine the tolerance of NHase to temperature, 10 μLof purified protein (1581 μg/mL) was added to 90 μL of PBS and incubated at 20, 30, 40, 50, 60, or 70 °C for 1 h. After adding 900 μL of sulfoxaflor solution (200 mg/L sulfoxaflor dissolved in 50 mmol PBS, pH 7.0), the mixture was incubated for 1 h at 30 °C. To determine the optimal pH of sulfoxaflor degraded by NHase, 10 μLof purified protein (1581 μg/mL) was added to 990 μL of sulfoxaflor solution [200 mg/L sulfoxaflor dissolved in 50 mmol Tris/HCl, citric acid/sodium citrate (CA/SC) or PBS, with pH values of 5.0, 6.0, 7.0, 8.0 or 9.0], and then the mixture was incubated for 1 h at 30 °C. To determine the tolerance of NHase to pH, 10 μL of NHase (1581 μg/ mL) was added to 90 μL of Tris/HCl, CA/SC, or PBS at pH values of 5.0, 6.0, 7.0, 8.0, or 9.0 and incubated at 30 °C for 1 h; then, the solution was added into 900 μL of sulfoxaflor solution (200 mg/L sulfoxaflor dissolved in 50 mmol PBS, pH 7.0) and incubated for 1 h at 30 °C. To examine the influence of various metal ions on the sulfoxaflor degradation by NHase, 10 μL of purified protein (1581 μg/mL) and 2 μ L of 0.05 mmol/L CuSO4, FeSO4, MnCl2, ZnSO4, NiSO4, MgSO4, CoCl2, CaCl2, or ethylenediaminetetraacetic acid (EDTA) was added to 988 μL of 200 mg/L sulfoxaflor solution (dissolved in PBS, 50 mmol, pH 7.0); then, the mixture was incubated for 1 h at 30 °C. Figure 2. High-performance liquid chromatography (HPLC) and To determine the influences of various organic solvents on the liquid chromatography−mass spectrometry (LC−MS) analysis of reaction of sulfoxaflor degradation by NHase, 10 μLofn-butyl metabolites produced during the degradation of sulfoxaflor by alcohol, ethyl acetate, methyl alcohol, methylene dichloride, or ethyl Aminobacter sp. CGMCC 1.17253. (A) HPLC analysis of the alcohol was added to 980 μL of sulfoxaflor solution (200 mg/L transformation of sulfoxaflor by Aminobacter sp. CGMCC 1.17253. sulfoxaflor dissolved in 50 mmol PBS, pH 7.0), the reaction was (B) Positive- and (C) negative-ion mode mass spectrometry analysis started by adding 10 μL of NHase (1581 μg/mL). The reaction of degradation product P. mixture was incubated for 1 h at 30 °C, 800 rpm. fl To determine the kinetic parameters of NHase in sulfoxa or colonies obviously different in their morphologies were degradation, 5 μL of NHase (1581 μg/mL) was added to 995 μLof fl fl selected and their sulfoxa or-degrading ability was tested. sulfoxa or (concentration ranging from 50 to 1000 mg/L) dissolved fl in 50 mmol/L PBS (pH 7.0). The reaction solution was then One isolate, labeled JW2, was determined with sulfoxa or- ° − degrading ability. A sulfoxaflor-degrading assay confirmed that incubated for 1 h at 40 C, 800 rpm. The Hanes Woolf graphical fl method was used for the kinetic parameters of the reaction between JW2 could convert sulfoxa or to a product labeled P (Figure NHase and sulfoxaflor determination. The linear relationship between 2A). The morphology of JW2 on LB plates was circular, substrate concentration and enzyme reaction velocity ratio ([S]/V) maroon, wet-looking, and convex colonies of ∼0.5 mm in and substrate concentration ([S]) was used. diameter. Following Gram staining, the isolate was confirmed

