Diapositive 1

ESCMID Postgraduate Education Course Cluj-Napoca, Romania. State-of-the-art in Emerging Fungal Infections 8th-9th September 2011

Diagnosis of zygomycosis in the clinical microbiology laboratory

Eric DANNAOUI • Université Paris Descartes © by author • Unité de Parasitologie-Mycologie, Service de Microbiologie Hôpital Européen Georges Pompidou (HEGP)

ESCMID Online Lecture Library Introduction

 Why is it important to have a diagnosis of zygomycosis and to identify the species ?

 Specific treatment of zygo vs other fungi (e.g. Aspergillus)1  Some species are contamination (e.g. R. stolonifer)  Sometimes nosocomial infection2  Species differ for antifungal susceptibility

 Current problems

 Identification of the species© by inauthor culture  Identification of the species directly from tissues when cultures are negative  Multiresistance to antifungals

ESCMID Online Lecture1. Spellberg Library et al. CID 2009 48:1743 2. Rammaert et al. ICAAC 2009 Introduction Zygomycetes

 Ubiquitous in environment

 From Antarctica1 to hot geothermal soil2

 Some species seem to be more restricted geographically Tropical areas (Saksenaea / Apophysomyces)  Europe3 (Lichtheimia spp.)  China4 (Rh. variabilis) © by author

1. Lawley B., et al.ESCMID 2004. Appl. Environ. Online Microbiol. 70: 5963. Lecture 3. Nicco Library E., et al. 2011. ICAAC. M-1513. 2. Redman RS., et al. 1999. Appl. Environ. Microbiol. 65: 5193. 4. Lu XL., et al. 2009. CID. 49: e39. Zygomycetes : ecology Ecology, pathogenic species

 Group of filamentous fungi characterized by non-septate mycelium

 Saprobes  soil  decaying organic matter  fruits  various grains

 Sporulation ++, fungal spores in the air ESCMID Frequently isolatedOnline as Lecturea culture contaminant Library Pathogenic species Pathogenic species : ca. 20 species / 10 genera

Family Genus Species Mucoraceae Rhizopus R. oryzae R. microsporus Mucor M. circinelloides M. indicus Rhizomucor R. pusillus Apophysomyces A. elegans Lichtheimiaceae Lichtheimia L. corymbifera © by author L. ramosa

Cunninghamellaceae Cunninghamella C. bertholletiae Saksenaeaceae Saksenaea S. vasiformis ESCMID Online Lecture Library Pathogenic species Correlation species / clinical form

Distribution of zygomycetes species Rhinocebral Rhizopus oryzae responsible for human infections in France, 2003-2008 Pulmonary Rhizopus microsporus Rhizomucor pusillus Cunninghamella spp. Lichtheimia spp.

Cutaneous © by author Mucor circinelloides Lichtheimia spp. Saksenaea vasiformis ESCMID Online Lecture Library Abstract P810. ECCMID April 2010 Diagnostic strategy

Samples

Microbiology Histology Lab Lab

Fixative / Inclusion Direct Culture Slice cuts Exam

MB/ FFPE Staining Staining MB/ fresh molecular morpho ID biopsies tissues ID myco / IHC myco© by author

 No serology, no antigen detection (beta-glucan neg), no PCR kitESCMID Online Lecture Library Processing of samples and interpretation of results Garcia-Hermoso D., et al. Manual of Clinical Microbiology 2011, ASM Press

sample

Histopathology lab Mycology lab Collection of sampleCollection

Tissue section (PE) Direct stained with HE, PAS, - - - Culture + examination + + Techique GMS Typical hyphae Typical hyphae Sporulating Zygomycete

yes no yes no yes no

•Morphology •Special •Immunohisto •MB •Max growth temp media •MB •MB •MB

Confront with direct Species

Results andResults additional tests Confront with culture © by authorexam / histology results identification results

Histo / direct exam Culture Interpretation Positive Positive Definite diagnosis Positive Negative Definite diagnosis (for biopsies) NegativeESCMID OnlinePositive LectureConfront Library with clinical context Negative Negative Obtain new samples Interpretation of resultsInterpretation Mycological diagnosis

