Repetitive Dna Sequence from Whooping Cranes (Grus Americana)

The Auk 109(1):73-79, 1992

CHARACTERIZATION AND PHYLOGENETIC SIGNIFICANCE OF A REPETITIVE DNA SEQUENCE FROM WHOOPING CRANES (GRUS AMERICANA)

JAMIE LOVE1'3 AND PRESCOTTDEININGER 1'2 •Departmentof Biochemistryand Molecular Biology, Louisiana State University Medical Center, New Orleans, Louisiana 70112, USA; and 2Departmentof MolecularGenetics, Alton OschnerResearch Foundation,

New Orleans, Louisiana70212, USA Downloaded from https://academic.oup.com/auk/article/109/1/73/5172808 by guest on 29 September 2021

ABSTR•CT.--Wesurveyed a WhoopingCrane (Grus americana) genomic library enrichedfor repetitiveclones, and isolateda clonewhose insert hybridized stringently to a repeated-DNA family in the genomesof Whooping Cranes,but not Sandhill Cranes(G. canadensis).This tandemsequence, repeated approximately 500 times in theWhooping Crane genome, displays taxon-specificproperties suggesting that the CommonCrane (G. grus) is the Whooping Crane's nearestliving relative. Low-stringencyhybridizations with this repeatproduced conserved patternsin all cranesexcept crowned-cranes (Balearica), which indicatesan earlydivergence of the crowned-cranesand the remainingcranes. Sequence and DNA-hybridization analyses imply that this repeatis a satellitesequence of similarcomplexity and organizationto the primatealphold DNA-sequence family, which alsohas chromosome and speciesspecificity. Received13 December1990, accepted 30 April 1991.

A SUBSTANTIALportion of the eukaryotic ge- throughout the genome. The large, complex nome consistsof sequencesrepeated thousands, tandem repeats,which are lessstudied in birds, to hundreds of thousands, of times. Because most are the subjectof this paper. We isolated from repetitive sequencesdo not codefor genes,they a Whooping Crane (Grusamericana) an autoso~ often escapeselection and may accumulatemu- mal, complex tandem repeat with taxon speci- tationsrapidly. Consequently,repeats are good ficity and suggestthat it may contribute to the candidatesfor the study of closely related spe- isolating mechanism in cranes. cies. Repeats may be interspersed throughout the genomeor arrangedin long, tandem arrays. MATERIALS AND METHODS Arthur and Straus (1977) found that repeated Constructionof WhoopingCrane library.--We extract- sequenceswere not extensively interspersedin ed high-molecular-weightDNA from female Whoop- the chicken (Gallusgallus) genome, and estab- ing Cranered bloodcells by standardmethods (Mani- lished that avian-genome sequence organiza- atiset al. 1982).It wassheared by sonicationto greater tion is most similar to that of Drosophila.The Cot than 1-kilobase (kb) average fragment length, and curves they produced from DNA samples purified by NACS columnchromatography (Bethesda shearedto differentlengths, indicating that both Research Laboratories, Gaithersburg, Maryland). the fold-back component and the moderately Fragmentswere end-repairedusing the Klenow frag- repeated component of chicken genomes are ment of DNA polymeraseI, and blunt-ligated into primarily tandem repeats. the Sinaisite of pUCl18 following the proceduresof Tandem repeatsare divided into severaltypes King and Blakesley(1986). CompetentXL-1 Blues(a strain of Escherichiacoli from Stratagene,La Jolla, Cal- (families) basedupon length and complexityof ifornia) were transformed with aliquots of the liga- the repeating units. The variable-number tan- tion mix, and recombinantswere selectedby growth dem repeatsthat yield "DNA fingerprints" in on ampicillin plates.The library of 20,000indepen- Southern blot analysisare familiar (for exam- dent clonescontained an averageinsert size of 0.5 kb, ples of their use, see Wetton et al. 1987, Burke representinga total of 10,000kb, or approximately and Bruford 1987).These simple repeatscontain 1%, of the crane's genome, assuming a genome the short sequences,tandemly repeateda moderate same size as the chicken's (1 x 106 kb; Shields 1983). number of times and mostly interspersed Isolationof the whooperrepeat.--The specific clone for the Whooping Crane (whooper repeat) was isolated fortuitouslyduring an unsuccessfulsurvey for 3 Present address:AFRC, Edinburgh ResearchSta- sex-specificrepetitive sequences(data not shown). tion, Roslin, Midlothian EH25 9PS, United Kingdom. Clones were tested individually for their ability to

