Gene Transcription Γ Regulates IFN- Cell-Specific Transcription Factor and Kinase of Tec Family, Acts As a Th1 Txk, a Member Of

Txk, a Member of Nonreceptor Tyrosine Kinase of Tec Family, Acts as a Th1 Cell-Specific Transcription Factor and Regulates IFN- γ Gene Transcription This information is current as of September 29, 2021. Yuko Takeba, Hiroko Nagafuchi, Mitsuhiro Takeno, Jun-ichi Kashiwakura and Noboru Suzuki J Immunol 2002; 168:2365-2370; ; doi: 10.4049/jimmunol.168.5.2365

http://www.jimmunol.org/content/168/5/2365 Downloaded from

References This article cites 40 articles, 21 of which you can access for free at: http://www.jimmunol.org/content/168/5/2365.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Txk, a Member of Nonreceptor Tyrosine Kinase of Tec Family, Acts as a Th1 Cell-Speciﬁc Transcription Factor and Regulates IFN-␥ Gene Transcription1

Yuko Takeba,2* Hiroko Nagafuchi,2† Mitsuhiro Takeno,* Jun-ichi Kashiwakura,* and Noboru Suzuki3*

Precise mechanisms responsible for Th1 cell activation and differentiation are not fully elucidated. We have recently reported that Txk, a member of Tec family nonreceptor tyrosine kinase, is expressed on Th1/Th0 cells, and Txk regulates specifically IFN-␥ gene expression. In this study, we found that Txk bound to IFN-␥ promoter region. Txk transfection increased transcriptional activity of IFN-␥ promoter plus luciferase constructs severalfold, including IFN-␥ promoter ؊538, ؊208, and ؊53. IFN-␥ promoter ؊39 was refractory to the Txk transfection. The actual site to which Txk bound was the element consisting of ؊53 and ؊39 bp from Downloaded from the transcription start site of human IFN-␥ gene, a site distinct from several previously characterized binding sites. We found that the entire ؊53/؊39 region was necessary for the binding to and function of Txk, because mutant promoter oligoDNA that contained contiguous five base substitutions dispersed throughout the ؊53/؊39 inhibited the binding, and the mutant promoters did not respond to the Txk transfection. Similar sequences of this element are found within the 5؅ flanking regions of several Th1 cell-associated protein genes. Thus, Txk is expressed on Th1/Th0 cells with the IFN-␥ production and acts as a Th1 cell-specific transcription factor. The Journal of Immunology, 2002, 168: 2365Ð2370. http://www.jimmunol.org/

uch interest has focused on Th1 and Th2 subsets that presumed to function in vivo as important signaling mediators have been characterized on the basis of the discrete (26Ð31). Schneider et al. (26) suggested that TCR can utilize M cytokine production profiles; Th1 cells secrete IL-2, mouse Rlk (as well as ZAP-70) in the phosphorylation of key sites IFN-␥, and lymphotoxin and are important for the cell-mediated in the adaptor protein, SLP-76, leading to the up-regulation of response; Th2 cells produce IL-4, IL-5, IL-10, and IL-13 and pro- Th1-preferred cytokine IL-2. Similarly, Rajagopal et al. (27) iden- vide help for Ig production (1Ð4). Accumulating evidence sug- tified the T cell-specific adaptor protein, RIBP, which binds to gests that distinct signaling molecules and transcription factors mouse Rlk/Txk and modulates production of IL-2 and IFN-␥. mediate cytokine expression pattern in Th1 and Th2 cells (5Ð13). However, information concerning roles of Txk in human T lym- by guest on September 29, 2021 However, to date, precise mechanisms responsible for the differ- phocyte function is limited. We have recently reported that Txk entiation and development of polarized Th1 responses are not fully expression is restricted to Th1/Th0 cells with IFN-␥-producing clarified in humans. Especially, intracellular signaling pathway potential, and that Txk transfection resulted in severalfold increase specific for Th1 cells remains elucidated. of IFN-␥ mRNA expression and protein production by up-regu- The Tec family has emerged recently as a subfamily of nonre- lating IFN-␥ enhancer activity specifically (32). This finding ceptor tyrosine kinases, consisting of Tec, Btk, Itk/Tsk/Emt, Bmx, prompted us to study a mechanism of Txk to provoke IFN-␥ pro- and Txk/Rlk, all of which are importantly involved in the lym- duction in humans. phocyte signaling pathways (14Ð24). Recently, Itk, the T cell-associated Tec family kinase, has been suggested for the involve- Materials and Methods ment of Th2 cell development (5, 25). Txk/Rlk has been shown to Plasmid vectors be involved in signaling pathways of lymphocyte activation and is Human Txk cDNA in ␭ phage was provided by G. W. Litman (University of South Florida, St. Petersburg, FL) (16). Full-length Txk cDNA was ligated into a mammalian expression vector, pME18S (SR-␣ promoter; † *Departments of Immunology and Medicine, and Institute of Medical Science, St. provided by K. Maruyama, Tokyo Medical and Dental University, Tokyo, Marianna University School of Medicine, Kawasaki, Kanagawa, Japan Japan), as described (32). Received for publication May 8, 2001. Accepted for publication December 21, 2001. IFN-␥ promoter plus luciferase plasmids were kindly provided by C. B. The costs of publication of this article were defrayed in part by the payment of page Wilson (University of Washington, Seattle, WA) and H. A. Young (Na- charges. This article must therefore be hereby marked advertisement in accordance tional Cancer Institute, Frederick, MD) (33, 34). with 18 U.S.C. Section 1734 solely to indicate this fact. The IFN-␥ promoter mutant plus luciferase plasmids were created using 1 QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA.). This work was supported, in part, by a grant for the Promotion of the Advancement ␥ Ϫ of Education and Research in Graduate Schools from the Promotion and Mutual Aid Briefly, pIFN- promoter 208 plus luciferase was used as a template. The Corporation for Private Schools of Japan; a grant-in-aid for Scientific Research primers containing the desired mutation were extended during PCR cycling Project 13037033 and special coordination funds from the Ministry of Education, by PfuTurbo DNA polymerase (Stratagene). The amplification cycle con- Culture, Sports and Technology of Japan; Comprehensive Research on Aging and sisted of one cycle of denaturation (95¡C) for 1 min, followed by 18 cycles Health research grants from the Ministry of Health, Labor and Welfare of Japan; and of denaturation (95¡C) for 30 s, annealing for 1 min (55¡C), and polymer- a grant from the SRF Foundation. ization for 10 min (68¡C). After PCR cycling, the PCR product was treated 2 Y.T. and H.N. contributed equally to this study. with Dpn I that is specific for methylated and hemimethylated DNA, and 3 Address correspondence and reprint requests to Dr. Noboru Suzuki, Departments of the synthesized nonmethylated DNA containing the mutation was recov- Immunology and Medicine, St. Marianna University School of Medicine, 2-16-1, ered. The resultant mutant vector was used for transformation of Esche- Sugao, Miyamae-ku, Kawasaki, Kanagawa 216-8511, Japan. E-mail address: richia coli, DH5␣. Their sequences have been verified by DNA sequenc- [email protected] ing. c-Jun expression vector has been reported previously (35).