4582 https://dx.doi.org/10.1021/acs.jafc.9b06668 J. Agric. Food Chem. 2020, 68, 4579−4587 Journal of Agricultural and Food Chemistry pubs.acs.org/JAFC Article

finding enhances our understanding of sulfoxaflor degradation by microbes. This finding could help in developing a bioremediation agent for the degradation of sulfoxaflor environmental residues. Identification of the Metabolites. In the HPLC spectrum, two sulfoxaflor peaks were evident with retention times of 13.3 and 14.3 min, but sulfoxaflor is a chiral molecule with four optical isomers, so there is a peak overlap. The retention time of product P was found to be 6.5 min by HPLC Figure 3. Time-course analysis of sulfoxaflor degradation. (A) Time analysis. LC−MS analysis showed that product P exhibited course of sulfoxaflor degradation by resting Aminobacter sp. CGMCC mass-to-charge ratio values of 296, 318, 334, 294, and 330 m/z, fl − 1.17253 cells. (B) Degradation of sulfoxa or in soil by Aminobacter sp. corresponding to [M + H]+, [M + Na]+,[M+K]+,[M− H] , CGMCC 1.17253. and [M + Cl]−, respectively (Figure 2B,C), and the relative molecular weight of P was calculated to be 295. In previous reports, X11719474, X11721061, X11519540, X11579457, and X11596066 were examined as the metabolites of sulfoxaflor.5,13 The molecular weight of X11719474 was 295. Thus, the product P was inferred to be X11719474, and it is a chiral molecule with four optical isomers. There is a peak overlap, which results in only one peak in the HPLC spectrum. Aminobacter sp. CGMCC 1.17253 could transform sulfoxaflor into X11719474 via the hydration pathway. The reaction is similar to that of some other cyano-containing pesticides, such as thiacloprid and acetamiprid, where cyano is catalyzed to amido. This is the first report that sulfoxaflor is degraded by bacteria through the hydration pathway. Figure 4. Sodium dodecyl sulfate polyacrylamide gel electrophoresis Time Course of Sulfoxaflor Degradation by Resting (SDS-PAGE) analysis of NHase overexpressed in E. coli Rosetta Aminobacter fi sp. CGMCC 1.17253 Cells. Resting Amino- (DE3) along with puri ed NHase. Lanes 1 and 3: total protein bacter sp. CGMCC 1.17253 cells degraded sulfoxaflor from an extracts from E. coli Rosetta (DE3) strains containing pET28a initial concentration of 703.3 to 425.0 μmol/L over 96 h, with (control) and pET28a-NHase, respectively. Lanes 2 and 4: soluble μ protein fractions from E. coli Rosetta (DE3) strains containing a degradation rate of 39.6% (Figure 3A). While 262.7 mol/L pET28a (control) and pET28a-NHase, respectively. Lane 5, purified of X11719474 was formed, with a molar conversion rate of NitD with an N-terminal His-tag. Lane M, standard protein markers 94.4%. The sulfoxaflor degradation half-life was 5.5 days in the (116.0, 66.2, 45.0, and 35.0 kDa). The molecular weights of the α and presence of Aminobacter sp. CGMCC 1.17253. These results β subunits are similar and therefore could not be visibly separated by indicated that Aminobacter sp. CGMCC 1.17253 efficiently SDS-PAGE. The accessory protein was not detected by SDS-PAGE. degraded sulfoxaflor into X11719474 via the hydration pathway. Although the degradation activity of Aminobacter Table 1. Degradation of Sulfoxaflor by the Recombinant E. sp.CGMCC1.17253isnotveryhigh,ituncoversa coli Rosetta (DE3) Strain Expressing the NHase Genes from biodegradation pathway of sulfoxaflor residuals in the environ- Aminobacter a sp. CGMCC 1.17253 ment. fl Aminobacter concentration (μmol/L) Degradation of Sulfoxa or in Soil by sp. CGMCC 1.17253. fl Aminobacter sp. CGMCC 1.17253 was sample X11719474 reduced sulfoxa or inoculated into sulfoxaflor-containing soil and 59.1% of NHase gene 509.77 ± 5.17 519.34 ± 7.35 sulfoxaflor was degraded within 9 days, with a half-life of control ND ND sulfoxaflor of 6.97 days (Figure 3B). By contrast, in soil aThe initial sulfoxaflor concentration was 759.82 μmol/L. without the addition of Aminobacter sp. CGMCC 1.17253, only 20.2% of sulfoxaflor was degraded over the same time to be Gram negative and appeared as rod-shaped, non-spore- period, with a half-life of sulfoxaflor of 27.68 days. It was forming colonies by optical microscopy. The BLAST analysis concluded that inoculation of Aminobacter sp. CGMCC of JW2 16S rRNA gene sequence (GenBank: MN372076) 1.17253 into the soil accelerated sulfoxaflor degradation, showed high similarity to Aminobacter. The phylogenetic tree confirming that Aminobacter sp. CGMCC 1.17253 could of the neighbor-joining method based on 16S rRNA gene degrade sulfoxaflor in the soil. sequences was constructed, and it confirmed that JW2 was Degradation of Sulfoxaflor by Resting E. coli Rosetta clustered with Aminobacter (Figure S1). JW2 was designated as (DE3) Cells Overexpressing NHase. X11719474 is the Aminobacter sp. and stored in the China General Micro- product of sulfoxaflor that is generated via the hydration biological Culture Collection Center (CGMCC) (Beijing, pathway and requires the activity of NHase.32 The NHase- China), with preservation number of CGMCC 1.17253. Lots encoding gene (GenBank accession number: subunit α of neonicotinoid insecticide residuals, such as imidacloprid, MN381727, subunit β MN381728, accessory protein thiacloprid, and acetamiprid, could be degraded by micro- MN381729) from Aminobacter sp. CGMCC 1.17253 was − organisms screened from the environment.21 23 No previous amplified and ligated into the expression vector pET28a. Then, study has reported that sulfoxaflor could be degraded by pure the plasmid was transformed into E. coli Rosetta (DE3). A bacteria, and this is the first study to discover pure bacteria phylogenetic tree was constructed, and the confirmed Amino- isolated from soil with sulfoxaflor-degrading ability. This bacter sp. CGMCC 1.17253 NHase was clustered with

