Acta Botanica Brasilica doi: 10.1590/0102-33062020abb0051 Toward a phylogenetic reclassification of the subfamily Ambavioideae (Annonaceae): establishment of a new subfamily and a new tribe Tanawat Chaowasku1 Received: February 14, 2020 Accepted: June 12, 2020 . ABSTRACT A molecular phylogeny of the subfamily Ambavioideae (Annonaceae) was reconstructed using up to eight plastid DNA regions (matK, ndhF, and rbcL exons; trnL intron; atpB-rbcL, psbA-trnH, trnL-trnF, and trnS-trnG intergenic spacers). The results indicate that the subfamily is not monophyletic, with the monotypic genus Meiocarpidium resolved as the second diverging lineage of Annonaceae after Anaxagorea (the only genus of Anaxagoreoideae) and as the sister group of a large clade consisting of the rest of Annonaceae. Consequently, a new subfamily, Meiocarpidioideae, is established to accommodate the enigmatic African genus Meiocarpidium. In addition, the subfamily Ambavioideae is redefined to contain two major clades formally recognized as two tribes. The tribe Tetramerantheae consisting of only Tetrameranthus is enlarged to include Ambavia, Cleistopholis, and Mezzettia; and Canangeae, a new tribe comprising Cananga, Cyathocalyx, Drepananthus, and Lettowianthus, are erected. The two tribes are principally distinguishable from each other by differences in monoploid chromosome number, branching architecture, and average pollen size (monads). New relationships were retrieved within Tetramerantheae, with Mezzettia as the sister group of a clade containing Ambavia and Cleistopholis. Keywords: Annonaceae, Ambavioideae, Meiocarpidium, molecular phylogeny, systematics, taxonomy et al. 2019). Every subfamily received unequivocally Introduction and consistently strong molecular support except the subfamily Ambavioideae, which is composed of nine Annonaceae, a pantropical family of flowering plants genera: Ambavia, Cananga, Cleistopholis, Cyathocalyx, prominent in lowland rainforests, consist of 110 genera Drepananthus, Lettowianthus, Meiocarpidium, Mezzettia, (Guo et al. 2017; Chaowasku et al. 2018a; b; Xue et al. and Tetrameranthus (e.g., Surveswaran et al. 2010; 2018) and approximately 2430 species (Chatrou et al. Chatrou et al. 2012; Guo et al. 2017; Couvreur et al. 2018). The family has been classified into four subfamilies, 2019). The monotypic Meiocarpidium endemic to Africa viz., Anaxagoreoideae, Ambavioideae, Annonoideae, and is a phylogenetically problematic genus because it was Malmeoideae; the last two subfamilies, which constitute identified as the sister group of a clade composed of the majority of generic and species diversity in the family, the remaining genera of Ambavioideae, but with only have each been further subdivided into tribes (Chatrou moderate to no support in certain analyses (Guo et al. et al. 2012). Two additional tribes in Malmeoideae have 2017), which is in contrast to the analyses presented by been subsequently proposed (Guo et al. 2017; Couvreur Surveswaran et al. (2010), Chatrou et al. (2012), and Xue 1 Herbarium, Division of Plant Science and Technology, Department of Biology, Faculty of Science, and Research Center in Bioresources for Agriculture, Industry, and Medicine, Chiang Mai University, 50200, Chiang Mai, Thailand. [email protected] Diagramação e XML SciELO Publishing Schema: www.editoraletra1.com.br Toward a phylogenetic reclassification of the subfamily Ambavioideae (Annonaceae): establishment of a new subfamily and a new tribe et al. (2018), yielding rather strong support. Further, DNA extraction, amplification, and sequencing in an analysis using a targeted enrichment of nuclear genes by Couvreur et al. (2019), this genus was either All methods for DNA extraction, amplification, and weakly supported as the sister group of the remaining sequencing used in the present study were the same as those Ambavioideae genera or moderately supported as the described in Chaowasku et al. (2018a; b; 2020). For plastid sister group of Annonaceae excluding Anaxagoreoideae regions not included in Chaowasku et al. (2018a; b; 2020), their and other Ambavioideae members. primer sequences for the amplification and sequencing were The primary aim of the present study is, therefore, to obtained from Hoot et al. (1995) and Scharaschkin & Doyle re-elucidate the position of Meiocarpidium by sequencing two (2005) for atpB-rbcL intergenic spacer, with internal primers and three additional plastid regions of this genus compared newly designed for the present study: ATPB-RBCL-INT-A to Chatrou et al. (2012) and Guo et al. (2017), respectively. (5’- GGATGCTGAAATAAAGAACAACAGCC -3’) and ATPB- In addition, more plastid regions are also sequenced for RBCL-INT-B (5’- GGCTGTTGTTCTTTATTTCAGCATCC representatives of Mezzettia, Cyathocalyx, and