DOCSLIB.ORG

Complete Nucleotide Sequence and Gene Rearrangement of the Mitochondrial Genome of the Bell-Ring Frog, Buergeria Buergeri (Family Rhacophoridae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Complete Nucleotide Sequence and Gene Rearrangement of the Mitochondrial Genome of the Bell-Ring Frog, Buergeria Buergeri (Family Rhacophoridae) Genes Genet. Syst. (2004) 79, p. 151–163 Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of the bell-ring frog, Buergeria buergeri (family Rhacophoridae) Naomi Sano1, Atsushi Kurabayashi1, Tamotsu Fujii2, Hiromichi Yonekawa3, and Masayuki Sumida1* 1Institute for Amphibian Biology, Hiroshima University, Higashihiroshima, Hiroshima 739-8526, Japan 2Department of Health Science, Hiroshima Prefectural Women’s University, Hiroshima 734-8558, Japan 3Department of Laboratory Animal Science, The Tokyo Metropolitan Institute of Medical Science, Tokyo 113-8613, Japan (Received 22 March 2004, accepted 26 May 2004) In this study we determined the complete nucleotide sequence (19,959 bp) of the mitochondrial DNA of the rhacophorid frog Buergeria buergeri. The gene content, nucleotide composition, and codon usage of B. buergeri conformed to those of typ- ical vertebrate patterns. However, due to an accumulation of lengthy repetitive sequences in the D-loop region, this species possesses the largest mitochondrial genome among all the vertebrates examined so far. Comparison of the gene organ- izations among amphibian species (Rana, Xenopus, salamanders and caecilians) revealed that the positioning of four tRNA genes and the ND5 gene in the mtDNA of B. buergeri diverged from the common vertebrate gene arrangement shared by Xenopus, salamanders and caecilians. The unique positions of the tRNA genes in B. buergeri are shared by ranid frogs, indicating that the rearrangements of the tRNA genes occurred in a common ancestral lineage of ranids and rhacophorids. On the other hand, the novel position of the ND5 gene seems to have arisen in a lineage leading to rhacophorids (and other closely related taxa) after ranid divergence. Phylogenetic analysis based on nucleotide sequence data of all mito- chondrial genes also supported the gene rearrangement pathway. Key words: Buergeria buergeri, complete mitochondrial genome, gene rearrange- ment, Japanese bell-ring frog, ND5 gene 1981; Roe et al., 1985; Tzeng et al., 1992; Boore, 1999). INTRODUCTION Although minor rearrangements have been reported for Vertebrate mitochondrial DNA (mtDNA) is a closed cir- marsupials (Pääbo et al., 1991), birds (Desjardins and cular molecule. The genome organization is highly com- Morais, 1990, 1991; Quinn and Wilson, 1993; Mindell et pact and the genome is approximately 16 kbp in length al., 1998), reptiles (Kumazawa and Nishida, 1995; Quinn (Wolstenholme, 1992). This genome typically contains and Mindell, 1996; Macey et al., 1997), lampreys (Lee and 37 genes for 2 ribosomal (r)RNAs, 22 transfer (t)RNAs Kocher, 1995), and teleost fishes (Miya and Nishida, and 13 proteins, and a long noncoding region called the 1999; Inoue et al., 2001; Miya et al., 2001), most of these D-loop that includes signals required for regulating and cases involve only a few rearrangements of tRNA genes initiating mtDNA replication and transcription (Wolsten- and/or the D-loop region. holme, 1992; Janke et al., 1994). Mitochondrial gene arrangements have attracted the Mitochondrial gene arrangements are generally con- attention of evolutionary biologists as novel phylogenetic served in vertebrates. All 37 genes are arranged in the markers (Smith et al., 1993; Kumazawa and Nishida, same relative order in almost all vertebrate species from 1995; Quinn and Mindell, 1996; Macey et al., 1997; Boore teleost fishes to eutherian mammals (Anderson et al., and Brown, 1998; Boore, 1999; Kurabayashi and Ueshima, 2000). The complete mtDNA sequences have Edited by Toshihiko Shiroishi been published for only six amphibian species, including * Corresponding author. E-mail: [email protected] a caecilian (Zardoya and Meyer, 2000), three sala- 152 N. SANO et al. manders, (Zardoya et al., 2003; Zhang et al., 2003a, b), ity to the family Ranidae (true