4583 https://dx.doi.org/10.1021/acs.jafc.9b06668 J. Agric. Food Chem. 2020, 68, 4579−4587 Journal of Agricultural and Food Chemistry pubs.acs.org/JAFC Article

Figure 5. Enzymatic characterization of NHase. (A) Effects of pH on NHase activity. (B) Effects of pH on NHase stability. (C) Effects of temperature on NHase activity. (D) Effects of temperature on NHase stability. (E) Effects of metal ions on NHase activity. (F) Effects of organic solvents on NHase activity. Superscript letters indicate that mean values within a column are significantly different at p ≤ 0.05 according to the analysis by Duncan’s test.

Figure 6. Kinetic parameters of sulfoxaflor degradation reactions catalyzed by NHase. (A) Effects of the sulfoxaflor concentration on the rate of the NHase catalytic reaction. (B) Kinetic parameters for the hydration of sulfoxaflor by NHase, determined using the Hanes− Woolf graphical method.

a Table 2. Substrate Speciﬁcity of NHase

substrate degradation rate (%) 3-CP 100 ACE 15.97 Figure 7. Alignment of NHase with the template sequence. (A) BN 100 Alignment of NHase subunit α with the template sequence. (B) THI 97.00 Alignment of NHase subunit β with the template sequence. IAN 100 a The degradation rate was calculated by the degradation of 200 mg/L Mesorhizobium alhagi CCNWXJ12-2 (Figure S2). Protein of the corresponding substrate. expression was induced, and the protein was expressed as shown by SDS-PAGE analysis (Figure 4). E. coli Rosetta

4584 https://dx.doi.org/10.1021/acs.jafc.9b06668 J. Agric. Food Chem. 2020, 68, 4579−4587 Journal of Agricultural and Food Chemistry pubs.acs.org/JAFC Article

Figure 8. Three-dimensional homology model of NHase and the active sites of NHase. (A) Three-dimensional homology model of NHase. (B) Active sites of NHase. Amino acid residues marked in green constitute the putative cobalt ion binding sites. Amino acid residues marked in yellow participate in the recognition of substrate and form a hydrophobic pocket. Amino acid residues marked in purple form hydrogen bonds stabilizing the claw setting.