Drepananthus -3’); and Hamilton (1999) for trnS-trnG intergenic in order to gain deeper insights into relationships of particular spacer, with internal primers newly designed for clades in Ambavioideae, i.e., the Ambavia-Cleistopholis- the present study: TRNSG-NEW-F-SHORT (5’- Mezzettia and Cananga-Cyathocalyx-Drepananthus clades. It CCTCTTTGATTCCGTACGAAAGG -3’), TRNSG-NEW-R is worthy of notice that the relationships in the latter clade (5’- GTCGAATAAGCGAATGAGACG -3’), and TRNSG-INT- have been controversial since Cyathocalyx was found to be R-SHORT (5’- GGAATGGAAATAGCCTTTGTCAC -3’). the sister group of Drepananthus in one study (Guo et al. 2017), whereas Cananga and Drepananthus were recovered Phylogenetic analyses as sister genera in another study (Xue et al. 2018). Sequences were edited using the Staden package [http:// staden.sourceforge.net] (Staden et al. 2000) and then Materials and methods aligned by Multiple Alignment using Fast Fourier Transform (MAFFT; Katoh et al. 2002) via an online platform (Katoh Character and taxon sampling (see List S1 in et al. 2017), with default settings. The aligned matrix supplementary materials, for a list of taxa, voucher was subsequently checked and manually adjusted (where information, and GenBank accession number) necessary) using the similarity criterion (Simmons 2004). In total, 7,149 aligned nucleotide plus twelve binary- Twenty-four accessions comprised the ingroup, with coded indel characters were included. Following Simmons three representatives of Annonoideae, four representatives & Ochoterena (2000), the simple coding method for the of Malmeoideae, and 17 representatives of Ambavioideae binary indel characters was implemented, with the focus on covering all currently accepted genera in this subfamily. At non-autapomorphic and less homoplasious indel structures. least two accessions or species per genus were included for A 15 base-pair inversion is present in certain accessions in Cananga, Cyathocalyx, Drepananthus, Meiocarpidium, and the psbA-trnH intergenic spacer and was complementarily Mezzettia. Two species of Anaxagorea (the only genus of reversed to be homologically alignable to the remaining Anaxagoreoideae) were assigned as outgroups because this accessions, following Pirie et al. (2006). The phylogenetic subfamily has always been recovered as the sister group trees were rooted by specifying the two Anaxagorea species of a consistently strongly supported clade comprising as outgroups. the remaining subfamilies of Annonaceae (e.g., Chatrou Parsimony analysis was performed in TNT version 1.5 et al. 2012; Guo et al. 2017). Up to eight plastid regions (Goloboff & Catalano 2016). All characters were equally (matK, ndhF, and rbcL exons; trnL intron; atpB-rbcL, psbA- weighted and unordered. Incongruence among regions was trnH, trnL-trnF, and trnS-trnG intergenic spacers) were assessed by performing an analysis for each region to see included in this study. Seventy-seven sequences were if there was any significant conflict in clade support (e.g., newly produced for the present study; the remaining Wiens 1998). Most parsimonious trees were generated sequences were taken from GenBank. There were some by a heuristic search of the combined data, with 9,000 missing data in the following accessions (see List S1 in replicates of random sequence addition, saving 10 trees supplementary materials): Ambavia gerrardii (Baill.) Le per replicate, and using the tree bisection and reconnection Thomas, Lettowianthus stellatus Diels, Tetrameranthus (TBR) branch-swapping algorithm. Clade support was duckei R.E.Fr., and one specimen of Meiocarpidium evaluated by symmetric resampling (SR; Goloboff et al. oliverianum (Baill.) D.M.Johnson & N.A.Murray (M. 2003). A default change probability was used. One hundred oliverianum is the same species as the well-known M. thousand replicates were run, each with five replicates of lepidotum (Oliv.) Engl. & Diels; the basionym of the random sequence addition, saving five trees per replicate. A former was published before the basionym of the latter; clade with SR ≥ 85 %, 70–84 %, or 50–69 % was considered see Johnson & Murray 2018). strongly, moderately, or weakly supported, respectively. Acta Botanica Brasilica - 34(3): 522-529. July-September 2020 523 Diagramação e XML SciELO Publishing Schema: www.editoraletra1.com.br Tanawat Chaowasku Maximum likelihood analysis was accomplished in IQ- rule consensus tree derived from the Bayesian analysis, TREE version 1.6.10 (Nguyen et al. 2015) under partition with corresponding support values from the other two models (Chernomor et al. 2016) performed with the “-spp” analyses, parsimony and maximum likelihood, whereas command, whereas Bayesian Markov chain Monte Carlo Figure 2 depicts a phylogram derived