Molecular Cloning and Characterization of LAPTM4B, a Novel Gene Upregulated in Hepatocellular Carcinoma

Molecular cloning and characterization of LAPTM4B, a novel gene upregulated in hepatocellular carcinoma

Gen-Ze Shao1, Rou-Li Zhou*,1, Qing-Yun Zhang1, Ye Zhang1, Jun-Jian Liu1, Jing-An Rui2, Xue Wei2 and Da-Xiong Ye2

1Department of Cell Biology & Genetics, School of Basic Medical Sciences, Peking University, Beijing 100083, China; 2Department of Basic Surgery, Peking Union Medical College Hospital, Beijing 100032, China

Lysosomal-associated protein transmembrane-4 beta mortality rates. A recent statistic (Nakakuya et al., (LAPTM4B), a novel gene upregulated in hepatocellular 2000) showed that 89% of the HCC cases around the carcinoma (HCC), was cloned using fluorescence differ- world occurred in developing countries, especially in ential display, RACE, and RT–PCR. It contains seven Southeast Asia and South Africa. In many countries, exons and encodes a 35-kDa protein with four putative including the United States, a definite increase in the transmembrane regions. Both the N- and C-termini of the incidence of HCC was also noticed in the report (El- protein are proline-rich, and may serve as potential Serag, 2002). As estimated by IARC, the total incidence ligands for the SH3 domain. Immunohistochemical in 2000 was 564 000 and the mortality was up to 549 000. analysis localized the protein predominantly to intracel- The major risk factors for this cancer have been lular membranes. Northern blot showed that the identified as chronic infections with hepatitis B (HBV) LAPTM4B mRNAs were remarkably upregulated in or hepatitis C (HCV) viruses, and dietary exposure to HCC (87.3%) and correlated inversely with differentia- aflatoxins. In China, 90% of the HCC patients are tion status. LAPTM4B was also overexpressed in many infected with HBV. Moreover, more than 10% of HCC-derived cell lines. It was also highly expressed in Chinese in mainland are chronic HBV carriers. There- fetal livers and certain adult normal tissues including the fore, HBV appears to be the first important risk factor heart, skeletal muscle, testis, and ovary. Promoter for HCC in the country (Yeh et al., 1989; Tang, 1995). function assays showed a distinct difference in the gene’s The exact molecular mechanisms underlying hepatocar- activities between BEL7402 and HLE cell lines, suggest- cinogenesis in the setting of viral infections have not ing that the transcription factors responsible for regula- been elucidated, although there are evidences suggesting tion of the gene in the two cell lines are different, and that that virus-encoded proteins (HBx, HBs) contribute to possible negative regulatory cis-elements may exist up- malignant transformation (Cromlish, 1996; Feitelson, stream of the promoter region. It was demonstrated that 1999; Anthony, 2001). the N-terminus of LAPTM4B was essential for survival of The development of HCC is a multistep process the cells. Cells harboring the full-length LAPTM4B associated with complicated changes in host gene- cDNA expression clone displayed a slightly increased expression patterns. During initiation and progression efficiency in colony formation. These results suggest that of HCC, tumor-suppressor genes such as p53 (Li et al., LAPTM4B is a potential protooncogene, whose over- 1993), p16, p21 (Qin et al., 1998), p27 (Tannapfel et al., expression is involved in carcinogenesis and progression of 2000), beta-catenin (Wong et al., 2001), PTEN (Yao HCC. In normal cells, it may also play important roles et al., 1999), and Rb were frequently deregulated or such as regulation of cell proliferation and survival. completely disrupted by point mutations, loss of Oncogene (2003) 22, 5060–5069. doi:10.1038/sj.onc.1206832 heterozygosity (LOH), and methylation. On the other hand, oncogenes and certain cell cycle controllers, such ONCOGENOMICS Keywords: LAPTM4B; hepatocellular carcinoma; dif- as c-myc (Wu et al., 1996), c-Jun, c-fos (Twu et al., ferential expression; promoter analysis 1993), c-met (Boix et al., 1994; Grigioni et al., 1995), c- ets-1 (Ozaki et al., 2000), cyclin D1 (Peng et al., 1998; Deane et al., 2001; Joo et al., 2001), cyclin E (Peng et al., Introduction 1998), and gankyrin (Higashitsuji et al., 2000), were overexpressed or re-expressed in the later stage of Hepatocellular carcinoma (HCC) is a very common hepatocellular carcinogenesis. Finally, some genes in- cancer worldwide with poor prognosis and high volved in cell–cell or cell–extracellular matrix interac- tions, such as MMPs (Arii et al., 1996), integrin a6b1 (Begum et al., 1995), syndecan-1, nm23 (Fujimoto et al., *Correspondence: R-L Zhou, School of Basic Medical Sciences, Peking University, 38#Xue Yuan Road, Beijing 100083, China; 1998), and KAIL (Guo et al., 1998), were reported to E-mail: [email protected] play important roles in HCC progression due to Received 11 December 2002; revised 20 May 2003; accepted 28 May 2003 correlation with invasive and metastatic potentials. Molecular cloning and characterization of LAPTM4B G-Z Shao et al 5061 Recently, several novel genes of unknown functions were found to be involved in hepatocellular carcinogenesis (Zeng et al., 2002). The mechanisms underneath the broad-spectrum gene-expression aberrations in HCC are not fully understood. However, since many tumor-suppressor genes and oncogenes are themselves transcription factors, inactivation of the former or activation of the latter show regions 16q, 17p, 13q, 4q, lp, and 8p. Gains frequently occurred on 8q, 1q, 6p, and 17q (Marchio et al., 1997; Lin et al., 1999). Therefore, further investigation of HCC-specific gene-expression aberrations, especially those involving novel genes, is of fundamental significance. In order to search novel genes that involved in proliferation and/or differentiation of hepatocytes and in hepatocarcinogenesis, fluorescence differential display was performed with HCC, paired noncancerous liver (PNL), fetal liver (FL), and normal adult liver (NL) Figure 1 The nucleotide and deduced amino-acid sequences of tissues. A novel gene, which was upregulated highly in LAPTM4B cDNA. The sequence numbers of the first nucleotide HCC and slightly in PNL and FL, was found, and its (left) and the final amino acid (right) in each row are indicated, k LC27 respectively. Exon divisions are indicated ( ). The start codon partial cDNA (NM_018407, designated as ) (ATG) and polyadenylation consensus sequences (AATAAA, was first cloned in our laboratory (Liu et al., 2000a, b). AATTAAA) are underlined. Transmembrane regions are boxed. This novel gene was designated by HUGO as The putative N-glycosylation site is marked with a hexagon; LAPTM4B (lysosome-associated protein transmem- potential phosphorylation sites are circled, with the corresponding brane-4 beta). Here we report the cloning and kinases indicated in italic characters. The peptide (residues 232– 241) used in generating antibodies is double-underlined. Stop characterization of the full-length cDNA of LAPTM4B codon or inframe stop codons are indicated as an asterisk or # and its promoter. The putative protein of LAPTM4B is highly conserved, with 92% identity at the amino-acid level to a murine lysosome-associated protein transmembrane-4 RACE and Northern blot (Figure 2a). The full-length beta, mLAPTM4B. It is also 46% homologous at the LAPTM4B cDNA predicts a putative protein of 317 amino-acid level to a human lysosome-associated amino acids. It has an MW of 35 kDa and a pI of 9.7. transmembrane-4 protein, LAPTM4A. The ortholog Computer analysis shows that LAPTM4B is an integral of LAPTM4A in murine is a nucleoside transporter on membrane protein, with four transmembrane regions intracellular membrane-bound compartments, and med- at 117–133, 163–179, 200–216, and 243–259 aa, respec- iates a multidrug resistance phenotype in drug-sensitive tively. It has potentially one N-glycosylation site, strains of S. cerevisiae (Hogue et al., 1996; 1999; Cabrita eight phosphorylation sites, and four N-myristylation et al., 1999). LAPTM4B shares a number of character- sites. istics with other lysosome-associated proteins such as LAPTM5 (Adra et al., 1996). These clues inspired us to Genomic structure organization of LAPTM4B investigate the functions of LAPTM4B and its roles in hepatocarcinogenesis. BLAST program analysis shows that the LAPTM4B gene is mapped to chromosome 8q22.1, spanning at least 50 kb. It is composed of seven exons separated by six introns (Table 1). The sequences at the exon–intron Results boundaries comply with the canonical AG–GT acceptor/donor splice sites. Exon 1 contains the 50 untrans- Full-length cDNA cloning of LAPTM4B and sequence 0 analysis lated sequence (5 UTR) and the initiating methionine (Met). The full-length cDNA of LAPTM4B (Accession no. Sequence homology searches in human draft genome AY057051) was cloned from human HCC tissues using databases found at least four homologous sequences, rapid amplification of cDNA ends (RACE) and RT– with identities of 88–94%, at chromosome 1q PCR, and confirmed by Northern blot. As shown in (AL606502.2, 87%), 3q (AC117470.8, 89%), 3p Figure 1, the mRNA of LAPTM4B is approximately (AC114876.2, 91%), 4q (AC107048.3, 94%), and 2.2 kb in length and is in good agreement with the size of 7q33–7q35 (AC004941.2, 86%), respectively. Some of the mRNA observed in Northern blots. There are two these sequence homologs were confirmed by Southern polyadenylation signal sites, AATAAA and AAT- blot analysis. These sequences are different from TAAA. The alternative polyadenylation (AATAAA) LAPTM4B in that they are intronless, indicating that results in another B1.5 kb mRNA variant (GenBank probably they are paralogs or retropseudogenes and Accession no. AF527412), which was confirmed by 30 functionally inactive.