Transfection into Jurkat cells and luciferase assay dialyzed against buffer consisting of 20 mM HEPES, 20% glycerol, 0.2 mM EDTA, 0.5 mM PMSF, and 0.5 mM DTT. The protein concentration Purified plasmids were transfected into Jurkat cells by electroporation, as in the nuclear extracts was determined by Bio-Rad protein assay kit (Bio- ␮ ␥ ␮ described (30). In brief, 5 g of pIFN- promoter plus luciferase, 5 gof Rad, Richmond, CA). In some experiments, human Th1 cell lines were 4 ␮ pRSV-chloramphenicol acetyltransferase (CAT), and 10 g of pME18S- established, as described previously (32), and nuclear proteins of the cells Txk (Txk transfection) or pME18S (empty vector; mock transfection) were were recovered. cotransfected. Forty-eight hours after transfection, the Jurkat cells were stimulated with 1 ␮g/ml PHA and cultured for various periods. Thereafter, DNA-protein-binding assay protein assay, luciferase assay, and CAT-ELISA (Roche Diagnostics, To- kyo, Japan) of the cell lysates were conducted (32). IL-2 promoter plus A gel shift assay was performed using digoxigenin gel shift kit (Boehringer luciferase vector was also included as a control promoter vector. In some Mannheim Biochemica, Mannheim, Germany). In brief, digoxigenin-la- experiments, c-Jun expression vector was used to transfect Jurkat cells to beled DNA fragments were incubated at room temperature for 15 min with obtain control nuclear proteins (35). 5Ð10 ␮g of nuclear proteins. Protein-DNA complexes were separated from free probe on a polyacrylamide gel. Thereafter, the gels were electrically Immunoblotting analysis transferred to nylon membrane and detected by chemiluminescence. We verified that a 20-fold excess of specific cold oligonucleotide competed the The cells were lysed with buffer containing 50 mM Tris, pH 8, 1% Nonidet binding of the protein to the digoxigenin-labeled probe, whereas a similar P-40, 150 mM NaCl, and the protease inhibitors, as described (35). Equiv- excess from another site would not compete (see Figs. 3 and 4). alent amounts of proteins were resolved by SDS-PAGE. Proteins were transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, DNA probes MA) and blocked with 3.5% BSA. Immunoblotting was performed using goat anti-Txk Ab (Santa Cruz Biotechnology, Santa Cruz, CA) and/or anti- The probes were derived from sequences present in the IFN-␥ promoter Txk Ab developed by immunizing rabbits with whole Txk protein pro- region (33, 34), related promoter regions, and irrelevant promoter regions. duced by bacterial cells. Blots were probed with appropriate biotin-conju- Actual DNA sequences synthesized were as follows: IFN-␥ gene (desig- Downloaded from gated secondary Ab, followed by streptavidin-alkaline phosphatase and nated as IFN Ϫ53/Ϫ39), Ϫ56 to Ϫ36 region, ACGTAATCCTCAG detection by chemiluminescence. GAGACTTC; IFN-␥ gene (designated as IFN-irr), Ϫ160 to Ϫ140 region, AAACTCTAACTACAACACCCA; CCR5 gene (designated as CCR5), Nuclear extracts Ϫ899 to Ϫ885 region, CACCAACCGCCAAGAGAGCTT; TNF-␣ gene (designated as TNF-␣), Ϫ457 to Ϫ437 region, TGGGCCACTGACT Nuclear extracts were prepared from T cells by a modification of the GATTTGTG; IL-2 gene (designated as IL-2), Ϫ135 to Ϫ115 region, method of Dignam et al. (36). Briefly, cells were homogenized in two cell AAAGAGTCATCAGAAGAGGAA. http://www.jimmunol.org/ pellet volumes of 10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl2,1 mM EDTA, 0.5 mM DTT, 10% glycerol, and the protease inhibitors. The resultant nuclear pellet was homogenized in two cell pellet volumes of 20 Results mM HEPES, pH 7.9, 0.42 M KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM We recently found that Txk expression is restricted to Th1/Th0 DTT, 25% glycerol, and the protease inhibitors. After a 30-min incubation cells with IFN-␥-producing potential, and that Txk itself translo- at 4¡C, the samples were centrifuged for 20 min and the supernatants were cates into nuclei and enhances IFN-␥ gene transcription in T cells. In this study, we have focused on whether Txk itself or a protein complex including Txk acts as a Th1 cell-specific transcription 4 Abbreviation used in this paper: CAT, chloramphenicol acetyltransferase. factor for IFN-␥ gene transcription. by guest on September 29, 2021