frogs), and the genus Buer- and two anurans, the clawed frog Xenopus laevis (Roe et geria is regarded as the most basal group in the former al., 1985) and the Japanese pond frog Rana nigromacu- (Channing, 1989; Jiang et al., 1987; Liem, 1970; Richards lata (Sumida et al., 2001). The mitochondrial gene and Moore, 1998; Wilkinson and Drewes, 2000; Wilkinson arrangements of five of these six amphibian species are et al., 2002). identical with those of typical vertebrates. However, in In this report, we present the first data on the complete the R. nigromaculata mtDNA, the positions of four tRNA mtDNA sequence of a rhacophorid frog and describe fea- genes (tRNA-Leu(CUN), tRNA-Thr, tRNA-Pro, and tures of the genome. The evolutionary implications of tRNA-Phe) differ from those of typical vertebrates (see our findings are also discussed. Fig. 3). The same gene arrangement is also found in other ranid frogs so far investigated (Rana catesbeiana, MATERIALS AND METHODS Yoneyama, 1987; Rana limnocharis, Macey et al., 1997; Rana porosa, Sumida et al., 2000). A lack of available DNA sources. Bell-ring frogs (Buergeria buergeri) were information on the mitochondrial genomic organization of collected from Ota River, Hiroshima prefecture, western other anuran family members makes it difficult to deter- Japan. The total genomic DNAs were extracted from a mine whether this unique arrangement is shared by other clipped toe of a living frog using the DNeasy Tissue Kit anuran groups besides the ranids. (QUIAGEN) according to the manufacturer’s protocol. In order to elucidate various aspects of mitochondrial gene rearrangement, we determined the complete PCR and sequencing. The total length of B. buergeri mtDNA sequence of the bell-ring frog Buergeria buergeri, mtDNA was amplified by polymerase chain reaction a representative of the family Rhacophoridae (tree frogs). (PCR), beginning with partial mitochondrial segments Rhacophoridae is generally considered to have close affin- and finishing with the remaining mtDNA region. Two Fig. 1. Sequencing and cloning strategy for Buergeria buergeri mtDNA. Localizations and directions of primers used in the LA-PCR amplification and DNA sequencing are denoted by arrowheads. The sequences of these primers are available from the www site, http://home.hiroshimau.ac.jp/~amphibia/syukeisei/usedprimers.html. LA-PCR products are shown as bold lines below the gene map. Cloned restriction fragments and their lengths are indicated above the gene map. Table 1. Primers used for PCR amplification in the present study. Primer name Sequence (5’-3’) F20N7a TGAATCGGGGGCCAACCAG R16b ATAGTGGGGTATCTAATCCCAGTTTGTTTT FR16c AAAACAAACTGGGATTAGATACCCCACTAT R51d GGTCTGAACTCAGATCACGTA F70e GGGTATCCCAGTGGTGCAGCCGCTACTAAT R71e CGAATGTCTTGTTCGTCATTGAGGTTATGA ND5Fow1e TTYATHGGHTGRGARGGVGTNGG R16M1c GGGTATCTAATCCCAGTTTG Positions with mixed bases are labeled with their IUB codes: H = A / T / G, N = A / T / G / C, R = A / G, V = A / G / C, Y = C / T. aDesigned based on Sumida et al. (2001), Roe et al. (1985), Zardoya and Meyer (2000) and Zardoya and Meyer (1997). bSumida et al. (1998). cModified from Sumida et al. (1998). dSumida et al. (2002). ePresent study. Mitochondrial genome of rhacophorid frog 153 partial mitochondrial segments were amplified from B. employed to sequence almost all portions of the mtDNA buergeri total DNA by long-and-accurate PCR (LA-PCR) (Fig. 1). The sequencing was performed using 373A and using two primer sets (F20N7 and R16; FR16 and R51) 3100-Avant automated DNA sequencers (ABI) with DYE- (Fig. 1 and Table 1). PCR mixtures were prepared using namic ET Terminator cycle sequencing reagent a TaKaRa LA Taq™ Kit as recommended by the manu- (Amersham). Sequencing primers for internal portions facturer (TaKaRa). LA-PCR reactions consisted of an of the long PCR fragment were designed by cloning five initial denaturation at 94°C for 1 min, 30 cycles of dena- restriction fragments (see Fig. 1) into pUC 118 E. coli vec- turation at 94°C for 20 sec plus annealing and extension tor and sequencing them. The D-loop region was diffi- at 60°C for 3 min, and a final extension at 72°C for 10 cult to sequence by primer walking