Development of a SYBR Green… Safar Ali. A. et al 241
ORIGINAL ARTICLE
Development of a SYBR Green Multiplex Real Time PCR for Simultaneous Detection of Mycobacterium Tuberculosis and Nocardia Asteroides in Respiratory Samples Safar Ali Alizadeh1*, Amir Javadi2, Jalal Mardaneh3,4, Neda Nasirian5, Sajjad Alizadeh6, Maryam Mohammadbeigi7, Siamak Heidarzadeh8
5Department of pathology, School of Medicine, Qazvin University of Medical Sciences, OPEN ACCESS Qazvin, Iran. 6Medical Doctor, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. Citation: Safar Ali Alizadeh, Amir 7Department of Microbiology and Immunology, School of Medicine, Qazvin University of Javadi, Jalal Mardaneh, Neda Nasirian, Medical Sciences, Qazvin, Iran. Sajjad Alizadeh, Maryam 8Department of Microbiology and Virology, School of Medicine, Zanjan University of Mohammadbeigi, Siamak Heidarzadeh. Medical Sciences, Zanjan, Iran. Development of an SYBR Green *Email: [email protected] Multiplex Real Time PCR for Simultaneous Detection of ABSTRACT Mycobacterium Tuberculosis and
Nocardia Asteroides in Respiratory Samples. Ethiop J Health Sci. 2021; BACKGROUND፡ Nocardia asteroides and Mycobacterium 31(2):241 tuberculosis are worldwide-distributed bacteria. These infectious doi:http://dx.doi.org/10.4314/ejhs.v31i2.6 Received: October 27, 2020 agents can cause many infections in humans, especially in Accepted: November 23, 2020 immunocompromised individuals. Pulmonary infections are more Published: March 1, 2021 common and have similar clinical symptoms. Proper diagnosis Copyright : © 2021 Safar A.A.., et al. This is an open access article distributed and treatment of these patients are important for accurate under the terms of the Creative treatment and could be lifesaving. Commons Attribution License, which permits unrestricted use, distribution, METHODS: In this study, a multiplex real-time PCR assay was and reproduction in any medium, established for the simultaneous detection of the N. asteroides provided the original author and source and M. tuberculosis. Both this homemade multiplex real time are credited. Funding: This work was supported by PCR and routine commercial tuberculosis tests were performed Qazvin University of Medical Sciences on 150 pulmonary specimens collected from individuals suspected (grant number to have tuberculosis. IR.QUMS.REC.1397.012). Competing Interests: The authors RESULTS: From 150 specimens, 20 samples were acid fast declare that this manuscript was positive, 14 positives for M. tuberculosis by singleplex real time approved by all authors in its form and that no competing interest exists. PCR, 10 positives for N. asteroides by singleplex real time PCR Affiliation and Correspondence: and 2 positives for M. tuberculosis and N. asteroides by multiplex 1Medical Microbiology Research real time PCR whereas 14 samples were positive for M. Center, Qazvin University of Medical Sciences, Qazvin, Iran. tuberculosis with commercial test. Differential diagnosis of 2Department of Social Medicine, pulmonary tuberculosis is useful for their proper treatment. School of Medicine, Qazvin CONCLUSION: Our test had good performance for differential University of Medical Sciences, Qazvin, Iran. diagnosis of tuberculosis and nocardiosis. Therefore, it is 3Department of Microbiology, School recommended to be used to diagnose such patients. of Medicine, Infectious Diseases Research Center, Gonabad University KEYWORDS: Mycobacterium tuberculosis, Nocardia asteroides, of Medical Sciences, Gonabad, Iran. Respiratory samples 4Department of Microbiology, School of Medicine, Student Research Committee, Gonabad University of Medical Sciences, Gonabad, Iran.
DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6
242 Ethiop J Health Sci. Vol. 31, No. 2 March 2021
INTRODUCTION Sputum and bronchoalveolar lavage (BAL) in pulmonary disease, abscesses and skin biopsies in skin Mycobacterium tuberculosis (MTB) and infections are typically sent to medical laboratories for Nocardia asteroides (NA) are diagnosis of in all of these samples, both bacteria can worldwide- distributed bacteria (1,2). be present as possible causes of infection (10). Prompt These microorganisms can cause many and accurate diagnosis of patients will result in timely infections in humans especially those and appropriate treatment (10,11). Therefore, the who are immunocompromised. The development of new methods is necessity for clinical manifestations of these infections differential diagnosis of nocardiosis and tuberculosis are mostly pulmonary (1,3,4). (11). Tuberculosis and nocardiosis often have In order to rapid and efficient Identification of similar clinical symptoms and MTB and NA in clinical samples, we developed a radiological view, although extra multiplex real time PCR that identifies both bacteria at pulmonary infections have also been the same time in single tube with high sensitivity and reported in the brain, skin and lymphatic specificity. systems (1,5,6). In many cases, the bacteria that cause the infection are not MATERIAL AND METHODS properly diagnosed. However, accurate differential diagnosis of the causative Design of primers: We designed two pairs of agents of infections plays an essential dedicated primers to identify MTB and NA using role in their treatment. Usually, the first Beacon designer 7 software (Table 1). The melting step in the laboratory diagnosis of these temperature (Tm) of each primer pair was adjusted infections is established based on direct so that they did not have a significant distance but tests including gram stain, Ziel-Neelsen, the Tm of reaction products has a significant direct fluorescence test and culture distance to be distinguishable in melting curve methods. Both bacteria are directly seen analysis. M. tuberculosis and N. asteroides as gram positive and acid fast positive (7). After direct exams, culture of clinical reference DNA sequences were extracted from samples and identification tests are Gene Bank usually performed. Generally, clinical (http://www.ncbi.nlm.nih.gov/GenBank). We used samples are cultured based on the direct the target conserved sequence used in previous study results. The apparent similarity of studies and encoded the primers (11,12). The these bacteria in direct vision can cause primers were evaluated at NCBI database that the detection process to deviate in the proved to be unrelated to the genome of other wrong direction. In addition, the bacteria and human target. The primers were also cultivation technique for these bacteria, cross-analyzed for reactivity with together. especially MTB is time consuming and prolonged (8,9).
Table 1: Primer sequences used to identify Mycobacterium tuberculosis (MTB) and Nocardia asteroides (NA)
Primers names Primers sequences Tm of amplicons Mycobacterium F: 5´ GACCCGCCAGCCCAGGAT 3´ 90.2 tuberculosis (MTB) R: 5´TTCGGACCACCAGCACCTAA 3´ Nocardia asteroides (NA) F: 5´ TAGGGTGCGAGCGTTGTC 3´ 85.9 R: 5´CTTCTCAGCGTCAGTTACTTCC 3´ Beta actin F: 5′ GTGGGCCGCTCTAGGCACCAA 3´ 88.2 R: 5′ AAATCGTGCGTGACATCAAAGAG 3´
DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6
Development of a SYBR Green… Safar A.A. et al 243
Standard bacterial strains: M. pulmonary tuberculosis diagnosis. Sputum and tuberculosis H37R and N. asteroids ATCC other pulmonary secretions were collected. 19247 were prepared from Pasteur Institute of Initially, all specimens were stained with Ziel Iran. The DNA of these bacteria was used to Neelsen method and carefully studied by optimize Real Time PCR reactions. microscopy. DNA of all patient samples were