(DE3) harboring NHase gene transformed 68.35% of the exhibits positive effect. Zn2+,Ni2+, and Cu2+ inhibited the sulfoxaflor to X11719474 within 10 min (Table 1). The NHase activity on sulfoxaflor by 7.8, 7.6, and 54.3%, enzymatic behavior of E. coli Rosetta (DE3) harboring NHase respectively. Fe2+ exhibited no obvious effect on the NHase gene was consistent with the enzymatic behavior of Amino- activity on sulfoxaflor (Figure 5E). Like most enzymes, this bacter sp. CGMCC 1.17253, which further verified that NHase was strongly inhibited by Cu2+. All five organic solvents sulfoxaflor was transformed into X11719474 via hydration tested, namely, ethyl alcohol, ethyl acetate, n-butyl alcohol, pathway mediated by NHase. Similar to sulfoxaflor degraded methylene dichloride, and methyl alcohol, showed decreased by Aminobacter sp. CGMCC 1.17253 mediated by NHase, NHase activity against sulfoxaflor by 20.3, 19.9, 8.9, 9.1, and some other cyano-containing pesticides, for example, thiaclo- 14.1%, respectively (Figure 5F). Similar to most enzymes, this prid and acetamiprid, could be transformed into the NHase was inhibited by organic solvents. Kinetic parameter corresponding amide products via hydration pathway mediated analysis indicated that the degradation of sulfoxaflor by NHase by NHase. This is the first report that sulfoxaflor is converted exhibited the classic Michaelis−Menten kinetics. In the into X11719474 via the hydration pathway mediated by catalysis reaction of sulfoxaflor degraded by NHase, the value NHase. of Vmax was 1.97 mU/mg and that of Km was 3.54 mmol/L Enzymatic Characterization of Aminobacter sp. (Figure 6). Substrate specificity assays confirmed that NHase CGMCC 1.17253 NHase. Aminobacter sp. CGMCC has activity toward BN, IAN, 3-CP, THI, and ACE, displaying 1.17253 NHase was expressed and purified (Figure 4). The broad substrate specificity to NHase (Figure 1B). Substrate optimal pH of NHase to degrade sulfoxaflor was 7.0 and specificity assays showed that 200 mg/L of 3-CP, BN, and IAN defined as 100% enzyme activity (Figure 5A). The activity of was degraded to completion within 20 min, and the NHase toward sulfoxaflor decreased obviously, while the degradation rates of 200 mg/L of ACE and THI within 20 reaction pH was lower than 7.0 or higher than 7.0. So, this min were 15.97 and 97.00%, respectively, thereby displaying a NHase exhibits higher activity under neutral pH conditions. broad substrate specificity of Aminobacter sp. CGMCC When NHase was preincubated at pH 6.0, 7.0, 8.0, or 9.0, the 1.17253 NHase (Table 2). NHase activity showed no obvious difference, but when Homology Modeling of Aminobacter sp. CGMCC preincubated at pH 5.0, only 77.73% of the enzymatic activity 1.17253 NHase. The three-dimensional homology model of at the optimal pH was observed; the highest NHase activity NHase was constructed by the SWISS-MODEL workspace, was at pH 7.0 and defined as 100% enzyme activity (Figure following the template of the crystal structure of NHase from 5B). This inferred that Aminobacter sp. CGMCC 1.17253 P. putida (Figures 7 and 8A). The GMQE values were 0.84 and NHase is not stable in acidic environment, but it is stable in a 0.78 for the α and β subunits, respectively. The QMEAN neutral or alkaline pH environment. The optimal temperature values were −0.16 and −2.61 for the α and β subunits, of NHase to degrade sulfoxaflor was 40 °C and defined as respectively. The amino acid sequence identity of the subunit α 100% enzyme activity (Figure 5C). When preincubated at 20, between NHase and the model was 66.2%, and for the subunit 30, 40, 50, 60, or 70 °C, the highest NHase activity was at 40 β was 44.7%. Based on alignments against selected NHase °C and defined as 100% enzyme activity (Figure 5D). The sequences (Figures S3 and S4), αCys-105, αCys-108, αCys- enzyme activity decreased rapidly when the preincubation 110, and αSer-109 were predicted to be involved in cobalt ion temperature was higher than 40 °C, and NHase activity was binding, amid acid residues βArg52 and βArg150 formed completely inhibited at 70 °C. This suggested that NHase hydrogen bonds to stabilize the claw setting, and βIle-48, βSer- cannot tolerate high temperatures. Mn2+,Mg2+,Co2+,Ca2+, 51, and βTrp-72 participated in the recognition of substrate by and EDTA positively affect sulfoxaflor degradation by NHase forming a hydrophobic pocket (Figure 8B). compared with the unsupplemented control, with observed This is the first study of sulfoxaflor degraded by pure increases of 16.8, 20.1, 19.1, 23.5, and 14.0% in enzyme bacteria. Aminobacter sp. CGMCC 1.17253 efficiently activity, respectively. It can be inferred that the addition of degraded sulfoxaflor into X11719474 via hydration pathway, EDTA lowers the concentration of the available ions dissolved and the enzyme that participated in this pathway was verified in the solution, which decreases the NHase activity, so EDTA to be cobalt-containing NHase. The enzymatic activity of

