Louisiana State University LSU Digital Commons
LSU Historical Dissertations and Theses Graduate School
1995 Transcriptional Studies of the Muscle-Specific Expression of the Rabbit Muscle Phosphofructokinase Gene. Haiqing Fu Schiltz Louisiana State University and Agricultural & Mechanical College
Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses
Recommended Citation Schiltz, Haiqing Fu, "Transcriptional Studies of the Muscle-Specific Expression of the Rabbit Muscle Phosphofructokinase Gene." (1995). LSU Historical Dissertations and Theses. 6075. https://digitalcommons.lsu.edu/gradschool_disstheses/6075
This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.
Hie quality of this reproduction Is dependent upon the quality of the copy snbmitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandardm a rg in * , and improper alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are mi«ing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g^ maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and confirming from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced fonn at the back of the book.
Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.
A Beif & Hewed information Company 300 Norm Zeeb Road Ann Arbor Ml 48106-1346 USA 313-761-4700 800 521-0600 TRANSCRIPTIONAL STUDIES OF THE MUSCLE-SPECIFIC EXPRESSION OF THE RABBIT MUSCLE PHOSPHOFRUCTOKINASE GENE
A Dissertation
Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy
in
The Department of Biochemistry
by Haiqing Fu Schiltz B.S., South China Normal University, P. R. C., 1983 M.S., Zhongshan University, P. R. C., 1986 December 1995 UMI Numbert 9613427
UMI Microform 9613427 Copyright 1996, by UMI Company. All rights reserved.
This microform edition is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, Ml 48103 ACKNOWLEDGMENTS
I would like to express my sincere thanks to all of those whose
support and encouragement have helped me during my graduate school career. I thank my mentor, Dr. Simon H. Chang, who has provided
professional advice and financial support. I also thank the members of my
advisory committee, Dr. Eric Achberger, Dr. Sue Bartlett, Dr. Ding Shih, and
Dr. Patrick DiMario for their guidance and advice. I thank the Department of Biochemistry for providing me the teaching assistantship. I would also
like to extend my thanks to my fellow graduate students in Dr. Chang's lab and in the department for all the wonderful memories that we have shared.
Special thanks to Drs. Harold Weintraub of the Fred Hutchinson
Cancer Research Institute in Seattle, Victor Lin of the University of Texas, Southwestern Medical Center in Dallas, and Hans Arnold of the University of Hamburg in Germany, for providing me the myogenic cDNA expression vectors that have been very important for this work. I dedicate this dissertation to Dr. Harold Weintraub who died of a brain tumor in early
March of 1995. He will inspire me for years to come.
I am specially grateful to my parents, my brother Hai-Shan and his wife Xiao-Yun, and my relatives in China whose love, support, and understanding made it possible for me to fulfill my dream. I also thank my mother-in-law Mrs. Tosso and her family, my father-in-law Mr. Schiltz, and his wife Sally for their love and support.
Most of all, I thank my husband Louie for his love, patience, advice, inspiration, and sacrifice that have carried me through this journey. We are very grateful for our three-year old son Stephen who has brought us joy, love, and hope.
ii TABLE OF CONTENTS
ACKNOWLEDGMENTS...... ii
LIST OF FIGURES...... v
LIST OF ABBREVIATIONS vi i
ABSTRACT ...... ix
CHAPTER 1 LITERATURE REVIEW ...... 1 1.1 Enzyme Kinetic Properties and Physiological Relevance of PFK...... 1 1.2 Tissue-Specific Distribution of PFK Isozymes and Their mRNAs ...... 4 1.3 Structural Organization of the PFK Genes ...... 6 1.4 Transcriptional Control of the Muscle PFK Genes ...... 11 1.5 Control Mechanisms of Muscle Gene Expression ...... 13 1.6 Structure, Function, and Regulation of the Myogenic bHLH Proteins ...... 16 1.7 Other Muscle-Specific Regulatory Factors ...... 30 1.8 Gene Tissue-Specific Inactivation by DNA Methylation ...... 33 1.9 Tissue-Specific Expression of the L- and C-PFK Genes...... 35 1.10 Research Objectives...... 36
2 MATERIALS AND METHODS...... 39 2.1 M a te ria ls...... 39 2.1.1 Enzymes and Sera ...... 39 2.1.2 Chemicals and Culture Media ...... 39 2.1.3 Cell Lines, Bacterial Strains, and Helper Phage ...... 41 2.1.4 DNA Plasmids ...... 41 2.1.5 Radioisotopes and Oligonucleotides ...... 43 2.2 Methods ...... 43 2.2.1 Construction of PFK-CAT Chimeras ...... 43 2.2.2 Cell Cultures ...... 52 2.2.3 Transfection and Enzymatic Assays ...... 55 2.2.4 Preparation of Glutathione S-transferase Fusion Proteins ...... 57 2.2.5 Preparation of Nuclear Extracts ...... 58 2.2.6 l32PJ End-Labeling of DNA Probes ...... 59 2.2.7 Electrophoretic Mobility Shift Assay (EMSA) ...... 60 2.2.8 DNasel Footprinting ...... 61 3 RESULTS AND DISCUSSION ...... 63 3.1 Transactivation of the RM-PFK Gene by the Myogenic bHLH Factors...... 63 3.2 Delineation of the Positive and Negative Regulatory Elements within the RM-PFK 5'-Flanking Region ...... 76 3.3 Interactions of MyoD and the C2C12 Nuclear Proteins with the El Enhancer In V itro...... 84 3.4 Determination of the Boundary and Activity of the Proximal Promoter ...... 93 3.5 Detection of Multiple Protein Binding Sequences within the Proximal Promoter Region ...... 106 3.6 Characterization of Another Muscle-Specific Promoter ...... 116
4 SUMMARY, CONCLUSIONS, AND FUTURE STUDIES...... 122 4.1 Summary and Conclusions ...... 122 4.2 Future Studies ...... 128 REFERENCES...... 131
APPENDIXES A RESTRICTION ENDONUCLEASE DIGESTION MAP OF THE 3 KB 5’ FLANKING SEQUENCE OF THE RM-PFK GENE...... 151 B LETTERS OF PERMISSION ...... 160
VITA ...... 166
i v LIST OF FIGURES
1-1 Schematic diagram of the exon-intron composition of the rabbit muscle PFK gene ...... 7 1-2 Comparison of the gene organizations of the rabbit muscle PFK and the mouse liver PFK ...... 8 1-3 Schematic representation of the six mRNAs of the rabbit muscle PFK gene ...... 9 1-4 Diagram of the MyoD bHLH domain/DNA complex ...... 19 1-5 Myogenic regulatory pathway...... 27 1-6 The 3 kb 5’-flanking DNA sequence of the RM-PFK gene ...... 38 2-1 Schematic diagram of the GST (glutathione S-transferase) fusion expression plasmid ...... 42 2-2 Schematic diagram of the myogenic cDNA expression vectors ...... 44 2-3 Cloning scheme for plasmids pUC-PFK and pB3.0 ...... 45 2-4 Schematic diagram of the 5’ to 3' deletion of plasm id pGEM3.0 by Exo III digestion ...... 47 2-5 Cloning scheme for plasmids pB1.2 and pB1.8 ...... 49 2-6 Schematic diagram of the proximal promoter CAT constructs ...... 51 2-7 Schematic diagram of the promoter b CAT constructs ...... 53 3-1 CAT activity representation of pB3.0 in C2C12 ...... 64 3-2 Comparison of the pB3.0 CAT activities at different days post transfection ...... 66 3-3 Concentration effect of pEMSV-MyoD on stimulation of pB3.0 CAT activity in C2C12 ...... 67 3-4 Concentration effect of MyoD plasmid on stimulation of pB3.0 CAT activity in primary myoblasts ...... 68 3-5 Comparison of the CAT activities of pB3.0 in 3T3 and C2C12 cells ...... 69 3-6 Differential transactivation of pB3.0 CAT expression in C2C12 by the myogenic bHLH factors...... 71 3-7 Differential transactivation of pB3.0 CAT expression in primary myoblasts by the myogenic bHLH proteins ...... 72 3-8 CAT activities of the internal deletion constructs w ithin the 3 kb prom oter sequence...... 77 3-9 CAT activities of the 5' to 3' deletion constructs ...... 81 3-10 SDS-PAGE of the purified GST-MyoD proteins ...... 86
v 3-11 EMSA competition assays for binding of the GST-MyoD proteins to El enhancer sequence ...... 87 3-12 EMSA titration experiments on El enhancer sequence ...... 88 3-13 EMSA competition study for binding of the C2C12 nuclear extracts to El enhancer sequence ...... 90 3-14 DNasel footprinting of the El enhancer region ...... 91 3-15 Transactivation of pB268 by the myogenic bHLH factors in C2C12 ...... 94 3-16 Relative CAT activities of the CAT constructs containing sequences of the proximal promoter in C2C12 ...... 96 3-17 Comparison of the CAT activities of the proximal promoter CAT plasmids during C2C12 differentiation ...... 101 3-18 Relative CAT activities of the PFK-CAT plasmids in 3T3 fibroblasts ...... 103 3-19 Comparison of the RM-PFK Inr with Inr of other genes ...... 105 3-20 DNasel footprinting of the promoter 268 bp region (top strand) ...... 107 3-21 DNasel footprinting of the promoter 268 bp region (bottom strand) ...... 109 3-22 Summary of the footprinting pattern of the proximal promoter 268 bp sequence ...... 110 3-23 EMSA titration experiments on the promoter 268 bp sequence ...... I l l 3-24 EMSA competition assays for binding of the myoblast nuclear extracts to promoter 268 bp sequence ...... 113 3-25 EMSA competition assays for binding of the myotube nuclear extracts to promoter 268 bp sequence ...... 114 3-26 Relative CAT activities of the promoter b containing CAT constructs...... 117 3-27 Mutation effect of the G-C stem loop downstream of the TATA sequence on the promoter activity ...... 120
v ] LIST OF ABBREVIATIONS
ADP adenosine 5'-diphosphate AMP adenosine 5'-monophosphate ATP adenosine 5-triphosphate P-gal [3-galactosidase bHLH basic-helix-loop-helix BIS N, N'-methylene-bisacrylamide BSA bovine serum albumin CAT chloramphenicol acetyltransferase C/EBP CAAT/enhancer-binding protein DBP D-element-binding protein DMEM Dulbecco's modified Eagle's medium DTT dithiothreitol EDTA ethlenediaminetetraacetic acid EMSA electrophoretic mobility shift assay EMSV pEMSVscribe (containing Moloney sarcoma virus promoter) FCS fetal calf serum Fru-1,6-P2 fructose- 1,6-bisphosphate Fru-2,6-BP fructose-2,6-bisphosphate Fru-6-P fructose-6-phosphate GST glutathione S-transferase HEPES N-(2-hydroxyethyl) piperazine-N'-(2-ethanesuifonic acid) HL-PFK human liver phosphofructokinase HNF hepatocyte nuclear factor HM-PFK human muscle phosphofructokinase HS horse serum Id inhibitor of defferentiation IPTG isopropyl-b-D thiogalatopyranoside LAP liver activator protein MCBF M-CAT binding factor MCK muscle creatine kinase MEF-2 myocyte-specific enhancer factor-2 Myf5 myogenic factor 5 ML-PFK mouse liver phosphofructokinase MM-PFK mouse muscle phosphofructokinase MyoD myogenic determination factor ONPG O-nitrophenyl-p-D-galactopyranoside RM-PFK rabbit muscle phosphofructokinase RT-PCR reverse transcription-polymerase chain reaction PBS phosphate-buffered saline PCR polymerase chain reaction PFK phosphofructokinase PFK2 6-phosphofructo-2-kinase PMSF phenyl-methylsulfonyl fluoride p.c. postcoitum pRB retinoblastoma protein SV40 sim ian virus 40 SDS sodium dodecyl sulfate SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis TGF-p transforming growth factor-p Tris Tris-(hydroxymethyl) aminomethane UTR untranslated region ZIP leucine zipper
viii ABSTRACT
The rabbit muscle phosphofructokinase (RM-PFK) gene is pre
dominantly expressed in skeletal muscle. Its muscle-specific transcription
was investigated using transient transfection studies, electrophoretic
mobility shift assays, and DNasel footprinting experiments. The evidence
presented here provides the first example of the myogenic basic-Helix-Loop-
Helix proteins regulating a gene that encodes a glycolytic enzyme.
The 3 kb 5'-flanking sequence of this gene directed the expression of the chloramphenicol acetyltransferase gene in muscle and non-muscle cells.
MyoD, Myf5, and myogenin exhibited differential transactivation
capabilities. MyoD had the most pronounced transactivational effect, and its
N-terminal transactivation domain and the basic DNA-binding region were
required for its function. The RM-PFK gene has at least two muscle-specific promoters that are approximately 1.9 kb apart, and that were stimulated by
the myogenic regulators to different extents. The proximal promoter was the major promoter responding to transactivation of the myogenic regulators. Progressive deletional analysis revealed that there were two positive and two negative regulatory regions controlling the proximal promoter. An enhancer region, El, contains a CAGCTG E-box that was recognized by MyoD glutathione S-transferase fusion in vitro. Along with this E-box, two other specific sequences were also recognized by the nuclear proteins of C2C12 cells.
The TATA-less proximal promoter was localized to a 268 bp region, with its core promoter lying within region -95 to +23 with respect to the cap site. A pyrimidine-rich initiator and a myotube-specific AG-rich sequence within the core promoter were recognized by the nuclear proteins of C2C12 cells. MyoD stimulation was mediated through the sequences around the core promoter, mainly through the region (-195 to -95) containing a crucial
CAGATG E-box. A CAGCTG E-box and a CCATCGT sequence downstream of the core promoter were also recognized by the nuclear proteins of C2C12 cells. In contrast, the distal promoter b was localized within a 671 bp region and might contain a TATA element (TTATTTATT). Thus, the differences in regulation of these promoters may be correlated with their divergent
DNA compositions. CHAPTER 1 LITERATURE REVIEW
1.1 Enzyme Kinetic Properties and Physiological Relevance of PFK Phosphofructokinase (ATP: D-fructose-6-P-l Phosphotransferase, EC
2.7.1.11, PFK) catalyzes the ATP-dependent phosphorylation of fructose-6-
phosphate (Fru-6-P) to fructose- 1,6-bisphosphate (Fru-1,6-P2) and ADP. This reaction is the rate-limiting step in the glycolytic pathway (Bloxham and
Lardy, 1973; Uyeda, 1979; Dunaway, 1983). Thus, the kinetic and allosteric behavior, as well as the structure of PFK, have been studied extensively
(Passonneau and Lowry, 1963; U yeda, 1979; K em p and Foe, 1983; Kolb et at., 1980; Poorman et a/., 1984; Y ounathan et a/., 1984; Hellinga and Evans, 1985;
V aldez et at., 1989; Schirmer and Evans, 1990; French and Chang, 1987; Lee et a/., 1987a; Nakajima et at., 1987; Gehnrich et at., 1988; Sharma et at., 1990;
Yamasaki et at., 1991; U et at., 1993).
PFK activity is sensitive to the intracellular energy state and is modulated by several metabolites that act as allosteric effector molecules.
Negative effectors (for example, ATP and citrate) decrease the affinity of PFK for the substrate Fru-6-P, while positive effectors (for example, Fru-2,6-BP,
AMP, and ADP) increase PFK affinity for Fru-6-P.
PFK activity is stimulated by fructose-2,6-bisphosphate (Fru-2,6-BP) which functions as a master switching signal between gluconeogenesis and glycolysis. The synthesis of Fru-2,6-BP is controlled by a cAMP protein kinase cascade through the opposing activities of the peptide hormones glucagon and insulin. When glucagon interacts with its membrane receptor, adenylate cyclase activity is increased and intracellular levels of cAMP rise. Insulin, on the other hand, reduces intracellular cAMP levels.
1 2
A cAMP-dependent protein kinase can phosphorylate 6-phosphofructo-2- kinase (PFK2), which is the enzyme responsible for synthesis of Fru-2,6-BP.
Once phosphorylated the kinase activity of PFK2 is inhibited, reducing
synthesis of Fru-2,6-BP. Thus, a reduction in Fru-2,6-BP by glucagon inhibits
PFK activity, whereas an increase in Fru-2,6-BP by insulin stimulates PFK activity.
Many biological events can activate or inhibit glycolysis through
manipulation of PFK activity. For example, the inhibition of glycolysis by
aerobic respiration, known as the Pasteur effect, is due to an inhibition of
PFK activity by ATP and citrate (Tejwani, 1978). Alternation in cardiac glycolytic rates, that is activation during anoxia or inhibition during insulin deprivation, is the result of changes in PFK activity due to the action of its effectors (Dunaway, 1983). In mammals, the influence of these effectors on
PFK activity depends on the composition of the PFK isozymic subunits (Tsai et at., 1975; Dunaway and Kasten, 1985; Dunaway et at., 1988; Dunaway and Kasten, 1989).
The vital role of PFK function is evidenced by PFK-deficiency diseases of humans and canines (Vora et at., 1985; Giger and Harvey, 1987; Giger et at., 1988a; Giger et a i, 1988b; Nakajima et at., 1990b; Yamada et at., 1991).
Inherited deficiency of the muscle-type PFK in humans is associated with a number of clinical syndromes. Tarui-Layzer syndrome, for instance, is characterized by muscle weakness upon exertion and/or hemolysis due to a lack of PFK activity in muscle cells and erythrocytes, respectively.
Part of the progression of events during muscle maturation or myogenesis appears to be an increase in the levels of glycolytic enzymes.
These include increases in the specific activities of PFK, creatine kinase, fructose bisphosphate aldolase, pyruvate kinase, and glycogen 3
phosphorylase. As proliferating myoblasts (the non-differentia ted muscle
cells) differentiate into myotubes and myofibers, the energy demand
changes from a need to support cell growth and division to the need to
respond to changes in the environment during muscular contraction. Muscular contraction demands a constant supply of ATP at a rate proportional to its consumption. Glycolysis is rapid and meets readily the
ATP demands of all muscle cells. During contraction the intracellular levels of AMP and ADP rise, and the muscle PFK isozyme is capable of
responding with an increase in its activity, resulting in an increase in glycolysis (Wills and Mansour, 1990). Thus, as the rate-limiting enzyme in glycolysis, PFK is particularly suited to respond to energy needs, and its activity is stimulated during myogenesis.
The catalytically active mammalian PFKs are homo- or hetero- tetramers composed of three distinct isozymic subunits each encoded by one of three genes. These genes or enzymes are designated muscle (M), liver (L), and brain (C) in rabbit. In humans, the C-type is referred to as P-type
(platelet) (Tsai and Kemp, 1974; Thrasher et at., 1981; Dunaway, 1983; Foe and Kemp, 1985). The PFK isozymic subunits associate randomly, and thus the relative abundance of the three subunits in a given tissue accounts for the isozymic composition of the tetramers.
Although each PFK isozymic subunit has a similar molecular mass of
85,000+5000 daltons, they have distinctive kinetic and allosteric behaviors
(D u n aw ay et at., 1988). The M4 homo-tetramer has the highest affinity for
Fru-6-P. Inclusion of L- or C-subunits in the tetramer reduces the enzyme's affinity for Fru-6-P. Moreover, the M4 tetramer is more sensitive to activation by AMP and ADP than the L4 tetramer. ATP is a substrate of PFK, but is also a major inhibitor. ATP inhibits the activity of all isoforms, with 4
the C4 tetramer being the most sensitive and the M4 tetramer the least
affected. Fru-2,6-BP antagonizes ATP inhibition by substantially enhancing the Fru-6-P affinity of M- and L-rich isozymes, but not the C-rich isozyme
(Pilkis and El-Maghrabi, 1988).
12 Tissue-Specific Distribution of PFK Isozymes and Their mRNAs The abundance of various PFK subunits is tissue-specific and
developmentally-specific. The PFK isozyme isolated from rat skeletal
muscle is the M4 tetramer, whereas the L4 tetramer is the dominant species
in liver and placenta. C4 tetramers are found predominantly in fibroblasts,
platelets and brain cells (Dunaway, 1983; Dunaway et al., 1988; Foe and
Kemp, 1985).
During development, the increase in total PFK synthesis in a given tissue is coincident with a dramatic alteration of PFK isozyme patterns
(Dunaway, 1983). For example, in developing rat skeletal muscle, the
proportion of M4 tetramers increases from 0.5% at the myoblast stage to
almost 100% by the myotube stage. Concomitant with this increase, there is
a decrease in the LA tetramers from 8.8% to nearly 0%. During rat fetal heart
maturation, however, the PFK C-subunit increases 79-fold, while the bl
and L-subunits increase only 8- and 2-fold, respectively. Starting from equal expression of the three subunits in fetal liver, the L-subunit increases 4-fold
in neonatal liver, while the M-subunit remains constant and the level of
the C-subunit becomes negligible.
Alterations of PFK isozymes occur in mouse C2C12 ceils (Yaffe and Saxel, 1977) that undergo cell differentiation from myoblasts to myotubes under tissue culture conditions. The three PFK subunits are all synthesized in proliferating myoblasts. Synthesis of the M-subunit dramatically 5 increases 10-fold 48 hours after cell differentiation is induced and when myotubes first become visible. Synthesis of the L- and C-subunits, on the other hand, declines and then remains at relatively low levels (Gekakis et al., 1989). These results imply that expression of PFK in C2C12 cells mimics that in muscle tissue.
Analysis of mRNA levels by Northern blot and reverse transcription- polymerase chain reaction (RT-PCR) by several groups revealed that the expression profile of PFK mRNAs closely approximates the distribution of the PFK isozymes in a given tissue (Gehnrich et al., 1988; Gekakis et al., 1989;
N a k a jim a et al., 1990a; Nakajima et al., 1994; Sharma et at., 1990; Tamasaki et al., 1991; Xiao, 1995). The mRNAs of human muscle PFK (HM-PFK), for instance, are expressed to high levels in muscle and kidney, but are weakly expressed in stomach and reticulocytes, and can be scarcely detected in placenta, liver and pancreas (Sharma et al., 1990). Similarly, the mRNAs of rabbit muscle PFK (RM-PFK) are predominant in muscle, while they are detected at low levels in heart, kidney, liver, and brain (Xiao, 1995). In mouse C2C12 cells, the mRNAs of muscle PFK (MM-PFK) gradually increase about 90-fold during differentiation, whereas L-PFK mRNAs slightly increase 4-fold (Gekakis et al., 1989). Unlike the mRNAs of the M- and L-PFKs which are found in more than one tissue, rat C-PFK mRNAs are only detected in brain (Gekakis et al., 1994). The human L-PFK mRNAs, however, are predominantly expressed in kidney and are expressed at low levels in liver and reticulocytes (Nakajima et al., 1990a, 1990c). In addition, the levels of L-PFK mRNAs are under nutritional and hormonal controls
( G e h n r ic h et al., 1988). These results suggest that mRNAs of the mammalian PFK genes are regulated in a tissue-specific and developmental-specific manner. This regulation could be at the levels of 6 mRNA synthesis and/or mRNA stability. Therefore, transcriptional and/or post-transcriptional controls may be involved in the regulation of PFK gene expression.
Developmental and tissue-specific transcriptional control appears to be mediated via interactions between trans-acting regulatory factors and cis- acting elements embedded 5* to or within protein-coding regions. The mammalian PFK genes, M-, L-, and C-PFK, are located on three different chromosomes (Vora, 1982). The 5-flanking regions of these PFK genes are heterogenous (Li et al., 1990; Nakajima et al., 1994; Gekakis and Sul, 1994).
This suggests that each PFK gene encompasses a unique complement of cis~ elements that can be specifically recognized by different sets or combinations of frans-acting factors. Thus, the mechanism of transcriptional regulation for each PFK gene may be different. The identification of cis-acting elements and trans-acting factors is a prerequisite to understanding the basic mechanisms that mediate differential PFK gene expression.
1.3 Structural Organization of the PFK Genes
The structures of the PFK genes are well-characterized and highly homologous. The RM-PFK gene was the first eukaryotic PFK gene to be cloned, and its exon-intron arrangement has been defined (Lee et al., 1987a).
The cloned RM-PFK gene is 20 kb in length (Fig. 1-1 ). The predicted coding sequence of 789 amino acids (Poorman et al., 1984) is divided into 22 exons ranging from 15 to 63 codons in size. Sequence alignments reveal that the exon-intron arrangements of the HM-PFK, HL-PFK, and ML-PFK are very similar to that of RM-PFK (Fig. 1-2 & 1-3) (Lee et al., 1987a; Y am asaki etal., 1991; Rongnoparut et al., 1991). 7
0 -5 10 uti —•— r i i m a r i u n i Rwpfn geoe
CpG ' >tn
h i . mm RMPFK cONAA 111., HI RMPfK cONA-9 in , m h MPFk rONA- a
HMPFK (ORA-fl
HMPF K [ORA C
Fig. 1-1. Schematic diagram of the exon-intron composition of the rabbit muscle PFK gene. Panel a. cDNAs of the rabbit muscle PFK are aligned with the genomic sequence to show the 5' UTR positions. Panel b. Comparison of the cDNAs of the human muscle PFK with those of rabbit muscle PFK (Adapted from Li et a t, 1990 with permission). 0 2 ) • ) « ' 1 •> :0 1 >: l» I) !6 i J I 19 JC 5 1C
fikfel m«tc* n \\
H«*f W(
Fig. 1-2 Comparison of the gene organizations of the rabbit muscle PFK and the mouse liver PFK (Adapted from Rongrcparut et al, 1991 with permission). VI! XI! XIV XVIXVIIIXX XXI! I II III IV VVI V!! IX x XI |xilltxv|xvjjxixlx^ RMPFK gene - § i ■ - ■ ■ ■■ ■ «— ■—m m m —b t
TATA C ^ A T G
Northern Blot N/d N/c N/b N/b’ N/a probes
MS* m — mRNA-a
— mRNA-bi
— mRNA-b2
—* mRNA-c
— mRNA-d1
— mRNA-d2
Fig. 1-3. Schematic representation of the six mRN As of the rabbit muscle PFK gene (Xiao,. 1995). The positions of the probes lor Northern blots and RT-PCR are shown. Dash lines indicate the splicing mtrons. Transcription start sites are indicated with arrows a, b, c, and d. 10
Comparison of mammalian PFK coding sequences revealed that
there is substantial similarity in amino add sequence between the N- and C-
terminal halves of the molecule, and that each half has similarity to
prokaryotic PFK. However, the sequence of the N-terminal half of mammalian PFK is more similar to the bacterial sequences with 36-43% identity than is the C-terminal half with 25-33% identity. In addition, the N-terminal half possesses a fully functional active site, whereas the C-
terminal half does not.
Although the sizes of the introns are variable, the coding sequences of the mammalian PFK genes are highly homologous. The HM-PFK is 96% homologous in amino acid sequence and 89% identical in nucleotide sequence to the RM-PFK (Nakajima et al., 1987). In contrast, the amino acid sequence of ML-PFK shows less identity (68%) to RM-PFK. Unlike E. coli, the nematode Haemonhus coHforfws, and Drosophila which all contain a single copy PFK gene (Klein et al., 1991; C urrie and Sullivan, 1994), yeast has two PFK genes with each having a single open reading frame (Heinisch et al., 1989). The two yeast PFK genes share 55% amino add homology , and are also homologous to RM-PFK.
On the basis of sequence comparisons, it is believed that the N- terminal half of the mammalian PFK is ancient (Fothergill-Gilmore and
Michels, 1993), and that the mammalian PFK evolved from a prokaryotic progenitor through a process of gene duplication, divergence, and fusion, leading to the transcriptional coupling of two PFK genes (Poorman et al.,
1984). The conserved gene structures and the tissue-specific distributions of the mammalian PFK isozymes implies that there might be a similar transcriptional regulation scheme governing the expression of the PFK genes across species. Thus, it is anticipated that studies of the muscle- 11
specificity of the RM-PFK gene will extend the knowledge of transcriptional regulation of other muscle PFK genes as well.
1.4 Transcriptional Control of the Muscle PFK Genes The availability of genomic and cDNA probes has allowed researchers
to analyze the transcripts of the PFK gene in different tissues. Studies from
primer extension, SI mapping, and RNase protection (Xiao, 1995) indicate
that the RM-PFK gene, like other muscle PFK genes, has multiple
transcription start sites.
A two-promoter system has been proposed for the MM- and HM-PFK genes (Nakajima et al., 1990c; Nakajima et al., 1994). Similarly, two full
length RM-PFK cDNAs have been identified which differ in their 5' untranslated regions (UTR) (Li et al., 1990). cDNA-a of RM-PFK (Fig. 1-1) is formed by a splicing event that removes a 1.7 kb intron located upstream of the ATG translation initiation codon. cDNA-b, on the other hand, contains the 3' portion of this intron. A comparison of the 5' UTRs among the cDNAs of the RM-, HM-, and MM-PFK suggests that both utilization of multiple promoters and alternative splicing may play a role in controlling differential expression of these muscle PFK genes.
The 5' UTRs of cDNA-b of the HM- and RM-PFK are similar to a particular MM-PFK cDNA referred to as the EcoR I (+) type (Nakajima et al.,
1994). It is interesting to note that the mRNAs corresponding to these cDNAs are predominant in skeletal muscle (Nakajima et al., 1994; Xiao,
1995). The similarity of the 5' UTRs indicates that the promoter corresponding to these mRNAs is conserved and muscle-specific. The 5'
UTRs of the HM-PFK cDNA-c and of the MM-PFK cDNA referred as EcoR I (-) type are highly homologous, but different from that of RM-PFK cDNA-a. 12
This suggests that the promoter for transcription of cDNA-a of the RM-PFK
is unique to the RM-PFK gene.
It was recently determined that there are four RM-PFK mRNA
species in addition to the aforementioned cDNA-a and -b (Fig. 1-3) (Xiao,
1995). Among these six mRNAs, mRNA-a correlates to cDNA-b, whereas mRNA-b (bl and b2) correlates to cDNA-a (Fig. 1-1 & 1-3). These b-type mRNAs are two alternative splicing variants transcribed from the same promoter. mRNA-a, -b, and -c are preferentially detected in skeletal muscle.
Whereas mRNA-a and -b are equally abundant in skeletal muscle, the level of mRNA-c is very low. Unlike these muscle-specific mRNAs, mRNA-d appears to be distributed in all tissues examined. This mRNA-d is similar to the cDNA-a of HM-PFK and to the cDNA EcoR I (-) type of MM-PFK in terms of its expression pattern. Taken together, these observations indicate that the RM-PFK gene, as well as the MM- and the HM-PFK genes, contains a conserved proximal promoter which directs skeletal muscle-specific expression; the RM-PFK gene has at least three promoters distributing over the 3 kb 5'-flanking sequence (Xiao, 1995). When the 5'-flanking sequences of the HM-PFK,
MM-PFK, and RM-PFK genes are compared, it reveals that these sequences share very little homology (Gekakis and Sul, 1994; Johnson and McLachlan,
1994). In spite of the divergence of their control DNA sequences, each of the mammalian muscle PFK genes appears to have transcriptional control mechanisms to ensure high levels of transcription in skeletal muscle. This suggestion is supported by the fact that the sequence resposibte for muscle- specific expression of the MM-PFK gene was located between -4800 and -3900 bp in respect to the proximal transcription start site (Gekakis and Sul, 1994), whereas multiple Spl sites surrounding the transcription initiation site 13
were shown to be required for high level expression of the HM-PFK gene
from the proximal promoter (Johnson and McLanchlan, 1994).
It is currently unclear whether or not these six RM-PFK mRNAs identified to date have similar PFK coding potential since the full length
sequences of the latter four mRNAs are unknown. Furthermore, these
mRNAs have not been quantitated, and thus their relative abundance in
different tissues is not conclusively known. Although the different 5' ends
may endow the transcripts with varying stability, there yet is no evidence
for potential involvement of mRNA stability regulation in the control of
RM-PFK gene expression. In summary, to date there is no indication yet of
the possible biological relevance of having so many different mRNAs.
Studies of the MM-PFK in muscle tissue of diabetic mice have also
raised some interesting questions. Earlier studies by Bauer and Younathan (1984) demonstrated for the first time that a drop in PFK activity in diabetic
rats was caused at both genetic and allosteric regulation levels. Coincident with a decrease in the MM-PFK activity in cardiac and skeletal muscles of ketotic diabetic mice (Dunaway et al.r 1986a, 1986c), the level of total MM-
PFK mRNA declines in these tissues (Nakajima et al., 1994). This decrease
in mRNAs can be reversed by insulin treatment, indicating that nutritional
and hormonal conditions regulate the mRNA level of MM-PFK. It remains unclear whether these conditions affect mRNA stability or alter the
transcription patterns of the MM-PFK gene by changing the promoter usage.
1.5 Control Mechanisms of Muscle Gene Expression
The majority of muscle proteins exist in multiple isoforms that are characteristic of different types of muscle. In particular, actin, the major contractile protein, has six different isoforms in higher vertebrates: two in 14
striated muscles (a-cardiac and a-skeletal); two in smooth muscles (a- and
Y*smooth); and two in all non-muscle cells ((3-and ycytoplasmic). Creatine
kinase (CK), a major enzyme in muscle metabolism, is present in muscle and in non-muscle cells as MCK and BCK isozymes, respectively. How such
diversity of muscle isoforms is generated has been a major focus of studies
in muscle gene expression.
Utilization of multiple promoters and/or alternative splicing at the 5'
end of the muscle genes are important mechanisms that lead to more than
one isoform from a single muscle gene. This results in different 5' exons
that may have different 5’ UTRs or different N-terminal protein sequences.