Oncogene Molecular cloning and characterization of LAPTM4B G-Z Shao et al 5062 Expression analysis of LAPTM4B differentiated HCCs, and low in well-differentiated HCCs. It was also upregulated in FL compared Expression of LAPTM4B was analysed at the mRNA with NL (Figure 3a). Moreover, with the only exception level via Northern blot and in situ hybridization. As of HLE cells, the gene was also overexpressed in all LAPTM4B shown in Figure 2a, was widely expressed in of the human hepatic cell lines or HCC-derived cell human tissues. Its expression was high in heart, skeletal muscle, kidney, and testis; moderate in ovary, kidney, and pancreas; low in liver, spleen, and thymus; but lowest in lung and peripheral leukocytes. High expression was also seen in fetal kidney, heart, and spleen (Figure 2b). It was signiﬁcantly overexpressed (48 over 55 cases) in HCC when compared with the PNL (Figure 3a, b). Furthermore, the expression levels of LAPTM4B were signiﬁcantly related to the differentiation status of HCCs. As shown in Figure 3c, its expression was highest in poorly differentiated HCCs, high in moderately

Figure 3 Analysis of LAPTM4B mRNA expression in HCCs and HCC-derived cell lines. (a) Northern blot analysis of LAPTM4B in HCC tumor tissues (T), paired noncancerous liver tissues (N), fetal and adult normal liver tissues (F-, A-liv), as well as human hepatic or HCC-derived cell lines and mouse HCC-derived cell lines. (b) ISH was performed on sections. LAPTM4B mRNA expression in HCCs (i, ii), paired noncancerous tissues (iii), and BEL7402 (iv) were probed with digoxigenin-labeled LAPTM4B antisense cRNA or sense cRNA as negative control. Positive LAPTM4B mRNA Figure 2 Northern blot analysis of LAPTM4B expression in expression was preferentially in hepatic cancerous cells as indicated normal human tissues. (a) Expression of LAPTM4B in adult by blue staining. Original magniﬁcation, 40 (i, iii) or 100 (ii, iv). (c) human multitissues probed with LAPTM4B-C (corresponding to Correlation between LAPTM4B mRNA level and tumor grade. nt 460–774 on AY057051) and LAPTM4B-D (corresponding to nt Paired tumor (T) vs adjacent noncancerous liver tissues (N) from 55 1876-2171 on AY057051), respectively. Two isoforms of the HCC patients were compared for their LAPTM4B expression by LAPTM4B transcripts, named LAPTM4B_v1 and LAPTM4B_v2, Northern blot. Each spot in the ﬁgure represents the ratio (T/N) of are indicated with arrows or arrowhead, respectively. (b) Expres- the mRNA expression (tumor vs adjacent noncancerous liver sion of LAPTM4B in fetal multitissues tissue) from one patient

Table 1 Human LAPTM4B exon–intron sizes and boundaries Exon number Exon size (bp) Splice acceptora Splice donora Intron size (bp)