73 74 LOVEAND DEININGER [Auk, Vol. 109 hybridize to dot blots of male and female craneDNA Corp.) was used. Productsof the four forward and of both Whooping Cranes and Sandhill Cranes (G. four reversereactions were electrophoresedthrough canadensis)under high-stringencyconditions. We in- an 8% polyacrylamide,7 M urea gel, after which the vestigateda clone that produceda strong signal with gel was dried under vacuum and autoradiographed. Whooping Crane DNA from both sexes,but not with Sandhill Crane DNA of either sex. This was the RESULTS whooper repeat or clone. Preparationof the whooper-repeatfragment.--The Dot blots.--A one-day autoradiograph dem- whooper clone was double digested with EcoRI and onstrated hybridization of the DNAs of the BamHIto releasethe recombinantinsert. The digested DNA was electrophoresedthrough a 2% agarosegel Whooping Crane and the Common Crane (G. Downloaded from https://academic.oup.com/auk/article/109/1/73/5172808 by guest on 29 September 2021 and the 0.2 kb clone fragment collected. This frag- grus)with intensities equivalent to the control ment was used to make quantified standardsfor dot- Hela sample(2.5 •g) that was spikedwith 250 pg blot experiments and as probe in all hybridization (picograms)of whooper fragment(Fig. 1). This experiments. suggestsapproximately 10 -4 (250 pg/2.5 •g) of Dot-blotanalysis.--DNA from two male Whooping the genomesof these two speciescontain this Cranes,two male Sandhill Cranes,a male hybrid of repeat. The DNA of the Whooping Crane x the two species,and a female of each member of the Sandhill Crane hybrid displayed an intensity genusGrus (as well as a female chicken) were tested. approximatelyhalf that of the Whooping Crane We sonicated2.5 •g of DNA in 10 x SSC(!.5 M sodium chloride, 0.15 M sodium citrate) to approximately 0.5 DNA. No other craneDNA produceda hybrid- kb, boiled for 5 min, and quick-chilled.For quanti- ization signal after a one-day exposure.In fol- tation, 2.5 •g aliquotsof Hela DNA were spikedwith low-up experiments, DNA from all eight different amountsof the whooper fragment and treat- Whooping Cranes testedwere positive, and all ed in the same manner. The solution was vacuum dot sevenSandhill Cranestested were negative(data blotted onto nitrocellulose membrane, then vacuum- not shown). baked at 80øC for 2 h. A six-day exposureof the sameblot revealed The whooper-repeatfragment was radiolabeled with weak hybridizationwith someother speciesof c•2PdATP by nick-translation(Maniatis et al. 1982). crane, which indicatesthe presenceof similar The probe was separatedfrom unincorporated ma- sequence(s).Note that this experiment cannot terials by $ephadexG-50 chromatography. differentiatebetween copynumbers and degree After prehybridization (in 25mM KPO4, 5 x SSC, 5 x Denhardt's solution, 50 •g/ml sonicatedsalmon of sequencesimilarity. The low signalsfrom the milt DNA, 50%formamide), the dot blot was hybrid- longer exposeddot blot may be due to small ized at 42øCovernight in 10 ml of the same solution numbersof sequencesidentical to the whooper containing 6 x 106cpm (0.25 •g) of the boiled probe. sequences,or due to a large number of sequenc- The blot was washed twice in 2x SSC, 0.1% SDS at es that are similar enough to the whooper se- 37øC followed by a wash in 0.1 x SSC at 68øC,and quenceto causea fraction of them to hybridize autoradiographed. with the probe. DNA from the Black-necked Southernblot analysis.--Fivemicrograms of HaeIII- Crane (G. nigricollis)and the Hooded Crane (G. digestedDNA from a female member of eachspecies monachus)produced signals equivalent to ap- of Gruidae, a chicken, a parrot Amazonaochrocephela, and a hawk Parabuteo unicinctus (as well as male proximately 15 pg of the sequencein the 2.5 •g WhoopingCranes, Sandhill Cranes,and a hybrid of dotsof DNA, and that from the JapaneseCrane the two species)were electrophoresedthrough a I% (G. japonensis)contained slightly less. The re- agarosegel and transferred to nitrocellulose mem- maining membersof the Gruidae did not hy- brane (Maniatis et al. 1982). bridize with the whooper probe (at high strin- After prehybridization, the blot was hybridized gency),nor did the chickenor Hela DNAs, even overnight at 42øCin 10 ml of hybridizationsolution after six days of exposure. (asbefore) containing 14 x 106cpm (0.25•g) of probe. Southernblot analysis.--We utilized Southern The blot was washed twice in 2x SSC, 0.1% SDS at blot analysisto determine the pattern of restric- 37øCfollowed by a wash in 0.1x SSC at 60øC.This tion fragments containing this repeated se- low-stringency blot was autoradiographedfor 24 h, after which it was rewashed in 1 L of 0.1 x SSC at quence(Fig. 2). At low stringency,we observed 68øC. This high-stringency blot was autoradio- doubletpatterns of fragmentsin digestsof DNAs graphedfor a similar length of time. of most gruids, including the Wattled Crane Sequencing.--TheDNA of the whooper repeat was (Bugeranuscarunculatus). High-molecular-weight sequencedin both directionsby the methodof Kraft bandswere missingor were very light in some et al. (I 988).$equenase Version 2.0 (U.S. Biochemical species,such as the JapaneseCrane. The pattern January1992] WhoopingCrane Repetitive DNA 75