due to an abundance min. The resultant PCR fragments were electrophore- of lengthy tandem repeat units. To determine the pre- sed on a 0.7% agarose gel, and the DNAs were purified cise sequence of this region, a series of deleted subclones from excised pieces of gel using Wizard SV Gel and the was made from the clones of an Sma I/EcoR I-digested PCR Clean-UP System (Promega) and used for sequenc- fragment (see Fig. 1) using the Exonuclease III deletion ing (see below). The remaining mtDNA fragment was method (Henikoff, 1987). The nucleotide sequence of the amplified with the primer set F70 and R71 (Fig. 1 and B. buergeri mtDNA was deposited in the DDBJ database Table 1) designed based on the ND5 gene and 16S rRNA accession number AB127977. gene sequences determined above. LA-PCR reactions consisted of 1 cycle of 1 min at 94°C, 14 cycles of 20 sec Phylogenetic analysis. For the phylogenetic analysis, at 98°C followed by 20 min at 68°C, 17 cycles of 20 sec at we created an alignment dataset using CLUSTAL W 98°C followed by 20 min 20 sec at 68°C, and 1 final cycle (Thompson et al., 1994). The data set consisted of all 37 of 10 min at 72°C. The amplified mtDNA fragment of mitochondrial gene sequences from 9 vertebrates, includ- approximately 16.5 kbp was then purified using ing 7 amphibians, 1 coelacanth (Latimeria chalumnae), MicroSpin™ S-300 HR Columns (Pharmacia Biotech) and and 1 lungfish (Protopterus dolloi). The latter two were used for the sequencing reaction. used as outgroups. The alignment was checked by eye, The entire mtDNA genome of B. buergeri was sequenced and all positions with gaps and ambiguous sites were from both strands. The primer walking method was excluded. Based on the alignment data (12,865 nucle- Fig. 2. Organization of the B. buergeri mitochondrial genome. All protein-coding genes are encoded by the H strand, with the exception of ND6, which is encoded by the L strand. Transfer RNA genes are represented by the standard one-letter amino acid code and those encoded by the H and L strands are shown outside and inside the circle, respectively.
Load more

Recommended publications
  • Chapter 10. Amphibians of the Palaearctic Realm
    CHAPTER 10. AMPHIBIANS OF THE PALAEARCTIC REALM Figure 1. Summary of Red List categories Brandon Anthony, J.W. Arntzen, Sherif Baha El Din, Wolfgang Böhme, Dan Palaearctic Realm contains 6% of all globally threatened amphibians. The Palaearctic accounts for amphibians in the Palaearctic Realm. CogĄlniceanu, Jelka Crnobrnja-Isailovic, Pierre-André Crochet, Claudia Corti, for only 3% of CR species and 5% of the EN species, but 9% of the VU species. Hence, on the The percentage of species in each category Richard Griffiths, Yoshio Kaneko, Sergei Kuzmin, Michael Wai Neng Lau, basis of current knowledge, threatened Palaearctic amphibians are more likely to be in a lower is also given. Pipeng Li, Petros Lymberakis, Rafael Marquez, Theodore Papenfuss, Juan category of threat, when compared with the global distribution of threatened species amongst Manuel Pleguezuelos, Nasrullah Rastegar, Benedikt Schmidt, Tahar Slimani, categories. The percentage of DD species, 13% (62 species), is also much less than the global Max Sparreboom, ùsmail Uøurtaû, Yehudah Werner and Feng Xie average of 23%, which is not surprising given that parts of the region have been well surveyed. Red List Category Number of species Nevertheless, the percentage of DD species is much higher than in the Nearctic. Extinct (EX) 2 Two of the world’s 34 documented amphibian extinctions have occurred in this region: the Extinct in the Wild (EW) 0 THE GEOGRAPHIC AND HUMAN CONTEXT Hula Painted Frog Discoglossus nigriventer from Israel and the Yunnan Lake Newt Cynops Critically Endangered (CR) 13 wolterstorffi from around Kunming Lake in Yunnan Province, China. In addition, one Critically Endangered (EN) 40 The Palaearctic Realm includes northern Africa, all of Europe, and much of Asia, excluding Endangered species in the Palaearctic Realm is considered possibly extinct, Scutiger macu- Vulnerable (VU) 58 the southern extremities of the Arabian Peninsula, the Indian Subcontinent (south of the latus from central China.