1 528 CTGGTATCTG/gtgagcgcgg 29 244 2 112 cttgttgcag/ATCATCAATG GATGATGCCA/gtaagtagta 9863 3 74 ctttcggcag/ACATGTGCAT AGCGTACAAG/gtaagccgct 656 4 123 ttctgtttag/CAACGCGCAG ACGGCAACTG/gtacgtggac 2959 5 99 tcttttgcag/CCTCCTAATT GACTTTTAAG/gtaagcatga 5819 696tcattttc ag/GGTTACTTGA TGACACTACG/gtaggtatga n.d.b 7 1198 ttcttctcag/GTGCTGCTAC

aIntron sequences are shown in lower-case letters, and exon sequences are shown in upper-case letters. Conserved splice donor and splice acceptor dinucleotides are underlined. bn.d., not determined

Oncogene Molecular cloning and characterization of LAPTM4B G-Z Shao et al 5063 lines we tested, including SMMC-7721, QGY-7701, BEL7402, L02, and HG116cells (Figure 3a). However, LAPTM4B expression was very low in a mouse HCC-derived ascitic cell line H22 and in HcaF, a H22 derivative cell line with high lymph node metastasis (Figure 3a), suggesting that there are differences in hepatocarcinogenesis between humans and mice. No direct correlation between upregulation of LAPTM4B and HBV infection was detected. Other transc ripts of LAPTM4B (5.1, 3.8, 3.2 kb), which have not been cloned yet, are also shown in the top panel of Figure 2a.

Immunocharacterization of LAPTM4B To confirm that the cDNA of LAPTM4B indeed encodes a functional protein, several eukaryotic expression vectors were constructed and introduced into BHK cells. After transient transfection of BHK cells with pcDNA3-AF containing the whole ORF, two prominent protein bands with a molecular mass of 35 kDa (top arrow), and 24 kDa (bottom arrow) were detected in BHK cells by Western blot (Figure 4a). When transfected with pcDNA3-BF that contains a downstream Figure 4 Expression of LAPTM4B proteins in transfected cells. ORF starting from the second ATG to TAA, the BHK (a) Western blot analysis of recombinant LAPTM4B proteins in cells only expressed the 24- and a 26-kDa (middle arrow) BHK cells transfected with pcDNA3.0 (mock) and four LAPTM4B proteins. The difference between the 26- and 24-kDa cDNA constructs. The constructs pcDNA3-AF and -AE contained the complete ORF of LAPTM4B, while a truncated ORF was proteins may be caused by modifications such as present in pcDNA3-BF or -BE. A FLAG was fused into the C- glycosylation. termini of -AF or -BF, but absent in -AE or -BE. The membrane As shown in Figure 4b, immunohistochemical was probed with a mouse anti-FLAG-M2 monoclonal antibody analysis was undertaken to characterize the sub- (right), or stripped and reprobed with rabbit KLH-LAPTM4B-10P polyclonal antibodies (left). In the left: two bands (24 and 17 kDa) cellular localization of LAPTM4B in BHK cells are seen in both AF and BF lanes, while a 35-kDa band is seen only transfected transiently with pcDNA3-AF, using anti- in the AF lane. On the contrary, a prominent 26-kDa band is seen FLAG antibody. Positive brown signals were seen in the BF lane. In the right: the rabbit KLH-LAPTM4B-10P only in cells that expressed LAPTM4B-FLAG fusion polyclonal antibodies should be able to react with both the proteins. The brown particles scattered unevenly recombinant and native LAPTM4B proteins, as suggested by the bands in the mock lane. In -AF and -AE lanes, the recombinant 35- in cytoplasm, mainly around the nucleus. Some particles kDa proteins are prominent (top arrow). (b) Subcellular localiza- appeared as small vesicles, indicating that the tion of LAPTM4B in BHK cells. BHK cells were transfected with protein may be localized on intracellular membrane the vector pcDNA3-AF as described in ‘Materials and methods’. organelles. Cells were fixed, permeabilized, and analysed immunochemically using anti-FLAG-M2 antibody. Brown positive signals were seen only in transfected cells and mainly distributed in the cytoplasm. Colonogenic assay Original magnification was 600 pcDNA3-E2E7,-AE,and-BE, which contained the full- length cDNA, the whole ORF, and a truncated ORF (91 35-kDa LAPTM4B was ubiquitously expressed in all aa from N-terminus was deleted) of LAPTM4B, clones, highest in -E2E7 and lowest in mock, suggesting respectively, were constructed and introduced into that the UTRs in pcDNA3-E2E7 might play a regulatory HLE cells. Transfection efficiency, as determined by role in translation. cotransfection with a pSV-b-Gal vector, was approximately the same among all the vectors. As shown in Molecular cloning and characterization of LAPTM4B Figure 5, after 2–3 weeks of G418 selection, colony promoter formation in pcDNA3-BE-transfected cells was almost completely blocked (only a few cells survived), whereas To investigate the mechanism underlying the upregula- the pcDNA3-E2E7 or -AE-transfected cells and control tion of LAPTM4B in HCC, the promoter region of the cells formed colonies. Compared with the mock, there gene was cloned and analysed (GenBank Accession no.: was slight increase (8%) in colony-formation efficiency AY198226). Although two muscle initiator sequences in pcDNA3-E2E7-transfected cells, but no significant are shown, no classical promoters such as the CCAAT difference was observed in pcDNA3-AE-transfected box (TTGCGCAAT) or TATA box are present cells. Western blot analysis showed that a 24-kDa (Figure 6a). Since we have shown that LAPTM4B protein was detected in pcDNA3-AE but absent in is preferentially expressed in human skeletal muscle pcDNA3-E2E7 transfectants and mocks. However, the and heart, it is possible that the transcription of the