 Samples: BA, BAL, biopsies, others, (depending on localization)

 Direct examination: important ++ Chlorazol black, Calcofluor, Gomori-Methenamine-Silver (GMS)…

 Cultures: risk of false positive (contaminants)  Many media suitable, but cultures often negative  Media without cycloheximide++  Incubation 37°C, 30°C  Biopsies : no homogeneization+++, breakdown of hyphae

 Histopathology:  Definite diagnosis © by author  No species identification

ESCMID Online Lecture Library Current issues

 cultures often negative, or not done

ESCMID OnlineDiagnostic Lecture in tissues Library mandatory Roden M. et al. 2005. CID 41:634. Identification: the classical way Identification of Zygomycetes from culture The classical way

 Phenotypic identification  Mainly based on morphological characteristics  Remains difficult and sometimes needs expertise of a reference laboratory

R. oryzae R. microsporus Absidia Mucor Rhizomucor

 Some species (Apophysomyces, Saksenaea) fail to sporulate on routine media ESCMID Online Lecture Library Identification: the classical way

 Culture on standard media macroscopy

 Observation stereomicroscope Architecture of the colony

 Wet mount / lactophenol blue ESCMID microscopy Online Lecture Library Identification: the classical way Mucoraceae - Lichtheimiaceae

- In culture (general characteristics)

Sporangium Sporangiospores Columella Apophysis Collerette

Sporangiophore © by author

Rhizoïds ESCMID Online Lecture Library Identification: the classical way Identification of Zygomycetes from culture The classical way

• Evaluation of maximum temperature of growth

• Specialized tests :  SEM  mating  physiology © by author  Morphological-based identification erroneous in > 20% of the cases1 ESCMIDNew Online identification Lecture methods Library are needed 1. Kontoyiannis, D. P., et al. 2005. JID 191:1350. Identification: new tools Zygomycetes : physiological tests as an adjunct to identification Carbon source assimilation: ID32C®

0 1 2 3 4 5 6 7 8 9 A B C D E F A. corymbifera

GAL ACT SAC NAG LAT ARA CEL RAF MAL TRE 2KG MDG MAN LAC INO 0 SOR XYL RIB GLY RHA PLE ERY MEL GRT MLZ GNT LVT GLU SBE GLN ESC

0 1 2 3 4 5 6 7 8 9 A B C D E F R. microsporus

GAL ACT SAC NAG LAT ARA CEL RAF MAL TRE 2KG MDG MAN LAC INO 0 SOR XYL RIB GLY RHA PLE ERY MEL ©GRT MLZby GNT author LVT GLU SBE GLN ESC C

0 1 2 3 4 5 6 7 8 9 A B C D E F S. racemosum

GAL ACT ESCMIDSAC NAG LAT ARA CEL Online RAF MAL TRE Lecture2KG MDG MAN LAC LibraryINO 0 SOR XYL RIB GLY RHA PLE ERY MEL GRT MLZ GNT LVT GLU SBE GLN ESC Identification: new tools ID32C Zygomycetes : Assimilation + physiological Assimilation - identification

Cunninghamella bertholletiae Syncephalastrum racemosum Rhizomucor pusillus Absidia corymbifera

Mucor

Rhizopus oryzae ESCMID Online Lecture Library Schwarz P. et al. JCM 2007, 45, 1433. Molecular techniques

ESCMID Online Lecture Library Molecular identification in culture

Zygomycetes : molecular identification of species1

 Reliable identification (DNA barcoding) needs2

 An informative DNA target  Working for all species in the group  Low intra-specific and high inter-specific variability

 A validated sequence database for comparison (public,© commercial)by author  MicroSeq D2 large-subunit DNA sequencing kit: misidentification of Zygo in ~50%3

1. Dannaoui, E.ESCMID 2009. Clin Microbiol InfectOnline 15 Suppl 5: 66Lecture-70. Library 2. Balajee A. et al. 2007. Med. Mycol 45:475. 3. Hall L. et al, 2004. JCM 42:622. Identification: new tools Zygomycetes : molecular identification of species

