Towards the Construction of Escherichia Coli Cell-Free Protein Synthesis System Platform

Towards the construction of Escherichia coli cell-free protein synthesis system platform

Sara Alexandra Peça de Sousa Rosa

Thesis to obtain the Master of Science Degree in Biotechnology

Supervisor(s): Professor Luís Joaquim Pina da Fonseca

Examination Committee Chairperson: Professor Arsénio do Carmo Sales Mendes Fialho Supervisor: Professor Luís Joaquim Pina da Fonseca Member of the Committee: Professor Gabriel António Amaro Monteiro

July 2015 ii Acknowledgments

I would like to express my gratitude to professor Lu´ıs Fonseca, for giving me the opportunity to work in a subject that I fell in love with. I would like to thank to all my colleges of 7th and 8th floor, for all the help, advice, and support. Without all of you I would not be able to finish my work. I would also like to thank to Doctor Ana Azevedo and Sofia Duarte, for all the help and tips. I would like to give a special thanks to Ana, Andreia, Catia,´ Elsa, Pedro, Rita and Ricardo, for help and support during the best and worst times. I also want to thank to Claudia,´ for the time spent inside IST walls. Most of all, I would like to thank my mom and dad for all the support. I also want to thank to my grandmother, for all the concern, and to my nieces, Beatriz and Margarida. Finally, I want to thank Davide, for always being there. My words will be never enough to express my gratitude towards you. Thank you all.

iii iv Resumo

Sistemas produtores de prote´ınas livres de celulas´ sao˜ descritos como a expressao˜ in vitro de prote´ınas recombinantes sem o recurso a celulas´ vivas. Esta abordagem usa lisados celulares que contem´ varios´ componentes qu´ımicos e biologicos´ necessarios´ para a transcriçao,˜ traduçao,˜ enrolamento de prote´ınas, e metabolismo energetico;´ tudo o que e´ necessario´ para sintetizar directamente prote´ınas. Contudo, existem problemas associados ao uso destes sistemas: capacidade de sintetizar com fiabil- idade uma prote´ına activa numa plataforma universal, falta de uma plataforma rentavel´ e escalavel,´ e incapacidade de realizar padroes˜ de glicosilaçao.˜ O objectivo principal deste trabalho e´ construir uma plataforma robusta e rentavel´ para s´ıntese de prote´ınas in vitro num sistema de transcriçao˜ e traduçao˜ copulado. Neste trabalho, um modelo de DNA foi desenhado e purificado. Este foi purificado por lise alcalina e cromatografia por interaçao˜ hidrofobica.´ Este metodo´ permite produzir em maior quanti- dade e com um menor custo. RNA de transferenciaˆ foi purificado extraindo os acidos´ nucleicos por extraçao˜ com fenol, separando o DNA com acetato de sodio´ e removendo os restante contaminantes por cromatografia de troca anionica.´ Aquando da produçao˜ do lisado S30, nao˜ foi poss´ıvel atingir a concentraçao˜ proteica necessaria´ para ter um lisado activo. Apesar de o objectivo principal, construir uma plataforma de produçao˜ de prote´ınas livre de celulas´ reprodut´ıvel nao˜ foi conseguido, foram dados alguns passos importantes para atingir esse objectivo. No futuro, uma das prioridades e´ melhorar o metodo´ de produçao˜ de lisados para se obter um maior rendimento a partir do sistema livre de celulas.´

Palavras-chave: Sistemas livres de celulas,´ Escherichia coli, lisado S30, Purificaçao˜ de tRNA, Purificaçao˜ de plasm´ıdeo

v vi Abstract

Cell-free protein systems are described as the in vitro expression of recombinant proteins without the use of living cells. This approach uses a cell lysate containing a wide array of biological and chemical components for transcription, translation, protein folding, and energy metabolism; all required to directly synthesise the target protein. However, there are some problems when using these systems: the ability to reliably synthesize any biologically active protein in a universal platform, the lack of a cost-effective and scalable platform, and the inability to carry out humanized glycosylation patterns. The main aim of this work is to construct a robust and cost effective platform for in vitro protein synthesis in a coupled transcription–translation system. In this work, a DNA template was design and purified. The DNA template was purified using an alkaline lysis and hydrophobic interaction chromatography. This method allows us to produce in higher quantity and lower cost. The tRNA purification was achieved by extracting the nucleic acids by phenol extraction, separate the DNA with sodium acetate, and remove the remaining contaminants by anion exchange chromatography. When producing the S30 lysate, it was not possible to achieve the protein concentration necessary to have a highly active lysate. Although the main goal of creating a reproducible E. coli cell-free protein synthesis system platform was not achieved, some major steps were taken towards this goal. In the future, one of the priorities is to improve the lysate production method so that we get a better yield from the cell-free system.

Keywords: Cell-free systems, Escherichia coli, S30 lysate, tRNA puriﬁcation, Plasmid puriﬁca- tion, Cytomimic system

vii viii Contents

Acknowledgments...... iii Resumo...... v Abstract...... vii List of Tables...... xiii List of Figures...... xviii Nomenclature...... xix

1 Introduction 1 1.1 State-of-the-art...... 2 1.1.1 Cell-free Protein Synthesis...... 2 1.1.2 cell lysates...... 5 1.1.3 Cell free protein synthesis system templates...... 9 1.1.4 Other components and Energy systems...... 12 1.1.5 Conﬁgurations of Cell-free systems...... 17 1.1.6 Folding and post-translational modiﬁcations...... 20 1.1.7 History and applications...... 22 1.1.8 Applications...... 23 1.1.9 Synthetic biology frontiers...... 28

2 Objectives 31

3 Materials and Methods 33 3.1 Template preparation...... 33 3.1.1 pEXP5-NT/GFP construction...... 34 3.2 Agarose gel electrophoresis...... 36 3.3 Cell transformation...... 36 3.3.1 Preparation of chemically competent cells...... 36 3.3.2 Transformation of chemically competent cells...... 37 3.3.3 Cell banks preparation...... 37 3.4 Plasmid production and puriﬁcation...... 37 3.4.1 Cell production...... 37 3.4.2 Alkaline lysis...... 38

ix 3.4.3 Plasmid purification...... 38 3.4.4 HIC purification...... 38 3.4.5 SEC purification...... 39 3.4.6 Dialysis...... 39 3.4.7 Plasmid concentration...... 39 3.5 tRNA purification...... 39 3.5.1 Cell growth...... 39 3.5.2 Phenol extraction...... 40 3.5.3 Contaminant removal...... 40 3.5.4 Anion-exchange chromatography...... 40 3.5.5 RNA electrophoresis...... 41 3.5.6 tRNA concentration...... 41 3.6 GFP production and purification...... 42 3.6.1 Cell production...... 42 3.6.2 Cell lysis...... 42 3.6.3 HIC purification...... 42 3.6.4 IMAC purification...... 43 3.7 S30 Lysate preparation...... 43 3.7.1 Cell production...... 43 3.7.2 Biomass processing...... 44 3.7.3 Cell lysis efficiency determination...... 44 3.8 Cell free protein synthesis...... 45 3.8.1 Expressway cell-free kit...... 45 3.8.2 Cytomim system...... 45 3.8.3 Optimisation...... 46 3.9 Protein analysis...... 46 3.9.1 Protein concentration...... 46 3.9.2 SDS-PAGE...... 47 3.9.3 Western blotting...... 47 3.9.4 Fluorimetry...... 48

4 Results and Discussion 49 4.1 Template preparation...... 49 4.1.1 pEXP5-NT/GFP...... 49 4.2 Plasmid purification...... 51 4.2.1 Hydrophobic interaction chromatography...... 52 4.2.2 Plasmid desalting...... 54 4.3 tRNA purification...... 57 4.4 GFP purification...... 61

x 4.5 S30 lysate preparation...... 63 4.6 Cell-free protein synthesis...... 67

5 Conclusions 73

Bibliography 89

xi xii List of Tables

3.1 Digestion tests. Four different tests were performed. In all tests, 1000 ng of plasmid and 0.5 of each enzyme (PvuII and SacII) were used. In the tests 1 and 2, 2 and 4µL of 10X buffer were tested. The same volumes were tested for G 10X Buffer in 3 and 4. Water was also added to achieve the volume of 20 µL ...... 34 3.2 PCR components and volumes (in microliters) used in the reaction...... 35 3.3 PCR program...... 35 3.4 Molecular cloning reaction components and the respective volumes in µL ...... 36 3.5 Components of RNA samples for electrophoresis in TAE agarose gels and the respective volumes in µL...... 41 3.6 Reagents used to perform cell-free protein synthesis from Expressway kit and the respective volumes in µL ...... 45 3.7 Feed buffer reagents from Expressway kit and the respective volumes in µL ...... 45 3.8 Reagents for 25µL reaction kit, stock and reaction concentrations and the respective volumes used in µL ...... 46

4.1 Primers sequences and properties used in the PCR to produce the insert containing GFP and the restriction enzymes locals used for cloning pEXP5-NT/GFP...... 51 4.2 Genotypes of the E.coli strains BL21(DE3), DH5α and TOP10...... 57 4.3 Cell lysis efﬁciency of the 6 lysated produced calculated from equation 3.4...... 66 4.4 Protein concentration for the 6 different lysates. The last entry corresponds to the protein concentration from the lysate of Invitrogen cell-free kit...... 67

xiii xiv List of Figures

1.1 Comparison of in vivo protein expression with cell-free protein synthesis (CFPS). CFPS systems provide a more rapid process/product development timeline. Example proteins shown include a virus-like particle (VLP), single-chain antibody variable fragment (scFv), and a membrane bound protein (MBP) (Carlson u. a., 2012)...... 3

1.2 ATP regeneration pathways for cell-free protein synthesis. Commonly used reaction sequences (Cre-P (Creatinephosphate); PANOxSP (PEP, Amino acids, NAD+, Oxalic acid, Spermidine and Putrescine) are indicated (Whittaker, 2013)...... 14

1.3 The active biochemical reactions in the Cytomim system. Glutamate is used as an energy source in this system to produce reducing equivalents (NADH) through the TCA cycle. NADH fuels oxidative phosphorylation in which oxygen serves as the ﬁnal electron acceptor, resulting in the supply of ATP. ATP mainly generated from oxidative phosphorylation promotes the transcription and translation processes.GLU-glutamate; SUC- succinate; MAL-malate; PYR-pyruvate; AC-acetate; OAA-oxaloacetate; ASP-aspartic acid; Pi-inorganic phosphate; IMVs- inverted inner membrane vesicles; ETC-electron transport chain; PMF-proton motive force (Lian u. a., 2014)...... 15

1.4 ATP regeneration in the dual-energy system combined creatine phosphate and glucose as the energy sources. GAP-glyceraldehyde-3-phosphate; GAPDH-glyceraldehyde-3- phosphate dehydrogenase; DPG-1,3-diphosphoglycerate; CP-creatine phosphate;CK-creatine kinase (Lian u. a., 2014)...... 16

1.5 The formats of CFPS system. a) Conventional batch-formatted CFPS system. b) CFCF protein synthesis system.c) CECF protein synthesis system. d) Hollow ﬁber reactor. e) Bilayer CFPS system. f) Thin ﬁlm format.Reaction mixture includes cell extract, template (DNA or RNA), and RNA polymerase (when necessary). Feeding solution includes amino acids, energy components, NTPs or NMPs, cofactors,etc (Lian u. a., 2014)...... 18

1.6 Timeline for CFPS milestones in the production of complex proteins. Abbreviations: scFv: single-chain antibody variable fragment, vtPA: variant of human tissue-type plasminogen activator, GM-CSF: granulocyte macrophage colony stimulating factor, IGF-I: insulin-like growth factor I, cIFN-α: human consensus interferon-alpha, rhGM-CSF: human granulocyte macrophage colony-stimulating factor (Carlson u. a., 2012)...... 24

xv 3.1 Representations of the plasmids used in this study. 3.1a) pEP5-NT/CALM3 (3194 bp); 3.1b) pEXP5-NT/GFP (3685 bp); 3.1c) pETGFP (6088 bp)...... 33

3.2 Steps of the S30 lysate processing...... 44

4.1 A 1% agarose gel containing the plasmid and the respective digestions. 1-undigested pEXP5-NT/CALML3 plasmid in different isoforms. 2- pEXP5-NT/CALML3 digestion with buffer G and SacII. 3-pEXP5-NET/CALML3 digestion with buffer B, SacII and PvuII. 4- pEXP5-NT/CALML3 digestion with buffer C and PvuII. M-NZYDNA Ladder III...... 50

4.2 A 1% agarose gel containing the undigested plasmid and the double digestions. 1- Undigested plasmid isoforms oc, linear and sc (from top to bottom). 2- Digestion with SacII, PvuII and 1×C buffer. 3-Digestion with SacII, PvuII and 2× C buffer. 4-Digestion with SacII, PvuII and 1× G buffer. 5-Digestion with SacII, PvuII and 2× G buffer. M- NZYDNA Ladder III...... 50

4.3 A 1% agarose gel containing the pEXP5NT-CALML3 digestion and the PCR product. 1- pEXP5NT-CALML3 double digestion with SacII and PvuII. 2- Digested PCR product. M- NZYDNA Ladder III...... 51

4.4 A 1% agarose gel containing the 3 puriﬁed plasmids obtained from cloning and the respective digestions. 1-Plasmid obtained with a incubation for 1 hour at 22oC; 1a-Digestion with XmnI; 1b-Double digestion with SacII and PvuII. 2-Plasmid obtained with incubation overnight at 4oC; 2a-Double digestion with SacII and PvuI; 2b-Digestion with XmnI; 3- Plasmid obtained with incubation overnight at 4oC; 3a-Double digestion with SacII and PvuI; 3b-Digestion with XmnI. M- NZYDNA Ladder III...... 52

4.5 HIC chromatogram of the pETGFP purification. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line) and the conductivity of the flowtrough in mS/cm (blue line)...... 53

4.6 A 1% agarose gel of the selected fraction of pETGFP puriﬁcation HIC chromatography. 1 to 3 correspond to puriﬁed plasmid peak. 4 corresponds to the second peak. 5 to 8 correspond to contaminant peak. M-NZYDNA Ladder III...... 54

4.7 HIC chromatogram of the pEXP5/GFP purification and a 1% agarose gel of the selected fractions. 4.7b) HIC chromatogram. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line) and the conductivity of the flowtrough in mS/cm (blue line). 4.7a) A 1% agarose gel of the selected fraction of pETGFP purification HIC chromatography. 1 to 4 correspond to the first peak (pure plasmid). 7 and 8 correspond to the second peak. 9 to 12 correspond to the final peak (contaminants). 13- Feed sample. M-NZYDNA Ladder III...... 54

4.8 Two 1% agarose gels containing pure pETGFP recovered from HIC chromatography after dialisys. oc-open circular form; l- linear form; sc: supercoild form. M-NZYDNA Ladder III. 55

xvi 4.9 SEC chromatogram of pEXP5-NT/GFP desalting and 1% agarose gel of the selected fractions. 4.9a) SEC chromatography. The x axis correspond to the volume of the ﬂowtrough, and the double y axis to the absorvance at 254 nm (green line) and the conductivity of the ﬂowtrough in mS/cm (blue line). 4.9b) A 1% agarose gel containing the selected fractions (1-14) of multiple SEC chromatographies. M-NZYDIA Ladder III...... 56

4.10 Two 1% agarose gels containing the digestion of pEXP5-NT/GFP puriﬁed by HIC and desalted by SEC. 4.10a) Agarose gel containing: 1-pEXP-NT/GFP digested with XmnI; 2-pEXP5-NT/GFP undigested; M-NZYDIA Ladder III. 4.10b) Agarose gel containing: 1- pEXP-NT/GFP digested with XmnI; 2-pEXP-NT/GFP double digested with SacII and PvuII; M-NZYDIA Ladder III...... 56

4.11 A 1.2% agarose gel containing different steps of tRNA puriﬁcation. 1 and 2- Samples the supernatant of the precipitation with ethanol. 4- Samples of the pellet resultant phenol extraction and ethanol precipitation. 6- pellet obtained with the addition of 1NaCl in acetate buffer. 8- Supernatant obtained after the puriﬁcation step with 1NaCl in acetate buffer. 10- Pellet obtained after the last precipitation step. M-NZYDNA Ladder III...... 58

4.12 A 1.2% agarose gel containing different steps of tRNA puriﬁcation. 1 and 2-Samples the supernatant of the precipitation with ethanol. 3-Pellet sample after the puriﬁcation with 0.3 M sodium acetate. M-NZYDNA Ladder III...... 59

4.13 AEC chromatogram of tRNA purification. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line), the conductivity of the flowtrough in mS/cm (blue line) and the the percentage of 1M NaCl buffer in the flowtrough (%B) (orange line)...... 60

4.14 AEC chromatogram of tRNA purification and 1.2% agarose gel of the selected fractions. 4.14a) AEC chromatography with a gradient elution from 30 to 70% of NaCl buffer. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line), the conductivity of the flowtrough in mS/cm (blue line), and the percentage of 1M NaCl buffer in the flowtrough (%B) (orange line). 4.14b) A 1.2% agarose gel containing: 1 to 2- Fractions from the first peak; 2 to 9- The selected fractions corresponding to tRNA peak; 10-Feed sample. M-NZYDIA Ladder III...... 60

4.15 AEC chromatogram of tRNA purification and 1.2% agarose gel of the selected fractions. 4.14a) AEC chromatography with a elution step of 45% NaCl buffer. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line), the conductivity of the flowtrough in mS/cm (blue line), and the percentage of 1M NaCl buffer in the flowtrough (%B) (orange line). 4.14b) A 1.2% agarose gel containing: 1 to 5- Fractions from the first peak; 6 to 9- The selected fractions corresponding to tRNA peak; 11-Feed sample. M-NZYDIA Ladder III...... 61

4.16 A SDS-page gel silver stained containing samples from the ﬁrst peak of tRNA puriﬁcation chromatogram. Marker: Precision Plus Protein Standards duo Color (Bio Rad)...... 61

xvii 4.17 E.coli cells containing the GFP produced from pETGFP (figure 4.17a) and pEXP5-NT/GFP (figure 4.17b) seen with a flurescence microscope with blue filter...... 61 4.18 A 12% acrylamide gel stained with comassie blue containing samples from the washing and elution of GFP HIC purification. Marker: Precision Plus Protein Standards duo Color (Bio Rad)...... 62 4.19 Two 15% acrylamide SDS PAGE gels containing samples of GFP purification by IMAC chromatography. 4.19a) 15% acrilamide gel containing: 1- Feeding sample: 2 to 4- Elution samples containing GFP; 5- Washing sample. 4.19b) 15% acrylamide gel containing two elution samples with GFP after the optimization of imidazole concentration in the buffer used. M- Precision Plus Protein Standards duo Color (Bio Rad)...... 63 4.20 A 15% acrylamide gel stained with comassie blue containing samples from the washing (3) and elution (1 and 2) of GFP purified by IMAC. A western blot with His-tag ant-body from with the same samples as the acrilamide gel on top. Marker: Precision Plus Protein Standards duo Color (Bio Rad)...... 64 4.21 E.coli BL21 growth curve represented by average and the respective standard deviations

until the harvest. the y axis corresponds to the optical density (OD600) of the cells. The x axis corresponds to the culture time in hours. The curve corresponding cell growth without plasmid is represented in light blue, and the dark blue represent cell growth with plasmid. 65 4.22 A 15% acrilamide SDS-PAGE gel containg samples of pEXP5-NT/GFP tests using Ex- pressway Cell-Free textitE. coli Expression System (Invitrogen). 1) Test containing the control vector (pEXP5-NT/CALML3); 2 to 4) Tests containg pEXP5/GFP as expression vector. M) Precision Plus Protein Standards duo Color Marker (Bio Rad)...... 68 4.23 A 15% acrilamide SDS-PAGE gel containg samples of pETGFP tests using Expressway Cell-Free textitE. coli Expression System (Invitrogen). 1) Test containing the control vector (pEXP5-NT/GFP); 2 to 4) Tests containg pETGFP as expression vector. M) Precision Plus Protein Standards duo Color Marker (Bio Rad)...... 68 4.24 A histogram containing the GFP produced with Expressway cell-free kit at two incubation temperatures- 37oC (dark blue bar) and 37oC (light blue bar) and the respective standard deviations...... 69 4.25 A histogram containing the average relative flurescence (RFU) of the produced GFP in the 6 lysates and the lysate from the kit...... 69 4.26 Optimisation screens of E. coli cell-free protein synthesis containing the cytomimic system as a energy system, pEXP5-NT/GFP as a template and the lysate 6. 4.26a) Active GFP produced, in relative fluorescence units, with the variation of magnesium concentration from 2mM to 12mM in increments of 2mM. 4.26b) Active GPF produced, in relative fluorescence units, with the variation of template (pEXP5-NT/GFP) concentration in µg × mL−1. 4.26c) Active GPF produced, in relative fluorescence units, with the variation of lysate volume (%)...... 70

xviii List of abbreviations

3’-UTR-Three prime untranslated region ICE-Insect cells 5’-UTR-Five prime untranslated region IMAC-Immobilized metal ion affinity chromatogra- AEC-Anion exchange chromatography phy ATP-Adenosine triphosphate IPTG-β-D-1-thiogalactopyranoside BSA-Bovine serum albumin mRNA-Messenger ribonucleic acid CECFS-Continuous exchange cell-free protein NAD-Nicotinamide adenine dinucleotide synthesis PAGE-Polyacrylamide gel electrophoresis CFCFP-Continuous flow cell-free protein synthesis PANOx-Phosphenol pyruvate, amino acids, Nicoti- CFPS-Cell-free protein synthesis namide adenine dinucleotide , oxalic acid CoA-Coenzyme A PCR-Polymerase chain reaction CP-Creatine phosphae pDNA-plasmid DNA CTP-Cytidine triphosphate PE-Polyethylene glycol DEAE-Diethylaminoethanol PEP-Phosphenol pyruvate DMSO-Dimethyl sulfoxide RRL-Rabbit reticulocyte DNA-Deoxyribonucleic acid RM-Reaction mixture DTT-Dithiothreitol RNA-Ribonucleic acid E. coli-Escherichia coli RNAP-Ribonucleic acid polymerase FM-Feeding mixture SDS-Sodium dodecylsulfate GFP-Green fluorescent protein TrisTtris(hydroxymethyl)aminomethane GTP-Guanosine triphosphate tRNA-Transfer ribonucleic acid G1P-glucose 1-phosphate TX-TL-Transcription and translation G6P-Glucose 6-phosphate UTP-Uridine triphosphate HIC-Hydrophobic interaction chromatography WGE-Wheat germ

xix xx Chapter 1

Introduction

Today, fossil fuels and their derivatives (methanol, ethylene, propane, butane, benzene) serve as a building block for almost all chemicals and materials used daily (Moulijn u. a., 2013). This dependence of fossil fuels and the petrochemical materials paradigm has consequences: supply limitations due to increasing and fluctuating prices (and finite availability), undesirable climate effects (Hoök¨ und Tang, 2013), and constraints on materials innovation due to a limited set of petrochemical building blocks (Bozell und Petersen, 2010). Thus, the desire to produce chemicals and materials derived from biomass led to the development of novel, sustainable, and cost-effective technologies based on biological synthesis.

Biology is able to produce complex molecules and polymers from simple building blocks (Harris und Jewett, 2012). Biological systems have innumerable pathways and macromolecular machines that are capable of convert a precursor into a variety of products, with high fidelity, efficiency, and yield. These combined characteristics is what makes the biological systems perfect for the production not only of high-value products (Liese u. a., 2006), but also of commodity chemicals and fuels (Dudley u. a., 2015). In the recent decades, there has been a growth of the industrial biotechnology and metabolic engineering (Bozell und Petersen, 2010). This exploit growth promoted the exploit of enzymes as robust, specific, and efficient catalysts of chemical reactions (Quin und Schmidt-Dannert, 2011), and the use of living organisms to produce a variety of useful small molecules, peptides, and polymers (Nielsen u. a., 2013). Recently, the first-generation ethanol (Cherubini, 2010), 1,3-propanediol (Dupont Tate & Lyle) (Nakamura und Whited, 2003), polylactic acid (Cargill), and isoprenoids (Amyris) (Paddon u. a., 2013), among other, were successfully commercially produced.

Although there is a number of success stories, the use of a cell-based system has some drawbacks. The production is economically limited, as it requires hundreds of person-years of work to bring a single pathway to market (Hodgman und Jewett, 2012). The major obstacle inherent to this system is the limitation imposed by cells. It is very difﬁcult to keep a balance between a active synthetic pathway and cell growth and maintenance. There is a tight restriction to the physiological ambient conditions (pH, temperature) and a necessity to prevent the accumulation of toxic compound. The concentration of target molecules is limited to non-toxic levels and the production of unwanted by-products is common.

1 The scaling up of cultures to the industrial level and to separation and purification if the target product are challenging problems. The productivity is affected by the inability to control the resources exclusively towards to the target protein pathway. Therefore, the unwieldy complexity of cells makes rational design unpredictable and difficult to engineer (Kwok, 2010). In order to overtake the drawbacks aforementioned, many solutions are being designed. Synthetic biology offers new advanced tools and generalised capabilities to modify living organisms for process engineering objectives (Dudley u. a., 2015). Nevertheless, this is a major challenge: our knowledge of how life works is incomplete, cells are inherently complex, there is unintended interference between native and synthetic parts, and the micro and macroevolution and adaptation of the cells creates noise(Hodgman und Jewett, 2012). Other solution to these problems can be the switch of focus from the whole cell to the reaction within it. The synthesis can be conducted without using intact cells: using either purified enzyme systems, or crude cell lysates. This way, the synthesis can be accurately monitored and modelled. In the recent years, many advances in the cell-free systems were made by optimising and reducing the production cost; the approach was transformed from a specialised analytical tool to a powerful preparative method with broad applicability (Dudley u. a., 2015). These systems have the advantage of not requiring the process of cell viability and growth and thus, offer a powerful platform for accelerating the optimisation of the pathways –not only harnessing but also expanding the chemistry of life–(Dudley u. a., 2015).

1.1 State-of-the-art

1.1.1 Cell-free Protein Synthesis

Cell-free biology is defined as the activation of complex biological processes without using intact living cells (Hodgman und Jewett, 2012; Swartz, 2012). The metabolism can focus cellular resources towards an exclusive and defined objective. The removal of physical barriers enables the direct access to the inner working of the cell: allowing easy substrate addition, product removal, system monitoring, and rapid sampling. Furthermore, with the removal of genomic DNA, there is no longer the need for genetic regulation (and cell viability is also removed). In short, cell-free biology decrease the dependence on cells and increases the engineering flexibility (Forster und Church, 2007). The most prominent and developed example of cell-free biology is cell-free protein synthesis (CFPS) (Harris und Jewett, 2012). As the name implies, CFPS is described as the in vitro expression of recombinant proteins, without the use of living cells. It uses a cell lysate containing a diverse array of biological and chemical components for transcription, translation, protein folding and energy metabolism required to directly synthesise the target protein. The lysates can –theoretically– be created from any cell source or origin and can be reconstituted for biosynthesis of proteins by adding exogenous genetic information. The added substrates include amino acids, nucleotides, DNA or mRNA template encoding the target protein, energy substrates, cofactors, and salts. As in a fermentation reaction, the cell-free protein synthesis production continues until one of the substrates (e.g. ATP or cysteine) is depleted as

2 the by-product accumulation reaches an inhibitory concentration.

Figure 1.1: Comparison of in vivo protein expression with cell-free protein synthesis (CFPS). CFPS systems provide a more rapid process/product development timeline. Example proteins shown include a virus-like particle (VLP), single-chain antibody variable fragment (scFv), and a membrane bound protein (MBP) (Carlson u. a., 2012).

Cell-free protein synthesis systems are becoming increasingly more popular due to them advantages in the protein production process when compared to the in vivo approach (figure 1.1). They are con- siderably faster, because the process does not involve transfection or cell cultures, nor does it require a difficult downstream purification. Moreover, only the desired protein is produced so there are no ex- penses in the production of proteins and metabolites involved in the cell maintenance and growth. It also reduces the effect of toxicity, because there is no need to maintain the cell viability (it only maintains the metabolisms required to the production). With cell-free systems, one can influence the complex reaction network directly, by adjusting different supplies for the optimal production. Catalysts and reagents can be added or removed: such as complex

3 enzymatic subtracts, cofactor or non-natural reagents, and energy supplier. Template or PCR product concentration can be adjusted to optimal production. Another advantageous feature is the possibility to monitor the complex reaction network directly, because it easy to acquire samples, and enables on- line monitoring. Duo to the absence of cell membranes, there are no barriers to access the product. There is no need for transporters, and it simpliﬁes the product harvest and the monitoring of the product levels. The environment is diluted and therefore less crowded, which has several effects: There is no background synthesis directed by chromosomal DNA, the sigma factors uncouple from native RNA polymerase and no longer produce messenger RNA from DNA in the lysate, the rate of undesired reactions is reduced, and diffusion rates are improved (Swartz, 2012). The dilution also has effects on protein folding. The protein elongation is slowed due to lower concentrations of elongation factors: allowing the protein to fold before the following domains emerge from the ribosome, also, there is less chance for inclusion bodies to form. The catalytic system will be stabilised as the dilution reduces the concentrations of proteases and nucleases.

In in vivo systems, proteins expressed in the cytosol have to be recovered by celular lysis, which can result in protein denaturation. Since there are no barriers, there is no need to lysate the cells and protein puriﬁcation is simpler and safer. Furthermore, the CFPS can be performed on a microliter scale making it ideal for high-throughput applications (mutant screening for optimal physicochemical/functional properties) (Casteleijn u. a., 2013).

Cell-free systems allow the production of several proteins that otherwise would be quite difficult to produce. First, it allows the production of proteins with co-translational modification. The system can incorporate non-natural or chemically modified amino acids into the nascent polypeptide at defined positions during translation. This has greatly facilitated labelling of proteins with isotopic, fluorescent, biotin or photoreactive groups for downstream applications (He, 2008). Besides, the application of this technique to the production of non-natural analogues with reactive side chains have immense potential in structural and functional proteomics. The ability to engineer physicochemical properties of proteins with relative ease would expand the utility of cell free system towards expression and production of proteins with pharmaceutical relevance (Casteleijn u. a., 2013).