Oncogene Molecular cloning and characterization of LAPTM4B G-Z Shao et al 5064

Figure 6 Promoters of LAPTM4B and their activities in BEL7402 and HLE cells. (a) The promoter region of LAPTM4B. Genomic sequences are indicated in lowercase letters. Transcriptable nonintronic sequences are in uppercase letters. The nucleotide sequence is numbered with the initiation codon ATG (boxed) as 157. Transcription start sites are marked by a bent arrow. The consensus sequences, that is, the potential targets of some transcription factors are underlined. DNA repeats are marked in gray. (b) Promoter activities in BEL7402 and HLE cells. A series of deletion constructs covering the LAPTM4B promoter region were Figure 5 Colony-formation assay. (a) HLE cells were transfected fused with the promoterless luciferase gene in the pGL3-Basic. The with pSV-b-Gal plus either pcDNA3-E2E7,-AE, -BE, or mock diagram of the fusion constructs indicates the start points (e.g., vector, and selected with G418 for 3 weeks. The colony foci were À1341) of the constructs relative to the transcription start site of stained and photographed. (b) Quantification of the number of LAPTM4B. Human HCC BEL7402 and HLE cells were trans- colonies. Colonies were counted and normalized to mock. The fected with these fusion constructs. In each cell line, transfection empty vector control was set at 100%. The data represent the efficiency was normalized by setting the luciferase activity of the 7 mean s.d. of three independent experiments, each done in pGL3-Promoter (with a SV40 promoter) as 100%. Luciferase triplicate plates. **Po0.01. (c) Western blot analysis of LAPTM4B activities of each construct were shown in the left expression in HLE clones stably transfected with pcDNA3-E2E7, -AE, or mock vector, using KLH-LAPTM4B-EC2-pAb polyclonal antibodies. The 35-kDa protein was highly expressed in pcDNA3- E2E7,-AE clones, but less expressed in mock. A 24-kDa protein lines. Since luciferase activities were detected in cells band was seen in -AE lane, but absent (undetectable) in -E2E7 and transfected with pGL3-PF4, the minimum constructs mock lane among all, it is possible that the core promoter of LAPTM4B is mapped to this region (a 38 bp DNA gene is driven by the muscle initiators in these segments upstream of the TSS). tissues. Other attractive motifs are CREBP1/c-Jun, The pGL3-PF1-transfected BEL7402 cells yielded CEBP, PAX2/5/8, GATA, c-Ets-1, E2F, LYF-1, activity that was 20% of the SV40-promoter-driven and c/v-Myb binding sequences. Interestingly, the construct pGL3-Promoter, whereas transfected HLE promoter region contains DNA repeats (the gray cells yielded low luciferase activity (only 6%). This sequences in Figure 6a). result was in good accordance with the Northern blot of The promoter activities were evaluated using pGL3- LAPTM4B in the two cell lines (Figure 3a), which Luc constructs that contained various promoter seg- represented the background promoter activities of ments upstream of the TSS, the entire 50 UTR, and the endogenous LAPTM4B in both cell lines. Furthermore, 35 bp coding sequence in exon 1, respectively (Figure 6b). BEL7402 generated almost sevenfold higher luciferase The constructs were transiently transfected into either activity than HLE when transfected with pGL3-PF4. BEL7402 or HLE cells. (The endogenous expression of These results suggested that the mechanisms regulating LAPTM4B was high in BEL7402 and low in HLE cells, the expression of LAPTM4B in the two cells are respectively (see Figure 3a)). As shown in Figure 6, different. luciferase activities were detected in both cell lines In HLE cells, the luciferase activities of pGL3-PF3 transfected with different constructs, although signifi- transfectants were sevenfold higher than that of pGL3- cant differences were observed between the two cell PF4 transfectants, suggesting that LAPTM4B could be

Oncogene Molecular cloning and characterization of LAPTM4B G-Z Shao et al 5065 positively regulated, alone or in combination, by transcription factors such as c-ets-1, STAT, GATA, LYF-1, c-Jun, and c-Myb. In BEL7402 cells, on the contrary, no signiﬁcant difference in luciferase activity was found between pGL3-PF3 and pGL3-PF4 transfectants. It was reported previously (Jiang et al., 2001) and conﬁrmed recently in our lab that c-ets-1 is upregulated in HLE cells. We also found that c-ets-1 expression level was low in BEL7402 cells (not shown). All these results indicated that the regulation of LAPTM4B in the two cell lines is different and complicated. Luciferase activity in pGL3-PF3 transfectants is higher than that of pGL3-PF1 or -PF2 in both cell lines, suggesting the existence of negative regulatory cis-elements upstream of the promoter region (À558BÀ1341). As shown in Figure 6a, there are two DNA repeats in the promoter region ( 41 to 328, Figure 7 Homology analysis. (a) C-terminal comparison of À À LAPTM4B and related proteins. Conserved residues are shaded. À574 to À859), and motifs for potential transcription The putative transmembrane regions are underlined. The YXXF factors such as LYF-1 and E2F are located in the two and LL/VL motifs are boxed. (b) Alignment of the N-terminal repeats. It was reported that such DNA repeats could amino-acid sequences of LAPTM4B, proline-rich domains in serve as targets for recruitment and dimerization of protein kinase C (mu type), human phosphatidylinositol 3-kinase regulatory alpha subunit (PI3-kinase p85-alpha subunit, PI3K), some transcription factors. It is possible that the absence and serine/threonine protein phosphatase 2A (PP2A, subunit B). of one repeat in pGL3-PF3 may lead to the dissociation Conserved residues are shaded. PXXP motif is indicated of repressors and thus enhances the transcription of the gene.

respectively. The 26-kDa protein may be a modified form of the 24-kDa protein. However, stable transfec- Discussion tion of HLE with the full-length LAPTM4B cDNA (pcDNA3-E2E7) produced only the 35-kDa protein, The LAPTM4B fragment was first screened out by suggesting that the UTRs may play a regulatory role in fluorescent differential-display PCR, and confirmed by mRNA translation. A similar effect has been reported slot blot (Liu et al., 2000a, b). It was overexpressed in on another gene (Graziano et al., 2001). As is predicted HCCs compared with paired noncancerous liver or by the scanning model (Le and Maizel, 1997; Kozak, normal liver tissues. Significantly higher expression was 1999), most eukaryotic mRNA translations initiate at also noticed in poorly differentiated HCCs when the first AUG encountered by the 40S ribosomal subunit compared with moderately or well-differentiated HCCs. starting from the 50m7G cap. However, there is also an Human FL moderately expressed LAPTM4B. The alternative mechanism that utilizes the cap-independent expression of LAPTM4B in human FL was significantly internal ribosome entrance site (IRES) mediated by a Y- higher than that in adult liver. The fact that LAPTM4B shaped secondary structure located in the 50 UTR. Thus, was overexpressed in poorly differentiated HCC tissues translation can bypass the upstream of AUG codon and as well as in HCC-derived cell lines, strongly suggests initiate at a more distal AUG. According to this that LAPTM4B may play important roles in regulation mechanism, denoted as leaky scanning, multiple pro- of cell growth, proliferation, and differentiation. In teins can be obtained from the same mRNA. Since the 50 addition, we have demonstrated recently that NIH 3T3 end of the LAPTM4B mRNA is GC-rich and may form cells transfected with LAPTM4B cDNA displayed a stem-loop structure, the leaky scanning mechanism is profound changes, including increased cell growth and likely accountable for the 35- and 24-kDa isoforms. proliferation rates, increased colony-formation effi- However, other transcripts of LAPTM4B produced by ciency in soft agar, reduced serum dependence, and alternative splicing might also exist, as was suggested in morphological alterations such as increases of filopodia/ Northern blot (Figure 2a), though we could not clone microvilli on cell surfaces, etc., implying increased these alternatively spliced isoforms yet. malignancy (He et al., 2003). Two types of conserved motifs, ‘YXXF’ and ‘LL’, The full LAPTM4B mRNA predicts a putative 4- shared in the cytoplasmic tails of many lysosomal transmembrane protein of 317 aa, with a molecular membrane proteins, are believed to function as signals mass of 35 kDa. Transient transfection of LAPTM4B for lysosomal membrane targeting and sorting (Hunzi- constructs into BHK cells produced three protein ker and Geuze, 1996; Honing et al., 1998; Dell’angelica isoforms with molecular masses of 35, 24, and 26kDa, et al., 2000). As shown in Figure 7a, alignment of the respectively. Similar results were observed in stable cytoplasmic tail at the C-terminus of LAPTM4B and transfection of pcDNA3-AE in HLE cells. As predicted, that of LAPTM4A revealed three ‘YXXF’, one ‘VL’, the 35- and 24-kDa proteins were the products of and one ‘LL’ motifs. It has been shown recently that two translations initiating from ATG at nt 157 and 430, ‘YXXF’ and one ‘VL’ motifs within the cytoplasmic tail