Six-day One-day Birds Fragment exposure exposure 1 2 3 1 2 3 1 2 3

Ga. gal G. gru I ng

G. vip G. ame 500 pg Downloaded from https://academic.oup.com/auk/article/109/1/73/5172808 by guest on 29 September 2021

G. rub G. ame 250 pg

G. ant G. ame 125 pg

G. nig G. hyb* 60 pg

G. jap G. can 30 pg G. leu G. can 15 pg G. mon G. can 0 pg

Fig. 1. Dot blots of crane (and chicken)DNAs hybridizedwith whooperprobe. We dotted 2.5 •g of genomicDNA and positivecontrols of Hela DNA spiked with quantity of WhoopingCrane fragmentlisted onto nitrocellulosepaper. Hybridization with radiolabeledwhooper fragment (probe) followed by high- stringencywash and autoradiography. Abbreviations: Ga. gal = Gallusgallus (chicken); G. vip = G. vipio(White- napedCrane); G. rub= G. rubicunda(Brolga); G. ant = G. antigone(Sarus Crane); G. nig= G. nigricollis(Black- neckedCrane); G. jap = G.japonensis (Japanese Crane); G. mon= G. monacha(Hooded Crane); G. gru = G.grus (CommonCrane); G. ame= G. americicana(Whooping Crane);G. hyb = hybrid G. americanax G. canadensis; G. can = G. canadensis(Sandhill Crane). for the Sandhill Crane consistedof a few, very (the smear may representan experimental ar- small bands (<300 bp) in this low-stringency tifact). An l 1-day exposureof the high-strin- experiment. Both speciesof the genus Anthro- gencyblot revealedsmall, very light bandsfor poides(Demoiselle Crane, A. virgo;Stanley Crane, some of the other cranes,congruent with find- A. paradisea)produced small, very light bands. ings from the dot-blot experiment. DNAs of both species of Balearica (Black Sequenceanalysis.--The Southern analysisin- Crowned-Crane, B. pavonina;Gray Crowned- dicated that the sequenceof the 135 base-pair Crane, B. regulorum)were negative. Birds from whooper-repeatclone (Fig. 3) representsonly three other avian ordersalso failed to hybridize a portion of the overall repeat sequence(see with the whooper-repeatprobe. 'Discussion).The whooper-repeat sequence con- The high-stringencywash removed the sig- sists of 51% G+C and its structure contains no nal from DNAs of all but the Common Crane apparent structuresof simple internal repeats. and the Whooping Crane. The smallest dou- We comparedthe sequence,in both directions, blets, approximately 0.38 and 0.44 kb, were to sequencesstored in the EuropeanMolecular dearly visible on autoradiographs.The DNA of BiologyOrganization's (EMBL) databanks(up- the hybrid crane produceda pattern identical dated August 1989) using the fast-N-scanpro- to that of the Whooping Crane, but of half the gram with a K-tuple value of 6 and 3 (Intelli- intensity. The pattern for the Common Crane genetics).No significantsimilarities were found had a slight smearas well asthe doublet pattern to any other sequence.The sequencewas sub- 76 LoveAND DEININGER [Auk,VoL 109