FIGURE 1. IFN-␥ promoter-binding activity of Txk protein in Jurkat T FIGURE 2. Effects of Txk transfection on transcriptional activity of cells. Jurkat cells were transfected with pME18S-Txk (wild-type Txk) ex- Jurkat cells transfected with a panel of IFN-␥ promoter plus luciferase pression vector and cultured for 48 h. Thereafter, the cells were activated plasmids. Jurkat cells were cotransfected with the pIFN-␥ promoter plus with PHA for1horkept unstimulated. IFN-␥ promoter region Ϫ538 was luciferase, pRSV-CAT, and pME18S-Txk. As a control vector, empty biotin labeled and incubated with nuclear proteins of the Txk-transfected Ju- pME18S was used. Forty hours after transfection, one-half of the cells was rkat cells in the presence of 5 ␮g/reaction poly(dI-dC). The DNA-binding stimulated with PHA for 8 h, and the remaining was kept unstimulated. pRSV- nuclear proteins were recovered by streptavidin-Dynabeads and magnet. CAT was used to compare the transfection efﬁciency, and accordingly the Thereafter, the proteins were analyzed by immunoblotting with anti-Txk Ab. luciferase activity of the promoter assays was corrected. We found that pIFN-␥ As control DNA, calf thymus DNA was sonicated; ϳ550-bp DNA fragment promoter Ϫ53 reproducibly responded to the Txk transfection, whereas was recovered by glass beads and similarly treated. Txk protein (64 kDa; pIFN-␥ promoter Ϫ39 did not. As a control promoter vector, pIL-2 promoter arrow) binds to the IFN-␥ promoter region Ϫ538. The results shown are rep- Ϫ568 plus luciferase vector was used. The results shown are representative of resentative of three independent experiments with essentially the same result. ﬁve independent experiments with essentially the same result. The Journal of Immunology 2367

It is important to clarify whether Txk protein directly binds to ciferase vectors were transfected into the Jurkat cells. As a control, we IFN-␥ promoter/enhancer region to exert the positive effect for IFN-␥ used IL-2 promoter plus luciferase vector. The transfected cells were gene transcription. To this end, we labeled IFN-␥ promoter Ϫ538 then treated with PHA for 8 h. pME18S-Txk or empty pME18S vec- with biotin, which was recovered from pIFN-␥ promoter Ϫ538 plus tor and pRSV-CAT were cotransfected with the luciferase vector. luciferase vector. Biotin-labeled IFN-␥ promoter Ϫ538 was reacted Treatment of the mock (empty pME18S)-transfected Jurkat cells with with nuclear proteins of Txk-transfected Jurkat cells stimulated with PHA increased luciferase activity moderately (Fig. 2). Txk-trans- PHA for 1 h. Thereafter, DNA-binding proteins were recovered by fected Jurkat cells induced severalfold more luciferase activity than streptavidin-Dynabeads (Dynal, Oslo, Norway) and magnet, and an- the mock-transfected Jurkat cells. Txk transfection had no detectable alyzed by immunoblotting with anti-Txk Ab. We found that Txk ac- effect on the activity of multimers of NF-␬B, AP-1, CRE, and glu- tually binds to IFN-␥ promoter Ϫ538 region (Fig. 1). cocorticoid response element (data not shown). A construct contain- The induction of IFN-␥ gene transcription during Th1 cell ac- ing the IFN-␥ promoter Ϫ53 had a reproducible increase in response tivation is mediated mainly by a region extending ϳ538 bp up- to Txk transfection with mitogenic activation. In contrast, a construct stream of the transcription start site (33, 34), and this region con- with the IFN-␥ promoter Ϫ39 did not respond to Txk transfection tains binding sites for several nuclear proteins (33, 34). (Fig. 2). Similarly, IL-2 promoter Ϫ568 plus luciferase did not re- To identify to which element Txk binds for up-regulation of IFN-␥ spond to Txk transfection, as has been shown previously (32). gene transcription, we tested a panel of constructs that contain sub- We next performed a gel shift assay to determine whether Txk fragments of the IFN-␥ gene linked to the reporter gene luciferase in binds to this region (Ϫ53 to Ϫ39). Nuclear extracts from Txk- transient expression system (Fig. 2). The pIFN-␥ promoter plus lu- transfected Jurkat cells stimulated with PHA for 30, 60, and 90 Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021