Oncogene Molecular cloning and characterization of LAPTM4B G-Z Shao et al 5066 of LAPTM4A are important for lysosomal membrane We have shown that LAPTM4B is overexpressed in targeting (Hogue et al., 2002). Therefore, LAPTM4B is most of the HCCs. An explanation for this phenomenon likely a lysosome-associated transmembrane protein. is that the transcription factors of LAPTM4B are Immunohistochemistry of LAPTM4B-FLAG transfec- upregulated in HCC. Promoter analysis revealed many tants showed that there were stained particles distrib- potential transcription factor binding sites within the 50 uted unevenly in the cytoplasm, suggesting that flanking sequence of LAPTM4B, including c-Ets-1, LAPTM4B may be localized predominantly on mem- LYF-1, E2F, c-JUN, and c-Myb. It has been reported brane-bound organelles including endosomes and that the c-Ets-1 oncogene was upregulated and involved lysosomes. Noticeably, there were also immunohisto- in the overexpression of MMP-7 (matrix metalloprotei- chemical stains on plasma membranes. Many newly nase-7) in human HCC (Ozaki et al., 2000). Our data synthesized proteins are transported to lysosomes also indicated that c-Ets-1 was overexpressed in HCC indirectly through a mechanism in which they are first compared with noncancerous liver tissues (not shown). delivered from the trans-Golgi network (TGN) to the Whether the increase of c-Ets-1 is responsible for cell surface, and then internalized and delivered to overexpression of LAPTM4B in HCC remains to be lysosomes by the endocytotic pathway (Hunziker and investigated. Further studies on this aspect are currently Geuze, 1996). There is evidence that some lysosome- underway. Other transcription factors such as LYF-1 associated proteins, such as CD63, are highly expressed and E2F may work synergistically with Ets-1 (Masu- on the cell surface, and interact with integrin a6b1 when moto et al., 2002). We also observed that the expressions malignant transformation or metastasis occurs (Radford of c-JUN and c-FOS were dramatically enhanced in et al., 1997). In HCC, whether overexpressed LAPTM4B-transfected HLE cells (data not shown). LAPTM4B on the cell surface contributes to cancer In conclusion, we reported the identification of development remains to be investigated. LAPTM4B, a novel gene overexpressed in most HCCs Both N- and C-termini of LAPTM4B contain the and HCC cell lines, and showed that upregulation of the proline-rich motif PXXP. In particular, the N-terminal gene correlated significantly with differentiation of stretch of LAPTM4B (ranging about 15 amino acids) HCC. Deregulation of the gene may contribute to the is not only rich in proline, but also flanked by development of HCC. We also demonstrated that the N- hydrophobic residues. This is the characteristic in terminus of the protein is essential for cell growth and SH3-domain ligands (Yu et al., 1994). All high-affinity survival. In addition, the promoter of the gene was SH3 ligands identified so far contain the PXXP cloned and analysed between BEL7402 and HLE cells, motif. Interestingly, sequences around the PXXP which would provide new clues to the mechanism motif in LAPTM4B revealed good alignment with the underlying deregulation of the gene in HCC. amino-acid stretches in PI3K, serine/threonine protein phosphatase 2A, protein kinase C, and guanylate cyclase, etc. (Figure 7b). Therefore, the proline-rich Materials and methods domain in LAPTM4B may point to a functional significance. Subjects The N-terminus of LAPTM4B contains several A total of 55 pairs of specimens were obtained from patients potential phosphorylation sites, that is, two sites for with HCC (aged from 35 to 70 years, average 5476.0) who cAMP/cGMP-dependent protein kinases and two for undertook hepatectomy at the Peking Union Medical College protein kinase C. There is also a tyrosine-phosphoryla- Hospital (the West Hospital) in Beijing between 1997 and tion site in the C-terminus. It is possible that LAPTM4B 2002. Histopathological analyses were independently per- may play important roles in signal transduction. The formed by pathologists. Tumor differentiation was graded as importance of the N-terminus of LAPTM4B was I, II, III, or IV according to the Edmindson Grading System investigated in HLE cells, a HCC cell line which (Edmondson and Steiner, 1954; Kenmochi et al., 1987). expresses LAPTM4B at a very low level (Figure 3a). Assayed by standard serological kits, the HBV infection rate As shown in colonogenic assay, HLE cells did not form was 84% among these patients. Specimens were frozen immediately after surgical resection and stored in liquid colonies when the pcDNA3-BE vector (containing the nitrogen. Total RNA from tissues was extracted and purified truncated LAPTM4B that lacks a 91 aa stretch from N- using a single-step method (Chomczynski and Sacchi, 1987). terminus) was introduced (Figure 5). This implies that the intact endogenous protein containing the N-terminal Primers 91 aa stretch is essential to cell survival. Therefore, the 24-kDa isoform (lacking the 91 aa stretch from the N Primers are listed below, followed with parentheses indicating terminus) expressed in the pcDNA3-BE transfectants their locations in LAPTM4B cDNA or promoter regions: may antagonize the endogenous protein (35 kDa) in a Gsp1: 50 TCCGTAAGTAGCCATAGCAC 30 (nt 686–705) dominant-negative manner. Such an antagonizing effect 0 0 can also explain the lacking of a significant increase in Gsp2: 5 GAGAAGAGAAATCGCAATGGCAATG 3 (nt 648–672) colony-formation efficiency observed in pcDNA3-AE- Gsp3: 50 ACATGTTGGCATCATCCATGAACTC 30 transfected HLE cells, since the pcDNA3-AE transfec- (nt 622–646) tants produced both 35- and 24-kDa isoforms. It is also Gsp4: 50 CTTTGACTTTGCCCTGAAC 30 (nt 756–774) highly possible that balances of the 35- and 24-/26-kDa Gsp5: 50 CATGAGCCTCTCTGAGCTTGTTTG 30 (nt 1190– proteins are subject to regulation in vivo. 1213)