6.6 • Downloaded from https://academic.oup.com/auk/article/109/1/73/5172808 by guest on 29 September 2021 4.4 •

2.3 • 2.0 •

0.56

A. LowStringency *overloaded B. HighStringency

Fig. 2. Autoradiographsof craneDNA hybridized with Whooping Crane fragment. GenomicDNA from variousspecies digested with HaeIII and analyzed by Southernanalysis using whooper fragment as probe. (A) Low-stringencywashes and (B) high-stringencywashes. Abbreviations: A. vir = Anthropoidesvirgo (Dem- oiselle Crane);A. par = A. paradisea(Stanley Crane); B. car = Bugeranuscarunculatus (Wattled Crane);G. vip = Grusvipio (White-naped Crane); G. rub = G. rubicunda(Brolga); G. jap = G. japonensis(Japanese Crane); G. ant = G. antigone(Sarus Crane); G. leu = G. leucogeranus(Siberian Crane); G. mon = G. monacha(Hooded Crane); G. nig = G. nigricollis(Black-necked Crane); G. gru = G. grus(Common Crane); G. ame = G. americana (Whooping Crane);G. amex can = G. americanusx G. canadensishybrid; G. can = G. canadensis(Sandhill Crane). reitted to EMBL and is assignedthe accession sperm concentration of the hybrid is low number X54174. (GeorgeGee, pers. comm.).The whooper probe can distinguish between these two North DISCUSSION American cranesand their hybrids. Wildlife of- ricersmay find the probe valuable as a means The whooper-repeatprobe could be useful to of identifying evidence. Recent advancesin biologistsinvolved in the Whooping Crane re- probe technology may allow its use in identi- covery program and law enforcement.For ex- ficationof dried featherpulp or droppings.Field ample, cross-fosteringis one aspectof the re- biologistsmay wish to usethe probe in a similar covery program that could benefit from the manner. availabilityof a methodfor identifyingWhoop- Gelter and Tegelstrom(1990) used the pat- ing Cranes and Whooping Crane x Sandhill terns of tandem repeatsproduced after electro- Crane hybrids. Female Sandhill Cranes artifi- phoresis of endonudease-digestedDNA to cially inseminatedwith spermfrom Whooping compare genomesof different species.Due to Cranesproduce hybrid offspring,although the the relatively low copy number of the whooper January1992] WhoopingCrane Repetitive DNA 77