Disulﬁde-bonded proteins are ordinarily formed in extracytoplasmic compartments in which conditions are more oxidising (Katzen u. a., 2005): the periplasm of prokaryotes and the lumen of the endoplasmic reticulum (ER) of eukaryotes. One of the major drawbacks of E. coli in vivo systems is the inability to produce these proteins. This is a serious limitation since many of the proteins with pharmaceutical relevance have multiple diffuse bonds that require proper folding. A set of nine complex proteins with multiple disulﬁde bonds was expressed using a cell free protein synthesis system (Goerke und Swartz, 2008). Cell-free protein synthesis systems also allow the expression of protein complexes and membrane proteins. The production of protein complexes (consisting of hetero subunits) is achieved using multiple mRNAs that will be co-translated and form the active protein complex (Matsumoto u. a., 2008).

This system is also efﬁcient to synthesise toxic protein that would inhibit the cellular machinery and limit the expression in cell-based systems. Cell free systems provide an alternative to synthesise these

4 proteins (either as precipitates or translated directly) in the presence of surfactants or preformed liposomes. For instance, E. coli multi-drug transporters (EmrE, SugE, TehA and YﬁK) were expressed using a modiﬁed E. coli S30 extract at high levels as precipitates and the solubilised in detergent micelles (Casteleijn u. a., 2013). Finally, the cell-free protein synthesis has an important role in the production of proteins with mul- tidomains eukaryotic proteins with high content of A/T and low complexity sequences. A major issue of concern in malaria vaccine discovery research is the lack of an ideal recombinant protein synthesis system that can express A/T rich and low complexity sequences of the malaria genome. The wheat germ system proved highly suitable for A/T rich malaria genes, not requiring codon optimisation (Casteleijn u. a., 2013). Further exploring the versatility of these systems towards expression of eukaryotic multido- main low complexity region sequences is certainly a matter of further research.

1.1.2 cell lysates

Cell lysates contain active enzymes as well as helper factors for transcription, translation, and protein folding. The components in the cell lysate act ad as chemical factory to synthesise and fold the target protein upon an incubation with the essential substrates. A variety of cell lysate preparation methods have been developed for CFPS. In theory, any organism can provide a source of crude lysate. To date, a number of organisms were successfully used to create lysates: E.coli, yeast, rabbit reticulocyte, wheat germ, hyperthermophile, Drosophila embryo, hybridoma, Xenopusoocyte or egg, insect, mammalian and human cells (Endoh u. a., 2006). Since all these cells are very different, the extracts derived from them behave very differ- ently. Thereby, the first decision when using CFPS to produce biological active proteins is to choose the source of lysate. There are some criteria to taking into account: the required amount of synthesised recombinant protein, the source that provide the most favourable background for promoting protein folding and to increase the likeability of post-translational modifications, the protein origin and complexity, the downstream processing, the system availability and cost. The prokaryotic E.coli CFPS system is the most popular and it is commercially available. E.coli based systems achieve the highest protein yield, from hundreds of micrograms to milligrams per millilitre, in a batch reaction, depending on the protein of interest. For instance, it was achieved 1.7mg.mL−1 for chloramphenicol acetyl (Kim u. a., 2011) and 0.7mg.mL−1 for human granulocyte-macrophage colony- stimulating factor (Zawada u. a., 2011). In addition, the E. coli CFPS has the ability of activate metabolic reactions in the extract that fuels high-level protein synthesis without the need for using expensive energy substrates. Thus, E. coli based systems are very efficient and have higher yields, however they do not provide most post-translational modifications nor specific eukaryotic folding systems. So far, complex modifications, such as glycosylation, lipidation, or phosphorylation are only described from systems with eukaryotic extracts such as rabbit reticulocytes (RRL), insect cells (ICE), or wheat germ (WGE). However, these systems usually have more laborious extract preparation procedures, are more costly, and have lower protein yields. Despite these negatives characteristics, they are better for

5 functional studies, particularly for post-translationally modified proteins. The most productive eukaryotic based system is the one based on wheat germ. It is prepared from isolated wheat seed embryos and typically produces between several hundred micrograms to milligrams of recombinant protein per millilitre reaction (Madin u. a., 2000). While WGE is the most efficient at producing proteins, it is not suitable for some post-translational modifications like glycosylation (Tarui u. a., 2001). Rabbit reticulacytes and insect cells have shown the most versatility in post-translational modifications. There are reports of isoprenylation, acetylation, N-myristoylation, phosphorylation, ubiquitin- conjugation, signal peptide processing, and core glycosylation being achieve in this systems (Carlson u. a., 2012). In terms of yield, RRL reactions typically report several to tens of micrograms protein per milligram reaction (Tarui u. a., 2001). ICE system are usualy prepared from Spodoptera frugiperda cells (Ezure u. a., 2010) and produce several tens of micrograms per millilitre reaction. These systems have an advantage over RRL in terms of glycosylation.They do not require the addition of micromosal membranes and enzymes (needed for proper post-translational modifications in RRL). One of the disadvantages is that these microssomal membranes must be purified separately. Thus, ICE system is one of the fastest growing CFPS platforms (Hodgman und Jewett, 2012). Beyond the platforms listed above, eukaryotic CFPS systems based on yeast (Wang u. a., 2008), cancer cells (Weber u. a., 1975), and hybridoma (Mikami u. a., 2006), have also been developed. There are limitations factors to protein production efficiency in cell extracts. They may have high concentrations of endogenous degrading enzymes, poor synchronisation of ribosome activity during cell growth, or stability problems of essential enzymes(Proverbio u. a., 2014). Also, lysates from cells showing high expression activities in vivo may not be very efficient in cell-free expression. However, the protocols are continuously being optimised and further potential for improved protein synthesis might exist. Cell lysates are not the only source of the enzymatic machinery. Despite being one of the most complex basic cellular processes, the whole translational mechanism from E. coli was reconstituted in vitro with more than 100 individually purified components. The Protein Synthesis Using Recombinant Elements (PURE) system is based on the reconstitution of the translational machinery of the cell from purified protein components, such as initiation factors, elongation factors, release factors, ribosome recycling factors, 20 aminoacyl tRNA synthetases, methilonyl tRNA formyltransferase, and pyrophosphatase (Shimizu u. a., 2001). The system exhibits high translational efficiency with the added advantage of simpler manipulation of the reaction conditions and easy purification of untagged protein products (Katzen u. a., 2005).

Wheat germ lysate

Alongside E. coli systems, WGE is the most used and developed cell-free system. WGE is frequently operated as translation system with supplied mRNA as template and different concentrations of Mg2+ from transcription and translation (TX-TL) systems. The lysates are highly stable which allows the ex-

6 tension of reaction times for weeks with final protein yields up to 10mg.mL−1 at optimal conditions (Sawasaki u. a., 2002b). These lysates are difficult to prepare because the embryo used is surrounded by the endosperm containing high levels of protein and nucleic acids degrading enzymes as well as translation inhibitors. To improve WGE systems, the endogenous inhibitory pathways of the translation machinery originating from the endosperm can be blocked (Madin u. a., 2000). Besides, there is a high batch variation in the lysate quality. This usually depends on the origin and source of the wheat germs. In order to obtain high stables WGE lysates, the endosperm contaminants must be removed, through extensive washing. The high performance of WGE systems has been demonstrated in the so-called “human protein factory study” (Goshima u. a., 2008). This project targeted the expression of 13364 human proteins, where 12996 of their clones produced protein were produced with a wheat germ system (97.2%) and 12,682 of those were found in the soluble fraction (Arumugam u. a., 2014). Thus, WGE cell free systems can be a very effective high-throughput expression system for rapid preparation of multiple proteins for antigen characterisation, and fir generating quality antibody molecules. It is the method of choice for production of stable, properly folded, appropriately post-translationally modified proteins and for high- throughput protein expression at various scales (Endo und Sawasaki, 2004).

E.coli S30 lysate

E. coli lysates are the most used from CFPS. The first procedure for preparation of this lysate was developed by Nirenberg (Nirenberg, 1963) in 1963. Although Zubay (Zubay, 1973)and Pratt (Pratt, 1984)made some alterations to the method, it remains almost the same up until the last decade.The cell lysate preparation is a key step to obtain successful and reproducible results using the cell-free protein synthesis (Kigawa u. a., 2008). In general, the cells are harvested in the mid-exponential phase of a low- density fermentation and then processed by a high-presure lysis (20,000 psi) . The resulting lysate is then centrifuged twice at 30000×g to remove wall fragments and genomic DNA (Schwarz u. a., 2008). In addition, it removes endogenous mRNA as well as all low molecular weight compounds –which helps to suppress background expression and to have complete control over the amino acid pool in the reaction–. The lysate is further clarified with a runoff reaction and dialysed to provide suitable storage buffer. The extract obtained (denominated S30 extract) consist of the cell-crude, ribosome, proteins, factors and soluble RNA necessaries to the protein production. However, this procedure remains a time and labor-intensive process. Besides, it is also difficult to standardise, leading to different lysate performances. Furthermore, this procedure involve a large volume of cell culture, costly high pressure disruption equipment to lyse cell, and it has a low yield. Obtaining and using a large number of cell extracts from different source strains is not yet routine. Thus, it is surprising that only in the last decade, studies focusing alteration to this procedure for improved productivity and reproducibility started to appear. One of the most important change was the E.coli strain used in this preparation. Previously, E. coli starins lacking the major RNase (such as A19 and MRE600) were used (Zubay, 1973)(Pratt, 1984). Today, strains BL21-derivatives –containing extra copies of genes for minor tRNAs– are used. This

7 includes BL21 codon-plus strains (Stratagene, USA), Rosetta strains (Novagen, USA), or the originally developed strain from (Chumpolkulwong u. a., 2006). The use of this strains bypasses the low productivity due to rare rare codons. BL21-Star (DE3)(Invitrogen,USA) is one of the best strains to used because it is deﬁcient in major RNase (RNase E) and in ompT endoproteinase (Ahn u. a., 2005).

In order to stabilise the energy supply, modifications to the growth medium were done. The development of a defined medium (2YT) for consistent growth produces active extracts from high-density fermentations (Liu u. a., 2005). The addition of phosphates and excess glucose, avoidS the induction of phosphatase which resultS in a 30% decrease of ATP hydrolysis activity and a 40% more productive cell (Kim und Choi, 2000). Apart from medium composition, other aspects of cell growth were addressed. The use of shake flask fermentation was reported twice to simplify the cell growth (Kigawa u. a., 2004; Yang u. a., 2012). The addition to the medium of isopropyl β-D-1-thiogalactopyranoside (IPTG) during the cell growth –to overexpress the T7 RNA polymerase– eliminates the need to add independently purified T7 RNA polymerase to the CFPS reaction, which is a very important and expensive component in the reaction (Kim u. a., 2006).

The cell disruption method is another important modiﬁcation. In order to disrupt the cell wall, but keep the components necessary to the cell-free system intact, a mechanical method must be applied. A french press is a popular device to disrupt the E. coli cells. However,it is difﬁcult to obtain reproducible cell disruption results on a laboratory-scale preparation (Kigawa u. a., 2008). One of the most used alternatives is the high-pressure homogeniser and bead mill, but again they are a costly equipment. There is a report on the use of bead vortexing (Shrestha u. a., 2012), and a sonicator (Kwon und Jewett, 2015) to produce this lysates.

The run-off reaction is a subject of discordance. The step consist in a preincubation (or run-off reaction) which reduces the background incorporation of amino acids into undesired proteins. During this reaction, the lysate is incubated with an energy source with no exogenous mRNA or DNA. This releases the ribosomes and facilitates the degradation of endogenous mRNA and DNA (Nirenberg, 1963). The polysomes and the ribosomes in the extract dissociate into 30S and 50S ribosomal subunits (Shrestha u. a., 2012). The nature of the extract activation during the run-off reaction is still unknown, but one possibility is that the incubation activates certain factors or deactivates certain inhibitors that improve protein yields in the cell-free system. Although almost all procedures available incubate the lysate with an energy source, there is little effect on ﬁnal lysate performance. However, without the reagent additions, the 70S ribosomes do not dissociate into subunits (Shrestha u. a., 2012).

In 2006, Kim group presented a new protocol for the production of lysate (Kim u. a., 2006). Unlike the conventional S30 lysate, the preparation of the S12 does not involve high-speed centrifugation or dialysis steps. Instead, centrifugation is done at 12000 × g for 10 minutes and the run-off step is done with a brief incubation without the pre-incubation mixture (Kim u. a., 2006). As a result, the overall processing time and cost were reduced by 60 and 80% respectively. The translational activity of the centrifuged lysate prepared with the simpliﬁed procedures was also substantially higher than that of a standard S30 lysates.

8 PURE system

The Protein synthesis Using Recombinant Elements (PURE) is a cell-free protein synthesis system approach based on reconstitution of the translational machinery of the cell from affinity purified protein components (Shimizu und Ueda, 2010). The components include initiation factors (IF1, IF2, IF3), elongation factors (EF-Tu, EF-Ts, EF-G), release factors (RF1, RF2, RF3), ribosome recycling factors, 20 aminoacyl tRNA synthetases, methionyl tRNA formyltransferase and pyrophosphatase, all bearing a 6 × His tag. They are combined with ribosomes and tRNAs isolated from E. coli strains, NTPs, aminacods, an ATP-generating catalytic module and recombinant T7 RNA polymerase (RNAP). This will produce a self-contained reaction that can be used for protein synthesis with the addition of DNA templates. This system has been commercialised (e.g., PURESYSTEM, Cosmo Bio, Tokyo, Japan; PURExpress, New England Biolabs, Beverly,MA, USA), making it available for a variety of laboratory research applications (Whittaker, 2013). There are many advantages of the PURE systems over tradition lysate based ones: levels of con- taminating proteases, nucleases, and phosphatases are reduced, greater reproducibility resulting from more defined chemistry, and the flexibility of a modular system. Also, metabolic side reactions that deplete the amino acid pool in cell extracts can be entirely avoided. The purification of the products with the 6 × His affinity tags associated with the PURE components can be done by extracting the tagged proteins by metal affinity chromatography. The major advantage of PURE systems its modular- ity: it supports a variety of modifications for specialised applications. It includes ribosome display and site-selective incorporation of not genetic encoded amino acids (ngeAAs). One the other hand, PURE system are very expensive (which is prohibitive for most commercial applications) leaving crude extract systems the clear current choice (Hodgman und Jewett, 2012). In addition, cell lysate systems have a better protein yield per ribosome (Jewett und Forster, 2010). Re- cently, there is an effort to close the gap between lysate-based and purified-based systems. Genome engineering technology is being used simultaneously to tag multiple components from the translation apparatus in a single strain for co-purification and to reconstruct in vitro (Wang u. a., 2009).

1.1.3 Cell free protein synthesis system templates

A typical Cell-free protein synthesis system is led by transcription from sub-nmol quantities of template. With the increasing improvements in the efﬁciency of transcriptional processing has brought the technology near the single-molecule limit of template sensitivity. This level of sensitivity is important for a variety of nano-scale processing applications, including protein printing (Whittaker, 2013). CFPS systems can act as coupled or linked transcription and translation reactions. The linked reactions imply a two-step sequential process, where the transcript is formed ﬁrst. Usually, these reactions require a mRNA template produced from native sources or by in vitro transcription. The coupled reactions imply simultaneous synthesis of mRNA and protein within an extended polysome complex (Whittaker, 2013). Most of these systems include a DNA template which can be a plasmid or a linear DNA fragment such as a polymerase chain reaction (PCR) product. The DNA template must contain a

9 efficient promoter and a translation initiation signal such as a Shine–Dalgarno (prokaryotic) or a Kozak (eukaryotic). When comparing the coupled with the linked transcription/translation (TX-TL) in E.coli, it is clear that greater quantities of mRNA (20-30fold) over plasmid DNA are necessary to produce similar amounts of the target (Rosenblum und Cooperman, 2014). This can be a consequence of the instability of mRNA in the reaction medium. This problem is mitigated when mRNA is generated in a coupled TX-TL system. In general, coulped CFPS sysem is prefered because it uses small amounts of plasmids or PCR products which are easier to obtain and it eliminates the time and cost for mRNA in vitro transcription. Nevertheless, the use of mRNA prepared separately can sometimes be advantageous. For instance, it allows the study of effects of post-transcriptional mRNA modification. The study of these effects is deter- minant in tailoring synthetic mRNAs with desirable properties such as stability, translational capacity and controlled immunogenicity (Kariko´ u. a., 2008). Another example is the study of how mRNA secondary and tertiary structures affect the translation. This structures may contain stem-loops, pseudoknots and G-quadruplexes that may be fully formed when linked TX-TL is used, but form only partially (if at all) when the TX-TL processes are coupled. This allows for a detailed study of how such structures the influence translation rate and how this influence can be manipulated by the addition of molecules and proteins that specifically bind and stabilise these structures (Bugaut und Balasubramanian, 2012).

Coupled transcription and translation CFPS systems

Coupled CFPS systems imply the addition of a DNA template, formed either by a closed circular vector (plasmid) or a linear fragment (PCR product). In either form, the template must be under control of a specific and strong promoter sequence recognised by phage polymerases, such as T7, SP6, or T3 RNA-polymerase (RNAP). The T7 promoter is usually chosen since it is the most popular among E. coli protein expression systems. There are many suitable vectors commercially available, such as pET (No- vagen) or pIVEX (Roche Diagnostics) derivatives (Schwarz u. a., 2008). The transcription is performed by recombinant phage T7 RNAP, generating the mRNA used by the ribosomal machinery will use to produce the target protein. The T7 RNAP is a single-subunit polymerase with high promoter specificity and transcriptional fidelity (Sousa und Mukherjee, 2003). The use of T7 RNAP also allows the use of the same DNA templates in both in vivo and in vitro systems. The DNA template used in CFPS systems must have the following components: A 5’ untranslated region (UTR) comprising a T7 promoter sequence, a Shine-Dalgarno (SD) sequence (which serves as ribosome entry point), and a 3’-UTR (including an efficient translation termination codon, followed by six or more nucleotides). The Shine-Delgarno sequence should be at a optimal distance from the open reading frame (ORF) (usually eight nucleotides from the AUG start codon) (Dreyfus, 1988). The SD sequence interacts with the 3’ end of the 16S ribosomal RNA (rRNA) to allow efficient initiation. Other components can be added to the template to improve the yield. An epsilon (Enchancer of Protein Synthesis Initiation) sequence can be added to the 5’-UTR and a T7 terminator in the 3’UTR improves the efficient release and recycling of the ribosome. In the prokaryotic systems, the productivity highly depends on the rate of translation initiation (Schwarz u. a., 2008). The use of N-terminal tags (T7

10 tag, His × 6) or smaller fusion proteins can also enhance the expression. For eukaryotic CFPS systems, an engineered 5’-UTR is used to induce efficient translation. In in vivo systems, capped and poly-adenylated mRNA is required for efficient translation initiation. Although capped mRNA can be used, this is expensive and has a low efficiency. Internal Ribosome Entry Site (IRES) is a highly structured element found within viral mRNA that is able to induce eukaryotic initiation (Jang u. a., 1988). Most eukaryotic cell-free systems use the IRES sequences to initiate translation. They are unique for each organism and usually derived from viruses. For example, an upstream IRES was shown to be important for the expressioncof large proteins such as GCN2 (160 kDa), Dicer (200 kDa) and mTOR (260 kDa) in a HeLa (human)-derived CFPS system (Mikami u. a., 2008). A universal DNA sequence for protein initiation in both prokaryotic and eukaryotic systems has also been designed. Species-independet translation sequences (SITS) eliminate species barriers to cell-free translation. This universal adapter relaxes the secondary structure in the transcript and enables the assembly of the translation complex in E.coli, yeast, wheat germ, insect cell, rabbit (Mureev u. a., 2009).

Template production

A purified template is one of the most expensive substrates in CFPS systems. Also, the purification of templates is a time-consuming step and it can be a bottleneck when expressing a large number of proteins. In the case of plasmids, although alkalise lysis and liquid chromatography are a well establish techniques for plasmid preparation and purification, to produce a high pure product the procedure must combine two chromatographic techniques as well as an efficient sample preparation method. Thus, this process is time consuming and has a low yield. To overcome this, alternative methods are being developed. DNA rolling circle amplification is a process of unidirectional nucleic acid replication that can rapidly synthesise multiple copies of circular molecules of DNA or RNA. In a recent report, this method was used to amplify 5µgof circular DNA from 100 ng of starting material (which served as a high-quality template for protein synthesis) (Kumar und Chernaya, 2009). For the preparation on linear DNA templates, a two-step PCR method was developed. This allows virtually any coding sequence to be assembled together with promoter and terminator elements for cell-free synthesis. First, the open reading frame (ORF) of a domain fragment of ORF is amplified by PCR using using gene-specific primers and/or universal primers. Second, the first PCR product, a T7 promoter fragment (with the tag-coding sequence), a T7 terminator fragment, and the universal primer (these are non-gene-specific and thus in common with all the genes) are subjected to overlapping PCR. This produces a construct that expresses a fusion protein under the control of the T7 promoter (Kigawa u. a., 2008). This method has the advantage that different tags can be attached simply by changing the common tag-coding fragment at the second PCR step with the same specific primer pair for each target. This method is so efficient and robust that it is routinely use in different labs (Kigawa u. a., 2008) (Whittaker, 2013). Another direction to address the problem is high-throughtput gene construction. The Gateway vector system (available from Invitrogen) uses integrase enzymes for one-step insertion of a desired gene into a vector. This avoids excess restriction digest and ligation reactions. This platform was used for high-

11 throughput production of 33,275 entry clones that were subsequently used for CFPS of a portion of the human proteome (Goshima u. a., 2008). An improved E. coli based CFPS system was recently developed. This system uses an endoge- nousE. coli RNA polymerase instead of the more standard bacteriophage polymerases. This may provide advantages for the synthesis of particular genes (Chalmeau u. a., 2011).

Multigene expression

Cell free protein synthesis systems can be used to produce multiple polypeptides in a single reaction mixture simultaneously. The addition of multiple templates results in the parallel synthesis of distinct proteins. This approach can be used to assemble complex multicomponent proteins, as successfully demonstrated with the synthesis of the heterotrimeric core of Paracoccus denitrificanscytochrome coxi- dase in an E. coli CFPS system (Katayama u. a., 2010). An alternative strategy for multigene expression from polycistronic constructs has been demonstrated for the production of up to five distinct protein products from a single ‘BioBrick’ plasmid template (Du u. a., 2009). Sequential synthesis is also possible by immobilising template DNA on magnetic microbeads. Cell-free protein synthesis can then be arbitrarily reset and reprogrammed which is an example of artificial gene circuits (Lee u. a., 2012).

1.1.4 Other components and Energy systems

Beyond lysate preparation, stabilising the reaction with a variety of essential compounds is critical for cell-free protein synthesis systems. They help to control the concomitant accumulation of unwanted side products to maximise protein production yield and the lifetime of the system. One of the most essential compound in all CFPS system in the divalent Mg2+. This ion is important for many biological reactions, both for in vivo and in vitro systems. It is very difﬁcult to determine the concentration values for maximum protein production yields, but usually it ranges from 4 to 20 mM for E.coli, and 2 to 4 mM for eukaryotic systems (Madin u. a., 2000). This concentration must be optimised for every lysate batch. Potasssium and ammonium acetate or the corresponding glutamate are also added to the E.coli system at high concentrations. ATP and GTP are sufﬁcient to provide the required energy for mRNA translation in WGE systems, but in E. coli the four nucleoside triphosphates (ATP, CTP,GTP,UTP) are necessary. Protein synthesis requires all 20 amino acids are present in amounts super-stoichiometric with the amount of protein to be formed. It also requires the addition of all 20 amino acid tRNA synthetases and the full complement of tRNAs (Whittaker, 2013). In cell-free systems, amino acids are supplied in concentrations between 0.3 and 2 mM. Membrane protein production is dependent on the composition of the amino acid pool, therefore, the individually adjustment of the concentration may result in higher expression yields. Problems with codon usage upon synthesis of heterologous genes can be addressed by manipulation of total tRNA concentration and by additing rare codon-enriched tRNA (Schwarz u. a., 2008). In cell-free reactions, the energy source (NTPs) are rapidly consumed. Moreover, E. coli lysates have

12 high endogenous phosphatase and ATPase activities resulting in uncoupled NTP hydrolysis. Therefore, energy supply is the main limiting factor of CFPS systems. Many protocols for these systems have been developed with the major different between them being the energy source and pathways for efficient ATP regeneration. In most protocols, the problem of energy depletion is addressed by the addition of high energy source, such as phosphenol pyruvate (PEP), acetyl phospate, or creatine phosphate (CP) as a secondary energy substrate, together with the corresponding kinases (Kigawa u. a., 1999). The use of these energy sources has some downsides: phosphenol pyruvate is degraded by the cell lysate and its addition increases the levels of inorganic phosphate in the reaction. This accumulation leads to seques- tration of magnesium ions and causes early stoppage of protein synthesis (even with sufficient amount of ATP present) (Kim und Kim, 2009). Creatine phosphate, unlike PEP,is not a natural substrate of E.coli metabolism, therefore, it can be consumed through a number of metabolic enzymes in the cell lysate. Compared with other energy sources, CP can drive the regeneration of ATP with higher efficiency. Nev- ertheless, as in case of phosphate-containing compounds, its utilisations leads to the accumulation of inorganic phosphate. This problem will always occur as long as ATP regeneration is conducted based on direct substrate-level phosphorylation reactions. There are protocols that propose a modified energy regeneration using oxidation of substrates from glycolytic pathway for the generation of ATP concomitant with the consumption of reaction by-products (Calhoun und Swartz, 2005a). Substrates used include pyruvate, glucose-6-phosphate, and glucose. The key advantage of these energy substrates is that environmental factors like pH and inorganic phosphate concentrations are more stable, which leads to an extended duration of the protein expresstion and a higher yield (Carlson u. a., 2012). Moreover,these substrates are substantially cheaper than the conventional energy source (PEP).

PANOx system

The PANOx system (PEP, amino acids, NAD+, oxalic acid) was the first energy system for Cell-free protein synthesis (Kim und Swartz, 2001). This system is based on the activation for an E. coli pathway involving pyruvate dehydrogenase (PDH) and phosphotranscetylase (PTA) (figure 1.2). In the presence of nicotinamide adenine dinucleotide (NAD) as a cofactor, PDH catalyses the condensation of coenzyme A (CoA) and pyruvate to make acetyl-CoA. The acetyl-CoA is then converted to acetylphosphate by PTA. Since these two enzymes are present in the cell lysate, the simple addition of the cofactor (NAD and CoA) is sufficient to regenerate ATP from pyruvate. Besides, since PEP leads to the accumulation of pyruate, the simple addition of the cofactors to the conventional PEP-utilising cell-free synthesis system improves the efficiency of ATP supply substantially through the secondary ATP regeneration from pyruvate (Kim und Swartz, 2001). Also, the addition of sodium oxalate –which inhibits PEP synthase– helps to retard the non-productive degradation of PEP. Using this energy regeneration protocol, approximately 300mg.mL−1 of protein can be generated in a single batch reaction.The PANOx technology was licensed to Roche Diagnostics and provides the basis for their high yielding cell-free protein synthesis kits (Swartz, 2006).

13 Figure 1.2: ATP regeneration pathways for cell-free protein synthesis. Commonly used reaction sequences (Cre-P (Creatinephosphate); PANOxSP (PEP, Amino acids, NAD+, Oxalic acid, Spermidine and Putrescine) are indicated (Whittaker, 2013).

Cytomim system

The Cytomim system was developed taking into account that cytoplasmic mimicry would encourage more natural metabolism (Record u. a., 1998). The use of unnatural components such as HEPES buffer, polyethylene glycol (PEG), and acetate was banned. Spermidine and putrescine were added as an alternative to stabilise and regulate the function of DNA, RNA, tRNA, and several other components. In addition, acetate was aloso replaced by glutamate. However, the most important change in the system was the energy source.

The activation of oxidative phosphorylation was also explored in this system (figure 1.3). In the presence of thiamine pyrophosphate (TTP) and flavin adenine dinucleotide (FAD), acetyl phosphate is generated through the condensation of pyruvate and inorganic phosphate (Lian u. a., 2014). The acetyl phosphate is Tthen catalysed by endogenous acetyl kinase in the E. coli S30 lysate. Oxygen is required for the generation of acetyl phosphate and the H2O2 (produced as a by-product) was sufficiently degraded by endogenous catalytic activity (Kim und Kim, 2009). Nevertheless, this system requires inverted membrane vesicles to perform oxidative phosphorylation. The vesicles are produced by the high shear rate during cell lysis and remain in the cell extract after the clarification steps.

The Cytomim system provides a stable energy supply and maintains better homeostasis for protein expression without phosphate accumulation, pH change, or the need for expensive high-energy phosphate compounds. With this system, the protein synthesis was extended for up to 6 hours with thechloramphenicol acetyltransferase (CAT) expression ﬁvefold greater than the PANOx system(Jewett und Swartz, 2004a). Furthermore, it also promotes protein folding as it maintains a closer distance to

14 Figure 1.3: The active biochemical reactions in the Cytomim system. Glutamate is used as an energy source in this system to produce reducing equivalents (NADH) through the TCA cycle. NADH fuels oxidative phosphorylation in which oxygen serves as the ﬁnal electron acceptor, resulting in the supply of ATP. ATP mainly generated from oxidative phosphorylation promotes the transcription and translation processes.GLU-glutamate; SUC-succinate; MAL-malate; PYR-pyruvate; AC-acetate; OAA- oxaloacetate; ASP-aspartic acid; Pi-inorganic phosphate; IMVs- inverted inner membrane vesicles; ETC-electron transport chain; PMF-proton motive force (Lian u. a., 2014). the physiological environment (Yin und Swartz, 2004).

Dual energy system

Glucose (one of the least expensive and most desirable commercial substrate) is also used as an energy source for CFPS systems (Calhoun und Swartz, 2005b). The usage of glycolytic intermediaries was also studied after the studies that use pyruvate as an energy source that demonstrated that much of the endogenous enzymes related to energy metabolism remain active in the lysate, and pyruvate is a downstream product of glycolytic pathway. When the first intermediate (glucose 6-phosphate (G6P)) was tested, it was used in the same con- dition of the PANOx system. Under this conditions, G6P extended ATP supply and supported protein synthesis (Kim und Kim, 2009). This indicated that all the enzymes required in glycolys to convert G6P into pyruvate are active; meaning one can make use of different energy sources. During the conversion of glucose into pyruvate through the glycolytic pathway, one molecule of glucose can generate 2 molecules of ATP. In cell-free systems, pyruvate can also be used in energy production through oxidative phosphorylation pathway, however, ATP is also consumed in the glycolytic pathway. This consumption significantly impacts in ATP concentration in the reaction mixture in the initial phase of incubation. To overcome this problem, the dual energy system was developed (Kim u. a., 2007). In this system, a mixture of creatine phosphate and glucose are used as energy sources (figure 1.4). The inorganic phosphate from creatine phosphate was recycled to the drive glycolytic pathway (thereby generating additional ATP molecules and retarded the phosphate accumulation during cell-free protein synthesis). However, with this system, an appropriate pH buffer with greater buffering capacity has to be used to compete with the rapid decreased of pH caused by the accumulation of organic acids.