 Sequencing ITS region : intra and inter-species variability

V9D LS266

SSU (18S) 5.8S LSU (28S) ITS1 ITS2

Species n Rhizopus oryzae  54 strains, known agents of (T) 17 zygomycosis, 16 species Rhizopus microsporus (T) 7  Mostly clinical origin © byAbsidia author corymbifera 6  Diverse geographic areas Rhizomucor pusillus (T) 7  Including type strains Mucor circinelloides (T) 5 Other 13 ESCMID Online (T)Lecture Including type strain Library Identification: new tools ITS sequencing - Intra-specific variability

Species % similarity R. oryzae 99 – 100 R. microsporus 99-100 Rh. pusillus 100 A. corymbifera 99-100 M. circinelloides © by author99

Low variability within a given species ESCMID Online Lecture Library Schwarz P. et al. 2006. JCM 44:340. Molecular identification

Intra species sequence variability for strains of R. oryzae (Schwarz P. et al. 2006. JCM 44:340) R. oryzae

CCT - - TAG GAGTACC GGTGATG TTTTTTT CAGTAAC CCTCTTAG GAGCACC GGTAATG TTTCTTT CAGCAAC

ITS 1 ITS 4 ITS 1 ITS 2 5.8S 0 50 169 224 382 409 512 554 629

New proposed species: R. delemar© by author Abe A. et al. 2007. Mycologia 99:714-22

ESCMID Online Lecture Library Identification: new tools ITS sequencing

Species R. o A. c M. c R. p

A. corymbifera (A. c) 36 Percentage of similarities M. circinelloides (M. c) 48 37 of the ITS region between species of zygomycetes R. pusillus (R. p) 37 37 42 R. microsporus (R. m) 61 34 47 33

 Heterogeneous between genera : similarity ≤ 68%  Heterogeneous between species : similarity ≤ 95% few exceptions © by author  Homogenous within a given species : similarity  99%

Sequencing of ITS region is a suitable tool for DNA ESCMIDbarcoding Online the zygomycetes Lecture Libraryspecies Molecular identification in culture Current guidelines  The Clinical Laboratory Standards Institute (CLSI) proposed guidelines for fungal identification by DNA Target Sequencing

Zygomycetes Microorganism or Group: ITS Target Comments for ITS Target Alternative DNA Target Resolution to Good discrimination of genera; D1/D2 region may genus and interspecies variation 0- 40%; provide resolution usually to intraspecies differences 0-2%. to species species Five species of Rhizopus can be distinguished.© by author

CLSI. InterpretiveESCMID Criteria for Microorganism Online Identification Lecture by DNA Target Library Sequencing; Approved Guideline. Document MM18-A, 2008. Molecular identification in culture Current guidelines  International Working Group: Standard Operating Practice for DNA Sequence-Based species identification format for Aspergillus, Fusarium, Zygomycetes1

Question Response Relevance of species identification in the Relevant clinical setting Available loci for species identification ITS first-line Proposing cut-off criteria for species Not enough data ? identification using % identity scores How to compare the sequences© by in public author Use sequences of well- databases for identification? characterized collection strains (type+) ESCMID Online Lecture Library Balajee, S. A., et al. 2009. J Clin Microbiol 47:877-84. Pathogenic species

 New species of Lichtheimia  27 clinical isolates  Morphologically identified as L. corymbifera  Very divergent ITS sequences  2 species

CNRMA/F1-97 CNRMA/F4-27 CNRMA/F8-54 BES 227 CNRMA/F7-88 CBS 100.31 CNRMA/F8-24 CNRMA/F5-24 CNRMA/F6-32 CBS 101040 L. corymbifera CNRMA/F3-82 CNRMA/F4-14 CNRMA/F7-76 CNRMA/F8-4 UMIP 1129.75 UMIP 1279.81 CNRMA/F2-62 UMIP 1280.81 CBS 429.75* CNRMA/F5-100 CBS 100.28 L. blakesleeana CBS 173.67 L. hyalospora CNRMA/F2-8 CNRMA/F4-35 CNRMA/F7-70 CNRMA/F7-63 CBS 270.65** CNRMA/F9-5 CNRMA/F9-12 © by author CNRMA/F2-33 CNRMA/F5-79 CNRMA/F7-69 L. ramosa CNRMA/F7-40 CNRMA/F7-80 CNRMA/F9-20 CBS 269.65** CNRMA/F3-62 BES 228 CNRMA/F4-61 CNRMA/F4-93 Rhizomucor pusillus CNRMA/F9-7 0.05 ESCMID Online Lecture Library Garcia-Hermoso, D., et al. 2009. J Clin Microbiol 47:3862-70. Pathogenic species  Other “new” pathogenic species of Zygomycetes