    [Show full text]
  • 1704632114.Full.Pdf
    Phylogenomics reveals rapid, simultaneous PNAS PLUS diversification of three major clades of Gondwanan frogs at the Cretaceous–Paleogene boundary Yan-Jie Fenga, David C. Blackburnb, Dan Lianga, David M. Hillisc, David B. Waked,1, David C. Cannatellac,1, and Peng Zhanga,1 aState Key Laboratory of Biocontrol, College of Ecology and Evolution, School of Life Sciences, Sun Yat-Sen University, Guangzhou 510006, China; bDepartment of Natural History, Florida Museum of Natural History, University of Florida, Gainesville, FL 32611; cDepartment of Integrative Biology and Biodiversity Collections, University of Texas, Austin, TX 78712; and dMuseum of Vertebrate Zoology and Department of Integrative Biology, University of California, Berkeley, CA 94720 Contributed by David B. Wake, June 2, 2017 (sent for review March 22, 2017; reviewed by S. Blair Hedges and Jonathan B. Losos) Frogs (Anura) are one of the most diverse groups of vertebrates The poor resolution for many nodes in anuran phylogeny is and comprise nearly 90% of living amphibian species. Their world- likely a result of the small number of molecular markers tra- wide distribution and diverse biology make them well-suited for ditionally used for these analyses. Previous large-scale studies assessing fundamental questions in evolution, ecology, and conser- used 6 genes (∼4,700 nt) (4), 5 genes (∼3,800 nt) (5), 12 genes vation. However, despite their scientific importance, the evolutionary (6) with ∼12,000 nt of GenBank data (but with ∼80% missing history and tempo of frog diversification remain poorly understood. data), and whole mitochondrial genomes (∼11,000 nt) (7). In By using a molecular dataset of unprecedented size, including 88-kb the larger datasets (e.g., ref.
    [Show full text]
  • (Amphibia, Anura): Morfología Y Desarrollo Del Sistema Esquelético
    UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE CIENCIAS BIOLÓGICAS Departamento de Biología Animal I (Zoología) TESIS DOCTORAL Evolución de Pelobatidos y Peloditidos (Amphibia, Anura): morfología y desarrollo del sistema esquelético MEMORIA PARA OPTAR AL GRADO DE DOCTOR PRESENTADA POR María del Rosario Rodríguez Talavera Director Francisco de Borja Sanchiz y Gil de Avalle Madrid Ed. electrónica 2019 © María del Rosario Rodríguez Talavera, 1989 /L °'`^`^^ Departamento de Biología Animal I Facultad de Ciencias Biológicas Universidad Complutense de Madrid ireeemema HVOLIICIOB DH PHLOBATIDOS Y PHLODITIDOS (A1^[PHIBIA, AHURA): XORFOLOGIA Y DHSARROLLO DHL SISTHxA HSQIIñLHTICO Memoria presentada para optar al grado de doctor en Ciencias Biológicas por l[aría del xosarío Rodríguez Talavera v^ B^ del director de la tesis ^^%^ ^a ^-...^r ^ Dr. D. Francisco de Borja Sanchíz y Gil de Avalle Invest:igador del CSIC en el Museo Nacional de Ciencias Iiaturales Madrid, octubre de 1989 AGRADfiCII[ IfiHTOS En primer lugar deseo expresar mi agradecimiento al Dr. Sanchíz, director de esta tesis, por sugerirme el tema de investigación y por su valiosa colaboración, tolerancia y acertadas críticas durante el desarrollo del trabajo. E1 Dr. Castanet CLaboratoire d'Anatomie Comparée, IJniversité Paris VII) revisó amablemente los resultados esqueletocronológicos. Aumerosas personas me acompañaron en los viajes de recolección de material. Especialmente agradezco la colaboración de Begoña Arano y Asunción Rodríguez Espeso en Portugal; Juan Carlos Arrechea y Jesús Dorda en 14arruecos, y Marisa Esteban en el sur de Espa4ia. Las siguientes personas colectaron material adicional para este estudio: Begoña E►rano, Ignacio Doadrio, Jesús Dorda, Carmen Díaz-Paniagua, Marisa Esteban, Mario García-Paris, Paloma Garzón, Rafael Márquez y Carolina Martín- Albaladejo.