15 Figure 1.4: ATP regeneration in the dual-energy system combined creatine phosphate and glucose as the energy sources. GAP-glyceraldehyde-3-phosphate; GAPDH-glyceraldehyde-3-phosphate dehydrogenase; DPG-1,3-diphosphoglycerate; CP-creatine phosphate;CK-creatine kinase (Lian u. a., 2014).

With this system, protein synthesis was extended up to 3 hours, accompanied by an enhanced yield of protein synthesis. The amount of the synthesised protein was 2 to 3 times higher than that from the reactions using creatine phosphate or glucose as the sole energy source (Kim u. a., 2007).

Maltose and Maltodextrin

Maltodextrin and maltose are also being study for energy supply. These systems uses maltodextrin or maltose phosphorolysis, glycolysis, and PANOx pathways. Maltodextrin was first described as a way to improve ATP regeneration by recycling inorganic phosphate accumulated during cell-free expression (Wang und Zhang, 2009). In the presence of inorganic phosphate, maltodextrin is slowly cleaved into glucose-1-phosphate (G-1-P) catalysed by maltodextrin phosphorylase. G-1-P is further converted into G-6-P by exogenous phosphoglucomutase. Three moles of ATP can be generated from one mole of G-6-P through the glycolytic pathway. Finally, one mole of ATP is generated from two moles of pyruvate through the PANOx pathway. As a result, four molecules of ATP produced from one glucose equivalent of maltodextrin without releasing phosphate in the system. Since no phosphate is generated by this energy source, one avoids inorganic phosphate accumulation to an inhibitory level. Compared with glucose, the generation of G-1-P from maltodextrin does not consume ATP, therefore one molecule of ATP is saved from glucose phosphorylation. Due to the generation of more ATP per substrate consumed, less organic acids are generated; the pH profile is also more stable. This system requires the addition of maltodextrin phosphorylase maltodextrin and phosphoglucomutase to the lysate. In the last year, maltose was also used as an energy source with great success (Caschera und Noireaux, 2014). In their study, Caschera and Noireaux were able to produce 2.3mg × mL−1 of protein . They showed that to produce the same amount of protein, a lower concentration of maltose was needed (around 12 to 15 mM) when compared with maltodextrin (round 30 to 35 mM). Also, the addition of the purified enzymes(maltodextrin phosphorylase and phosphoglucomutase) to the lysate did not improve the production: meaning that they must be present in the lysate. Finally, by coupling maltose or maltodextrin with 3-phosphoglycerate (3-PGA), the system was able to produce a higher protein yield

16 than previously described system using dual energy sources. For the ﬁrst time, more than 2mg × mL−1 of protein was synthesised in vitro using a commercial E. coli strain (Caschera und Noireaux, 2014).

1.1.5 Conﬁgurations of Cell-free systems

Cell-free protein synthesis can be carried in different configurations. The first –and most widely used– is the batch-mode CFPS system (figure 1.5a). This simple configuration has several advantages: higher efficiency when using expensive reagents, easy to scale-up, amenable to high-throughput processes, and convenience of operation. This format is still one of the most common approaches for protein synthesis (Kim und Kim, 2009). It is a convenient process for quick protein production with the production reaching from several micrograms to 1 milligram of protein per 1 mL reaction mixture (Jewett und Swartz, 2004b). Batch reactions are ideal for high-throughput expression screens in small scales with reaction volumes as low as a few microliters. Also, the reaction can be carried out in a microplate format and the whole process could be automated with the implementation of modified pipetting roboters (Schwarz u. a., 2008). This configuration has been applied to screen protein constructs suitable not only for the structural analysis but also to the functional analysis of proteins in a genome scale (Kigawa u. a., 2008). Nevertheless, there are disadvantages when using this system. Usually the reaction time is limited to rapid shortage of precursors and accumulation of inhibitory by-products. As a consequence, the protein yield is relatively low. In order to overcome this, two approaches can be used: a more efficient energy supply (as described above), or the development of novel formats for CFPS systems that take the principle of continuous supply of substrates into account and simultaneously the continuous removal of the small molecule by-products (which causes inhibitory effect) (Lian u. a., 2014).

Continuous-Flow Cell-Free Protein Synthesis System

The continuous system is a major technological breakthrough in cell-free system. The continuous flow system (CFCFS) was the first being developed (Spirin u. a., 1988). This first prototype was a modified Amicon 8MC micro-ultrafiltration system. It consisted in a reservoir to keep the feeding solution (containing ATP, GTP and amino acids), a reaction chamber containing all translation components, an ultrafitration membrane, a peristaltic pump, and a fraction collector. The feeding solution is pumped into the reaction chamber through the upper lid at constant flow rate and the reaction products are removed through the membrane at the bottom and collected by the fraction collector. Despite the size of the membrane, the small proteins involved in the reaction don’t leak. This may happen because the components form multi-protein units. With this system, the duration of the reaction is extended to 20 to 40 hours. In order to improve reproducibility the Amicon unit is replaced with a chamber with the capacity equal to the reaction volume, the feeding mixture is pumped from the bottom and the ultrafiltration membrane is placed on the top (figure 1.5b) (Kigawa und Yokoyama, 1991). In addition, a reactor with two membranes, named Y-flow CFCFS, was developed (Spirin, 2004). The two membranes have different pore sizes: a small pore membrane (where low molecular weight by-products are removed) and a large pore membrane (where the protein synthesised is collected) The advantage of this reactor is that

17 Figure 1.5: The formats of CFPS system. a) Conventional batch-formatted CFPS system. b) CFCF protein synthesis system.c) CECF protein synthesis system. d) Hollow fiber reactor. e) Bilayer CFPS system. f) Thin film format.Reaction mixture includes cell extract, template (DNA or RNA), and RNA polymerase (when necessary). Feeding solution includes amino acids, energy components, NTPs or NMPs, cofactors,etc (Lian u. a., 2014). it allows the increase of the feeding solution supply and simultaneously avoids the excessive dilution of protein product in the collection fractions. The protein yields obtained with the CFCF system were dependent on the prolongation of the reaction lifetime. However, the rate of protein synthesis did not increase and the final amount of produced protein was not significantly larger than the one obtained from an optimised batch system. Moreover, the complexity and high cost of this system makes it impractical (Lian u. a., 2014).

Continuous-Exchange Cell-Free Protein Synthesis System

The continuous-exchange cell-free protein synthesis system (CECFS) was designed to simplify the operation complexity of the CFCF system (ﬁgure 1.5c). The idea is to separate the reaction into two compartments: one holds the reaction mixture (RM) with the high molecular weight compounds (such as the lysate, enzymes a nucleic acids); the second holds the feeding mixture (FM) composed of low molecular weight compounds (such as NTPS, energy source and amino acids). The reaction mixture

18 is separated from feeding solution by the dialysis membrane (Kim und Choi, 1996). The diffusion between reaction mixture and feeding solution through the dialysis membrane allows continuous supply of low molecular weight substrates for the reaction, and low molecular weight by-products were continuously removed from the reaction chamber. Sufﬁcient exchange between the compartments is insured by vigorous stirring or shaking during incubation This strategy is very effective at extending the duration of active translation. By preventing the leak- age of protein synthesis machinery, the initial rate of protein synthesis could be maintained for at least for 14 hours and 1.2mg × mL−1 CAT protein was produced (Lian u. a., 2014). By using a condensed E. coli S30 extract, the yield of CAT was raised to 6mg × mL−1 in the coupled transcription/translation system (Kigawa u. a., 1999). This system was also successfully used to measure NMR spectra (Kigawa u. a., 2008).

Hollow Fiber Reactor

In this CFPS system (figure 1.5d), the reaction mixture is placed inside or outside of the hollow fiber with the feeding mixture placed on the opposite side (Yamamoto u. a., 1999). Because of the large ratio of membrane/surface (compared to the reactor volume), sufficient exchange is achieved with a hollow fiber reactor. In addition, in-place condensation of reaction mixture can be achieved, which increases the protein production rate. One major advantage over other CECF systems is that this system can be scaled-up easily for industrial production.

Bilayer System

Although the continuous CFCF and CECF systems are capable of producing larger amounts of proteins than batch systems, the complexity of the membrane makes them unsuitable for high-throughput strategies. Thus, there is a need to develop a reaction system which is mechanically simpler and more cost-effective than membrane systems and that can synthesise greater amounts of protein than the batch reaction. One system that overcomes this limitation is the bilayer system (ﬁgure 1.5e) system (Sawasaki u. a., 2002a). In this systems, the feeding mixture is overlaid onto reaction mixture, without a mixing process. This allow a continuous supply of substrates as well as the continuous removal of small by- products through the interphase between the two mixtures by diffusion. This system can be performed in well plates 10µL and stay functional for a longer time (Rosenblum u. a., 2012). It produces than ten times more than the similar batch reaction. The synthesised protein quantities in this system are high enough for functional analysis of gene products, which makes bilayer systems a suitable option for high-throughput processes in the post-genome era (Lian u. a., 2014).

New Formats of Batch Mode Reaction

Although hollow ﬁber can be easily scaled-up, it cannot use reagent effectively (since it is based in continuous exchange system). It does not allow energy systems that require gas exchange, such as

19 the Cytomim system. The batch mode reaction has several advantages: it is relatively simple, it uses reagents efficiently, and the gas exchange can be easily realised by a specific designed reactor. Despite these advantages, the protein yield of protein per ml reaction may be limited due to reactants depletion, and accumulation of inhibitory by-products. To overcame this problems, a scale-up model for cell-free protein synthesis system was developed, the thin film method (figure 1.5f) (Voloshin und Swartz, 2005). In this method, the batch reaction is placed on a thin film. This provides a large gas/liquid interface allowing a continuous oxygen transfer, as well as a large hydrophobic surface. This facilitates protein expression and folding by binding inhibitory hydrophobic molecules such as misfolded polypeptide chains, lipids, and various small molecules (Rosenblum und Cooperman, 2014). With this method, high concentration of active protein is achieved in a format that can be scaled up without the loss of yield. The thin film reaction format may be applicable to synthesise many target proteins under various cell-free systems and reaction scales (Lian u. a., 2014). A stirred tank reactor format was also developed as a scaled up method for CFP synthesis (Swartz, 2006). With the appropriate stirring rate, abundant gas supply, suitable temperature, real-time control of pH, and sufficient substrates, protein synthesis rate can be maintained at a high level. Due to its high controllability, the stirred tank reactor may be the most probably applicable reactor for industrial CFPS use (Lian u. a., 2014).

1.1.6 Folding and post-translational modiﬁcations

The synthesis of complex and active proteins has always been a main goal for cell-free protein systems. CFPS systems have the advantage of allowing the adjustment of the environmental conditions. This provides a high degree of control over post-translational processing events. To improve protein folding and post-translational processing many strategies have been developed: adding a variety of reagents to stabilise the proteins, the addition of folding catalysts, or even the re-feeding of critical components. In example, additives such as PEG can be supplemented to induce a molecular crowding effect. Besides, DTT can also be added to the reaction to maintain T7 RNAP in its reduced and active form. Nevertheless, even when the protein produced with a cell-free system is insoluble, it tend to be more readily solubilised and re-folded than protein recovered from inclusion bodies in cell-based systems (Swartz, 2012).

Membrane proteins

Production of integral membrane proteins in living cells can be difﬁcult as a result of toxic side-effects relating to membrane disruption. Due to their hydrophobicity, protein aggregation, misfolding and low yield, membrane proteins may be toxic to the cell. Also, when expressing ion channel proteins, they can disrupt the integrity of the cell membrane and lead to cell lysis. In vitro systems allow the direct insertion of an integral membrane protein product into lipid structures (Schneider u. a., 2010). These systems overcome all the problems present in the production of mem-

20 brane proteins in in vivo systems. Cell-free synthesis of membrane proteins has been accomplished using a variety of lipid structures: liposomes, micelles, bicelles and nanodiscs (Lyukmanova u. a., 2012). The presence of lipid structures mitigates aggregation and insolubility issues and there is no interfere with the translation activity. As an example, bacteriorhodopsin was synthesised in a cell-free system and co-translationally inserted into giant liposomes, where its photochemical proton pumping function was demonstrated (Kalmbach u. a., 2007).

Chaperones

The exogenous supply of chaperones to cell-free protein synthesis systems has also been reported (Jiang u. a., 2002). It suggest that the effect of these catalysts have in the system is protein-dependant. For example, The addition of puriﬁed DnaK, DnaJ, GroEL and GroES has been reported to be beneﬁcial for the synthesis of single chain and fragment antigen binding (Fab) antibodies. Besides the addition of natural foldases, synthetic approaches have also been developed. In order to mimic chaperone-assisted folding in the endoplasmic reticulum, eukaryotic Hsp70 chaperone BiP was tied to a trigger factor, which is a ribosome-associating E. coli chaperone. The result was an improvement in soluble protein yields for secreted eukaryotic proteins (Welsh u. a., 2011).

Disulﬁde bond formation

The formation of disulfide bonds is another important post-translational processing step that can be prob- lematic in prokaryotic expression systems. A cell-free system that can fold complex protein must secure the hydrophobic regions of the target protein from one another, provide the proper natural chemical environment, incorporate cofactors (such as iron–sulfur clusters), encourage disulfide bond formation, and promote disulfide bond (Carlson u. a., 2012). One of the main difficulty for CFPS systems is in reproduc- ing in vivo oxidative folding pathways to allow for formation and isomerisation of disulfide bonds. Unlike cell-based systems (which have different regions to separate protein biosynthesis from oxidative folding) cell-free systems have to accomplish both tasks using the same compartment. Despite these problems, considerable progress has been made towards enhancing the folding of eukaryotic proteins with multiple disulfide bonds. In CFPS systems, it is possible to achieve an oxidising environment balancing the redox potential reaction. For example, one can pre-treat the cell extract with iodoacetamide (IAM) (which is an alkylating agent that covalently blocks the free sulfhydryl groups of cellular enzymes). One can do this using a glutathione buffer to provide an oxidising environment, and providing the disulfide bond forming enzyme DsbC. The synthesis of active urokinase and a truncated form of tissue plasminogen activatator was achieved in (Kim und Swartz, 2004; Yin und Swartz, 2004). In E. coli disulfide bond formation systems, there are a variety of enzymes to form these bonds and help nascent polypeptides attain their active conformation without aggregation. Simple addition of these molecules has been important for the production of complex proteins in vitro (Katzen u. a., 2005). In the recent years, improved proper bond formation and protein folding was achieved by incorporating amphiphilic polysaccharide nanogels into the cell-free reaction (Sasaki u. a., 2011). This allows the

21 binding and then controlled release of peptide chains, preventing aggregation and misfolding for some proteins.

Glycosylation

Another post-translation modification is the glycosylation. It is the most widespread and complex form of post-translational modification in eukaryotes. One major challenge for production of glycoproteins is that these are produced as a mixture of glycoforms (Walter und Blobel, 1983). Proteins are translocated to the lumen of the vesicles where their leader peptide is cleaved and they acquire the oligosaccharide chain. In cell-free systems, this transportation is disrupted, therefore, further processing of the oligosac- charides is prevented. However, some variation in the glycosylation pattern can still be observed in CFPS systems due to non homogeneous folding that restricts the access of the glycosylating enzymes (Bulleid u. a., 1992). A cell-based lysate produced from Spodoptera frugiperda 21 was reported to provide core protein glycosylation enzymes without the need for supplementing the reaction with membrane vesicles (Tarui u. a., 2001). Other post-translational modifications, such as phosphorylation, myristylation, farnsylation, isoprenylation and adenylation have been observed in lysates from higher eukaryotes (Jackson u. a., 2004). Be- cause of all these modifications and the dynamic nature of post-translational modifications, it is very difficult to produce homogeneous protein samples in both in vivo and in vitro systems (Katzen u. a., 2005). Methods for creating artificial post-translational modification that mimic the structure of the natural ones, have been proposed as a solution for this problem (Davis, 2004). Cell-free systems may be the ideal platforms for this novel strategy.

1.1.7 History and applications

The first known example of a cell-free system is the Nobel Prize work by Eduard Buchner in 1897. Ed- uard Buchner was helping his brother, a physician, by looking for a way to preserve extracts from yeast cells. Thinking about jams and jellies, he tried adding sugar. To his surprise the mixture began bubbling as glycolysis converted the sugar to alcohol with the release of CO2. This was the first realisation that biological reactions could occur outside of a living cell, contradicting Louis Pasteur’s beliefs. Never- theless, it was only in the beginning of 1950s that the first demonstrations of cell-free protein systems appeared in different research labs, with the observation of the incorporation of radioactively labelled amino acids into proteins using crude cell extracts (Borsook, 1950; Winnick u. a., 1950). Disrupted cells or their isolated fractions were reported to be capable of synthesising proteins. A revolutionary step in the development of cell-free translation system was the introduction of exogenous messages. This was achieved in 1961 by Nirenberg and Matthaei with a bacterial system. They reported the use of CFPS to decipher the genetic code, earning the 1968 Nobel Prize in Physiology or Medicine (Nirenberg, 2004). Nirenberg and Matthaei also proved the dependence of bacterial cell-free system on the presence of DNA. Some years later, coupled transcription-translation systems were developed by using exogenous bacteriophage DNAs, but they were poorly active. This type of systems

22 became popular after major improvements made by Zubay research group. The Zubay group developed a system with a simple preparation, stable extracts and highly active. In 1973, he and his coworkers reported the cell-free synthesis of rat growth hormone (Bancroft u. a., 1973). In 1988, a substantial ad- vance was made when Alexander Spirin reported the use of ultrafiltration membranes to stabilise the small molecule environment by continually providing substrates and removing inhibitors. Protein synthesis catalysed by either E.coli or wheat germ extracts continued at constant rates for more than 40 hours and accumulated 100-fold more product than a batch reaction (Spirin u. a., 1988). This approach, referred as continuous-exchange cell-free system, was commercialised but it had a major problem: a large volume of the feeding solution made the technique relatively expensive. Many years went by without huge modifications to the process developed by Zubay. In the recent years, the Swartz laboratory made several advances. They focused on the commercial scale protein production, and started to analyse the process cost and feasibility. They concluded that the energy source and the nucleotide costs dominated and were unacceptable. Simple scale-up methods were required and protein folding was inadequate (particularly for proteins requiring diffusible bonds). To tackle the energy source cost, the PANOx (amino acids, NADPH, oxalic acid) system was first developed, but it was still expensive. In 2008, Michael Jewett developed the Cytomim (cytoplasmic mimic) (Kim und Swartz, 2004) , and Kim’s research group developed a system that used soluble starch or glycogen as energy substrates (Kim u. a., 2011). They produced the highest known protein yield. For the eukaryotic expression systems, Yaeta Endo’s group discovered that early wheat germ extracts contained a protein synthesis inhibitor (Madin u. a., 2000). This could be removed by extensive washing to dramatically increase protein expression yields. The resulting system has now been ex- tensively developed for the production of multiple proteins in parallel (Goshima u. a., 2008). Shimizu’s group extended the concept further by demonstrating protein synthesis using only purified components (Shimizu und Ueda, 2010). (This was named the PURE system.) In 2010, the first effective production of granulocyte macrophage colony stimulating factor (GMCSF) at the 100-L scale was reported by Sutro (Winnick u. a., 1950). Sutro is now establishing the first cell- free GMP capability for pharmaceutical protein production. Recently, founded biotechnology company (GreenLight Biosciences) uses an unconstrained metabolism technology platform based on a cell-free protein system to deliver an attractive solution for the production of chemicals and fuels from renewable resources. Figure 1.6 PRESENTS a time line of cell-free protein synthesis milestones in the production of complex proteins.

1.1.8 Applications

For decades, cell-free systems have been used as a tool in fundamental and applied research. However, it was not until recently that cell-free systems have been considered commercial feasible for therapeutics, metabolites or non-natural products (Zawada u. a., 2011). As mentioned before, those systems are capable of unconstrained metabolism, providing advantages for optimising pathway ﬂux, bypassing substrate limitations through metabolic channelling, and directing resources towards a single objective

23 Figure 1.6: Timeline for CFPS milestones in the production of complex proteins. Abbreviations: scFv: single-chain antibody variable fragment, vtPA: variant of human tissue-type plasminogen activator, GM- CSF: granulocyte macrophage colony stimulating factor, IGF-I: insulin-like growth factor I, cIFN-α: human consensus interferon-alpha, rhGM-CSF: human granulocyte macrophage colony-stimulating factor (Carlson u. a., 2012).

(Hodgman und Jewett, 2012). Although cell-free systems are not yet well establish for industrial applications, the technology has tremendous potential to transform many aspects of biotechnology. This potential has already been demonstrated in many ﬁelds in the last decades.

Incorporation of Unnatural Amino Acids

One of the most signiﬁcant development in protein synthesis is the expansion of the genetic code. This approach uses bioorthogonal cognate pair of tRNA and aminoacyl tRNA synthetase to suppress nonsense or frameshift mutations, incorporating unnatural amino acids into the growing polypeptide and thereby creating a chemical toolbox for protein engineering (Whittaker, 2013). Using this technique, more than 70 distinct unnatural amino acids have been incorporated into proteins (Shrestha u. a., 2014).

Although the majority of this work has been done in vivo, cell-free systems offer some important advantages. Unlike cell-based systems, CFPS systems are not susceptible to the toxic side-effect on non-natural amino acids. Furthermore, these systems can be customised with unusual side chain structures by modifying the components of the translation machinery. The application of the technique to cell-free systems is done by adding the bioorthogonal components.

The incorporation of unnatural amino acids with cell-free systems was successfully demonstrated by the production of p-propargyloxyphenylalanine-containing proteins that can be crosslinked to form bioconjugates via click chemistry (Bundy und Swartz, 2010). Milligram amount of ras protein were also produced with this system, incorporating selenomethionine (Kigawa u. a., 2002). In addition, new orthogonal aminoacyl-tRNA synthetase/tRNA pairs have been used for site-speciﬁc incorporation of unnatural amino acids, and approximately 70 unnatural amino acids have been incorporated with high speciﬁcity (Shrestha u. a., 2014).

24 Isotopic labeling

Labeling recombinant proteins with stable isotopes or radionucleides is important for a variety of applications including biological NMR and tracer experiments. When comparing cell-based with CFPS systems for the production of labelled proteins, the latter have several advantages: less amino acid metabolic scrambling, high protein yields, and selective labelling of almost any type of amino acids. The purity of expressed products in cell-free systems can also allow for direct heteronuclear NMR analysis without puriﬁcation (Takai u. a., 2008). Already, several thousands of protein structures have been discovered using cell-free systems (Endo und Sawasaki, 2004). For example, these systems were used to produce 15N and 2H,13 C,15N-labeled calmodulin (CaM) samples for NMR studies (Torizawa u. a., 2004). The S30 lysate preparation protocol was modiﬁed to decrease the content of endogenous amino acids. In addition, high yields of N-Glu- labeled protein were obtained with the replacement of potassium L-glutamate with potassium Nacetyl- L-glutamate and potassium glutarate (Jia u. a., 2009).

Virus-like particles

Virus-like particles (VLPs) are self-assembled complexes created from one or more structural proteins. They are similar to virues, as they evoke an immunogenic response; because they do not contain genetic material, they can be potentially used as safe vaccines (Jennings und Bachmann, 2008). Furthermore, their self-assembled and hollow structure makes them interesting for drug delivery and gene therapy agents. The production of VLPs with cell-based systems is difficult due to the structural inconsistencies involved in the scale-up, protein impurities from in vivo production, and the high costs associated with recombinant strain development (Rothengass, 2007). E. coli based CFPS platforms improved the efficiency of VLPs production. For example, the MS2 coat protein was efficiently synthesised in batch CFPS reactions (Bundy u. a., 2008). An E. coli CFPS system was also used to incorporate click-chemistry functional unnatural amino acids into VLPs at a yield of 300µgmL−1 (Patel und Swartz, 2011). This showed that multiple ligands can be added to these VLPs at once (with the surface composition depending on the ligand ratios introduced). These advances demonstrate the merits of CFPS systems as a potentially powerful VLP production platform for drug delivery and vaccines applications (Carlson u. a., 2012).

High-throughput production and screening

High-throughput protein expression platform are becoming increasingly important. Cell-free systems serve as the basis of high throughput and automated platforms for protein production (Spirin, 2004). Cell-free systems have many advantages: the direct use of PCR templates, high-yield batch reactions in well plates, potential for miniaturisation and automation using microchips, easy manipulation of reaction conditions and incorporation of isotope-labeled amino acids (Carlson u. a., 2012). Cell-free systems are ideal for proteomics studies and protein engineering for identifying the desired proteins from libraries of high-sequence diversity. As these systems can express protein population

25 in a single reaction, they are ideal for the comprehensive screening and isolation of cloned proteins from libraries. In vitro expression cloning (IVEC) is a technology where a large collection of clones is ﬁrst divided into pools of 50–100 cloned plasmids in multiple wells for expression in a cell-free system followed by activity analysis (Jackson u. a., 2004). Pools with a positive active clones were further subdivided until single clones were obtained. This way, cell-free protein synthesis has been used to screen and isolate engineered proteins from a diversiﬁed mutant library fully in vitro. This system was used to screen whole genome libraries to discover new genes from Arabidopsis talia (Sawasaki u. a., 2002b). Another application is to use cell-free systems to screen for optimal conditions and DNA constructs before large scale protein production in vivo. Studies suggested that the optimised expression conditions obtained in this system are applicable to in vivo production (Lamla u. a., 2006).

In Vitro Display Technology

In vitro display technologies (which include ribosome display, mRNA display, and DNA display) are powerful tools for the selection of proteins and peptides from large libraries. When compared with cell-based systems, these technologies are faster and have a lower cost. They are based on the concept of the linkage of phenotype to a genotype in CFPS systems. For example, in ribosome display, the individual nascent proteins are coupled to their corresponding mRNAs, creating stable protein–ribosome–mRNA complexes. In DNA display, the protein-DNA fusions are formed through the linkage of streptavidin- fused polypeptides and their encoding biotinylated DNAs are formed in emulsion compartments. Other hypothesis is the use of the cis-nicking activity of the replication initiator protein from E. coli bacteriophage (Rothe u. a., 2006). In mRNA display technology, proteins are linked to encoding mRNA after dissociation from the translating ribosome (Roberts und Szostak, 1997). In this technology, hybrid RNA–DNA molecules are first generated chemically in vitro and used as a template. When the ribosome reaches the RNA-DNA junc- tions forms a covalent linkage with the growing nascent polypeptide. Purified protein–mRNA fusion molecules are then used as the selection entities (He, 2008). This technique has been used to select both natural and synthetic libraries. For example, it has been used to obtain antigen-binding proteins based on the scaffold fibronectin type III, producing high affinity molecules that bound TNF-α (Xu u. a., 2002). mRNA display selected “adnectins” against VEGF receptor R2 is currently in clinical trials (He, 2008). In ribosome display, the expression of constructs in which the stop codon has been deleted produces protein–ribosome–mRNA complexes as selection particles in which the nascent polypeptide is linked to its encoding mRNA. This linkage allows the isolation of the protein together with its encoding mRNA and that can be used in a recursive cycle of functional selection and mutagenesis to drive molecular evolution of proteins with improved activity. Both eukaryotic and prokaryotic in vitro ribosome display systems (with different modifications and distinctive DNA recovery procedures) have been studied (He und Khan, 2005). However, PURE systems are especially well suited for this application, because they allow release factors to be omitted and can accommodate incorporation of unnatural amino acids (Watts

26 und Forster, 2012). Ribosome display has been widely used in for in vitro antibody selection, evolution and humanisa- tion (He und Khan, 2005). Antibody fragments with high affinity, recognising conformational epitopes or having catalytic activities have been selected or evolved (Jackson u. a., 2004). Novel peptides, tag sequences, ligand-binding domains/motifs, transcription factors, proteases, receptors and enzymes have also been successfully selected. Protease-resistant domains have also been engineered and isolated for use as alternative scaffolds or antibody mimics (Binz u. a., 2004). Recently, an intracellular ribosome display method was developed using E. coli Sec M translation arrest mechanism to generate complexes inside living cells (Contreras-Mart´ınez und DeLisa, 2007). In proteomic applications, ribosome display allowed a comprehensive identification of antigenic proteins for use as potential vaccine candidates from an entire genomic cDNA library of Staphylococcus aureus (Contreras-Mart´ınez und DeLisa, 2007). In addition, a sequence of 5’-untranslated region (5’ UTR) –promoting translation efficiency– has been identified through ribosome display of diversified sequences (Mie u. a., 2008).

Cell-free protein array technologies

Protein microarray technology is a powerful tool for high-throughput, parallel analysis of proteins in a time and cost-effective manner. It is composed by hundreds or thousands of proteins that are immobilised on a solid surface in a miniaturised format. This technology has been applied to proteomic studies, such as protein-protein interactions, protein expression profile, biomarker discovery and monitoring post- translational modifications (Lian u. a., 2014). Traditional cell-based microarrays are a time-consuming and cost-intensive technology, which requires the expression and purification of the individual proteins to be arrayed. In addition, there are limitations in maintaining proteins in their functional state on surfaces for long-term storage. Cell-free systems offer an alternative to cell-based systems as they allow direct high-throughput protein synthesis and screening. These proteins arrays are produced by in situ methods: proteins are synthesised directly onto the surface from arrayed DNAs or mRNAs (He u. a., 2008b). This way, there is no need to separate protein expression, purification, and spotting; there are also no limitations with the maintenance of the stability during storage. Cell-free based in situ protein microaarays can be produced in a variety of methods and take advantage of the programmability of protein synthesis by transcripts formed from either linear DNA or a plasmid vector. There are several formats for protein microarrays including protein in situ array (PISA), nucleic acid programmable protein array (NAPPA), DNA array to protein array (DAPA), and in situ puromycin capture from a mRNA array (Lian u. a., 2014). Protein in situ arrays (PISA) is performed on a surface precoated with a protein-capturing reagent where the newly synthesised protein is captured and immobilised in situ (He und Taussig, 2001). In nucleic acid programmable protein array (NAPPA), DNA and an antibody are spotted onto a glass side and then covered with the cell-free system. This way, the expressed protein is trapped by the antibody in each spot (Ramachandran u. a., 2004). NAPPA has been applied to produce high-density protein arrays

27 to identify immune response signatures of breast cancer autoantibodies in patient sera (Anderson u. a., 2008). DNA array to protein array (DAPA) differs from the other methods because it allows the reuse of the DNA array. It generates pure protein arrays on a separate surface (He u. a., 2008a). DAPA has been used to array antibody fragments, GFP, GTP-binding protein and, transcription factors.