4585 https://dx.doi.org/10.1021/acs.jafc.9b06668 J. Agric. Food Chem. 2020, 68, 4579−4587 Journal of Agricultural and Food Chemistry pubs.acs.org/JAFC Article

NHase was characterized and a three-dimensional homology https://pubs.acs.org/10.1021/acs.jafc.9b06668 model of NHase was constructed. The Aminobacter sp. CGMCC 1.17253 NHase was verified to have a broad Funding substrate specificity. Our findings provide insight into a This research was financed by the National Science bacterial sulfoxaflor-degrading mechanism. This study will Foundation of China (Grant Nos. 31570104 and 31970094) enhance our understanding of the importance of microbes in and the Program for Jiangsu Excellent Scientificand degrading sulfoxaflor environment residues and highlights a Technological Innovation Team (17CXTD00014). bacterium with potential bioremediation applications for the Notes fl degradation of sulfoxa or residues. The authors declare no competing financial interest. ■ ASSOCIATED CONTENT ■ REFERENCES *sı Supporting Information (1) Watson, G. B.; Loso, M. R.; Babcock, J. M.; Hasler, J. M.; The Supporting Information is available free of charge at Letherer, T. J.; Young, C. D.; Yuanming, Z.; Casida, J. E.; Sparks, T. https://pubs.acs.org/doi/10.1021/acs.jafc.9b06668. C. Novel nicotinic action of the sulfoximine insecticide sulfoxaflor. Insect Biochem. Mol. Biol. 2011, 41, 432−439. Phylogenetic tree of isolate JW2 built by the neighbor- (2) Chen, X.; Ma, K.; Li, F.; Liang, P.; Liu, Y.; Guo, T.; Song, D.; joining method; phylogenetic tree of Aminobacter sp. Desneux, N.; Gao, X. Sublethal and transgenerational effects of CGMCC 1.17253 NHase; and alignment of the NHase sulfoxaflor on the biological traits of the cotton aphid, Aphis gossypii α and β subunits sequence with selected nitrile hydratase Glover (Hemiptera: Aphididae). Ecotoxicology 2016, 25, 1841−1848. sequences (PDF) (3) Dader,́ B.; Vinuela, E.; Moreno, A.; Plaza, M.; Garzo, E.; del Estal, P.; Fereres, A. Sulfoxaflor and natural pyrethrin with piperonyl ■ AUTHOR INFORMATION butoxide are effective alternatives to neonicotinoids against juveniles of Philaenus spumarius, the European Vector of Xylella fastidiosa. Corresponding Authors Insects 2019, 10, No. 225. Feng Ge − College of Life Science, Nanjing Normal University, (4) Xu, L.; Zhao, C.-Q.; Zhang, Y.-N.; Liu, Y.; Gu, Z.-Y. Lethal and Nanjing 210023, People’s Republic of China; Nanjing Institute sublethal effects of sulfoxaflor on the small brown planthopper of Environmental Sciences, Ministry of Ecology and Environment Laodelphax striatellus. J. Asia-Pac. Entomol. 2016, 19, 683−689. of the People’s Republic of China, Nanjing 210042, People’s (5) Chung, H. S.; El-Aty, A. M. A.; Kim, S.-W.; Lee, H. S.; Rahman, Republic of China; Email: [email protected] M. M.; Kabir, M. H.; Shin, H.-C.; Shim, J.-H. Simultaneous Yi-Jun Dai − Jiangsu Key Laboratory for Microbes and determination of sulfoxaflor and its metabolites, X11719474 and X11721061, in brown rice and rice straw after field application using Functional Genomics, Jiangsu Engineering and Technology LC-MS/MS. Int. J. Environ. Anal. Chem. 2017, 97,99−111. Research Center for Industrialization of Microbial Resources, (6) Kim, S.-W.; Rahman, M. M.; Abd El-Aty, A. M.; Kabir, M. H.; College of Life Science, Nanjing Normal University, Nanjing Na, T. W.; Choi, J.-H.; Shin, H.-C.; Shim, J.