The myosin alkali light chains of fast skeletal muscle are produced from
these mechanisms. Based on the previous discussion of the structures of
the RM-PFK cDNAs, the RM-PFK gene may also fall into this category.
Alternatively, some muscle genes utilize multiple polyadenylation
sites that cause transcription to be terminated differentially, resulting in
different 3’ exons, or different C-terminal protein sequences. Another
important mechanism that allows multiple isoforms to be produced from a
single muscle gene is internal alternative splicing. This leads to the
presence of different internal sequences due either to alternative splicing of one or more exons, or to retention of one or more introns, or to utilization of multiple splice sites within a single exon.
The troponin T (TnT) gene presents the greatest complexity of
alternative splicing in mammalian muscle genes to date. By different
combinations of internal exons, two near the 3' end and four near the 5' end of the gene, 64 TnT mRNAs are produced (for review, see Buckingham,
1989). Yet it is unknown whether each mRNA represents a unique isoform, or how this alternative splicing may be regulated. It is clear, however, that 15
it takes place in a tissue-specific manner. Several studies have indicated
that the splice signals for alternative splidng of the TnT gene are not tissue-
specific, but that protein factors required for correct alternative splicing are induced during myogenesis (Breitbart and Nadal-Ginard, 1987).
In the cases of multigene families, expression of most muscle-specific genes is primarily controlled at the transcriptional level. Myogenesis
(muscle cell differentiation from myoblasts to myotubes and myofibers) is manipulated by altering the signals provided by growth factors, hormones,
and components of the extracellular matrix. Once myoblasts enter the
differentiation pathway, they withdraw from the cell cycle at the G1 phase, and fuse with neighboring myoblasts to form multi-nucleated myotubes.
This complex process is accompanied by the transcriptional activation of a
series of muscle-specific genes, which products are required for the unique
contractile and metabolic properties of the muscle fiber (Lassar and Weintraub, 1992).
A central question remaining is whether co-expression of the various
unlinked muscle-specific genes is governed by common or diverse trans
acting factors. Recently, several laboratories have identified specific DNA
consensus sequences that control expression of genes encoding several
contractile proteins. The muscle-specific genes that harbor these consensus
cis-elements include those encoding a-actin (Walsh and Schimmel, 1988),
muscle creatine kinase (MCK) (Trask et al., 1992; Adolph et al., 1993), myosin
heavy chain (J (Shimizu et al, 1992a; Adolph et al., 1993), troponin I (Lin et at., 1991), TnT (Mar and Ordahl, 1990; Farrance et al., 1992), desmin (Li and
Paulin, 1993), nicotinic acetylcholine receptor P subunit (Prody and Merlie,
1992), and dystrophin (Gilgenkrantz et aL, 1992). Several transcriptional
activators capable of specifically associating with these regulatory sequences 16 and transactivating muscle gene expression have been intensively investigated.
1.6 Structure, Function, and Regulation of the Myogenic bHLH Proteins The best-characterized muscle-specific transcription factors are the myogenic basic-helix-loop-helix (bHLH) proteins. These include MyoD 1 (D av is et al., 1987), myogenin (Edmonson and Olson, 1989; Wright et al.,
1989), Myf5 (Braun et at., 1989a), and MRF4/myf6/herculin (Rhodes and
Konieczny, 1989; Braun et al., 1990c; Miner and Wold, 1990). Members of this protein family have been identified in a variety of vertebrates, as well as in invertebrates, such as Drosophila, nematodes and sea urchin (Venuti et al., 1991; Krause and Weintraub, 1992). These proteins share 80% homology within their bHLH motifs that consist of about 70 amino acids. The myogenic factors isolated from sea urchins and nematodes can activate myogenesis in mammalian cells, indicating that the mechanisms that regulate muscle gene expression are conserved throughout evolution (for review, see Olson and Klein, 1994).
Proteins that share this bHLH motif are transactivators of transcription and are found in yeast, plants, and mammals. These proteins play an important role in the metabolic regulation of yeast, in the sex- determination of Drosophila, and in the differentiation of muscle, neural, myeloid, B-cells and erythroid cells of mammals (Lassar and Weintraub,
1992).
The bHLH proteins can be classified into three subfamilies based on the composition of their bHLH domains. These include the bHLH/ZIP, the bHLH, and the HLH subfamily. Proteins of the bHLH/ZIP subfamily, such as myc protein family, contain a leucine zipper motif (ZIP) following the 17
bHLH domain. Proteins of the bHLH subfamily do not have this ZIP motif
(for example, E-proteins and the MyoD proteins), whereas proteins of the
HLH subfamily, such as Id (inhibitor of differentiation) proteins, have
neither the ZIP motif nor the basic region (Lassar and Weintraub, 1992).
The bHLH proteins may be expressed either ubiquitously or
specifically in certain cell types. The E-proteins, El2 and E47, are
ubiquitously expressed in all tissues and cells tested. In contrast, the
myogenic bHLH proteins are found exclusively in skeletal muscle. As will be discussed later, the ubiquitous bHLH proteins preferentially form
heterodimers with the cell-specific bHLH proteins to facilitate their DNA
binding. All these bHLH proteins recognize the consensus sequence CANNTG (E-box), where N refers to any nucleotide.
Functional studies of the myogenic bHLH proteins have been carried
out using different genetic approaches including sequence deletion, base
substitution, domain swapping, and transgenics. Mutagenesis has shown
that the HLH motif serves as an interface for protein dimerization, which brings together the basic regions of the bHLH proteins to form a composite
DNA-binding domain (Voronova and Baltimore, 1990; Davis et al., 1990).
Members of the MyoD family do not efficiently form homodimers, but they
do readily form heterodimers with the ubiquitous E-proteins (Murre et al.,
1989b; Murre and Baltimore, 1992).
All bHLH proteins described to date bind to variations of the consensus sequence CANNTG; however, only the myogenic bHLH proteins are able to activate muscle-specific transcription (Davis et al., 1987; Braun et al., 1990b; Edmonson and Olson, 1989; Rhodes and Konieczny, 1989; Wright et al., 1989; Miner and Wold, 1990). This cell-type specificity of transcriptional activation is dependent on residues Ala-114, Thr-115 and 18
Lys-124 within the basic regions of the myogenic bHLH proteins (Davis et al. 1990; Brennan and Olson, 1991; Weintraub et a l, 1991a , 1991b; Schwarz et al., 1992). These three residues are specific to and conserved in all the
myogenic HLH proteins. When introduced into the DNA binding domain of E l2, these three residues are enough to confer on El2 the ability to
transactivate muscle-specific transcription (Davis and Weintraub, 1992).
Mutagenesis of the basic region prevents DNA binding, but not dimerization. HLH proteins that lack functional basic regions function as
negative regulators of E-box-dependent transcription. Two such proteins are Id and the MyoD basic region deletion mutant (MyoDAB). They dimerize preferentially with E-proteins and thereby inactivate myogenic bHLH proteins by sequestering their dimerization partners (Benezra et al.,
1990). The presence of Id at high levels in undifferentiated myoblasts and its down-regulation during differentiation suggests that it may play a role as a negative regulator of myogenesis.
The crystal structures of the bHLH domain-DNA complexes of four bHLH proteins (Max, E47, USF, and MyoD) have been solved and refined at 2.8 A resolution (Ferre-D’Amare et al, 1993, 1994; Ma et al, 1994; Ellenberger et a l, 1994). It appears that the bHLH structure is very well conserved in spite of the low sequence homologies between protein subfamilies. Max and USF are bHLH/ZIP proteins, but the presence of the leucine zipper motif does not significantly affect the structure of the bHLH domain.
In general, these proteins bind to DNA in the major groove as a dimer (Fig. 1-4). Each monomer forms two long a helices connected by a flexible loop. The first helix contains the basic region and the helix 1 region
(HI); the second helix corresponds to the helix 2 region (H2) and the ZIP region in the case of a bHLH/ZIP protein. The hydrogen-bond networks 3' 5'
Fig. 1-4 Diagram of the MyoD bHLH domain/DNA complex. MyoD homodimer is shown to interact with the major groove of the binding sequence (containing CAGCTG) through the composite basic region DNA binding motif. The bHLH domains of MyoD diinerize through their HLH regions. (Adapted from Ma et al., 1994 with permission). stabilize the conformation of the loop as well as the orientation of helices 1
and 2 within each monomer. Two monomers fold into a parallel, left-
handed, four-helix bundle, and the conserved hydrophobic residues in the hydrophobic core are packed together by van der Waals interactions. The
leucine zipper regions of Max and USF extend the protein dimer interface,
thereby increasing the efficiency of dimerization and DNA binding. It
seems that different dimerization mechanisms between the bHLH and the
bHLH/ZIP proteins provide specificity for these protein dimerization
interactions. This may explain why the bHLH/ZIP proteins usually fail to
dimerize with the bHLH proteins. The bHLH protein E47, however, has an
unique salt bridge between a histidine residue of helix 1 and a glutamate
residue of helix 2. This feature allows the E47 monomer to be more stable,
and facilitates dimerization of E47 with MyoD.
The bHLH domains of MyoD interact with E-box DNA through
residues within the basic region, the loop, and the amino-terminal end of
helix 2. In particular, residues in the basic region make most of the DNA contacts. Each monomer recognizes one-half of the dyad or pseudo-dyad
DNA binding site CANNTG with DNA contacts at more than ten positions.
A conserved glutamate residue (Glu-118 of MyoD, Glu-345 of E47, Glu-32 of
Max, and Glu-208 of USF) recognizes CA of the CANNTG by accepting one hydrogen bond from both the residues C and A . Interestingly, Arg-111 of
MyoD hydrogen bonds with the G of the CANNTQ and with Thr-115, which in turn makes hydrophobic contacts and a hydrogen bond with the T of the
CANNTG. The corresponding arginine residues in the non-myogenic bHLH proteins do not make DNA contacts as Arg-111 of MyoD does.
In contrast to the conserved recognition mechanism for the CA of
CANNTG. bHLH proteins have subtle preferences for the central 2-bp. Glu- 21
118 of MyoD makes a water-mediated H-bond with the C in CAG£TG.
Therefore, CAGCTG is the preferred sequence for MyoD binding. E47 makes
H-bonds with the left-side G of the lower strand, and contacts the DNA backbone of the left-side C of the upper strand CA£CTG. Thus, a CACNTG
is preferred by E47. Max and USF prefer CACGTG because of H-bonding
with the G of CACGTG by Arg-36 of Max and Arg-212 of USF. In addition,
the MyoD protein has a preference for purines on the 5'-flanking side of the E-box (R A-CANNTG) and pyrimidines on the 3'-flanking side (CANNTGTY).
The crystal structures also provide some implications for myogenic transactivation of MyoD. As previously described, the bHLH domain of
MyoD is necessary and sufficient for DNA binding and muscle cell conversion. A region of about 50 residues located at the N-terminus of
MyoD is referred to as the transactivation domain. In addition, three residues (Ala-114, Thr-115, and Lys-124) of the basic region are critical for transcriptional activation. The crystal structures show that only Lys-124 is exposed on the surface of the MyoD-DNA complex, and that it does not make contact with the DNA. This suggests that Lys-124 can readily participate in protein-protein interactions. Ala-114 and Thr-115, however, are buried in the DNA major groove. Importantly, these three residues have been recently shown to be required for MyoD interaction with the myocyte-specific enhancer factor 2A (MEF-2A). As will be described later, MEF-2A is a myogenic factor that induces MyoD expression and cooperates with MyoD to activate muscle gene expression (Kaushal et al., 1994).
It is speculated that A rg-lll’s burial in the major groove is necessary for the transactivation activity of the myogenic bHLH proteins. Ala-114 and
Thr-115 are critical in determining the conformation of Arg-111. Ala-114 22
with its small side chain provides room for Arg-111 to fit into the groove.
Thr-115 makes a H-bond with Arg-111 to stabilize its conformation. The
corresponding arginine residues in the non-myogenic bHLH proteins swing
out from the major groove, and thus do not contact DNA as Arg-111 of
MyoD does. Introducing other residues at positions 114 and 115 may force
Arg-111 out of the major groove, and may interfere with transcriptional activation of MyoD. This assumption is based on the fact that the residues of the corresponding positions 114 and 115 in E47 are not alanine and
th re o n in e .
The myogenic bHLH region functions only in certain cellular contexts. In contrast, the transcription activities of the transactivation
domains of the myogenic regulators, located in either their N- or C- termini,
are not restricted to muscle cells (Weintraub et al., 1991a, 1991b; Schwarz et al., 1992; Braun et al., 1990b). Further investigation has suggested that the
specific DNA binding alone is insufficient to activate the muscle gene
expression, and that transcriptional activation by HLH regulators requires cell-specific recognition factors or cofactors.
Muscle LIM protein (MLP) appears to be one of these cofactors that
play important roles in qualitative and quantitative aspects of myogenesis
and muscle-specific gene expression (Arber et al., 1994). The MLP gene is
expressed exclusively in myotubes, but not in proliferating myoblasts.
Transfection studies revealed that the requirement of MLP for myogenesis
is first detected at the exit from the cell cycle. Early differentiation events
preceding exit from the cell cycle apparently do not depend on MLP.
The functional activities of the myogenic bHLH proteins are
controlled by the signal transduction network. It was initially evident in
C2C12 cells that differentiation from myoblasts to myotubes requires 23
withdrawal of growth factors from the medium (Tapscott et al., 1988; Yutzey
et al., 1990). Fibroblast growth factor inhibits myogenesis by inactivating
myogenic HLH proteins through phosphorylation of a conserved site in
their basic regions. This modification is mediated via the protein kinase C-
dependent pathway, resulting in the loss of DNA-binding abilities of these
myogenic proteins (Li et al., 1992a, 1992c). Similarly, cAMP-dependent
protein kinase inactivates the myogenic bHLH proteins through phosphorylation (Li et al., 1992b; Winter et al., 1993). Transforming growth
factor-P (TGF-P), on the other hand, selectively inhibits function of the myogenic bHLH proteins, but not that of E-proteins. This inactivation is
independent of DNA binding, and it is mediated by the bHLH region
(B ren n an et al., 1991; Martin et al., 1992). It has been proposed that TGF-P-
dependent pathway interferes with the expression or activity of a co
activator that recognizes the myogenic basic region. A variety of transforming genes (such as src, ras, fos, jun, fps, erbA,
myc, and E1A) also inhibit myogenic differentiation (Holtzer et at., 1975;
L assar et al., 1989; Olson et al., 1987; LaRocca et al., 1989; Webster et al., 1988;
Su et al., 1991). The growth factor-inducible proteins Jun, Fos, and Ras can
inhibit expression and activities of the myogenic bHLH proteins (Lassar et al., 1989; Bengal et al., 1992). Since c-Jun can physically associate with MyoD between the bHLH region of MyoD and the leucine zipper of c-Jun, it
prevents MyoD from binding to cognate DNA sequences (Bengal et al., 1992).
The retinoblastoma protein (pRB) is a tumor suppresser that
functions as a negative growth regulator (Lee et al., 1987b; Huang et al., 1988). The unphosphorylated form of pRB actively maintains the cells in
the Go/Gi phase of the cell cycle (Buchkovich et al., 1989; Goodrich et at.. 24
1991). In particular, pRB plays an important role in the production and
maintenance of the terminally differentiated phenotype of muscle cells (Gu
et al., 1993). It is known that pRB mediates the MyoD-induced cell cycle
arrest and permanent withdrawal of muscle cells from the cell cycle. MyoD
and pRB of the unphosphorylated form interact specifically in vitro an d in
vivo , forming a heterodimer that does not bind to E-box sequence. The
sequences required for MyoD and pRB interaction include a portion of the pRB pocket and the bHLH domain of MyoD, which are also known to be
involved in other protein-protein interactions. MyoD interacting regions of
pRB overlap, but they are distinctive from binding sites of viral
oncoproteins SV40 T antigen and El A (DeCaprio et al., 1988; Whyte et al., 1988; Kaelin et al,, 1990).
It is suggested that MyoD locks pRB in its unphosphorylated form such that pRB is unresponsive to growth factor signals. Further studies
have shown that pRB or a related protein pl07 is required for the myogenic
effect of MyoD. Formation of E12 homo- and MyoD-E12 hetero-dimers are
not disrupted by addition of pRB. However, E-box DNA binding activity is
abolished when pRB is removed from muscle cell extracts, either by
depletion with an anti-pRB monoclonal antibody or with El A protein. This
result along with other observations suggest that pRB is involved in
formation or stabilization of the E-box-containing complex, and thus is
required for the transactivation function of MyoD.
Intriguingly, the myogenic bHLH factors are present in proliferating
myoblasts (Tapscott et al., 1988; Wright et at., 1989; Braun et al., 1989b), where they do not actively form DNA-binding complexes, do not act as muscle-specific transcription factors, and do not act as inhibitors of the cell cycle (Mueller and Wold, 1989). This inactivation is partially due to the fact 25
that c-Jun is abundant in serum-stimulated cells. In addition, pRB
preferentially associates with E2F through its pocket region in proliferating
cells; thus, it is not available for MyoD interaction. E12 or E47 is sequestered by Id proteins and thus is prevented from interacting with the myogenic
bHLH proteins. Id proteins also interact with the unphosphorylated form of
pRB to exert its inhibition of MyoD (Iavarone et al., 1994).
There are three Id genes that have been identified including Id-1
(B e n e z ra et al., 1990), Id-2 (Sun et al., 1991; Biggset al., 1992), and Id-3 (C h risty et at., 1991; Ellmeier et al., 1992; Deed et al., 1993). The Id genes are
regulated by growth factors (Ogata et al., 1993), and are highly expressed
during early development while proliferation is occurring. These proteins are typically not expressed in most mature tissues. They specifically
associate with the bHLH proteins of the E-class but not with the bHLH/ZIP
proteins, thus inhibiting myogenic effect of the myogenic bHLH proteins (S un et al., 1991; Jen et at., 1992). Interestingly, Id-2 protein preferentially
binds to pRB through the HLH domain of Id-2 and an intact pocket domain
of pRB (Iavarone et al., 1994). This association blocks the interaction
between pRB and MyoD. Therefore, Id proteins antagonize the function of
the myogenic bHLH proteins either directly or indirectly.
The myogenic bHLH proteins play an important role in determining
myoblast proliferation or differentiation. When expressed ectopically in a
variety of non-muscle cells, each of the four myogenic bHLH proteins can
activate skeletal muscle gene transcription. In addition, these myogenic
factors bind to the consensus E-box with limited sequence preference, and
activate their own and one another's expression (autoregulation). Whether or not they possess identical or distinctive activities in vivo has been
uncertain from transfection experiments. 26
Recently, gene knockout experiments (in which individual myogenic regulatory genes were inactived by DNA homologous recombination) have revealed very surprising results. In transgenic MyoD-null mice, MyoD
appears not to be required for myogenesis in the mouse embryo; MyoD-null
mice are fully viable and show no obvious muscle abnormalities (Rudnicki
et al., 1992). The only apparent effect of MyoD inactivation is an increase in
the level of Myf5 mRNAs in skeletal muscle, consistent with the reciprocal functions of these two genes in tissue cultured cells. However, MyoD is not
essential for activation of genes for myogenin and MRF4 (or Myf6).
Similarly, Myf5-null mice also develop normal skeletal muscle, but
they die at birth due to the absence of the distal parts of the ribs which
results in an inability to breathe (Braun et al., 1992b). The only apparent
alteration within the skeletal muscle in these mice is a 2-day delay in the initiation of expression of the muscle markers. Moreover, despite the fact
that Myf5 is the first myogenic bHLH protein expressed during embryogenesis, Myf5-null mice transcribe normal levels of the other
myogenic bHLH mRNAs.
The studies of the MyoD and Myf5 double-null mice further
confirmed that the functions of these genes are overlapping. These mutant
mice produce no detectable myoblast marker desmin (Rudnicki et al., 1993), suggesting that both MyoD and Myf5 act early in the myogenic lineage and determine myoblast conversion from myogenic stem cells.
In contrast, myogenin-null mice display severe skeletal muscle deficiencies, and do not express several muscle-specific genes (Hasty et al.,
1993; Nabeshima et al., 1993). The fact that there is a normal level expression of MyoD but a reduced level of MRF4 in these mutant mice also suggests that MyoD is insufficient for normal muscle differentiation in the ® e > MYOBLAST MESODERMAL PROGENITOR *- oMyo& M Y O TU Bf mvoh &er
' U p t l r t i m ' Dtitrmtoifton UyotXiti \ W n»‘»i>oi u l , i W u f * M o n MilF4 - - . Myithw Acilvtiof CtlHI " ^ ” Gtma* > Uyotuh* G t n t * CD F«ciof*G rowih
Fig. 1-5. Myogenic regulatory pathway. (Adapted from Olson and Klein, 1994 with permission). 28
absence of myogenin; further, it suggests that the absence of myogenin does
not affect MyoD expression. Therefore, myogenin is not required for the
commitment of cells to the myogenic lineage, but it is important for terminal differentiation. Olson and Klein (1994) proposed a "hypothetical
regulatory pathway" (Fig. 1-5) to summarize the function of each of these
myogenic bHLH proteins in myogenesis.
Even though these myogenic bHLH proteins share the same DNA
binding sequence and have inter-changeable transactivation activity in
vitro, they show unique expression patterns in vivo (Buckingham, 1992).
Myf5 is the first of them to be expressed during mouse embryogenesis, with transcripts appearing in the somite at day 8.0 postcoitum (p.c.). Myogenin transcripts appear in the myotome by day 8.5 p.c., while MRF4 and MyoD are expressed in the myotome at day 9 and 10.5 p.c., respectively. In addition, MyoD is preferentially expressed in fast-twitch muscle fiber (Hughes et al.,
1993). Thus, expression of the myogenic bHLH proteins is temporal, sequential, and auto-regulated. This expression profile may be necessary for maintaining muscle-specific transcription constitutively throughout differentiation, once muscle gene transcription is induced by these myogenic regulatory proteins (Braun et al., 1989a; Rhodes and Konieczny, 1989; Thayer et al., 1989; M iner and W old, 1990).
E-boxes are present in the control regions of most skeletal muscle genes where they mediate muscle-specific transcription and transactivation by the myogenic HLH proteins. These E-boxes are generally surrounded by binding sites for other transcription factors that collaborate with the myogenic regulators to induce muscle-spccific transcription. MyoD proteins cooperatively bind to DNA that contains multiple E-boxes for high level induction of muscle gene transcription (Weintraub et al., 1990). For 29
instance, the cooperative interactions between MyoD, serum response
factor, and Spl regulate the a-actin gene promoter (Sartorelli et at., 1990),
whereas interactions of myogenic bHLH proteins and MEF-2 enhance
transcription of the muscle creatine kinase (MCK) gene (Gossett et al., 1989;
Cserjesi and Olson, 1991). Other serum-indudble factors and MyoD proteins
are involved in myoblast-specific expression of desmin (Li and Paulin,
1993). However, there are also examples of muscle genes that are regulated by the myogenic HLH proteins, but which lack E-boxes in their control
regions. Activation of these types of muscle-specific genes is directly regulated by MEF-2 whose expression is controlled by the MyoD proteins.
Muscle-specific gene expression appears to be synergistically controlled by the muscle-specific regulatory factors. Synergism of transcriptional activators is a common phenomenon. This is simply because the regulatory regions of eukaryotic genes often contain clusters of binding sites for several different activators (or repressors), with some of the activators (and repressors) having multiple binding sites. Synergism refers to greater than additive increase or decrease in transcription when two or more activators or repressors are present simultaneously, or when additional binding sites for a single activator or repressor are presented. It also implies that activators facilitate a single transcriptional event in which activators stimulate the same transcription complex.
As proposed by Herschlag and Johnson (1993), synergistic effects can be classified as positive cooperativity and negative cooperativity. For positive cooperativity, activators interact with each other as well as with the transcriptional apparatus. Alternatively, binding of one activator to the transcriptional complex could facilitate the binding of another activator.
Thus, the presence of one activator strengthens the binding of another. For 30
negative cooperativity, the binding of one activator hinders binding of the
other.
During myogenesis, it appears that synergistic regulation of muscle genes is important for coordinating responses from many different signals,
and for amplifying these responses from small changes in activator
concentrations (Herschlag and Johnson, 1993). This regulation is
accomplished by myogenic bHLH factors, other muscle-specific activators,
and the ubiquitous transcriptional factors.
1.7 Other Muscle-Specific Regulatory Factors Myogenic bHLH proteins are not the only pathway for activation of muscle-specific gene expression. For instance, MEF-2 was originally
identified as a muscle-specific DNA binding activity that recognizes an A+T
rich sequence [CTA(A/T> 4TAG] found in the control regions of numerous
muscle genes (Gossett et al., 1989; Adolph et al., 1993; Cserjesi et al., 1994;
L eib h am et at., 1994; Li and Capetanaki, 1994). Another muscle-specific
factor, M-CAT binding factor (MCBF), has been reported to act
independently of the myogenic bHLH proteins, and to regulate the
expression of several cardiac genes (Mar et at., 1988; M ar and O rdahl, 1990;
T hom pson et at., 1991; Shimizu et al., 1992b; Flink et at., 1992; Parmacek et al., 1992; Iannello et at., 1991; Stewart et al., 1994).
MEF-2 comprises a group of tissue-restricted MADS box transcription
factors (Yu et at., 1992; Martin et al., 1993; Martin et al., 1994). The term
"MADS" is the abbreviation for MCM1, which regulates mating type-specific genes in yeast, A ga mo us and D eficiens, which are the homeogenes in plants, and serum response factor, which regulates muscle-specific and
serum-inducible gene expression (Pollock and Treisman, 1991). Members of 31 the MADS family share homology within a region called the MADS box; this region is comprised of about 56 amino acids which mediate DNA binding and dimerization. Immediately adjacent to the MADS box is an additional 29-amino-acid region called MEF-2 domain, that is highly conserved only among MEF-2 proteins.
Four distinct genes encoding MEF-2 proteins (MEF-2A, -2B, -2C, and
-2D) have been cloned. They are predominantly, if not exclusively, expressed in skeletal, cardiac, and smooth muscle as well as in neuronal cells (Yu et al., 1992; Pollock and Treisman, 1991; Chambers et a/., 1992;
B reitb art et at., 1993; Leifer et al., 1993; McDermott et at., 1993; Martin et al.,
1993; Nguyen et a l, 1994; Lilly et a l, 1994). MEF-2D accumulates in the
C2C12 myoblasts; MEF-2A, B, and C can only be detected in myotubes.
MEF-2 proteins form homo- or hetero-dimers upon binding to the
DNA recognition sequence; these dimers are essential for high level expression of many striated muscle genes (Braun et a l, 1989a; Gossett et a l,
1989; Horlick and Benfield, 1989; Wentworth et a l, 1991; Zhu et a l, 1991;
Ian n e llo et a l, 1991; Lee et al., 1992; Nakatsuji et a l, 1992). In many muscle genes, MEF-2 sites are often juxtaposed to one or more E-boxes. More importantly, MEF-2 proteins, such as MEF-2A, cooperate with the myogenic bHLH proteins to synergistically activate transcription of the muscle genes
(K au sh al et a l, 1994). These interactions are mediated through the MADS domain of MEF-2A and the three unique amino acid residues (Ala-114, Thr-
115, Lys-124) in the basic region of the myogenic bHLH proteins (Kaushal et al., 1994). MEF-2A itself can induce myogenic development when ectopically expressed in non-muscle cells. The fact that ectopic expression of myogenin or MyoD induces MEF-2 expression in many non-muscle cells 32
suggests that MEF-2 genes are downstream of the myogenic bHLH genes in
the hierarchy of myogenic regulators.
However, functional MEF-2 DNA-binding sites are also found in the
control regions of both the mouse myogenin and Xenopus MyoD (XMyoD)
genes, indicating that MEF-2 proteins are important regulators of the
myogenic bHLH gene expression. In the 5'-flanking region of XMyoD gene,
there is a 58-bp fragment containing the transcription initiation site, a GC- rich region, and overlapping binding sites for the general transcription
factor TFIID and for MEF-2; this fragment is sufficient to direct muscle-
specific transcription (Leibham et al., 1994). This minimal XMyoD promoter
is activated in non-muscle cells by the co-expression of X enopus MEF-2, which requires binding of both TFIID and MEF-2 to the TATA box (Leibham
et al., 1994). Therefore, skeletal myogenesis is mediated by two distinct but mutually inducible and interactive transcription factor families, the
myogenic bHLH proteins and MEF-2 proteins.
MCBF, the third class of the muscle-specific regulator, was first found in the regulation of muscle-specific transcription of the cardiac troponin T
(cTNT) gene (Mar and Ordahl, 1988; Mar and Ordahl, 1990; Stewart et al.,
1994). This cTNT gene is expressed constitutively in cardiac muscle, but transiently in skeletal muscle during embryonic development. It is
transcribed at the onset of terminal differentiation and repressed in adult
muscle — unless it is activated in satellite cells during skeletal muscle regeneration (Mar and Ordahl, 1990). MCBF recognizes the conserved M-
CAT sequence CATTCCT that has been found in the control regions of
several muscle-specific genes (Nikovits et al., 1986; Thompson et al., 1991; S h im u z u et at., 1992a). 33
In any event, MCBF-dependent genes appear not to require the myogenic bHLH proteins for their transcription. The enrichment of MCBF in nuclear extracts of muscle, but not from other tissues, is consistent with its function. Although the structure and function of this protein(s) has not been studied in great detail, MCBF represents an alternate bHLH protein- independent pathway of muscle gene regulation (Farrance et al., 1992).
1.8 Gene Tissue-Specific Inactivation by DNA Methylation
It is believed that differentiation requires continuous regulation of the tissue-specific genes (Blau and Baltimore, 1991). This regulation is thought to be controlled by an active mechanism. Thus, continuous activity of positive and negative regulators is required to maintain differentiation during normal development. For instance, activation of the silent MyoD gene in fibroblasts (undifferentiated cell types) causes a complete myogenic conversion, indicating that the MyoD gene is actively controlled. In contrast, the sequential expression and autoregulation of the myogenic bHLH genes ensures that levels of these regulators are stable, leading to continuous control of muscle gene expression.
In fact, gene silencing by methylation modification of the 5' CpG islands during the early development results in inactivation of certain genes in a tissue-specific manner. While tissue-specific genes are methylated in most cell types, housekeeping genes are constitutively unmethylated (Yisraeli and Szyf, 1984; Bird, 1986; Cedar, 1988; Comb and Goodman, 1990; Bird, 1992; Rhodes et a t, 1994). CpG islands are DNA sequences averaging 1 kb long that are found almost exclusively at the 5'- flanking regions of both the housekeeping and tissue-specific genes 34
(Antequera and Bird, 1993). The CpG dinucleotide is the target for methyltransferase that methylates the C residue at the carbon 5 position. DNA methylation at CpG islands presumably affects gene expression in three ways. First, it can directly reduce the DNA-binding activity of transcription activators or repressors by altering the conformation of their
DNA cognate sequences (Comb and Goodman, 1990; Klempnauer, 1993;
Frendergast and Ziff, 1991; Bednarik et al., 1991). Spl and NF-1, however, are insensitive to DNA methylation (Harrington et at., 1988; Holler et al.,
1988; Ben-Hattar et al., 1989). Second, DNA methylation can alter the chromatin structure such that genes become transcriptional inactive (Keshet et al., 1986). The fact that histone HI, a transcriptional repressor, preferentially binds to the methylated DNA suggests that HI proteins are involved in methylation-mediated inhibition of transcription (Weintraub,
1984; Cronston et al., 1991; Levine et al., 1993). Finally, DNA methylation can inhibit transcription through 5-methyl-C-binding proteins (Huang et al.,
1984; Meehan et al., 1989). These proteins specifically bind methylated CpG sequences, possibly blocking transcriptional activators to the access of cis- elem en ts.
The unmethylated and methylated states of the housekeeping and tissue-specific genes produce a bimodal pattern of methylation in somatic cells. This bimodal somatic methylation is probably established through the combined action of a general de novo methylation mechanism with some stage-specific factors that either protect islands from methylation or actively demethylate these sequences (Brandeis et al., 1994). Demethylation of the
CpG islands can be directed by the GC-box of the Spl binding sites, indicating that Spl may be involved in this process (Bird 1986; Holler et al., 1988; M acleod etal., 1994). 35
In the case of RM-PFK gene, there is a 1 kb CpG island which is 2 kb 5* upstream of the ATG codon. To determine if the chromatin structure and
DNA methylation may play a role in the tissue-specific regulation of this gene, the patterns of the DNasel hypersensitive sites and methylation in different tissues were studied (Knaak, unpublished data). Results demonstrated that the CpG island of the RM-PFK gene is almost not methylated in skeletal and cardiac muscle, while it is highly methylated in liver, and less methylated to different extents in kidney, spleen and brain.
1.9 Tissue-Specific Expression of the L- and C-PFK Genes Mechanisms for transcriptional regulation of the other mammalian
PFK genes L-, and C-PFK remain undetermined. In general, three mammalian PFK genes are located on separate chromosomes, and their expression seems to be regulated independently. Transcription of the mouse L-PFK gene, however, is under hormonal and nutritional controls (Gehnrich et al., 1988; Gekakis et al., 1989). DNasel footprinting experiments showed that there are five regions on its control sequence where liver nuclear proteins may interact (Rongnoparut et al.,
1991). Although evidence is lacking on how the liver-specific expression of the L-PFK gene is controlled, studies from the expression of several other liver-specific genes imply that several liver-specific transactivators are involved in regulation of liver gene specificity.