Oncogene Molecular cloning and characterization of LAPTM4B G-Z Shao et al 5067 0 0 E1:5 GAATCTCGACCCTTGAATGGAGT 3 (nt 1–23) based on the cDNA sequence of LAPTM4B and the presence 0 0 E2:5 GCCGACTAGGGGACTGGCGGA 3 (nt 72–92) of GT–AG dinucleotide pairs in candidate splicing sites. The 0 0 E7:5 GTGGGCAAACCTTGTTTTAATTGC 3 (nt 2206– MatInspector program (http://www.genomatix.de/cgi-bin/ma- 2230) tinspector/matinspector.pl) was used to detect transcription 0 0 C1:5 TACTCCAACAGCTGCTGCTTGTG 3 (nt 460–482) factor binding sites in the promoter region. The Psort program 0 0 C2:5 GTTCAGGGCAAAGTCAAAG 3 (nt 756–774) was used for prediction of the transmembrane region. Multi- 0 0 D1:5 TTACTAAGTGTTCTGCCCTAGATTG 3 (nt 1876– alignments of LAPTM4B and its related proteins were per- 1900) formed using T-COFFEE program (http://www.ch.embnet. 0 0 D2:5 CAACAGGAGAGTTGCTGACTTTGT 3 (nt 2148– org/software/TCoffee.html). 2171) 0 0 G1:5 CTTTGACTTTGCCCTGAAC 3 (nt 756–774) Northern blot analysis 0 0 G2:5 CGTAGTGTCATTGCTGGTAACAT 3 (nt 1010– 1032) LAPTM4B-C,-D, and -G cDNA fragments located at nt 460– A: 50 GGGATCCGCCACCATGACGTCACGGACTCGG 774 and nt 1876–2171 of LAPTM4B (AY057051) were GTC 30 (nt 157–177) amplified from the LAPTM4B cDNA clone, using primer B: 50 CGGGATCCGCCACCATGAAGATGGTCGCGCC pairs C1/C2,D1/D2, and G1/G2. DIG labeling of LAPTM4B- CTGGA 30 (nt 430–451) C/D/G was performed as described in the DIG High Prime E: 50 CGGAATTCTTAGGCAGACACGTAAGGTGG 30 DNA Labeling and Detection Starter Kit II (Boehringer (nt 1090–1110) Mannhein, Germany). An MTN Northern blot (Clontech) F: 50 CGGAATTCGGCAGACACGTAAGGTGGCGG 30 containing 1 mg of poly(A) RNA of human tissues was first (nt 1090–1107) probed with DIG-LAPTM4B-D, and then stripped and F1: 30 GCGCTCGAG GCTCCAGGTGGA AGAGTGTGC 30 reprobed with DIG-LAPTM4B-C. For HCC and fetal tissue (nt À1341 to À1321) Northern blots, 30 mg of total RNAs from various cells and F2: 50 GCGCTCGAG TAA AAACGCTGTGCCAGGCGT tissues was fractionated on a 1% formaldehyde/agarose gel by þ 30 (nt À881 to À861) electrophoresis and transferred to Hybond-N nylon mem- F3: 50 CCGCTCGAG TACCGGAAGCACAGCGAGGAT branes, baked at 801C for 2 h, and used for hybridization. All þ 30 (nt À558 to À538) the Hybond-N nylon membranes were probed with DIG- F4: 50 GCGCTCGAG AGTAGAAGGGAAGAAAATCGC LAPTM4B-D, except that DIG-LAPTM4B-G was used for 30 (nt À38 to À18) H22 and HcaF cell lines instead. b-Actin was used as an R1: 50 GCGAAGCTT GGACTTGGCCATGTGACCCG 30 internal control. The membranes were exposed to X-ray films (nt 172–191) for 6–12 h. Quantitation of bands was performed with densitometry. Rapid amplification of cDNA ends (RACE) In situ hybridization To extend the cDNA transcript, 50- and 30-extension PCR were performed on human HCC cDNA. For 50 RACE, the first Antisense or sense cRNA probe for LAPTM4B (nt 1876–2171) round of PCR was performed with the gene-specific reverse was transcribed with SP6or T7 RNA polymerase using a primer Gsp1, followed by two rounds of nested PCR reactions digoxigenin labeling kit according to the manufacturer’s with the primers Gsp2 and Gsp3, respectively. For 30 RACE, protocol (Roche Molecular Biochemicals, Mannheim, Ger- the first PCR reaction with the gene-specific primer Gsp4 was many). Fresh HCC surgical specimens were sectioned and followed by a nested PCR using the primer Gsp5. Amplifica- fixed in 4% paraformaldehyde. Sections (mm) were subjected tion products were ligated into the pGEM-T Easy Vector to an in situ hybridization (ISH) according to the method (Promega). Sequence analysis was performed utilizing the ABI described by Zeng (Zeng et al., 2002). PRISM Ready Reaction Sequencing Kit and the ABI 310 automated sequencer (Perkin-Elmer). Eukaryotic expression and immunocharacterization Expression vectors pcDNA3-AE and -BE representing coding Full-length cDNA cloning of human LAPTM4B sequences initiating from the first and the second ATG in the To isolate the cDNA sequence of LAPTM4B, we took the ORF of LAPTM4B were constructed, respectively. pGEMT- approach of identifying its genome sequence first. The human E2E7 was used as the template to amplify the LAPTM4B genomic sequence was identified (Accession no. AC023073) ORFs using primers A or B and E, respectively. The PCR products were digested with BamHI and EcoRI, and subse- and used for designing primers (E1,E2, and E7) to clone the full-length cDNAs of LAPTM4B. HCC total RNA was quently ligated into pcDNA3.0 to produce pcDNA3-AE or reverse-transcripted to the cDNA at 601C, using ThermoScript -BE. The pcDNA3-AF and -BF were constructed with the same RT-PCR Systems (Gibco-BRL) according to the manufac- scheme except that pcDNA3-FLAG (tagged with FLAG at the turer’s instructions. PCR was performed using the HCC C-terminus) was used instead. pcDNA3-E2E7 contains the full- cDNA as templates. The RT–PCR products were ligated into length LAPTM4B cDNA (E2E7). The LAPTM4B cDNA the pGEM-T Easy Vector (Promega). Positive clones were fragment (E2E7) was obtained by NotI digestion of pGEMT- E E , and then cloned into pcDNA3.0 to generate pcDNA3- sequenced and named as pGEMT-E1E7 and -E2E7. 2 7 E2E7. Transient and stable transfections were conducted as follows. Exponentially growing BHK21 or HLE cells were Sequence analysis and determination of the genomic structure plated at 5 Â 105 cells/well in the six-well tissue culture dishes Nucleotide and protein BLAST programs at NCBI (http:// and grown for 18–24 h until up to 90% confluence was www.ncbi.nlm.nih. gov/BLAST/) were used for sequence reached. The cells were transfected with 5 mg of either homology searches in public databases, using the cDNA pcDNA3-E2E7,-AE, -BE, -AF, -BF, pcDNA3.0,orpcDNA- sequence of LAPTM4B (GenBank Accession no.: FLAG and 15 ml of LipofectAMINE 2000 (Invitrogen). For NM_018407, AY057051) as the query sequence. Aligned stable transfections, HLE cells were selected under G418 sequences were manually analysed for intron–exon junctions (600 mg/ml) for 2 weeks and clones were picked out. For