GGGCTGTGAATGGGACCATGGTAGAGGTTTCAGGAAAGCAAGAGCATTCG

GGGCTGGGATGTTTTCCTTGGGAGCTGGGTCTGGATGTTTGCAGTTTTGA

101 Downloaded from https://academic.oup.com/auk/article/109/1/73/5172808 by guest on 29 September 2021 GGCTTGAATCTCGACTATGGCTAGAGAGCTGCTAA

Fig. 3. Sequenceof Whooping Crane Repeatfrom forward primer starting at point of insertion (reading 5' to 3'). repeat (500 copies,see below), tandem blocks Common Crane) produced an intensity equiv- were not visible under ultraviolet light after alent to 10-4 of the genome, we estimate this staining with ethidium bromide. However, a sequenceto be presentin about 500 copiesper pair of bandsbelonging to anothertandem block diploid genome of the Whooping Crane or (a different family of repeats)was observedin Common Crane. DNA cleaved with HaeIII from all cranes, in- The DNA hybridization of cranes with the cluding crowned-cranes,but not the chicken, whooper probe provides evidence of crane re- parrot, or hawk (data not shown). latedness. In concordance with other recent in- The whoopersequence is probablypart of a vestigations(Ingold et al. 1989,Krajewski 1989), tandem repeat. Doublets were produced by the failure of the DNAs of speciesof crowned- HaeIII, the bandsconsisting of fragmentsof ap- cranesto hybridize to the whooper repeat fol- proximately 0.86, 0.80, 0.65, 0.59, 0.44, 0.38 and lowing a low-stringencywash supportsthe dis- 0.2 kb (Fig. 2); the smallestband disappearedat tinctivenessof Balearica.Overall, the large range the higher stringency.The pairsin eachdoublet of hybridization signals obtained with DNAs were separatedby approximately0.06 kb. Bands of different cranessuggests that crane repeats in each doublet were separatedfrom their re- may offer an effective approach for estimating spectiveband in other doubletsby 0.21 kb. A phylogeneticaffinities of crane species. possibleexplanation for these patterns is that The very weak signalsproduced by DNA of the Whooping Crane DNA containsa 215 base- other cranesin the longer exposuresof the dot pair tandemrepeat with two HaeIII sites,60 base blot may have phylogeneticrelevance. We be- pairs apart. Random point mutationswould in- lieve the Common Crane is the nearest living troduce a ladderlike pattern as restriction sites relative to the Whooping Crane. A list of the were lost over time. This tandemrepeat should genusGrus, according to their relatednessto the give rise to a 215-bp ladder when cleaved with Whooping Crane sequencewould rank them endonucleasesfound once in the sequence,and as: (1) Common Crane and Whooping Crane a high molecular-weightband when not cleaved (very similar, approximately 100%);(2) Black- at all. MspI, PstI and HinfI, producesimple lad- necked Crane and Hooded Crane (both ap- der patterns, each band in multiples of 0.2 kb. proximately6%); (3) JapaneseCrane (< 6%);and EcoRIand BamHI produced a high molecular- (4) other Grus(produced no measurablesignal). weight band (data not shown). Krajewski(1989) placed these five members The dot blots revealed the quantity of se- of the genus Grus in a single SpeciesGroup quenceswithin each genome that hybridized Grus. We can resolveKrajewski's Species Group to the Whooping Crane sequence.The cloned Grus with respectto the Whooping Crane. Ac- whooper fragment represented135 bp of the cording to the dot-blot experiments, the overall 215 bp repeat. If one assumesthat the WhoopingCrane's nearest living relativeis most crane genome is the same size as a chicken's likely the Common Crane. The Hooded Crane (109bp, Shields 1983), one single whooper re- and Black-necked Crane are the next closest, peat (of 215 bp) would make up 2.15 x 10-7 of and the JapaneseCrane is the most distant of the genome. Becausethe Whooping Crane (and the group. 78 LoveAND DEININGER [Auk,Vol. 109