The PFK2 gene contains a liver-type promoter that is under the control of hepatocyte nuclear factor (HNF) 3, CAAT/enhancer-binding protein (C/EBP) related factors, and other liver-specific factors (Lemaigre et al., 1991 & 1993). HNF1 regulates transcription in early liver development
(M e n d e l et al., 1991); C/EBPoc is active during late fetal liver and early 36 postnatal liver development (Birkenmeier et al., 1989); both liver activator protein (LAP) and D-element-binding protein (DBP) are most active in the postnatal liver during development (Descombes and Schibler, 1991; Mueller et al., 1990). These liver-specific factors also control temporal expression of the human alcohol dehydrogenase gene family (Ooij et al., 1992).
Interestingly, C/EBPa, LAP, and DBP are proteins within the basic-leudne zipper (bZIP) protein family. Like bHLH proteins, bZIP proteins recognize specific DNA sequences through their basic domains upon protein dimerization at their leucine zipper motifs (Johnson and McKnight, 1989).
1.10 Research Objectives
It is believed that the regulation of muscle-specific expression of the
RM-PFK gene occurs mainly at the transcriptional level. To illustrate this controlling mechanism, the cis-acting elements and the trans-acting factors involved in this regulation must be identified. For this reason, approximately 3 kb of the 5' upstream sequence of the RM-PFK gene had been previously sequenced (Fig. 1-6).
Sequence analysis shows that RM-PFK has a high GC content at its 5- region with 50 CpG loci, multiple transcription initiation sites, and alternative splice donor sites. More importantly, there are multiple putative E-boxes and other muscle-specific enhancer elements such as M-
CAT sequences (CATTCCA) and the MEF-2 AT-rich sequence. In addition, there is no TATA-box in the 1 kb region up- and down-stream of the transcription initiation site a (Figs. 1-3 and 1-6), indicating that the proximal p ro m o te r a may be a TATA-less promoter. Transcription of mRNA-b is initiated from the distal promoter b which is farther upstream of a TATA consensus sequence (Fig. 1-6). It was not clarified whether or not this TATA 37 sequence is functional. Promoters that direct transcription of the mRNA-a, -b, and -c appear to be muscle-specifically controlled (Xiao, 1995).
Therefore, the purpose of this project was to elucidate the molecular mechanism that controls muscle-specific transcription of the RM-PFK gene.
The specific goals of this research are as follows: (1) demonstration of transactivation of the RM-PFK gene by the myogenic bHLH proteins (MyoD,
Myf5, and myogenin) using transient cotransfection studies; (2) identification of the positive and negative regulatory elements within the control region of the RM-PFK gene by deletional analysis; (3) determination of the boundaries of the muscle-specific promoters (proximal promoter a and distal promoter b) by deletional analysis; (3) examination of the activity profiles of these promoters in muscle and non-muscle cells; (4) demonstration of the direct interaction of the myogenic bHLH proteins with the positive regulatory element of the RM-PFK gene in vitro using EMSA and DNasel footprinting experiments; (5) characterization of the structural feature of the proximal promoter by examining protein recognition sequences using EMSA and DNasel footprinting experiments. CO
It 0 rr rt rr tQ » to o to to O O to to C C to it d ft d ft KJ KJ ft ft o o rt rt tQ n - - • rt rt m rt ft rtfl rtfl ft rt n rt rt rt n rt fl ft r (l fl r (l ft fl rtfl rt tQ tQ rtfl rt n n rt ft to d ft to rt ft rt rtd to ft rt o to ft ft ft o to rt rt to to rtrt to fl A A fl fl fl fl fl fl fl fl fl fl fl to c to n n fl (l to to rt ft rr tQ tQ n n n n n rt iQ c ft ft ft r t c r t 0 Q fir r to n n f t to fto t n rr a c r r d Cl C c d ft o o rtfl fl fl rtfl rt rt n to Cl rt rtfl n n n rt rt f l rt P* P* fT C to rtfl to rr ft to o n rt f t IQ fl f l f l r t fl to ) fl to to fl ft C d fl to fl fl to fl rtfl fl rt fl fl rt f l f l fl I I 1 I I I 1 I I k I | iq n n r t C O C Cl r t 0 0 f l c o to pr to fi fi q « o to o a cfl r* to o rt O Q rr rr rr rt iQ rr (1 rt rt IQ tv rt (1 n to to r» r» iq iq to to c & O to Cl r r iQ KJ O IQ n r r d d ft n u j r r o n to n d f t n f t IQ r» to to O |Q Q Q Q Fig. 1-6. The 3 kb 5'-flanking DNA sequence of the RM-PFK gene. The exons are in uppercase and underlined, whereas the introns are in lowercase (Xiao, 1993). CHAPTER 2 MATERIALS AND METHODS 2.1 Materials 2.1.1 Enzymes and Sera Restriction endonucleases and DNA modifying enzymes [including T4 DNA Hgase, Exonuclease III (Exo in), SI nuclease, T4 polynucleotide kinase, Klenow fragment DNA polymerase, and T4 DNA polymerase] were purchased from Bethesda Research Laboratories (BRL) (Bethesda, MD), Boehringer- Mannheim Biochemicals (Indianapolis, IN), Promega Corporation (Madison, Wl), and New England Biolabs, Inc. (Beverly, MA). Trypsin-EDTA was obtained from GIBCO-BRL (Bethesda, MD). RNase A, DNase I, Protease K, and lysozyme were obtained from Sigma Chemical Company (St. Louis, MO). Sequencing Kits with Sequenase version 2.0 were purchased from United States Biochemicals Corporation (USB) (Cleveland, OH) and Amersham Corporation (Arlington Heights, IL). Polymerase chain reaction (PCR) reagent kits with Taq DNA polymerase were purchased from Perkin Elmer Cetus (Norwalk, CT). Fetal calf serum (PCS) and horse serum (HS) for cell culture were obtained from Hyclone Laboratories, Inc. (Logan, UT). 2.1. 2 Chemicals and Culture Media Chemicals used for E. co/i cell culture included tryptone, yeast extract, and agar that were purchased from Difco Laboratory (Detroit, MI). Type I agarose, low melting point Seaplaque agarose, and ammonium persulfate were purchased from GIBCO BRL. Cesium chloride, acrylamide, N, N’-methylene- bisacrylamide (BIS), acrylamide stock solution ACRYL-40, saturated phenol, 39 40 and saturated phenol/chloroform were obtained from American Research Products Co. (AMRESCO) (Solon, OH). Urea was obtained from BRL or USB. Glycerin was purchased from Curtin Matheson Scientific, Inc. (Houston, TX). Piperidine and dimethyl sulfate (DMS) were obtained from Aldrich Chemical Company, Inc. (Milwaukee, WI). O-nitrophenyl-b-D-galactopyranoside (ONPG) was purchased from Promega. Most of the other reagents were obtained from Sigma. These included Tris-(hydroxymethyl) aminomethane (Tris), Trizma base, N-(2-hydroxyethyl) piperazine-N’-(2-ethanesulfonic acid) (HEPES), Nonidet P-40, Triton X-100, ethlenediaminetetraacetic acid (EDTA), sodium dodecyl sulfate (SDS), dithiothreitol (DTD, sucrose, isopropyl-b-D thiogalatopyranoside (IPTG), Chick embryo extract; antibiotics such as ampicilline, chloramphenicol; spermidine, spermine, poly (dl-dC); protease inhibitors such as phenyl-methylsulfonyl fluoride (PMSF), leupeptin, pepstatin, aprotinin, chymostatin, and benzamidine; reduced glutathione, and reduced glutathione-agarose resin. Penicillin and streptomycin for cell culture were purchased from Pfizer, Inc. (New York, NY). Sephadex G-50 and G-25 spin columns were purchased from 5 Prime - 3 Prime, Inc. (Boulder, CO). Maxi DNA Prep Kits and Gene Clean kits were ordered from Qiagen, Inc. (Chatsworth, CA) and Bio 101, Inc. (Lo Jolla, CA), respectively. Protein assay reagent was obtained from Bio-Rad Laboratories (Richmond, CA). Whatman 3 MM filter papers were obtained from Fisher Scientific (Pittsburgh, PA). Polaroid 667 films, and Kodak XAR-5 and XRP-5 X-ray films were purchased from Polaroid (Cambridge, MA) and Kodak (Rochester, NY), respectively. Tissue culture media including Ham's F-12 and Dulbecco's modified Eagle's medium (DMEM) were prepared by Dr. Robert Truax in the Dept, of Vet. Microbiology and Parasitology, in the School of Veterinay Medicine, Louisiana State University (Baton Rouge, LA). 41 2.1. 3 Cell Lines, Bacterial Strains, and Helper Phage Mouse C2C12 and fibroblasts NIH3T3 were purchased from American Type Culture Collection (Rockville, MD). The frozen cell stocks were stored in liquid nitrogen tanks in the Tissue and Organ Culture Lab of the School of Veterinary Medicine, Louisiana State University (Baton Rouge). Bacterial strains HB101, JM109 and helper phage R408 were obtained from Promega, whereas strains XLl-blue and DH5a were purchased from Stratagene Cloning Systems (La Jolla, CA). 2.1. 4 DNA Plasmids The plasmid pGEM-7zf(-) containing T7 expression system was purchased from Promega. The plasmid pSV-fi-galactosidase for monitoring transfection efficiency is under the control of the simian virus 40 (SV40) early promoter and the 72-bp enhancer, and it was purchased from Promega. The chloramphenicol acetyltransferase (CAT) reporter plasmid pCAT-Basic (or pCAT-B) was purchased from Promega. This pCAT-B lacks eukaryotic promoter and enhancer sequences; thus, expression of the CAT gene of this plasmid is dependent on insertion of a functional promoter upstream of the CAT gene. MyoD glutathione S-transferase (GST) fusion expression plasmids were the generous gifts of Dr. Weintraub. The full length cDNA of MyoD (Davis et qI„ 1987) was ligated into a Sma I-cleaved pGEX-3X (Smith and Johnson, 1988) (Fig. 2-1). Myogenic bHLH protein expression vectors were based on a plasmid pEMSVscribe which contains the Moloney sarcoma virus LTR promoter and the SV40 poly A sequence flanking the unique EcoR I cloning site. The full length cDNAs of MyoD, myogenin, and Myf5 were inserted into EcoR I site of 4 2 tac stop codons laclq lacZ GST BamHI EcoRI Sma I pG£X-3X Factor Xa I------1 Leu lie Glu Gly Arg Gly lie Pro Gly Asn Ser Ser ---- CTG ATC GAA GGT CGT GGG ATC CCC GGG AAT TCA TCG I______I 1______I BamHI | | EcoRI Sma I Fig, 2-1. Schematic diagram of the GST (glutathione S-transferase) fusion expression plasmid. MyoD cDNA was subcloned into the unique Sma I site of pGEX-3X. GST sequence in this plasmid encodes the C- terminal portion of the GST protein. The arrow indicates Factor Xa cutting site. 43 pEMSVscribe, generating pEMSV-MyoD (or pEMcIIs), pEMSV-MyoG, and pEMSV-Myf5, respectively (Davis et a l, 1987; Wright et a l, 1989; Braun et al, 1989a) (Fig. 2-2). Deletion mutants of MyoD were also cloned by the same strategy. Plasmid pEMSV-MyoDAB expresses MyoDAB protein (102-135) that is devoid of the basic region of the MyoD, whereas pEMSV-MyoDAN expresses MyoDAN (3-56) that is a N-terminal deletion mutant of MyoD (Davis et al., 1987). Constructs of the MyoD expression vectors were kindly provided by Dr. H. Weintraub. pEMSV-MyoG and pEMSV-Myf-5 were the generous gifts from Drs. V. tin and H. Arnold, respectively. 2.1. 5 Radioisotopes and Oligonucleotides 32P-labeled nucleotides including (a-32P]-dCTP, [y-32P]-ATP, [a-32P]- dATP, [a-35SJ-dATP, and [14CJ-butyryl coenzyme A were purchased from ICN Biochemicals, Inc. (Irvine, CA) or Du Pont Company (Wilmington, DE). Oligonucleotides were synthesized by either the GeneLab in the School of Veterinary Medicine, Louisiana State University (Baton Rouge, LA), or by Ana- Gen Technologies, Inc. (Palo Alto, CA). 2.2 Methods 2. 2.1 Construction of PFK-CAT Chimeras The RM-PFK genomic DNA fragment originally cloned into plasmid pUC18 at the Kpn I and BamH I sites (Fig. 2-3) was approximately 6 kb long. The fragment included the N-terminal sequence of RM-PFK gene and the 3 kb of the 5'-flanking region located immediately upstream of the ATG translation initiation codon. The plasmid generated by this process is referred to as pUC- PFK6.0. This plasmid was digested with EcoR I, and was blunt-end repaired 44 pEMSV-MyoD MSVLTR SV40 PolyA EcoRI EcoRI Myogenic cDNA Fig. 2-2. Schematic diagram of the myogenic cDNA expression vectors. The cDNAs of the MyoD, MyoD mutants, myogenin, and Myf5 were cloned into the unique EcoR I site of the vector pEMSVscribe (Davis et al., 1987; W right et al., 1989; Braun et al., 1989a). Plasmid pEMSVscribe was derived from pBluescribe in which the MSV LTR promoter fragment and the SV40 Poly A sequence were inserted. 45 Kpnl EcoRI PFK 5 sequence BamHI Xbal Exon 1 Intron 11 pUC18 pU C -P F K 6.0 Hindi/EcoRI J Xbal PstI ' PstI PstI pUC19 Hindlll PstI pUC-PFK 3.0 HindIU PstI PstI AccI PsO PstI pB 3.0 Fig. 2-3. Cloning scheme for plasmids pUC-PFK and pB3.0. The 6 kb genomic DNA fragment of the RM-PFK gene including the 3 kb of the 5' flanking region was first subcloned into pUCI8. The 3 kb EcoR I (filled with Klenow)/Xta I fragment corresponding to the 5'-flanking sequence was then further subcloned into the Hinc II (filled with klenow) and X fra I sites of pUC19 to yield pUC- PFK3.0. This 3 kb sequence was finally inserted into pCAT-Basic vector as a H ind HI /Xba I fragment, generating pB3.0. 46 with Klenow enzyme prior to Xba I digestion. The purified EcoR I fX ba I fragment was then subdoned into the Htnc n (filled with Klenow) and Xba I sites of pUC19, producing pUC-PFK3.0. The PFK 5'-flanking fragment in pUC-PFK3.0 was cut out with Hind m and Xba I, and was inserted into the Hind III and Xba I sites of pCAT-B, generating pB3.0 for transient expression studies (Fig. 2-3). The same Hind HI /X ba I PFK fragment was also inserted into the Hind HI and Xba I sites of pGEM-7zf(-) to yield pGEM3.0 for deletion by Exo m exonud ease digestion. To pinpoint the regulatory regions within the above 3 kb PFK sequence, the internal deletions were generated by Pst I partial digestion (Sambrock et al., 1989). Progressive deletions in the 5' to 3’ direction were performed by using the Erase-a-base Exo III system (Promega). Briefly, pGEM3.0 was cut with Sma I and Kpn I to create blunt ends at the 5' side of the DNA insert for Exo III digestion, and to create the 3' overhangs for preventing Exo m digestion in the 3’ to 5’ direction. After Exo III digestion for different time periods, the DNA fragments were repaired with SI nuclease and Klenow enzyme prior to ligation. The end point of each deletion mutant was determined by single stranded dideoxy DNA sequencing. The confirmed mutation constructs were selected, and the PFK fragments were cut and subcloned into the Hind III and Xba I sites of pCAT-B (Fig. 2-4). To delineate the boundary of the proximal promoter, PFK-CAT fusion constructs were made as follows. The 3 kb PFK insert of pB3.0 was separated at the unique Acc I site into 1.8 kb and 1.2 kb fragments . Plasmid pB1.2 contains the 3’ sequence of -994 to +73 with respect to +1 position of the proximal promoter. It was created by inserting the Acc 11 Xba I DNA fragment of pB3.0 into the Hin c II/X ba I sites of pCAT-B where the Acc I site of the insert and the Hin c II site of the vector have been filled-in with Klenow enzyme (Fig. 2-5). 4 7 Fig. 2-4. Schematic diagram of the 5* to 3' deletion of plasmid pGEM3.0 by Exo III digestion. The Hind Ill/Xfra I PFK fragment from pUC-PFK3.0 was subcloned into the same sites of pGEM-7Zf(-) vector, creating pGEM3.0. pGEM3.0 was digested with Kpn I and Sma I which are at the 5' end and in the PFK insert (-2533 in respect to proximal transacription start site as +1 position), respectively. The blunt ends generated by Sma I digestion are sensitive to Exo in. By contrast, Kpn I digestion creates 3’ overhangs that are Exo m resistant. Thus Exo III digestion was unidirectional from 5' to 3' on the PFK insert. DNA samples were treated with Exo III for different time periods, and immediately repaired with SI and Klenow treatments. The deletion end points were checked by sequencing. From those deletion constructs, the desired PFK inserts were cut with Hind III and Xba I, and subcloned into vector pCAT-Basic. The polycloning sites of pGEM 7Zf(-) are also shown in this figure. 4 8 Hind III Xbal Nsil K pnl Apal -\///A d — . ------s a ^ 2 ------73 Q SmaI SphI BamHI Hincn/EcoRI ^ Kpnl and Smal digestion Hindlll Xbal Nsil Kpnl Smal i Apal A y / A ^ + ------\ z p d r - BamHI HincII/EcoRI SphI Exo III digestion Repair ends Ligations ▼ Hind ID Xbal K pnlNsil KpnlKpnlNsil Apal _b fffilnwt \ w 7 ^ ~ BamHI Hincn/EcoRI SphI 49 AccI HindUl PstI PstI pB 1.8 t H indlll AccI Xbal I PstI PstI PstI PstI CAT pB 3.0 Hindi/AccI Xbal PstI PstI CAT pB 1.2 Fig. 2-5. Cloning scheme for plasmids pB1.2 and pB1.8. Plasmid pB3.0 was digested with Acc I, and filled in with Klenow prior to Hind in digestion. To create pBl.8, the Hind III /Acc I fragment of about 1.8 kbp was purified and subcloned into the Hind IU/Acc I sites of pCAT-B, of which the Acc I ends were also blunt-end repaired. To create pBl.2, theAcc I /Xba I insert of about 1.2 kbp from pB3.0 was subdoned into the Hind HI /Xba I sites of pCAT-B, of which Hind III ends were Klenow repaired. Transcription start sites including a (proximal) and b are indicated with arrows. 50 Plasmid pB268 (-195 to +73) contains the 268 bp Pst I/Xba I fragment harboring the proximal transcriptional start site (Fig. 2-6). It was generated by subcloning this 268 bp Pst I /Xba I fragment into the Pst I and Xba I sites of pCAT-B (Fig. 2- 6). This pB268 was then digested with Nhe I and Xba I to remove a 50-bp fragment (+23 to +73) containing an E-box (CAGCTG) to yield pB218. Alternatively, pB268 was digested with Hind HI and Dra in to remove the 5' end 100-bp fragment (-195 to -95) including an E-box (CAGATG), generated pB168 (-95 to +73). This pB168 was further digested with Nhe I and Xba I to delete the 3’ end Nhe I/Xba I fragment of 50-bp, yielding pB118 (-95 to +23). In a parallel study, PFK-CAT fusion constructs conatining various sequences of the distal promoter b corresponding to the transcription start site b were made as follows. The 1.8 kb Hind in/Acc I (filled with Klenow at Acc I end) fragment (-2783 to -994) of pB3.0 was subcloned into the Hind III andAcc 1 (filled with Klenow) sites of pCAT-B to yield pB1.8 (Fig. 2-5). This pB3.0 was digested with Hind III and Xmn I; this generated a 1.4 kb fragment (-2783 to -1642) which was then subcloned into the Hind in andAcc I (filled with Klenow) sites of pCAT-B, yielding pB1.4 (Fig. 2-7). The Exo III deletion mutants pGEM5- 2 (-2313 to +74) and pGEM 3-4 (-1898 to +74) were doubly digested with Hind m and Xmn I. These two Hind III/X m n I PFK fragments were subcloned into the Hind III /A cc I sites of pCAT-B similarly to pB1.4, generating pB671 (pGEM5-2: -2313 to -1642) and pB256 pB1.4 and pB671 contain the transcriptional start site b, whereas pB256 only contains most of the sequence of exons B and Br (Figs. 1-6 and 2-7) including a TATA sequence (-1706). This TATA sequence lies 230 bp downstream of the transcriptional initiation site b, and is immediately followed by a GC-rich region which presumably forms a stable G-C stem loop secondary structure. It was speculated that this stem loop prevents the transcriptional complex from 51 TCTTGCCAGTCT PstI D ram r ~ ^ Xbal 1------'j y\ / \ Nhel ^ / X CAT CAGATG CAGCTG pB218 -H JpB168 pB118 ‘v ''S.''' Fig. 2-6. Schematic diagram of the proximal promoter CAT constructs. Plasmid pB268 contains 268 bp proximal promoter sequence surrounding the transcription start site a (as arrow indicates). Plasmid pB218 is the deletion mutant of pB268 of which the 50-bp Nhe I /Xba I fragment has been removed; thus, it contains the 218 bp Pst l/Nhe I promoter fragment. After removal of the Pst I /Dra III 100-bp fragment by Hind IH and Dra in digestions (Hind III site is 5’ to the Pst I cloning site) and was repaired with T4 polymerase, pB268 was then religated to yield pB168. This pB168 thus contains the Dra III/Xba 1 168 bp promoter sequence. This plasmid was then cut with Nhe I and Xba I to rem ove the 50-bp fragment, and was blunt-end repaired with T4 polymerase, generating pB118. This pB118 thus contains the 118 bp core promoter sequence. The E-boxes and the transcription start site a are shown. 52 assembling around this TATA-box sequence. Therefore, this G-C stem loop was disrupted by base substitution using PCR. A lower primer (1249-mu) containing the substituted bases and the Sp6 promoter primer (as upper primer) were added to a PCR reaction with pGEM3-4 (-1898 to +74) as the DNA template (Fig. 2-7). The 230 bp PCR fragment was phosphorylated and end- repaired with T4 polymerase before it was inserted into the Acc I (filled with Klenow) site of pCAT-B, yielding pB230mu. For control, a lower primer of the wild type sequence (1249-wt) and Sp6 promoter primer (as upper primer) were used to amplify the wild type DNA fragment of the similar size to generate pB230wt. 2. 2. 2 C ell C u ltu res Mouse C2C12 myoblasts and NIH3T3 fibroblasts were propagated in DMEM supplemented with 10% (v/v) FCS. C2C12 cell differentiation from myoblasts to myotubes was initiated by switching cells to DMEM supplement with 2% (v/v) HS. Myotubes were visualized four days after induction under this condition. Rabbit skeletal muscle primary myoblasts were prepared by following the modified method of Blau and Webster (1981). Briefly, leg muscle of the 3-day old rabbit was dissected and cut into small cubes of about 1 mm3. Muscle pieces were rinsed with cold phosphate buffered saline (PBS; 0.14 M NaCl, 0.15 M KH 2PO 4, 0.27 M KC1, 0.8 M Na2H P04, pH 7.4) containing penidllin-streptomycin before they were transferred into Ham's F-10 medium for overnight incubation at 4°C. The next day, muscle cells were dissociated by three successive 30-minute treatments of 5 ml of 0.25% trypsin-EDTA at 37°C, with occasional stirring. After each treatment, the released cells were pooled and diluted with 15 ml of Growth Medium 2 (GM2; 80% Ham's F-10, 20% horse serum, 0.5% chick embryo extract, 1% pen-strep) to terminate further protease 53 Fig. 2-7. Schematic diagram of the promoter b CAT constructs. (A). The 1.4 kb H ind HI /Xm n I PFK fragment from pB3.0 was subcloned into the Hind III /Acc I sites of pCAT-B in which the Acc I site was filled in with Klenow, generating pB1.4. This pB1.4 thus contains the 5' end of the 3 kb PFK flanking sequence which harbors transcription start sites b, c, and d (Fig. 1-3). Plasmid pB671 contains the 671 bp Hind III/Xmn I fragment (-2313 to -1642) that was inserted into Hind III /Acc I sites of pCAT-B. This 671 bp fragment is 140 bp down stream of the transcription start site c, but retains die sequence upstream of the transcription start site b. Plasmid pB256 contains a 256 bp Hind HI/Xmn I fragment 40 bp which is downstream of the start site b, and is within the sequence of Exon b (Fig. 1-6). (B). PCR scheme for cloning pB230mu and pB230wt with pGEM3-4 as the DNA template. Sp6 promoter primer of 19-mers was the upper primer. The lower primer was either 1249-mu or 1249-wt with the mutated bases underlined. The PCR products were subcloned into the filled-in Acc I site of pCAT-B to yield pB230mu and pB230wt, respectively. The TATA sequences and the G-C stem loop region are also underlined, and a questionable transcription start site is indicated with an arrow. 54 A. AccI XmnI -J__ pB1.8 I T T H in dUI TTAnTATT TATA CAT pB230wt pB230mu B. S p 6 p /p 5’-CATTT AGGTC AC ACT AT AG-3' HindlD Xbal XmnI i TATA Nsil I ^ ? C AGGT AT AAA ACGTG AG AGGGGCAGGCTGCTG ACCCCC A ATCT AGTCCA A AC 3’-CCGTCCG ACG ACT£G AGGTT AG-5’ 1249-mu 3TCCGCGTTTAG ATCAGGTTTC-5’ 1249-wt 55 activity. Cells were pelleted at <1000 rpm for 10 min, and resuspended in GM2 medium prior to plating on collagen-coated 35 mm tissue culture dishes. Myoblasts selectively attach to the dishes under this condition, separating from fibroblasts and other cells in the population (Blau and Wester, 1981). These myoblasts were allowed to proliferate in Growth Medium 1 (GM1; 80% Ham’s F-10, 20% FCS, 0.5% chick embryo extract, 0.1% pen-strep) prior to transfection. Only the first and the second passages were used for transient expression studies in this report. The myoblast population is usually greater than 90% in these primary cells when this method is followed according to Blau and Webster (1981). 2. 2. 3 Transfection and Enzymatic Assays Approximately 2-3 x 105 cells were plated in each well (35 mm 6-well plate) for one or two days until they reached 70-85% confluency. Cells were given a single feeding with DMEM plus 10% FCS just four hours before transfection. DNA plasmids were amplified in the E. coli HB101 host strain, and purified either by two rounds of cesium chloride density centrifugation (Fordis and Howard, 1987) or by chromatography using Qiagen’s Maxi kit. Supercoiled DNA plasmids were added to the cells in a calcium phosphate precipitate (Fordis and Howard, 1987). For each 35 mm well, CAT constructs (5 pg) and pSV-p-gal (1 pg) were cotransfected with the myogenic cDNA expression vector (5 pg) or pEMSV, respectively. Plasmid pEMSV substitutes for the myogenic cDNA expression vectors such that the amount of DNA in each transfection is normalized. The pSV-p-gal plasmids were cotransfected in each transfection to control for transfection efficiency. Plasmid pSV2CAT was used as the positive control plasmid for CAT activity. After removal of the calcium phosphate precipitate 6-7 hours post-transfection, cells were washed 56 once with PBS, glycerol-shocked for 2 min with 10% glycerol in HBS (HEPES- buffered saline; 280 mM NaCl, 50 mM HEPES acid, 1.5 mM Na 2HPC>4), and refed with fresh DMEM plus 10% FCS. To induce differentiation in transfected cells, they were switched to DMEM plus 2% HS after glycerol shock, for tin additional three to four days. Cells were harvested and lysates were prepared by three cycles of freezing and thawing (Fordis and Howard, 1987). Briefly, cells were rinsed twice with cold PBS, and then detached by the addition of TEN solution (40 mM Tris-HCl pH 7.5, 1 mM EDTA pH 8.0, 150 mM NaCl; 0.5 ml per well). Cells were transferred into Eppendorf tubes, pelleted at 14,000 rpm for 1 min at 4°C, and resuspended in 100 pi of 0.25 M Tris-HCl (pH 7.5). Cells were then put through three freeze/thaw cycles in which they were frozen in a dry ice/ethanol bath for 3 min, and thawed in the 37°C water bath for another 3 min. Cell lysates were collected by a 5 min centrifugation (14,000 rpm) at 4°C. A proportion of the cell lysates (10 to 30 pi) from each sample was taken for the ^-galactosidase assay, while the rest of the lysates were heat-treated for 15 min at 65°C for the CAT assay, ^-gal activities were measured according to the supplier's recommendations (Promega). A 300 pi reaction contained 150 pi of lysate diluted with distilled deionized water and 150 pi of 2x buffer (200 mM sodium phosphate pH 7.3, 2 mM M gCh,100 mM p-mercaptoethanol, and 1.33 m g/m l ONPG). Reaction mixtures were incubated at 37°C until a yellow color was present (6 hours to overnight), and the reaction was terminated with the addition of 500 pi of 1 M Na;>C 0 3 . Absorbency at 420 nm was determined with a Gilford spectrophotometer. Lysate volumes containing equivalent units of p-gal activity were assayed for CAT activity by the kinetic diffusion method (Neumann et at., 1987). The CAT reaction was performed in a 17 ml scintillation vial. The lysate 5 7 was adjusted to 50 pi with 100 mM Tris-HCl (pH 7.8), and mixed with 200 pi of 1.25 mM chloramphenicol solution. The reaction was initiated by adding 5 pi of [,4C]- butyryl coenzyme A. Three ml of scintillation solution (Econofluor-2, Du Pont) were gently added to the top of the CAT assay mixture. The counts per minute (cpm) of each reaction was counted during a 10 min interval in a liquid scintillation spectrometer (LS60001C, Beckman). The slope of the linear CAT reaction was presented as the CAT activity. The relative CAT activity was presented as a percentage of the expression level of pSV2CAT. Alternatively, the fold changed in CAT activity by cotransfection with the myogenic cDNA expression plasmids was relative to the basal CAT activity of that CAT construct in cotransfection with the control plasmid pEMSV. 2. 2. 4 Preparation of Glutathione S-transferase (GST) Fusion Proteins GST and GST-MyoD fusions were purified according to the manufacturer's recommendation (Davis et al., 1987). E. coli HB101 cells transformed with GST expression vectors were grown at 37°C in 400 ml LB with ampicilline at a final concentration of 100 pg/m l. IPTG stock solution was added to the culture to a final concentration of 0.1 mM when the OD^oo reached 0.4-0.5. Cultures were incubated for an additional 3-4 hours prior to harvesting by centrifugation (5000 rpm, 20 min) with Sorvall GSA rotor. Cell pellets were resuspended in buffer A (50 mM Tris pH 8.0, 25% sucrose, 10 mM EDTA). Cells were then incubated on ice for 1 hour with lysozyme (2 ml, 20 m g/m l stock in buffer A), and pelleted at 8000 rpm for 10 min. Cell pellets were resuspended in 10 ml of buffer B (10 mM Tris pH 7.4, 1 mM EDTA, 1 mM PMSF, 1 mM DTT, 1 gg/m l of leupeptin, 1 Mg/ml of pepstatin) with an addition of 0.4 ml aprotinin solution (5 m g/m l in buffer C). Cells were completely lysed by freezing and thawing at least twice. The completion of lysis was determined 58 microscopically (430X). Two volumes of buffer C (20 mM HEPES pH 7.6, 100 mM KC1, 0.2 mM EDTA, 20% glycerol, 1 mM PMSF, 1 mM DTT, 1 pg/m l of each leupeptin and pepstatin) was then added, followed by an addition of 1/3 volume of 10% Triton X-100. Four ml of reduced glutathione-agarose (1:1 in buffer C) was added, and the lysate mixtures were incubated with gentle rocking for an additional 1-2 hours at 4°C. The glutathione agarose beads were then pelleted (2000 rpm, 1-2 min) in a clinical centrifuge, and batch-washed five times with 20 volumes of buffer C. Proteins were eluted from beads with 5 mM reduced glutathione (in buffer C). The protein peaks were determined at OD 28O/ and the collected fractions were aliquoted, quick-frozen, and stored at -80°C. The concentration of the purified proteins was determined by using Bio- Rad's reagent, following the modified method of Bradford (1976). Finally, the purity of the purified proteins was clarified on a 10% SDS-PAGE gel. 2.2. 