Old New

Saksenaea vasiformis1,2 Saksenaea vasiformis complex Saksenaea oblongispora Saksenaea erythrospora Apophysomyces elegans3,4 Apophysomyces elegans Apophysomyces ossiformis Apophysomyces trapeziformis Apophysomyces variabilis Mucor sp.5,6 Mucor velutinosus Mucor ellipsoideus Rhizomucor variabilis var. variabilis5,7 Mucor irregularis © by author Actinomucor elegans8 Actinomucor elegans

1. Alvarez et al. JCM 2010 48:4410 5. Alvarez et al. Med Mycol 2011 49:62 2. Hospenthal et al. JCM 2011Aug 24 6. Sugui et al. JCM 2011 49:2728 3. Alvarez et al. ESCMIDRev IberoamMicol.2010;27(2):80– Online89 Lecture7. Lu et al. Library CID 2009 49:e39 4. Guarro et al. EID 2011 17:135 8. Tully et al. JCM 2009 47:3394 Diagnosis in tissues : the classical way and new tools Diagnosis of zygomycosis in tissues The classical way

 Direct examination +++ : GMS, Calcofluor  Histopathology : definite diagnosis BUT no species / genus identification

Zygomycetes : wide hyphae, ribbon-like, non septate. Right-angles branching © by author

ESCMID Online Lecture Library Diagnosis in tissues : the classical way Diagnosis in tissues : the classical way Direct exam Interpretation Culture / diagnosis Sinus

Zygomycosis ? Aspergillus fumigatus

Sinus © by author Zygomycosis ? Rhizopus oryzae

ESCMID Online Lecture Library Diagnosis in tissues : the classical way Diagnosis in tissues : the classical way

Direct exam Interpretation Culture / diagnosis Brain

Difficult to Lichtheimia conclude ?? corymbifera

Lung © by author Filamentous ? Scedosporium Yeasts ? apiospermum

ESCMID Online Lecture Library Molecular identification in tissues New tools : Molecular diagnosis

Molecular diagnosis is interesting BUT

1 ■ Best target? (panfungal, panzygo, specific)

Two different situations

ESCMID Online Lecture Library Diagnosis in tissues : new tools  The best target ?  Pan fungal, ITS, 28S, good for identification in culture, probably less effective for tissues (human DNA)

 Pan zygo, not obvious  Example of multiple alignments of ITS1 region for several zygo species

© by author  Species specific, less interesting for routine ESCMID Online Lecture Library A lot of work remains to be done !!! Molecular identification in tissues Diagnosis of zygomycosis in FRESH tissues: experimental study Molecular identification from organs of mice infected with various species

Six species used :  Outbred mice infected with 104 to L. corymbifera 106 spores IV M. circinelloides  Each group contained 3 to 6 non M. indicus immunocompromised mice R. pusillus  Sacrificed 3 to 4 days R. microsporus postinfection R. oryzae  Brains and kidneys analysed© by author V9D LS266

SSU (18S) 5.8S LSU (28S) ESCMIDITS1 Online LectureITS2 Library Schwarz P. et al. 2006. JCM 44:340. Molecular identification in tissues

Diagnosis of zygomycosis in FRESH tissues: experimental study Molecular identification from organs of mice infected with various species Presence of Positive PCR from hyphae Species tissues identification No. positive/No. No. positive/No. total total kidney brain kidney brain R. oryzae 2 / 3 2 / 3 3 / 3 2 / 3 + A. corymbifera 2 / 5 1 / 5 2 / 5 2 / 5 + R. microsporus 4 / 5 2 / 5 5 / 5 4 / 5 + R. pusillus 1 / 5 4 /© 5 by author1 / 5 4 / 5 + M. circinelloides 2 / 6 2 / 6 5 / 6 4 / 6 + M. indicus 4 / 4 4 / 4 4 / 4 4 / 4 +