Therapeutics

The advances made in terms of costs, scale, and protein folding in the cell-free systems made them commercial desirable which led to the use of this technology in therapeutics being intensified (Zawada u. a., 2011). One potential use for this technology is the production of personalised medicines. Cell-free system have some important advantages for the production of patient specific medicines. The system is fast, flexible, has high-yield expression, and a simple downstream processing method. A cytokine-fused single chain antibody fragment (scFv) of immunoglobulin (Ig) idiotype (found on the surface of specific B-cell lymphoma) was produced using a E. coli CFPS system (Kanter u. a., 2007). The scFv fusion was able to elicited an immune response against the native Ig protein. This vaccine was produced in a matter of days, instead of moths as the traditional mammalian cell expression. Besides patient specific medidices, CFPS systems have been used to identify new drug candidates for existing and emerging threats in different diseases such as cancer, hepatitis, and malaria. The Protein Truncated Test (PTT) was developed to identify open reading frames (ORFs) for diagnostics of genetic diseases caused by translation-terminating mutations (Roest u. a., 1993). Screening of vaccine candidates by cell-free systems led to the identification of effective vaccines that protected mice against tumour (Kanter u. a., 2007). As another example, WGE systems were used to express 124 genes from the malaria genome as possible vaccine candidates (Tsuboi u. a., 2008). CFPS was also used to synthesise vaccine candidates for botulinum toxinsat in concentrations 1mg ×mL−1 greater (Zichel u. a., 2010).

1.1.9 Synthetic biology frontiers

Cell-free synthetic biology is emerging as a powerful technology, capable of complementing the work in cellular in vivo systems. This is due to the extraordinary level of control and surprising diversity of approaches available for building biosynthetic systems without the constraints that limit cellular engineering. For decades, most cell-free systems have focused on obtaining and activating biocatalysts that make a desired product. Less attention has been given to establishing a fundamental molecular ”toolkit” for engineering. However, cell-free systems offer a ﬂexible platform to use orthogonal chemistries in order to synthesise non-natural products towards the goal of expanding the chemistry of life (Hodgman und Jewett, 2012). Therefore, in the last years cell-free systems are being used to construct genetic circuits, protein cascades, compartmentalisation, spatial organisation, and minimal cells. With the help of cell free systems, synthetic biology continues to push the boundary of what does exist to what can exist. One of the main ﬁelds in synthetic biology is the construction of genetic circuits. This relies on the

28 ability to use DNA as a language to write synthetic genetic programs comprised of ”parts” that rewire and reprogram organisms. Cell-free system are being used to attempt to program circuits and logic gates. Genetic circuits contain well-characterised promoters and regulatory sites with factors to implement logic operators using circuit-like connectivity. A CECF system was used to synthesise ortgonal RNA polymerases in series when controlled by the previous polymerase promoter region, and eventually expressing a protein of interest (Noireaux u. a., 2003). This example is similar to a linear electrical ampliﬁer, but without instantaneous signals. In vitro transcriptional oscillators were also developed (Kim und Winfree, 2011).

The reintroduction of synthetic compartments to a cell-free system offers a versatile approach for confining enzyme systems to a specific geometry, linking functional phenotypes to the genes that encode for them, or adding new function. There are two main approaches to encapsulate cell-free systems: in phospholipid membranes and capturing enzymes and in water droplets suspended in an oil emulsion, termed in vitro compartmentalisation (IVC). IVC is used for directed evolution of enzyme activity. For example, it was used to increase the activity of bacterial phosphotriesterase, creating one of the fastest hydrolases ever recorded (Griffiths und Tawfik, 2003). Besides encapsluation, functionality can also be added by introducing synthetic biocompatible compartments, such as DNA hydrogels or lipid disks for membrane bound protein expression (Hodgman und Jewett, 2012).

One of most important difference between in vitro and in vivo systems is the enzyme concentration. Since biochemical reaction networks involve multiple reactions, increasing the concentrations (and hence proximity of enzymes and other mediating factors necessary for synthetic networks to function optimally) may increase productivity. In order to overcome this, synthetic biologists have already developed a number of methods for immobilising or tethering enzyme pathways in a speciﬁed geometric arrangement. One example is surface tethering in microships: by changing the composition of DNA on the chip, pathways can be built, optimised, and reconstructed (Zhang u. a., 2005). Protein scaffolding is another technology that can be used. The key idea is to localise the enzymes of a pathway using protein–protein interactions so that they function as a metabolic channel (rather than as individually dispersed enzymes). A more simple and non-speciﬁc method is to produce covalently linked enzyme aggregate (CLEA) particles (van Rantwijk und Sheldon, 2007). This method was successfully used to produce nucleotide analogs that are otherwise toxic to cells (Scism und Bachmann, 2010). Finally, chemical or natural detergents and surfactants such as Tween-20 and Ranaspumin-2 can be used as a foam to spatially disperse enzymes and (Hodgman und Jewett, 2012).

In order to improve the understanding of life, its origins and enable production of natural and unnatural chemical entities, synthetic minimal cells are being designed (Jewett und Forster, 2010). There are two methods to approach minimal cells: top-down approach (where efforts to reduce the complexity in vivo by minimise cellular genomes), and a bottom up approach (where the synthesis of DNA, RNA, protein and membrane in done in vitro). The intention is to build a minimal biological system that is self-replicating, or autopoietic, from individual biomolecular parts that function together (Murtas, 2009). In one example, a PURE system was used to produce active membrane-bound proteins that converts n- glycerol-3-phosphate to phosphatidic acid, a key precursor to membrane synthesis. This demonstrates

29 a necessary step towards a self-sustaining system that can grow and maintain a bilayer membrane (Kuruma u. a., 2009).

30 Chapter 2

Objectives

Cell-free protein synthesis has emerged as an important and effective alternative to both cell-based expression systems and solid-phase protein synthesis. However, there still some challenges that must be exceeded: the ability to reliably synthesize any biologically active protein in an universal platform, the lack of a cost effective and scalable CFPS platform, and the inability to carry out humanized glycosylation patterns (Carlson u. a., 2012). The main objective of this work is to construct an E. coli cell-free system platform. Since a cell-free system is constituted by complex variables, we decided to divide the work in 4 major task: Template preparation and puriﬁcation, tRNA puriﬁcation, lysate preparation, and cell-free protein synthesis.

Template preparation and puriﬁcation

In the first task (plasmid preparation and purification) the main goal is to construct a DNA template suitable for this system. This template must contain all the key components and the simplicity necessary to be successfully used in these systems. In order to achieved a higher purification at a lower cost, alkalyne lysis and hydrophobic interaction chromatography (HIC) were tested for plasmid purification. tRNA purification

Total tRNA puriﬁcation methods are also being tested in this study. It is important to use exogenous tRNA in these systems because the addition of pure tRNA will increase protein production; this also allows a better control over the reaction.

Lysate preparation

Preparation of the S30 lysate is one of the most important steps for successfully constructing a cell-free system. In this step it is important to chose the adequate E. coli strain along with the mechanism of cell disruption. Here, the main objectives are to test BL21(DE3) strain and bead milling as lysis mechanism for the lysate production. Besides testing the produced lysates with the cell-free production, we are also quantifying the protein concentration and calculate cell-lysis efﬁciency.

31 Cell-free protein synthesis

Our last objective is to mount the cell-free system. First, t the DNA templates and the produced S30 lysates are going to be tested using a commercial kit. Next we are going build the cell-free system using a cytomimic system as the energy system. Finally, some of the cell-free system variables (magnesium concentrtion, plasmid concentration and lysate volume) are going to be further studied and optimised.

32 Chapter 3

Materials and Methods

3.1 Template preparation

Three plasmid template were chosen for this study: a pEXP5-NT/CALML3, a pETGFP and a pEXP5- NT/GFP (ﬁgure 3.1). The plasmid pEXP5-NT/CALML3 was obtain from Lifetecnologies. It contains a human calmodulin-like 3 gene (CALML3; GenBank accession number NM 005185) in frame with the N-terminal tag (His-tag), a bacteriophage T7 promoter, a ampicilin resistance gene for selection in E. coli, and a pUC origin. TOP10 (Invitrogen) competent cells were transformed with the protocol described bellow. The pETGFP plasmid was previous constructed in the laboratory. A GFP gene was isolated from pVAXIGFP and inserted in a pEt28a+ vector. The resulting plasmid contains a GFP gene, a bacterio- phate T7 promoter, a kanamycin resistance, a pBR322 origin, and a lacI coding sequence. The strain JM109 was transformed with this plasmid. The pEXP5-NT/GFP was produced in this study. The GFP gene was isolated from pVAXIGFP- BHGI and inserted in pEXP5-NT vector. The pEXP5-NT was obtain by excision of the CALML3 gene. The obtained plasmid has the same characteristics as pEXT-NT/CALML3. The BL21(DE3) (Invitrogen) competent cells were transformed with this plasmid.

(a) (b) (c)

Figure 3.1: Representations of the plasmids used in this study. 3.1a) pEP5-NT/CALM3 (3194 bp); 3.1b) pEXP5-NT/GFP (3685 bp); 3.1c) pETGFP (6088 bp).

33 3.1.1 pEXP5-NT/GFP construction

The E. coli strains (with the respective plasmid) were grown overnight in a 15 mL falcon tube with 5 mL of Luria-Bertani (LB) medium (Nzytech) in a rotary shaker at 37oC and 250 rotations per minute (rpm). The growth was supplemented with the respective antibiotic in a concentration of 100µg × mL−1 for the ampicilin (Sigma), and 50µg × mL−1 for kanamycin (Amresco). The cells were harvested by centrifugation in an Eppendorf centrifuge 5810R at 6000×g and 4oC for 5 minutes. The plasmid was puriﬁed with high pure plasmid puriﬁcation kit from Roche Life Sciences. The plasmid concentration was measured in NanovuePlus (GE Healthcare). The plasmids were stored at 4oC for further use. pEXT5-NT/CALM3 digestion

To obtain the vector for cloning, the pEXT5-NT/CALML3 plasmid was digested with restrictions enzymes. To Analyse the plasmid sequence and the restriction enzymes available, PvuIII (ThermoScientific) and SacII (Promega) were chosen. In order to optimise the digestion, a total four combinations with two diffident buffers and two different buffer volumes were tested. All of the tests were performed at 37oC in an incubator (Memmert) for 4 hours. The buffers used were the ones in which the respective enzyme had 100% activity: For PvuII, buffer G (ThermoScientific), and for SacII buffer C (Promega). The digestion was set in a 1.5 mL eppendorf tube with a final reaction volume of 20 µL. For the 1000 ng of plasmid added, 0.5 µL of each restriction enzyme was used. The volumes used in the digestion are represented in table 3.1. Finally, water was added to make up the 20 µL volume of the digestion.

Digestion 1 2 3 4 Plasmid(ng) 1000 1000 1000 1000 C 10X Buffer(µL) 2 4 - - G 10X Buffer (µL) - - 2 4 PvuII (µL) 0.5 0.5 0.5 0.5 SacII (µL) 0.5 0.5 0.5 0.5

Table 3.1: Digestion tests. Four different tests were performed. In all tests, 1000 ng of plasmid and 0.5 of each enzyme (PvuII and SacII) were used. In the tests 1 and 2, 2 and 4µL of 10X buffer were tested. The same volumes were tested for G 10X Buffer in 3 and 4. Water was also added to achieve the volume of 20 µL

After optimisation, a ﬁnal digestion with 3000 ng of plasmid in a ﬁnal volume of 50 µL. The conditions used were the same as previously. After cloning the plasmid was linearised with XmnI (Promega).

Insert preparation

A Polymerase chain reaction was used to amplify the GFP gene from the pVAXIGFP-BHGI plasmid. The primers (forward and reverse) were design with the help of APE software and manufactured by STAB vida. Upon arrival, the primers are diluted with PCR grade water to a concentration of 100 µM and stored at −20oC. The PCR was performed in 200 µL tubes. Before the reaction, both the primers and the plasmids were diluted to 10 µM and 11ng × µL−1 respectively. For this reaction, a KOD HotStart DNA polymerase

34 (Novagen) was used. The reaction components and the volumes are described in table 3.2

Components volume (µL) Buffer 5 Magnesium 4.5 Dntps 5 Primers 1.5 (each) DNA 1.5 KOD 1 Water 30.5 Final volume 50

Table 3.2: PCR components and volumes (in microliters) used in the reaction.

The PCR reaction was performed in a thermal cycler Biometer TGradient. The program was design taking into account that the desired DNA fragment has 857 base pairs (pb) and KOD enzyme has an extension time of 25 seconds per 1000 pb. The PCR program consisted on an enzyme activation cycle of 2 minutes at 95oC and 30 cycles with the following parameters: 95oC for 20 seconds, followed by 10 seconds at 70.3oC and a ﬁnal step of 30 seconds at 70oC. The PCR program is summarised in table 3.3. Number of Cycles Temperature (oC) Time (seconds) 1 95 120 30 95 20 70.3 10 70 30

Table 3.3: PCR program.

Puriﬁcation of PCR product and digested vector

Both the PCR product and the digested vector were purified from an agarose gel. After the electrophoresis, the bands corresponding to the PCR product and digested vector were excised from the gel and then purified by NZYGelpure kit (Nzytech). After purification, the concentration of both products was measured in nanodrop NanovuePlus (GE Healthcare) and stored at 4oC for further use.

Molecular Cloning

After obtaining a pure insert and vector, the next step was the construction of the pEXP5-NT/GFP plasmid. First of all, the volume of insert and vector was calculated taking into account that 100 ng of vector are needed and the ratio of Vector/Insert is 3. The amount of necessary insert was calculated as follows:

Vector concentration × Insert size × 3 (3.1) Vector size

Taking into account the concentrations measured in the nanodrop, and the amount needed, the volume of both vector and insert was obtained.

35 The cloning reaction was performed in 1.5 mL eppendorf tube, and the T4 DNA ligase kit (Thermo- Scientiﬁc) was used. The volumes of the components used for this reaction are represented in table 3.4

Components Volume (µL) Vector 3.8 Insert 2.2 T4 DNA ligase 0.25 T4 Buffer 2 Water 11,75 Total volume 20

Table 3.4: Molecular cloning reaction components and the respective volumes in µL

The reaction was performed in two different ways. First it was incubated at 22oC for 1 hour in a dried bath (AccuBlock Digital dry bat, Labnet International). Then, 10µL were used to transform BL1 (DE3) competent cells and the remaining was incubated overnight at 4oC. In the next day, the overnight reaction was also used to transform BL21 (DE3) competent cells.

3.2 Agarose gel electrophoresis

In order to access the plasmid quality, the digestions and the PCR product a agarose gel electrophoresis was performed. The gel was prepared with 1% of agarose (Nzytech) in 1×TAE buffer. The agarose was dissolved by heating the mixture in the microwave. When fully dissolved, the mixture was poured into a tray it was left to solidify. After solidiﬁcation the gel is transferred to an electrophoresis tray where it stays submersed with TAE buffer (0.04 M Tris–acetate (Eurobio), 1 mM EDTA (Panreac)). The samples were prepared by adding a 6× loading buffer (40% (w/v) sucrose (Sigma), 0.25%(w/v) bromophenol blue (Sigma)) to a concentration of 1× and then inserted into the wells on the gel. A NZYDNA Ladder III (Nzytech) was loaded into the gel. Electrophoresis was performed using TAE as ruining buffer at a voltage gradient of 5 V/cm . The gel was stained in a 0.4µg × mL−1 ethidium bromide (Sigma) bath for 15 minutes. Finally, the gel was visualised and photographed with Stratagene Eagle Eye II imaging system.

3.3 Cell transformation

3.3.1 Preparation of chemically competent cells

In order to transform E. coli chemically, competent cells must be prepared ﬁrst. Cells without plasmid were grown overnight at 37oC and 250 rpm in 15 mL falcon tubes with 5 mL of LB medium without antibiotic supplementation. In the morning, the optical density was measured at a wavelength of 600 nm

(OD600nm) on a Hitachi U-2001 UV/Vis Spectrometer. The cells used to inoculate new LB medium to an OD600 of 0.1. A 100 mL erlenmeyer with the 30mL of medium was incubated in an orbital shaker at

36 o o 37 C and 250 rpm until it reached an OD600 of 1. The cells were centrifuged at 6000 rpm and 4 C for 3 minutes. The pellet obtained was resuspended in 1/10 of original volume of TSS with ice-cold TSS buffer. This buffer is composed of 10% of PEG 8000 (Sigma), 1% DMSO (Sigma), and 20mM MgCl2 (Fragon) with a pH of 6.5. After resuspension, the cells were placed on ice for 10 minutes. The cell suspension was conditioned in a volume of 100 mL in 1.5 mL eppendorf tubes, and store at −80oC for further use.

3.3.2 Transformation of chemically competent cells

The pure plasmid obtained was inserted into competent cells by thermal transformation using a heat shock. The plasmid was added to the chemically competent cells and left on ice for 30 minutes. Then, the mixture was heated in a water bath for 1.5 minutes and immediately placed on ice for 2 minutes. The mixture was added to 1 mL of LB and incubated at 37oC for one hour. 100 mL of the resulting culture were spread on a LB agar (Nzytech) plates (supplemented with the respective antibiotic) and grown overnight at 37oC. The next day, isolated colonies were picked from the plates and cultured in 15 mL falcons with LB medium supplemented with the respective antibiotic to produce cell banks.

3.3.3 Cell banks preparation

Isolated colonies of previous cell banks were inoculated to a 15 mL falcon containing 5 mL of LB medium supplemented with the respective antibiotic. The cells were cultured overnight at 37oC and 250 rpm in an orbital shaker. In the next day, the optical density was measured. This culture was used to inoculate

30 mL LB medium to an OD600 of 0.1. The 30 mL were placed in a 100 mL erlenmeyer with the correct antibiotic supplementation. The cells were grown until an OD600 of 1 at the previous conditions. The cell culture is divided into 70 mL and it was mixed with 30µL of glycerol (Fluka), obtaining 100 mL mixture in 1.5 mL eppedorf tubes. The tubes were stored at −80oC.

3.4 Plasmid production and puriﬁcation

3.4.1 Cell production

A cell banks with E. coli JM109 strain transformed with pETGFP cell were inoculated in a 100 mL erlenmeyer ﬂask with 30 mL of LB medium supplemented with kanamycin (50µg × mL−1). The culture was grown overnight at 37oC in an orbital shaker at 250 rpm. In the next day, the optical density was measured and 4 2000 mL elernmeyer ﬂasks with 250 mL of LB medium (pH 7.4) were inoculated to an

DO600 of 0.1. This medium was also supplemented with the respective antibiotic. The elernmeyer ﬂask were cultured in the same conditions as before until the cultures reached an OD600 of 5 . The cells were harvested by centrifugation in Sorvall RC-6 Plus superspeed centrifuge with SLC-300 rotor at 6000 × g

o and 4oC, for 15 minutes. The supernatant was discharged and the pellet was stored at −20 C for further use.

37 A cell bank containing BL21(DE3) with pEXP5-NT/GFP was inoculated in a 500mL kitasato ﬂask with 100 mL of TB medium (pH 7.4) (12g × L−1 of tryptone (BD), 24g × L−1 of yeast extract (Himedia), 4mL × L−1 glycerol (JMGS)) supplemented with ampilicin (100µg × mL−1). The inoculum was grown o until it reached an OD600 of 3 in an orbital shaker at 37 C and 250 rpm. A 5 liter Biostat B fermenter, containing 4L of TB medium (12g × L−1 of tryptone, 24g × L−1 of yeast extract, 4mL × L−1, 17mM

KH2PO4 and 0.72mM K2HPO4 (Panreac)) at pH of 7.4 (supplemented with the respective antibiotic) was inoculated with the previous culture. The culture was fermented overnight with an oxygenation rate of 30%. The pH was not controlled. In the next day, the cells were harvested by centrifugation in Sorvall RC-6 Plus superspeed centrifuge with SLC-300 rotor at 6000 × g and 4oC for 15 minutes. The supernatant was discharged the pellet was stored at −20oC for further use.

3.4.2 Alkaline lysis

Both cell strains were disrupted by alkaline lysis. The pellets were resuspended with P1 buffer (50 mM glucose (Merck), 25mM tris-HCl, pH 8.0, 10mM EDTA, pH 8.0). The volume of the P1 buffer used was calculated as follows:

OD × Culture volume (mL) 600 (3.2) 60

The same amount of P2 buffer (0.2N NaOH (Merck), 1% (m/v) SDS (Merck) was added to the mixture and then followed by a gentle homogenisation. The resultant solution was left to rest at room temperature for 10 minutes. To stop the reaction, P3 (3M potassium acetate (Panreac), acid acetic (Fisher)) was added to the mixture. After gentle homogenisation, the mixture was placed on ice for 10 minutes. The neutralised alkaline lysate was centrifuged (Sorvall RC-6 Plus, SS34 rotor) twice at 20000×g and 4oC for 30 minutes. Between centrifugations the pellet was discharged. The supernatant obtained was stored at −20oC until further processing.

3.4.3 Plasmid puriﬁcation

0.7 volume of isopropyl alcohol (Sigma) was added to supernatant. After homogenisation, the mixture was left for 2 hour at −20oC. Then, it was centrifuged (Sorval RC-6 Plus, SS34 rotor) at 2000 × g and 4oC for 30 minutes. The supernatant was discharged and the pellet was resuspended in 10 mM Tris- HCL (pH 8). Ammonium sulphate was added to the solution in a concentration of 0.33g × mL−1 and after homogenisation, the resulting solution was left on ice for 15 minutes. It was then centrifuged in an Eppendorf centrifuge 5417R at 1300 rpm and 4oC for 30 minutes. The supernatant was collected.

3.4.4 HIC puriﬁcation

The plasmids were purified by hydrophobic interaction chromatography (HIC) in an AKTA¨ 100 Purifier system, using a Phenyl Sepharose 6 fast flow (high sub) column (Tricorn 10/100 column, GE Health- care). First, the column was equilibrated with 3 column volumes of 1.5M ammonium sulphate (Panreac)

38 in 10 mM Tris-HCL (pH 8). Then, 1 mL of the sample was injected into the column. To remove the unbounded material, the column was washed with 2 column volumes of 1.5M ammonium sulphate in 10 mM Tris-HCL (pH 8). The run was performed at a ﬂow of 1 mL× minute−1. The elution was made with 3 column volumes of 10 mM Tris-HCL (pH 8) and 1.5 mL fractions were collected. After each run, the column was washed with water and it was stored in 20 % ethanol solution at room temperature.

3.4.5 SEC puriﬁcation

In order to exchange the buffer where the purified plasmid was accommodated, a size exclusion chromatography (SEC) was performed. The same column of HIC purification was used. 3 column volumes of Tris-HCL (pH 8) were used to equilibrate the column. 1 mL of purified plamids in 1.5M ammonium sulphate in 10 mM Tris-HCL (pH 8) was injected and the column was washed and eluted with 3 colunm volumes of 10 mM Tris-HCL (pH 8) at a flow of 1 mL× minute−1. 1.5 mL fractions were collected. After use, the column was washed with water and stored in 20 % ethanol at room temperature.

3.4.6 Dialysis

The exchange of buffers from the puriﬁed plasmid was also attempted using a dialysis membrane with 12000-14000 MWCO (Orange Scientiﬁc). 1.5 mL eppendorf tubes without cap (containing the collected fractions) were accommodated with squares of the dialysis membrane with a rubber band. The eppen- dorfs were placed in a water bath with agitation overnight.

3.4.7 Plasmid concentration

After purification, the plasmid was concentrated using a Savant DNA120 speedvac Concentration (Ther- moScientific) at the medium temperature setting, until reached the final volume of 500 µL. The final concentration was measured in the nanodrop and the plasmid was stored at −20oC for further use.

3.5 tRNA puriﬁcation

3.5.1 Cell growth

E.coli cell banks were inoculated in an erlenmeyer flask containing 30 mL of 2 × YT medium (16g × L−1 Tryptone, 10g×L−1 yeast extract,5g×L−1NaCl (Sigma) ) (pH 7.4) and supplemented with the respective antibiotic. The inoculum grown overnight at 37oC in an orbital saker at 250 rpm. In the morning, the optical density was measure. 2 2000 mL erlenmeyer flaks containing 500 mL 2×YT medium each were inoculated to an OD600 of 0.1 and the respective antibiotic was also added. The flasks were cultured in the same conditions as before until the optical density reached an OD600 of 5. The cells were harvested by centrifugation in Sorvall RC-6 Plus superspeed centrifuge with SLC-300 rotor at 6000 × g and 4oC for 15 minutes. The supernatant was discharged and the pellet was stored at −20oC until further use.

39 3.5.2 Phenol extraction

The extraction of the cellular RNA was done by the reported phenol extraction procedure with minor modiﬁcations (Cayama u. a., 2000). All the buffers were prepared with autoclaved water. All centrifugations were performed at 4oC, unless speciﬁed. The cells were resuspended in 25 mL of 1.0 mM Tris–HCl,

10 mM MgCl2, pH 7.2. The same amount of phenol saturated in the same solution was added and was vigorously mixed for 2 hours. Then, it was centrifuged in an Eppendorf centrifuge 5810R at 15000 × g for 30 minutes. After centrifugation, two different phases were observed: a ﬂuid and transparent phase at the top and one turbid viscous at he bottom. The ﬂuid one was collected and 0.1 volumes of 20% potassium acetate and 2 volumes of 70% were added. After homogenisation, the mixture precipitated overnight at -4oC. In the next day, the mixture was centrifuged in an Eppendorf centrifuge 5810R at 15000 × g for 30 minutes. The pellet was then collected.

3.5.3 Contaminant removal

In order to remove the contaminants (such as DNA and rRNA) two protocols were tested. In the first one, the separation is done by high salt concentration and stepwise precipitation (Zubay, 1962). The pellet was resuspended in 1 volume of 1M of NaCl and mixed for 1 hour at 4oC. The mixture was centrifuged in an Eppendorf centrifuge 5810R at 15000 × g for 30 minutes. This procedure was repeated twice. 2 volumes of ethanol were added to the supernatant and it was precipitated for 2 hours at 4oC. The precipitate was collected by centrifugation in the same conditions as before. The precipitate was dissolved in 1 volume of 0.3M sodium acetate, pH 7. 0.5 volumes of isopropyl alcohol were added to the mixture. Then, it was slow stirred for 1 hour at room temperature. The precipitate was removed by centrifugation for 30 minutes at 15000 × g and 20oC. 0.5 volumes of isopropyl alcohol were added to the supernatant, and precipitated for 2 hours at −20oC. The precipitated was collected by centrifugation at 1500 × g for 30 minutes. The final pellet was dissolved in water, the concentration was measured in nanodrop and it was stored at −20oC for further use. The second procedure tested was based on a separation with a low pH buffer and purification by anion-exchange chromatography (Kelmers u. a., 1965). 1 volume of 0.3 M sodium acetate, pH 5 and 0.5 volumes of isopropyl alcohol were used to resuspend the pellet. The mixture was vigorously stirred at room temperature for 1 hour and the precipitate was removed by centrifugation in Eppendorf centrifuge 5810R at 15000 × g and 20oC for 30 minutes. The supernatant was cooled to 4oC and 0.5 volumes of isopropyl alcohol were added. After 2 hours at −20oC, the precipitate was collected by centrifugation in an Eppendorf centrifuge 5810R at 15000 × g for 30 minutes. The precipitate was dissolved in 10 mM of Tris-HCl (pH 8).

3.5.4 Anion-exchange chromatography

The tRNA was further purified by Anion-exchange chromatography in AKTA¨ 100 Purifier system using a DEAE Sepharose 6 fast flow (GE Healthcare) column (Tricorn 10/50 column, GE Healthcare). First,

40 the column was equilibrated with 3 column volumes of 10 mM Tris-HCl (pH 8). 1 mL of the tRNA samples was injected to the column. To remove the unbounded material, the column was washed with equilibration buffer. The elution was made by a gradient from 0% to 100% of 1 M NaCl, 10 mM Tris-HCl (pH 8). After chromatogram analysis, the elution method was altered to a gradient from 30% to 70% of 1M NaCl buffer. Finally, a equilibration with 0% of 1 M NaCl, 10 mM Tris-HCl (pH 8), and a elution with a step of 45% of 1 M NaCl, 10 mM Tris-HCl (pH 8), was tested

3.5.5 RNA electrophoresis

The quality of the tRNA was assessed by a RNA electrophoresis. The method chosen uses TAE agarose gels and the samples are denaturated with hot formamide (Masek u. a., 2005). First, a 1.2% agarose gel was prepared in 1×TAE buffer (0.04 M Tris–acetate, 1 mM EDTA). The agarose mixture was dissolved by heat in the microwave. When fully dissolved, the mixture was poured into a tray and left to solidify. After solidiﬁcation the gel is transferred to an electrophoresis tray where it stays submersed with TAE buffer. The samples were prepared in 1.5 mL eppendorf tubes, by adding formamide (Boehringe), 6× loading buffer (LB) and the collected fractions (in the volumes described in table 3.5). They were then denaturated by heating in a water bath for 5 minutes at 65oC and immediately chilled on ice for 5 minutes. The samples and a DNA marker (NZYDNA Ladder III, Nzytech) were loaded into the gel.

Components Volume (µL) Formamide 15 6× LB 2.5 Fraction sample 7.5 Total volume 25

Table 3.5: Components of RNA samples for electrophoresis in TAE agarose gels and the respective volumes in µL.

Electrophoresis was performed using a TAE running buffer at a voltage gradient of 5 V/cm. The gel was stained in an ethidium bromide bath for 15 minutes. Finally, the gel was visualised and photographed with Stratagene Eagle Eye II imaging system.