    [Show full text]
  • ©Zoologische Staatssammlung München;Download
    ©Zoologische Staatssammlung München;download: http://www.biodiversitylibrary.org/; www.biologiezentrum.at SPIXIANA ©Zoologische Staatssammlung München;download: http://www.biodiversitylibrary.org/; www.biologiezentrum.at symplesiomorphies with some African genera formerly considered as basal representatives of the Ranidae (and today seen as own families, Arthroleptidae and Astylosternidae; see Dubois 1992), rhacophorines shared synapomorphies with more derived representatives of the extremely diverse and speciose family Ranidae. Actually, rhacophorids are only distinguished from other ranids by the presence of an intercalary element between ultimate and penultimate phalanges of fingers and toes, and by generally (but not consistently) more arboreal habits. Based on the synapomorphies identified (e.g., presence of a bony sternal style), Laurent (1986), Dubois (1992) and Blommers-Schlösser (1993) proposed to include the Rhacophoridae as subfamily Rhacophorinae in the family Ranidae. However, the proposal of Blommers-Schlösser (1993) (i. e. the definition of the family Ranidae as group contain- ing almost all ranoid taxa with an ossified sternal style) is all but generally accepted by herpetologists. Most authors continue considering the Rhacophoridae as separate family (e.g., Frost 1985), a view also shared by internet databases (as the Amphibian Species of the World database, Amphibiaweb, Tree of life, Genbank; as of 10 November 2000). Furthermore, new names such as "fanged ifrogs" (Emerson & Ward 1998, Emerson et al. 2000a) and "boophids" (Richards et al. 2000) have been used to address ranoid subclades, without a nomenclatural formalization of these groups. In the last few years, numerous new results on Old World treefrog phylogeny have been published, several of them referring to the taxa endemic to Madagascar.
    [Show full text]
  • Diversity of Diversity of Anura
    Diversity of Anura WFS 433/533 1/24/2013 Lecture goal To familiarize students with the different families of the order anura. To familiarize students with aspects of natural history and world distribution of anurans Required readings: Wells: pp. 15-41 http://amphibiaweb.org/aw/index.html Lecture roadmap Characteristics of Anurans Anuran Diversity Anuran families, natural history and world distribution 1 What are amphibians? These foul and loathsome animals are abhorrent because of their cold body, pale color, cartilaginous skeleton, filthy skin, fierce aspect, calculating eye, offensive smell, harsh voice, squalid habitation, and terrible venom; and so their Creator has not exerted his powers to make many of them. Carl von Linne (Linnaeus) Systema Naturae (1758) What are frogs? A thousand splendid suns, a million moons, a billion twinkle stars are nothing compared to the eyes of a frog in the swamp —Miss Piggy about Kermit, in Larry king live, 1993 Diversity of anurans Global Distribution 30 Families 4963 spec ies Groups: •Archaeobatrachia (4 families) •Mesobatrachia (5 families) 30 Families •Neobatrachia (all other families) 2 No. of Known Species in Number of Species Number of Species in Family World in the United States? Tennessee? Allophrynidae 10 0 Arthroleptidae 78 0 0 Ascaphidae 22 0 Bombinatoridae 11 0 0 Brachycephalidae 60 0 Bufonidae 457 23 2 Centrolenidae 139 0 0 Dendrobatidae 219 1* 0 Discoglossidae 11 0 0 Heleophrynidae 60 0 Hemisotidae 90 0 Hylidae 851 29* 10 Hyperoliidae 253 0 0 Leiopelmatidae 40 0 30 families Leptodactylidae
    [Show full text]
  • Early Eocene Frogs from Vastan Lignite Mine, Gujarat, India
    Early Eocene frogs from Vastan Lignite Mine, Gujarat, India ANNELISE FOLIE, RAJENDRA S. RANA, KENNETH D. ROSE, ASHOK SAHNI, KISHOR KUMAR, LACHHAM SINGH, and THIERRY SMITH Folie, A., Rana, R.S., Rose, K.D., Sahni, A., Kumar, K., Singh, L., and Smith, T. 2013. Early Eocene frogs from Vastan Lignite Mine, Gujarat, India. Acta Palaeontologica Polonica 58 (3): 511–524. The Ypresian Cambay Shale Formation of Vastan Lignite Mine in Gujarat, western India, has yielded a rich vertebrate fauna, including the earliest modern mammals of the Indian subcontinent. Here we describe its assemblage of four frogs, including two new genera and species, based on numerous, diverse and well−preserved ilia and vertebrae. An abundant frog, Eobarbourula delfinoi gen. and sp. nov., with a particular vertebral articulation similar to a zygosphene−zygantrum complex, represents the oldest record of the Bombinatoridae and might have been capable of displaying the Unken reflex. The large non−fossorial pelobatid Eopelobates, known from complete skeletons from the Eocene and Oligocene of Europe, is also identified at Vastan based on a single nearly complete ilium. An abundant “ranid” and a possible rhacophorid Indorana prasadi gen. and sp. nov. represent the earliest records of both families. The Vastan pelobatids and ranids confirm an early worldwide distribution of these families, and the bombinatorids and rhacophorids show possible origins of those clades on the Indian subcontinent. Key words: Amphibia, Bombinatoridae, Ranidae, Pelobatidae, Rhacophoridae, Eocene, Vastan, India. Annelise Folie [[email protected]] and Thierry Smith [[email protected]], Royal Bel− gian Institute of Natural Sciences, Department of Paleontology, Rue Vautier 29, B−1000 Brussels, Belgium; Rajendra S.