FIGURE 3. Gel shift assays of the Txk protein. A and B, Jurkat T cells were transfected with Txk expression vector (A), and a Th1 cell line was established from normal PBLs (B). The cells were recovered and were stimulated with PHA for the periods indicated. IFN-␥ promoter region (core region, Ϫ53 to Ϫ39; actual synthetic oligoDNA, Ϫ56 to Ϫ36) was labeled with digoxigenin. Nuclear extracts were incubated with the digoxigenin-labeled probe and analyzed. C, Nuclear extracts from the Txk-transfected Jurkat cells stimulated with PHA for 1 h were incubated with the digoxigenin-labeled probe in the presence of a 10- or 20-fold molar excess of unlabeled (Ϫ56 to Ϫ36) oligoDNA or unlabeled AP-3 competitor oligoDNA (40). The DNA-protein complex was disappeared specifically by the introduction of the relevant oligoDNA, indicating the specificity of the binding. D, Txk-transfected Jurkat cells were kept unstimulated or stimulated with PHA for 1 h. The nuclear proteins were incubated with the Ϫ56 to Ϫ36 oligoDNA in the presence of control (anti-c-Fos) Ab and anti-Txk Ab, and analyzed similarly. Anti-Txk Ab, but not anti-c-Fos Ab, specifically depleted the binding, indicating that the DNA-protein complex includes Txk protein. E, Nuclear proteins were prepared from c-Jun-transfected Jurkat cells (35) and Txk-transfected Jurkat cells. The cells were kept unstimulated or stimulated with PHA for 1 h. The nuclear proteins were incubated with the biotin-labeled double-stranded IFN-␥ Ϫ56 to Ϫ36. The binding proteins were recovered by streptavidin-Dynabeads and magnet, and analyzed by immunoblotting with anti-Txk Ab. c-Jun-transfected Jurkat cells contained undetectable levels of Txk protein bound to the Ϫ53 to Ϫ39 region. In contrast, Txk-transfected Jurkat cells contained full-length Txk (64 kDa). F, Double-stranded oligoDNA were synthesized according to the sequences of Th1-associated gene promoters, irrelevant sequences of the IFN-␥ Ϫ160 to Ϫ140 and IL-2 Ϫ135 to Ϫ115 promoters. The oligoDNA were similarly tested for the binding. When we used IFN-irr and IL-2 promoter oligoDNA, there have been several DNA-protein complexes that appeared by the Txk-overexpressing Jurkat cells. However, none of the complexes has been disappeared by the introduction of the anti-Txk Ab, suggesting Txk did not bind to the irrelevant IFN-␥ and IL-2 promoter regions. The protein-DNA complexes have been formed when we used CCR5 and TNF-␣ promoter oligoDNA. The complexes have been specifically disappeared by the anti-Txk Ab, suggesting that Txk binds to CCR5 and TNF-␣ promoter regions. All the complexes were specific to the relevant oligoDNA, because 20 times excess of unlabeled oligoDNA abolished the binding (data not shown). 2368 Txk AS A HUMAN Th1 LYMPHOCYTE-SPECIFIC TRANSCRIPTION FACTOR min contained binding activity to a double-stranded oligoDNA that corresponded to Ϫ53 to Ϫ39 (actually Ϫ56 to Ϫ36: it is generally known that addition of a few nucleotides to both ends of the core recognition sequence is preferable as a DNA probe of a gel shift assay, and actually the Txk protein binds to the Ϫ56/Ϫ36 oli- goDNA much better than the other three oligoDNA, Ϫ56/Ϫ42, Ϫ53/Ϫ39, and Ϫ50/Ϫ36; data not shown) of the human IFN-␥ gene. Unstimulated Txk-transfected (Fig. 3A) or unstimulated and PHA-stimulated mock-transfected Jurkat cells (data not shown) contained marginally detectable binding proteins. Th1 cell lines were established from normal PBLs, as described (32), and tested in the gel shift assay. The DNA-protein complex appeared in the Th1 cell line when stimulated, as Txk-transfected Jurkat cells (Fig. 3B). Competition with a 10- and 20-fold molar excess of unlabeled double-stranded IFN-␥ Ϫ53 to Ϫ39 oligoDNA specifically inhibited the binding of the complex; competition with a 10- and 20-fold molar excess of AP-3 binding site had no detectable effect (Fig. 3C). It is possible that the protein-DNA complex that appeared in Txk-transfected Jurkat cells contained Txk protein itself. To prove Downloaded from the possibility, we have performed the gel shift assay with anti-Txk Ab to show the complex reacts with the Ab. We found that the complex was depleted by the treatment of the complex with anti- Txk Ab (5 ␮g/reaction) but not anti-c-Fos Ab (Fig. 3D). Thus, it is evident that the DNA-protein complex contained Txk.