The whooper repeat is a member of a repeat hybrid cranecontains repeats from both species familythat is found in all cranesexcept crowned- and a mix of (hypothetical) proteins that bind cranes (although lower-stringencyhybridiza- them. The protein that binds the chicken W-re- tions might reveal its repeats).This suggestsa peat is a homo-multimeric structure(Harata et divergenceor amplificationof this sequence al. 1988). Hetero-multimers of DNA-binding occurred after the Balearicinae/Gruinae diver- proteins composedof Whooping Crane and gence. SandhillCrane repeat-binding proteins may not Vogt (1990) presentedevidence to support be effectiveat binding the repeat blocksof ei- the argumentthat large, complex,tandemly re- ther species. During meiosis, these chromo- peated sequencesare involved in chromatin somesmight be unable to pair correctlyat the Downloaded from https://academic.oup.com/auk/article/109/1/73/5172808 by guest on 29 September 2021 folding prior to chromosomecondensation and metaphaseplate hindering gametogenesis.The cell division. The alphold DNA sequencefam- low spermcount noted for the WhoopingCrane ily of tandemrepeats, first identified in African x Sandhill Crane hybrid (0.1 of normal num- green monkeys(Cercopithecus aethiops), are found bers;George Gee, pers. comm.) could result from in man (Homo sapiens),many subfamilies of this factor.Conversely, we predicta Whooping which are chromosomespecific. Indeed, most Crane x Common Crane hybrid would be of humanchromosomes have chromosome-specif- normal fertility, becauseits repeatsare so sim- ic sequencescomposed of members of this al- ilar that its proteins would behave similarly. phoid family. Vogt (1990) suggestedeach tan- Unfortunately, such a hybrid does not exist. dem block folds into a specific structure Future experimentsto isolatethe Gruinae re- recognized by specific DNA-binding proteins peat from each speciesof Gruinae may allow a that stabilizethe structureand (perhaps)iden- reconstructionof the group'sphylogeny. Ther- tify it during meiosis. These attributes cause mal-stability experiments with radiolabeled Vogt (1990) to postulate that tandem repeats Gruinae repeats as a probe could be used to may act as "speciesbarriers" in sympatricpop- quantify its divergence among the cranes. Fi- ulations. nally, isolationof proteinsthat bind to this re- Sex-chromosomespecific sequences are more peat family may allow comparisonsof the co- easily identified than autosomalones, and a W- evolution of these two biomolecules and their chromosome-specificsequence has been found contributionto speciesisolation. in chicken (Tone et al. 1982).Subsequent work- ers (Tone et al. 1984, Kodama et al. 1987) have reported the sequenceto be present in approx- ACKNOWLEDGMENTS imately 20,000 copies(46% of the W-chromo- This studywas supported by a grant from the Amer- some) and to display unusual electrophoretic ican Museum of Natural History (Frank M. Chapman mobility due to its ability to form DNA cur- Memorial Fund), the National Science Foundation vatures(tertiary structures).The chicken W-re- (Grant N. BSR-8715094 to Love), and the U.S. Public peat hybridizes exclusivelyto female Gallusat Health Service (Grant #HG00340-09 to Deininger). high-stringencyconditions, and other females We thank the Patuxent Wildlife Research Center and of the order Galliformes using 1ow-stringency the International Crane Foundation for providing conditions. Harata et al. (1988) isolated a DNA- samplesof crane blood. We alsothank H. C. Dessauer for reviewing the manuscript. binding protein from chicken livers, showing high affinity for the W-chromosome-specificre- peat of chickens.Griffiths and Holland (1990) LITERATURE CITED recently isolated a W-chromosome-specificre- peat from the LesserBlack-backed Gull (Larus ARTHUR,R., AND N. STRAUS.1977. DNA-sequence fuscus). organizationof the domesticchicken (Gallusdo- The hypothesisthat species-specifictandem mesticus).Can. J. Biochem. 56:257-263. BURKE,T., AND M. W. BRUI•ORD.1987. DNA finger- repeats and the proteins that bind them co- printing in birds. Nature 327:149-152. evolve to regulate chromosomerecognition and GELTER,H. ?., AND H. TEGELSTROM. 1990. Restriction meiosis is consistent with the fact that the enzyme cleavageof nuclear DNA revealsdiffer- Whooping Crane x Sandhill Crane hybrid ences in repetitive sequencesin two speciespairs (producedby artificial inseminationat Patuxent (Ficedulaand Parus). Auk 107:429-431. National Wildlife Center) is of low fertility. The GRIFFITHS,R., AND P. W. H. HOLLAND. 1990. A novel January1992] WhoopingCrane Repetitive DNA 79