    [Show full text]
  • Phylogenetic Relationships of Pelobatoidea Re-Examined Using Mtdna
    MOLECULAR PHYLOGENETICS AND EVOLUTION Molecular Phylogenetics and Evolution 28 (2003) 12–23 www.elsevier.com/locate/ympev Phylogenetic relationships of Pelobatoidea re-examined using mtDNA Mario Garcııa-Parııs,a,* Daniel R. Buchholz,b and Gabriela Parra-Oleac a Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal, 2. 28006 Madrid, Spain b Museum of Vertebrate Zoology and Department of Integrative Biology, University of California, Berkeley, CA 94720-3160, USA c Instituto de Biologııa, UNAM. AP 70-153, Mexico DF 04510, Mexico Received 1 April 2002; revised 15 January 2003 Abstract Pelobatoidea is a clade of ancient anurans with obscure relationships to the remaining clades of frogs. We used partial sequences of two mitochondrial genes (cytochrome b and 16S RNA) from all Pelobatoidea subclades, including all species of Pelobatidae and Pelodytidae and four outgroup taxa (Xenopus, Ascaphus, Discoglossus, and Rana), to propose a phylogenetic hypothesis for rela- tionships within Pelobatoidea. Maximum likelihood and Bayesian analyses support the monophyly of Pelobatoidea, but our hy- pothesis of internal relationships differs substantially from all previous hypotheses. Megophryidae is sister to Pelobates, and this clade is sister to Pelodytes. The most basal clade within Pelobatoidea is formed by Scaphiopus and Spea. The family Pelobatidae, as previously defined is not monophyletic, and it is split into Eurasian spadefoot toads Pelobates which retain the name Pelobatidae and North American spadefoot toads Scaphiopus and Spea which comprise the revived taxon Scaphiopodidae. Our analysis un- covers the existence of morphologically cryptic taxa within previously recognized species of the genus Spea and reveals marked genetic differentiation within Iberian Pelodytes. We discuss biogeographic implications and the evolution of fossoriality in the light of the new phylogenetic hypothesis.