5 Preparation of Nuclear Extracts Nuclear extracts were prepared based on the modified method of D ignam et al. (1983) and Li and Paulin (1993). Fifteen flasks (125 cm3 each) of cultured cells were harvested after two rounds of cold PBS washes. Cells were scrapped off in cold PBS, pooled into two 50 ml centrifuge tubes, and centrifuged for 2 min at 2200 rpm in a clinical centrifuge. All subsequent steps were performed on ice. Cell pellets were resuspended by gentle pipetting in 5 ml of buffer A (10 mM HEPES pH 8.0, 50 mM NaCl, 0.5 M sucrose, 1 mM EDTA, 0.5 mM spermidine, 0.15 mM spermine, 0.1% Nonidet). Cells were then transferred to a glass Dounee homogenizer (type A pestle), and homogenized with 10 strokes. Lysis was checked microscopically until it exceeded 95%. The homogenate was centrifuged for 10 min at 1500 rpm in a clinical centrifuge. The nuclear pellets were resuspended by gentle shaking with 5 ml of buffer B 59 (10 mM HEPES pH 8.0, 50 mM NaCl, 25% glycerol, 0.1 mM EDTA, 0.5 mM spermidine, 0.15 mM spermine, 2 mM benzamidine, 1 mM PMSF, 1 mM DTT, and protease inhibitors of pepstatin, leupeptin, aprotinin, antipain, chymostatin at 50 pg/m l each). The crude nuclei were collected by centrifugation for 10 min at 1500 rpm, and incubated with 2 ml of extraction buffer (10 mM HEPES pH 8.0, 400 mM NaCl, 25% glycerol, 0.1 mM EDTA, 0.5 mM spermidine, 0.15 mM spermine, 1 mM DTT, 2 mM benzamidine, 1 mM PMSF, and protease inhibitors of pepstatin, leupeptin, aprotinin, antipain, chymostatin at 50 pg/m l each). Nuclear proteins were extracted for one hour at 4°C with gentle shaking on a rotator, followed by centrifugation for 30 min in the eppendorf centrifuge (14,000 rpm) to remove the cell debris. The supernatant from this step was dialyzed for 5 hours at 4°C with 1 L of dialysis buffer (20 mM HEPES pH 8.0, 50 mM KC1, 20% glycerol, 0.2 mM EDTA, 1 mM DTT, 1 mM PMSF, 2 mM benzamidine). The nuclear extracts were clarified after dialysis by centrifugation again in the eppendorf contrifuge (10 min, 14,000 rpm) to remove the precipitate. The extracts were aliquoted, quick-frozen in a dry ice bath, and stored at -80°C. Protein concentration was determined as previously mentioned. This procedure yields about 7-10 mg of proteins. 2.2. 6 [32P] End-labeling of DNA Probes DNA probes used for electrophoretic mobility shift assay (EMSA) and DNasel footprinting experiments, and for Maxam-Gilbert sequencing (Maxam and Gilbert, 1980) were 32P end-labeled. For the EMSA experiments, digested DNA fragments with 3’-recessed ends were Klenow-labeled with the incorporation of [a-32P]-dCTP or [a-32P]-dATP. In the case of DNA probes generated by PCR, both the upper and lower primers were 5’ end-labeled with [•y_32p]_ATP by T4 polynucleotide kinase reaction. The labeled oligonucleotides 60 were then separated from the free nucleotides by the Sephadex G50 spin column procedure, and directly used for the PCR reaction. For the DNasel footprinting and the Maxam-Gilbert reaction, PCR fragments and the digested DNA fragments were singly 32P end-labeled. DNA plasmids were digested with the first endonuclease that generated 3-recessed ends, and the [a-32P]-dCTP or [a-32P]-dATP was incorporated into the 3' ends by Klenow reaction. This singly-cut fragment was further digested with a second endonuclease to remove one side of the end-label, thus leaving only one strand labeled at once. Alternatively, if the second enzyme generates 5'- recessed ends, the DNA plasmids were digested with both endonucleases, and were Klenow-labeled directly. The digests were electrophoresed on a 6% nondenaturing polyacrylmide gel (0.5 x TBE, 90 volts). The gel was either stained with ethidium bromide or subjected to autoradiography to locate the desired DNA bands. The excised gel slabs were crushed with a micropippet tip, and soaked in 500 pi of 1 M NaCl (in TE) overnight at 37°C. The supernatant was collected and ethanol-precipitated. The preparation of PCR probes for the footprinting and sequencing reaction is similar to that for EMSA, except that there was only one end-labeled primer in the PCR reaction. 2. 2. 7 Electrophoretic Mobility Shift Assay (EMSA) EMSA was performed in a 20-pl reaction consisting of 20 mM Tris-HCl (pH 7.9), 2 mM MgCl2, 50 mM NaCl, 1 mM EDTA, 10% glycerol, 0.1% Nonidet P40, 1 mM DTT, 50 pg/m l BSA, lO^lO5 cpm of probe (0.5-1.0 ng), 0.5-1.0 pg of poly (dl-dC) or salmon sperm DNA, and different amounts of the nuclear extract or purified GST proteins (Garabedian et al., 1992). The proteins were incubated with DNA carrier at room temperature for 10 min before the labeled DNA probe was added. The binding reactions were extended for additional 20- 61 30 min, and immediately loaded on a pre-electrophoresed (1-2 hr) 6% non denaturing polyacrylmide gel (200 volts). The running buffer was recirculated with a pump to maintain an even pH gradient. For competition studies, excess amounts of unlabeled DNA fragments or the muscle creatine kinase (MCK) enhancer (upper strand, 5'-GATCCCCCCAACACCTGCTGCCTGA-3'. where E- box is underlined) were added prior to addition of labeled probes. For non specific competition, oligo AT (a gift from Dr. Sue Bartlett in the Dept, of Biochemistry, Louisiana State University) was added instead (upper strand, 5’- G ACCTTTT ATnTTTTAT A A A AAA AG A ATTG A A AG-3’). Gels were dried and subjected to autoradiography. 2. 2. 8 DNasel Footprinting Footprinting experiments were based on the method of Garabedian et al. (1992). Fifty pi of the protein mixture contained nuclear extracts (30-60 pg) or GST fusions (5-10 pg) in a binding buffer (20 mM Tris-HCl (pH 7.9), 2 mM MgCl2, 50 mM NaCl, 1 mM EDTA, 10% glycerol, 0.1% Nonidet P40, and 1 mM DTT). Another 50 pi of DNA mixture containing singly end-labeled DNA probe (20-50 kcpm) and poly (dl-dC) (0.5-1 pg) in lxTE buffer was combined with the protein mixture and incubated at room temperature for 20-30 min. DNasel digestion was carried out by adding 10 pi of the diluted DNasel solution (2 mg/ml stock in binding buffer) for exactly 1 min at room temperature after the addition of 10 pi of salt mixture (100 mM MgCl2, 5 mM CaCh) for 1 min. Two hundred pi of the DNasel stop solution (0.2 M NaCl, 40 mM EDTA, 1% SDS, 125 pg/m l tRNA, 100 pg/m l proteinase K) were added to each tube for 30 min at 37°C. The digested probes were extracted with phenol/chloroform and precipitated with ethanol. The DNA was dissolved in 10 pi formamide-loading dye (95% formamide, 4% EDTA pH 8.0, 0.1% 62 Bromophenol Blue, 0.1% xylene cyanol). Equal amounts of radioactivity (determined by Cerenkov counter or liquid scintillation counter) were loaded onto a 6% sequencing gel. The gel was dried and subjected to autoradiography. Maxam-Gilbert sequencing was used to generate DNA ladder for sequence marker (Maxam and Gilbert, 1980). For the G+A reaction, 10 pi of the labeled probe were mixed with 25 pi of formic acid and incubated at room temperature for 10 min. The reaction was stopped by addition of 200 pi DMS stop solution (1.5 M NaOAc, 1 M f5-mercaptoethanol, and 100 pg/m l tRNA; pH 7.0). DNA probes were precipitated with 750 pi of ethanol for 30 min in a dry ice/ethanol bath, and were centrifuged for 20 min at 14,000 rpm at 4°C. The DNA pellets were resuspended in 250 pi of 0.3 M NaOAc (pH 5.2), and precipitated again with 750 pi of ethanol for another 15 min. After centrifugation for 10 min, the DNA pellets were washed with ethanol and Speed vac dried completely. One hundred pi of 1 M piperidine (freshly prepared, 1:10 diluted with distilled dionized water) were added to each DNA sample. The cleavage reaction was carried out in a 90°C heat-block in tubes that were sealed with two layers of Telfon tape to eliminate volume reduction. The DNA was precipitated with 2.5 volumes of ethanol in the presence of 1/10 volume of 3 M NaOAc for 20 minutes before centrifugation. The DNA pellets were washed twice with 90% ethanol, and the remaining piperidine was removed completely by Speed vac-drying the pellets for at least 1 hour. Loading dye (10-15 pi) was added to resuspend the DNA. As mentioned before, equal amounts of radioactivity were loaded on the sequencing gel. CHAPTER 3 RESULTS AND DISCUSSION 3.1 Transactivation of the RM-PFK Gene by the Myogenic bHLH Factors To understand the molecular mechanism for the transcriptional control of the RM-PFK gene, I chose to investigate the possibility that the RM-PFK gene is regulated by the myogenic bHLH factors. Thus, I constructed a CAT plasmid, pB3.0, in which the CAT coding sequence was linked at the downstream end of the 3 kb 5’-flanking region of the RM-PFK gene (Fig. 2-1). For transient transfection studies, pB3.0 was cotransfected with three different myogenic cDNA expression vectors into different types of tissue culture cells. Transfection studies of pB3.0 were first carried out in the mouse C2C12 cell line for two reasons. First, C2C12 myoblasts can undergo differentiation from the proliferating stage to myotubes under conditions of serum depletion. Thus, the CAT activity of the PFK-CAT chimera in the transfected cells can be measured and compared between these two cell stages. Second, C2C12 is a stable muscle cell line that allows the muscle- specific promoter to be activated and the myogenic bHLH proteins to function in a normal cellular context. As shown in Figure 3-1, cotransfection with MyoD significantly enhanced the CAT activity of pB3.0 in C2C12 myoblasts, and this stimulation was even greater in myotubes. The CAT activity of pB3.0 without MyoD cotransfect ion showed very little difference between the myoblast and the myotube stages (Fig. 3-1). When tested in C2C12 63 64 30000-1 +M yoD(M B) +MyoD(MT) -MyoCKMB) -MyoCXMT) 2 0000 - y « - 606.00 + 265.81x RA2 - 0.986 y = 989.36 + 126.48x RA2 = 0.992 0 20 4060 80 100 120 Tim e (min) Fig. 3-1. CAT activity representation of pB3.0 in C2C12. The cpm of the [1'*C]-butyryl chloramphenicol (product of the CAT reaction) was measured as a time course, and the slope of each reaction represents the CAT activity level of that reaction. Lysate volumes containing 0.2 units of the [3-gal activity were used in this study. Plasmid pB3.0 was transfected into C2C12 with (+) or without (-) MyoD cotransfection. Transfected cells were either maintained as myoblast (MB) or induced to be myotubes (MT). 65 myoblasts, MyoD transactivation of pB3.0 persisted up to five days post transfection, although it decreased slightly (Fig. 3-2). The forced expression of the exogenous myogenic proteins can induce expression of the endogenous proteins (Davis et al., 1987). Therefore, cell lysates were prepared from the transfected cells and the CAT assays were performed two to three days post-transfection, while the change in the endogenous myogenic proteins was still minimal. To optimize the conditions for cotransfection, different amounts of the MyoD expression plasmid pEMSV-MyoD were tested for their abilities to transactivate the CAT expression of pB3.0. As shown in Figure 3-3, increasing pEMSV-MyoD from 0 to 5 pg/well (35 mm) increased the CAT activity of pB3.0 about seven fold. A further increase in the amount of pEMSV-MyoD to 10 pg/w ell resulted in no additional increase in transactivation activity. Therefore, 5 pg/well appeared to be sufficient to complete activation of the CAT gene, and this level was used in subsequent cotransfection studies. A similar transfection experiment was conducted in primary rabbit skeletal muscle myoblasts. As was seen with C2C12 cells, the CAT activity of pB3.0 was enhanced by increasing the amounts of pEMSV-MyoD (Fig. 3-4). At 5 pg/well, MyoD exhibited six fold stimulation of the CAT activity of pB3.0. When these cotransfection studies were conducted in NIH3T3 fibroblast cells, MyoD stimulated the CAT activity of pB3.0 to two fold (Fig. 3-5). These results provide the first indication that the promoter of the RM- PFK gene is transactivated by MyoD in vivo. That pB3.0 expression in C2C12 cells mimics its expression in the rabbit primary cells also suggests that C2C12 is a suitable system in which to study the mechanism for the muscle- specific expression of the RM-PFK gene. 66 -M yoD +M yoD 126.5 S •u a < U Day 3 Day 4 Day 5 Fig. 3-2. Comparison of the pB3.0 CAT activities at different days post transfection. C2C12 myoblasts were cotransfected with pEMSV-MyoD (+MyoD) or with pEMSV (-MyoD). Lysates were prepared three, four, and five days after transfection. Lysate volumes with 0.2 units of (3-gal activity were analyzed for CAT activity. The mean from two separate experiments is sh o w n . 67 ♦MyoDlO +MyoD5 +M yoDl 0 2 4 6 8 Relative CAT Activity (fold) Fig. 3-3. Concentration effect of pEMSV-MyoD on stimulation of pB3.0 CAT activity in C2C12. Plasmid pB3.0 was cotransfected with pEMSV-MyoD (+MyoD) at 1, 5, and 10 pg (per well). Lysate volumes with 0.5 units of fi-gal activity were analyzed for the CAT activity. The relative CAT activity over the basal level of CAT expression in cotransfection with control pEMSV (- MyoD) is presented at the right side of each column. The mean from two separate experiments is shown. 0 2 4 6 8 10 Relative CAT A ctivity (fold) Fig. 3-4. Concentration effect of pEMSV-MyoD on stimulation of pB3.0 CAT activity in primary myoblasts. Plasmid pB3.0 was transfected into primary rabbit skeletal muscle myoblasts with cotransfection of pEMSV-MyoD (+MyoD) at 1, 5, and 10 pg (per well). Lysate volumes containing 0.5 units of (3-gal activity were analyzed for the CAT activity. The relative CAT activity over the basal level of CAT expression in cotransfection with control pEMSV (-MyoD) is presented at the right side of each column. The mean from two separate experiments is shown. 69 ■ +M yoD □ -M yoD 3T3 C2C12 200 Relative CAT Activity (% of SV2CAT) Fig. 3-5. Comparison of the CAT activities of pB3.0 in 3T3 and C2C12 cells. Plasmid pB3.0 was cotransfected with pEMSV-MyoD (+MyoD) or with pEMSV (-MyoD). Lysate volumes containing 0.5 units of fi-gal activity were analyzed for CAT activity. The respective value of the CAT activity is expressed as a percentage of the activity level of pSV2CAT in each cell line. The mean ± SE values from three experiments are shown. 70 Along with MyoD, two other myogenic bHLH proteins, myogenin and Myf5, were tested for their transactivation activities in C2C12 cells. As shown in Figure 3-6, cotransfection with the cDNA expression vectors of MyoD, Myf5, and myogenin increased the CAT activity of pB3.0 to 10, 5.5, and 2.1 fold, respectively. These data indicated that MyoD had the highest transactivation activity among these three myogenic factors. Myf5 stimulated the PFK promoter to about 55% of the level of MyoD, while myogenin was only about 21% as efficient as MyoD. In addition, MyoDAB, in which the basic DNA-binding region of the MyoD has been deleted (Davis et al., 1987), failed to stimulate the CAT activity of pB3.0 (Fig. 3-6). MyoD AN, in which the N-terminal transactivation domain has been removed (Davis et al., 1987), did not exhibit any transactivation effect (Fig. 3-6). A similar differential transactivation pattern of pB3.0 by these myogenic proteins was also observed in the primary myoblasts (Fig. 3-7). Cotransfection with the cDNA expression vectors of MyoD, Myf5, and myogenin resulted in an increase in the CAT activity of pB3.0 to 6, 3.1, and 1.1 fold, respectively. Thus, MyoD and Myf5 efficiently stimulated the promoter activity of pB3.0. Myogenin, on the other hand, had very little transactivation effect under this condition. Taken together, these three myogenic bHLH proteins exhibited differential transactivation capabilities on the RM-PFK promoter(s) in C2C12 and in the primary cells. The CAT activity of pB3.0 was dependent on the amount of the MyoD cDNA expression vector used in a particular cotransfection experiment (Figs. 3-3 & 3-4); thus, the differential transactivation activities of these myogenic factors could be due to their different expression levels. In fact, MyoD mRNAs are expressed constitutively at a low level in proliferating C2C12 myoblasts (Davis et al., 1987), and at slightly increased levels in the 71 +M yoDAN +MyoDAB +m yogem n +M yoD +EMSV CAT Activity Fig. 3-6. Differential transactivation of pB3.0 CAT expression in C2C12 by the myogenic bHLH factors. For each of the cDNA expression plasmids of MyoD, MyoDAB, MyoDAN, myogenin, and Myf-5, 5 jig of plasmids were cotransfected with pB3.0. MyoDAB is a MyoD mutant with deletion of the basic region, whereas MyoDAN is the MyoD mutant with deletion of the N- terminal transcriptional activation domain. Lysate volumes with 0.5 units of f}-gal activity were analyzed for CAT activities. The relative CAT activity over the basal level of CAT expression in cotransfection with control pEMSV (+EMSV) is presented at the right side of each column. The mean+SE values from at least three separate experiments are shown. 72 +m yogenin +Myf5 +M yoD +EMSV 0 5 10 15 20 CAT A ctivity Fig. 3-7. Differential transactivation of pB3,0 CAT expression in primary myoblasts by the myogenic bHLH proteins. Transfection experiments here are identical with those in Figure 3-5 except that the rabbit muscle primary myoblasts were used instead of C2C12. Tbe relative CAT activity over the basal level of CAT expression in cotransfection with control pHMSV (+EMSV) is presented at the right side of each column. The mean from two separate experiments is shown. 73 myotubes. By contrast, myogenin is not expressed in C2C12 cells until myoblasts enter the differentiation pathway in response to mitogen withdrawal. Myf5, on the other hand, is expressed at a much lower abundance compared to MyoD, and its expression does not increase during differentiation (Braun et al., 1989b). Therefore, differential transactivation effects of these bHLH proteins on pB3.0 may simply be correlated with their concentrations. It is unknown whether these three myogenic bHLH genes are active in the rabbit skeletal primary cells, but they are all expressed to similar extents in human primary myoblasts (Braun et al., 1989b). However, the endogenous levels of these endogenous myogenic factors are negligible when excess amounts of the exogenous counterparts are expressed in the transfected cells. Therefore, when equal amounts of the cDNA expression vectors were cotransfected into C2C12 cells, the concentrations of MyoD, Myf5, and myogenin should be similar. As a result, it is unlikely that the differential transactivation of these proteins is primarily determined by their endogenous differential expression levels. The observations here suggest that the transactivation abilities of the myogenic bHLH proteins are not identical. This notion is supported by the previous observations that myogenin and MRF4 differentially activated the transcription of the muscle creatine kinase (MCK) gene from the MCK enhancer, whereas MyoD and Myf5 failed to do so (Chakraborty et al., 1991; Y u tzey et al., 1990). This MCK enhancer contains a functional CACCTG sequence, and it was used in the later experiments as a competitor for MyoD binding studies. Moreover, transgenic studies of the myogenin also revealed that myogenin only transactivated some -- not all -- of the muscle gene expression (Hasty et al., 1993; Nabeshima et al., 1993). It is now dear that MyoD and Myf5 determine myoblast conversion from myogenic stem 74 cells, and activate myoblast-specific gene expression (Olson and Klein, 1994). Myogenin, on the other hand, maintains terminal differentiation and activates the myotube-specific gene expression (Olson and Klein, 1994). Therefore, results of this study agree that the myogenic bHLH proteins have differential transactivation activities. Furthermore, these myogenic factors recognize the consensus CANNTG sequence with similar specificities and limited sequence preference, thus it is also unlikely that their differential transactivation activities are simply due to their divergent DNA-binding abilities. It is believed that the differences of their transactivation abilities are relative to their abilities to interact with other transcription factors. The unique functional domains of these bHLH proteins lie near their N- or C-terminus where they share very little sequence homology (Chakraborty and Olson, 1991; Olson and Klein, 1994). The diverse functions of these myogenic regulators may be also related to their temporal and compartmental expression patterns. While myogenin mRNAs accumulate preferentially in slow-twitch muscle, MyoD mRNAs are enriched in fast-twitch muscles (Hughes et al., 1993). M yoD and Myf5 are expressed earlier than myogenin during development (Buckingham, 1992). These observations imply that the myogenic regulators may control the expression of different subsets of the muscle genes. Since MyoD is expressed preferentially in slow muscle, it will be interesting to see if the RM-PFK gene is more activated in slow muscle than in fast muscle. Transactivation activities of the myogenic bHLH proteins have been previously shown to be dependent on their binding as heterodimers with the ubiquitous proteins El 2 or E47 to a conserved DNA sequence referred to as an E-box (CANNTG) (Murre et al., 1989a, 1989b). Cooperative interactions 75 among E-box and binding sites of other muscle-spedfic and/or ubiquitous factors were shown to be required for muscle-spedfic transcription (Piette et al., 1990; Sartorelli et al., 1990; Weintraub et al., 1990; Wentworth et al., 1991). Consistent with these findings, cotransfection with pEMSV-MyoDAB or with pEMSV-MyoDAN failed to transactivate the expression of pB3.0 (Fig. 3- 6). pEMSV-MyoDAB expresses MyoDAB which is devoid of amino add residues 102 to 135 within the basic region of MyoD. pEMSV-MyoDAN, on the other hand, expresses another truncated MyoD with a deletion from residues 3 to 56 in the N-terminal transcription activation domain. These results suggest that MyoD is directly involved in enhancing the activity of the RM-PFK promoter. The transactivation ability of MyoD was also examined in 3T3 fibroblasts (Fig. 3-5). 3T3 fibroblasts lack endogenous myogenic factors and their endogenous MyoD gene cannot be activated by the expression of the exogenous MyoD protein (Davis et al., 1987). The transactivation effidency of MyoD was much lower in 3T3 fibroblasts than in the muscle cells (Figs. 3- 5, 3-6, & 3-7). The lower sensitivity of MyoD function observed here agrees with the reduced ability of MyoD to activate myogenesis and to transactivate the muscle-spedfic gene in 3T3 cells as observed by Davis et al., (1987). The CAT activities of pB3.0 without MyoD cotransfection in C2C12 myoblasts and myotubes showed no significant difference (Fig. 3-1). This may be because a very low percentage of the cells fused to form myotubes at the time of the assay. If there is a difference, a myocyte cell line would be better suited for detecting it. In addition, it will be worthwhile to see if the RM-PFK gene can be activated by the fourth member of the myogenic bHLH proteins, MRF4, which has been shown to control myofiber-specific gene 76 expression (see Fig. 1-5; Miner and Wold, 1990; Rhodes and Konieczny, 1989; M ak etal., 1992). Taken together, results presented here suggest that the RM-PFK gene achieves its muscle specificity through up-regulation by the myogenic bHLH proteins. MyoD, Myf5, and myogenin differentially stimulated transcription of the CAT reporter gene which is controlled by the 3 kb 5'-flanking sequence of the RM-PFK gene. Thus, this 3 kb upstream sequence contains both the promoter(s) and the regulatory elements which respond to the stimulation of the myogenic regulators. 3. 2 Delineation of the Positive and Negative Regulatory Elements within the RM-PFK 5*-Flanking Region To identify MyoD response elements within the 3 kb stretch of the 5 - flanking sequence of this PFK gene, various deletions were made within this 3 kb region. These deletion constructs were tested for their promoter activities after being inserted upstream of the CAT reporter gene. Internal deletion constructs in which the 3 kb promoter sequence had been partially deleted were generated by performing Psf I digestions. As shown in Figure 3-8, there are four Pst I sites referred to as Pst 1-1, Pst 1-2, Pst 1-3, and Psf 1-4 in the 5' to 3' direction. Thus, the 3 kb promoter sequence contains three Psf I/Pst I fragments, including a 464-bp between Psf 1-1 and Pst 1-2, a 1570-bp between Psf 1-2 and Psf 1-3, and a 561-bp between Psf 1-3 and Psf 1-4. Psf 1-4 was 268 bp upstream of the Xba I cloning site. When one or a combination of two of these Psf I/Psf I fragments was deleted from pB3.0, four deletion mutants were generated. The CAT activities of these deletion mutants were compared to the expression levels of pB3.0 under the conditions of cotransfection with pEMSV-MyoD and pEMSV in C2C12 m yoblasts. Fig. 3-8. CAT activities of the internal deletions within the 3 kb promoter sequence. pB3.0 was partially digested with Pst I to create these deletion constructs. CAT plasmids were cotransfected with pEMSV-MyoD (+MyoD) or pEMSV (-MyoD) into C2C12 myoblasts. Lysate volumes containing 0.5 units of fi-gai activity were analyzed for CAT activity. The relative value in MyoD cotransfection (+MyoD) is relative to CAT activity of the construct in cotransfection with control plasmid pEMSV (-MyoD), ans is presented as fold in this figure. The mean + SE values from at least three separate experiments are shown here. 3 CAT Activity Fold -MyoD +MyoD AccI pB3.0 8.5 ±0.6 85.0±3.7 10 | 464 bp | 1570 bp | 561 bp | Pstl-l PstI-2 PstI-3 PstI-4 pB30.1 2.010.4 4.711.0 2.4 pB60.3 12.7+4.9 70.311 0 5.5 pB831 16 814.8 43.214.1 2.6 pB60.2 10.41 2.0 41.712.7 4 0 Nl 00 79 The plasmid pB60.3, in which the 464-bp sequence has been deleted, showed CAT activities of 12 and 70.3 when transfected without and with MyoD, respectively. These activity levels are comparable with the expression levels of pB3.0 (8.5 and 85) under the same conditions (Fig. 3-8). This suggests that the 464 bp region contains no major regulatory sequence, or that it exhibits a weak positive regulatory activity. When both the 464-bp and the 1570-bp regions were deleted, pB831 was generated. This pB831 without MyoD cotransfection exhibited a CAT activity of 16.8 that is comparable with the normal level of pB3.0 (8.5). However, with MyoD cotransfection, the CAT activity of pB831 was increased 43.2 which is only 50% of the cotransfection level of pB3.0 (85.0). Thus, this 1570-bp region is thought to contain a MyoD positive response element. The regulatory function of the 561-bp sequence was examined in plasmid pB30.1 in which this fragment was deleted. The CAT activity of pB30.1 was drastically reduced (2.0), and showed no stimulation in response to MyoD cotransfection (4.7). This reduction may be due to a loss of the positive regulatory activity of the 561-bp sequence, and/or to a negative regulatory effect within the 1570-bp region under this construction. Moreover, when both the 561-bp and the 1570-bp regions were deleted, pB60.2 was generated. Without MyoD cotransfection, pB60.2 revealed a CAT activity of 10.4 that is comparable with the normal expression level of pB3.0 (8.5). With MyoD cotransfection, pB60.2 responded to MyoD stimulation by increasing its CAT activity (41.7) to 50% of the cotransfection level of pB3.0 (85.0). Therefore, the net activity of the sequence between Psf 1-2 and Pst 1-5 is positive. These results suggest that there may be multiple positive and negative elements within each of these Psf I /Pst I regions. 80 Furthermore, progressive deletional analysis within the 3 kb flanking region in the 5' to 3* direction revealed more interesting results regarding the regulatory cis-elements (Fig. 3-9). As shown in Figure 3-9A, these CAT constructs contain the same CAT coding sequence, but different promoter fragments that were generated by Exo in digestion (Fig. 3-9A). The number on each construct indicates the length of promoter sequence in base pairs. These CAT constructs were cotransfected with pEMSV-MyoD and pEMSV in C2C12 myoblasts, respectively, and their expression levels are summarized here (Figs 3-9A & B). The plasmid pB268 which contained the 268 bp Pst l/Xba I promoter sequence surrounding the transcription start site a, was originally generated by subcloning from pB3.0 (same as pB3000 here) into pCAT-Basic at the Pst l/Xba I sites. This plasmid exhibited a CAT activity of 38.6 that is 4.5 fold of the activity level of pB3000 without MyoD cotransfection. Nonetheless, MyoD cotransfection stimulated the CAT activities of both CAT plasmids to similar levels (85.0 and 85.5, respectively). These observations suggest that this 268 bp sequence contains the proximal promoter and essential cis-elements responsive to MyoD transactivation. On the basis of CAT activity analysis, the DNA sequence extending upstream of 268 bp to 3 kb contains several positive and negative regulatory regions (Figs. 3-9A & B). First, a strong negative regulatory region was localized within the 557 bp region (designated as Rl) between pB268 and pB825. This was evidenced by the fact that CAT activity of pB825 declined 10 and 2 fold relative to the activity levels of pB268 and pB3000. This inhibition could not be reversed by MyoD cotransfection; the CAT activity of pB825 showed only 15% of the activity level of pB3000 or pB268 (85 and 85.6) in cotransfection with MyoD. Second, the 157 bp sequence (designated as El) that lies immediately upstream of Rl exhibited a pronounced MyoD Fig. 3-9 CAT activities of the 5’ to 3’ deletion constructs. (A) Plasmid pGEM3.0 which contained the 3 kb 5'- flanking sequence between Hind III and Xba I sites of pGEM -7Zf(-) (Promega) was digested with Exo ID (see Fig. 2- 4). The deletion fragments of the RM-PFK sequence were then subdoned into the Hind 111/Xba I sites of pCAT- Basic to generate the deletion CAT constructs. The number indicates the length of the promoter sequence in base pairs Plasmids were cotransfected with pEMSV (-MyoD) or pEMSV-MyoD (+MyoD) into C2C12 myoblasts. Lysate volumes with 0.5 units of [5-gal activity were analyzed for CAT activity. The relative value in MyoD cotransfecbon is relative to the CAT activity of the CAT construct in cotransfection with control plasmid pEMSV, and is presented as fold in this figure. The mean + SE values from at least three separate experiments are shown here. Also shown are the positions of the positive regulatory regions El and E2, and the inhibitory regions Rl and R2. (B) Comparison of the CAT activities of the deletion constructs in a linear graph. The mean + SE values from (A) are used to plot this figure. A. L_ 1 Kb d AccI r PstI CAT Activity Fold ~ T ~ -MyoD ♦MyoD TATA 38.6 ±3.5 85.6 ±4.1 2.2 3.3 ±0.6 13.0 ±2.3 4.0 16.8 ±4.8 43.2 ±4.1 2.6 9.9 ±1.8 257.8 ±10.3 26 8.5 ± 0.2 57.1± 3.6 6.7 3.5 ±1.2 49.5 ±2.7 14.1 1971 16.9 ± 6.7 104.3± 14.3 6.2 5.8 ± 0 .5 128.6± 14.5 22.2 2412. ammrniG 12.7 ±4.9 70.3 ± 0.4 5.5 3000 E2 R2 El Rl .. 