To more precisely define the recognition sequences of the com- http://www.jimmunol.org/ plex, we performed competition analysis with oligoDNA that contained contiguous five base substitutions dispersed throughout the Ϫ53 to Ϫ39 region (Fig. 4, A and B). The 20-bp oligoDNA containing Ϫ53 to Ϫ49 mutant (designated as 53 M), Ϫ48 to Ϫ44 mutant (48 M), and Ϫ43 to Ϫ39 mutant (43 M) were synthesized. Ten and 20 times excess of wild-type and the three mutant oli- goDNA efficiently inhibited formation of the labeled oligoDNA/ Txk complex. These results suggest that promoter region Ϫ53 to Ϫ39 is important for the Txk binding. by guest on September 29, 2021 To confirm the above finding, we constructed mutant IFN-␥ ␥ promoter plus luciferase constructs. We used pIFN- promoter FIGURE 4. Mutations of the Txk binding site of the IFN-␥ promoter/en- Ϫ 208 as a wild-type vector. We used site-directed mutagenesis to hancer region render the promoter/enhancer unresponsive to Txk transfection. introduce the mutations into the pIFN-␥ promoter plus luciferase A, Sequences and position of the mutant IFN-␥ promoters used in this study. construct, and obtained Ϫ53 to Ϫ49 mutant, Ϫ48 to Ϫ44 mutant, Three 20-bp mutant oligoDNA (Ϫ56 to Ϫ36) that were used in the gel shift and Ϫ43 to Ϫ39 mutant vectors. We found that the Ϫ53 to Ϫ49, assay and the mutant promoter plasmids were shown. B, Mutational analysis Ϫ48 to Ϫ44, and Ϫ43 to Ϫ39 mutants did not respond to the Txk of the Txk binding site. Nuclear extract from the Txk-transfected T cells stim- transfection (Fig. 4C), suggesting that the entire sequence (Ϫ53 to ulated with PHA for 1 h was incubated with the digoxigenin-labeled wild-type Ϫ Ϫ Ϫ39) is critical for the recognition and function of the Txk. Thus, ( 56 to 36) probe in the presence of 10- or 20-fold molar excess of the Ϫ Ϫ indicated unlabeled oligoDNA. The binding was completely abolished by the the Txk protein acts on the 53 to 39 region to up-regulate Ϫ Ϫ Ϫ Ϫ Ϫ ␥ three mutant oligoDNA, indicating that 53 to 49, 48 to 44, and 43 IFN- gene transcription. Ϫ ␥ to 39 are necessary for Txk to bind the region. C, Luciferase assay of the To further characterize binding of Txk to IFN- gene, biotin- mutant IFN-␥ promoters. Site-directed mutagenesis was used to introduce ex- ␥ Ϫ Ϫ labeled double-stranded IFN- 53 to 39 region was synthe- actly the same mutations (53 M, 48 M, and 43 M) into the pIFN-␥ promoter sized. Nuclear proteins were prepared from c-Jun-transfected Ϫ208 plus luciferase plasmid. The resulting constructs were transfected sep- Jurkat cells (35) and Txk-transfected Jurkat cells. The nuclear pro- arately into the Jurkat cells, which were cotransfected with pRSV-CAT and teins were incubated with the oligoDNA. The binding proteins Txk expression vector (pME-18S-Txk), or empty vector (pME-18S). After were recovered by streptavidin-Dynabeads and magnet, and ana- 40 h, the cells were treated with PHA or kept unstimulated. After 8-h stimu- lyzed by immunoblotting with anti-Txk Ab. As shown in Fig. 3E, lation, the cells were harvested, and the luciferase activity and CAT activities c-Jun-transfected Jurkat cells contained undetectable levels of Txk were measured. The results shown are representative of five independent ex- protein bound to the Ϫ53 to Ϫ39 region. In contrast, Txk-trans- periments with similar results. fected Jurkat cells contained full-length Txk (64 kDa). Thus, the region Ϫ53 to Ϫ39 is specifically involved in the binding of Txk. Similar sequences to this DNA-binding motif were found within the 5Ј flanking regions of IFN-␥ promoter of several mammals and tain Txk protein in the complex, confirming the specificity of the Txk several human Th1 cell-associated protein genes, including CCR5 binding to the region Ϫ53 to Ϫ39. Similarly, the same nuclear protein and TNF-␣ (Fig. 5). Thus, we have conducted gel shift assays contained binding protein to human IL-2 promoter region Ϫ135 to using the double-stranded oligoDNA corresponding to several hu- Ϫ115, but the binding complex did not contain Txk. In contrast, the man Th1 cell-associated protein gene promoters. As shown in Fig. same nuclear protein bound to the CCR5 and TNF-␣ promoters, and 3F, the same nuclear protein included binding protein to the IFN- the complexes were disappeared by the anti-Txk Ab, suggesting that irr region Ϫ160 to Ϫ140, but the DNA-protein complex did not con- Txk bound to the Th1 cell-associated gene promoters. The Journal of Immunology 2369