ESCMID OnlineGood sensitivity Lecture and Library specificity Schwarz P. et al. 2006. JCM 44:340. Molecular identification in tissues

Diagnosis of zygomycosis in FRESH tissues: experimental study

 Quantitative PCR assay, experimental model

 Rabbit model of pulmonary zygomycosis  Four species: R. oryzae, R. microsporus, M. circinelloides, C. bertholletiae

 qPCR1 (28S) for R. oryzae, R. microsporus, M. circinelloides (no amplification for Absidia)  qPCR2 (28S) for C.© bertholletiaeby author

 Good detection in BAL, lung tissues, +/- serum ESCMID Online Lecture Library Kasai M. et al. 2009. JCM 46:3690. Molecular identification in tissues

Diagnosis of zygomycosis in FRESH tissues: clinical cases ■ PCR + sequencing of ITS1 region in 7 samples from 3 patients with histo and culture proven zygomycosis (A. elegans, R. oryzae)1

■ Several case-reports2-7  Various infections (pulmonary, rhino-cerebral, cutaneous)  Various species (Rhizopus, Absidia, Cunninghamella, Rhizomucor, Mucor)  Various techniques and targets (sequencing, RFLP, PCR+HRM, 18S, 28S,© ITS)by author Overall: good results

1. Lau A. et al. 2007. JCM 45:380 4. Machouart M. et al. 2006. JCM 44:805. 2. Kobayashi M.ESCMID et al. 2004. Respirology Online 9:397. Lecture5. Iwen PC.Library et al. 2005. JCM 43:5819. 3. Larché J. et al. 2005. CID 41:1362. 6. Khan Z et al. 2009. JCM 47:1244 7. Hrncirova K et al. 2010. JCM 48:3392 Molecular identification in tissues: a clinical case healthy 14-year-old patient cutaneous biopsy cutaneous lesion scorpion sting

Non sporulating Zygomycete Culture non-viable, lost

cutaneous biopsy (frozen)

Direct examination PCR + sequencing of the tissue sample ESCMIDITS / 28S Online Lecture Library(calcofluor) Lechevalier P. et al. JCM. 2008 46:3169 10 20 30 40 50 60 70 80 90 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CNRMA 07.577 TTTGAAAAAACAACTTTCAGCAA-TGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAACTGCGATAAGTAGTGTGAATTGCATT S. vasiformis EU182902 ...... Molecular...... -...... identification...... in... .tissues:...... a... clinical...... case..... S. vasiformis AY211275 ...... A......

PCR + sequencing100 110 120 130 140 150 160 170 180 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CNRMA ITS07.577 / 28S CAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCACTGGTATTCCGGTGAGTACGCCTGTTTCA-GTATCATTGAAAACCCACAACC S. vasiformis EU182902 ...... -...... S. vasiformis AY211275 ...... -...... A......

ITS2 190 200 210 220 230 240 250 260 270 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CNRMA 07.577 AAATATTT---TGTTTGG--TTGGACTTGGGCTACTAGTTTGGTAGT---CATGGTATTAATTTTTAATGCCA-AACGACAAGCCAAGCA S. vasiformis EU182902 ...A....---.T.....--...... T.C...... A..A---TT...... A..AT.-.TTT...... S. vasiformis AY211275 C..C....TTT...... CG...... T.C...... GTTTT...... GG..TC...G......

280 290 300 310 320 330 340 350 360 ....|....|....|....|....|.... |....|....|....|....|....|....|....|....|....|....|....|....| CNRMA 07.577 GCCTGGAATCTATGGAATGGTCAATT-GTATCGTAGTAATCATTATACAAGGCCTGAGCTTTATAAACGAACT---GGACTT----TGAT S. vasiformis EU182902 ...... A..-CTGT...... T...... ------...A.T.TG...... AGA..GAA.TCAT.... S. vasiformis AY211275 ...NT.G.AT.C.CTGT...... -...... A...... ---..G...CTTT....