8.5 ±0.6 85.0 ± 3.7 10 0N> 0 B. 300 4 -MyoD 0 +MyoD ” 1— — 1— — 1— — r~ CO m « o m CO - o CO co O' o Cm O ' CO O T—* T 4 fM CM Length (bp) 9°. 84 positive response. This was evidenced by the fact that CAT activity of pB988 was increased to 26 fold upon MyoD cotransfection, which is twice as high as the CAT activity of pB268 or pB3.0 under these conditions. With further extension of a 255 bp in the 5' direction (see pB1067 and pB1243), the CAT activities of pB1067 and pB1243 were reduced again and could not be fully recovered by MyoD cotransfection. These results indicate that there is a second negative regulatory region (designated as R2) within this 255 bp sequence. The remaining 1 .6 kb promoter sequence at the 5’ end appeared to have positive regulatory activity that is mainly resides within the 728 bp region (designated as E 2) immediately upstream of R2. This was evidenced by the fact that pB1971, which contains this E2 region, reversed the inhibitory effect of the R2 region. Taken together, by doing deletional analysis of the 3 kb promoter sequence of the RM-PFK gene, two negative regulatory regions (Rl and R2) and two MyoD positive response regions (El and E2) were identified. These regulatory sequences are located between the transcription start sites a and b; thus, they appear to have regulatory effects on the proximal promoter in these deletion constructions. The proximal promoter activity resides within the 268 bp Psf l/Xba I fragment that is immediately upstream of the ATG translational initiation codon. Thus, it is worthwhile to further characterize this promoter and the regulatory elements. 3.3 Interactions of MyoD and the C2C12 Nuclear Proteins with the El Enhancer In Vitro The strong MyoD positive response within the 157-bp region (El) suggested that MyoD might recognize the cognate DNA sequence within 85 this region. Further investigation of that possibility was proceeded by means of EMSA and DNasel footprinting. In the EMSA experiments, purified GST-MyoD fusions (Fig. 3-10) were bound to the El DNA probes amplified by PCR, giving rise to C2 and C3 shifted complexes (Fig. 3-11, lane 3). These complexes were absent in the binding reactions that contained either no proteins or GST proteins (Fig. 3- 11, lanes 1-2), and in reactions where GST-MyoD binding was competed with the MCK enhancer oligos (Fig. 3-11, lanes 4-5) that contained a CACCTG sequence (Chakraborty et at., 1991). Complex Cl was observed in the MCK competition experiments (Fig. 3-11, lanes 4-5), and was the dominant GST- MyoD DNA complex when lower amounts of GST-MyoD were incubated with the El probe (Fig. 3-12, lanes 2-4). Because there is a CAGCTG consensus sequence within the El region, it is possible that GST-MyoD specifically recognizes the CAGCTG sequence, resulting in formation of multiple DNA-protein complexes. Nuclear extracts of the C2C12 myoblasts and myotubes were also used for the similar gel-shift assays. As a result, both the myoblast and the myotube nuclear extracts recognized the El sequence, giving rise to three shifted complexes Ml, M2 and M3 (Fig. 3-12). The mobilities of these three complexes were similar between myoblast and myotube extracts, indicating that the protein contents are similar, if not identical. The M2 complex was the predominant species at low protein concentrations (Fig. 3-12, lanes 5 & 9), whereas M3 appeared to be a minor complex. The Ml complex was both the fastest migrating and the second major complex. Interestingly, the Ml complex of the myotubes extracts appeared to be more intense than that of the myoblasts extracts (Fig. 3-12, lanes 7 & 12). In contrast, the M2 complex was more intense in the lanes with myoblast nuclear extracts (Fig. 3-12, lanes 86 GST-MyoD ■mm Fig. 3-10. SDS-PAGE of the purified GST-MyoD proteins. Lane M, protein markers. Lanes 1 and 4, input of the cell lysates for GST and GST-MyoD, respectively. Lanes 2 and 5, fractions of the final wash through of these two protein samples. Lanes 3 and 6 , eluted fractions of GST and GST-MyoD, respectively, with their positions indicated. 87 MCK 1 2 3 4 5 Fig. 3-11. EMSA competition assays for binding of the GST-MyoD proteins to El enhancer sequence. El DNA fragments were amplified by PCR with oligo primers that were 5’ end-labeled with [y 32P]-ATP and with pB1067 (Fig. 3-9) as the DNA template. Lanes 1, free probe. Lane 2, with 3 tig of GST added. Lane 3, with 3 pg of GST-MyoD added. Lane 4-5, with the MCK competitor oligo at 500 and 1000 ng , respectively, and 3 |ig of GST-MyoD. 88 GST-D MB MT I r C oncentration - ^ —' I - 1 2 3 4 5 6 7 8 9 10 11 12 Fig. 3-12. EMSA titration experiments on El enhancer sequence. Lanes 2-4, with purified GST-MyoD at 0.5, 0.8, and 1.4 pg, respectively. Lanes 5-8, with nuclear extracts of myoblasts (MB) at 3.5, 10.5, 17.5, and 28 fig, respectively. Lanes 9-12, with nuclear extracts of myotubes (MT) at 1.8, 5.4, 8 .8, and 14 pg, respectively. Lane 1, free probe. 89 5 & 10). In the competition studies, MCK enhancer oligos competed with the formation of Ml and M2 complexes, while it did not affect the formation of the M3 complex (Fig. 3-13, lanes 2, 3, 5, & 6 ). These results indicate that nuclear extracts of C2C12 cells contain activity that specifically bind to the E- box of the El region, which is responsive to the formation of complexes Ml and M2. In addition, this binding activity is altered during differentiation from myoblasts to myotubes. Myogenic proteins associate with non-myogenic bHLH proteins in vivo for DNA recognition and transcriptional activation. Other researchers have shown that for myogenic proteins to bind to E-boxes, their minimal compelx must be at least homo- or heterodimers; further, oligomers are formed when the protein reaches high concentrations and/or when there are multiple E-boxes present (Tapscott et at., 1991c). There is binding cooperativity between the myogenic bHLH proteins and other transcription activators (such as Spl and MEF-2) for higher level transactivation of the muscle-specific genes (Sartorelli et al.f 1990; Gossett et at., 1989; Cserjesi and Olson, 1991). MEF-2 proteins are the myocyte-specific transactivator which has recently been shown to induce high level transcription of the muscle gene in conjunction with MyoD protein (Kaushal et al., 1994). Another line of evidence for MyoD interaction with the El sequence came from the DNasel footprinting experiments (Fig. 3-14). Purified GST- MyoD proteins specifically protected the CAGCTG sequence of the El region (Fig. 3-14A, lanes 4-5). This footprint was diminished when MCK competitor oligo was added to the binding reaction (Fig. 3-14A, lane 6 ), and it was absent when no protein was added (Fig. 3-14A, lane 2) or GST proteins were added to replace GST-MyoD (Fig. 3-14A, lane 3). The nuclear extracts of C2C12 myoblasts protected three DNA regions from DNasel digestion (Fig. 3- 90 i MB 11 1,17 i MCK ~ + ++ - + ++ Comp, oligo M3 M2 M l 1 2 3 4 5 6 Fig. 3-13. EMSA competition assay for binding of the C2C12 nuclear extracts to El enhancer sequence. Lanes 1-3, with 17.5 pg of myoblasts nuclear extracts (MB). Lanes 4-6, with 14 pg of nuclear extracts of myotubes (MT). Lanes 1 and 4, no MCK competitor oligo. Lanes 2 and 5, with 500 ng of MCK oligo. Lanes 3 and 6 , with 1000 ng of MCK oligo. 91 Fig. 3-14. DNasel footprinting of the El enhancer region. (A) DNasel footprinting of the bottom strand El sequence. El fragments were amplified by PCR with a upper primer (-916 to -896) and a lower primer (-750 to -770). The DNA template for PCR reaction was pB1067 (same as pB1.2). The lower primer was 5' end-labeled with T4 kinase and [y32p]_ATP and then used in the PCR reaction. Lane 1, Maxam-Gilbert G+A sequence marker. Lane 2, free probe. Lane 3, with 5 ng of GST proteins. Lanes 4-5, with 5 and 10 pg of GST-MyoD, respectively; Lane 6 , with 10 pg of GST-MyoD and 500 ng of the MCK competitor oligo. Lane 7, with 30 ng of the myoblast nuclear extracts. (B) Summary of the footprinting pattern of the El enhancer region (upper strand). The indicated regions are the AT-rich sequence, the E-box sequence CAGCTG, and the CAGG repeated sequence that were protected from DNasel digestion by the myoblast nuclear extracts. 9 2 A Bottom Strand B. -916 TTCTCTGCTTCTCTCATTCCCCCGCCAAAGTC3CTCAAAT -076 lAAATAAGTGTTTTTTtAAAAAGAGAAAGACAGGAGCCCAGC -836 AGGGGA^ACCAGCTGTjP/>jCAGGGAGCAGGTCAGGAAGACA| -796 [G^CAATGGGGGGGAGAAGGGAGTTGGGGAGGACGGCACTG -756 CAGGGGG 93 14A, lane 7). In addition to the CAGCTG E-box region, an AT-rich sequence (beginning approximately 44 bp upstream of the E-box), and a CAGG repeated sequence (immediately following the E-box) were recognized by myoblasts extract in these experiments (Figs. 3-14A, lane 7; 3-14B). In summary, results from both the EMSA and DNasel footprinting experiments indicate that MyoD protein can directly contact the CAGCTG sequence of El, and that nuclear extracts of C2C12 cells contain E-box binding activity. Thus, the transactivation ability of MyoD demonstrated in the transient transfection studies is mediated through its direct interaction with the E-box sequence of the El enhancer. Because several specific sequences of El were recognized by C2C12 nuclear proteins, it is possible that these sequences may be the potential targets of the regulatory factors in vivo. Further experiments are needed to investigate the identities of the proteins that bind to these DNA sequences. 3.4 Determination of the Boundary and Activity of the Proximal Promoter From the deletion studies discussed above (Fig. 3-9), it has become clear that the 268 bp Pst l/Xba I fragment in pB268 contains the proximal promoter and MyoD positive response sequences. Therefore, MyoD, Myf5, and myogenin were tested for their abilities to stimulate CAT activity of pB268 in cotransfection studies. As shown in Figure 3-15, myogenic cDNA expression plasmids stimulated the CAT activity of pB268 2-3 fold in the cotransfection experiments (Fig. 3-15). However, MyoD transactivation was abolished when MyoD AN was cotransfected with pB268 (Fig. 3-15), suggesting that MyoD function requires the integrity of the transactivation domain. Moreover, MyoD A B inhibited promoter activity more than 60% 94 +MyoDAB +MyoDAN +Myf5 +m yogenin +M yoD +EMSV 0 20 40 60 80 100 120 CAT A ctivity Fig. 3-15. Transactivation of pB268 by the myogenic bHLH factors in C2C12. For each myogenic cDNA expression plasmid, 5 pg were cotransfected with pB268. These plasmids included pEMSV-MyoD, pEMSV-MyoDAB, pEMSV- MyoDAN, pEMSV-myogenin, and pEMSV-Myf5. For a control, pB268 was cotransfected with pEMSV (+EMSV). Lysate volumes with 0.5 units of p-gal activity were analyzed for CAT assay. The relative value in cotransfection with myogenic expression plasmid is relative to the expression level of pB268 in cotransfection with the control plasmid pEMSV, and is shown at the right side of each column. The mean+SE values from three separate experiments are shown. 95 when its cDNA expression plasmid was cotransfected with pB268 (Fig. 3-15). These results further support the previous observations that MyoD as a transactivator is dependent on its interaction with other protein factors through the N-terminal transactivation domain (Davis et al., 1987). Although it is unable to bind to the DNA sequence, MyoD A B should still be able to interact with E12 protein through its HLH domain. However, because MyoDAB-E12 (or E47) dimers are unable to interact with cognate E- box sequence, MyoD A B proteins sequester E-proteins, thereby reducing the myogenic effect of MyoD and/or other myogenic bHLH proteins (Davis et al., 1987). Therefore, the observed inhibitory effect of MyoDAB supports the conclusion that MyoDAB is functionally similar to Id proteins (Jen et al., 1992). DNA sequence analysis indicates that there are two potential MyoD binding sites in pB268 (Fig. 3-16A): CAGATG (-186 to -192, in respect to transcription start site as + 1); and, CAGCTG (+41 to +46). To determine whether these E-boxes are functional, sequence deletions within the 268 bp region were performed. When transient transfection studies were carried out in C2C12 myoblasts, the CAT activities of these deletion constructs with and without MyoD cotransfection are summarized in Figure 3-16. Removal of the 50 bp Nhe l/Xba I fragment (including the downstream CAGCTG sequence) reduced the promoter activity, but not its transactivation induction by MyoD cotransfection. This can be observed in Figure 3-16 where the CAT activity of pB218 was not affected in cotransfection with MyoD (Fig. 3-16B), as compared to the control experiment (cotransfected with pEMSV) in which there was a 70% reduction from 38.6 in pB268 to 10.7 in pB218 (Fig. 3-16A). MyoD stimulation must rely on the N-terminal transactivation domain because cotransfection with MyoDAN did not Fig. 3-16. Relative CAT activities of the CAT constructs containing sequences of the proximal promoter in C2C12 myoblasts. (A) Three deletion mutants (pB218, pB168, and pB118) were constructed by digestion with endonucleases. The CAT activities of these constructs in cotransfection with the cDNA expression plasmids of MyoD, MyoDAB, and MyoDAN are summarized. For a control experiment, pEMSV was cotransfected with the CAT constructs. Lysate volumes with 0.5 units of jl-gal activity were analyzed for CAT activity. The locations of two E-boxes are shown here. (B) The relative CAT activity of each transfection is presented as a percentage of the CAT activity of pSV2CAT. The mean + SE values from at least three separate experiments are used to plot these figures. O' A. r * TCTTGCCAGTCT CAT Activity Xbal PstI DraDI +MvoD +DAB-rEMSV pB268 38.613.5 85.614.1 13.211.4 41.913.4 1 CAGATG Nhel' CAGCTG pB218 10.711.5 105.3111.5 40.318 15.512 pB168 9.511.1 17.811.6 3.710.7 4.21 0.8 pB118 4.512 14.615 1.610.4 2.710.5 vC 'v l □ MyoDAN pB268 I MyoDAB £3 MyoD ■ EMSV pB218 pB168 pB118 Relative CAT Activity (% of SV2CAT) 99 enhance the transcription of pB218. On the other hand, direct binding to the E-box sequence is not absolutely required for MyoD function, as co- transfection with MyoDAB still induced the CAT activity of pB218 to about 38% of the induction level of the wild type MyoD (Fig. 3-16). Further removal of the 100 bp Pst l/Dra in fragment (containing the upstream CAGATG) from pB218 generated pB118 which only contains the 118 bp Dra III/N he I fragment (-95 to +23). The plasmid pB118 revealed a much lower promoter activity compared to those of pB218 and pB268, and could not be stimulated by MyoD cotransfection to the levels of pB218 and pB268 (Fig. 3-16). Thus, these results indicate that the major MyoD response element resides within the 100 bp Psf l/Dra in fragment. It is reasonable to speculate that the upstream CAGATG may mediate the transactivation of MyoD in this promoter region. This by no means excludes the possibility that there is an unknown DNA binding site for a transcription factor other than MyoD within this region that may be important for the transactivation by MyoD. For instance, MyoD protein is known to indirectly transactivate muscle-specific gene by inducing other muscle-specific factors such as MEF- 2 . In a similar experiment, pB168 (containing the 168 bp Dra lll/Xba I promoter sequence) showed a CAT activity comparable to pB218 (Fig. 3-16). However, MyoD only increased the CAT activity of pB168 by two fold in the cotransfection studies. Further, the two MyoD mutants (MyoDAB and MyoDAN) inhibited the CAT activities of pB168 to much lower levels than in pB218 (Fig. 3-16). Therefore, the 50 bp Nhe l/Xba I sequence (containing CAGCTG) appeared to be a minor MyoD response element. When the two E-boxes co-existed (as in pB268), a synergistic effect was observed in which the promoter activity of pB268 was greater than the summation of the 100 values for pB218 and pB168 (Figs. 3-16A and B). Alternatively, other cis- elements within the Nhe l/Xba I region might cooperate with the upstream E-box in response to MyoD activation. Taken together, results here indicate that the sequence between Pst I and Dra III sites is critical for MyoD stimulation of the proximal promoter. The sequence between Nhe I and Xba I site does not have profound impact in regulation of the promoter activity in response to MyoD. MyoD stimulation does not necessarily require E-box present, since pBl 18 that does not contain an E-box sequence was also stimulated by MyoD. Further, because the CAT activity of pB118 was the lowest among these four CAT constructs (Fig. 3-16), the 118 bp Dra III/Nhe I promoter sequence in pB118 contains the core promoter element of this proximal promoter. To illustrate the muscle-specific transcription pattern of this proximal promoter, CAT activities of these four promoter constructs were assayed in C2C12 myoblasts and myotubes (Fig. 3-17). In these results, the relative CAT activities of pB268, pB218, and pB118 in myotubes were not significantly increased when compared in myoblasts. However, the relative CAT activity of pB168 was increased from 17 in myoblasts to 52 in myotubes. Interestingly, the CAT activity of pB268 in myotubes appeared to be the additive of the activities of pB218 and pB168, which is distinguished from the synergistic effect observed in myoblasts. These observations imply that different combinations of the transcription factors may be involved in transcriptional initiation from this proximal promoter during myogenesis. Furthermore, the indifference in the CAT activities of pB268 between myoblast and myotube stages may be due to the fact that a very low percentage of the cells fused to form myotubes at the time of the assays. 101 pB268 pB218 pB168 MT □ MB pB118 0 20 40 60 80 100 Relative CAT Activity (% of SV2CAT) Fig. 3-17. Comparison of the CAT activities of the proximal promoter CAT plasmids during C2C12 differentiation. Cells were fed with growth medium (for myoblasts, MB) or differentiation medium (for myotube, MT) after transfection. Lysate volumes with 0.5 units of the fi-gal activity were analyzed for CAT activity. The relative CAT activity is represented as a percentage of the CAT activity of pSV2CAT. The mean+SE values from three experiments are shown here. 102 To further understand the role of MyoD in transactivation of the proximal promoter, parallel transient expression studies were repeated in the NIH3T3 fibroblast cells. The relative CAT activities of the proximal promoter constructs in C2C12 and 3T3 cells were compared. Surprisingly, the CAT activities of pB268, pB218 and pB168 were much higher in 3T3 than in C2C12 cells (Figs. 3-16B & 3-18). For instance, the relative CAT activity of pB268 in C2C12 myoblasts was about 60% of the pSV2CAT level, whereas it was 250% of the pSV2CAT level in 3T3 cells. On the other hand, pB118 remained unchanged in its CAT activity between these two cell lines (Figs. 3-16B and 3-18). MyoD cotransfection did not stimulate CAT activity for each of the CAT constructs (Fig. 3-18). Rather, it showed some degree of inhibition as the CAT activity of pB218 was reduced significantly by MyoD cotransfection (Fig. 3-18). Even though the CAT activity of pB218 (without MyoD cotransfection) was higher than that of pB268, it was not statistically different (Fig. 3-18). From these results, it is further confirmed that pB118 contains the core promoter sequence, and its promoter activity is consistent from one cell-type to another. It is also revealed that the 100 bp Pst l/Dra m and the 50 b p Nhe l/Xba I regions surrounding the core promoter (see Fig. 3-16A) contain the signals for regulating promoter activity in 3T3 cells. However, the 100 bp Pst l/Dra III region has more pronounced effects than does the 50 bp Nhe I/Xba I region. Since the full length promoter of pB3.0 was weaker than the proximal promoter of pB268 in both the C2C12 and 3T3 cells (Figs. 3-5, 3-9A, & 3-18), it is suggested that the negative regulatory activity of a sequence upstream controls the activity of the proximal promoter. This promoter, on the other hand, was highly inducible in response to the cellular environment. m +MyoD pB671 MyoD pB268 pB218 pB168 pB118 Relative CAT Activity (% of SV2CAT) Fig. 3-18. Relative CAT activities of the PFK-CAT plasmids in 3T3 fibroblasts. CAT plasmids were cotransfected with pEMSV (-MyoD) and pEMSV-MyoD (-*-MyoD) into 3T3 cells, respectively. Lysate volumes with 0.5 units of (J- gal activity were analyzed for CAT assay. The relative CAT activity after subtracting the background activity of pCAT-Basic, is presented as a percentage of the CAT activity of pSV2CAT The mean ± SE values for three separate experiments are used to plot this graph. 104 In addition, these results also indicate that ectopic expression of MyoD in 313 cells may negatively regulate the proximal promoter. The negative function of MyoD has not been previously reported and needs to be confirmed. It is possible that the versatile protein-protein interactions of MyoD with other musde-specific and ubiquitous transcription factors allow MyoD to intercept the diverse growth or differentiation signals in the cells and to respond depending on its dimerization partner, with either up- or down-regulation of muscle gene expression. Alternatively, the negative regulation of MyoD in fibroblasts may be due to an indirect mechanism in which MyoD activates another factor whose expression inhibits the proximal promoter activity of the RM-PFK gene. Mutation of these two E- boxes within the 268 bp promoter region will provide more direct evidence to clarify this argument. DNA sequence analyses revealed that the core promoter of 118 bp sequence does not have a TATA-like element that is recognized by the TATA binding protein (TBP) which fadlitates the transcriptional initiation process. Rather, there is only an initiator-like (Inr-like) element surrounding the transcription initiation site. Sequence comparison (Fig. 3- 19) revealed that the Inr of RM-PFK gene (CTCTTGCCAGTCTGA, with +1 position underlined) shares high homology with the Inr sequences of the following gene: rat c-mos proto-oncoprotein (Lenormand et at., 1993); mouse primase p49 (Prussak et at., 1989); SV40 major late promoter (Ayer and Dynan, 1990; Roy et at., 1991); terminal deoxynucleotidyl transferase (TdT) (Smale and Baltimore, 1989); human leukocyte interferon (LelF-J) (U llrich et at., 1982); adeno-associated virus type 2 P5 promoter +1 region (P5+1 element) (Setoef at., 1991); and, HIV Inrl and Inr2 (Roy et at., 1991). 105 + 1 TGCCAGTCTGA RM-PFK TGTCXgtCCTG rat c-mos TGTC^AGTCCTG mouse primase p4 9 GTTC_ACGCCAG SV4 0 MLP CC T C _A C T C TC T AdML CCTCA^TTCTGG TdT CTCC_AGAAAAC LelF-J CTCCATTTTGA P5 Py Py Py C Py Py Py Py Consensus Inr Fig. 3-19. Comparison of the RM-PFK Inr sequence with Inr of other genes. The transcription initiation site is underlined and is surrounded by the pyrimidine-rich sequence. 1 0 6 3.5 Detection of Multiple Protein Binding Sequences within the Proximal Promoter Region DNasel footprinting experiments were carried out to see if this Inr region could be recognized by protein factors from the nuclear extracts. As shown in Figure 3-20, this pyrimidine-rich Inr region was indeed protected by the nuclear extracts of the C2C12 myoblasts and myotubes from the DNase digestion, suggesting that this Inr-like sequence is the promoter element. Another AG-rich region around -74 to -65 was specifically bound by myotube nuclear extracts (Fig. 3-20). In contrast, nuclear extracts of myoblasts did not show such binding in this region. The CAGCTG E-box (located downstream of the Inr sequence) and a short region (GACCATCG) located a few base pairs downstream from this E-box were also bound by the nuclear extracts of C2C12 (Fig. 3-20). Further, the upstream CAGATG E-box (as in pB218) was recognized by the C2C12 nuclear extracts of myoblasts and myotubes (Fig. 3-21). Overall, the DNA protected regions were broader with the nuclear extracts of myoblasts than with that of myotubes. Therefore, as summarized in Fig. 3-22, there are multiple specific DNA sequences that were recognized by the protein factors of the C2C12 nuclear extracts. This is an implication of the potential regulatory functions of the proteins that recognize these DNA sequences. EMSA experiments were performed to investigate the DNA-binding profile of the nuclear extracts and of the purified GST-MyoD on this proximal promoter. Purified GST-MyoD associated with this promoter sequence to give rise to three major complexes (Fig. 3-23, lanes 7-8). These complexes were absent in the binding reaction incubated with no protein or with GST (Fig. 3-23, lanes 1-5), and were prevented by the addition of MCK enhancer (not shown here). Thus, GST-MyoD appeared to specifically 107 Fig. 3-20. DNasel footprinting of the promoter 268 bp region (top strand). Lanes 1 and 9, Maxam-Gilbert G+A sequence marker. Lanes 2, 5, and 8, no proteins added. Lanes 3 and 4, with nuclear extracts of myotubes (70 pg). Lanes 6 and 7, with nuclear extracts of myoblasts (40 pg). 108 Top Strand 5* A G Inr \ r G G C T G A V C c A T H>00 C T C 3 ’ 123456789 - M T -MB- 109 Bottom Strand 123456769 - M T MB - Fig. 3-21. DNasel footprinting of the promoter 268 bp region (bottom strand). Lane 1, Maxam-Gilbert G+A sequence maker. Lanes 2, 5, 6, and 9, no nuclear extracts added. Lanes 3 and 4, with nuclear extracts of myotubes (30 and 40 pg, respectively). Lanes 7 and 8, with nuclear extracts of myoblasts (30 and 40 pg, respectively). The CAGATG E-box sequence is underlined. no P s t I I 1 9 6 CTGCAGATGG GTTCCTCTCG GGGAGGGAGG GACTAGGGAG - 1 5 6 GGATTAGCCA GGACTTTTGA GTCTTGGGCT TGATTACTGT D ra I I I I -116 GGCATTTCAG CTTGTCATTC CACAGGGTGT GGCTCTCCCT _7 6 <5 g a a g a a g t c __c^ g a g t t c c c AGGCTGCAAA GCTGAGGTGG I* - 3 6 TGGAGTGGGA GAGCCTGCCT GAGGTGGCTC TTGCCAGTCT N h e I +6 GACGAAGCTG TCGCTTGAGC TAGCGGCACC TTGACCCAGC + 4 6 TGTGTCCTAA C|TGACCATCG TCJTTGCCTTC TAGA I X ba I Fig. 3-22, Summary of the footprinting pattern of the proximal promoter 268 bp sequence. Tlie protected E-boxes are singly underlined and the Inr- like sequence is doubly underlined. The rectangle represents protected sequences with nuclear extracts of C2C12 myoblasts and myotubes. The oval represents a myotube-specific protected sequence. The arrow represents the +1 transcription start site of this promoter. Restriction endonuclease recognition sites are indicated. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Fig. 3-23. EMSA titration experiments on the promoter 268 bp sequence. Lane 1, free probe. Lanes 2-5, with GST at 0.19, 0.57, 0.95 and 1.5 pg, respectively. Lanes 6-8, with GST-MyoD at 0.53, 0.9 and 1.4 pg, respectively. Lanes 9-12, with 3.5, 10.5, 17.5 and 28 pg of myoblast nuclear extracts (MB), respectively. Lanes 13-16, with 1.75, 5.25, 8.75, and 14 pg of myotube nuclear extracts (MT), respectively. The exposure period for MB binding was one half of that for MT binding. 112 recognize the E-box sequences of the promoter region. The nuclear extracts of both myoblasts and myotubes formed multiple DNA-protein complexes upon binding to the promoter (Figs. 3-23, 3-24, & 3-25). As the amounts of the nuclear extracts in the binding reaction increased, protein binding revealed a cooperative pattern (Fig. 3-23, lanes 9-16). The nuclear extracts that were treated at 47°C for 10 min (to inactivate TBP protein) reduced the mobility of complex Q (Figs. 3-24, lanes 5; 3-25, lanes 4). As shown in Figure 3-24, the Q complex in the binding reactions with the myoblast nuclear proteins was competed by the cold probe Dra lU/Nhe I (lane 10). In contrast, the MCK oligos and two other cold probes (Psf l/Dra III and Nhe 1/Xba I) did not prevent the Q complex formation (lanes 6-9). However, the Q complex in the binding reaction incubated with the myotube nuclear extracts was specifically competed by the addition of the MCK oligo (Fig. 3-25, lane 5). Thus, the core promoter sequence Dra U l/N he I is corresponding to the formation of the Q complex. The complexes Ml, M2, and M3 appeared to be the weak complexes under these condition. It was unclear from these results whether they could be competed by the E-box containing competitors. Taken together, the results presented here suggest that MyoD as a GST fusion can specifically bind to the proximal promoter sequence, and that not only the E-box binding protein but also other factors can bind to this promoter sequence. Even though the downstream E-box can be recognized in vitro and even though it is closer to the Inr sequence than the upstream E-box, it does not have great impact on the regulation of the proximal promoter. The Q complex appeared to be retarded by the proteins of the C2C12 nuclear extracts that recognize the core promoter sequence. When these extracts were treated at 47°C and added to the binding reactions, the mobility of the Q complex was slightly reduced. Because TBP protein can be 113 C om petitor - - - - - + + + + + + 1 2 3 4 5 6 7 8 9 10 11 Fig. 3-24. EMSA competition assays for binding of the myoblast nuclear extracts to promoter 268 bp sequence. Lanes 2-4, with nuclear extracts at 3.5, 8.8, and 15 pg, respectively. Lime 5, with 15 pg of the nuclear extracts heat- treated at 47°C for 10 min. Lanes 6-7, with 15 pg of the nuclear extracts and MCK oligo at 100 and 300 ng, respectively. Lanes 8-10, with 15 pg of the nuclear extracts with the addition of 200 ng of the cold probes Nhe l/Xba I, Pst If Dra III, and Dra Ul/Nhe I fragments, respectively. Lane 11, with 15 pg of the nuclear extracts and 300 ng of the non-specific oligo AT. 114 Competitor + + MTNud. Ext. 1 2 3 4 5 6 Fig. 3-25. EMSA competition assays for binding of the myotube nuclear extracts to promoter 268 bp sequence. Lanes 1-3, with increasing amounts of myotube nuclear extracts from 3.5 to 7.0, and 14 pg. Lane 4, with 14 pg of heat-treated extracts (47°C, 10 min). Lane 5-6, with 14 pg of the nuclear extracts with the addition of 300 ng of the MCK oligo and the non-specific oligo AT, respectively. 