3.5.6 tRNA concentration

The pure tRNA samples were precipitated to concentrate and remove the salt present in the buffer. The samples containing tRNA were combined and 1 volume of 70% ethanol was added. The mixture precipitated overnight at 4oC. The precipitated was collected by centrifugation in an Eppendorf centrifuge 5810R at 15000×g. After drying, the pellet was dissolved in water. The ﬁnal concentration was measured at nanodrop.

41 3.6 GFP production and puriﬁcation

JM109 E. coli cells containing pETGFP and BL21(DE) E.coli cells containing PEXP5-NT/GFP were cultured. In order to purify GFP, two chromatografies were used: hydrophobic interaction and affinity purification.

3.6.1 Cell production

JM109 cells banks were inoculated into a 100 mL erlenmeyer flask containing 30 mL of LB medium supplemented with kanamycin (50µg × mL−1). The cells grown overnight at 37oC in an orbital shaker at 250 rpm. In the next day the optical density was measured. 1 erlenmeyer flask containing 250 mL of LB medium and supplemented with kanamycin was inoculated to an OD600 of 0.1. The flask was cultured at same conditions as the inoculum. When the culture reached an OD600 of 0.6, 1 M of isopropyl β-D- 1-thiogalactopyranoside (IPTG) was added to a concentration of 0.1 mM. The cells were harvested 8 hours later by centrifugation in Sorval R-6 superspeed centrifuge with SLC-300 rotor at 6000 × g for 15 minutes. The pellet was stored for further use. BL21(DE3) cells banks were inoculated into a 100 mL erlenmeyer flask containing 30 mL of LB medium supplemented with ampicilin (100µg × mL−1). The cells were grown at 37oC and 250 rpm until they reached an OD600of 3. 1 erlenmeyer flask containing 250 mL of LB medium, and supplemented with amplicilin, was inoculated to an OD600 of 0.1. 1 M of isopropyl β-D-1-thiogalactopyranoside (IPTG, Fisher) was added to a concentration of 0.1 mM. The flask was cultured at 30oC and 250 rpm overnight. In the next day, cells were harvested by centrifugation in Sorval R-6 superspeed centrifuge with a SLC- 300 rotor at 6000 × g for 15 minutes. The pellet was stored at −20oC for further use. Samples of both E. coli cells strains (expressing the respective GFP) were observed Leica DMLB microscope with a blue filter.

3.6.2 Cell lysis

JM109 cell pellets were ressuspended in 100 mM phosphate buffer (NaH 2PO4, pH 8). They were then disrupted by sonication (Bandelin) with a TT13 with an amplitude of 30% for 6 x 30 seconds on ice with interruptions of 30 seconds. The resulting mixture was centrifuged at 12000 × g, for 20 minutes in an Eppendorf centrifuge 5417R and the supernatant was recovered.

BL21(DE3) cell pellets were ressuspended in 50 mM NaP O4, pH 8, 500 nM NaCl, 500 mM imidazole. They They were then disrupted by sonication (Bandelin) with a TT13 with an amplitude of 30% for 5 x 30 seconds on ice with interruptions of 30 seconds. The resulting mixture was centrifuged at 12000 × g for 20 minutes in an Eppendorf centrifuge 5417R and the supernatant was recovered.

3.6.3 HIC puriﬁcation

GFP from JM109 cells was puriﬁed by hydrophobic interaction chromatography (HIC) using a Phenyl Sepharose 6 fast ﬂow (high sub) (GE Healthcare) in a Bio-Rad Econo-Pac column (Bio-rad). 5 mL of

42 4 M ammonium sulfate buffer (4 M (NH4)2SO4, 10 mM Tris, 10 mM EDTA, pH 8) were mixed with 5 mL of the supernatant liquid containing GFP and then loaded onto the column. Unbound proteins were removed with 3 washing steps: First, with 25 mL of 2 M ammonium sulfate buffer; secondly, with 25 mL of 1.3 M ammonium sulfate buffer and ﬁnally with 50 mL of TE buffer (1 mM Tris, 10 mM EDTA, pH 8). The bounded GFP was then eluted with water. The eluted GFP was stored at −20oC for further use.

3.6.4 IMAC puriﬁcation

GFP from BL21(DE3) cells was puriﬁed by immobilised metal ion afﬁnity chromatography (IMAC) using Ni Sepharose 6 Fast Flow(GE Healthcare) in Poly-prep column (Bio-rad). The column was equilibrated with 5 ml of 20 mM imidazole (Sigma), 500 mM NaCl, 50 mM NaP O4, pH 8. 2mL of the sample was injected and the column was washed in 2 steps: First, 5mL of 20 mM imidazole, 500 nM NaCl, 50 mM

NaP O4, pH 8, then with 5 mL of 250 mM imidazole, 500 mM NaCl, 50 mM NaP O4, pH 8. The protein was eluted with 500 mM imidazole, 500 mM NaCl, 50 mM NaP O4, pH 8. The eluted GFP was stored at −20oC for further use.

3.7 S30 Lysate preparation

For the production of S30 lysate, BL21(DE3) strain with and without plasmid were used. The bead mill was chosen to perform a mechanical disruption was bead mill (Sun u. a., 2013). A diagram of the lysate processing used is represented in ﬁgure 3.2. The S30 buffer was prepared as needed from autoclaved Milli-Q water and three separate 100× concentrates (1 M Tris acetate pH 8.2, 1.4 M magnesium acetate (Fisher), and 6 M potassium acetate) which were sterile ﬁltered, and stored at room temperature. The pH of the 1 M Tris solution was adjusted to 8.2 with 1 M of HCl (Acros Organics). All the centrifugation were made at 4oC.

3.7.1 Cell production

Cell banks containing BL21(DE) with and without plasmid were inoculated in a 100 mL elernmeyer ﬂask with 30 mL of 2 × YT medium (16g × L−1 Tryptone, 10g × L−1 yeast extract,5g × L−1NaCl ) (pH 7.4) and supplemented with the respective antibiotic (when needed). The inoculum grown overnight at 37oC in an orbital shaker at 250 rpm. The optical density was measured in the morning. Two 2000 mL elernmeyer ﬂaks containing 500 mL each of 2 × YTPG ( 16g × L−1 Tryptone, 10g × L−1 yeast extract,5g × L−1NaCl ,22 mM sodium phosphate monobasic (Sigma), 40 mM sodium phosphate dibasic (Panreac), 100 mM glucose) supplemented (when necessary) with the respective antibiotic were inoculated to an OD600 of

0.1. The ﬂasks were cultured in the same conditions as the inoculum until they reached an OD600 of 4.5. The cells were chilled immediately and harvested by centrifugation in a Sorval RC-6 Plus superseed centrifuge with a SLC-300 rotor at 6000 × g for 15 minutes.The cells were then washed with 100 mL of 1 × S30 buffer (10 mM Tris acetate, 14 mM magnesium acetate, 60 mM potassium acetate) and

43 centrifuged again in the same conditions. The pellet was were weighed and stored at −20oC for further use. Furthermore, the same process was performed in a 2000 mL cell culture. In this case, the inoculum was made in a 250 mL elernmeyer ﬂask containing 50 mL of 2×YT . The 2000 mL of 2×YTPG medium was divided by 4 2000 mL elernmeyer ﬂaks with 500 mL each. The same amount of S30 buffer was used to washed the cells.

3.7.2 Biomass processing

The pellet was ressuspended with 1 mL of room temperature S30 buffer per gram of cells. Once thawed, the cell suspension was set on ice. Two concentrations of cell beads were mixed in the solution: 3 and 5 grams of autoclaved 1 mm beads × grams of cell. The cells were lysed in a bead mill (Vibrogen- Zellmuhle,¨ Edmund Buhler).¨ For 1000 mL of cell culture, 4 cycles of 1 minutes (30 seconds on, 30 seconds on ice) were performed and, for the 2000 mL culture, 6 cycles of 1 minute (30 seconds on, 30 on ice). To separate the beads and cell debris from the lysate, a centrifugation with a Sorval RC-6 Plus superspeed witha SS34 rotor was performed at 30000 × g for 30 minutes. The lysate obtained should not be turbid. The supernatant was collected and incubated in an orbital shaker at 37oC for 80 minutes. Then, they were centrifuged in an Eppendorf centrifuge 5810R at 18000 × g for 20 minutes. The ﬁnal supernatant was aliquoted and stored at −80oC until further use.

Cell Culture Centrifugation Centrifugation Cell disruption Run-off reaction (1X 18,000 g, 30 min, 4ºC ) (Shake Flask) (Bead mill) (1X 30,000 g, 30 min, 4ªC) (37ºC, 80 min, 250 rpm)

Figure 3.2: Steps of the S30 lysate processing.

3.7.3 Cell lysis efﬁciency determination

To determine Cell lysis efﬁciency, the number of colonies present before and after lysis was compared. For that, 20 µL from the lysates were plated on sterile LB agar petri dishes (without antibiotic) and incubated overnight at 37oC. A sample the ressuspended pellets was diluted (1 : 109) and 20 µL were plated and incubated as the lysates samples. In the next day, the number of colonies was counted and the colony forming unit (CFU) per millilitre of sample was calculated by as follows:

no. of conolies × Dilution factor CFU/mL = (3.3) Volume plated (mL)

The efﬁciency (η) was calculated by the following equation:

CF U/mL − CF U/mL η = p l (3.4) CF U/mLp

Where CF U/mLp corresponds to the resuspended pellets, and tCF U/mLl to the lysates.

44 3.8 Cell free protein synthesis

A Expressway Cell-Free E.coli Expression system kit (Invitrogen) was acquired to test the plasmid and lysates produced. This kit contained all the components needed to produce proteins and the pEXP5- NT/CALML3 for a positive control. Besides the kit, a system based on Cytomim system Zawada(2012) was tested and optimisation attempts were made.

3.8.1 Expressway cell-free kit

Pure plasmid template in a concentration of 500ng × µL−1 produced as described before to use with this kit. The reaction was performed in a sterile 1.5 mL eppendorf tube at 37oC in an orbital shaker at 300 rpm for 6 hours. The ﬁnal volume of each reaction was 25µL, and the reagents were added in the amounts represented in table 3.6.

Reagents Volume (µL) E. coli sly D- Extract 5 2.5× IVIPS E. coli Reaction Buffer 5 50 mM Amino Acids (-Met) 0.3 75 mM Methionine 0.25 T7 Enzyme Mix 0.25 DNA template 0.5 Dnase/Rnase-free Distilled Water 1.2 Total volume 12.5

Table 3.6: Reagents used to perform cell-free protein synthesis from Expressway kit and the respective volumes in µL

After the ﬁrst 30 minutes of reaction, a feed buffer was added to each reaction. The feed buffer contained the reagents represented in table 3.7.

Reagents Volume (µL) 2× IVIPS Feed Buffer 6.25 50 mM Amino Acids (-Met) 0.3 75 mM Methionine 0.25 Dnase/Rnase-free Distilled Water 5.7 Total volume 12.5

Table 3.7: Feed buffer reagents from Expressway kit and the respective volumes in µL

Once the reaction ﬁnished, it was stored at −20oC for further analysis.

3.8.2 Cytomim system

A reaction based on th Cytomim system was performed in a sterile 1.5 mL eppendorf tube containing 25µL of reaction. Beforehand, two buffers were prepared: 10× Salt solution, containing 1.3 M potassium acetate, 100 mM ammonium acetate (Sigma), 80 mM magnesium glutamate, and 10× Master mix, containing 12 mM ATP,8.5 mM GTP,8.5 mM CTP,8.5 mM UTP, 340µg×mL−1 folinic acid, 1.7mg×mL−1

45 E. coli tRNA. These buffers were aliquoted and stored at −20oC. The following reagents were prepared: 1 M Sodium pyruvate (Fisher), 100 mM Sodium Oxalate (Fisher), 100 mM Spermidine (Fisher). The amino acid solutions used belonged to expression kit. T7 RNA polymerased 20 U ×L−1 from Life Technologies was also used.

The reaction was performed at 37oC in an orbital shaker at 300 rpm for 5 hours. The reagents concentrations and volumes used are described in table 4.2 . Once the reaction ﬁnished, the samples were stored at −20oC for further analysis.

Reagents Stock concentration Reaction concentration Volume (µL) 10× Salt Solution 10× 1× 2.5 10× Master mix 10× 1× 2.5 50 mM Amino Acids (-Met) 50 mM 2 mM 0.6 75 mM Methionine 75 mM 2 mM 0.5 Sodium Pyruvate 1 M 33 mM 0.83 Sodium Oxalate 100 mM 4 mM 1 Spermidine 100 mM 1 mM 0.25 T7 RNA polymerase - - 1 Lysate - 24% 2.1 Plasmid Template 0.5 µg × mL−1 33 µg × mL−1 1.7 Dnase/Rnase-free Distilled Water - - 8.12 Total volume - - 25

Table 3.8: Reagents for 25µL reaction kit, stock and reaction concentrations and the respective volumes used in µL

3.8.3 Optimisation

The ﬁrst attempted optimisation was the lowering of the temperature in the reaction to 30oC. This test was made with Expressway Cell-free kit, using pEXT-5NT/GFP as a template, and the lysate from the kit. No alteration to the reagent concentrations or to other conditions were made with this kit. With the Cytomim system several tests were made: lysate volume, plasmid concentration and magnesium acetate concentration. The conditions and reagent concentrations were the same as before.

3.9 Protein analysis

3.9.1 Protein concentration

The lysates protein concentrations and GFP concentration were also determined. For that, a Pierce BCA protein assay kit (ChemCruz) was used. A BSA calibration curve was prepared using S30 buffer as diluent for the lysates, and with water for GFP. The samples were also diluted (1:50) with the same buffer. They were measured at 562 nm in a plate reader (Molecular Devices).

46 3.9.2 SDS-PAGE

Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) was performed to analyse the cell-free production and GFP puriﬁcation. 5µL of the the cell-free production samples were precipitation by the addition of 20 µL acetone (Sigma). The buffer sample was prepared with 62.5 mM Tris–HCl pH 6.2, 2% (w/v) SDS, 0.01% (w/v) bromophenol blue, and 10% (v/v) glycerol. All samples were denaturated in reducing conditions with 100 mM dithiothreitol (DTT) (Sigma) at 100oC for 5-10 minutes. Samples were loaded in a 15% acrylamide gel, prepared from a 40% acrylamide/bis stock solution (37.5:1) (National Diagnostics), and ran at 120 mV using a running buffer composed of glycine 192 mM, Tris 25 mM, and 0.1% SDS pH 8.3. Gels were stained with Coomassie PhastGel (Pharmacia AB Labo- ratory Separations). Gels were de-stained using a 30% ethanol/10% acetic acid solution. The molecular marker used was the Precision Plus Protein Standarts Dual Color (BioRad).

When the intensity of the bands was unsatisfying, the gels were silver stained. First the band where ﬁxated using an oxidiser solution composed of 0.8 mM sodium thiosulphate for 10 minutes. After washing 3 times with Milli-Q water, the gels were incubated with a fresh silver nitrate solution (11.8 mM silver nitrate, 0.02% formaldehyde), for 30 minutes. Then, they were washed 3 times and the band developed was performed by incubating the gel in developer solution (composed of 0.566 M sodium carbonate, 0.02 mM sodium thiosulphate and 0.02% formaldehyde). The reaction was stoped with a solution containing 50% ethanol, 12% acetic acid in Milli-Q water, for 15 minutes.

The gels were scanned and analysed using GS-800 Calibrated Densitometer and Quantity one software (Bio-rad).

3.9.3 Western blotting

For the western blot, SDS-PAGE was performed without staining the gel. The Western blot was assembled (as instructed by the manufacturer (Bio-rad)), using two sponges, 2 ﬁlter papers and one nitrocel- lulose blotting membrane (Bio-rad). All the components were pre-weted in the transfer buffer 25 mM Tris, 192 mM 30 glycine and 20% methanol (v/v) before assembly. The transfer was carried out at 100 V, 350 mA for 1h. The membrane was then blocked with a TBS-Tween buffer ( TBS with 0.5% Tween 20) containing 5 % non-fat milk. Then, the membrane was washed 5 times with TBS-Tween Buffer and incubated overnight at 4oC with primary antibody anti poly-His in mouse (Santa Cruz Bioscience) diluted 1:500 in 5 % non-fat milk, TBS-Tween. In the next day, the membrane was incubated for 1 hour with the secondary antibody goat anti-mouse IgG-HRP (Santa Cruz Bioscience) diluted 1:2000 in TBS-Tween and washed ﬁve times with TBS-Tween. To visualise the bands, a 100 mL TBS solution containing 50 mg of 3,3’-diaminobenzidine (DAB)(Bio-rad). This solution was mixed with 300 µL 30% hydrogen per- oxide. The Blot was incubated with this solution for 20 min. The reaction was stopped with tap water, and the blots were dried at RT.

47 3.9.4 Fluorimetry

The GFP fluorescence was measured using VersaFluor Fluorometer (BioRad) containing EX490/10 excitation filter and EX510/10 emission filter. The samples were diluted with water and placed on a 200 µ L cuvette. The range was set to medium setting and the zero was done using water.

48 Chapter 4

Results and Discussion

4.1 Template preparation

The plasmids pEXP5-NT/CALML3 pETGFP and pEXP5-NT/GFP were chosen to be used in this work because they contain: a bacteriophage RNA polymerase T7 promoter placed upstream of the gene of interest (which is a strong promoter widely used in cell free systems), a prokaryotic Shine-Dalgarno ribosome binding site (RBS), an ATG initiation codon, a stop codon, and a t7 termination. The pEXP5- NT/CALML3 and pEXP5-NT/GFP contain an N-terminal peptide with 6×His tag and a TEV recognition site which allow easy detection and puriﬁcation. The TEV recognition site allows TEV protease-mediated removal of the tag, generation an almost native recombinant protein. The pEXP5-NT/CALML3 and pEXP5-NT/GFP contain a pUC replication origin, and the pETGFP a pBR322 origin. This last regulates the number of plasmids using a protein called Rop/Rom. The pUC origin is derived from pBR322 but contains a mutation in the origin itself and another that deletes the Rop/Rom gene. This removes all the regulatory constraints on the plasmid replication allowing the cell to produce over 500 plasmids per cells instead of 30-40 plasmids per cell with pBR322. Other important aspect of the templates used in cell-free systems is their size. Bigger plasmids tend to lower the protein yield. In this case, the plasmids are not very large, wherein the largest one is pETGFP (6088 bp), followed by pEXT5-NT/GFP (3685 bp), and pEXT5-NT/CALML3 (3194 bp).

4.1.1 pEXP5-NT/GFP

The pEXP5-NT/GFP plasmid was constructed using a GFP gene from pVAXIGFP-BHGI plasmid and PEXP5-NT/CALML3 as a vector. For that, the CALML3 gene was removed by a double digestion with SacII and PvuII. Because these two restriction enzymes didn’t have 100% activity for the same buffer, the digestion had to be optimised. 4 approaches were attempted: the use of the buffer C (for which SacII has 100% activity, in the usual and the double concentrations); and the use of buffer G (for which PvuII has 100%, again with the normal and double concentrations). This approach was chosen instead of a sequential digestion because it has less steps and higher yield. Before, the behaviour of the enzyme in buffer (for which the other enzyme has 100% activity) was

49 studied. SacII was tested with buffer G and PvuII with buffer C. A buffer in which both enzymes had 70% activity (B). The ﬁgure 4.1 presents the reults for the undigested plasmids and the respective digestions results. The undigested plasmid presens the 3 expected conformations: suppercoild (sc), linear and open circular (oc) (from bottom to top). Furthermore, on top of oc pDNA, another isoform is observed. Regarding the digestion, the enzymes didn’t present 100% activity in none of the tests. Nevertheless, it seems that the digestion with buffer G was slightly more complete as the band corresponding to the sc pDNA is less visible. The digestion with buffer B was the most incomplete.

Figure 4.1: A 1% agarose gel containing the plasmid and the respective digestions. 1-undigested pEXP5-NT/CALML3 plasmid in different isoforms. 2- pEXP5-NT/CALML3 digestion with buffer G and SacII. 3-pEXP5-NET/CALML3 digestion with buffer B, SacII and PvuII. 4-pEXP5-NT/CALML3 digestion with buffer C and PvuII. M-NZYDNA Ladder III.

Tanking into account the results from ﬁgure 4.1, the buffer B was no longer tested. A different approach was attempted instead. Here, double digestions with buffer B and C in 1 ×and 2 × concentration were tested. The results can be observed in the ﬁgure 4.2. The complete digestion was achieved in the test 4 with double concentration of buffer G.

Figure 4.2: A 1% agarose gel containing the undigested plasmid and the double digestions. 1- Undigested plasmid isoforms oc, linear and sc (from top to bottom). 2- Digestion with SacII, PvuII and 1×C buffer. 3-Digestion with SacII, PvuII and 2× C buffer. 4-Digestion with SacII, PvuII and 1× G buffer. 5-Digestion with SacII, PvuII and 2× G buffer. M- NZYDNA Ladder III.

Once the digestion was optimised, the insert was prepared. We use the pVAXIGFP-BHGI plasmid. This plasmid was chosen because it was used successfully in other works. The primers were designed taking into account that SacII and PvuII needed to be added to each end of the insert. The primers sequences and properties are described in table 4.2. The PCR was performed with the conditions already described. Then, the PCR result was double digested with SacII and PvuII in the optimised

50 conditions.

Primer name 5’-3’ Sequence Properties GFPInsert Foward ATCGATCAGCTGAAGGGAGACCCAAGCTGGCTAG 34 b, Tm 62.2oC 55.9% GC GFPInsert Reverse ATCGATCCGCGGGAAGGCACAGTCGAGGCTGAT 33 b, Tm 60.3oC 60.6% GC

Table 4.1: Primers sequences and properties used in the PCR to produce the insert containing GFP and the restriction enzymes locals used for cloning pEXP5-NT/GFP.

The ﬁgure 4.3 presents the result of the digestions and PCR. The PCR produced a DNA insert with a size around 800-900 bp as expected (882 bp). The double digestion was complete and produced a vector (top band) with a size between 2500-3000 bp was obtained (2828 bp). The top band of the digestion and the PRC product band were cut from the agarose gel and puriﬁed. Both the insert and the vector were used in the cloning step with T4 DNA ligase kit and with the two incubation methods (1 hour at 22oC and overnight at 4oC).

Figure 4.3: A 1% agarose gel containing the pEXP5NT-CALML3 digestion and the PCR product. 1- pEXP5NT-CALML3 double digestion with SacII and PvuII. 2- Digested PCR product. M- NZYDNA Lad- der III.

The resulting reaction was used to transform BL21(DE3) competent cells. 3 isolate colonies from the transformation were inoculated in liquid medium and the plasmids were purified. To confirm the cloning, to each plasmid was tested with 2 digestions: a double digestion with SacII and PvuII, and a digestion with XmnI for linearisation. Figure 4.4 shows the plasmids and the respective digestions. By analysing the digestion pattern and the plasmid size, the plasmid 2 was selected to be the correct pEXP5-NT/GFP. This plasmid (when linearised) have 3685 bp and when double digested presents two fragments with the size correspondent to the insert and vector used. Further confirmation was obtained with DNA sequencing.

4.2 Plasmid puriﬁcation

The plasmids pETGFP and pEXP5-NT/GFP were produced from JM109 and BL21(DE3) respectively. The cells were lysed by alkaline lysis. The nucleic acids and the proteins were precipitated by isopropyl

51 Figure 4.4: A 1% agarose gel containing the 3 purified plasmids obtained from cloning and the respective digestions. 1-Plasmid obtained with a incubation for 1 hour at 22oC; 1a-Digestion with XmnI; 1b-Double digestion with SacII and PvuII. 2-Plasmid obtained with incubation overnight at 4oC; 2a-Double digestion with SacII and PvuI; 2b-Digestion with XmnI; 3-Plasmid obtained with incubation overnight at 4oC; 3a- Double digestion with SacII and PvuI; 3b-Digestion with XmnI. M- NZYDNA Ladder III. alcohol and protein were precipitated with ammonium sulphate. Cell lysis is one of the most critical downstream processing steps (Prazeres u. a., 1999). Alkaline lysis was the method of choice as it is the most popular and widely adopted cel lysis technique (Zhu u. a., 2005). After cell lysis, the resulting solution have a high concentration of salt and sodium acetate. In solution, sodium acetate will break + − − into Na and CH3COO . The positive charge ions will neutralise the negative charged PO3 groups on the nucleic acids. This makes the molecule far less hydrophilic, and less soluble in water. The isopropyl alcohol is added to lower the dielectric constant of the solution. Because water have a high dielectric constant, it is difficult for positive ions to interact with the negative charged groups. When isopropyl alcohol is present this interaction is facilitated and the nucleic acid became less hydrophilic, precipitating. Besides nucleic acids, proteins may also precipitate with isopropyl alcohol. To remove the remaining proteins ”salting-out” technique is applied. Ammonium sulphate is added to the solution to a concentration of 2.5 M. This high salt concentration attract the water molecules and decreased the number which interact with charged part of the protein. This way, the demand of solvent molecules increase and protein-protein interaction became stronger. The proteins coagulates by forming hydrophobic interactions with each other. Besides proteins, some amount of the contaminant RNA is removed. The two operations preformed sequentially concentrate the plasmid (50-fold) (Freitas u. a., 2006). The plasmids were further purified by two chromatographic steps: hydrophobic interaction and size exclusion.

4.2.1 Hydrophobic interaction chromatography

Hydrophobic interaction (HIC) is a method of choice when pDNA puriﬁed. It separates the pDNA based on the difference in surface hydrophobicity between the supercoiled plasmid and the impurities (RNA, endotoxins and proteins). It is a puriﬁcation process that achieves high purity and considerable amounts of plasmid DNA. First, the samples is loaded and the column is washed with high salt concentration. In this step a

52 interaction between the hydrophobic functional regions of the solutes and hydrophobic function takes place (Trindade u. a., 2005). Since the plasmid is double stranded, it contains a week hydrophobic nature, and it is eluted while the impurities are retained in the column. Because HIC binding process in more selective than the elution process, the plasmid separation depends on the optimization of the start buffer conditions, such as the salt used, its concentration and purity.

In this case, 1.5 M ammonium sulphate was chosen as a binding buffer due to: its high salting-out ability, high solubility (varying little in a range of 0–30oC), its stability (up to pH 8.0), and low cost (Behnke, 1983). For the elution buffer, 10 mM Tris-HCl pH 8 was chosen. 1 mL of the sample was injected to a column equilibrated with the binding buffer. The column was washed with 2 column volumes of the binding buffer and eluted with 3 of 10 mM Tris-HCl pH 8. The flow was set at 1mL × min−1 and the flowtrough was collected in 1.5 mL fractions. Figure 4.5 shows the chromatogram correspondent to the pETGFP purification by this method after the injection (volume 0). The first peak after injection corresponds to the purified plasmid. The second peak appears conjugated with a peak in conductivity. This may mean that the peak is caused by the increase of salt in the flowtrough and not by any contaminant. The final peak correspond to the contaminants and starts when the conductivity decrease. When conductivity decreases, the salt concentration on the flowtrough also decreases, and the hydrophobic areas of the contaminants stop to interact with the matrix and are eluted.

Figure 4.5: HIC chromatogram of the pETGFP purification. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line) and the conductivity of the flowtrough in mS/cm (blue line).

Figure 4.6 shiows a 1% agarose gel with selected fraction of the pETGFP purification chromatography from figure 4.5. The first 3 fractions are corresponded with to the first peak and they present pure plasmid as expected. It is also observed that the second peak is indeed due to the increase of salt in the flowtrough. The final peak contains RNA. It is noted that the salt concentration is so high that the plasmid bands are not well defined and it is not possible to identify the plasmid isoforms.

A puriﬁcation of pEXP5-NT/GFP plasmid was also performed using the same method. Figure 4.7 presents the chromatogram and the agarose gel with the selected fractions of the run. This chromatogram is very similar to the previous as it presents 3 peaks corresponding to the pure plasmid,

53 Figure 4.6: A 1% agarose gel of the selected fraction of pETGFP purification HIC chromatography. 1 to 3 correspond to purified plasmid peak. 4 corresponds to the second peak. 5 to 8 correspond to contaminant peak. M-NZYDNA Ladder III. salt and contaminants (RNA). These assumptions are verified with the agarose gel. The first 3 samples exhibit purified plasmid, the samples 7 and 8 don’t show plasmid or RNA and in samples 9 to 12 RNA is present. In this gel is also observed a sample of the feed injected in the column.

(a) (b)

Figure 4.7: HIC chromatogram of the pEXP5/GFP purification and a 1% agarose gel of the selected fractions. 4.7b) HIC chromatogram. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line) and the conductivity of the flowtrough in mS/cm (blue line). 4.7a) A 1% agarose gel of the selected fraction of pETGFP purification HIC chromatography. 1 to 4 correspond to the first peak (pure plasmid). 7 and 8 correspond to the second peak. 9 to 12 correspond to the final peak (contaminants). 13- Feed sample. M-NZYDNA Ladder III.

4.2.2 Plasmid desalting

The pure plasmid collected was in 1.5 M ammonium sulphate buffer. This high salt concentration does not allow a correct analysis of the plasmid quality and quantity since it interferes with the agarose gel analysis and with the concentration measurement. To overcome this issue two approaches were tested. To exchange buffer, the plasmids were dialysed with a dialysis membrane with 12000-14000 MWCO. This membrane allowed the salt ions to ﬂow trough the membrane pores but the plasmid stayed trapped inside. The other method tested was a size exclusion chromatography. This method separates the molecules according to their size. Because the plasmid is larger than the salt ions, the plasmid will be

54 eluted before. The fraction that contained pETGFP plasmid was dialysed against water overnight. Figure 4.8 shows two 1% agarose gels containing the dialysed pETGFP. By observing the gel, we can conclude that the plasmid has the correct size. Most of the time, the 3 plasmid forms are observed: open circular (oc), linear (l), and supercoiled 8sc. In lane 3 of the picture on the right, one more isoform is observed. It is also noted that in most samples, the open circular form is present in more quantity. This form decreases the quality of plasmid and may affect the yield of cell-free protein synthesis (Zawada, 2012). This high amount of open circular plasmid may be caused by the dialysis process. Comparing the agarose gels before and after this steps, there is a difference. Before, a blur band corresponding to the suppercoild plasmid is much more prominent.

Figure 4.8: Two 1% agarose gels containing pure pETGFP recovered from HIC chromatography after dialisys. oc-open circular form; l- linear form; sc: supercoild form. M-NZYDNA Ladder III.