It has been shown that Rlk/Txk has two isoforms generated by alternative translation start sites in mice (21). As shown in Fig. 3E, we have recovered the IFN-␥ promoter (region Ϫ53/Ϫ39) binding protein and conducted immunoblotting analysis employing anti- Txk Ab (this Ab was developed against whole Txk protein). We found that the binding protein contained a longer type of Txk pref- erentially. However, it is possible that small amount of a shorter form of Txk is involved in the binding to IFN-␥ promoter. Our study indicates that Txk can greatly increase IFN-␥ enhancer activity as a Th1 cell-speciﬁc transcription factor. The region of the IFN-␥ enhancer that responds to Txk is absolutely conserved between the human and other mammalian IFN-␥ genes, and similar sequences are present in the 5Ј ﬂanking regions of several Th1 cell-associated genes. This suggests an important function of this signal transduction pathway and DNA-binding complex involving Txk for the Th1 cell development.

References FIGURE 5. Conserved sequences in the 5Ј flanking region of Th1-as- 1. Mosmann, T. R., and R. L. Coffman. 1989. TH1 and TH2 cells: different patterns Downloaded from sociated protein genes. The sequences have been compared with the human of lymphokine secretion lead to different functional properties. Annu. Rev. Im- IFN-␥ sequence. The different nucleotide was underlined. munol. 7:145. 2. Seder, R. A., and W. E. Paul. 1994. Acquisition of lymphokine-producing phe- notype by CD4ϩ T cells. Annu. Rev. Immunol. 12:635. 3. Gately, M. K., L. M. Renzetti, J. Magram, A. S. Stern, L. Adorini, U. Gubler, and D. H. Presky. 1998. The interleukin-12/interleukin-12-receptor system: role in Discussion normal and pathologic immune responses. Annu. Rev. Immunol. 16:495. ␥ 4. Abbas, A. K., K. M. Murphy, and A. Sher. 1996. Functional diversity of helper http://www.jimmunol.org/ In this study, we found that Txk specifically binds to the IFN- pro- T lymphocytes. Nature 383:787. moter Ϫ53/Ϫ39 region to exert a positive effect on IFN-␥ gene tran- 5. Fowell, D. J., K. Shinkai, X. C. Liao, A. M. Beebe, R. L. Coffman, D. R. Littman, and R. M. Locksley. 1999. Impaired NFATc translocation and failure of Th2 scription. Similar sequences of this element are found within the 5Ј ϩ development in Itk-deficient CD4 T cells. Immunity 11:399. flanking regions of several Th1 cell-associated protein genes, and Txk 6. Yang, D. D., D. Conze, A. J. Whitmarsh, T. Barrett, R. J. Davis, M. Rincon, and also bound to the regions in the gel shift assay. Thus, it is possible that R. A. Flavell. 1998. Differentiation of CD4ϩ T cells to Th1 cells requires MAP ␥ kinase JNK2. Immunity 9:575. Txk is expressed on Th1/Th0 cells with the IFN- production and acts 7. Ouyang, W., M. Lohning, Z. Gao, M. Assenmacher, S. Ranganath, A. Radbruch, as a Th1 cell-specific transcription factor. and K. M. Murphy. 2000. Stat6-independent GATA-3 autoactivation directs IL- The importance of the proximal element (Ϫ71 to Ϫ43) for the 4-independent Th2 development and commitment. Immunity 12:27. ␥ 8. Kiani, A., J. P. Viola, A. H. Lichtman, and A. Rao. 1997. Down-regulation of