115 inactivated by this heat-treated condition (Roy et a/., 1993b), the results here imply that TBP may be involved in the formation of the Q complex. In summary, there are multiple protein recognition sequences located within the 268 bp proximal promoter region. Since GST-MyoD proteins specifically bound to this promoter sequence in the EMSA studied, it is suggested that the MyoD transactivational effect can be mediated by its direct association with the E-boxes of this promoter sequence. Further, these E- boxes were specifically recognized by the C2C12 nuclear proteins, suggesting that they may be the functional regulatory elements in vivo. The Inr sequence is highly homologous to the Inr element of the adenovirus major late promoter (AdML) which was shown to be the binding sequence of the transcription initiation factor TFII-I (Roy et a/., 1991); thus, it is possible that TFII-I or its related factor may be involved in the formation of the Q complex in the EMSA experiments presented here. TFII-I protein (120 Kd) binds to the Inr element of the AdML, and mediates a novel pathway of transcription initiation (Roy et al.f 1991; Roy et al„ 1993a and b). Interestingly, this protein also directly binds to an E-box sequence CACGTG around -60, which is a high-affinity E-box for USF protein (a bHLH protein). Moreover, Myc and USF, two of the HLH proteins recognizing E-boxes, have been demonstrated to directly interact with TFII-I (Roy et al., 1993a; Roy et al.r 1993b) -- possibly through their bHLH domains -- as if TFII-I is also a bHLH protein. The cooperative interaction of TFII-I and USF at both the Inr and the E-box provide a possible explanation for MyoD function. It would be interesting to illustrate whether MyoD and other myogenic bHLH factors could make such interaction with TFII-I. In addition, the myotube-specific sequence GGAAGAAGTCC (Fig. 3- 22) is similar to the MEF-2 site (Yu et al., 1992; Martin et ai, 1993). MEF-2 is 116 another muscle-specific transcriptional activator that cooperates with the myogenic bHLH proteins to stimulate muscle gene transcription to higher levels. Another region (GACCATCGTCT) following the downstream E-box (Fig. 3-22) was also protected by an unknown factor of the nuclear extracts. Therefore, further experiments are needed to identify the nuclear proteins that interact with the proximal promoter of the RM-PFK gene, and to understand their roles in the regulation of the promoter activity. 3. 6 Characterization of Another Muscle-Specific Promoter Results from mRNA detection experiments have shown that mRNA-bl and mRNA-b2 of the RM-PFK accumulated preferentially in the skeletal muscle (Fig. 1-3). The bl and b2 mRNAs are the alternative splicing products from the same transcription start site b (Fig. 1-3). Sequence analyses showed that there is a TATA-like sequence (TTATTTATT, at -30 with respect to the transcription start site b as +1) similar to the TFII-D binding site (CAATATTATTTAAGGAC) previously reported (Hahn et al., 1989). To delineate the promoter b sequence, several PFK-CAT constructs containing different sequences upstream and/or downstream of this putative TATA-like sequence were made (Fig. 2-7) and tested for their promoter activities. Transfection studies were performed in C2C12 myoblasts. pB1.4 contains the 1.4 Kb upstream sequence including transcription start sites b, c, and d, whereas pB671 only contains the 671 bp sequence around the transcription start site b (Fig. 2-7). The CAT activity of pB1.4 was twice as high as that of pB671 (Fig. 3-26). However, these two constructs reached the same CAT activity levels upon MyoD cotransfection. MyoD stimulated their promoter activities to four (pB1.4) and eight fold (pB671) (Fig.3-26). 117 +M yoD pBasic -MyoD pB1.4 pB671 pB256 0 10 20 30 40 50 Relative CAT Activity (% of SV2CAT) Fig. 3-26. Relative CAT activities of the promoter b containing CAT constructs. These constructs were cotransfected into C2C12 with pEMSV (- MyoD) or pEMSV-MyoD (+MyoD), respectively. CAT activities were measured as a percentage of the expression level of pSV2CAT. pCAT-Basic (pBasic) was used as the negative control. The relative value in MyoD cotransfection is relative to the expression level of the CAT construct in cotransfection with the control plasmid pEMSV, and is shown on the right side of each column. The mean from two separate experiments is shown. 118 These results indicate that the 671 bp fragment of pB671 harbors the promoter b sequence. When the promoter activities of pB671, pBl 18, and pB268 were compared in C2C12 cells (Figs. 3-16B vs 3-26), the activity level of pB671 was comparable with that of pB118 (containing the proximal core promoter), and was much lower than that of pB268 (containing the proximal promoter). When further examined in 3T3 fibroblasts, the promoter activity of pB671 was nearly undetectable (Fig. 3-18). These results suggest that promoter b of 671 bp sequence is only activated in the muscle cells, and has lower activity than does the proximal promoter. Because MyoD did not stimulate the transcription of pB671 to a level similar to that of pB268, it is possible that the muscle-specificity of promoter b is not regulated by the MyoD factor. In an earlier experiment (not shown here), there was no detectable activity from the promoter of pB1.8 which contains the 5' portion 1.8 kb sequence of the 3 kb promoter region (Figs. 2-5 & 2-7). This result indicates that the regulatory element(s) for promoter b is probably not within this 1.8 kb fragment. The E2 enhancer region defined by the deletion experiments (Fig. 3-9) is located within this 1.8 kb sequence, whereas the HI enhancer and two other negative regulatory regions (R1 and R2) are located downstream of this 1.8 kb sequence. Thus, the E2 enhancer is not essential for the regulation of promoter b activity. It is unknown whether the El enhancer and negative regulatory regions also play roles in controlling the activity of the promoter b. An ambiguous observation was that primer extension experiments had detected a transcription start site downstream of a TATA sequence — that is, 236 bp downstream of the transcription start site b (Fig. 2-7). However, SI mapping, as well as RNase protection, did not resolve this start 119 site (Xiao, 1995). Thus, pB256 was constructed to answer the question of whether or not this TATA sequence had any promoter activity (Fig. 2-7). The plasmid pB256 in transient transfection studies did show a CAT activity similar to that of pB671 (Fig. 3-26) without MyoD cotransfection, further, MyoD enhanced the CAT activity of pB256 to six fold, which is about 50% of the induction level of pB671. The higher transactivation of MyoD for pB671 is probably because there are two putative E-boxes (CATCTG and CAAGTG) within this 671 bp sequence compared to only one in the 256 bp region (CAAGTG). Shortening 26 bp at the 3’ end of the 256 bp fragment, as in pB230wt (Fig. 2-7), did not change the promoter activity (Fig. 3-27). Mutation at the G-C stem loop sequence (pB230mu) downstream of the TATA sequence slightly increased the promoter activity (Fig. 3*27). Therefore, the evidence did not support the original speculation that this G- C stem loop prevents formation of a transcriptional complex at this TATA region. Without further experiments, it is unknown at this point whether this TATA-box is an authentic promoter element in vivo. Site-directed mutagenesis and an in vitro transcription system can provide further information to answer this question. Taken together, it is believed that, unlike the proximal promoter, promoter b is much weaker and is activated at a much lower level in muscle cells by MyoD cotransfection. Thus, these two muscle-specific promoters examined are components of a complex controlling mechanism for the muscle-specific transcription of the RM-PFK gene. The proximal promoter is the major promoter that is transactivated by the myogenic bHLH protein. The sequence within the 3 kb 5'-flanking region is capable of regulating this proximal promoter. However, the regulatory sequence for the distal promoter b seems to be located beyond this 3 kb boundary. The muscle* 120 ■ +M yoD ■ -M yoD pB230wt pB230mu 0 5 10 15 Relative CAT Activity (% of SV2CAT) Fig. 3-27. Mutation effect of the G-C stem loop downstream of the TATA sequence on the promoter activity. The plasmid pB230mu contains the substituted bases within the G-C stem (Fig. 2-7), whereas pB230wt contains the wild type sequence. Plasmids were cotransfected into C2C12 cells with either pEMSV (-MyoD) or pEMSV-MyoD (+MyoD). CAT activities are presented as a percentage of the expression level of pSV2CAT. The plasmid pCAT-Basic (pBasic) containing no promoter was used for a negative control. The relative value in MyoD cotransfection is relative to the expression level of the CAT construct in cotransfection with the control plasmid pEMSV, and is shown at the right side of each column. The mean from two separate experiments is shown. 121 specific regulatory sequence of the mouse muscle PFK gene was located between -4800 and -3900 bp (Gekakis and Sul, 1994); thus, it is worthwhile to investigate the regulatory function of the DNA sequence farther upstream of the 3 kb flanking region of the RM-PFK gene. The proximal promoter of the human muscle PFK gene is regulated by the multiple Spl sites at the transcription start site (Johnson and McLachlan, 1994); thus, the possible involvement of other transcription factors such as Spl, MEF-2 remains to be illustrated. In any event, these observations indicate that the transcriptional regulation of the mammalian muscle PFK genes is different. Furthermore, the fact that similar levels of mRNAs-a and mRNA-b accumulated in the skeletal muscle (Xiao, 1995) did not agree with the strengths of these two promoters. Because alternative splicing is involved in the production of the mRNA-b species, it is possible that the post- transcriptional events may contribute to the regulatory mechanism of the RM-PFK gene. As a metabolic enzyme, PFK gene transcription is under both developmental control and growth control. This dissertation has provided some preliminary evidence for the muscle-specific regulation of the RM- PFK gene at the transcriptional level. At least two promoters are up- regulated by the myogenic bHLH proteins in skeletal muscle cells. If this is the case, this is the first report of the muscle-specific transcriptional regulation of the muscle PFK gene, indicating that the understanding of the transcriptional control of this gene has begun. CHAPTER 4 SUMMARY, CONCLUSIONS, AND FUTURE STUDIES 4.1 Summary and Conclusions In this dissertation, the muscle-specific transcriptional mechanism of the rabbit muscle phosphofructokinase gene was investigated in tissue culture cells by using the CAT reporter gene system. The 3 kb 5’-flanking sequence of the RM-PFK gene was examined in order to define the promoters and the regulatory regions that are responsive to transactivation by the myogenic bHLH transcription factors such as MyoD, myogenin, and Myf5. Plasmid pB3.0 (containing a CAT coding region driven by the 3 kb PFK promoter sequence) was expressed in the mouse C2C12 and the primary rabbit skeletal muscle myoblasts (Figs 3-1 to 3-4), and was also expressed in the 3T3 fibroblasts (Fig. 3-5). This expression was stimulated by the muscle- specific bHLH transcription factor MyoD during cotransfection (Figs. 3-1 to 3- 5). MyoD transactivated the CAT gene expression of pB3.0 to 10 and 2 fold in C2C12 and 3T3 cells, respectively (Fig. 3-5). Along with MyoD, two other myogenic bHLH factors (Myf5 and myogenin) stimulated the CAT gene expression of pB3.0 in C2C12 cells (Fig. 3-6) as well as in the primary myoblasts (Fig. 3-7). Thus, the transactivation activities of these three myogenic factors were in the descending order of MyoD > Myf5 > myogenin (Figs. 3-6 & 3-7). Therefore, results presented here indicate for the first time that the muscle-specific bHLH transcription factors play an important role in the control of the muscle-specific transcription of this PFK gene. This muscle PFK gene is the first glycolytic enzyme that has been shown to be regulated by myogenic bHLH proteins. 122 123 Of these myogenic bHLH proteins, this study focused on MyoD mainly because of its strong transactivation activity towards PFK gene transcription (Figs. 3-1, 3-6 & 3-7). Both its N-terminal transactivation domain and its basic region (DNA binding and protein interaction domain) were required for MyoD function (Fig. 3-6), which further confirmed the earlier findings by other research groups. Thus, MyoD transactivation requires direct contact with its cognate DNA binding sequence E-box and association with other transcription factors. DNA sequence deletion experiments led to the construction of a series of the CAT plasmids containing different 5'-flanking regions of the PFK gene. After close examination of the CAT activities of these constructs, two major positive and two negative regulatory regions were identified along with the proximal promoter region (-195 to +73) (Figs. 3-8 & 3-9). The positive region, El (-916 to -758), dramatically enhanced the CAT activity of the proximal promoter in the MyoD cotransfection experiments (Fig. 3-9). EMSA studies revealed that purified GST-MyoD fusions physically bound to the El sequence (Fig. 3-11). The MCK enhancer oligonucleotide (containing CACCTG E-box) specifically prevented MyoD from binding to this El sequence (Fig. 3-11). DNasel footprinting experiments showed that GST-MyoD recognized the CAGCTG E-box sequence (-827 to -821) (Fig. 3-14). In addition, nuclear extracts of the C2C12 myoblasts and myotubes contained E-box binding activity (Figs. 3-12 & 3-13), and protected several regions from DNasel digestion (Fig. 3-14). These regions included the CAGCTG E-box sequence, an AT-rich sequence (-886 to -863, CGCTCAAATAAATAAGTG X i l l), and a CAGG repeated sequence (- 810 to -795, CAGGTCAGGAAGACAGG) (Fig. 3-14). 124 The RM-PFK gene contains multiple promoters. This was evidenced by the detection of multiple transcription start sites distributed along the 3 kb 5'-flanking region (Xiao/ 1995). The mRNAs transcribed from the proximal promoter (or promoter a) and from the distal promoter b are preferentially accumulated in the skeletal muscle tissue (Xiao, 1995). Concomitant with these findings, plasmid pB671 (-2313 to -1642, in respect to the proximal transcription start site as +1) contained the promoter b sequence and had detectable CAT activity only in the C2C12 cells (Fig. 3-26). In contrast to pB671, pB268 contained the proximal promoter 268 bp sequence (-195 to +73) and showed much higher CAT activities in both the C2C12 and 3T3 cells (Figs. 3-16 to 3-18). In C2C12 cells, MyoD stimulated CAT activities of both pB268 and pB671 (Figs. 3-16 & 3-26). However, the stimulated expression level of pB268 was much higher than that of pB671 (Figs. 3-16 & 3-26). Thus, the proximal promoter is considered the major promoter in response to transcriptional activation by MyoD. The sequence deletion studies suggest that MyoD transactivation was probably mediated through the CAGATG (-192 to -187) and the CAGCTG (+40 to +45) E-box sequences (Fig. 3-16). In particular, the CAGATG E-box provided most of the MyoD stimulation of the proximal promoter; thus, it is the crucial E-box for MyoD function (Fig. 3-16). As shown in the DNasel footprinting experiments, these two E-boxes were also recognized by the E-box binding activity in the nuclear extracts of myoblasts and myotubes (Figs. 3-20 to 3-22). In 3T3 fibroblasts, MyoD transactivation was less effective than in C2C12 (Figs. 3-5, 3-16 & 3-18), which agrees with previous observations by others (Davis et al.r 1987). However, an inhibitory effect on the CAT activities of pB218 (containing CAGATG) and pB168 (containing CAGCTG) 125 by MyoD cotransfeclion was also observed (Fig. 3-18). Plasmids pB218 and pB168 bear a common core promoter sequence (-95 to +23, see pB118) which directed CAT gene expression at a constitulively lower level (Figs. 3-16 to 3- 18). Two DNA regions within this 118 bp core promoter sequence were protected by the C2C12 nuclear proteins from the DNasel digestion (Fig. 3- 20). These sequences included a myotube-specific region (-76 to -64, GGAAGAAGTCC), and the region surrounding the transcription start site referred to as Inr which was recognized by both myoblast and myotube nuclear extracts. Even though it has not been demonstrated to be a true Inr, this pyrimidine-rich sequence (-8 to +7, CTCTTGCCAGTCTGA) is similar to the initiator elements of several genes (Fig. 3-19). One of these Inr sequences, that is the Inr of the adenovirus major late promoter, has been previously shown to be the recognition sequence of the transcription factor TFII-I (Roy et at., 1991,1993a & 1993b). Since there is no TATA element within this PFK proximal promoter region, it is implied that TFII-I or its related protein factor may be involved in the transcriptional initiation of the RM-PFK proximal promoter. The high level transcription from this promoter appears to require both the core promoter and its surrounding sequences (Figs 3-16 to 3-18). That multiple sequences were recognized in vitro implies that proteins which recognize these DNA sequences may play roles in the regulation of the proximal p ro m o ter. It remains unclear why MyoD inhibited CAT activity of pB218 and pB168 in 3T3 cells (Fig. 3-18). It is also unclear why the detected levels of mRNAs from the proximal promoter and the distal promoter b were very similar in spite of their different promoter strengths. It is possible that a 126 post-transcriptional event could contribute to the muscle-specificity of this PFK gene. Nevertheless, the evidence so far suggests that the proximal promoter activity is not restricted to muscle cells. That the CAT activity of pB3.0 (containing the full length promoter sequence) was much lower than that of pB268 (containing the proximal promoter sequence) (Figs. 3-5 & 3-16) suggests that an unknown negative regulatory mechanism controls the activity of this proximal promoter. The negative regulatory regions 5' upstream of the proximal promoter may serve this function, and would be worth further investigation. Alternatively, DNA methylation may play a role in the negative regulation of the tissue-specificity. My preliminary results indicated that methylation of plasmids pB3.0 or pB1.2 in vitro reduced their CAT activities more than 50% in C2C12 cells. The MyoD transactivation of the methylated plasmids was reduced to 50% of the unmethylated pB3.0 level. Finally, the possible promoter elements of the promoter b have been intended to be identified. The evidence here demonstrates that a 265-bp sequence (which is included in the 671-bp sequence of pB671) downstream of the transcription start site b contains promoter activity (Fig. 3-27, see pB265). A perfect TATA-box sequence is located within this region and is possibly the promoter element in pB256. However, a transcription start site downstream of this TATA sequence was not consistently detected by using different detection methods (Xiao, 1995). Thus, whether this TATA sequence is a functional promoter element in vivo remains undetermined. On the other hand, a possible functional TATA element for the promoter b lies at the -31 to -23 region (TTATTTATT, with reference to transcription start site b as +1). 127 In conclusion, the 3 kb 5'-flanking sequence of the RM-PFK gene contains the promoter and the regulatory elements that were shown to respond to the transactivation by the myogenic bHLH proteins. Two muscle-spedfic promoters of the RM-PFK gene were examined in this study. Their different promoter structures may determine their divergent mechanisms of transcriptional regulation. The TATA-less proximal promoter contains an initiator element as well as several other nuclear protein binding sites (including E-boxes). This promoter in the content of pB268 is also activated in non-muscle cells, indicating that some negative control mechanism exists at the upstream region to prevent its expression in tissues other than muscle. Furthermore, there are two positive and two negative regulatory regions which are located within the region between the transcription start sites a and b. These regulatory sequences were shown to control the proximal promoter activity. Furthermore, the transactivation effect of MyoD was shown to be mediated through its direct interaction with the cognate sequences of the El enhancer in vitro. On the other hand, another muscle-spedfic promoter, promoter b, is a weak promoter and may contain a TATA-box sequence. The MyoD cotransfection did not stimulate the activity of this promoter to the level as was seen with the proximal promoter. Thus, it is possible that promoter b is not mainly regulated by the myogenic bHLH factors. Therefore, the proximal promoter is the major promoter of the RM-PFK gene that is transactivated by the myogenic bHLI I proteins. The transcriptional mechanisms of these two muscle-specific promoters are different. 128 4J2 Future Studies One of the important issues in this research was that the rabbit myogenic bHLH proteins have not been identified. It is difficult to judge whether differential transactivation of the RM-PFK gene by these bHLH factors was not due to their differential expression. Detection of the mRNAs of these bHLH genes from the rabbit skeletal muscle tissue or primary cells by Northern blot (using their unique cDNA sequences as probes) can provide useful information to discriminate against this possibility. A second question that must be addressed is whether the transcription start site of plasmid pB268 (which contains the proximal promoter) in 3T3 and C2C12 matches with the authentic position in the rabbit muscle tissue. This can be done by a primer extension experiment using isolated mRNAs from the transfected cells and the oligo primer positioned at the 5’ end of the CAT coding sequence (such as primer CAT- R24). This synthetic oligo has been used as a sequencing primer for selection of the corrected CAT deletion constructs. The muscle-specific expression mechanism of the proximal promoter is not very clear at this point. It will be interesting to see whether pB268 and other CAT constructs containing the proximal promoter have any CAT activity in cells from other tissues (such as liver, heart, brain, kidney) where the mRNAs transcribed under the direction of this promoter were undetected. Further clarification of promoter elements such as Inr and E- boxes will also be an interesting topic in the future. Site-directed mutagenesis will be useful to confirm the functions of these cis-elements. Alternatively, synthetic oligos of these DNA sequences can be used as the probes for EMSA competition studies, and for identifying the protein factors that bind to these sequences. 129 Much has remained unknown about the structure of promoter b. The putative TATA element (TTATTTAT) which lies upstream of the transcription start site b needs to be confirmed by mutation and deletion studies. An unsolved mystery is why this promoter in pB671 is much weaker compared to the proximal promoter. It would be worthwhile to reconstruct the CAT plasmid so as to delineate the basal promoter region. A n unique Bsm I site 84 bp upstream of the putative TATA site can be used to remove the 257 bp sequence at the 5’ end of the promoter insert of pB671. Systematic deletion in the 3' to 5' direction of the sequence downstream of the transcription start site b will allow identification of any sequence within this region that is necessary for the promoter activity. The potential involvement of other muscle-specific transcription factors in high level transcription of this muscle gene is certainly worthy of further investigation. Spl, MEF-2, and M-CAT binding protein are the possible targets of that research. The AT-rich sequence within the positive regulatory region El resembles a MEF-2 binding site. Thus, it will not be surprising to find out that MEF-2 and MyoD cooperatively induce transcription of this PFK gene. Furthermore, the CAT activities of plasmids pB3.0 and pB268 did not reveal significant increase during C2C12 cell differentiation under the assay conditions; thus, it remains unclear whether it is because a low percentage of the cells fused to form myotubes or it is because other important muscle-specific regulatory elements are not included in the 3 kb 5' sequence tested. Therefore, the 5' sequence farther upstream of the 3 kb region and the sequence downstream of the ATG translational initiation codon are worthy of further investigation. Furthermore, a myocyte cell line that readily forms myotubes would be also better suited to address this issue. 130 Finally, the ultimate goal of this research is to unravel the physiological significance of why the rabbit muscle PFK gene has multiple promoters, with every one having its own expression pattern. Understanding the structural features and the regulatory mechanisms of the other two promoters (c and d) is required for this purpose. Until we know whether all six mRNAs of this PFK gene have the same coding capacity, it is difficult to suggest any explanation. If they have the same capacity, then the complex promoter structure and the complicated transcriptional regulations ensure that this PFK gene maintains its active and inducible status where its activity is demanded, even when some of its promoters are shut-down by mutation or other inactivation mechanisms in the cells. REFERENCES Adolph, E. A., Subrainaniam A., Cserjesl P., Olson E. N. and Robbins J. 1993. Role of myocyte-specific enhancer-binding factor (MEF-2) in transcriptional regulation of the a-cardiac myosin heavy chain gene. j. Biol. Chem. 268: 5349-5352. Antequera, F. and Bird A. 1993. Number of CpG islands and genes in human and mouse. Proc. Natl. Acad. Sci. USA 90: 11995-11999. Anthony-Cahill, S. J., Benfield P. A., Fairman R., Wasserman Z. R., Brenner S. L., S tafford W. F. Ill, A ltenbach C , H u b b ell W. L. and D eG rado VV. F. 1992. Molecular characterization of helix-loop-helix peptides. Science 255: 979-983. Arber, S., Haider G. and Caroni P. 1994. Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation. Cell 79: 221-231. Ayer, D. E. and Dynan W. S. 1990. A downstream-element-binding factor facilitates assembly of a functional preinitiation complex at the simian virus 40 major late promoter. Mol. Cell. Biol. 10: 3635-3645. Bauer, B. A. and Younathan E. S. 1984. Decreased phosphofructokinase activity in skeletal musde of diabetic rats. Clin. Physiol. Biochem. 2: 137- 145. Bednarik, D. Gross D. S. and Garrard W. T. 1991. DNA CpG methylation inhibits binding of NF-kappa B proteins to the HIV-1 long terminal repeat cognate DNA motif. New Biologist 3: 969-976. Ben-Hatter, J., Beard P. and Jiricny J. 1989. Cytosine methylation in CTF and Spl recognition sites of an HSV tk promoter: effects on transcription in vivo and on factor binding in vitro. Nucl. Acids Res. 17: 10179-10190. Benezra, R., Davis R. L., Lockshon D. L., Turner D. L. and Weintraub H. 1990. A negative regulator of helix-loop-helix DNA binding proteins. Cell 61: 49-59. Bengal, E„ Ransone L., Scharfmann R., Dwarki V. J., Tapscott S. K., W eintraub H. and Verma I. M. 1992. Functional antagonism between c-Jun and MyoD proteins: a direct physical association. Cell 72: 507-519. Biggs, J,, Murphy E. V. and Israel M, A. 1992. A human Id-like helix-loop- helix protein expressed during early development. Proc. Natl. Acad. Sci. USA 89: 1512-1516. 131 132 Bird, A. P. 1986. CpG islands and the function of DNA methylation. Nature (London) 321: 209-213. Bird, A. P. 1992. The essentials of DNA methylation. Cell 70: 5-8. Birkeiuneier, E. H., Gwynn B., Howard S., Jerry J., Dordon L, Landschulz W. H. and McKnight S. L. 1989. Tissue-specific expression, developmental regulation, and genetic mapping of the gene encoding CCAAT/enhancer binding protein. Genes Dev. 3: 1146-1156. Blau, H. M. and Webster C. 1981. Isolation and characterization of human muscle cells. Proc. Natl. Acad. Sci. USA 78: 5623-5627. Blau, H. M. and Baltimore D. 1991. Differentiation requires continuous regulation. J. Cell Biol. 112: 781-783. Bloxham, D. P. and Lardy H. A. 1973. Phosphofructokinase. In The Enzymes, P. D. Boyer Ed. 18: 239-278. Academic Press, New York. Brandeis, M„ Frank D., Keshet I., Siegfried Z., Mendelsohn M., Nemes A., Temper V., Razin A. and Cedar H. 1994. Spl elements protect a CpG island from de novo methylation. Nature (London) 371: 435-438. Bradford, M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 72: 248-254. Braun, T., Buschhausen-Denker G., Bober E., Tannich E. and Arnold H. H. 1989a. A novel human muscle factor related to but distinct from MyoDl induces myogenic conversion in 10T1/2 fibroblasts. EMBO J. 8: 701-709. Braun, T„ Bober E., Buschhausen-Denker G„ Kotz S., Grzeschik K.-H. and Arnold H. H. 1989b. Differential expression of myogenic determination genes in muscle cells: possible autoactivation by the Myf gene products. EMBOJ. 8:3617-3625. Braun, T., Bober E., Winter B., Rosenthal N. and Arnold H. H. 1990a. Myf-6, a new member of the human gene family of myogenic determination factors: evidence for a gene duster on chromosome 12. EMBO J. 9: 821-831. Braun, T., Winter B., Bober E. and Arnold H. H. 1990b. Transcriptional activation domain of the muscle-specific gene-regulatory protein myf5. Nature (London) 346: 663-668. 