Oncogene Molecular cloning and characterization of LAPTM4B G-Z Shao et al 5068 Western blot analysis, untransfected and tansfected cells were 0.4% crystal violet in 20% ethanol. Colonies larger than 60 mm harvested and lysed in 80 ml lysis buffer (50 mm Tris-Cl, pH 7.6, were counted. Colony numbers were normalized by setting the 150 mm NaCl, 1% Triton X-114), and then centrifuged at 500 g colony number of the mock vector to 100%. The above for 3 min. The supernatants were separated on a 12% SDS– transfection experiment was repeated three times, and each PAGE gel and transferred to nitrocellular membranes for time triplicate transfections with each vector were performed. hybridization with the mouse anti-FLAG M2 monoclonal antibody (Sigma), or with the rabbit anti-LAPTM4B-10P Reporter plasmid construction and promoter analysis antibodies produced in our lab by immunization with a KLH- conjugated synthetic peptide composed of a 10 aa sequence in The 50 end flanking sequences upstream of exon 1 (including LAPTM4B (232–241 aa). ECL was used for detection of partial sequence of exon 1) were amplified by PCR primers F1 signals (Santa Cruz). (an XhoI site was introduced at the 50 end) and reverse primer R1 (an HindIII site was introduced at the 50 end), using the Immunohistochemistry genomic DNA from HCC as the template. The PCR fragments were digested with XhoI and HindIII and then cloned into the Cells were grown on 12-mm coverslips in 35-mm wells and polylinker site of the luciferase vector pGL3-Basic (Promega) transfected as described above. After post-transfection grow- to generate pGL3-PF1. Using pGL3-PF1 as the template, we ing for 48 h, cells were fixed in 4% PFA in PBS for 10 min, amplified the following proximal promoters (primer pairs are washed twice with PBS, and incubated in 3% H2O2 to block in parentheses): pGL3-PF2 (F2, R1); pGL3-PF3 (F3, R1); endogenous peroxidase activities. The cells were then incu- pGL3-PF4 (F4, R1). All of the PCR fragments were digested bated either at room temperature for 1 h or at 41C overnight with XhoI and HindIII, and then subcloned into pGL3-basic. with 2% goat sera in PBS to block nonspecific binding of All the plasmids were sequenced and confirmed that there were antibodies. The coverslips were further incubated sequentially no unwanted mutations. For transient transfections, BEL7402 with anti-FLAG M2 mouse monoclonal antibody (Sigma) and or HLE cells were transfected with LipofectAMINE 2000 in goat anti-mouse IgG conjugated to horseradish peroxidase. the 24-well culture plates without serum according to the Color developments were by incubation with 3,30-diamino- manufacturer’s recommendations. The LipofectAMINE 2000 benzidine tetrahydrochloride in 0.03% H2O2 and 50 mm Tris- complexes contained either the pGL-3 basic plasmid, or the HCl, pH 7.4. Hematoxylin was used for counterstaining. pGL-3 Promoter plasmid (positive control), or the test luciferase reporter plasmid without any supplements. After Colonogenic assay 6h incubation with the transfection reagents, the media were

4 changed to fetal bovine serum-containing media that did not HLE cells were seeded at a density of 6 Â 10 cells/well in the contain antibiotics. The transfected cell lines were cultivated 24-well plate 18–24 h before transfection. At 90% confluence, for 48 h, harvested, lysed, and assayed for luciferase activity cells were cotransfected with 0.5 mg of pSV-b-Gal (Promega) using the Luciferase Reporter Assay System (Promega) on a pcDNA3.0 pcDNA3-E E -AE -BE plus 1 mg of either , 2 7, or in POLARstar galaxy luminometer (bMG Corporation). Luci- the absence of serum, using the LipofectAMINE 2000 system. ferase activity of individual transfection was normalized At 48 h after transfection, one-fifth of the harvested cells were against the luciferase activity of the pGL3-Promoter. plated in six-well plates and incubated for 6h in 10% DMEM for measuring transfection efficiency using the In situ-b- Galactosidase Staining Kit (Stratagene). The remaining four- fifths of the cells were plated in 30 cm2 flasks and selected with Acknowledgements 700 mg/ml G418 (Invitrogen) in 10% DMEM for colony- This work was supported by grants from 985 Foundation of formation assays. G418 selection was continued for 3 weeks, Peking University and the National Natural Science Founda- cells were fixed with 2% formaldehyde in PBS and stained with tion of China (39800076).