IFN- production has already been reported by C. B. Wilson et al. IL-4 gene transcription and control of Th2 cell differentiation by a mechanism by guest on September 29, 2021 (37); they suggested that activating transcription factor-2 and c-Jun involving NFAT1. Immunity 7:849. play an important role in the induction of transcription by this 9. Ranger, A. M., M. Oukka, J. Rengarajan, and L. H. Glimcher. 1998. Inhibitory function of two NFAT family members in lymphoid homeostasis and Th2 de- proximal element. The Txk binding region we identified (Ϫ53 to velopment. Immunity 9:627. Ϫ39) partly overlaps with the proximal element (Ϫ71 to Ϫ43), 10. Yoshida, H., H. Nishina, H. Takimoto, L. E. Marengere, A. C. Wakeham, D. Bouchard, Y. Y. Kong, T. Ohteki, A. Shahinian, M. Bachmann, et al. 1998. supporting their finding that the proximal region is important for The transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2 IFN-␥ gene transcription. cytokine production. Immunity 8:115. Recently, SLP-76 and RIBP were shown to be adaptor proteins 11. Li-Weber, M., P. Salgame, C. Hu, I. V. Davydov, O. Laur, S. Klevenz, and Ϫ Ϫ P. H. Krammer. 1998. Th2-specific protein/DNA interactions at the proximal of mouse Rlk (26, 27). We found that the 53 to 39 binding nuclear factor-AT site contribute to the functional activity of the human IL-4 protein containing Txk did not contain activating transcription fac- promoter. J. Immunol. 161:1380. tor-2 (70 kDa) and c-Jun (39 kDa) by the gel shift assay (data not 12. Moriggl, R., C. Kristofic, B. Kinzel, S. Volarevic, B. Groner, and V. Brinkmann. 1998. Activation of STAT proteins and cytokine genes in human Th1 and Th2 shown and Fig. 3E). It thus is important to identify the adaptor cells generated in the absence of IL-12 and IL-4. J. Immunol. 160:3385. protein of human Txk. 13. Gollob, J. A., E. A. Murphy, S. Mahajan, C. P. Schnipper, J. Ritz, and D. A. Frank. 1998. Altered interleukin-12 responsiveness in Th1 and Th2 cells is In addition, they suggested that CpG dinucleotide in the proximal associated with the differential activation of STAT5 and STAT1. Blood 91:1341. element is selectively methylated in Th2 cells that do not express 14. Mano, H. 1999. Tec family of protein-tyrosine kinases: an overview of their IFN-␥, and is demethylated in Th1 cells, and that methylation of this structure and function. Cytokine Growth Factor Rev. 10:267. 15. Hu, Q., D. Davidson, P. L. Schwartzberg, F. Macchiarini, M. J. Lenardo, region correlates strongly and inversely with the capacity of T cells to J. A. Bluestone, and L. A. Matis. 1995. Identification of Rlk, a novel protein express IFN-␥ (37, 38). These findings partly support our present tyrosine kinase with predominant expression in the T cell lineage. J. Biol. Chem. result that the region Ϫ53 to Ϫ39 is the Txk binding site and is 270:1928. 16. Haire, R. N., Y. Ohta, J. E. Lewis, S. M. Fu, P. Kroisel, and G. W. Litman. 1994. important for Th1 cell-specific IFN-␥ gene transcription. TXK, a novel human tyrosine kinase expressed in T cells shares sequence identity Because Txk is a nonreceptor tyrosine kinase, it is important to with Tec family kinases and maps to 4p12. Hum. Mol. Genet. 3:897. 17. Sommers, C. L., K. Huang, E. W. Shores, A. Grinberg, D. A. Charlick, clarify whether phosphorylation of Txk is involved in the function C. A. Kozak, and P. E. Love. 1995. Murine txk: a protein tyrosine kinase gene of Txk. With regard to the kinase activity of Txk, Chamorro et al. regulated by T cell activation. Oncogene 11:245. (39) demonstrated that Rlk/Txk can be phosphorylated and acti- 18. Ohta, Y., R. N. Haire, C. T. Amemiya, R. T. Litman, T. Trager, O. Riess, and G. W. Litman. 1996. Human Txk: genomic organization, structure and contigu- vated by Src kinases. They suggested that Rlk/Txk is phosphory- ous physical linkage with the Tec gene. Oncogene 12:937. lated by Src family kinases in response to TCR engagement. We 19. Ellis, J. H., R. P. Sutmuller, M. J. Sims, and S. Cooksley. 1998. Functional found that phosphorylation of Txk is necessary to exert its positive analysis of the T-cell-restricted protein tyrosine kinase Txk. Biochem. J. 335:277. 20. Schneider, H., P. L. Schwartzberg, and C. E. Rudd. 1998. Resting lymphocyte 5 effect on IFN-␥ production. kinase (Rlk/Txk) phosphorylates the YVKM motif and regulates PI 3-kinase binding to T-cell antigen CTLA-4. Biochem. Biophys. Res. Commun. 252:14. 21. Debnath, J., M. Chamorro, M. J. Czar, E. M. Schaeffer, M. J. Lenardo, 5 J.-I. Kashiwakura, N. Suzuki, M. Takeno, S. Itoh, T. Oku, T. Sakane, S. Nakajin, H. E. Varmus, and P. L. Schwartzberg. 1999. rlk/TXK encodes two forms of a and S. Toyoshima. Evidence of autophosphorylation in Txk: Y91 is an autophos- novel cysteine string tyrosine kinase activated by src family kinases. Mol. Cell. phorylation site. Submitted for publication. Biol. 19:1498. 2370 Txk AS A HUMAN Th1 LYMPHOCYTE-SPECIFIC TRANSCRIPTION FACTOR