370 380 390 400 %410 identity420 with430 S. 440 450 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CNRMA 07.577 TTGACC---AGTTTTAGCTCTAGTCATT--GGGATTACAGTAAATCGATvasiformisCTTGGCTTAAA--GG isolatesTCTAGTCAG-TTT CGGCTGTCTAAAC S. vasiformis EU182902 ...... TTTG...... A.T...... TTAT.G...... C...CAAC.....C..--...... T.AGTTGG S. vasiformis AY211275 ...... ---...... --...... ITS...... C..84GTC -T .90...... AACC....T.T.TCT.G.

460 470 480 28S 94 - 98 ....|....|....|....|....|....|... CNRMA 07.577 TAATACCAAATCA-TTTTCTCAGTATCGATCTG S. vasiformis EU182902 ..TAC.A...... -....T...... ©...... by author S. vasiformis AY211275 C..-...... A.C......

Saksenaea vasiformis ESCMID Online Lecture Library Lechevalier P. et al. JCM. 2008 46:3169 Molecular identification in tissues Diagnosis of zygomycosis in PE tissues Aim of the study

 To assess the reproducibility of a technique for the molecular identification of different Zygomycetes species from paraffin embedded tissues  Tissues from experimentally infected mice – 5 species  European interlaboratory exercise – 7 laboratories

 Secondary aim was to broadly assess the sensitivity of the technique by amplification of different quantities of tissues

© by author Czech Republic. Tomas Freiberger, Michal Slany. France. Patrick Schwarz, Eric Dannaoui, Françoise Dromer, Stéphane Bretagne, Michel Huerre, Olivier Lortholary. Germany . Juergen Loeffler.. Norway. Peter Gaustad, Anne Tomine Jorde. Spain . Juan Luis Rodriguez TudelaESCMID, Manuel Cuenca -EstrellaOnline. Switzerland Lecture . Jacques Library Bille, Philippe Hauser. UK . David Denning, Peter Warn Molecular identification in tissues Overall results – 7 labs Tissue quantity PCR results ID results (number of cuts) 30 52/56 (93%) 52/52 (100%)

10 50/56 (89%) 49/50 (98%) 1 15/56 (27%) 14/15 (93%)

Discussion  Overall, similar results between labs  PCR less sensitive than© histopathologyby author  Due to non specific primers (homology with human/mice rDNA) ?  Good identification when PCR+ ESCMID Online Lecture Library Dannaoui et al. (ESCMID Fungal Infection Study Group). 2010 JCM, 48:2043-46 Molecular identification in tissues Diagnosis of zygomycosis in PE tissues

 Different molecular approaches

 Panfungal PCR1 (ITS region): PCR+ in 5/9 samples (all histo+)

 18S-targeted semi-nested PCR specific for zygo  PCR+ in 14/23 samples2  Prospectively evaluated3: PCR assay superior to culture in histo+ samples  PCR+ in 22/27 ©samples by author4

1. Lau A. et al. ESCMID2007. JCM 45:380. Online Lecture3. Rickerts Library V. et al. 2007. CID 44:1078. 2. Bialek et al. JCP 2005, 58, 1180 4. Hammond et al. JCM 2011, 49, 2151

MALDI-TOF identification

TABLE 1. Fungal culture collection strains used to establish the reference database for matrix- assisted laser desorption ionization time-offlight mass spectrometry-based species identification

TABLE 2. Identification results for the 103 clinical fungal isolates obtained by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) in comparison with those obtained by multilocus sequence-based species identification © by author

ESCMID Online Lecture Library De Carolis et al. 2011 CMI, Early view Conclusions

 Microbiological diagnosis of zygomycosis remains difficult

 New methods for identification of species  Reliable techniques  International guidelines

 Molecular diagnosis in tissues  Need standardization  Sensitivity for FFPE tissues to be improved © by author  Need to develop new tools (biomarkers?, antigen detection?, …) ESCMID Online Lecture Library