Alkaline lysis may also affect the amount of open circular. During alkaline lysis, the chromosomal DNA is denatured while the supercoiled plasmid DNA remains intact, if the pH does not exceed a threshold of approximately 12.3 (Vinograd u. a., 1966). However, the lysis solution used have a pH of 13, and if the macromolecules released into the crude lysate do not provide enough acidity, the lysate pH may not decrease bellow 12.3 (Cloninger u. a., 2008). This means that the plasmid may not recover to the original supercoild form. The fractions containing pEXP5-NT/GFP plasmid were used in SEC chromatography. The column where HIC was performed was also used to desalt the samples by SEC. 10 mM Tris-HCl pH 8 was used as buffer. Figure 4.9 shows a chromatogram of a SEC run with pEXP5-NT/GFP and a 1% agarose gel containing selected fraction of the SEC runs. By analysing the chromatogram, we can say that almost all plasmid was desalted. Both curves intersect almost at the end of the plasmid peak which means that only one small portion of the plasmid contains a salt. This intersection could be avoid by using a column with higher height. With a higher height, salt molecules will take longer to reach the bottom and a greater separation would be achieved. The 1% agarose gel of the SEC samples show multiple bands (ﬁgure 4.9b). In this case more than the typical supercoild, linear, and open circular forms are presented. This may suggest a contamination

55 (a) (b)

Figure 4.9: SEC chromatogram of pEXP5-NT/GFP desalting and 1% agarose gel of the selected fractions. 4.9a) SEC chromatography. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line) and the conductivity of the flowtrough in mS/cm (blue line). 4.9b) A 1% agarose gel containing the selected fractions (1-14) of multiple SEC chromatographies. M-NZYDIA Ladder III with a different size plasmid. To test this, a double digestion with SacII and PvuII and a simple digestion with XmnI was performed. Figure 4.10 show the results of the digestions. With the simple digestion, two bands appear (figure 4.10a and 4.10b, row 1). This suggests the contamination with a plasmid of a greater size. However, with the double digestion (figure 4.10b, row 2) multiple bands appear. The band corresponding to the insert is visible. Two bands with size between 1400 and 2000 bp appear above that. The positions of these two bands is very similar to the last two bands found in the undigested plasmid (figure 4.10a, row 2), which may be non digested plasmid. Other two bands are visible with size between 2000 and 2500 bp, and on the top of them more two bands (between 3000 and 4000 bp). The top one may correspond to linear plasmid (uncompleted digestion). The band below may correspond to the plasmid without the GFP insert. A blur band on the top is also visible.

(a) (b)

Figure 4.10: Two 1% agarose gels containing the digestion of pEXP5-NT/GFP puriﬁed by HIC and desalted by SEC. 4.10a) Agarose gel containing: 1-pEXP-NT/GFP digested with XmnI; 2-pEXP5-NT/GFP undigested; M-NZYDIA Ladder III. 4.10b) Agarose gel containing: 1-pEXP-NT/GFP digested with XmnI; 2-pEXP-NT/GFP double digested with SacII and PvuII; M-NZYDIA Ladder III.

56 Besides these tests, a sample of the cell culture was observed with a fluorescent microscope and the cells were green. Also, a bank of the same batch was used to confirm the sequence. It seems that it was not a contamination but recombination of the plasmid. This event can be explain by the use of BL21(DE3) strain as a host. Unlike BL21(DE3), strains usually used for plasmid propagation (e.g. DH5α) contain recA mutation. The recA gene is essential for homologous recombination and DNA repair in E.coli (Koomey und Falkow, 1987). EndA mutation is also important for plasmid stability. Strains without endA mutation were proven to degraded plasmid when protein extraction was not perform before alkaline lysis (Taylor u. a., 1993). Besides, E. coli genes mcrA, mcrB, mcrC, and mrr express the 5-methylcytosine-specific restriction endonucleases McrA, McrBC and Mrr, respectively. These endonucleases degrade exogenous DNA with the methylated sequences CmCGG, RmC,CmAG, or GmAC (Mulligan und Dunn, 2008). Some of the upper bands can also be due to other isoforms, such as concactamers and catenanes. Concatemers are dimerics plamids with double the size. Usually they are formed by homologous recombination. Catenanes are isolated plasmid that are interlocked as chain links. These forms are usually found in plasmid preparations Schleef(2008). The extra bands observed in the undigested pEXP5- NT/CALML3 (figures 4.1 and 4.2) can also have these forms.

Strain Genotype BL21(DE3) F– ompT gal dcm lon hsdSB(rB − mB −) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) DH5α F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZ∆M15 ∆(lacZYA-argF)U169, hsdR17(rK- mK+), λ− TOP10 F- mcrA ∆(mrr-hsdRMS-mcrBC) Φ80lacZ∆15 ∆lacX74 nupG recA1 araD139 ∆(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ-

Table 4.2: Genotypes of the E.coli strains BL21(DE3), DH5α and TOP10.

4.3 tRNA puriﬁcation

Amino acids are activated for peptide bond formation by amino acyl tRNA synthetases that are specific for the amino acid substrate and the cognate set of tRNAs, covalently linking the residue to the 3’- terminal adenosine of the tRNA (Ling u. a., 2009). For protein synthesis occurs, all 20 amino acids must present in amounts super-stoichiometric with the amount of protein to be formed, in addition to catalytic amounts of all 20 amino acid tRNA synthetases and the full complement of tRNAs. The addition of exogenous tRNA to the cell-free system not only increases the protein yield, but also allows to control the system through changing tRNA composition (Kanda u. a., 1996) and facilitates in incorporation of unnatural amino acids. To this work, total tRNA with amino acids attached to the terminal adenosine groups were purified. Two protocols were tested. In the first, a attempt to separate RNA from pDNA and rRNA with high salt concentration and a stepwise precipitation with isopropyl alcohol. The second method, a low pH solution was used to precipitate pDNA and an anion-exchange chromatography was used to remove the remaining contaminants. In both methods, a phenol extraction method was performed. By adding a phenol saturated buffer to

57 the cell mixture, the permeability of the cell wall will increase, and small molecules, such as tRNA, can diffuse out of the cell. This way, cell lysis is avoided. Besides, it allows the separation of nucleic acids from the proteins. Since phenol and the buffer are immiscible, they form a two phases when centrifuged. Phenol is less polar than water, and since nucleic acids are polar, they will stay soluble in the water. This means that when phenol is mixed with water, they do not dissolve in the phenol ant remain in the buffer. However, proteins are composed by polar and non-polar amino acids. Usually, when protein are exposed to a less polar solvent, the folding changes and the less polar residues, which usually are inside the protein structure, will interact with phenol and are forced to the outside. This means that the proteins are denatured and they will stay in the phenol phase. Since the top phase, containing the nucleic acids, is collected, most proteins will be removed. In the first protocol tested, the step after ethanol precipitation is to add 1M NaCl in acetate buffer (pH 5). In the presence of this amount of salt, ribosomal RNA becomes insoluble and precipitates (Crestfield u. a., 1955). After this removal, the solution still contains DNA and polysaccharides. Both of them are removed by adding 0.2M of sodium acetate, pH 7 and 0.5 volumes of isopropyl alcohol. This precipitation has the same principles as the isopropyl alcohol precipitation used in the plasmid purification. In figure 4.11 a 1.2% agarose gel containing samples of this method is observed. Figure 4.11, 4 contains a sample of the recovered pellet after phenol extraction and ethanol precipitation. This samples contains the plasmid, rRNA (23s and 16s) and small RNAs (5s and tRNA). It’s also visible that the precipitation had some loss of tRNA since small RNA is visible in row 1 and 2. It should also be noted that adding 1M NaCl in acetate buffer (pH 5) had little or none effect. The bands corresponding to the ribosomal RNA are still visible in 8. On the other hand, they disappear with the precipitation with 0.2M of sodium acetate (ph 7) but the pDNA is still there.

Figure 4.11: A 1.2% agarose gel containing different steps of tRNA puriﬁcation. 1 and 2- Samples the supernatant of the precipitation with ethanol. 4- Samples of the pellet resultant phenol extraction and ethanol precipitation. 6- pellet obtained with the addition of 1NaCl in acetate buffer. 8- Supernatant obtained after the puriﬁcation step with 1NaCl in acetate buffer. 10- Pellet obtained after the last precipitation step. M-NZYDNA Ladder III.

Since RNA puriﬁcation with multiple precipitation did not work, we attempted a different protocol. In this case, after the phenol extraction and ethanol precipitation, the pellet was resuspended with 0.3M

58 sodium acetate (pH 5.2) and 0.5 volumes of isopropyl alcohol, and incubated at room temperature. In this step, pDNA and large molecular weight RNA will be precipitated (Kelmers u. a., 1965). The tRNA and remaining contaminants were precipitated with 0.5 volumes of isopropyl alcohol. Figure 4.12 shows a 1.2% agarose gel containing samples of the purification is observed. In this figure, 1 and 2 contain samples of the recovered pellet after phenol extraction and ethanol precipitation. 3 shows a sample of the recovered pellet after the purification with 0.3 M sodium acetate at ph 5.2 method. With is method, both pDNA and most of all the other RNAs were removed.

Figure 4.12: A 1.2% agarose gel containing different steps of tRNA puriﬁcation. 1 and 2-Samples the supernatant of the precipitation with ethanol. 3-Pellet sample after the puriﬁcation with 0.3 M sodium acetate. M-NZYDNA Ladder III.

tRNA was further purified with an anion exchange chromatography. The resin used was DEAE sepharose and as buffers 10 mM Tris-HCl (pH 8) (equilibrium) and 1M NaCl, 10 mM Tris-HCl (pH 8) (elution). An anion exchange chromatography is a process that separates based on molecules charge. The resin is coated with a positively charged counter-ions and will bind to negatively charged molecules. In the equilibrium phase, all cations are bonded to counter ions present in the equilibration buffers. When the sample is injected, negatively charged molecules will bind to the resin. The unbounded molecules are washed out. The elution is usually perform with a gradient to increase of ion strength. The molecules are disordered according to the number of negativity charged groups. In this case, the charge phosphate from tRNA will bind to the matrix. When the ion strength exceed the strength of the tRNA it will detach and eluted from the column. Figure 4.13 shows the chromatogram obtained from tRNA purification with anion exchange chromatography. The column was equilibrated with 3 column volumes of 10 mM Tris-HCl, pH 8. 1 mL of sample was injected, and the column was washed with the same buffer. During the was a peak is visible. The elution was made with a step of volumes gradient where the percentage of 1M NaCl buffer in the flowtrough (%B) went from 0 to 100. During the gradient, only one peak appeared. Two 1.2% agarose gels containing the samples collected from the peaks present in the AEC chromatogram are observed in figure 4.14.Figure 4.14a shows the peak that appear during washing. Since no nucleic acids are visible, the peak may correspond to contaminants such as proteins. The second peak samples are observed in figure 4.14b. It seems that pure tRNA as obtained.

59 Figure 4.13: AEC chromatogram of tRNA purification. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line), the conductivity of the flowtrough in mS/cm (blue line) and the the percentage of 1M NaCl buffer in the flowtrough (%B) (orange line).

(a) (b)

Figure 4.14: AEC chromatogram of tRNA purification and 1.2% agarose gel of the selected fractions. 4.14a) AEC chromatography with a gradient elution from 30 to 70% of NaCl buffer. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line), the conductivity of the flowtrough in mS/cm (blue line), and the percentage of 1M NaCl buffer in the flowtrough (%B) (orange line). 4.14b) A 1.2% agarose gel containing: 1 to 2- Fractions from the first peak; 2 to 9- The selected fractions corresponding to tRNA peak; 10-Feed sample. M-NZYDIA Ladder III.

Considering that the AEC purification with a gradient presented only on peak, a chromatography with a step elution was design. The elution step was set to be with 45% of 1 M NaCl buffer. Figure 4.15 shows the AEC chromatogram of tRNA purification with a 45% step elution and a 1.2% agarose gel of the selected fractions. In the chromatogram (figure 4.15a) it is observed that 2 two peaks are maintained. It is also noted that the tRNA peak is more condensed. This was verified with in the 1.2% agarose gel (figure 4.15b). The fractions containing tRNA were reduced from 7 to 4. The first peak did not contain any nucleic acid as before.

To confirm if the first peak contained any protein, a SDS-gel containing samples from fraction of the first peak from different runs, was run. The gel was stained with silver stain. In figure 4.16 the gel is observed. The band visible in this gel may justify the peak in the chromatograms.

60 (a) (b)

Figure 4.15: AEC chromatogram of tRNA purification and 1.2% agarose gel of the selected fractions. 4.14a) AEC chromatography with a elution step of 45% NaCl buffer. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line), the conductivity of the flowtrough in mS/cm (blue line), and the percentage of 1M NaCl buffer in the flowtrough (%B) (orange line). 4.14b) A 1.2% agarose gel containing: 1 to 5- Fractions from the first peak; 6 to 9- The selected fractions corresponding to tRNA peak; 11-Feed sample. M-NZYDIA Ladder III.

Figure 4.16: A SDS-page gel silver stained containing samples from the ﬁrst peak of tRNA puriﬁcation chromatogram. Marker: Precision Plus Protein Standards duo Color (Bio Rad)

4.4 GFP puriﬁcation

GFP produced from the plasmids pETGFP and pEXP5-NT/GFP was purified to be use for charactering the protein produced in the cell-free systems. First the cells were cultured using the protocols described in the section 3.6.1. The production was verified by observing the cells with a Leica DMLB microscope. The figure 4.7 represents the E.coli cells containing the GFP produced from pETGFP (figure 4.17a) and pEXP5-NT/GFP (figure 4.17b).

(a) (b)

Figure 4.17: E.coli cells containing the GFP produced from pETGFP (figure 4.17a) and pEXP5-NT/GFP (figure 4.17b) seen with a flurescence microscope with blue filter.

After this verification the GFP was purified. GFP produced from the pETGFP plasmid was purified by

61 HIC chromatografy on the bench. HIC separates proteins and other biomolecules from a crude lysate based on differences in hydrophobicity. Proteins best suited for purification by HIC include those with hydrophobic surface regions and able to withstand exposure to salt concentrations in excess of 2 M ammonium sulphate (Murphy u. a., 2011). In this case, 4 M ammonium sulphate is used to equilibrate the column. In a high salt concentration environment, the GFP hydrophobic groups become exposed and bound to the matrix. During the washing, the concentration of salt is lowered by using 2 M and 1.3 M ammonium sulphate buffer. This way, the proteins with less hydrophobic regions are washed out. The elution was made with a low salt (TE) buffer (10 mM Tris, 10 mM EDTA, pH 8). By lowering the salt concentration, the hydrophobic groups will return to the interior of the protein, and they detach from the matrix. This way, pure GFP is eluted from the column. The quality of purification was analysed with a SDS-PAGE gel. Figure 4.18 shows a SDS-PAGE gel stained with comassie blue with samples of washing and elution steps of the GFP HIC purification. It is observed that during the elution, step 4 fractions contained pure and almost pure GFP with a size of 33 kD. It sould also be noted that during washing (first 3 column), a high size proteins are eluted.

Figure 4.18: A 12% acrylamide gel stained with comassie blue containing samples from the washing and elution of GFP HIC puriﬁcation. Marker: Precision Plus Protein Standards duo Color (Bio Rad)

GFP produced by pEXP5-NT/GFP was purified with a different chromatografy process. Because pEXP5-NT/GFP have a N-terminal peptide containing 6× tag, it was possible to purify by affinity chromatografy. This chromatography is based on the ability of reversible adsorption of biomolecules trough bio-specific interactions on the ligant. In this case a metal affinity chromatography (IMAC) was performed. This chromatography is based on the specific coordinate covalent bonds of amino acids (histidine in particular) to metals. A Ni-sepharose resin was used, which is precharged with Ni2+. Ni2+ usually is the preferred metal ion to purify proteins containing his-tag. To detach the tag from the matrix, buffer containing imidazole is used. Imidazole is a ring compound present in histidine, which have electron donor groups that form bonds with the immobilised transition metal (Bornhorst und Falke, 2000). To perform this chromatography, three buffers containing imidazole were use: an equilibration buffer containing 20 mM, a washing buffer containing 250 mM, and an elution buffer containing 500 mM. Figure 4.19 shows two 15% acrylamide SDS PAGE gels of the GFP purification by IMAC chromatography. The samples observed in the figure 4.19a belong to a IMAC chromatography before imidazole concentration optimization. The equilibration and washing buffer both had 10 mM imidazole. Comparing the gel in figure 4.19a with the figure to the gel after optimization (4.19b), the latter has less unwanted

62 protein bonded to the matrix. In the ﬁrst gel, a feeding and a washing sample as also presented. In both gels, two prominent bands are present in the elution fractions. The top band has 33kD (which is with approximately 27 kD is also visible. This band does not seem to be present on the feed. Since GFP protein with the tag has 27 kD, the lower band may correspond to it. This band is so salient that it is unlikely to be a non speciﬁc bond to the matrix.

(a) (b)

Figure 4.19: Two 15% acrylamide SDS PAGE gels containing samples of GFP puriﬁcation by IMAC chromatography. 4.19a) 15% acrilamide gel containing: 1- Feeding sample: 2 to 4- Elution samples containing GFP; 5- Washing sample. 4.19b) 15% acrylamide gel containing two elution samples with GFP after the optimization of imidazole concentration in the buffer used. M- Precision Plus Protein Standards duo Color (Bio Rad)

To test if the lower band has the 6× His tag a western blot using His-tag anti-body was used. Figure 4.20, shows a 15% acrylamide gel stained with comassie blue containing samples from the washing (3) and elution (1 and 2) of GFP purified by IMAC. Below in the figure 4.20, a western blot with His-tag ant- body with the same samples as the acrilamide gel. Only one band was visible in the western blot: only the upper band has the His tag. By this analysis, it is safe to say that the protein is being degraded in the fusion site. The samples were run again in a SDS-PAGE gel to observe if the degradation increased over time. The results showed that the GFP containing His-tag stayed the same throughout time. So, the degradation should have occurred during chromatography. Since these proteins had to have the tag to bind to the matrix, this degradation should have occurred during the elution. This degradation may oocur because the chromatography was perform with gravity-flow and the temperature was not controlled. To avoid protein degradation it is advised to spend little time as possible in an environment temperature bigger than 4oC.

4.5 S30 lysate preparation

The first step to prepare the S30 lysate is to chose the E. coli strain. The first cell free systems used strains that lacked a major Rnase, (i.e. rna and/or rne mutations) such as the MRE600 and the A19. These mutations increase the mRNA half-life (Kigawa u. a., 2004). The strain should be deficient in OmpT and lon protease activities to reduce proteolyic degradation of the target protein. In this study, the BL21(DE3) strain was chosen to produce the S30 lysate. This strain has a

63 Figure 4.20: A 15% acrylamide gel stained with comassie blue containing samples from the washing (3) and elution (1 and 2) of GFP puriﬁed by IMAC. A western blot with His-tag ant-body from with the same samples as the acrilamide gel on top. Marker: Precision Plus Protein Standards duo Color (Bio Rad).

λprophage carrying the t7 RNA polymerase gene and a lacIq. This allows the protein production from the plasmid containing the T7 promoter ( such as pEXP5-NT/GFP, pEXP5-NT/CALM3 and pETGFP). The strain also lacks OmpT endoproteinase, lon protease, and a major RNase –making them one of the best strains for the extract lysate. Besides, this strain doesn’t have a tight control for the production of T7 RNA polymerase, which means that even without induction, the strain has a basal expression. This way, some amount of T7 RNAP will be present in the lysate.

However, in recent studies a BL21-derivative strain containing extra copies of argU, ileY, and leuW tRNA gene has been used. This strain encodes tRNA species that recognize the arginine minor codons (AGA and AGG), the isoleucine minor codon (AUA), and the leucine minor codon (CUA), respectively (i.e. BL21 codon-plus strains, Stratagene, or Rosetta strains, Novagen). These results showed that lysates has 50% more activity for cell-free protein synthesis (Kigawa u. a., 2004).

Other important aspect that inﬂuences protein synthesis in a cell free system is the cell growth. The growth rate of the culture determines the ribosomal content of the extract (Zawada und Swartz, 2006), so a medium that supports rapid growth ( µ>0.5h−1) should be used for best results. Usually, 2× YT supplement with glucose and inorganic phosphate is the medium of choice because it produces better lysated and longer cell-free reactions. Studies demonstrated that, although the cell growth rate is similar in 2× YT and 2× YTPG, the lysates prepared from with cells grown in the latter have a lower phosphatase activity (Kim u. a., 2008). The glucose added is used for a more efﬁciently regeneration of ATP due to enrichment of glucose-metabolizing enzymes. It was also demonstrated that the regeneration of ATP due to glucose leads to a higher rate of protein synthesis in a cell free system.

In this study, the inoculum was prepared with 2× YT medium because the lag phase is smaller (Zawada, 2012). The cells were cultured in 2× YTPG medium, with a pH of 7.3 (since optimum pH for E. coli is typically about 7.2–7.4). The cells were harvested in the mid-log phase. Figure 4.21 SHOWS the average and standard deviations of the E.coli BL21(DE3) growth curve until the harvest. Comparing

64 the growth of the BL21(DE3) strain with (dark blue line) and without plasmid (ligth blue line), it seems that both cultures have a 2 hour lag phase followed by 2 hours exponential phase (without plasmid) OR 3 hours (for cells with plasmid). It seems that cells without plasmid grow faster, which is expected.

Figure 4.21: E.coli BL21 growth curve represented by average and the respective standard deviations until the harvest. the y axis corresponds to the optical density (OD600) of the cells. The x axis corresponds to the culture time in hours. The curve corresponding cell growth without plasmid is represented in light blue, and the dark blue represent cell growth with plasmid.

The second and most important step in the S30 lysate preparation is the biomass processing. The first step is to add S30 buffer to the biomass. Most protocols call for the addition of 1 mL per gram cell paste. This value can vary, since the use of more buffer leads to a more diluted cell lysate and improves clarification. The choice of volume used must be the most convenient for the lysis method used. However, the optimum volume of extract used for cell-free reactions will depend on the cell dilution factor. If more buffer is used to resuspend the cells, more extract will be needed in the reaction. In this case, a 1 mL per gram of cell paste was chosen to use. After resuspension, the cell must be lysated. This step is a key operation on lysate preparation. The first methods usually used a fresh press to produce the lysate. Nowadays the most common protocols use a specialised high-pressure homogenizer. However, this equipment is expensive so there is an effort to develop methods to lysate cells using a less expensive and more common equipment (Kwon und Jewett, 2015). There are already studies that use bead milling, bead vortexing (Liu u. a., 2005), and a sontication study from this year. In this study, a bead mill was the equipment chosen for this step. The method used was based on published studies (Sun u. a., 2013). In the first batch produced, 3 grams of beads per grams of cell were used and, in the next 5 batchs, 5 grams were used. The first 3 batches were produced with cell paste corresponding to 1L of cell culture. In the last 3, 2L of cell culture was used. For the 1L of cell, the cycles of bead milling were optimised and the final protocol obtained was 4 cycles of 30 seconds on, 30 seconds on ice. For the 2L of cell culture the protocol used was 6 cycles of 30 seconds on, 30 seconds on ice. After cell disruption, the lysate was centrifuged. Usually, 2 sequential centrifugations are preform at 30000× g, for 30 minutes. Recent studies indicate that centrifugation can be done at a lower g-force and

65 for less time (Kim u. a., 2006). In this study, the centrifugation was performed just one time at 3000× g for 30 minutes. The next step is a reaction named run-off. It was thought that this step allowed the ribosomes to finish translating their current mRNA substrate to be released for in vitro translation of the mRNA of interest (Jermutus u. a., 1998). The usual reaction was performed with the addition of several expensive components. In a recent study, these reagents were omitted, simplifying the process and its cost (Liu u. a., 2005). An added benefit of the empty runoff is that the absence of the reagents prevents unneces- sary dilution. However, without this addition, the 70S ribosomes do not dissociate into subunits. In this study, the run-off reaction was perform without the addition of reagents, at 37oC for 80 minutes. Most lysate preparation procedures include extensive dialysis after the runoff reaction. Typically this is done at 4oC for four 45 minutes periods versus 20 volumes of S30 buffer (changed every 45 minutes) using 6–8000 Da molecular weight cut-off dialysis tubing. Recent studies showed little if any benefit of the dialysis step for cell-free reactions (Liu u. a., 2005). In this study, the first 3 lysates were dialysed against 20 volumes of S30 buffer overnight using a 12-14000 Da dialysis tubing. After preparation, the S30 lysate must be stored in aliquots at −80oC sin ce higher temperatures can reduce the extract activity. Also, the lysate volume is usually obtained in small quantities. In most cases 2 mL of lysate is obtained from 1 L cell culture. Other important aspect is the protein concentration. Usually, the lysate must contain between 27-30 mg × mL−1 of protein (Liu u. a., 2005). However, extract characteristics vary from batch to batch. We evaluated the 6 lysate produced in two ways. First, the lysis efficiency was evaluated by compare the number of colonies presented in the lysates with a sample before lysis (as described in 3.7.3). Table 4.3 shows the efficiency of lysis for each lysate. It seems that any alteration to the lysis method had no impact on the lysis efficiency. Although there was some “apparent” difference between the first and the rest of the colonies –on the plate– since the mixture is so concentrated (1 mL per gram of cells), the lysis efficiency is not affected.

Lysate (η) 1 0.99 2 0.99 3 0.99 4 0.99 5 0.99 6 0.99

Table 4.3: Cell lysis efﬁciency of the 6 lysated produced calculated from equation 3.4.

This result does not mean that all the lysates had the same protein concentration. The table 4.4 shows the protein concentration found in the 6 lysates as well as a summary of the procedures used with each of them. The ﬁnal entry corresponds to the protein concentration on the lysate of Invitrogen cell-free kit. Not much conclusions can be taken from this. None of the lysates have the desired protein concentration. However it seems that the last one is closer that the other. This one was produced with cells not containing plasmid. This low protein concentration may be due to the lysis equipment used. The bead mill available in the lab did not allow to chose the velocity as the ones described on other

66 studies. Moreover, the cells were lysed all at once and then transferred to the centrifugation tubes; since the solution was very viscous, during the transference some of solution was lost. Other studies did the lysis and centrifugation in the same tubes (Sun u. a., 2013). To understand better if the low protein concentration is due to the lysis equipment, another lysis method should be tested, such as high-pressure homogenizer. Since it is widely used for this process it would be easer to compare the results.

Lysate Cell culture Bead mill lysis Dialysis Protein concentration (mg × mL−1) 1 1L 3 grams and 4 cycles yes 9.78 2 1L 5 grams and 4 cycles yes 14.66 3 1L 5 grams and 4 cycles yes 10.29 4 2L 5 grams and 6 cycles no 10.87 5 2L 5 grams and 6 cycles no 19.82 6 2L 5 grams and 6 cycles no 26.3 Lysate from kit - - - 30.32

Table 4.4: Protein concentration for the 6 different lysates. The last entry corresponds to the protein concentration from the lysate of Invitrogen cell-free kit.

4.6 Cell-free protein synthesis

The first step towards the construction of a cell-free platform was to test the plasmids pEXP5-NT/GFP and pETGFP.In theory, this plasmid has all the components necessary to be used as a expression vector in transcription/translation E.coli cell-free system. The test was performed with a Expressway Cell-Free E. coli Expression System (Invitrogen). This kit contains an optimised E. coli extract, produced based on the original protocol (Zubay, 1973),a reaction buffer composed of an ATP regeneration system, a feed buffer containing salts and other substances to replenish depleted or degraded components, all amino acids, T7 RNA polymerase, and the plasmid pEXP5-NT/CALML3 for use as a positive control. The tests were performed as described in 3.8.1. pEXP5-NT/GFP was tested first. 4 reactions were prepared: 1 containing the positive control (pEXP5-NT/CALML3) and 3 containing the plasmid pEXP5-NT/GFP. Figure 4.22 shows a 15% acrilamide SDS-PAGE with samples of the 4 reactions. In the samples 2 to 4, corresponding to the reactions with pEXP5-NT/GFP plasmids, is visible a bands with approximately 33 kD that is not visible in the reaction with pEXP5-NT/CALML3. However, in the samples corresponding to the positive control, the band corresponding to the CALML3 protein (19 kD) is not visible. This may be due to the acrilamide concentration used, which only allows to separate proteins with a kDA higher than 15 kD. Besides, the lysate seems to have proteins with the same size. To confirm the production of CALML3 protein a western blot with His-tag or CALML3 anti-body could be used. The GFP production was confirmed by measuring the fluorescence of active GFP using a VersaFluor fluorometer with EX490/10 excitation filter and EX510/10 emission filter (Bio-rad). The GFP concentration was calculated by a concentration curve measured with pure GFP protein produced from BL21(DE3) cells containing pEXP5-NT/GFP, as described earlier. Using this kit, we were able to produce 9.25 +- 5.79 µg × µL−1. The high standard deviation may be due to operation errors since we are dealing with

67 Figure 4.22: A 15% acrilamide SDS-PAGE gel containg samples of pEXP5-NT/GFP tests using Ex- pressway Cell-Free textitE. coli Expression System (Invitrogen). 1) Test containing the control vector (pEXP5-NT/CALML3); 2 to 4) Tests containg pEXP5/GFP as expression vector. M) Precision Plus Pro- tein Standards duo Color Marker (Bio Rad). small volumes. Then, pETGFP was tested. The same 4 tests were perform, but instead of using pEXP5-NT/CALML3 as a positive control, we used pEXP5-NT/GFP. The results can seen in figure 4.23. It seems that in the first sample (corresponding to the positive control) a band with approximately 33 kD is observed. However, in the other samples, any band with around 33 kD is observed. The presence of a lac operator in front of the MCS, and a lacI gene from the lac operon that codes for the lac repressor (LacI) can explain these results. The lacI gene produces a protein (LacI) that binds in a sequence specific manner to the major groove of the operator sequence and blocks T7 RNA polymerase from binding the promoter sequence. In order to unblock it, lactose must be present. Lactose will bind to LacI and induce a conformation change in the LacI structure that makes it incapable of binding to the lac operon. Since IPTG (which structurally mimics lactose) was not added to the the reaction, the T7 RNA polymerase was not able to bind to the T7 promoter and, thereafter, the protein was not produce.