133 Braun, T. and Arnold H. H. 1991. The four human muscle regulatory helix- loop-helix proteins Myf3-Myf6 exhibit similar hetero-dimerization and DNA binding properties. Nucl. Adds Res. 19: 5645-5651. Braun, T., Bober E. and Arnold H. H. 1992a. Inhibition of muscle differentiation by the adenovirus Ela protein: repression of the transcriptional activating function of the HLH protein Myf-5. Genes Dev. 6: 888-902. Braun, T., Rudnicki M. A., Arnold H. H. and Jaenisch R. 1992b. Targeted Inactivation of the Muscle Regulatory Gene Myf-5 Results in Abnormal Rib Development and Perinatal Death. Cell 71: 369-382. Breitbart, R. E. and Nadal-Ginard B. 1987. Developmentally induced, muscle-specific trans factors control the differential splicing of alternative and constitutive troponin T exons. Cell 49: 793-803. Breitbart, R., Liang C , Smoot L„ Laheru D., Mahdavi V. and Nadal-Ginard B. 1993. A fourth human MEF-2 transcription factor, hMEF2D, is an early marker of the myogenic lineage. Development 118: 1095-1106. Brennan, T. J. and Olson E. N. 1991. TGF-b represses the actions of myogenin through a mechanism independent of DNA binding. Proc. Natl. Acad. Sd. USA 88:3822-3826. Buchkovich, K., Duffy L. A. and Harlow E. 1989. The retinoblastoma protein is phosphorylated during specific phases of the cell cycle. Cell 58: 1097-1105. Buckingham, M. E. 1989. The control of muscle gene expression: A review of molecular studies on the production and processing of primary transcripts. British Medical Bulletin 45: 608-629. Buckingham, M. 1992. Making muscle in mammals. Trends Gen. 8: 144-149. C edar, H. 1988. DNA m ethylation and gene activity. Cell 53: 3-4. Chakraborty, T., Brennan T. and Olson E. N. 1991. Differential trans activation of a muscle-specific enhancer by myogenic helix-loop-helix proteins in separable from DNA binding. J. Biol. Chem. 266: 2878-2882. Chakraborty, T. and Olson E. N. 1991. Domain outside of the DNA-binding domain impart target gene specificity to myogenin and MRF4. Mol. Cell. Biol. 11:6103-6108. 134 Chambers, A. E., Kolecha S., Towers N. and Mohun T. J. 1992. Muscle- spedfic expression of SRF-related genes in the early embryo of Xenopus laevis. EMBO J. 11:4981-4991. Christy, B. and Nathans D. 1989. DNA binding site of the growth factor- indudble protein Zif268. Proc. Natl. Acad. Sd. USA 86: 8737-8741. Christy, B. A., Sanders L. K., Lau L. F., Copland N. G., Jenkins N. A. and Nathans D. 1991. An Id-related helix-loop-helix protein encoded by a growth factor-indudble gene. Proc. Natl. Acad. Sd. USA 88: 1815-1819. Comb, M. and Goodman H. M. 1990. CpG methylation inhibits proenkephalin gene expression and binding of the transcription factor AP-2. Nud. Adds Res. 18: 3975-3982. Croston, G. E., Kerrigan L. A., Lira M., Marshak D. R. and Kadonaga J. T. 1991. Sequence-spedfic antirepression of histone Hl-mediated inhibition of basal RNA polymerase II transcription. Sdence 251: 643-649. Cserjesi, P. and Olson E. N. 1991. Myogenin induces the myocyte-specific enhancer binding factor MEF-2 independently of other muscle-spedfic gene products. Mol. Cell. Biol. 11: 4854-4862. Currie, P. and Sullivan D. T. 1994. Structure and expression of the gene encoding phosphofructokinase (PFK) in Drosophila melanogaster. J. Biol. Chem. 269:24679-24687. Davis, R. L., Weintraub H. and Lassar A. B. 1987. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51: 987-1000. Davis, R. L., Cheng P.-F., Lassar A. B. and W eintraub H. 1990. The MyoD DNA binding domain contains a recognition code for muscle-specific gene activation. Cell 60: 733-746. DeCaprio, J. A., Ludlow J. W., Figge J„ Shew J. Y. and Huang C. M. 1988. SV40 large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene. Cell 54: 275-283. Deed, R. W., Bianchi S. M., Atherton G. T., Johnston D., Santibanez-Koref M., Murphy J. J. and Norton J. D. 1993. An immediate early human gene encodes an Id-like helix-loop-helix protein and is regulated by protein kinase C activation in diverse cell types. Oncogene 8: 599-607. Descombes, P. and Schibler U. 1991. A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67: 569-579. 135 Dignam, J. D., Lebovilz R. M. and Roeder R. G. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucl. Acids Res. 11: 1475-1489. Dunaway, G. A. 1983. A review of animal phosphofructokinase isozymes with an emphasis on their physiological role. Mol. Cell. Biochem. 52: 75-91. Dunaway, G. A. and Kasten T. P. 1985. Nature of the rat brain 6- phosphofructo-1-kinase isozymes. J. Biol. Chem. 260: 4180-4185. Dunaway, G. A., Kasten T. P. and Kolm P. 1986a. Alteration of 6- phosphofructo-1-kinase isozyme pools during heart development and aging. J, Biol. Chem. 261: 17170-17173. Dunaway, G. A. and Kasten T. P. 1986. Are the rat tissue/organ proportions of 6-phosphofructo-l-kinase subunits strain-specific? Biochem. J. 237: 157- 161. Dunaway, G. A., Kasten T. P. and Naqui D. 1986b. Insulin-mediated regulation of heart atrial and ventricular 6-phosphofructo-l-kinase. J. Biol. Chem. 261: 7831-7833. Dunaway, G. A., Kasten T. P., Sebo T. and Trapp R. 1988. Analysis of the phosphofructokinase subunits and isoenzymes in human tissues. Biochem. J. 251:677-683. Dunaway, G. A. and Kasten T. P. 1989. Physiological relevance of the changing subunit composition and regulatory properties of the 6- phosphofructo-1 -kinase isozyme pools during heart and muscle development. Mol. Cell Biochem. 87: 71-77. Edmondson, D. G. and Olson E. N. 1989. A gene with homology to the myc similarity region of MyoD is expressed during myogenesis and is sufficient to activate the muscle differentiation program. Genes Dev. 3: 628-640. Ellenberger, T„ Fass D., Amaud M. and Harrison S. C. 1994. Crystal structure of transcription factor E47: E-box recognition by a basic region helix-loop- helix dimer. Genes Dev. 8: 970-980. Ellmeier, W., Aguzzi A., Kleiner E., Kurzbauer R. and Weith A. 1992. Mutually exclusive expression of a helix-loop-helix gene and N-myc in human neuroblastomas and in normal development. EMBO J. 11: 2563- 2571. 136 Farrance, I. K„ Mar J. H. and Ordahl C P. 1992. M-CAT binding Factor is related to the SV 40 enhancer binding factor, TEF-1. J. Biol. Chem. 267: 17234-17240. Ferre-D’Amare, A. R., Prendergast G. C-, Ziff E. B, and Burley S. K. 1993. Recognition by Max of its cognate DNA through a dimeric b/HLH/Z domain. Nature (London) 363: 38-45. Ferre-DVAmare, A. R., Pognonec P., Roeder R. G. and Burley S. K. 1994. Structure and function of the b/H LH /Z domain of USF. EMBO J. 13: 180- 189. FI ink, I. L., Edwards J. G., Bahl J. J., Liew C. C., Sole M. and M orkin E. 1992. Characterization of a strong positive cis-acting element of the human beta- myosin heavy chain gene in fetal rat heart cells. J. Biol. Chem. 267: 9917- 9924. Foe, L. G. and Kemp R. G. 1985. Isolation and characterization of phospho fructokinase C from rabbit brain. J. Biol. Chem. 260: 726-730. Fordis, M. and Howard B. H. 1987. Use of the CAT reporter gene for the optimization of gene transfer into eucaryotic cells. Meth. Enzym. 151: 382- 397. Fothergill-Gilmore, L. A. and Michels P. A. M. 1993. Evolution of glycolysis. Prog. Biophys. Mol.. Biol. 59: 105-235. French, B. A. and Chang S. H. 1987. Nucleotide sequence of the phosphofructokinase gene from Bacillus stearothermophilus and comparison with the homologous Escherichia coli gene. Gene 54: 65-71. Garabedian, M. J., La Baer J., Liu W.-H. and Thomas J. R.1993. In Gene transcription: A practical approach. 243-293. IRL Press. Gehnrich, S. C., Gekakis N. and Sul H. S. 1988. Liver (B-type) phospho fructokinase mRNA. J. Biol. Chem. 263: 11755-11759. Gekakis, N„ Gehnrich S. C. and Sul H. S. 1989. Phosphofructokinase isozyme expression during myoblast differentiation. J. Biol. Chem. 264: 3658-3661. Gekakis, N., Johnson R. C., Jerkins A., Mains R. E. and Sul H. S. 1994. Structure, distribution, and functional expression of the phospho fructokinase C isozyme. J. Biol. Chem. 269: 3348-3355. Gekakis, N. and Sul H. S. 1994. Control of the murine phosphofructokinase- A gene during muscle differentiation. Biochem. 33: 1771-1777. 137 G iger, U. and H arvey J. W. 1987. Hem olysis caused by phosphofructokinase deficiency in English Springer Spaniels: Seven cases (1983-1986). J. Ameri. Vet. Med. Assoc. 191:453-459. Giger, U., Kelly A. M. and Teno P. S. 1988a. Biochemical studies of canine muscle phosphofructokinase deficiency. Enzyme 40: 25-29. Giger, U., Argov Z., Schnall M„ Bank W. J. and Chance B. 1988b. Metabolic myopathy in canine muscle-type phosphofructokinase deficiency. Muscle and Nerve 11: 1260-1265. GUgenkrantz, H., Hugnot J.-P., Lambert M., Chafey P., Jean-Oaude and Kahn A. 1992. Positive and negative regulatory DNA elements including a CCArGG box are involved in the cell type-specific expression of the human muscle dystrophin gene. J. Biol. Chem. 267: 10823-10830. Goodrich, D. W., Wang N. P., Qian Y. W., Lee E. Y. and Lee W. H. 1991. The retinoblastoma gene product regulates progression through the G1 phase of the cell cycle. Cell 67: 293-302. Gossett, L. A., Kelvin D. J., Sternberg E. A. and Olson E. N. 1989. A new myocyte-specific enhancer-binding factor that recognizes a conserved element associated with multiple muscle-specific genes. Mol. Cell. Biol. 9: 5022-5033. Gu, W., Schneider J. W., Condorelli G., Kaushal S., Mahdavi V. and Nadal- Ginard B. 1993. Interaction of myogenic factors and the retinoblastoma protein mediates muscle cell commitment and differentiation. Cell 72: 309- 324. Hahn, S., Buratowski S., Sharp P. A. and Guarente L. 1989. Yeast TATA- binding protein TFIID binds to TATA elements with both consensus and nonconsensus DNA sequences. Proc. Natl. Acad. Sd. USA 86: 5718-5722. Harrington, M. A., Jones P. A., Imagawa M. and Karin M. 1988. Cytosine methylation does not affect binding of transcription factor Spl. Proc. Natl. Acad. Sd. USA 85: 2066-2070. Hasty, P., Bradley A., Morris J. H,, Edmondson D. G., Venuti J., Olson E. N. and Klein W. H. 1993. Muscle defidency and neonatal death in mice with a targeted mutation in the myogenin gene. Nature (London) 364: 501-506. Heinisch, J., Ritzel R. G., Borstel R. C. V., Aguilera A., Rodicio R. and Zimmermann F. K. 1989. The phosphofructokinase genes of yeast evolved from two duplication events. Gene 78: 309-321. 138 Hellinga, H. W. and Evans P. R. 1985. Nucleotide sequence and high-level expression of the major Escherichia coli phosphofructokinase. Eur. J. Biochem. 149: 363-373. Herschlag, D. and Johnson B. F. 1993. Synergism in transcriptional activation: a kinetic view. Genes Dev. 7: 173-179. Holler, M. G., Westin J., Jiricny J. and Shaffner W. 1988. Spl transcription factor binds to DNA and activates transcription even the binding site is CpG methylated. Genes Dev. 2: 1127-1135. Holtzer, H., Yeoh B. G., Meganathan R. and Kaji A. 1975. Effect of oncogenic virus on muscle differentiation. Proc. Natl. Acad. Sci. USA 72: 4051-4055. Horlick, R. A. and Benfield P. A. 1989. The upstream muscle-specific enhancer of the rat muscle creatine kinase gene is composed of multiple elements. Mol. Cell. Biol. 9: 2396-2413. Huang, L.-H., Wang R., Gama-Sosa M. A., Shenoy S. and Ehrtich M. 1984. A protein from human placental nuclei binds preferentially to 5- methylcytosine-rich DNA. Nature (London) 308: 293-295. Huang, H. J., Yee J. K., Shew J. Y., Chen P. L., Bookstein R., Friedmann T., Lee E. Y. and Lee W. H. 1988. Suppression of the neoplastic phenotype by replacement of the pRB gene in human cancer cells. Science 242: 1563-1569. Hughes, S. M., Taylor J. M., Tapscott S. J., Gurley C. M., Cartter W. J. and Peterson C* A. 1993. Selective accumulation of MyoD and myogenin mRNAs in fast and slow adult skeletal muscle is controlled by innervation and hormones. Development 118: 1137-1147. Iannello, R. C., Mar J. H. and Ordahl C. P. 1991. Characterization of a promoter element required for transcription in myocardial cells. J. Biol. Chem. 266: 3309-3316. Iavarone, A., Garg P., Lasorella A., Hsu J. and Israel M. A. 1994. The helix- loop-helix protein Id-2 enhances cell proliferation and binds to the retinoblastoma protein. Genes Dev. 8: 1270-1284. Jen, Y., W eintraub H. and Benezra R. 1992. Overexpression of Id protein inhibits the muscle differentiation program: In vivo association of Id with E2A proteins. Genes Dev. 6: 1466*1479. Johnson, J. L. and McLanchlan A. 1994. Novel clustering of Spl transcription factor binding sites at the transcription initiation site of the human muscle phosphofructokinase PI promoter. Nucl. Acids Res. 22: 5085-5092. 139 Johnson, P. F. and McKnight S. L. 1989. Eukaryotic transcriptional regulatory proteins. Ann. Rev. Biochem. 58: 799-839. Kaelin, W. G. J., Ewen M. E. and Livingston D. M. 1990. Definition of the minimal simian virus 40 large T antigen-and adenovirus ElA-binding domain in the retinoblastoma gene product. Mol. Cell. Biol. 10: 3761-3769. Kaushal, S., Schneider J. W., Nadal-Ginard B. and Mahdavi V. 1994. Activation of the myogenic lineage by MEF2A, a factor that induces and cooperates with MyoD. Science 266: 1236-1240. Kemp, R. G. and Foe L. G. 1983. Alios ter ic regulatory properties of muscle phosphofructokinase. Mol. Cell. Biochem. 57: 147-154. Keshet, I., Lieman-Hurwitz J. and Cedar H. 1986. DNA methylation affects the formation of active chromatin. Cell 44: 535-543. Klein, R. D., Olson E. R., Favreau M. A., Winterrowd C A., Hatzenbuhler N. T., Shea M. H., Nulf S. C. and Geary T. G. 1991. Cloning of a cDNA phospho fructokinase from Haemonchus con tortus. Mol. Biochem. Parasitol. 48: 17- 26. Klempnauer, K. H. 1993. Methylation-sensitive DNA binding by v-myb and c-myb proteins. Oncogene 8: 111-115. Kolb, E., Hudson P. J. and Harris J, I. 1980. Phosphofructokinase: complete amino-acid sequence of the enzyme from Bacillus Stearothermophilus. Eur. J. Biochem. 108: 587-597. Krause, M. and Weintraub H. 1992. CeMyoD expression and myogenesis in C. elegans. Semin. Dev. Biol. 3: 277-285. LaRocca, S. A., Grossi M., Falcone G., Alema S. and Tat F. 1989. Interaction with normal cells suppresses the transformed phenotype of v-myc- transformed quail muscle cells. Cell 58: 123-131. Lassar, A. B., Thayer M. J., Overell R. W. and Weintraub H. 1989. Transformation by activated ras or fos prevents myogenesis by inhibiting expression of MyoDl. Cell 58: 659-667. Lassar, A. B. and Weintraub H.1992. In Transcription regulation. 1037-1061. Cold spring Harbor Laboratory Press. Lee, C. P., Kao M. C., French B. A., Putney S. D. and Chang S. H. 1987a. The rabbit muscle phosphofructokinase gene: implications for protein structure, function and tissue specificity. J. Biol. Chem. 262: 4195-4199. 140 Lee, W. H., Bookstein R., Hong F., Young L. J., Shew J. Y. and Lee E. Y. 1987b. Human retinoblastoma susceptibility gene: cloning, identification, and sequence. Science 235: 1394-1399. Lee, K. J., Ross R. S., Rockman H. A., Harris A. N., O'Brien T. X., Van Bilsen M., Shubeita H. E., Kandolf R., Brem G., Price J., Evans S. M., Zhu H., Franz W.-M. and Chien K. R. 1992. Myosin light chain-2 luciferase transgenic mice reveal distinct regulatory programs for cardiac and skeletal muscle-specific expression of a single contractile protein gene. J. Biol. Chem. 267: 15875- 15885. Leibham, D., Wong M., T.-C. C., Schroeder S., Weil P. A., Olson E. N. and Perry M. 1994. Binding of TFIID and MEF2 to the TATA element activate transcription of the Xenopus MyoDa promoter. Mol. Cell. Biol. 14: 686-699. Leifer, D., Krainc D„ Yu Y.-T., McDermott J., Breitbart R. E., Heng J., Neve R. L., Kosofsky B., Nadal-Ginard B. and Lipton S. A. 1993. MEF2C, a MADS/MEF2-family transcription factor expressed in a laminar distribution in cerebral cortex. Proc. Natl. Acad. Sd. USA 90: 1546-1550. Lemaigre, F. P., Durviaux S. M. and Rousseau G. G. 1991. Identification of regulatory sequences and protein-binding sites in the liver-type promoter of a gene encoding 6-phosphofructo-2-kinase/fructokinase-2,6-bisphosphatase. Mol. Cell. Biol. 11: 1099-1106. Lemaigre, F. P., Durviaux S. M. and Rousseau G. G. 1993. Liver-specific Factor Binding to the Liver Promoter of a 6-Phosphofructo-2- Kinase/Fructose-2,6-bisphosphatase Gene. J. Biol. Chem. 26: 19896-19905. Lenormand, J.-L., Guillier M. and Leibovitch S. A. 1993. Identification of a ds acting element responsible for muscle specific expression of the c-mos protooncogene. Nud. Acids Res. 3: 695-702. Levine, A., Yeivin A., Ben-Asher E., Aloni Y. and Razin A. 1993. His tone Hl-mediated inhibition of transcription initiation of methylated templates in vitro. J. Biol. Chem. 268: 21754-21759. Li, J., Chen Z., Lu L., Bymes M. and Chang S. H. 1990. Sequence diversity in the 5' untranslated region of rabbit muscle phosphofructokinase mRNA. Biochem. Biophys. Res. Com. 170: 1056-1060. Li, L., Chambard J.-G, Karin M. and Olson E. N. 1992a. Fos and Jun repress transcriptional activation by myogenin and MyoD: the amino terminus of Jun can mediate repression. Genes Dev. 6: 676-689. 141 Li, L„ Heller-Harrison R., Czech M. and Olson E. N. 1992b. Cyclic AMP- dependent protein kinase inhibits the activity of myogenic helix-loop-helix preteins. Mol. Cell. Biol. 12: 4478-4485. Li, L., Zhou J., James G., Heller-Harrison R., Czech M. P. and Olson E. N. 1992c. FGF inactivates myogenic helix-loop-helix proteins through phosphorylation of a conserved protein kinase C site in their DNA-binding domains. Cell 71: 1181-1194. Li, J., Zhu X., Byrnes M., Nelson J. W. and Chang S. H. 1993. Site-directed mutagenesis of rabbit muscle phosphofructokinase cDNA. J. Biol. Chem. 268: 24599-24606. Li, Z. and Paulin D. 1993. Different factors interact with myoblast-specific and myotube-specific enhancer regions of the human desmin gene. J. Biol. Chem. 268: 10403-10415. Li, H. and Capetanaki Y. 1993. Regulation of the mouse desmin gene: transactivated by MyoD, myogenin, MRF4 and MyfS. Nucl. Acids Res. 21: 335-343. Lilly, B., Galewsky S., Firulli A. B., Schulz R. A. and Olson E. N. 1994. A MADS box transcription factor expressed in differentiating mesoderm and muscle cell lineages during Drosophila embryogenesis. Proc. Natl. Acad. Sci. USA 91: 5662-5666. Lin, H., Yutzey K. E. and Konieczny S. F. 1991. Muscle-specific expression of the troponin I gene requires interactions between helix-loop-helix muscle regulatory factors and ubiquitous transcription factors. Mol. Cell. Biol. 11: 267-280. Ma, P. C. M., Rould M. A., Weintraub H. and Pabo C. O. 1994. Crystal structure of MyoD bHLH domain-DNA complex: Perspectives on DNA recognition and implications for transcriptional activation. Cell 77: 451-459. M adeod, D., J. C., M ullins J. and Bird A. P. 1994. Spl sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island. Genes Dev. 8:2282-2292. Mak, K.-L., To R. Q., Kong Y. and Konieczny S. F. 1992. The MRF4 activation domain is required to induce muscle-specific gene expression. Mol. Cell. Biol. 12: 4334-4346. Mar, H. H. and Ordahl C. P. 1988. A conserved CATTCCT motif is required for skeletal muscle-specific activity of the cardiac troponin T gene promoter. Proc. Natl. Acad. Sci. USA 85: 6404-6408. 142 Mar, J. H. and Ordahl C. P. 1990. M-CAT binding factor, a novel trans-acting factor governing muscle-specific transcription. Mol. Cell. Biol. 10: 4271-4283. Martin, J. F., Li L. and Olson E. N. 1992. Repression of myogenin function by TGF-p is targeted at the basic helix-loop-helix motif and is independent of E2A products. J. Biol. Chem. 267: 10956-10960. Martin, J. F., Schwarz J. J. and Olson E. N. 1993. Myocyte enhancer factor (MEF) 2C: A tissue-restricted member of the MEF-2 family of transcription factors. Proc. Natl. Acad. Sd. USA 90: 5282-5286. Martin, J. F., Miano J. M., Hustad C. M., Copeland N. G., Jenkins N. A. and Olson E. N. 1994. A mef2 gene that generates a muscle-specific isoform via alternative mRNA splicing. Mol. Cell. Biol. 14: 1647-1656. Martinez, E., Chiang C.-M., Ge H. and Roeder R. G. 1994. TATA-binding protein-associated factors(s) in TFIID function through the initiator to direct basal transcription from a TATA-less class II promoter. EMBO J. 13: 3115- 3126. Maxam, A. M. and Gilbert W. 1980. Sequencing end-labeled DNA with base- specific chemical cleavages. Meth. Enzym. 65: 499-560. McDermott, J. C., Carduso M. C., Yu Y. T., Andres V., Leifer D., Krainc D., Lipton S. A. and Nadal-Ginard B. 1993. hMEF2C gene encodes skeletal muscle- and brain-specific transcription factors. Mol. Cell. Biol. 13: 2564- 2577. Meehan, R. R., Lewis J. D., McKay S., Kleiner E. L. and Bird A. P. 1989. Identification of a mammalian protein that binds specifically to DNA containing methylated CpGs. Cell 58: 499-507. Mendel, D. B., Hansen L. P., Graves M. K., Conley P. B. and Crabtree G. R. 1991. HHF-la and HNF-lb (vHNF-1) share dimerization and homeo domains, but not activation domains, and form heterodimers in vitro. Genes Dev. 5: 1042-1056. Miner, J. H. and Wold B. 1990. Herculin, a fourth member of the MyoD family of myogenic regulatory genes. Proc. Natl. Acad. Sci. USA 87: 1089- 1093. Mueller, P. R. and Wold B. 1989. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science 246: 780-785. 143 Mueller, C. R., Marie P. and Schibler U. 1990. DBP, a liver-enriched transcriptional activator, is expressed late in ontogeny and its tissue specificity is determined posttranscriptionally. Cell 61: 279-291. Murre, C., McCaw P. S. and Baltimore D. 1989a. A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell 56: 777-783. Murre, C., McCaw P. S., Vaessin H., Caudy M., Jan L. Y., Jan Y. N., Cabrera C. V., Lassar A. B., W eintraub H. and Baltimore D. 1989b. Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 58: 537-544. Murre, C. and Baltimore D. 1992. In Transcription regulation. 861-879. Cold Spring Harbor Laboratory Press. Nabeshima, Y., Hanaoka K., Hayasaka M., Esumi E., Li S., Nonaka I. and Nabeshima Y. 1993. Myogenin gene disruption results in perinatal lethality because of severe muscle defect. Nature (London) 364: 532-535. Nakatsuji, Y., Hidaka K., Tsujino S., Yamamoto Y., Mukai T., Yanagihari T„ Kishimoto T. and Sakoda S. 1992. A single MEF-2 site is a major positive regulatory element required for transcription of the muscle-specific subunit of the human phosphoglycerate mutase gene in skeletal and cardiac muscle cells. Mol. Cell. Biol. 12: 4384-4390. Nakajima, H., Noguchi T., Yamasaki T., Kono N., Tanaka T. and Tarui S. 1987. Cloning of human muscle phosphofructokinase cDNA. FEBS Lett. 223: 113-116. Nakajima, H., Kono N., Yamasaki T., Hamaguchi T., Hotta K., Juwajima M., Noguchi T., Tanaka T. and Tarui S. 1990a. Tissue specificity in expression and alternative RNA splicing of human phosphofructokinase-M and ~L genes. Biochem. Biophys. Res. Com. 173: 1317-1321. Nakajima, H,, Kono N., Tomoyuki, Hotta K., Kamachi M., Kuwajima M., Noguchi T., Tanaka T. and Tarui S. 1990b. Genetic Defect in muscle phosphofructokinase deficiency. J. Biol. Chem. 265: 9392-9395. Nakajima, H., Yamasaki T., Noguchi T., Tanaka T., Kono N. and Tarui S. 1990c. Evidence for alternative RNA splicing and possible alternate promoters in the human muscle phosphofructokinase gene at the 5' untranslated region. Biochem. Biophys. Res. Com. 166: 637-641. Nakajima, H., Noguchi T., Hamaguchi T., Tomita K., Hanafusa T., Kono N., Tanaka T., Kuwajima M. and Matsuzawa Y. 1994. Expression of mouse 144 phosphofructokinase-M gene alternative transcripts: evidence for the conserved two-promoter system. Biochem. J. 303: 449-453. Neumann, J. R., Morency C A. and Russian K. O. 1987. A novel rapid assay for chloramphenicol acetyltransferase gene expression. BioTech. 5: 444-447. Nguyen, H. T., Bodmer R., Abmayr S. M., McDermott J. C. and Spoerel N. A. 1994. D-mef2: a Drosophila mesoderm-specific MADS box-containing gene with a biphasic expression profile during embryogenesis. Proc. Natl. Acad. Sd. USA 91: 7520-7524. Nikovits, W. Jr., Kuncio G. and Ordahi C. P. 1986. The chicken fast skeletal troponin I gene: exon organization and sequence. Nud. Adds Res. 14: 3377- 3390. Ogata, T., M. W. J., Benezra R. and Noda M. 1993. Bone morphogenetic protein-2 transiently enhances expression of a gene, Id (inhibitor of Differentiation), encoding a helix-loop-helix molecule in osteoblast-like cells. Proc. Natl. Acad. Sd. USA 90: 9219-9222. Olson, E. N., Spizz G. and Tainsky M. A. 1987. The oncoger ic forms of N-ras or H-ras prevent skeletal myoblast differentiation. Mol. Cell. Biol. 7: 2104- 2111. Olson, E. N. and Klein W. H. 1994. bHLH factors in muscle development: dead lines and commitments, what to leave in and what to leave out. Genes Dev. 8: 1-8. Ooij, C., Snyder R. C., Paeper B. W. and Duester G. 1992. Temporal expression of the human alcohol dehydrogenase gene family during liver development correlates with differential promoter activation by hepatocyte nuclear factors 1, CCAAT/enhancer-binding protein a, liver activator protein, and D-element-binding protein. Mol. Cell. Biol. 12: 3023-3031. Parmacek, M. S., Vora A. J., Shen T., Barr E., Jung F. and Leiden J. M. 1992. Identification and characterization of a cardiac-specific transcriptional regulatory element in the slow/cardiac troponin C gene. Mol. Cell. Biol. 12: 1967-1976. Passonneau, J. V. and Lowry O, H. 1963. Phosphofructokinase and the control of the dtric acid cycle. Biochem. Biophys. Res. Com. 13: 372-379. Piette, J., Besserau J.-L., Huchet M. and Changeux J.-P. 1990. Two adjacent MyoDl-binding sites regulate expression of the acethylcholine receptor a- subunit gene. Nature (London) 345: 353-355. 145 Pilkis, S. J. and El-Maghrabi M. R. 1988. Hormonal regulation of hepatic gluconeogenesis and glycolysis. Ann. Rev. Biochem. 57: 755-783. Pollock, R. and Treisman R. 1991. Human SRF-related proteins: DNA- binding properties and potential regulatory targets. Genes Dev. 5: 2327-2341. Poorman, R. A., Randolph A., Kemp R. G. and Heinrikson R. L. 1984. Evolution of phosphofructokinase — gene duplication and creation of new effector sites. Nature (London) 309: 467-469. Prendergast, G. C and Ziff E. B. 1991. Methylation-sensitive sequence-specific DNA binding by the c-myc basic region. Science 251: 186-189. Prody, C. A. and Merlie J. P. 1992. The S'-flanking region of the mouse muscle nicotinic acetylcholine receptor b subunit gene promotes expression in cultured muscle cells and is activated by MRF4, myogenin and MyoD. Nucl. Adds Res. 20: 2367-2372. Prussak, C. E„ Almazan M. T. and Tseng B. Y. 1989. Mouse primase p49 subunit molecular cloning indicates conserved and divergent regions. ]. Biol. Chem. 264: 4957-4963. Rhodes, S. J. and Konieczny S. F. 1989. A new member of the muscle regulatory gene family. Genes Dev. 3: 2050-2061. Rhodes, K., Rippe R. A., Umezawa A., Nehls M., Brenner D. A. and M. B. 1994. DNA methylation represses the murine al (I) collagen promoter by an indirect mechanism. Mol. Cell. Biol. 14: 5950-5960. Rongnoparut, P., Verdon C. P., Gehnrich S. C. and Sul H. S. 1991. Isolation and characterization of the transcriptionally regulated mouse liver (B-type) phosphofructokinase gene and its promoter. J. Biol. Chem. 266: 8086-8091. Roy, A. L., M eisteremst M., Pognonec P. and Roeder R. G. 1991. Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature (London) 354: 245-248. Roy, A. L., Malik S., Meisteremst M. and Roeder R. G. 1993a. An alternative pathway for transcription initiation involving TFII-I. Nature (London) 365: 355-359. Roy, A. L., Carruthers C., Gutjahr T. and Roeder R. G. 1993b. Direct role for Myc in transcription initiation mediated by interactions with TFII-I. Nature (London) 365:359-361. 146 Rudnicki, M. A., Braun T., Hinuma S. and Jaenisch R. 1992. Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH gene Myf5 and results in apparently normal muscle development Cell 71: 383-390. Rudnicki, M. A., Schnegelsberg P. N. j.. Stead R. H., Braun T., Arnold H. H. and Jaenisch R. 1993. MyoD or Myf-5 is required for the formation of skeletal muscle. Cell 75: 1351-1359. Sambrock, J., Fritsch E. F. and Maniatis T. 1989. In Molecular cloning: a laboratory manual. Cold Spring Harbor Press. Sartorelli, V. Kv W ebster K. A. and Kedes L. 1990. Muscle-specific expression of the cardiac a-actin gene requires MyoDl, CArG-box binding factor, and S p l. G enes Dev. 4: 1811-1822. Schirmer, T. and Evans P. R. 1990. Structural basis of the allosteric behavior of phosphofructokinase. Nature (London) 343: 140-145. Schneider, J. W., Gu W., Zhu L., Mahdavi V. and Nadal-Ginard B. 1994. Reversal of terminal differentiation mediated by p i07 in RB -/- muscle cells. Science 264: 1467. Schwarz, J. J., Chakraborty T., Martin J., Zhou J. and Olson E. N. 1992. The basic region of myogenin cooperates with two transcription activation domains to induce muscle-specific transcription. Mol. C 41. Biol. 12: 266-275. Seto, E., Shi Y. and Shenk T. 1991. YY1 is an initiator sequence-binding protein that directs and activates transcription in vitro. Nature (London) 354: 241-245. Sharma, P. M., Reddy G. R., Babior B. M. and McLachlan A. 1990. Alternative splicing of the transcript encoding the human muscle isoenzyme of phosphofructokinase. J. Biol. Chem. 265: 9006-9010. Shimizu, N., Prior G., Umeda P. K. and Zak R. 1992a. Cis-acting elements responsible for muscle-specific expression of the myosin heavy chain b gene. Nucl. Adds Res. 20: 1793-1799. Shimizu, N., Dizon E. and Zak R. 1992b. Both muscle-specific and ubiquitous nuclear factors are required for muscle-sperific expression of the myosin heavy-chain beta gene in cultured cells. Mol. Cell. Biol. 12: 619-630. Simpson, C. J. and Fothergill-Gilmore L. A. 1991. Isolation and sequence of a cDNA encoding human platelet phosphofructokinase. Biochem. Biophys. Res. Com. 180: 197-203. 147 Smale, S. and Baltimore D. 1989. The "initiator" as a transcription control element. Cell 57:103-113. Smith, D. B. and Johnson K. S. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67: 31-40. Stewart, A. F. R., Larkin S. B., Farrance 1. K., Mar J. H., Hall D. E. and Ordahl P. C. 1994. Muscle-enriched TEF-1 isoforms bind M-CAT elements from muscle-specific promoters and differentially activate transcription. J. Biol. Chem. 269: 3147-3150. Su, H., Bos T. J., Monteclaro F. S. and Vogt P. K. 1991. Jun inhibits myogenic differentiation. Oncogene 6: 1759-1766. Sun, X.-H., Copeland N. G., Jenkins N. A. and Baltimore D. 1991. Id proteins, Idl and Id2, selectively inhibit DNA binding by one class of helix-loop-helix proteins. Mol. Cell. Biol. 11: 5603-5611. Tapscott, S. K., Davis R. L., Thayer M. J., Cheng P.