avian W chromosomeDNA repeatsequence in MANIATIS,T., E. F. FRITSCH,AND J. SAMBROOK.1982. the LesserBlack-backed Gull (Larusfuscus). Chro- Molecularcloning: A laboratorymanual. Cold mosoma 99:243-250. Spring Harbor Laboratory,New York. HARATA,M., K. OUCHI, S. OHATA, A. KIKUCHI,AND S. SHIELDS,G. F. 1983. Organizationof the avian ge- MIZUNO. 1988. Purification and characteriza- nome. Pages 271-290 in Perspectivesin orni- tion of W-protein.J. Biol. Chem. 263:13952-13961. thology (A. H. Brushand G. A. Clark, Jr., Eds.). INGOLD, J. L., J. C. VAUGHN, S. GUTTMAN, AND L. R. CambridgeUniv. Press,Cambridge. MAXSON.1989. Phylogenyof the cranes(Aves: TONE, M., N. NAKANO, E. TAKAO,S. NARISAWA,AND Gruidae)as deduced from DNA-DNA hybridiza- S. MIZUNO. 1982. Demonstration of W chro- tion and albumin micro-complement fixation mosome-specificrepetitive sequencesin the do- Downloaded from https://academic.oup.com/auk/article/109/1/73/5172808 by guest on 29 September 2021 analyses.Auk 106:595-602. mesticfowl, Gallusg. domesticus.Chromosoma 86: KING,P. V., ANDR. W. ]3LAKESLEY.1986. Optimizing 551-569. DNA ligationsfor transformation.Focus (journal TONE, M., Y. SAKAKI,T. HASHIGUCHI,AND S. MIZUNO. publ. by Life Technologies,Inc., Gaithersburg, 1984. Genusspecificity and extensivemethyla- Maryland) 8:1-3. tion of the W chromosome-specificrepetitive KODAMA,H., H. SAlTOH,M. TONE,S. KUHARA,Y. SAKA~ DNA sequencesfrom the domesticfowl, Gallus K•,AND S. MIZUNO. 1987. Nucleotide sequences gallusdomesticus. Chromosoma 89:228-237. and unusual electrophoreticbehavior of the W VOGT,P. 1990. Potential genetic functionsof tan- chromosome-specificrepeating DNA unitsof the dem repeatedDNA sequenceblocks in the hu- domesticfowl, Gallusgallus domesticus. Chromo- man genomeare basedon a highly conserved soma 96:18-25. "chromatinfolding code."Human Genet.84:301- KRAFT, R., J. TARDIFF,K. S. KRAUTER,AND L. A. LEIN- 336. WAND. 1988. Using mini-prep plasmid DNA for WETTON,J. H., R. E. CARTER,D. T. PARKIN,AND D. sequencingdouble stranded templateswith Se- WALTERS.1987. Demographicstudy of a wild quenase.BioTechniques 6:544-546. HouseSparrow population by DNA fingerprint- KRAJEWSKI,C. 1989. Phylogenetic relationships ing. Nature 327:147-149. among cranes (Gruiformes: Gruidae) based on DNA hybridization. Auk 106:603-618.