Optimizing real time PCR reactions: extracted using the Roche's DNA extraction kit Singleplex Real time PCR reactions were after homogenization. The quality of DNA optimized using each primer pair separately and samples was evaluated using Human beta actin the standard DNA of each bacterium. These gene as control gene. Any samples that had reactions were performed using the Takara negative response to beta actin gene specific SYBR Green master mix and StepOne plus ABI primers were replaced with other ones. Finally, real time PCR equipment. Finally, after all samples were tested using NA and MTB optimizing each pair of primers separately, specific primers singleplex and multiplexed optimization was performed with both primer using both pairs of primers. In addition, all pairs in single tube. The multiplex real time PCR samples were tested with a commercial Sina- reaction mixture consisted one microliter (µl) of clone kit for detecting of M. tuberculosis. extracted DNA containing approximately 50 Detection of MTB and NA was done by nanogram (ng) of DNA, 10 µl of SYBR Green analyzing the melting curve and Tm of the master mix (2x), 0.4 µl of MTB and NA primers reaction curve. Tm values were 85.9 for NA and (10 pmol/µl) and deionized water to a final 90.2 for MTB. Because the Tm temperatures of volume of 20 µl. The best physical conditions each particular product were sufficiently far were optimized to 10 min at 95 degrees as pre- apart, NA and MTB were easily distinguishable. denaturation, 35 cycles of 95ᵒC for 15 seconds, RESULTS 60ᵒC for 45 seconds. Finally, the melting curve was drawn from 65°C to 95°C with a gradual The NA and MTB genome sequences were increase of 0.11ᵒC. After adjusting the physical downloaded from Gene Bank and the specificity and chemical conditions of the multiplex of the two primers was confirmed. In addition, reaction, the melt curve of the reactions was using the NCBI database, it was found that analyzed to confirm the specificity of the primers do not bind to any target other than their reaction. At the end, real time PCR reaction original target such as other bacteria and human, products were analyzed by gel electrophoresis and only match the expected target. Using both too. primer pairs and standard MTB and NA strains,
Evaluation of multiplex real-time PCR: The Real Time PCR reactions were first optimized sensitivity of optimized multiplex Real time by singleplex. It was confirmed that the PCR was assayed by preparation serial dilution expected bands were being generated. The from 0.5 McFarland bacterial suspensions to 10 products of singleplex reaction were sequenced bacteria per milliliter. DNA from pellet of each and their accuracy was confirmed. When dilution was extracted using the Roche's standard MTB and NA strains were tested by commercial DNA extraction kit. Specificity was singleplex reactions separately, the Tm for MTB assessed using DNA of non-target bacteria and NA was obtained 90 °C and 85 °C, according to other researcher's methods (13). respectively as our expect. After these steps, the Finally, the reaction repeatability was performed multiplex reaction was optimized using the by triplicate. In order to simulate clinical DNAs of both MTB and NA and the melting samples, the DNA of target bacteria was mixed curve of the products was exactly similar with with blood in serial dilutions and the ability of the singleplex reaction and nonspecific peak was the multiplex reaction to detect the target not observed. A nontemplate reaction was also bacteria in the blood was investigated. done as negative control and no amplification plot was observed. Occasionally, due to the Running multiplex reaction on clinical formation of a primer dimer in the negative specimens: A total of 150 samples were selected control tube, a non-specific Tm was observed from patients referred to the laboratory for
DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6
244 Ethiop J Health Sci. Vol. 31, No. 2 March 2021 below 75°C (Figures 1, 2 and 3). Intra and Inter- singleplex and multiplex assays for all dilutions. assay were tested three times and the multiplex All tests were performed triplicate. The result reaction repeatability was confirmed. The 0.5- showed that this method was able to detect 1000 McFarland bacteria suspension was diluted copies, and this ability is stable when the serially. The Real Time PCR was done in the bacteria are mixed with whole blood.