-H. Simultaneous 210023, People’s Republic of China; orcid.org/0000-0001- detection of sulfoxaflor and its metabolites, X11719474 and 5848-8414; Phone: 86-25-85891731; Email: daiyijun@ X11721061, in lettuce using a modified QuEChERS extraction njnu.edu.cn; Fax: 86-25-85891067 method and liquid chromatography-tandem mass spectrometry. Biomed. Chromatogr. 2017, 31, No. e3885. Authors (7) Tosi, S.; Burgio, G.; Nieh, J. C. A common neonicotinoid Wen-Long Yang − Jiangsu Key Laboratory for Microbes and pesticide, thiamethoxam, impairs honey bee flight ability. Sci. Rep. Functional Genomics, Jiangsu Engineering and Technology 2017, 7, No. 1201. ’ Research Center for Industrialization of Microbial Resources, (8) Whitehorn, P. R.; O Connor, S.; Wackers, F. L.; Goulson, D. Neonicotinoid pesticide reduces bumble bee colony growth and College of Life Science, Nanjing Normal University, Nanjing − 210023, People’s Republic of China queen production. Science 2012, 336, 351 352. − (9) Raine, N. E. Pesticide affects social behavior of bees Zhi-Ling Dai Jiangsu Key Laboratory for Microbes and neonicotinoid exposure impairs the social dynamics of bumblebees Functional Genomics, Jiangsu Engineering and Technology inside the nest. Science 2018, 362, 643−644. Research Center for Industrialization of Microbial Resources, (10) Dupraz-Dobias, P. France bans all uses of neonicotinoid College of Life Science, Nanjing Normal University, Nanjing pesticides. Chem. Eng. News 2018, 96, 15. 210023, People’s Republic of China (11) Wang, W.; Wang, S.; Han, G.; Du, Y.; Wang, J. Lack of cross- Xi Cheng − Jiangsu Key Laboratory for Microbes and Functional resistance between neonicotinoids and sulfoxaflor in field strains of Q- Genomics, Jiangsu Engineering and Technology Research Center biotype of whitefly, Bemisia tabaci, from eastern China. Pestic. − for Industrialization of Microbial Resources, College of Life Biochem. Physiol. 2017, 136,46 51. Science, Nanjing Normal University, Nanjing 210023, People’s (12) Weng, S.; Zhu, W.; Dong, R.; Zheng, L.; Wang, F. Rapid Republic of China detection of pesticide residues in paddy water using surface-enhanced − Raman spectroscopy. Sensors 2019, 19, No. 506. Ling Guo Jiangsu Key Laboratory for Microbes and Functional (13) Cutler, P.; Slater, R.; Edmunds, A. J.; Maienfisch, P.; Hall, R. Genomics, Jiangsu Engineering and Technology Research Center G.; Earley, F. G.; Pitterna, T.; Pal, S.; Paul, V. L.; Goodchild, J. for Industrialization of Microbial Resources, College of Life Investigating the mode of action of sulfoxaflor: a fourth-generation Science, Nanjing Normal University, Nanjing 210023, People’s neonicotinoid. Pest Manage. Sci. 2013, 69, 607−619. Republic of China (14) Wiezorek, S.; Lamers, P.; Bolm, C. Conversion and degradation Zhi-Xia Fan − Jiangsu Key Laboratory for Microbes and pathways of sulfoximines. Chem. Soc. Rev. 2019, 48, 5408−5423. Functional Genomics, Jiangsu Engineering and Technology (15) Fang, S.; Zhang, Y.; You, X.; Sun, P.; Qiu, J.; Kong, F. Lethal toxicity and sublethal metabolic interference effects of sulfoxaflor on Research Center for Industrialization of Microbial Resources, − College of Life Science, Nanjing Normal University, Nanjing the earthworm (Eisenia fetida). J. Agric. Food Chem. 2018, 66, 11902 210023, People’s Republic of China 11908. (16) Siviter, H.; Brown, M. J. F.; Leadbeater, E. Sulfoxaflor exposure Complete contact information is available at: reduces bumblebee reproductive success. Nature 2018, 561, 109−112.