Figure 4.23: A 15% acrilamide SDS-PAGE gel containg samples of pETGFP tests using Expressway Cell-Free textitE. coli Expression System (Invitrogen). 1) Test containing the control vector (pEXP5- NT/GFP); 2 to 4) Tests containg pETGFP as expression vector. M) Precision Plus Protein Standards duo Color Marker (Bio Rad).

Since adding (and optimising) IPTG to the reaction would be adding other variable to a highly complex system, we decided to not use pETGFP to construct the cell-free system. All the tests bellow were made using pEXP5-NT/GFP as a expression vector, since it seems to be expressed and this systems and it

68 GFP was easily detected. One variable that inﬂuences the production of active protein is the incubation temperature. Usually, the protein synthesis reaction incubation temperature ranges from 30oC to 37oC, and the optimal temperature depends on the solubility of the target protein (Zawada, 2012). In most of cases, the highest yield is obtained at higher temperatures (i.e. 37oC). However, many studies suggest that a lower incubation temperature improves the activity of GFP protein (Iskakova u. a., 2006). Since in vivo GFP production from pEXP5NT/GFP was optimised to a temperature of 30oC, this temperature was also tested to produce in vitro with the Expressway cell-free kit. Figure 4.24 shows a histogram with the GFP concentration produced at 37oC and 30oC. It seems that at 30oC more active GFP is produced, as some studies already presented (Iskakova u. a., 2006).

Figure 4.24: A histogram containing the GFP produced with Expressway cell-free kit at two incubation temperatures- 37oC (dark blue bar) and 37oC (light blue bar) and the respective standard deviations.

The 6 lysates produced were also tested with the Expressway cell-free kit. The lysate from the kit was used as positive control. The tests were perform at the temperature recommended for the kit (37oC). Figure 4.25 shows the results obtained. It seems that none of the lysates produced protein with a comparable amount of the kit lysate. This was not a surprise for a number of reason: ﬁrst, the kit is optimised for the production with the lysate contained in the kit; second: The protein concentration present in the lysates ( table 4.3) was lower than the one from the kit. The last lysate showed a slightly higher protein production, when comparing to the other ﬁve. This one was also the one with a higher protein concentration. Taking into account these results and the lysate volume achieved, the lysate 6 was the one that could be considered for further studies.

Figure 4.25: A histogram containing the average relative ﬂurescence (RFU) of the produced GFP in the 6 lysates and the lysate from the kit.

After chosing the template and the lysate, the energy system was explored. The Cytomim system was chosen to used in this cell-free system. This energy system expores the activation of oxidative phos-

69 phorylation. In the presence of thiamine pyrophosphate (TTP) and ﬂavin adenine dinucleotide (FAD), acetyl phosphate is generated through the condensation of pyruvate and inorganic phosphate (Lian u. a., 2014). Then, the acetyl phosphate is catalysed by endogenous acetyl kinase in the E. coli S30 lysate.

This system requires the presence of oxygen for the generation of acetyl phosphate and produces H2O2 as a by-product, but it is sufficiently degraded by endogenous catalysis activity (Kim und Kim, 2009). The Cytomim system requires inverted membrane vesicles to perform oxidative phosphorylation. These vesicles are formed during the lysis step, usually a high pressure homogenization, and remain in the final lysate. This system was tested as described in 3.8.2. The lysate 6 and pEXP5-NT/GFP were used. The GFP obtained was measured in term of fluorescence of active GFP. 54.50 +- 3,25 relative fluorescence units of GFP were obtained. This system was further optimised. The most sensitive variable of a E.coli is the magnesium concentration (Zawada, 2012)(Sun u. a., 2013). The standard conditions (8mM) should provide a acceptable activity, nevertheless the different concentrations concentration should be tested. In this case, the magnesium concentration was varied from 2 to 12 mM in increments of 2mM. The other variable optimised was the plasmid concentration. Finally, taking into account that the lysate used has a low protein concentration, increasing the volume used was also screened. In figure 4.26 the results of the screens are presented.

(a) (b)

(c)

Figure 4.26: Optimisation screens of E. coli cell-free protein synthesis containing the cytomimic system as a energy system, pEXP5-NT/GFP as a template and the lysate 6. 4.26a) Active GFP produced, in relative fluorescence units, with the variation of magnesium concentration from 2mM to 12mM in increments of 2mM. 4.26b) Active GPF produced, in relative fluorescence units, with the variation of template (pEXP5-NT/GFP) concentration in µg × mL−1. 4.26c) Active GPF produced, in relative fluorescence units, with the variation of lysate volume (%).

In the ﬁgure 4.26, the graphics correspondent to the volume increase screens are presented. Figure

70 4.26a shows the active GFP produced, in relative fluorescence units, with the increment of magnesium concentration. It seems that the optimal Mg2+ is between 6 and 8 mM. However, these results can only be applied to this lysate batch. For every lysate, magnesium concentration must be optimised (Zawada, 2012). In case of plasmid concentration optimisation (figure 4.26b), it seems that from 33 µg × mL−1, increasing the concentration does not have much effect in protein production. This was already observed in other studies (Kai u. a., 2013). Finally, the volume of lysate added was tested (4.26c). Since the lysate buffer has a lower protein concentration, an increase in the lysate volume added should increase the protein produced. This seems to be observed. Besides these screens, it would be interesting to test variations in potassium and T7 RNA polymerase concentrations. Another possible research direction could be to test other energy systems (e.g. dual energy system or maltose energy system). Finally, it seems that the configuration also affects protein production. With the energy system used in this dissertation, a good gas exchange system is required, so using a thin film configuration would be interesting to test.

71 72 Chapter 5

Conclusions

Cell-free protein synthesis has emerged as an important and effective alternative to both cell-based expression systems and solid-phase protein synthesis. The numerous vantages over in vivo systems, such as the ability to monitor and control the reaction, makes these systems not only attractive for protein production, but also opens the doors to new possibilities for applications in biotechnology, ranging from microscale to industrial scale and diverse areas including protein microarrays, biotherapeutics, biomaterials, and synthetic biology (Whittaker, 2013). In recent years, it has been an effort overcome the cell-free systems challenges, such as the ability to reliably synthesize any biologically active protein in a universal platform, the lack of a cost effective and scalable CFPS platform, and the inability to carry out humanized glycosylation patterns (Carlson u. a., 2012).

In this dissertation, the ﬁrst steps to construct a robust and cost effective platform for in vitro protein synthesis in a coupled transcription–translation system were taken. First, an adequate DNA template (pEXP5-NT/GFP) was designed, containing all the key components and the simplicity necessary to be successfully used in these systems. The incorporation of GFP as the reported gene makes the production analysis simpler and more direct, when compared to the incorporation of radiolabelled amino acids traditionally used.

The use of alkaline lysis and HIC puriﬁcation to plasmid puriﬁcation allow us to achieved highly pure plasmid in a higher quantity and lower cost than using available commercial kits. Using SEC chromatography as desalting method proved to be better than dialysis. This step is important not only maintain the plasmid integrity but also high salt concentrations may inhibit protein production. Other important aspect is the strain used to plasmid production. A strain containing mutations in recA and endE (such as DH5α or TOP10) should be used.

Purification of total tRNA was also tested in this dissertation. The addition of pure tRNA to a cell-free systems not only increase the protein production, but also ensures a better control over the reaction. The tRNA purification was achieved by extracting the nucleic acids by phenol extraction, then DNA was then separated with sodium acetate at pH 5 and the remaining contaminants were removed by anion exchange chromatography (Kelmers u. a., 1965). This protocol worked better than expected, since almost all rRNA was removed in the DNA separation step. The use of phenol extraction simplifies

73 the purification because the cells are not lysed, and most proteins are removed. The anion exchange chromatography with a step elution allows a rapid purification and in a high concentration. This protocol could be easily scaled-up. One of the most important steps in the construction of a cell-free system platform is the preparation of the lysate. This preparation should be easy and reproducible (Shrestha u. a., 2012). One of the key points in the E. coli strain used. A strain lacking major Rnase and deficient in OmpT and lon protease was chosen. It is also important that the strain recognises the promoter used in the DNA template. BL21(DE3) was used because it has all the characteristics referred and BL21-derivatives are used in many studies (Ahn u. a., 2005). The second, and most important step is the cell disruption. Usually mechanical methods are applied, such as high pressure homogeniser. In recent years, studies successfully using bead vortexing (Shrestha u. a., 2012) and sonication (Kwon und Jewett, 2015) were published. In this dissertation a bead milling was used to produce the lysate. Although the cell lysis was efficient in all the attempts, the protein concentration never reached the desired values. We finished our study in a attempt to construct the cell-free system from scratch. The incubation temperature was first studied. As in previous studies (Iskakova u. a., 2006), active GFP was better produced at lower temperatures (in this case at 30oC). The cell-free system constructed uses the cytomim system as an energy source. This system explores the activation of oxidative phosphorilation and it is dependent on the presence of inverted membranes (produced during lysis) and an efficient gas exchange. In order to explore this energy system, the last lysate produced and the pEXP5-NT/GFP plasmid were used. Unfortunately, the protein produced by this system was not comparable to the ones produced by commercial kits. However, we attempted to optimised some of the variables. Cell-free system seem to be very sensible to magnesium concentrations (Zawada, 2012). For the lysate, in this dissertation, the ideal magnesium concentration appears to be between 6 mM and 8 mM. The plasmid concentration was also screen. As previous reported (Kai u. a., 2013), increasing the plasmid concentration from 33 µg × µL−1 does not have much effect in active protein produced. Finally, the lysate volume was also screen. Since the lysate have a lower protein concentration, increasing the volume added to the reaction should increase the protein production. This is observed to the volumes tested.

Future Work

Although the main goal of construct a reproducible E. coli cell-free protein synthesis system platform was not achieved, some major step were taken in this path. In the future, it would be important to improve the lysate production. Different lysis mechanism (such as high pressure homogeniser or a sonicator) should be tested. Also, lowering the centrifugation speed and produce the cell culture with pH control could affect results. Another possible research direction could be to test other energy systems, such as dual energy system and maltose energy system. Finally, it seems that the conﬁguration also affects protein production: it would important to experiment with a bilayer system or a thin ﬁlm approach. Finally, in a not so near future, it would be interesting to apply this systems to drug delivery or even to the study of minimal cells.

74 Bibliography

[Ahn u. a. 2005] AHN, Jin-Ho ; CHU, Hun-Su ; KIM, Tae-Wan ; OH, In-Seok ; CHOI, Cha-Yong ; HAHN,

Geun-Hee ; PARK, Chang-Gil ; KIM, Dong-Myung: Cell-free synthesis of recombinant proteins from PCR-ampliﬁed genes at a comparable productivity to that of plasmid-based reactions. In: Biochemical and biophysical research communications 338 (2005), Nr. 3, S. 1346–1352

[Anderson u. a. 2008] ANDERSON, Karen S. ; RAMACHANDRAN, Niroshan ; WONG, Jessica ; RAPHAEL,

Jacob V. ; HAINSWORTH, Eugenie ; DEMIRKAN, Gokhan ; CRAMER, Daniel ; ARONZON, Dina ; HODI,

F S. ; HARRIS, Lyndsay u. a.: Application of protein microarrays for multiplexed detection of antibodies to tumor antigens in breast cancer. In: Journal of proteome research 7 (2008), Nr. 4, S. 1490–1499

[Arumugam u. a. 2014] ARUMUGAM, Thangavelu U. ; ITO, Daisuke ; TAKASHIMA, Eizo ; TACHIBANA,

Mayumi ; ISHINO, Tomoko ; TORII, Motomi ; TSUBOI, Takafumi: Application of wheat germ cell-free protein expression system for novel malaria vaccine candidate discovery. In: Expert review of vaccines 13 (2014), Nr. 1, S. 75–85

[Bancroft u. a. 1973] BANCROFT, F C. ; WU, Guang-Jer ; ZUBAY, Geoffrey: Cell-free synthesis of rat growth hormone. In: Proceedings of the National Academy of Sciences 70 (1973), Nr. 12, S. 3646– 3649

[Behnke 1983] BEHNKE, U: RK Scopes: Protein Puriﬁcation. Principles and Practice (aus der Serie: Springer Advanced Texts in Chemistry, Herausgeber Ch. R. Cantor). 282 Seiten, 28 Tab., 145 Abb. Springer-Verlag, New York, Heidelberg, Berlin 1982. Preis: 79,–DM. In: Food/Nahrung 27 (1983), Nr. 8, S. 809–810

[Binz u. a. 2004] BINZ, H K. ; AMSTUTZ, Patrick ; KOHL, Andreas ; STUMPP, Michael T. ; BRIAND,

Christophe ; FORRER, Patrik ; GRUTTER¨ , Markus G. ; PLUCKTHUN¨ , Andreas: High-afﬁnity binders selected from designed ankyrin repeat protein libraries. In: Nature biotechnology 22 (2004), Nr. 5, S. 575–582

[Bornhorst und Falke 2000] BORNHORST, Joshua A. ; FALKE, Joseph J.: Puriﬁcation of proteins using polyhistidine afﬁnity tags. In: Methods in enzymology 326 (2000), S. 245

[Borsook 1950] BORSOOK, Henry: Protein turnover and incorporation of labeled amino acids into tissue proteins in vivo and in vitro. In: Physiological reviews 30 (1950), Nr. 2, S. 206–219

75 [Bozell und Petersen 2010] BOZELL, Joseph J. ; PETERSEN, Gene R.: Technology development for the production of biobased products from bioreﬁnery carbohydrates– The US Department of Energys ”top 10” revisited. In: Green Chemistry 12 (2010), Nr. 4, S. 539–554

[Bugaut und Balasubramanian 2012] BUGAUT, Anthony ; BALASUBRAMANIAN, Shankar: 5?-UTR RNA G-quadruplexes: translation regulation and targeting. In: Nucleic acids research 40 (2012), Nr. 11, S. 4727–4741

[Bulleid u. a. 1992] BULLEID, NJ ; BASSEL-DUBY, RS ; FREEDMAN, RB ; SAMBROOK, JF ; GETH-

ING, MJ: Cell-free synthesis of enzymically active tissue-type plasminogen activator. Protein folding determines the extent of N-linked glycosylation. In: Biochem. J 286 (1992), S. 275–280

[Bundy u. a. 2008] BUNDY, Bradley C. ; FRANCISZKOWICZ, Marc J. ; SWARTZ, James R.: Escherichia coli-based cell-free synthesis of virus-like particles. In: Biotechnology and bioengineering 100 (2008), Nr. 1, S. 28–37

[Bundy und Swartz 2010] BUNDY, Bradley C. ; SWARTZ, James R.: Site-speciﬁc incorporation of p- propargyloxyphenylalanine in a cell-free environment for direct protein- protein click conjugation. In: Bioconjugate chemistry 21 (2010), Nr. 2, S. 255–263

[Calhoun und Swartz 2005a] CALHOUN, Kara A. ; SWARTZ, James R.: An Economical Method for Cell- Free Protein Synthesis using Glucose and Nucleoside Monophosphates. In: Biotechnology progress 21 (2005), Nr. 4, S. 1146–1153

[Calhoun und Swartz 2005b] CALHOUN, Kara A. ; SWARTZ, James R.: Energizing cell-free protein synthesis with glucose metabolism. In: Biotechnology and bioengineering 90 (2005), Nr. 5, S. 606– 613

[Carlson u. a. 2012] CARLSON, Erik D. ; GAN, Rui ; HODGMAN, C E. ; JEWETT, Michael C.: Cell-free protein synthesis: applications come of age. In: Biotechnology advances 30 (2012), Nr. 5, S. 1185– 1194

[Caschera und Noireaux 2014] CASCHERA, Filippo ; NOIREAUX, Vincent: Synthesis of 2.3 mg/ml of protein with an all Escherichia coli cell-free transcription–translation system. In: Biochimie 99 (2014), S. 162–168

[Casteleijn u. a. 2013] CASTELEIJN, Marco G. ; URTTI, Arto ; SARKHEL, Sanjay: Expression without boundaries: cell-free protein synthesis in pharmaceutical research. In: International journal of pharmaceutics 440 (2013), Nr. 1, S. 39–47

[Cayama u. a. 2000] CAYAMA, Edmundo ; YEPEZ´ , Antonio ; ROTONDO, Fernando ; BANDEIRA, Ed-

uardo ; FERRERAS, Ana C. ; TRIANA-ALONSO, Francisco J.: New chromatographic and biochemical strategies for quick preparative isolation of tRNA. In: Nucleic acids research 28 (2000), Nr. 12, S. e64–e64

76 [Chalmeau u. a. 2011] CHALMEAU, Jerome ; MONINA, Nadezda ; SHIN, Jonghyeon ; VIEU,

Christophe ; NOIREAUX, Vincent: α-Hemolysin pore formation into a supported phospholipid bilayer using cell-free expression. In: Biochimica et Biophysica Acta (BBA)-Biomembranes 1808 (2011), Nr. 1, S. 271–278

[Cherubini 2010] CHERUBINI, Francesco: The bioreﬁnery concept: using biomass instead of oil for producing energy and chemicals. In: Energy Conversion and Management 51 (2010), Nr. 7, S. 1412– 1421

[Chumpolkulwong u. a. 2006] CHUMPOLKULWONG, Namthip ; SAKAMOTO, Kensaku ; HAYASHI, Akiko ;

IRAHA, Fumie ; SHINYA, Naoko ; MATSUDA, Natsuko ; KIGA, Daisuke ; URUSHIBATA, Akiko ; SHI-

ROUZU, Mikako ; OKI, Kenji u. a.: Translation of ”rare” codons in a cell-free protein synthesis system from Escherichia coli. In: Journal of structural and functional genomics 7 (2006), Nr. 1, S. 31–36

[Cloninger u. a. 2008] CLONINGER, Cheri ; FELTON, Marilyn ; PAUL, Bonnie ; HIRAKAWA, Yasuko ;

METZENBERG, Stan: Control of pH during plasmid preparation by alkaline lysis of Escherichia coli. In: Analytical biochemistry 378 (2008), Nr. 2, S. 224–225

[Contreras-Mart´ınez und DeLisa 2007] CONTRERAS-MART´INEZ, Lydia M. ; DELISA, Matthew P.: In- tracellular ribosome display via SecM translation arrest as a selection for antibodies with enhanced cytosolic stability. In: Journal of molecular biology 372 (2007), Nr. 2, S. 513–524

[Crestﬁeld u. a. 1955] CRESTFIELD, Arthur M. ; SMITH, Kendric C. ; ALLEN, Frank W.: The preparation and characterization of ribonucleic acids from yeast. In: J. biol. Chem 216 (1955), Nr. 1, S. 185–193

[Davis 2004] DAVIS, Benjamin G.: Mimicking posttranslational modiﬁcations of proteins. In: Science 303 (2004), Nr. 5657, S. 480–482

[Dreyfus 1988] DREYFUS, Marc: What constitutes the signal for the initiation of protein synthesis on Escherichia coli mRNAs? In: Journal of molecular biology 204 (1988), Nr. 1, S. 79–94

[Du u. a. 2009] DU, Liping ; GAO, Rong ; FORSTER, Anthony C.: Engineering multigene expression in vitro and in vivo with small terminators for T7 RNA polymerase. In: Biotechnology and bioengineering 104 (2009), Nr. 6, S. 1189–1196

[Dudley u. a. 2015] DUDLEY, Quentin M. ; KARIM, Ashty S. ; JEWETT, Michael C.: Cell-free metabolic engineering: Biomanufacturing beyond the cell. In: Biotechnology journal 10 (2015), Nr. 1, S. 69–82

[Endo und Sawasaki 2004] ENDO, Yaeta ; SAWASAKI, Tatsuya: High-throughput, genome-scale protein production method based on the wheat germ cell-free expression system. In: Journal of structural and functional genomics 5 (2004), Nr. 1-2, S. 45–57

[Endoh u. a. 2006] ENDOH, Takashi ; KANAI, Tamotsu ; SATO, Yuko T. ; LIU, David V. ; YOSHIKAWA,

Kenichi ; ATOMI, Haruyuki ; IMANAKA, Tadayuki: Cell-free protein synthesis at high temperatures using the lysate of a hyperthermophile. In: Journal of biotechnology 126 (2006), Nr. 2, S. 186–195

77 [Ezure u. a. 2010] EZURE, Toru ; SUZUKI, Takashi ; SHIKATA, Masamitsu ; ITO, Masaaki ; ANDO, Eiji: A cell-free protein synthesis system from insect cells. In: Cell-Free Protein Production. Springer, 2010, S. 31–42

[Forster und Church 2007] FORSTER, Anthony C. ; CHURCH, George M.: Synthetic biology projects in vitro. In: Genome research 17 (2007), Nr. 1, S. 1–6

[Freitas u. a. 2006] FREITAS, SS ; SANTOS, JAL ; PRAZERES, DMF: Optimization of isopropanol and ammonium sulfate precipitation steps in the puriﬁcation of plasmid DNA. In: Biotechnology progress 22 (2006), Nr. 4, S. 1179–1186

[Goerke und Swartz 2008] GOERKE, Aaron R. ; SWARTZ, James R.: Development of cell-free protein synthesis platforms for disulﬁde bonded proteins. In: Biotechnology and bioengineering 99 (2008), Nr. 2, S. 351–367

[Goshima u. a. 2008] GOSHIMA, Naoki ; KAWAMURA, Yoshifumi ; FUKUMOTO, Akiko ; MIURA, Aya ;

HONMA, Reiko ; SATOH, Ryohei ; WAKAMATSU, Ai ; YAMAMOTO, Jun-ichi ; KIMURA, Kouichi ;

NISHIKAWA, Tetsuo u. a.: Human protein factory for converting the transcriptome into an in vitro– expressed proteome. In: Nature methods 5 (2008), Nr. 12, S. 1011–1017

[Grifﬁths und Tawﬁk 2003] GRIFFITHS, Andrew D. ; TAWFIK, Dan S.: Directed evolution of an extremely fast phosphotriesterase by in vitro compartmentalization. In: The EMBO journal 22 (2003), Nr. 1, S. 24–35

[Harris und Jewett 2012] HARRIS, D C. ; JEWETT, Michael C.: Cell-free biology: exploiting the interface between synthetic biology and synthetic chemistry. In: Current opinion in biotechnology 23 (2012), Nr. 5, S. 672–678

[He 2008] HE, Mingyue: Cell-free protein synthesis: applications in proteomics and biotechnology. In: New biotechnology 25 (2008), Nr. 2, S. 126–132

[He und Khan 2005] HE, Mingyue ; KHAN, Farid: Ribosome display: next-generation display technologies for production of antibodies in vitro. (2005)

[He u. a. 2008a] HE, Mingyue ; STOEVESANDT, Oda ; PALMER, Elizabeth A. ; KHAN, Farid ; ERICSSON,

Olle ; TAUSSIG, Michael J.: Printing protein arrays from DNA arrays. In: Nature methods 5 (2008), Nr. 2, S. 175–177

[He u. a. 2008b] HE, Mingyue ; STOEVESANDT, Oda ; TAUSSIG, Michael J.: In situ synthesis of protein arrays. In: Current opinion in biotechnology 19 (2008), Nr. 1, S. 4–9

[He und Taussig 2001] HE, Mingyue ; TAUSSIG, Michael J.: Single step generation of protein arrays from DNA by cell-free expression and in situ immobilisation (PISA method). In: Nucleic acids research 29 (2001), Nr. 15, S. e73–e73

[Hodgman und Jewett 2012] HODGMAN, C E. ; JEWETT, Michael C.: Cell-free synthetic biology: thinking outside the cell. In: Metabolic engineering 14 (2012), Nr. 3, S. 261–269

78 [Ho¨ok¨ und Tang 2013] HO¨ OK¨ , Mikael ; TANG, Xu: Depletion of fossil fuels and anthropogenic climate change– A review. In: Energy Policy 52 (2013), S. 797–809

[Iskakova u. a. 2006] ISKAKOVA, Madina B. ; SZAFLARSKI, Witold ; DREYFUS, Marc ; REMME, Jaanus ;

NIERHAUS, Knud H.: Troubleshooting coupled in vitro transcription–translation system derived from Escherichia coli cells: synthesis of high-yield fully active proteins. In: Nucleic acids research 34 (2006), Nr. 19, S. e135–e135

[Jackson u. a. 2004] JACKSON, Alison M. ; BOUTELL, Joe ; COOLEY, Neil ; HE, Mingyue: Cell-free protein synthesis for proteomics. In: Brieﬁngs in functional genomics & proteomics 2 (2004), Nr. 4, S. 308–319

[Jang u. a. 1988] JANG, SK ; KRAUSSLICH¨ , HG ; NICKLIN, MJ ; DUKE, GM ; PALMENBERG, AC ;

WIMMER, E: A segment of the 5’nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. In: Journal of virology 62 (1988), Nr. 8, S. 2636– 2643

[Jennings und Bachmann 2008] JENNINGS, Gary T. ; BACHMANN, Martin F.: The coming of age of virus-like particle vaccines. In: Biological chemistry 389 (2008), Nr. 5, S. 521–536

[Jermutus u. a. 1998] JERMUTUS, Lutz ; RYABOVA, Lyubov A. ; PLUCKTHUN¨ , Andreas: Recent advances in producing and selecting functional proteins by using cell-free translation. In: Current opinion in biotechnology 9 (1998), Nr. 5, S. 534–548

[Jewett und Forster 2010] JEWETT, Michael C. ; FORSTER, Anthony C.: Update on designing and building minimal cells. In: Current opinion in biotechnology 21 (2010), Nr. 5, S. 697–703

[Jewett und Swartz 2004a] JEWETT, Michael C. ; SWARTZ, James R.: Mimicking the Escherichia coli cytoplasmic environment activates long-lived and efﬁcient cell-free protein synthesis. In: Biotechnol- ogy and bioengineering 86 (2004), Nr. 1, S. 19–26

[Jewett und Swartz 2004b] JEWETT, Michael C. ; SWARTZ, James R.: Rapid Expression and Puriﬁ- cation of 100 nmol Quantities of Active Protein Using Cell-Free Protein Synthesis. In: Biotechnology progress 20 (2004), Nr. 1, S. 102–109

[Jia u. a. 2009] JIA, Xinying ; OZAWA, Kiyoshi ; LOSCHA, Karin ; OTTING, Gottfried: Glutarate and N-acetyl-L-glutamate buffers for cell-free synthesis of selectively 15N-labelled proteins. In: Journal of biomolecular NMR 44 (2009), Nr. 2, S. 59–67

[Jiang u. a. 2002] JIANG, XiuPing ; OOKUBO, Yuji ; FUJII, Ikuo ; NAKANO, Hideo ; YAMANE, Tsu- neo: Expression of Fab fragment of catalytic antibody 6D9 in an Escherichia coli in vitro coupled transcription/translation system. In: FEBS letters 514 (2002), Nr. 2, S. 290–294

[Kai u. a. 2013] KAI, Lei ; DOTSCH¨ , Volker ; KALDENHOFF, Ralf ; BERNHARD, Frank: Artiﬁcial Environ- ments for the Co-Translational Stabilization of Cell-Free Expressed Proteins. In: PLoS ONE 8 (2013), 02, Nr. 2, S. e56637. – URL http://dx.doi.org/10.1371%2Fjournal.pone.0056637

79 [Kalmbach u. a. 2007] KALMBACH, Rolf ; CHIZHOV, Igor ; SCHUMACHER, Miria C. ; FRIEDRICH,

Thomas ; BAMBERG, Ernst ; ENGELHARD, Martin: Functional cell-free synthesis of a seven helix membrane protein: in situ insertion of bacteriorhodopsin into liposomes. In: Journal of molecular biology 371 (2007), Nr. 3, S. 639–648

[Kanda u. a. 1996] KANDA,T;TAKAI,K;YOKOYAMA,S;TAKAKU, H: Removing tRNA from a cell-free protein synthesis system for use in protein production. In: Nucleic acids symposium series, 1996, S. 319–320

[Kanter u. a. 2007] KANTER, Gregory ; YANG, Junhao ; VOLOSHIN, Alexei ; LEVY, Shoshana ; SWARTZ,

James R. ; LEVY, Ronald: Cell-free production of scFv fusion proteins: an efﬁcient approach for personalized lymphoma vaccines. In: Blood 109 (2007), Nr. 8, S. 3393–3399

[Kariko´ u. a. 2008] KARIKO´ , Katalin ; MURAMATSU, Hiromi ; WELSH, Frank A. ; LUDWIG,Janos´ ; KATO,

Hiroki ; AKIRA, Shizuo ; WEISSMAN, Drew: Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. In: Molecular Therapy 16 (2008), Nr. 11, S. 1833–1840

[Katayama u. a. 2010] KATAYAMA, Yukie ; SHIMOKATA, Kunitoshi ; SUEMATSU, Makoto ; OGURA,

Takashi ; TSUKIHARA, Tomitake ; YOSHIKAWA, Shinya ; SHIMADA, Hideo: Cell-free synthesis of cy- tochrome c oxidase, a multicomponent membrane protein. In: Journal of bioenergetics and biomembranes 42 (2010), Nr. 3, S. 235–240

[Katzen u. a. 2005] KATZEN, Federico ; CHANG, Geoffrey ; KUDLICKI, Wieslaw: The past, present and future of cell-free protein synthesis. In: Trends in biotechnology 23 (2005), Nr. 3, S. 150–156

[Kelmers u. a. 1965] KELMERS, AD ; NOVELLI, G D. ; STULBERG, MP: Separation of transfer ribonucleic acids by reverse phase chromatography. In: Journal of Biological Chemistry, 1965 240 (1965), Nr. ORNL-P–1177

[Kigawa u. a. 2008] KIGAWA, Takanori ; MATSUDA, Takayoshi ; YABUKI, Takashi ; YOKOYAMA, Shigeyuki: Bacterial Cell-Free System for Highly Efﬁcient Protein Synthesis. In: Cell-Free Protein Synthesis: Methods and Protocols (2008), S. 83–97

[Kigawa u. a. 2004] KIGAWA, Takanori ; YABUKI, Takashi ; MATSUDA, Natsuko ; MATSUDA, Takayoshi ;

NAKAJIMA, Rie ; TANAKA, Akiko ; YOKOYAMA, Shigeyuki: Preparation of Escherichia coli cell extract for highly productive cell-free protein expression. In: Journal of structural and functional genomics 5 (2004), Nr. 1-2, S. 63–68

[Kigawa u. a. 1999] KIGAWA, Takanori ; YABUKI, Takashi ; YOSHIDA, Yasuhiko ; TSUTSUI, Michio ; ITO,