References

Adra CN, Zhu S, Ko JL, Guillemot JC, Cuervo AM, Edmondson HA and Steiner PE. (1954). Cancer, 7, 462–503. Kobayashi H, Horiuchi T, Lelias JM, Rowley JD and Lim El-Serag HB. (2002). Hepatology, 36, S74–S83. B. (1996). Genomics, 35, 328–337. Feitelson MA. (1999). J. Cell. Physiol., 181, 188–202. Anthony PP. (2001). Histopathology, 39, 109–118. Fujimoto Y, Ohtake T, Nishimori H, Ikuta K, Ohhira M, Arii S, Mise M, Harada T, Furutani M, Ishigami S, Niwano Ono M and Kohgo Y. (1998). J. Gastroenterol., 33, M, Mizumoto M, Fukumoto M and Imamura M. (1996). 368–375. Hepatology, 24, 316–322. Graziano P, Flavio M, Carmela G, Giorgio G, Flavio L and Begum NA, Mori M, Matsumata T, Takenaka K, Sugimachi Sabino L. (2001). Gene, 276, 73–81. K and Barnard GF. (1995). Hepatology, 22, 1447–1455. Grigioni WF, Fiorentino M, D’Errico A, Ponzetto A, Crepaldi Boix L, Rosa JL, Ventura F, Castells A, Bruix J, Rodes J and T, Prat M and Comoglio PM. (1995). Hepatology, 21, 1543– Bartrons R. (1994). Hepatology, 19, 88–91. 1546. Cabrita MA, Hobman TC, Hogue DL, King KM and Cass Guo XZ, Friess H, Di-Mola FF, Heinicke JM, Abou-Shady CE. (1999). Cancer Res., 59, 4890–4897. M, Graber HU, Baer HU, Zimmermann A, Korc M and Chomczynski P and Sacchi N. (1987). Anal. Biochem., 162, Buchler MW. (1998). Hepatology, 28, 1481–1488. 156–159. He J, Shao GZ and Zhou RL. (2003). J. Peking University Cromlish JA. (1996). Trends Microbiol., 4, 270–274. (Health Sci.), 35 (in press). Deane NG, Parker MA, Aramandla R, Diehl L, Lee WJ, Higashitsuji H, Itoh K, Nagao T, Dawson S, Nonoguchi K, Washington MK, Nanney LB, Shyr Y and Beauchamp RD. Kido T, Mayer RJ, Arii S and Fujita J. (2000). Nat. Med., 6, (2001). Cancer Res., 61, 5389–5395. 96–99. Dell’Angelica EC, Mullins C, Caplan S and Bonifacino JS. Hogue DL, Ellison MJ, Young JD and Cass CE. (1996). J. (2000). FASEB J., 14, 1265–1278. Biol. Chem., 271, 9801–9808.

Oncogene Molecular cloning and characterization of LAPTM4B G-Z Shao et al 5069 Hogue DL, Kerby L and Ling V. (1999). J. Biol. Chem., 274, Ozaki I, Mizuta T, Zhao G, Yotsumoto H, Hara T, Kajihara 12877–12882. S, Hisatomi A, Sakai T and Yamamoto K. (2000). Cancer Hogue DL, Nash C and Ling V. (2002). Biochem. J., 365, 721– Res., 60, 6519–6525. 730. Peng SY, Chou SP and Hsu HC. (1998). J. Hepatol., 29, 281– Honing S, Sandoval IV and von Figura K. (1998). EMBO J., 289. 17, 1304–1314. Pineau P and Buendia MA. (2000). J. Hepatol., 33, Hunziker W and Geuze HJ. (1996). Bioessays, 18, 379–389. 152–156. Jiang Y, Xu WX, Lu J, He FC and Yang XM. (2001). Qin LF, Ng IO, Fan ST and Ng M. (1998). Int. J. Cancer, 79, Biochem. Biophys. Res. Commun., 286, 1123–1130. 424–428. Joo M, Kang YK, Kim MR, Lee HK and Jang JJ. (2001). Radford KJ, Thorne RF and Hersey P. (1997). J. Immunol., Liver, 21, 89–95. 158, 3353–3358. Kenmochi K, Sugihara S and Kojiro M. (1987). Liver, 7, 18–26. Tang Z. (1995). Chin. Med. J., 108, 568–570. Kozak M. (1999). Gene, 234, 187–208. Tannapfel A, Grund D, Katalinic A, Uhlmann D, Kockerling Le SY and Maizel JVJ. (1997). Nucleic Acids Res., 25, 362–369. F, Haugwitz U, Wasner M, Hauss J, Engeland K and Li D, Cao Y, He L, Wang NJ and Gu JR. (1993). Wittekind C. (2000). Int. J. Cancer, 89, 350–355. Carcinogenesis, 14, 169–173. Twu JS, Lai MY, Chen DS and Robinson WS. (1993). Lin YW, Sheu JC, Huang GT, Lee HS, Chen CH, Wang JT, Virology, 192, 346–350. Lee PH and Lu FJ. (1999). Eur. J. Cancer, 35, 652–658. Wong CM, Fan ST and Ng IO. (2001). Cancer, 92, Liu JJ, Zhang J, Zhang N, Rui JA, Jin C and Zhou RL. 136–145. (2000a). J. Beijing Med. Univ., 32, 411–414. Wu B, Wang M, You W and Yang S. (1996). Chin. Med. J., Liu JJ, Zhou RL, Zhang N, Rui JA and Jin C. (2000b). Chin. 109, 922–925. Med. J., 113, 881–885. Yao YJ, Ping XL, Zhang H, Chen FF, Lee PK, Ahsan H, Marchio A, Meddeb M, Pineau P, Danglot G, Tiollais P, Chen CJ, Lee PH, Peacocke M, Santella RM and Tsou HC. Bernheim A and Dejean A. (1997). Genes Chromosom. (1999). Oncogene, 18, 3181–3185. Cancer, 18, 59–65. Yeh FS, Yu MC, Mo CC, Luo S, Tong MJ and Henderson Masumoto N, Chen J and Sirotnak FM. (2002). Gene, 291, BE. (1989). Cancer Res., 49, 2506–2509. 169–176. Zeng JZ, Wang HY, Chen ZJ, Ullrich A and Wu MC. (2002). Nakakura EK and Choti MA. (2000). Oncology, 14, 1085–1098. Oncogene, 21, 4932–4943.

Oncogene