Figure 2: Melting curve reaction of NA Figure 1: Melting curve of MTB detection alone detection alone
Figure 3: Melting curve PCR reaction of NA and MTB detection in Multiplex Real Time PCR
As show in Table 2, the multiplex reaction line with the results of the Sina-clone showed 100% concordance with MTB detection commercial kit. Two samples of patients had a kit results. Our reaction is able to detect quickly mixture infection MTB and NA, which was well MTB and NA in clinical specimens by diagnosed with our test. examining the melting curve. The results were in
DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6
Development of a SYBR Green… Safar A.A. et al 245
Table 2: Results of homemade multiplex real time PCR and standard tests for Mycobacterium tuberculosis (MTB) and Nocardia asteroides (NA) detection
Results Multiplex Singleplex Real Time Singleplex Real Sina-clone Ziel-Neelsen Real Time MTB –PCR Time Commercial Kit Direct smear PCR NA- PCR Acid Fast Bacteria - - - - 20 NA 10 - 10 - - MTB 14 14 - 14 - MTB and NA (mixed) 2 - - - -
DISCUSSION collected from patients suspected of having tuberculosis. The results showed that this test Differential diagnosis of infectious agents with could be very useful in the differential diagnosis similar symptoms is difficult for both physicians of tuberculosis, nocardiosis and other similar and medical laboratories (11). Solving this infections. problem is important for physicians and exciting As shown in Table 2, of the 150 samples of for microbiology laboratories. Accurate, rapid clinically suspected tuberculosis, 20 patients and easy detection of infectious elements from a were Ziehl-Neelsen positive. The results of variety of clinical specimens has always been multiplex real time PCR were 10 NA positive the aspiration of microbiologists in laboratories. and 14 MTB positive. Two patients were Sometimes, symptoms of pulmonary nocardiosis positive for NA and MTB simultaneously. are nonspecific and mimic to tuberculosis in Based on these results, it can be concluded that clinical feature. The radiological signs of two mix-infected patients were misdiagnosed nocardiosis are similar to pulmonary with routine tests. Other two patients were MTB tuberculosis at times. Diagnosis of these positive by our test while were negative with infections is controversial (14-16). Ziel Neelsen method. Therefore, they would be Iran has a high potential for developing probably misdiagnosed by traditional methods. tuberculosis because of its geographical location On the other hand, ten patients who had only and neighboring countries. Iran's proximity to nocardiosis, were treated earlier. In addition, for countries such as the Russian Federation with the final diagnosis of patients, it was necessary to high levels of MDR-Tb and Afghanistan has wait a month for the results of culture tests. caused a high prevalence of TB in some By careful study of the multiplex test geographical areas such as Khorasan, Sistan and results in our small population of suspected Baluchistan (17). tuberculosis patients, the importance of our test Therefore, the accurate and rapid diagnosis in tuberculosis diagnosis and proper treatment of of TB and its differentiation with similar patients is obvious. However, this test worked diseases in Iran is highly important. We well in our study. We suggest that it should be designed a highly sensitive and precise performed in a larger population. molecular method capable of detecting both Mycobacterium tuberculosis and Nocardia ACKNOWLEDGEMENT asteroids simultaneously in a single test tube. Their validity was verified using NCBI This work was funded by a research grant from databases. In the laboratory using standard the Vice of Research, Qazvin University of bacteria MTB and NA, each assay was Medical Sciences, Qazvin, Iran. Project Number optimized separately and then multiplexed. The 28/20/15947. Ethical code: primers quality, sensitivity, and specificity were IR.QUMS.REC.1397.012. adjusted to excellent level, and analysis of the melting curves of all reactions confirmed that they produced no nonspecific reactions. Finally, this setup test was performed on 150 specimens
DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6
246 Ethiop J Health Sci. Vol. 31, No. 2 March 2021
REFERENCES clinical samples. African Journal of Biotechnology. 2011;10(26):5096-101. 1. Eshraghi SS, Heidarzadeh S, Soodbakhsh A, 9. Haldar S, Chakravorty S, Bhalla M, De Pourmand M, Ghasemi A, GramiShoar M, Majumdar S, Tyagi JS. Simplified detection et al. Pulmonary nocardiosis associated with of Mycobacterium tuberculosis in sputum cerebral abscess successfully treated by co- using smear microscopy and PCR with trimoxazole: a case report. Folia molecular beacons. Journal of medical Microbiologica. 2014;59(4):277-81. microbiology. 2007;56(10):1356-62. 2. Feyisa SG, Abdurahman AA, Jimma W, 10. Helal ZH, Khan MI, Ashour MS, Eissa SA. Chaka EE, Kardan-Yamchi J, Kazemian H. Detection and characterization of nocardia Resistance of Mycobacterium tuberculosis from patients diagnosed as tuberculosis in strains to Rifampicin: A systematic review egypt. International journal of biomedical and meta-analysis. Heliyon. science : IJBS. 2008;4(3):179-84. 2019;5(1):e01081. 11. Ekrami A, Khosravi AD, Zadeh ARS, 3. Lewinsohn DM, Leonard MK, LoBue PA, Hashemzadeh M. Nocardia co-infection in Cohn DL, Daley CL, Desmond E, et al. patients with pulmonary tuberculosis. Official American Thoracic Jundishapur journal of microbiology. Society/Infectious Diseases Society of 2014;7(12):e12495. America/Centers for Disease Control and 12. Wei Z, Zhang X, Wei C, Yao L, Li Y, Prevention clinical practice guidelines: Zhang X, et al. Diagnostic accuracy of in- diagnosis of tuberculosis in adults and house real-time PCR assay for children. Clinical Infectious Diseases. Mycobacterium tuberculosis: a systematic 2017;64(2):e1-e33. review and meta-analysis. BMC Infect Dis. 4. Amiri MRJ, Siami R, Khaledi A. 2019;19(1):701. Tuberculosis Status and Coinfection of 13. Li S, Peng Y, Rui Y. Multiplex real-time Pulmonary Fungal Infections in Patients PCR assays to detect Stenotrophomonas Referred to Reference Laboratory of Health maltophilia carrying sul1, sul2, and sul3 Centers Ghaemshahr City during 2007- genes. Journal of microbiological methods. 2017. Ethiopian journal of health sciences. 2019;156:52-9. 2018;28(6):683-90. 14. Saubolle MA, Sussland D. Nocardiosis: 5. Forbes BA, Hall GS, Miller MB, Novak review of clinical and laboratory experience. SM, Rowlinson MC, Salfinger M, et al. Journal of clinical microbiology. Practice Guidelines for Clinical 2003;41(10):4497-501. Microbiology Laboratories: Mycobacteria. 15. Valenzuela-Tovar JF, Contreras-Pérez C, Clinical microbiology reviews. 2018;31(2). Shibayama-Hernández H, Chávez-González 6. Kandi V. Human Nocardia Infections: A L, Vázquez-Chacón CA, Olivera-Díaz H. Review of Pulmonary Nocardiosis. Cureus. Biochemical identification and molecular 2015;7(8):e304. characterization (PCR-RFLP) of Nocardia 7. Couble A, Rodríguez-Nava V, de Montclos isolates from sputum. Archives of medical MP, Boiron P, Laurent F. Direct detection of research. 2005;36(4):356-61. Nocardia spp. in clinical samples by a rapid 16. De S, Desikan P. Pulmonary nocardiosis molecular method. Journal of clinical mimicking relapse of tuberculosis. BMJ case microbiology. 2005;43(4):1921-4. reports. 2009;2009. DOI: 8. Kohan L, Shahhosseiny MH, Razavi MR, 10.1136/bcr.06.2008.0233 Parivar K, Moslemi E, Werngren J. 17. Tavakoli A. Incidence and prevalence of Evaluation of loop mediated isothermal tuberculosis in Iran and neighboring amplification for diagnosis of countries. Zahedan Journal of Research in Mycobacterium tuberculosis complex in Medical Sciences. 2017;19(7):e9238.
DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6