Yutaka ; SHIBATA, Takehiko ; YOKOYAMA, Shigeyuki: Cell-free production and stable-isotope labeling of milligram quantities of proteins. In: FEBS letters 442 (1999), Nr. 1, S. 15–19

[Kigawa u. a. 2002] KIGAWA, Takanori ; YAMAGUCHI-NUNOKAWA, Emi ; KODAMA, Koichiro ; MATSUDA,

Takayoshi ; YABUKI, Takashi ; MATSUDA, Natsuko ; ISHITANI, Ryuichiro ; NUREKI, Osamu ; YOKOYAMA,

80 Shigeyuki: Selenomethionine incorporation into a protein by cell-free synthesis. In: Journal of structural and functional genomics 2 (2002), Nr. 1, S. 29–35

[Kigawa und Yokoyama 1991] KIGAWA, Takanori ; YOKOYAMA, Shigeyuki: A continuous cell-free protein synthesis system for coupled transcription-translation. In: Journal of biochemistry 110 (1991), Nr. 2, S. 166–168

[Kim und Choi 1996] KIM, Dong-Myung ; CHOI, Cha-Yong: A semicontinuous prokaryotic coupled transcription/translation system using a dialysis membrane. In: Biotechnology progress 12 (1996), Nr. 5, S. 645–649

[Kim und Swartz 2001] KIM, Dong-Myung ; SWARTZ, James R.: Regeneration of adenosine triphosphate from glycolytic intermediates for cell-free protein synthesis. In: Biotechnology and bioengineering 74 (2001), Nr. 4, S. 309–316

[Kim und Swartz 2004] KIM, Dong-Myung ; SWARTZ, James R.: Efficient production of a bioactive, multiple disulfide-bonded protein using modified extracts of Escherichia coli. In: Biotechnology and bioengineering 85 (2004), Nr. 2, S. 122–129

[Kim und Kim 2009] KIM, Ho-Cheol ; KIM, Dong-Myung: Methods for energizing cell-free protein synthesis. In: Journal of bioscience and bioengineering 108 (2009), Nr. 1, S. 1–4

[Kim u. a. 2011] KIM, Ho-Cheol ; KIM, Tae-Wan ; KIM, Dong-Myung: Prolonged production of proteins in a cell-free protein synthesis system using polymeric carbohydrates as an energy source. In: Process Biochemistry 46 (2011), Nr. 6, S. 1366–1369

[Kim und Winfree 2011] KIM, Jongmin ; WINFREE, Erik: Synthetic in vitro transcriptional oscillators. In: Molecular systems biology 7 (2011), Nr. 1, S. 465

[Kim und Choi 2000] KIM, RG ; CHOI, CY: Expression-independent consumption of substrates in cell-free expression system from Escherichia coli. In: Journal of biotechnology 84 (2000), Nr. 1, S. 27–32

[Kim u. a. 2006] KIM, Tae-Wan ; KEUM, Jung-Won ; OH, In-Seok ; CHOI, Cha-Yong ; PARK, Chang-

Gil ; KIM, Dong-Myung: Simple procedures for the construction of a robust and cost-effective cell-free protein synthesis system. In: Journal of biotechnology 126 (2006), Nr. 4, S. 554–561

[Kim u. a. 2008] KIM, Tae-Wan ; KIM, Ho-Cheol ; OH, In-Seok ; KIM, Dong-Myung: A highly efﬁ- cient and economical cell-free protein synthesis system using the S12 extract of Escherichia coli. In: Biotechnology and Bioprocess Engineering 13 (2008), Nr. 4, S. 464–469

[Kim u. a. 2007] KIM, Tae-Wan ; OH, In-Seok ; KEUM, Jung-Won ; KWON, Yong-Chan ; BYUN, Ju-

Young ; LEE, Kyung-Ho ; CHOI, Cha-Yong ; KIM, Dong-Myung: Prolonged cell-free protein synthesis using dual energy sources: Combined use of creatine phosphate and glucose for the efﬁcient supply of ATP and retarded accumulation of phosphate. In: Biotechnology and bioengineering 97 (2007), Nr. 6, S. 1510–1515

81 [Koomey und Falkow 1987] KOOMEY, J M. ; FALKOW, STANLEY: Cloning of the recA gene of Neisseria gonorrhoeae and construction of gonococcal recA mutants. In: Journal of bacteriology 169 (1987), Nr. 2, S. 790–795

[Kumar und Chernaya 2009] KUMAR, Gyanendra ; CHERNAYA, Galina: Cell-free protein synthesis using multiply-primed rolling circle ampliﬁcation products. In: Biotechniques 47 (2009), Nr. 1, S. 637

[Kuruma u. a. 2009] KURUMA, Yutetsu ; STANO, Pasquale ; UEDA, Takuya ; LUISI, Pier L.: A synthetic biology approach to the construction of membrane proteins in semi-synthetic minimal cells. In: Biochimica et Biophysica Acta (BBA)-Biomembranes 1788 (2009), Nr. 2, S. 567–574

[Kwok 2010] KWOK, Roberta: Five hard truths for synthetic biology. In: Nature News 463 (2010), Nr. 7279, S. 288–290

[Kwon und Jewett 2015] KWON, Yong-Chan ; JEWETT, Michael C.: High-throughput preparation methods of crude extract for robust cell-free protein synthesis. In: Scientiﬁc reports 5 (2015)

[Lamla u. a. 2006] LAMLA,T;HOERER,S;BAUER, MMT: Screening for soluble expression constructs using cell-free protein synthesis. In: International journal of biological macromolecules 39 (2006), Nr. 1, S. 111–121

[Lee u. a. 2012] LEE, Ka-Young ; LEE, Kyung-Ho ; PARK, Ji-Woong ; KIM, Dong-Myung: Flexible programming of cell-free protein synthesis using magnetic bead-immobilized plasmids. In: PloS one 7 (2012), Nr. 3, S. e34429

[Lian u. a. 2014] LIAN, Qianqian ; CAO, Hongzhi ; WANG, Fengshan: The Cost-Efﬁciency Realization in the Escherichia coli-Based Cell-Free Protein Synthesis Systems. In: Applied biochemistry and biotechnology 174 (2014), Nr. 7, S. 2351–2367

[Liese u. a. 2006] LIESE, Andreas ; SEELBACH, Karsten ; WANDREY, Christian: Industrial biotransfor- mations. John Wiley & Sons, 2006

[Ling u. a. 2009] LING, Jiqiang ; REYNOLDS, Noah ; IBBA, Michael: Aminoacyl-tRNA synthesis and translational quality control. In: Annual review of microbiology 63 (2009), S. 61–78

[Liu u. a. 2005] LIU, David V. ; ZAWADA, James F. ; SWARTZ, James R.: Streamlining Escherichia Coli S30 Extract Preparation for Economical Cell-Free Protein Synthesis. In: Biotechnology progress 21 (2005), Nr. 2, S. 460–465

[Lyukmanova u. a. 2012] LYUKMANOVA, EN ; SHENKAREV, ZO ; KHABIBULLINA, NF ; KOPEINA, GS ;

SHULEPKO, MA ; PARAMONOV, AS ; MINEEV, KS ; TIKHONOV, RV ; SHINGAROVA, LN ; PETROVSKAYA, LE u. a.: Lipid–protein nanodiscs for cell-free production of integral membrane proteins in a soluble and folded state: comparison with detergent micelles, bicelles and liposomes. In: Biochimica et Biophysica Acta (BBA)-Biomembranes 1818 (2012), Nr. 3, S. 349–358

82 [Madin u. a. 2000] MADIN, Kairat ; SAWASAKI, Tatsuya ; OGASAWARA, Tomio ; ENDO, Yaeta: A highly efﬁcient and robust cell-free protein synthesis system prepared from wheat embryos: plants apparently contain a suicide system directed at ribosomes. In: Proceedings of the National Academy of Sciences 97 (2000), Nr. 2, S. 559–564

[Masek u. a. 2005] MASEK, Tomas ; VOPALENSKY, Vaclav ; SUCHOMELOVA, Petra ; POSPISEK, Martin: Denaturing RNA electrophoresis in TAE agarose gels. In: Analytical biochemistry 336 (2005), Nr. 1, S. 46–50

[Matsumoto u. a. 2008] MATSUMOTO, Keisuke ; TOMIKAWA, Chie ; TOYOOKA, Takashi ; OCHI, Anna ;

TAKANO, Yoshitaka ; TAKAYANAGI, Naoyuki ; ABE, Masato ; ENDO, Yaeta ; HORI, Hiroyuki: Produc- tion of yeast tRNA (m 7 G46) methyltransferase (Trm8–Trm82 complex) in a wheat germ cell-free translation system. In: Journal of biotechnology 133 (2008), Nr. 4, S. 453–460

[Mie u. a. 2008] MIE, Masayasu ; SHIMIZU, Shun ; TAKAHASHI, Fumio ; KOBATAKE, Eiry: Selection of mRNA 5?-untranslated region sequence with high translation efﬁciency through ribosome display. In: Biochemical and biophysical research communications 373 (2008), Nr. 1, S. 48–52

[Mikami u. a. 2008] MIKAMI, Satoshi ; KOBAYASHI, Tominari ; MASUTANI, Mamiko ; YOKOYAMA,

Shigeyuki ; IMATAKA, Hiroaki: A human cell-derived in vitro coupled transcription/translation system optimized for production of recombinant proteins. In: Protein expression and puriﬁcation 62 (2008), Nr. 2, S. 190–198

[Mikami u. a. 2006] MIKAMI, Satoshi ; KOBAYASHI, Tominari ; YOKOYAMA, Shigeyuki ; IMATAKA, Hiroaki: A hybridoma-based in vitro translation system that efﬁciently synthesizes glycoproteins. In: Journal of biotechnology 127 (2006), Nr. 1, S. 65–78

[Moulijn u. a. 2013] MOULIJN, Jacob A. ; MAKKEE, Michiel ; VAN DIEPEN, Annelies E.: Chemical process technology. John Wiley & Sons, 2013

[Mulligan und Dunn 2008] MULLIGAN, Elizabeth A. ; DUNN, John J.: Cloning, purification and initial characterization of E. coli McrA, a putative 5-methylcytosine-specific nuclease. In: Protein expression and purification 62 (2008), Nr. 1, S. 98–103

[Mureev u. a. 2009] MUREEV, Sergei ; KOVTUN, Oleksiy ; NGUYEN, Uyen T. ; ALEXANDROV, Kirill: Species-independent translational leaders facilitate cell-free expression. In: Nature biotechnology 27 (2009), Nr. 8, S. 747–752

[Murphy u. a. 2011] MURPHY, Patrick J. ; STONE, Orrin J. ; ANDERSON, Michelle E.: Automated hydrophobic interaction chromatography column selection for use in protein puriﬁcation. In: Journal of visualized experiments: JoVE (2011), Nr. 55

[Murtas 2009] MURTAS, Giovanni: Artiﬁcial assembly of a minimal cell. In: Molecular BioSystems 5 (2009), Nr. 11, S. 1292–1297

83 [Nakamura und Whited 2003] NAKAMURA, Charles E. ; WHITED, Gregory M.: Metabolic engineering for the microbial production of 1, 3-propanediol. In: Current opinion in biotechnology 14 (2003), Nr. 5, S. 454–459

[Nielsen u. a. 2013] NIELSEN, Jens ; LARSSON, Christer ; MARIS, Antonius van ; PRONK, Jack: Metabolic engineering of yeast for production of fuels and chemicals. In: Current opinion in biotechnology 24 (2013), Nr. 3, S. 398–404

[Nirenberg 2004] NIRENBERG, Marshall: Historical review: Deciphering the genetic code–a personal account. In: Trends in biochemical sciences 29 (2004), Nr. 1, S. 46–54

[Nirenberg 1963] NIRENBERG, Marshall W.: Cell-free protein synthesis directed by messenger RNA. In: Methods in enzymology 6 (1963), S. 17–23

[Noireaux u. a. 2003] NOIREAUX, Vincent ; BAR-ZIV, Roy ; LIBCHABER, Albert: Principles of cell-free genetic circuit assembly. In: Proceedings of the National Academy of Sciences 100 (2003), Nr. 22, S. 12672–12677

[Paddon u. a. 2013] PADDON, CJ ; WESTFALL, PJ ; PITERA, DJ ; BENJAMIN,K;FISHER,K;MCPHEE,

D;LEAVELL, MD ; TAI,A;MAIN,A;ENG, D u. a.: High-level semi-synthetic production of the potent antimalarial artemisinin. In: Nature 496 (2013), Nr. 7446, S. 528–532

[Patel und Swartz 2011] PATEL, Kedar G. ; SWARTZ, James R.: Surface functionalization of virus-like particles by direct conjugation using azide- alkyne click chemistry. In: Bioconjugate chemistry 22 (2011), Nr. 3, S. 376–387

[Pratt 1984] PRATT, JM: Coupled transcription-translation in prokaryotic cell-free systems. In: Tran- scription and translation: a practical approach (1984), S. 179–209

[Prazeres u. a. 1999] PRAZERES, Duarte M. ; FERREIRA, Guilherme N. ; MONTEIRO, Gabriel A. ;

COONEY, Charles L. ; CABRAL, Joaquim M.: Large-scale production of pharmaceutical-grade plasmid DNA for gene therapy: problems and bottlenecks. In: Trends in biotechnology 17 (1999), Nr. 4, S. 169–174

[Proverbio u. a. 2014] PROVERBIO, Davide ; HENRICH, Erik ; ORBAN´ , Erika ; DOTSCH¨ , Volker ; BERN-

HARD, Frank: Membrane Protein Quality Control in Cell-Free Expression Systems: Tools, Strategies and Case Studies. In: Membrane Proteins Production for Structural Analysis. Springer, 2014, S. 45– 70

[Quin und Schmidt-Dannert 2011] QUIN, Maureen B. ; SCHMIDT-DANNERT, Claudia: Engineering of biocatalysts: from evolution to creation. In: ACS catalysis 1 (2011), Nr. 9, S. 1017–1021

[Ramachandran u. a. 2004] RAMACHANDRAN, Niroshan ; HAINSWORTH, Eugenie ; BHULLAR, Bhupin-

der ; EISENSTEIN, Samuel ; ROSEN, Benjamin ; LAU, Albert Y. ; WALTER, Johannes C. ; LABAER, Joshua: Self-assembling protein microarrays. In: Science 305 (2004), Nr. 5680, S. 86–90

84 [van Rantwijk und Sheldon 2007] RANTWIJK, Fred van ; SHELDON, Roger A.: Biocatalysis in ionic liquids. In: Chemical reviews 107 (2007), Nr. 6, S. 2757–2785

[Record u. a. 1998] RECORD, M T. ; COURTENAY, Elizabeth S. ; CAYLEY, Scott ; GUTTMAN, Harry J.: Biophysical compensation mechanisms buffering E. coli protein–nucleic acid interactions against changing environments. In: Trends in biochemical sciences 23 (1998), Nr. 5, S. 190–194

[Roberts und Szostak 1997] ROBERTS, Richard W. ; SZOSTAK, Jack W.: RNA-peptide fusions for the in vitro selection of peptides and proteins. In: Proceedings of the National Academy of Sciences 94 (1997), Nr. 23, S. 12297–12302

[Roest u. a. 1993] ROEST, Pauline A. ; ROBERTS, Roland G. ; SUGINO, Shigeto ; OMMEN, Gert-Jan B.

van ; DUNNEN, Johan T. den: Protein truncation test (PTT) for rapid detection of translation-terminating mutations. In: Human molecular genetics 2 (1993), Nr. 10, S. 1719–1721

[Rosenblum u. a. 2012] ROSENBLUM, Gabriel ; CHEN, Chunlai ; KAUR, Jaskiran ; CUI, Xiaonan ;

GOLDMAN, Yale E. ; COOPERMAN, Barry S.: Real-time assay for testing components of protein synthesis. In: Nucleic acids research 40 (2012), Nr. 12, S. e88–e88

[Rosenblum und Cooperman 2014] ROSENBLUM, Gabriel ; COOPERMAN, Barry S.: Engine out of the chassis: Cell-free protein synthesis and its uses. In: FEBS letters 588 (2014), Nr. 2, S. 261–268

[Rothe u. a. 2006] ROTHE, Achim ; HOSSE, Ralf J. ; POWER, Barbara E.: In vitro display technologies reveal novel biopharmaceutics. In: The FASEB journal 20 (2006), Nr. 10, S. 1599–1610

[Rothengass 2007] ROTHENGASS, Barbara E.: Advocating for the quadravalent HPV vaccination, Gardasil, by Merck. In: International journal of pediatric otorhinolaryngology 71 (2007), Nr. 4, S. 671– 672

[Sasaki u. a. 2011] SASAKI, Yoshihiro ; ASAYAMA, Wakiko ; NIWA, Tatsuya ; SAWADA, Shin-ichi ; UEDA,

Takuya ; TAGUCHI, Hideki ; AKIYOSHI, Kazunari: Amphiphilic Polysaccharide Nanogels as Artiﬁcial Chaperones in Cell-Free Protein Synthesis. In: Macromolecular bioscience 11 (2011), Nr. 6, S. 814– 820

[Sawasaki u. a. 2002a] SAWASAKI, Tatsuya ; HASEGAWA, Yoshinori ; TSUCHIMOCHI, Masateru ; KA-

MURA, Nami ; OGASAWARA, Tomio ; KUROITA, Toshihiro ; ENDO, Yaeta: A bilayer cell-free protein synthesis system for high-throughput screening of gene products. In: FEBS letters 514 (2002), Nr. 1, S. 102–105

[Sawasaki u. a. 2002b] SAWASAKI, Tatsuya ; OGASAWARA, Tomio ; MORISHITA, Ryo ; ENDO, Yaeta: A cell-free protein synthesis system for high-throughput proteomics. In: Proceedings of the National Academy of Sciences 99 (2002), Nr. 23, S. 14652–14657

[Schleef 2008] SCHLEEF, Martin: Plasmids for therapy and vaccination. John Wiley & Sons, 2008

85 [Schneider u. a. 2010] SCHNEIDER, Birgit ; JUNGE, Friederike ; SHIROKOV, Vladimir A. ; DURST,

Florian ; SCHWARZ, Daniel ; DOTSCH¨ , Volker ; BERNHARD, Frank: Membrane protein expression in cell-free systems. In: Heterologous Expression of Membrane Proteins. Springer, 2010, S. 165–186

[Schwarz u. a. 2008] SCHWARZ, Daniel ; DOTSCH¨ , Volker ; BERNHARD, Frank: Production of membrane proteins using cell-free expression systems. In: Proteomics 8 (2008), Nr. 19, S. 3933–3946

[Scism und Bachmann 2010] SCISM, Robert A. ; BACHMANN, Brian O.: Five-component cascade synthesis of nucleotide analogues in an engineered self-immobilized enzyme aggregate. In: Chem- BioChem 11 (2010), Nr. 1, S. 67–70

[Shimizu u. a. 2001] SHIMIZU, Yoshihiro ; INOUE, Akio ; TOMARI, Yukihide ; SUZUKI, Tsutomu ; YOKO-

GAWA, Takashi ; NISHIKAWA, Kazuya ; UEDA, Takuya: Cell-free translation reconstituted with puriﬁed components. In: Nature biotechnology 19 (2001), Nr. 8, S. 751–755

[Shimizu und Ueda 2010] SHIMIZU, Yoshihiro ; UEDA, Takuya: PURE technology. In: Cell-Free Protein Production. Springer, 2010, S. 11–21

[Shrestha u. a. 2012] SHRESTHA, Prashanta ; MICHAELE HOLLAND, Troy ; CHARLES BUNDY, Bradley: Streamlined extract preparation for Escherichia coli-based cell-free protein synthesis by sonication or bead vortex mixing. In: Biotechniques 53 (2012), Nr. 3, S. 163

[Shrestha u. a. 2014] SHRESTHA, Prashanta ; SMITH, Mark T. ; BUNDY, Bradley C.: Cell-free unnatural amino acid incorporation with alternative energy systems and linear expression templates. In: New biotechnology 31 (2014), Nr. 1, S. 28–34

[Sousa und Mukherjee 2003] SOUSA, Rui ; MUKHERJEE, Srabani: T7 RNA polymerase. In: Progress in nucleic acid research and molecular biology 73 (2003), S. 1–41

[Spirin 2004] SPIRIN, Alexander S.: High-throughput cell-free systems for synthesis of functionally active proteins. In: Trends in biotechnology 22 (2004), Nr. 10, S. 538–545

[Spirin u. a. 1988] SPIRIN, Alexander S. ; BARANOV, Vladimir I. ; RYABOVA, Lubov A. ; OVODOV,

Sergey Y. ; ALAKHOV, Yuly B.: A continuous cell-free translation system capable of producing polypeptides in high yield. In: Science 242 (1988), Nr. 4882, S. 1162–1164

[Sun u. a. 2013] SUN, Zachary Z. ; HAYES, Clarmyra A. ; SHIN, Jonghyeon ; CASCHERA, Filippo ;

MURRAY, Richard M. ; NOIREAUX, Vincent: Protocols for implementing an Escherichia coli based TX-TL cell-free expression system for synthetic biology. In: Journal of visualized experiments: JoVE (2013), Nr. 79

[Swartz 2012] SWARTZ, James R.: Transforming biochemical engineering with cell-free biology. In: AIChE Journal 58 (2012), Nr. 1, S. 5–13

[Swartz 2006] SWARTZ, Jim: Developing cell-free biology for industrial applications. In: Journal of Industrial Microbiology and Biotechnology 33 (2006), Nr. 7, S. 476–485

86 [Takai u. a. 2008] TAKAI, Kazuyuki ; SAWASAKI, Tatsuya ; ENDO, Yaeta: Development of key technologies for high-throughput cell-free protein production with the extract from wheat embryos. In: Advances in protein chemistry and structural biology 75 (2008), S. 53–84

[Tarui u. a. 2001] TARUI, Hiroshi ; MURATA, Masahiro ; TANI, Ikuko ; IMANISHI, Shigeo ; NISHIKAWA,

Shigemichi ; HARA, Toshio: Establishment and characterization of cell-free translation/glycosylation in insect cell (Spodoptera frugiperda 21) extract prepared with high pressure treatment. In: Applied microbiology and biotechnology 55 (2001), Nr. 4, S. 446–453

[Taylor u. a. 1993] TAYLOR, Robin G. ; WALKER, David C. ; MCINNES, RR: E. coli host strains significantly affect the quality of small scale plasmid DNA preparations used for sequencing. In: Nucleic acids research 21 (1993), Nr. 7, S. 1677

[Torizawa u. a. 2004] TORIZAWA, Takuya ; SHIMIZU, Masato ; TAOKA, Masato ; MIYANO, Hiroshi ;

KAINOSHO, Masatsune: Efﬁcient production of isotopically labeled proteins by cell-free synthesis: a practical protocol. In: Journal of biomolecular NMR 30 (2004), Nr. 3, S. 311–325

[Trindade u. a. 2005] TRINDADE, Inesˆ P ; DIOGO, Maria M. ; PRAZERES, Duarte M. ; MARCOS, Joa.:˜ Puriﬁcation of plasmid DNA vectors by aqueous two-phase extraction and hydrophobic interaction chromatography. In: Journal of Chromatography A 1082 (2005), Nr. 2, S. 176–184

[Tsuboi u. a. 2008] TSUBOI, Takafumi ; TAKEO, Satoru ; IRIKO, Hideyuki ; JIN, Ling ; TSUCHI-

MOCHI, Masateru ; MATSUDA, Shusaku ; HAN, Eun-Taek ; OTSUKI, Hitoshi ; KANEKO, Osamu ; SAT-

TABONGKOT, Jetsumon u. a.: Wheat germ cell-free system-based production of malaria proteins for discovery of novel vaccine candidates. In: Infection and immunity 76 (2008), Nr. 4, S. 1702–1708

[Vinograd u. a. 1966] VINOGRAD, Jerome u. a.: Physical and topological properties of circular DNA. In: The Journal of general physiology 49 (1966), Nr. 6, S. 103–125

[Voloshin und Swartz 2005] VOLOSHIN, Alexei M. ; SWARTZ, James R.: Efﬁcient and scalable method for scaling up cell free protein synthesis in batch mode. In: Biotechnology and bioengineering 91 (2005), Nr. 4, S. 516–521

[Walter und Blobel 1983] WALTER, Peter ; BLOBEL,Gunter:¨ Preparation of microsomal membranes for cotranslational protein translocation. In: Methods in enzymology 96 (1983), S. 84–93

[Wang u. a. 2009] WANG, Harris H. ; ISAACS, Farren J. ; CARR, Peter A. ; SUN, Zachary Z. ; XU,

George ; FOREST, Craig R. ; CHURCH, George M.: Programming cells by multiplex genome engineering and accelerated evolution. In: Nature 460 (2009), Nr. 7257, S. 894–898

[Wang u. a. 2008] WANG, Xiao ; LIU, Juan ; ZHENG, Yan ; LI, Jing ; WANG, Hong ; ZHOU, Yabin ;

QI, Mei ; YU, Han ; TANG, Wei ; ZHAO, Wei M.: An optimized yeast cell-free system: sufﬁcient for translation of human papillomavirus 58 L1 mRNA and assembly of virus-like particles. In: Journal of bioscience and bioengineering 106 (2008), Nr. 1, S. 8–15

87 [Wang und Zhang 2009] WANG, Yiran ; ZHANG, YH P.: Cell-free protein synthesis energized by slowly-metabolized maltodextrin. In: BMC biotechnology 9 (2009), Nr. 1, S. 58

[Watts und Forster 2012] WATTS, R E. ; FORSTER, Anthony C.: Update on pure translation display with unnatural amino acid incorporation. In: Ribosome Display and Related Technologies. Springer, 2012, S. 349–365

[Weber u. a. 1975] WEBER, LA ; FEMAN, ER ; BAGLIONI, C: Cell free system from HeLa cells active in initiation of protein synthesis. In: Biochemistry 14 (1975), Nr. 24, S. 5315–5321

[Welsh u. a. 2011] WELSH, John P. ; BONOMO, Jeanne ; SWARTZ, James R.: Localization of BiP to translating ribosomes increases soluble accumulation of secreted eukaryotic proteins in an Es- cherichia coli cell-free system. In: Biotechnology and bioengineering 108 (2011), Nr. 8, S. 1739–1748

[Whittaker 2013] WHITTAKER, James W.: Cell-free protein synthesis: the state of the art. In: Biotech- nology letters 35 (2013), Nr. 2, S. 143–152

[Winnick u. a. 1950] WINNICK, Theodore u. a.: Studies on the mechanism of protein, synthesis in embryonic and tumor tissues. 1. Evidence relating to the incorporation of labeled amino acids into protein structure in homogenates. In: Arch. Biochem. 27 (1950)

[Xu u. a. 2002] XU, Lihui ; AHA, Patti ; GU, Ke ; KUIMELIS, Robert G. ; KURZ, Markus ; LAM, Terence ;

LIM, Ai C. ; LIU, Hongxiang ; LOHSE, Peter A. ; SUN, Lin u. a.: Directed evolution of high-afﬁnity antibody mimics using mRNA display. In: Chemistry & biology 9 (2002), Nr. 8, S. 933–942

[Yamamoto u. a. 1999] YAMAMOTO, Yuichi ; SUGIMOTO, Shunjiro ; SHEN, Xin-chun ; NAGAMUNE,

Teruyuki ; YAO, Shui-liang ; SUZUKI, Eiji: In-place condensation of reaction mixture using hollow ﬁber membrane reactors improved productivity of cell-free protein synthesis. In: Biochemical engineering journal 3 (1999), Nr. 2, S. 151–155

[Yang u. a. 2012] YANG, William C. ; PATEL, Kedar G. ; WONG, H E. ; SWARTZ, James R.: Simplifying and streamlining Escherichia coli-based cell-free protein synthesis. In: Biotechnology progress 28 (2012), Nr. 2, S. 413–420

[Yin und Swartz 2004] YIN, Gang ; SWARTZ, James R.: Enhancing multiple disulﬁde bonded protein folding in a cell-free system. In: Biotechnology and bioengineering 86 (2004), Nr. 2, S. 188–195

[Zawada und Swartz 2006] ZAWADA, James ; SWARTZ, James: Effects of growth rate on cell extract performance in cell-free protein synthesis. In: Biotechnology and bioengineering 94 (2006), Nr. 4, S. 618–624

[Zawada 2012] ZAWADA, James F.: Preparation and testing of E. coli S30 in vitro transcription translation extracts. In: Ribosome Display and Related Technologies. Springer, 2012, S. 31–41

[Zawada u. a. 2011] ZAWADA, James F. ; YIN, Gang ; STEINER, Alexander R. ; YANG, Junhao ;

NARESH, Alpana ; ROY, Sushmita M. ; GOLD, Daniel S. ; HEINSOHN, Henry G. ; MURRAY, Christo- pher J.: Microscale to manufacturing scale-up of cell-free cytokine production– new approach for

88 shortening protein production development timelines. In: Biotechnology and bioengineering 108 (2011), Nr. 7, S. 1570–1578

[Zhang u. a. 2005] ZHANG, Kechun ; DIEHL, Michael R. ; TIRRELL, David A.: Artiﬁcial polypeptide scaffold for protein immobilization. In: Journal of the American Chemical Society 127 (2005), Nr. 29, S. 10136–10137

[Zhu u. a. 2005] ZHU, Kaichun ; JIN, Huali ; MA, Yijie ; REN, Zhihui ; XIAO, Chong ; HE, Zhonghuai ;

ZHANG, Fuchun ; ZHU, Qinghong ; WANG, Bin: A continuous thermal lysis procedure for the large- scale preparation of plasmid DNA. In: Journal of biotechnology 118 (2005), Nr. 3, S. 257–264

[Zichel u. a. 2010] ZICHEL,R;MIMRAN,A;KEREN,A;BARNEA,A;STEINBERGER-LEVY,I;MARCUS,

D;TURGEMAN,A;REUVENY, S: Efﬁcacy of a potential trivalent vaccine based on Hc fragments of botulinum toxins A, B, and E produced in a cell-free expression system. In: Clinical and Vaccine Immunology 17 (2010), Nr. 5, S. 784–792

[Zubay 1962] ZUBAY, G: The isolation and fractionation of soluble ribonucleic acid. In: Journal of Molecular Biology 4 (1962), Nr. 5, S. 347–356

[Zubay 1973] ZUBAY, Geoffrey: In vitro synthesis of protein in microbial systems. In: Annual review of genetics 7 (1973), Nr. 1, S. 267–287

89 90