    [Show full text]
  • The Origin of Modern Frogs (Neobatrachia) Was Accompanied By
    Irisarri et al. BMC Genomics 2012, 13:626 http://www.biomedcentral.com/1471-2164/13/626 RESEARCH ARTICLE Open Access The origin of modern frogs (Neobatrachia) was accompanied by acceleration in mitochondrial and nuclear substitution rates Iker Irisarri1, Diego San Mauro2, Federico Abascal1,3, Annemarie Ohler4, Miguel Vences5 and Rafael Zardoya1* Abstract Background: Understanding the causes underlying heterogeneity of molecular evolutionary rates among lineages is a long-standing and central question in evolutionary biology. Although several earlier studies showed that modern frogs (Neobatrachia) experienced an acceleration of mitochondrial gene substitution rates compared to non-neobatrachian relatives, no further characterization of this phenomenon was attempted. To gain new insights on this topic, we sequenced the complete mitochondrial genomes and nine nuclear loci of one pelobatoid (Pelodytes punctatus) and five neobatrachians, Heleophryne regis (Heleophrynidae), Lechriodus melanopyga (Limnodynastidae), Calyptocephalella gayi (Calyptocephalellidae), Telmatobius bolivianus (Ceratophryidae), and Sooglossus thomasseti (Sooglossidae). These represent major clades not included in previous mitogenomic analyses, and most of them are remarkably species-poor compared to other neobatrachians. Results: We reconstructed a fully resolved and robust phylogeny of extant frogs based on the new mitochondrial and nuclear sequence data, and dated major cladogenetic events. The reconstructed tree recovered Heleophryne as sister group to all other neobatrachians,
    [Show full text]
  • Native Frog (Leiopelma Spp.) Recovery Plan
    Native Frog (Leiopelma spp.) Recovery Plan Threatened Species Recovery Plan No. 18 Department of Conservation Threatened Species Unit PO Box 10-420 Wellington New Zealand Prepared by: Donald G. Newman Science & Research Division Department of Conservation for the Threatened Species Unit © March 1996, Department of Conservation ISSN 1170-3806 ISBN 0-478-01805-3 Cover photo: I. G. Crook, Department of Conservation CONTENTS page 1.0 Introduction 1 2.0 Past Distribution 3 2.1 Leiopelma hamiltoni 3 2.2 Leiopelma hochstetteri 3 2.3 Leiopelma waitomoensis (extinct) 3 2.4 Leiopelma markhami (extinct) 4 2.5 Leiopelma auroraensis (extinct) 4 3.0 Present Distribution 5 3.1 Hamilton's frog 5 3.2 Maud Island frog 5 3.3 Archey's frog 5 3.4 Hochstetter's frog 5 3.5 Captive stocks 6 4.0 Threats to Native Frogs 7 4.1 Hamilton's frog 7 4.2 Maud Island frog 7 4.3 Archey's frog 7 4.4 Hochstetter's frog 8 4.5 Global declines of amphibian populations 8 5.0 Ability to Recover 9 6.0 Options for Recovery 11 6.1 Hamilton's frog 11 6.2 Maud Island frog 11 6.3 Archey's frog 12 6.4 Hochstetter's frog 13 7.0 Recovery Strategy: Goal and Objectives 15 8.0 Recovery Strategy: Work Plan 17 9.0 Research Priorities 25 References 27 Acknowledgements 29 Appendix 1: Estimate of Funding Required Appendix 2: Monitoring Techniques for Native Frogs Appendix 3:Advocacy Pamphlet Appendix 4: Published Recovery Plans Figure 1: Former distribution of Leiopelma taxa identified from subfossils (Bell 1994, after Worthy 1986, 1987b) 4 Figure 2: Known distribution of extant Leiopelma species (Bell 1994) 6 1.0 Introduction The native frogs of New Zealand, Leiopelma spp., are regarded as amongst the most primitive living in the world today.
    [Show full text]
  • Cardioactive Toxins in True Toads (Anura: Bufonidae) Positive
    Downloaded from rsbl.royalsocietypublishing.org on 5 August 2009 Positive Darwinian selection results in resistance to cardioactive toxins in true toads (Anura: Bufonidae) David J. Moore, Damien C. T. Halliday, David M. Rowell, Anthony J. Robinson and J. Scott Keogh Biol. Lett. 2009 5, 513-516 first published online 22 May 2009 doi: 10.1098/rsbl.2009.0281 References This article cites 13 articles, 6 of which can be accessed free http://rsbl.royalsocietypublishing.org/content/5/4/513.full.html#ref-list-1 Receive free email alerts when new articles cite this article - sign up in the box at the top Email alerting service right-hand corner of the article or click here To subscribe to Biol. Lett. go to: http://rsbl.royalsocietypublishing.org/subscriptions This journal is © 2009 The Royal Society Downloaded from rsbl.royalsocietypublishing.org on 5 August 2009 Biol. Lett. (2009) 5, 513–516 Melanophryniscus and Dendrophryniscus, cardiotonic doi:10.1098/rsbl.2009.0281 steroids produced are bufadienolides (Flier et al. Published online 22 May 2009 1980; Mebs et al. 2007). Most other anurans are not Evolutionary biology tolerant to cardioactive steroids, but the hylid Scinax ruber and leptodactylid Leptodactylus macrosternum (Leptodactylus ocellatus species group) are natural pre- Positive Darwinian dators of bufonids in South America (Chen & Chen 1933; Crossland & Azevedo-Ramos 1999). selection results in Amino acid sites that determine tolerance to cardio- active steroids have been identified in the sodium resistance to cardioactive pump polymer. The initial extracellular loop of the toxins in true toads a1 subunit of the sodium pump is a primary binding site for cardiotonic steroids.