22. Siliciano, J. D., T. A. Morrow, and S. V. Desiderio. 1992. itk, a T-cell-specific novel cysteine string tyrosine kinase activated by Src family kinases. Mol. Cell. tyrosine kinase gene inducible by interleukin 2. Proc. Natl. Acad. Sci. USA 89: Biol. 19:1498. 11194. 32. Kashiwakura, J., N. Suzuki, H. Nagafuchi, M. Takeno, Y. Takeba, 23. August, A., A. Sadra, B. Dupont, and H. Hanafusa. 1997. Src-induced activation Y. Shimoyama, and T. Sakane. 1999. Txk, a nonreceptor tyrosine kinase of the of inducible T cell kinase (ITK) requires phosphatidylinositol 3-kinase activity Tec family, is expressed in T helper type 1 cells and regulates interferon ␥ pro- and the Pleckstrin homology domain of inducible T cell kinase. Proc. Natl. Acad. duction in human T lymphocytes. J. Exp. Med. 190:1147. Sci. USA 94:11227. 33. Penix, L., W. M. Weaver, Y. Pang, H. A. Young, and C. B. Wilson. 1993. Two 24. Andreotti, A. H., S. C. Bunnell, S. Feng, L. J. Berg, and S. L. Schreiber. 1997. essential regulatory elements in the human interferon ␥ promoter confer activa- Regulatory intramolecular association in a tyrosine kinase of the Tec family. tion specific expression in T cells. J. Exp. Med. 178:1483. Nature 385:93. 25. Liu, K. Q., S. C. Bunnell, C. B. Gurniak, and L. J. Berg. 1998. T cell receptor- 34. Cippitelli, M., J. Ye, V. Viggiano, A. Sica, P. Ghosh, A. Gulino, A. Santoni, and initiated calcium release is uncoupled from capacitative calcium entry in Itk- H. A. Young. 1996. Retinoic acid-induced transcriptional modulation of the hu- ␥ deficient T cells. J. Exp. Med. 187:1721. man interferon- promoter. J. Biol. Chem. 271:26783. 26. Schneider, H., B. Guerette, C. Guntermann, and C. E. Rudd. 2000. Resting lym- 35. Wakisaka, S., N. Suzuki, N. Saito, T. Ochi, and T. Sakane. 1998. Possible cor- phocyte kinase (Rlk/Txk) targets lymphoid adaptor SLP-76 in the cooperative rection of abnormal rheumatoid arthritis synovial cell function by jun D trans- activation of interleukin-2 transcription in T-cells. J. Biol. Chem. 275:3835. fection in vitro. Arthritis Rheum. 41:470. 27. Rajagopal, K., C. L. Sommers, D. C. Decker, E. O. Mitchell, U. Korthauer, 36. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription A. I. Sperling, C. A. Kozak, P. E. Love, and J. A. Bluestone. 1999. RIBP, a novel initiation by RNA polymerase II in a soluble extract from isolated mammalian Rlk/Txk- and itk-binding adaptor protein that regulates T cell activation. J. Exp. nuclei. Nucleic Acids Res. 11:1475. Med. 190:1657. 37. Penix, L. A., M. T. Sweetser, W. M. Weaver, J. P. Hoeffler, T. K. Kerppola, and 28. Sommers, C. L., R. L. Rabin, A. Grinberg, H. C. Tsay, J. Farber, and P. E. Love. C. B. Wilson. 1996. The proximal regulatory element of the interferon-␥ pro- 1999. A role for the Tec family tyrosine kinase Txk in T cell activation and moter mediates selective expression in T cells. J. Biol. Chem. 271:31964. thymocyte selection. J. Exp. Med. 190:1427. 38. Young, H. A., P. Ghosh, J. Ye, J. Lederer, A. Lichtman, J. R. Gerard, L. Penix, 29. Schaeffer, E. M., J. Debnath, G. Yap, D. McVicar, X. C. Liao, D. R. Littman, C. B. Wilson, A. J. Melvin, M. E. McGurn, et al. 1994. Differentiation of the T A. Sher, H. E. Varmus, M. J. Lenardo, and P. L. Schwartzberg. 1999. Require- helper phenotypes by analysis of the methylation state of the IFN-␥ gene. J. Im- Downloaded from ment for Tec kinases Rlk and Itk in T cell receptor signaling and immunity. munol. 153:3603. Science 284:638. 30. Hu, Q., D. Davidson, P. L. Schwartzberg, F. Macchiarin, M. J. Lenardo, 39. Chamorro, M., M. J. Czar, J. Debnath, G. Cheng, M. J. Lenardo, H. E. Varmus, J. A. Bluestone, and L. A. Matis. 1995. Identification of Rlk, a novel protein and P. L. Schwartzberg. 2001. Requirements for activation and RAFT localiza- tyrosine kinase with predominant expression in the T cell lineage. J. Biol. Chem. tion of the T-lymphocyte kinase Rlk/Txk. BMC Immunol. 2:3. 270:1928. 40. Wood, I. C., A. Roopra, C. Harrington, and N. J. Buckley. 1995. Structure of the 31. Debnath, J., M. Chamorro, M. J. Czar, E. M. Schaeffer, M. J. Lenardo, m4 cholinergic muscarinic receptor gene and its promoter. J. Biol. Chem. H. E. Varmus, and P. L. Schwartzberg. 1999. rlk/TXK encodes two forms of a 270:30933. http://www.jimmunol.org/ by guest on September 29, 2021