4586 https://dx.doi.org/10.1021/acs.jafc.9b06668 J. Agric. Food Chem. 2020, 68, 4579−4587 Journal of Agricultural and Food Chemistry pubs.acs.org/JAFC Article

(17) Dader,́ B.; Colomer, I.; Medina, P.; Viñuela, E. Compatibility of early natural enemy introductions in commercial pepper and tomato greenhouses with repeated pesticide applications. Insect Sci. 2019, 00, 1−14. (18) Ellis-Hutchings, R. G.; Rasoulpour, R. J.; Terry, C.; Carney, E. W.; Billington, R. Human relevance framework evaluation of a novel rat developmental toxicity mode of action induced by sulfoxaflor. Crit. Rev. Toxicol. 2014, 44,45−62. (19) Lebaron, M. J.; Gollapudi, B. B.; Terry, C.; Billington, R.; Rasoulpour, R. J. Human relevance framework for rodent liver tumors induced by the insecticide sulfoxaflor. Crit. Rev. Toxicol. 2014, 44, 15−24. (20) Liu, Z.; Dai, Y.; Huang, G.; Gu, Y.; Ni, J.; Wei, H.; Yuan, S. Soil microbial degradation of neonicotinoid insecticides imidacloprid, acetamiprid, thiacloprid and imidaclothiz and its effect on the persistence of bioefficacy against horsebean aphid Aphis craccivora Koch after soil application. Pest Manag. Sci. 2011, 67, 1245−1252. (21) Ge, F.; Zhou, L.-Y.; Wang, Y.; Ma, Y.; Zhai, S.; Liu, Z.-H.; Dai, Y.-J.; Yuan, S. Hydrolysis of the neonicotinoid insecticide thiacloprid by the N2-fixing bacterium Ensifer meliloti CGMCC 7333. Int. Biodeterior. Biodegrad. 2014, 93,10−17. (22) Lu, T.-Q.; Mao, S.-Y.; Sun, S.-L.; Yang, W.-L.; Ge, F.; Dai, Y.-J. Regulation of hydroxylation and nitroreduction pathways during metabolism of the neonicotinoid insecticide imidacloprid by Pseudomonas putida. J. Agric. Food Chem. 2016, 64, 4866−4875. (23) Guo, L.; Fang, W.-W.; Guo, L.-L.; Yao, C.-F.; Zhao, Y.-X.; Ge, F.; Dai, Y.-J. Biodegradation of the neonicotinoid insecticide acetamiprid by actinomycetes Streptomyces canus CGMCC 13662 and characterization of the novel nitrile hydratase involved. J. Agric. Food Chem. 2019, 67, 5922−5931. (24) Sun, S.-L.; Lu, T.-Q.; Yang, W.-L.; Guo, J.-J.; Rui, X.; Mao, S.- Y.; Zhou, L.-Y.; Dai, Y.-J. Characterization of a versatile nitrile hydratase of the neonicotinoid thiacloprid-degrading bacterium Ensifer meliloti CGMCC 7333. RSC Adv. 2016, 6, 15501−15508. (25) Brodkin, H. R.; Novak, W. R. P.; Milne, A. C.; D’Aquino, J. A.; Karabacak, N. M.; Goldberg, I. G.; Agar, J. N.; Payne, M. S.; Petsko, G. A.; Ondrechen, M. J.; Ringe, D. Evidence of the participation of remote residues in the catalytic activity of Co-type nitrile hydratase from Pseudomonas putida. Biochemistry 2011, 50, 4923−4935. (26) Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F. T.; De, T. B.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296−W303. (27) Benkert, P.; Biasini, M.; Schwede, T. Toward the estimation of the absolute quality of individual protein structure models. Bioinformatics 2011, 27, 343−350. (28) Miyanaga, A.; Fushinobu, S.; Ito, K.; Shoun, H.; Wakagi, T. Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding. Eur. J. Biochem. 2004, 271, 429−438. (29) Hourai, S.; Miki, M.; Takashima, Y.; Mitsuda, S.; Yanagi, K. Crystal structure of nitrile hydratase from a thermophilic Bacillus smithii. Biochem. Biophys. Res. Commun. 2003, 312, 340−345. (30) Yamanaka, Y.; Hashimoto, K.; Ohtaki, A.; Noguchi, K.; Yohda, M.; Odaka, M. Kinetic and structural studies on roles of the serine ligand and a strictly conserved tyrosine residue in nitrile hydratase. J. Biol. Inorg. Chem. 2010, 15, 655−665. (31) Martinez, S.; Wu, R.; Sanishvili, R.; Liu, D. L.; Holz, R. The active site sulfenic acid ligand in nitrile hydratases can function as a nucleophile. J. Am. Chem. Soc. 2014, 136, 1186−1189. (32) Kobayashi, M.; Shimizu, S. Metalloenzyme nitrile hydratase: structure, regulation, and application to biotechnology. Nat. Biotechnol. 1998, 16, 733−736.

4587 https://dx.doi.org/10.1021/acs.jafc.9b06668 J. Agric. Food Chem. 2020, 68, 4579−4587