    [Show full text]
  • CHAPTER 10B.Indd 1 5/2/08 04:39:56 CHAPTER 10
    CHAPTER 10b.indd 1 5/2/08 04:39:56 CHAPTER 10. AMPHIBIANS OF THE PALAEARCTIC REALM Figure 1. Summary of Red List categories Brandon Anthony, J.W. Arntzen, Sherif Baha El Din, Wolfgang Böhme, Dan Palaearctic Realm contains 6% of all globally threatened amphibians. The Palaearctic accounts for amphibians in the Palaearctic Realm. Cog lniceanu, Jelka Crnobrnja-Isailovic, Pierre-André Crochet, Claudia Corti, for only 3% of CR species and 5% of the EN species, but 9% of the VU species. Hence, on the The percentage of species in each category Richard Griffi ths, Yoshio Kaneko, Sergei Kuzmin, Michael Wai Neng Lau, basis of current knowledge, threatened Palaearctic amphibians are more likely to be in a lower is also given. Pipeng Li, Petros Lymberakis, Rafael Marquez, Theodore Papenfuss, Juan category of threat, when compared with the global distribution of threatened species amongst Manuel Pleguezuelos, Nasrullah Rastegar, Benedikt Schmidt, Tahar Slimani, categories. The percentage of DD species, 13% (62 species), is also much less than the global Max Sparreboom, Ismail Ugurtas, Yehudah Werner, and Feng Xie average of 23%, which is not surprising given that parts of the region have been well surveyed. Red List Category Number of species Nevertheless, the percentage of DD species is much higher than in the Nearctic. Extinct (EX) 2 Two of the world’s 34 documented amphibian extinctions have occurred in this region: the Extinct in the Wild (EX) 0 THE GEOGRAPHIC AND HUMAN CONTEXT Hula Painted Frog Discoglossus nigriventer from Israel and the Yunnan Lake Newt Cynops Critically Endangered (CR) 13 wolterstorffi from around Kunming Lake in Yunnan Province, China.
    [Show full text]
  • Ultrastructure of the Spermatozoon of Leiopelma Hochstetteri (Amphibia, Anura, Leiopelmatidae)
    Ultrastructure of the spermatozoon of Leiopelma hochstetteri (Amphibia, Anura, Leiopelmatidae) David M. SCHELTINGA Barrie G. M. JAMIESON Department of Zoology and Entomology, University of Queensland, Brisbane, Qld, 4072 (Australia) [email protected] Karen E. EGGERS Ecology, Institute of Natural Resources (INR), Massey University, Private Bag 11222, Palmerston North (New Zealand) David M. GREEN Redpath Museum, McGill University, 859 Sherbrooke St. West, Montreal, Quebec H3A 2K6 (Canada) Scheltinga D. M., Jamieson B. G. M., Eggers K. E. & Green D. M. 2001. — Ultrastructure of the spermatozoon of Leiopelma hochstetteri (Amphibia, Anura, Leiopelmatidae). Zoosys- tema 23 (1) : 157-171. ABSTRACT The spermatozoon of the basal frog Leiopelma hochstetteri Fitzinger, 1861 is ex- amined and compared with previously investigated lissamphibian spermatozoa. L. hochstetteri spermatozoa share with those of urodeles and Ascaphus the ple- siomorphic (primitive) features of an elongate conical acrosome, and an elongate nucleus, with distinct nuclear shoulders, which tapers to a point (as the nuclear rostrum) in the subacrosomal space. The spermatozoon of L. hochstetteri, alone among the Anura, resembles those of urodeles in having a juxta-axonemal fibre at doublet 8. L. hochstetteri shares with Ascaphus truei (homoplastically) the reduction of the undulating membrane to a short, thick paraxonemal rod. L. hochstetteri spermatozoa have the plesiomorphic condition, also seen in dip- noans, of a cytoplasmic collar, containing mitochondria, around the axoneme. Although the sperm of L. hochstetteri lacks the endonuclear perforatorium seen in Ascaphus, Bombinidae, urodeles and caecilians, it has what may be remnants of an endonuclear perforatorium within the nuclear rostrum. No synapomor- phic spermatozoal characters are present to support the placement of Leiopelma KEY WORDS Amphibia, and Ascaphus in the same family.
    [Show full text]