-F., W eintraub H. and Lassar A. B. 1988. MyoDl: A nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts. Science 242: 405-411. Tapscott, S. J., Lassar A. B. and Weintraub H. 1992. A novel myoblast enhancer element mediates myoD transcription. Mol. Cell. Biol. 12: 4994- 5003. Tejwani, G. A. 1978. The role of phosphofructokinase in the Pasteur effect. Trends. Biochem. Sci. 3: 30-33. Thayer, M. J., Tapscott S. J., Davis R. L., Wright W. E., Lassar A. B. and W eintraub H. 1989. Positive autoregulation of the myogenic determination gene M yoD l. Cell 56: 241-248. Thompson, W. R., Nadal-Ginard B. and Mahdavi V. 1991. A myoDl- independent muscle-specific enhancer controls the expression of the [}- myosin heavy chain gene in skeletal and cardiac muscle cells. J. Biol. Chem. 266: 22678-22688. Thrasher, J. R., Cooper M. D. and Dunaway G. A. 1981. Developmental changes in heart and muscle phosphofructokinase isozymes. J. Biol. Chem. 256: 7844-7848. Trask, R. V., Roster J. C., Ritchie M. E. and Billadello J. J. 1992. The human M creatine kinase gene enhancer contains multiple functional interacting domains. Nucl. Acids Res. 20: 2313-2320. 148 Tsai, M. Y. and Kemp R. G. 1974. Rabbit brain phosphofructokinase. Comparison of regulatory properties with those phosphofructokinase isozymes. J. Biol. Chem. 249: 6590-6596. Tsai, M. Y., Gonzalez F. and Kemp R. G. 1975. In Isozymes. 819-835. New York Academic Press Ullrich, A., Goeddel D. V. and Dull T. J. 1982. Nucleotide sequence of a protein of human chromosome 9 containing a leukocyte interferon gene cluster. J. Mol. Biol. 156: 467-486. Uyeda, K. 1979. Phosphofructokinase. In Advances in enzymology, Meister A. Ed. 48: 193-244. John Wiley and Sons, New York. Valdez, B. C., French B. A., Younathan E. S. and Chang S. H. 1989. Site- directed mutagenesis in Bacillus stearothermophilus fructose-6-phosphate 1-kinase. J. Biol. Chem. 264: 131-135. Venuti, J. M., Goldberg L., Chakraborty T., N. O. E. and Klein W. H. 1991. A myogenic factor from sea urchin embryos capable of programming muscle differentiation in mammalian cells. Proc. Natl. Acad. Sci. USA 88: 62196223. Vora, S. 1982. Isozymes: isozymes of phosphofructokinase. Curr. Top. Biol. Med. Res. 6: 119-167. Vora, S., Giger U., Turchen S. and Harvey J. W. 1985. Characterization of the enzymatic lesion in inherited phosphofructokinase deficiency in the dog: An animal analogue of human glycogen storage disease type VII. Proc. Natl. Acad. Sd. USA 82: 8109-8113. Voronova, A. and Baltimore D. 1990. Mutations that disrupt DNA binding and dimer formation in the E47 helix-loop-helix protein map to distinct domains. Proc. Natl. Acad. Sd. USA 87: 4722-4726. Walsh, K. and Schimmel P. 1988. DNA-binding site for two skeletal actin promoter factors is important for expression in muscle cells. Mol, Cell. Biol. 8: 1800-1802. Webster, K. A., Muscat G. E. O. and Kedes L. 1988. Adenovirus El A products suppress myogenic differentiation and inhibit transcription form muscle- specific promoters. Nature (London) 332: 553-557. W eintraub, H. 1984. Histone-H 1-dependent chromatin super-structures and the suppression of gene activity. Cell 38: 17-27. 149 Weintraub, H., Davis R„ Lockshon D. and Lassar A. 1990. MyoD binds cooperatively to two sites in a target enhancer sequence: occupancy of two sites is required for activation. Proc. Natl. Acad. Sci. USA 87: 5623-5627. Weintraub, H., Davis R., Tapscott S. Thayer M. Krause M., Benezra R., Blackwell T. K., Turner D., Rupp R., Hollenberg S., Zhuang Y. and Lassar A. 1991a. The myoD gene family: nodal point during specification of the muscle cell lineage. Science 251: 761766. W eintraub, H., Dwarki V. J., Verma I., Davis R., Hollenberg S., Snider L., Lassar A. and Tapscott S. J. 1991b. Muscle-specific transcriptional activation by MyoD. Genes Dev. 5:1377-1386. Weintraub, H., Hauschka S. and Tapscott S. J. 1991c. The MCK enhancer contains a p53 responsive element. Proc. Natl. Acad. Sci. USA 88: 4570-4571. Wentworth, B. M., Donoghue M„ Engert J. C , Berglund E. B. and Rosenthal N. 1991. Paired MyoD binding sites regulate myosin light chain gene expression. Proc. Natl. Acad. Sci. USA 88: 1242-1246. Whyte, P., Buchkovich K. J., Horowitz J. M., Friend S. H., Raybuck M., Weinberg R. A. and Harlow E. 1988. Association between an oncogene and an anti-oncogene: The adenovirus El A proteins bind to the retinoblastoma gene product. Nature (London) 334: 124-129. Wills, K. N. and Mansour T. E. 1990. Changes in phosphofructokinase isozymes during development of myoblasts U myotubes. Arch. Biochem. Biophys. 278: 81-87. Winter, B., Braun T. and Arnold H. H. 1993. cAMP-dependent protein kinase represses myogenic differentiation and the activity of the muscle- spedfic helix-loop-helix transcription factors Myf5 and MyoD. J. Biol. Chem. 13: 9869-9878. Wright, W. E., Sassoon D. A. and Lin V. K. 1989. Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell 56: 607- 617. Xiao, S. H. 1995. Six mRNAs of the rabbit muscle phosphofructokinase gene. Ph.D. thesis, Louisiana State University, Baton Rouge, LA. Yaffe, D. and Saxel O. 1977. A myogenic cell line with altered serum requirements for differentiation. Differentiation 7: 159-166. Yamada, Y., Kono N., Nakajima H., Shimizu T., Kuwajima M. and Tarui S. 1991. Low glucose-1,6-bisphosphate and high fructose-2,6-bisphosphate 150 concentrations in muscles of patients with glycogenosis types VII and V. Biochem. Biophys. Res. Com. 176: 7-10. Yamasaki, T., Nakajima H., Kono N„ Hotta K„ Yamada K., Imai E., Kuwajima M., Noguchi T., Tanaka T. and Tarui S. 1991. Structure of the entire human muscle phosphofructokinase-encoding gene: a two-promoter system. Gene 277-282. Yisraeli, J. and Szyf M. 1984. In DNA methylation: Biochemistry and biological significance. Springer. Yu, Y.-T., Breitbart R. E., Smoot L. B., Lee Y., Mahdavi V. and Nadal-Ginard B. 1992. Human myocyte-specific enhancer factor 2 (MEF2) comprised a group of tissue restricted MADS box transcription factors. Genes Dev. 6: 1783-1798. Yutzey, K. E,, Rhodes S. J. and Konieczny S. F. 1990. Differential trans activation associated with the muscle regulatory factors MyoDl, myogenin, and MRF4. Mol. Cell. Biol. 10: 3934-3944. Zhu, L., van den Heuvel S., Helin K., Fattaey A., Ewan M., Livingston D., Dyson N. and Harlow E. 1993. Inhibition of cell proliferation by pl07, a relative of the retinoblastoma protein. Genes Dev. 7: 1111-1125. APPENDIX A RESTRICTION ENDONUCLEASE DIGESTION MAP OF THE 3 KB S’-FLANKING SEQUENCE OF THE RM-PFK GENE 151 ]f>2 S e r f I" EcoR II BatN I S p i I Baa J I Fn u 4 H B aa J I Mn 1 I B a tU I Mae H I ri* r S p i I A lu I Ode I H ha I " Hpn i S a u 9 6 I i 11 I I I t I I I GTACCCAGGGCGAGAGCCGGGAGAAGCTGGGACTGAGGCCAGCGCGGCTTCGGTGACCAGGC - 2 7 2 1 catcgctcccgctctcgcccctcttcgaccctgactccgctcgcgccgaagccactcgtccc i • n I - I I I IIII I I I ‘- If - 2 7 B 2 -2767 -2758 -27SO -2 7 4 1 -2 7 3 1 - 2 7 2 3 -2 7 7 9 -2740 -2 740 -2 722 - 2 7 7 0 - 2 7 3 9 - 2 7 7 0 - 2 7 3 9 - 2 7 7 8 - 2 7 7 8 H a i I I I Hha Sc rF I " G d i I I B itU s c r F I- A lw N I Eat* 1 S p i I N c i I P f IM 1 Mn ]. I T n u 4 H I Hpa II Sdu9S I EcoR II l a c I T ; i I H ac I I I Baa JI Kae III BatN I S p i I S p i I spi i Hha 1’ S a u 9 6 I Ben I Mn 1 I fl&L—I F n a 4 H 1 s p i I H i n t I K ac 11 N la IV I <1 II II I I I I i I I I I I I I I I 1 I ccggggctgggaggcccacagcctggagggcggccgtgcggggcgggccgaatctatagagcgccacagacgcggccccc - 2 6 4 1 GGCCCCCACCCTCCGGGTCTCGGACCTCCCGCCGGCACGCCCCGCCCGCCTTAGATATC‘TCGC.GGTGTGTGCCCCCGGCG I I I II I I I I I I I I I ■ I I I I I I I ■ 2 7 2 0 - 2 7 10 - 2 7 0 0 - 2 6 9 1 - 2 6 7 8 -2 6 7 1 -2 66. ■ 2 6 4 B 2 7 2 0 - 2 7 0 6 2 6 9 9 - 2 6 9 1 -2 68 j -2 67 4 - 2 6 6 0 - 2 6 4 7 -2 7 2 0 • 2 7 0 0 - 2 6 9 9 - 2 69 0 -2 6 7 1 -2 64 6 2 7 2 0 -2105 -2695 2 64 5 -2 7 20 -2704 -2690 -2 6 4 4 -2699 -269C ■ 2 6 4 3 2 680 - 3 > 4 ; St:rF I" Me i 1 H pa I I 3 c n I H as I I I cd i : i Ea-.j 1 E a e I S a u 9 6 7 Spi 1 N l a IV F n u 4 H I H ae : i; Ava II BstU I Hat1 I PpuM I Spi I Spi I N l a IV F n u 4 H I S a c I t EcoOl0 9 I Mn1 i Mn1 1 NspB 11 2d ._ Mnll Spit H g a I S pl I B s a J I ipi ill III I I II Ml GCAGAGCGACCCCCGCCGCCTC t'CCCCTTGCCTCGCACCGCCTCTATCCGCGGCCC.CGTTTG . i VJ'J ... 4^. — ^ U 6 . CGTCTCCCTGGGGGCGGCGGAGAGGGGAACGCAGCGTGCCCGAGATACCCCCCGGCCCAAAC" SCCCTCCC '■ c r, a c g c T G I I I I II I • I Mill I - 2 6 3 7 - 2 6 2 8 -261 1 -2603 ■ 2 3 9 3 2 5 7 8 - 3 5 7 i - 2 5 6 2 -2 635 - 2622 2 t.00 -2 5 7 3 : 5 7 ■! - 2 6 3 5 - 2 62 6 -3593 - 2 5 7 2 - 2 6 3 5 -2 62 5 - 2 5 9 3 - 2 5 6 -26.34 - 2 5 9 2 -2 634 ■2591 - 2 5 60 - 2 6 3 4 - 2 5 9 i 2 59 0 -2590 2 590 - 2 5 8 3 -254 - 2 3 H ' ■■2501 --2 58" 15} Saa96 I Has H I Sau96 1 N la IV Bjpiias Ban 11 S c r F I" N c i I Hpa II Ben I Sma T S crF 1 ” He i I Fnu4H I B ia JI N ia I I I Bbv I Ben 1 Hha I" Hpa II Ava I Bar I S p i I F ip I B*mA I C f r lO I BipM I Apa I Kga I BspM I NspH I" Baa I I I I I II II I I I III II II GrCGCCCCCCACCGGCAGCCAAACCTGCCCCGGCCCACTGCGTCCGCACCTGCGCACATGCGTGGCTCTCTGTTCACACG - 2 * 9 1 rACC.GCGGGGTGGCCCTCGCTTTGCACGGGCCC GGGTCACGCAGGCGTGGACGCGTGTACGCACCCAGAGACAAGTGTCC I I I I II I I I I I !M i i • n - 2 5 5 0 •2 5 38 -2 5 3 0 2521 -2513 -2 5 OS -24 96 - 2 5 4 9 -2533 -2526 -2517 -2510 -2495 - 2 5 4 6 2 5 3 3 - 2 5 0 9 - 2 5 4 6 - 2 5 3 3 - 2 5 0 4 - 2 5 3 3 - 2 53 3 - 2 5 3 3 25 32 - 2 5 3 2 ■253? -75 32 ■ ? 3 3 0 -2 5 30 2 5 30 7 5 JO ■ 2' 12 1 - 2 3 2 9 N la I I I Hpa I I Sa u 9 6 I crtio : H ae I I I SauAC / A a e I Ga.iSH I A v a I I 5 a u 96 I Nla IV Ppum r NI a Ava II n 1 j : i; 0 s p . 7 6 6 E c o O 10 9 1 NspH Nla IV 8 5. a I ■■ B an II NJ a I I I Alw N J S p i I S p i I F s p I A pa I I I I I I I I III II I I I 1 I CAlCGArrcCAGGACCrGTGTTTATCCGCATCTG'lGi IGTTGCGCGACCGGT TGTGTGCCCATCAG1 GCI 3GTGCGCCC - 24; GIACCTAACGTCCTGGACACAAATAGGCGTACACACCCAACGCCCTGGCCACACACACGCGtACTCACC 2CACCCGGG I I I I III- III1 I I -24 80 - 2 4 1 1 -2 4 5 5 2 4 40 -2 42 4 - 2 4 5 6 - 2 4 70 - 2 45 3 -2 4 38 - 2 4 2 3 - 2 4 0 6 - 2 4 70 -2 4 52 -2 4 J 7 - 2 4 . - 2 4 0 6 - 2 4 6 9 -2 4 3 3 - 2 4 C 6 - 2 4 69 -2 4 3 5 - 7 4 0 6 - 2 4 3 5 - 2 4 3 4 - 2 4 I 5 -24; H ae I I Mae I St I Frill; Hae I FislrJ ( B sa a I Mn 1 I Mn 1 5 t AN A l l I I I Dde I P s: Hqa I I ; i i ! HI ATCTGTGTCCTCOTO rGTCCATCGCTATI A'TA.iI ACCTGC 1CTCACGCCTTC ACT'. G TC n AC AC.VCAGGAGC AC AC ACGTAGCGATAi ~ni g’gcac;/ c a j t :: t c j a a c : c A c :: _ a g a c g tc AGa g a a gc a c o CAG • i i i , -1 -2 197 -2 382 -2 3 69 -I \ 60 -2339 - 2 J 21 2 368 -2 J53 -2 J 3 2 368 -2lbl -2122 -2 3 6 7 -2 3 5? -2 356 154 Alu I Foi r Sac T Spi 1 HqiA I BstU I Bipl286 I Spi 1 Ban II Sac II Hpa II NspB II SLy I BipM II Kaa I Hnl I Bia JI Mnl I Bsa JI Mil I I I I I I I I CGAAATCCCCTCCCGACCTCCTTGCTAGGATTTCTCCTCCGTGAGAACGCTGGGCTTtCCCGGATtACCTCCTCTCCTTG -2 2 4 1 GCTTTACGGCACGCCTCGAGGAACGATCCTAAAGAGGAGGCACTCTTGCGACCCGAAGGCGCCTACTGCAGGACAGCAAC II II - I * I - ■ 111*1 I I -2310 -2296 -2295 -2263 -2253 -2245 -2309 -2263 -2245 -2306 - 2263 -2306 -2263 -2306 -2262 -2306 -2261 *2305 2259 S au 96 I 5 c r r r** N e t I Hpa I1 Baa J I Ben I H ae I I I Mbe II Sau96 I Ava II SfaN I Nla IV Mnl I Mnl i Nla IV N ' a IV Hpn I I I I I I 1 ] I I I ; GGACAGGAACCTTGTGATTTTCCTCCAGCAATGAGGAGAAGAAACGGGGCCGGCGCGICC GAGTCCTGAGATGCCTTGCT -2161 CCTGTCClTGGAACACTAAAAGGAGGTCGTTACTCCTCTTCTTTGCCCCCGCCCiICCAGGi:I • * I - I I III I * 'I • ICAGCACTGTACGGAACGA I I - -2235 - 221 9 2208 -2i95 -2i36 -2M6 ■ 2203 2 i 94 -2'85 -2.71 - 2 1 9 3 - 2 1 -} I -2 I 9 i -7\H\ -2 191 7 191 2 ;flb T t h l ] 1 I I ?.LV T BscU I V- '-L L ) 1 I ; Mfsl 1 Mai I M e i Hh? I 1 Mde I 1 * I I | I | | i i CCTCCCTGTTTCCTCCAAGTCCTCCCACTTAGCTTCTGCGCGTTCTCTCTCCCT1 TCTCGTTTCTCACTC TCCTTCCTTC -20Q 1 gcagggacaaaccaggttcaggaggctgaatcgaacacgcgcaagagacacggaaacaccaaacagtcac ^ c c a a c g a a g i i i i i n * ' i i -2 160 ’ 2110 7 1 3 1 - 2 1 2 3 2 0 9 ^ -2 1 5 1 - 2 l 30 “ 2 1 22 -2090 Mn i : Hae . I I S c u I ride I ScrF EcoR T Dde I 9s:N f 0 s rriA, I Es TTGCTACTTGCATTGGCACTTTCTGTGG'iTATTTATTGCGCTGTAATGTGCiwAACrtCC TCGCCAGC TT7ACTAOCCC TG - : 92 1 AACCATGAACGTAACCGTGAAACACAG CAAT AAATAACCOGAC ATT AC ACCOTT'- 7 GGACCGGT 7 GA A AC T:_ A TCGCGAG j i l 9 ^ 4 : 9 J 1 - 9 2 I Pie I EcoN I Hi* III 9sc I Alu I Hae I Hinf ) Mui I I I I I I I I CGTCATCGGWiTCATCTGTCCAGTGGTGGCCAACCTCCTGCGAAAGGCC ACAGAGTCAAGTCTGTGACCCTTTGTGGGGT -184 1 GCAGTAGCCCCAGTAGACAGGTCACCACCCGTTCGAGGACGCTTTCCGCTGTCTC. AGTTCACACACTCCGAAACACCCCA * I ■ • I I ■ I I - ! - I * -1901 -19SB -1876 -18 68 -1855 -1888 -1815 -1 8 6 8 N l a T i l F n u 4 H [ Spi L Bbv I Tfi I S a n 3A 7 R a a I Fnu«H I Hha I" Hi/if I Mnl I Fok I I I II I I I I I l GGACGATCTCTTGCCGAGTACCTGTTCTGCCGCCGTAGCACAGCGCAGCCATGAATCCTGTGTGAATGGAGGTGTAACGA - 1 7 61 CCTGCTAGAGAACGGCTCATGGACAAG ACGGCGGCATCGTGTCGC GTCGGT ACTT AGGACACACTTACCTCCACATTCCT I . ( I)' ‘ I I I - I * t • I -1636 -18? 3 -18 7 2 -1 7 98 -1188 -HH 1163 -18)1. -1196 -1188 - 1 196 - I 191 Tfi I Hpa II BsmA I Hph 1 Alu I Mnl I Mnl I FnulH L 3*a I Hinf T Mnl I Mbo II Mae III BspM II Mae II Bbu I i l l l I I I I i I I I I I TGGTCTC TGAATCTGAATTTCCTCTGT TCTTC ACCTGTCACAGCTCTCCGGAGC T ATA/iAACOTGaG AGCGGC AGCCTGC -168 1 aCCAGAGACTTAGACTTAAAGGAGACAAGAAGTGGAIAGTGlCGAGAGGCCTCCATATTr‘TCCACTCT'_rCCCTCCGACG ■ I I I • I I I I ‘ I I I I I I i -1159 -1152 -1140 113J IV2 4 -1114 -1100 -168 5 -1758 -1130 ■17 19 -1710 .694 -1685 - i ! 5 2 - 1 7 1 3 M ae I n fli- I Xnn I r. Jli ' Mae 1 ' I I ’ i I TGA( CCCGAATCTACrTCC AAACCC I TC’i TAG rt-f.A FAAGA mGCAGT TCAAGTCGG a c a c '.AGG 1AFTAGGYGAG FGCTAA - 1 6 0 : ACTGGCGGTT AGATCAGGT''1 1GGAAG AA FCACG FATI CTTC G K AAGTT' a GC.CI'GT g TTO'. A'I AA.TCCACTCACr ATT ■ I I * I ■ ■ • I -1669 -1654 -1642 -1612 -1634 H ae I I I l a e I Icrf l " Sail 54 I L'cnH I I Nla IV BsvN I A va T I Elsa J I tls.ril. 1 I I I I I I CTGTGTGGTCCCGTTGAA 7GT ATG.TCA01G33 GCVTFCCCACGCOAACAGGTG"GTCTCCACCAGTGGGTGGCGGTCTGT -15 2 1 GACACAC CACGGCAACTT AC A TAC AC. TO AC A At V AAAGGGTGCGGTTCl CCACAC.AGAGG TCGTC ACCCACGCGt AC A0 A I ■ - II U I - 1 594 - 1 563 - i 5 4 6 - 1 5 94 - 1 5 5 2 -1594 -1562 -1 5 62 - 1 5 6 0 - 1 4 6 9 N l a IV S c r F I " fclroR I I Hha 1 1 BSLN 1 NLa IV Elsa j J Ha: 1" Bsa JI Hae j j 5aij 9 6 I 0 a n I Mn . 1 Hae III Aha 1 [ Gpl I 1 I I I I II III GCSAAGC.CCCACGG AGCC TT C VGG ATAAG AG •TC.V.f.GcGCi' 3 I. C AAC A TGI ACOC.T7 ASAGCGGCmCGaC. A G JI ;.GAA •. 1 7 1 CGC1 rCCGGGTCCCTCGGAAGACf YATTl TC A' c : f ‘CTGC'~GAC-T,'TCTAC 3 T : 'i : A A .s n ,( v 2 . CT "1 VJCT::' A AC 27 | | i - i ■ • i ■ - 15 1 5 ’ 404 ’ 'i 4 I . 1 v - 1 5 1 5 - ’ 1 H <• ■ '.4-4 - 1 5 1 3 14 8 4 - 1 5 1 2 1 4 84 -1512 14;; 4 - 1 5 1 2 v i e i -1 6 1 2 - i s c e 156 N l* III SAu 3 A I Fn u 4 H I Alv I Mnl I Sau3A I Bbv I M i l I I GCCATACGACACGTCTGCATCATGGACCCTTTGCGAGCAACCCCAGCAGTTGAACTTGATCTGTCACTGCTGCTTCTGTG -1 3 6 1 CGGTATCCTGTCCAGACCTACTACCTCCGAAACGCTCCTTGGCCTCC.TCAACTTGAACTAGACAGTCACCACGAACACAC • M i l * - * I • I • -1424 -1416 -13B3 -1312 - 1 4 2 3 -1 372 -1120 Mm* 1 Horn I N la l i t Hi nG II BmmA I BminA I 8 *tX I III III TGGTGTCTGCGTGTTAACTGTGTCTCCTAATCCTATGTGTGTGTTGTGTGTCTCATTGCCATGTGTGTGGATTTGTGTGT - 1261 ACCACACACGCACAATTGACACAGAGGATTACGATACACACACAACACACAGAGTAACGGTACACACACCTAAACACACA • M * I ■ * M II* -1340 -1339 -1 31 1 -1 302 -1 3 4 a - 1 3 0 1 '13 4 3 A lv N J Mae I I I I Alu 1 Nla ITI Dde I Mae 1 N la 111 AlwN I N la 111 II III l I M I CAlGTGACCTGTATCTGAGrCAUTGCC'i'Gl. TT'.C.C' AGATGTGGC rGGAAGCATGAACTTCCGTGAGCTCCTGTTGATGT -12 3 1 C«T AC ACTCGACATAGAtTCGtiTC ACCGAi'TAACi".CATCTACAC‘i:CACCTTCGTAfT,’GAAGGCAC''CGAGGACAAGTACA I I I I I I ■ i • i I ■ i -1280 ■■ i 2 6 6 -1240 1229 -1216 -12C5 -1277 -12(51 -12:3 - 1 2 6 0 H ae 111 F n u 4 H 1 F nu4H I S faN I bail 9 6 i Mnl I Bbv 1 Hp1' I Bsr T Ava 1 Als--N ( Hria I" Alu 1 Mnl. 1 M ae H I A lu I LtoN I Bhv I Fsp l Mse 1 AlwN I III II I I I I I III II 111 l CiAGGTGATGCTGTAACTGGAAGCTCGGGCCTGAACCTTCC AGAGtlCTGC AC TCTGCCCAGTGGCTTAAGCTCCATATCAG -1121 CTCCACTACGACATTGACCTTCGAGCCCGGACTTGGAAOGTCTCCGACGTGACACGCCTCACCCAATVCGACGTATACTC I I I - I | I I II ■ I l-ll II * III* I -1200 -1189 1 180 ~U6h -115 6 ■114 1 -1136 -1123 -1198 -1186 -1 1 78 -1161 - 1 196 -Mil -119b -117b -Lib1) -1132 -1174 -.156 -1132 Mat? 1 S l y : a s a n Hq L A 1 FoX 1 r'ruHH ' Hs pl2S6 1 SfaN I Dde 1 8sl 1 Bbv I Tthill 1' Mae! nir 11 II I I l i I i i I AAACTGCATCCA1ATCTGAGTGCCAGTTTGAr.lTCTGGCTCCTCTGCTTGCAGTCCACTTTCCTGCTAGTGCTCCTAGGA -1311 TTTC.ACGTAGGTAVAGACTCACGGTCAAACTCAAGAt CCACGAGACGAACGTCACGTGAAAGGACCATCACCACGATCCT M I * I ’ ■■ I - ‘ I l - II -11.1b --1 10 5 -1098 -10C 3 ’3)6 -1355 104 7 - i l 1 4 - 1 08 3 - .0 5 2 - ; 0 52 ■ 1 3 4 1 1j 7 Sau96 I Nla IV Haa III 5au96 I Nla IV Mia ri Eco0109 I Piall Bspl286 I Mbo II Baa A1 Ban II S c r F I" f no4H I Bat X 1 Apa I E coR 11 BDv 1 SaulA I T thl 11 ri Ace I Kqa I BstN I t 1 1 III 1 1 1 1 1 1 AGGCAGCAGAAGATCGCCACCTCCrTGGGCCCCTACTGTGCGTCTGGTACACCTGACCCAA7TCCTCCCT7TCGC:G?7G ■ 961 tccgtcctcttctagcggtgcacgaacccccccatcacacccacaccatctggactgcgttaagcaccgaaaccgacaac * I 1*1 I II * I I I * ■ 1 * 1 * 1 10 38 -102 9 -1019 -9 9< -9*6 -97 7 1038 -102 4 -1014 -977 -1032 -1023 -1014 -977 -1023 -1014 -1022 -1014 -1 0 1 4 -1 0 1 4 -1 0 1 1 -1 0 1 3 -1 0 1 3 Fok I PC1M I Mnl T Bjl I Fcik > S p i ’ I I I I I TC.GAC ATCTCGGGACAGTCAACO AGTCGATGGATG ACCTCTCTG7TTCTC7CCTTC7CTC ATTCCCC <" OCCAA AGTCCr'r 88. f.rf v e t ;ACCCC7'C"rCAC7TCGTC ACCTACC T ACTGCACAGACAAACAGACGAAGAGACTA AGGCCCCGGT1 YCAGCO A • I I I I • ■ i * - 9 3 9 - 930 ■ 3 y - 5 3 9 -9 2 4 ■ 934 A lu I P v u 11 Bspl28 6 I NapB I I Ms* I Ban IT Bs;nA I Mbo Oral NialV tlsal Mas I 2 I BspMI Bjdv . f T II II II I i AAAT.\A«lf.AG rGTTn'TTAAAAAGAGAAAGACAGCAGCCH AGCACGGGACACC AGO 1G7T AC AGCC.'C LAGGTC.'C.O A 90 . 1, r." T rt 77 T A TT C A C A A A A A A 77T T TC TC TTTC TO 71.1 7 C CGC r e G TC:: C C T ;■ 7C 0 T C C AC A A TC T C C r 1 ■? Gl ..v: T C 7 II* • I • I • I I i ■ I • I 863 -94 5 -8 3 1 82 1 -8 .'. -8 0 2 -862 -944 -831 802 314 - 3 2 C - 8 2 6 - 8 2 5 6 p i I M n 1 I P s z I 0 il a I I I AG AC ACGCC^jTOOIiOmOli AGAAGu j AG - -j-1- ACTui - ^ O-j 1 1 . O j . r-^7 1 CTCTCCGCCACCCCCCCT'CTTCCCTCAACCCCTCCCOCCGTGACGTCCCCCACCACCCCAACCACCG'CAAAACCAACAI . . | - | - 7 <) 4 - 7 6 9 - 7 3 3 u c - 1 S.j c F I " F cR II Hpa I L 7; - 1 *. 1 1 r S c i I 6p i I BspM I BstN I B c.~ I : I I I I I I (»A1' n AG a A AGCGCGG A CC A AC ~ C A A A A A C ACC A G G 7 -J 7 T . G u C TOG T t G C C ■_ C GA ■'_* A ... T A l A-^ C . . A _ a -j , ,, . J ( tctcti tcccgcctcgt-cactttttgtcctccacaaacggaccaacgggcctctcactactcgcc rccv :goaaaa,:: Cl -he -68 0 - 6 7 2 -;9 6 - 6 7 7 - 6 9 C - 6 7 1 -68 0 -672 158 M ae I : A f i ; r ; HgiA I Fnu4H I Pmll BsfliA I Bbv I P i c 1 B»a AI a * p l 2 9 6 I B * p l2 8 6 X BimA I H in f I Mac I I I StaN I I II III III I GGGCACAGAAGTC'TCCTGTGCTCCTTTGGGAG ACAGCAGCAGCAGTCCCTGTGTCACGTGTGTGCGTCTGTGCATC7GTG -5 6 1 CCCGTGTCTTCAGAGGACACGAGGAAACCCTCTGTCGTCGTCCTCACGGACACAGTGCACAOACCCACACACGTAGACAC I I I 1*1-1 -III- - 1 -640 -62 3 -611 -598 -588 -569 -630 -605 -598 -586 -623 -605 -506 - 5 8 5 - 585 A lu I ScrF I" EcoR II 9 * cN E FnuAH I Ha* III Bbv I Mnl T Mnl I Sau96 I Mn1 I I I I I I I I I GCAGCCACCTGITCCTTTTCAt-ATTTAGTI'CTCTCG AGTGCGAGAGGC. AGOGGCACGAGGGTTCTGCGCCTGGACCTGCC -481 CGTGGCTGCACAACGAAAAGTGTAAATGAACAC ACGTCACGCTCTt-CGTCCCCGTCCTCCC AAGACCCGGACCICGACCC I ' • • I I - II I ■ I I -560 -517 -504 -495 -481 - 5 6 0 -494 -4 92 -4 92 -4 92 - 4 8 7 5 c r F’ 7- C coR i l UstN J H.41 J I F i t t Mn 1 r F) 5 4 *7 T F *' r T a q l 5 a j 1 5 l Mlpf ij '4 I j i V Hsu I Mn | ■ Ha#? i l l i Ban 1 I I I I I I I I I I I AGGTACAGGCAGCTCGAGGAATGCCCCAGGGCTTCCTGAGCC"! TTCAACAGTCTTGCCAGTGGTGCCTTCATAACCCCAA - 40 1 TCCATGTCCCTCCACCTCCTTACCGGCTCCCCAAGCACTCGGAAACTTCTCAGAACCGTCACCACGGAACTATTGGGCTT ■ I I - I I ■ I I I I I I I -498 - 4 'I 1 -45b 445 -<'35 - 4 l 9 -467 -4 5 6 4 X5 419 -4 6 5 -456 4 jt; - 4 5 b - 4 J2 -4 4 5 - 4 5 5 'V.5 t\ 1 .■ T f i I F n v 4 H 1 Fn u 4 H I Hinf i Bbv T Bbv T A l u T M u I S faN 1 .nat; 1 1 1 I I I I I I 1 ACTCC AGCTTGAATCCC AGCTCTTCCGATGCl'GCT A AT’ TGTA ACGC AC.C TT GTT1TTGTTTT TCTCCT TT GTTGGTGC ?T - 12 1 TCAGGTCGAACTTAGGGTCGAGAGGGCTAC '■■At'GAT iGACAT 1 TV G TC C A A C AGG A A C AA AAAGA.CGAAAr AA C C AC GA A I I I I I * 1 ■ I 1 - -395 -1£ 3 3 74 - ini - 190 - I7 1 .15 6 - J 90 - 1 7 1 . 66 ■ 15 1 Mbo I : Sau96 I Spi I Tfi I Nla W A va I I H f- 4 I H i .11 I Mn 1 1 N l a TV Mn 1. I Man I I 1 Ofjo 1 Mnl I i'aq I 15 h II 11 I 1 I 1 1 1 1 , ' 1 fTGGGCXCVACACiTCVt.At-r G C '' A:. CG1 GTf. AG-'Or-; KGC VG AGA AGg Arc;A ATCTT I'GAGGC ' GGCTTGCTCIV T". - 24 I A ACCCIL nC G l C TOC.4G/.1 TGA'~G'..~ GC ■ k r A-yTGGl. 9 c, , » GAGYCTTG T ICi"77 AgAAG TTCCGAG.7 lAACG VI AAA I i ■ ! I l l I ■ I i -3! 7 >08 4 l ■ 1 : i 2 b 4 -316 -2 In -2 66 -2 r'e - 3 1 6 -28 - 266 -256 26 I 159 A v a I A lu I M n1 I Mn1 1 Ode I Pit I NLa IV Mnl I Mae I II I ll< II i GCTTTCTGTTCAGTCATCTGCCCTTCTtCCTGACCTTAGCTTATCCTGCAGA TGGGTTCCTCTCGGGCAGGGAGGGACTA - 1 61 CGAAAGACAAGTCAGTAGACGGCAACAGGGACTGGAATCGAATACGACCTCTACCCAAGGAGACCCCCTCCCTCCCTGAT II- I * I 1*1 I • I I -206 -195 -186 -173 -163 -203 -182 -169 - 1 7 9 D r d l S c r F I " EeoR II P ie I Mnl I Bit N I Hinf I Alu 1 Dra III I I I I II GGGAGGGATTAGCC'AGCACTTTTGAGTCTTGGGCTTGATTACTGTGGCAT l'TCAGCTTGTC ATTCCACAGGGTGTGGCTC -81 CCCTCCC.TAATCCGTCCTGAAAACTCAGAACCtCAACTAA'I’GACACCGTAAAGTCGAACAGTAAGG'iGTCCCACACCGAC • I '11*1 ■ • -I " I * -158 -148 -137 -107 -95 -14 8 - 1 3 7 - 1 4 0 - 1 4 4 F n u 4 H I Mbo I I Bbv I ScrF I" ScrF I" Mn1 I EcoR II EcoR II Mnl I Dde I Bat.N I B s l N I Ode I amJi _L Baa JI Qaa JI Alu I ItoN 1 B sr I I I I II I III ill V C tO GGAACAAGTt GAGAGTTCCCAGGCTGCAAAGrTGAGGTGGTGGAGTrjGGAGAGCCYCCe1G Af.ATnGtTtTlt :r: -1 AGCGACCTTCTTCAC.GTrTGAAGGGTCCGACGTT re r. AC TO t At C AGC TG AC t CT GT t GG ACGG At 7 ■"'? AGCG A J *r.' G., • I I | ■ I I I ■ I I I • ■ i • : I 79 -58 -46 -2 1 -2 -78 -57 -■14 -19 - 7 B -57 -42 -17 - 78 -57 -!5 7 4 - 5 1 - 5 3 N l a IV b p i 1 Tnu4H I Mae I Alu I Alu I N he I Pvu II Mae Dr d r A 1 li I B an ] N st/R 11 1 r\i . II <1.11 II : I AGTCTGACGAAGCTGTCGCTTGAGCTAGGCC.CACCTTGAJOClAGCTGTGTCCTAArTGACCA'G-GTCTTCCCTTCTAGAG 90 TCAGACTGCTTCGACAGCGAACTCGATCGCCGVGGAAtTGGGTCGACAGAGGATTGACTGGTAGCAGAACGGAAGATCTC I • I > I I I I I 1 * - , i 6 2 3 30 4 2 M U 2 4 4 2 7 5 2 5 4 3 28 28 3 j N l a I I I BaoB L 5au3A I Mbd II 41*. I N l a I I I I i I I I t tggaicatgacccatgaaga A t t T AC T AC T GGG T AC T TC T I i I I * I 82 9 3 9 3 Ni 8 5 fl 6 APPENDIX B LETTERS OF PERMISSION 160 161 JUN 9 6 iggij ju;i3G':vi ^ Ms. Haiqing Fa Schiltz 322 Choppin Hall r-, . --T Biochemistry Dept. Louisiana State University Baton Rouge, LA 70803 Tel: (504) 388-8790 Fax: (504) 388-4638 or 388-5321 Editorial Office 525 B Streer, Suite 1900 San Diego, CA 97101 4495 Deaj Sir or Madam, I am wnting this letter to request the permission for using a figure for my Ph.D. dissertation. The figure is Figure 3 in paper "Sequence diversity in the 5‘ untranslated region of rabbit muscle phosphofructokinase mRNA", 1990, Biochem. Biophys. Res. Com., Vol. 170, pp. 1056-1060 (0006-291X/90) I will appreciate your piompt response. Thanks. Sincerely, Haiqing Fu Schiltz PLEASE TU-Oi 0 ::; s??*/asb y /i/ts - 162 July 7, 1995 PERMISSION GRANTED, provided that 1) complete credit is given to the source, including the Academic Press copyright notice, 2) the material to be used has appeared in our publication without credit or acknowledgement to another source and 3) If commercial publication should result, you must contact Academic Press again. We realize that University Microfilms must have permission Lo sell copies of your thesis, and we agree to this. However, we must point out chat we are_ npT glving/permilsi'on for separate sale of your article. C h e r y X / ' f . U n g e r PermibiSinns D^parfnpn ACADEMIC PRESS, INC. Orlando, FL. 32 8 8 7 163 Ms. Haiqing Fu SchiJa 322 Choppin RxU Biochemistry Dept Louisiana State University Baton Rouge. LA 70803 Tel: (504) 388-8790 Fax: (504) 388-4638 or 388-5321 r*) t, 4. t i J Editorial Office American Society for Biochemistry & M olecular Biology, Inc. 9650 Rockville Pike Bethesda. MD70811 Dr it Sir or Marhrn, I am writing this letter to request the permission for using a figure for my Ph.D. dissertation. The figure is Rg. I in title "Structure of the mouse liver phosphpofructokiuTse gene", in paper Isolation and characterization of the transcriptionally regulated mouse liver (B-type) phosphofiuctokinase gene and its promoter", 1991, J. Biol, Chem., Vol. 266. No. 13, pp. 8086 8091. I will appreciate your prompt response. Thanks. S incerely. JUN 2 2 1995 164 Ms. Haiqing Fu Schilct 322 Choppin HaU Biochemistry Dept. Louisan* State University Baton Rouge, LA 70803 Tel: (504) 388- 8790 Fax: (504) 388-4638 or 388*5371 Editorial Office Cell Press 50 church Surer Cainbtidge, Massachusetts 02138 Dear Sir or Madam. I am writing this letter to request the permission for using a figure for my Ph.D dissertation. The figure is Figure 7b in title "Gvervievv of the MyoD-DNA complex", in paper ' Crystal structure of MyoD bHLH domain-DNA complex, perspectives on DNA recognition and implications for transcriptional activation ', 1994, Cell, Vol. 77, pp. 451- 4 59. I will appreciate your ptocnp'ret [icuse. Thanks. Haiqing Fu Schiltz 165 Ms. Haiqing Fu Schilet 322 Choppin Hail Biochemistry Dept I n r i - n t n iState University Baton Rouge, LA 70803 Tel: (504) 388 8790 Fa*; (504) 388-4638 or 388-5321 C_7h^e>* (fj (f?S~ Editorial Offices Gecles A Devtkrpmen' Cold Spring HaTbor Laboratory Press Box 100,1 Bungtown Road Cold Spring Harbor. New York 11774-2203 Dear Sir or Marfani. 1 ant writing this Letter to request the permission for using a figure for my Ph-D. dissertation. The figure is Figure 1 to otie ’Hypothetical regulatory pathway for muscle determination and differentiation', in paper "bHUl factors in muscle development: dead lines and commitments, what to leave in and what to leave out', 1994, Cenes A Dev., Vol S. pp. I -8. I will appreciate yon prompt response. Thanks. S incerely, Haiqing Fu Schilu Ptrnliilon granted by cue copyright ovnrr, contingent upon the consent of the original author, provided couple re credit is gjven to the original source and copyright date. PAT E k ( 7j ~ l (** C Cold Spring Machor Labn ra c o c y . P.O Bov ,oo, tola Spr.ng Hirbu; hew :ork i l r j o •rjrea f* (}> VITA Haiqing (Helen) was born on June 24, 1962 in Hainan, People's Republic of China. She grew up in this beautiful sub-tropical island which is located in the South China Sea. In 1979, she attended college at South China Normal University in Guangzhou, the capital of the Guangdong (Cantong) province. She received a B. S. at Biology, and finished at top five of her class in 1993. She was active in sports and music as well that she had participated and won in many campus wide competitions. Her interest in science was gradually developed through her childhood, and was mostly influenced by her mentor of undergraduate research, Professor Pan Rui-chi, whose plant physiology textbook has being used for years in China. She went on to Zhongshan University to pursue her Master's degree in plant physiology in 1993. The three-year graduate school carrier in Zhongshan has turned out to be the invaluable moment of her life. She was a part of the Graduate Student Council, the editor of the Graduate School Journal. Her thesis project was the biochemical and physiological studies of cotton bud abscission due to the environmental stress. She lectured plant physiology at the undergraduate senior level at her alma mater for two years after receiving her M. S. degree in 1986. Later she worked in the Chinese International Trust and Investment, Inc. before she came to LSU in the Spring of 1989. While in LSU, she first joined Dr. N. Murai's lab in the Department of Plant Physiology and Pathology, and later entered the Ph.D. program of the Biochemistry Department. She has worked in the laboratory of Dr. Simon Chang in order to complete her degree. Her primary focus was to characterize the promoter ns-elements of 166 167 the rabbit muscle phosphofructokinase gene, and functionally study the muscle-specific transcription activator MyoD and related proteins in the transcriptional control of this PFK gene. She was a teaching assistant for the undergraduate biochemistry lab of senior level, and th freshmen level of biology lab. While in graduate school, she met and fell in love with her graduate student fellow R. Louis Schiltz, who soon became her husband and the father of her son Stephen. After receiving her Ph.D. degree, she will head to National Institute of Health to do post-doctoral training along with her husband and son. She has become very interested in the fundamental research of how the transcription activators of cellular or viral activate transcription of the specific genes. Her goal is to pursue an active academic carrier. As for her personal goal, she would like to have one more child to keep the companion of their beloved son Stephen. DOCTORAL EXAMINATION AND DISSERTATION REPORT Candidate: Haiqing Fu Schiltz Major Field: Biochemistry Title of Dissertation: Transcriptional Studies of the Muscle-Specific Expression of the Rabbit Muscle Phosphofructokinase Gene Approvedi i f / / , Major Professor and chairman EXAMINING COMMITTEE Date of Examination: July 5/ 1995 to to to to> to rfl rt iflflfl o n rt o n ft o o rt c* to n tQ rt ft f> n «Q to o rr to rt tQ rt rt rt r r K> (i ft n (i it (l t n to to rtrrdflfl rt rt rt rtfl it n IQ IQ fl fl ftflfl rt Q rt tQ ft |Q rt rt rt n rt rr fl o fl rr flto to fl fl rt to 4 to rt to rt ft r rt n r tofl f l rtfl rr » 4 fl rr ft n rtfl rtfl to C O tooto c fl a a iflflfl n ft fl rt rr C iQ
jftrtfl ci tQ rr fl fl rr jftrtfltQ ci firttonQQctto no rro4 o QtotortdftotQ Cto rt C rt ...A C Cto rr A n rT OOrrOrrnnB QO 0 rtfl rt» fl > rt ^rtfttototoflft u fl r: rtfl uftflfl rtfl r: fl at 14 I I I ' I I C I I ( t I M W a\ OHHtJUUtolA 01 Ul o oooooooo a o n n O ft n d n Ofl fl Ofl r t IQ IQ o o c o IQ d a d ft n tQ n (V [V (V n n iq |Q |Q Cl iq IQ i q *J *J IQ rr n r r Q r r ci ft !Q ft fT Cl n n C IQ c ct IQ C c o
rtfl O |k rtfl p rt rt C fl to »fl rr c n ia ft ft rt rt n f l •Q O fl rt rt fl rt fl P rt C n » O C| rt r fl fl flrr flfl fl fl fl rt n fl rt fl fl Ci fl fl fl fl fl rna fl fl Ci fl fl fi (t fl fl (k fl n fl rtfl fla (• fl ci fl fl rt fl rt rt rt c O to fl » r fl fl|k rtfl rtflfl rr fl A n r tfl a ort tQ IO tQ r+ 01 fT o fl fl fl rt fl > rt fl O fl fl rt |i fl o rt flfl «fl d rt to (Q (Q fl fl fl r. fl ^ fl flfl » fl a fl n rt fl Q iu iq *Q iq r r o to to r t C n o n n c n n Of d fT (Q d a r t c r t iQ r r iC Q d ■Q iq n O n n n (Q to r r Q o d ft r r i d C* C* IQ £ iQ id iQ d d d W ^W frtn?\'J'J(DU3y)Or', r‘WUi^PLnffitri '-j K) i q iq iq