DOCSLIB.ORG

Development of a SYBR Green Multiplex Real Time PCR For

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development of a SYBR Green Multiplex Real Time PCR For Development of a SYBR Green… Safar Ali. A. et al 241 ORIGINAL ARTICLE Development of a SYBR Green Multiplex Real Time PCR for Simultaneous Detection of Mycobacterium Tuberculosis and Nocardia Asteroides in Respiratory Samples Safar Ali Alizadeh1*, Amir Javadi2, Jalal Mardaneh3,4, Neda Nasirian5, Sajjad Alizadeh6, Maryam Mohammadbeigi7, Siamak Heidarzadeh8 5Department of pathology, School of Medicine, Qazvin University of Medical Sciences, OPEN ACCESS Qazvin, Iran. 6Medical Doctor, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. Citation: Safar Ali Alizadeh, Amir 7Department of Microbiology and Immunology, School of Medicine, Qazvin University of Javadi, Jalal Mardaneh, Neda Nasirian, Medical Sciences, Qazvin, Iran. Sajjad Alizadeh, Maryam 8Department of Microbiology and Virology, School of Medicine, Zanjan University of Mohammadbeigi, Siamak Heidarzadeh. Medical Sciences, Zanjan, Iran. Development of an SYBR Green *Email: [email protected] Multiplex Real Time PCR for Simultaneous Detection of ABSTRACT Mycobacterium Tuberculosis and Nocardia Asteroides in Respiratory Samples. Ethiop J Health Sci. 2021; BACKGROUND፡ Nocardia asteroides and Mycobacterium 31(2):241 tuberculosis are worldwide-distributed bacteria. These infectious doi:http://dx.doi.org/10.4314/ejhs.v31i2.6 Received: October 27, 2020 agents can cause many infections in humans, especially in Accepted: November 23, 2020 immunocompromised individuals. Pulmonary infections are more Published: March 1, 2021 common and have similar clinical symptoms. Proper diagnosis Copyright : © 2021 Safar A.A.., et al. This is an open access article distributed and treatment of these patients are important for accurate under the terms of the Creative treatment and could be lifesaving. Commons Attribution License, which permits unrestricted use, distribution, METHODS: In this study, a multiplex real-time PCR assay was and reproduction in any medium, established for the simultaneous detection of the N. asteroides provided the original author and source and M. tuberculosis. Both this homemade multiplex real time are credited. Funding: This work was supported by PCR and routine commercial tuberculosis tests were performed Qazvin University of Medical Sciences on 150 pulmonary specimens collected from individuals suspected (grant number to have tuberculosis. IR.QUMS.REC.1397.012). Competing Interests: The authors RESULTS: From 150 specimens, 20 samples were acid fast declare that this manuscript was positive, 14 positives for M. tuberculosis by singleplex real time approved by all authors in its form and that no competing interest exists. PCR, 10 positives for N. asteroides by singleplex real time PCR Affiliation and Correspondence: and 2 positives for M. tuberculosis and N. asteroides by multiplex 1Medical Microbiology Research real time PCR whereas 14 samples were positive for M. Center, Qazvin University of Medical Sciences, Qazvin, Iran. tuberculosis with commercial test. Differential diagnosis of 2Department of Social Medicine, pulmonary tuberculosis is useful for their proper treatment. School of Medicine, Qazvin CONCLUSION: Our test had good performance for differential University of Medical Sciences, Qazvin, Iran. diagnosis of tuberculosis and nocardiosis. Therefore, it is 3Department of Microbiology, School recommended to be used to diagnose such patients. of Medicine, Infectious Diseases Research Center, Gonabad University KEYWORDS: Mycobacterium tuberculosis, Nocardia asteroides, of Medical Sciences, Gonabad, Iran. Respiratory samples 4Department of Microbiology, School of Medicine, Student Research Committee, Gonabad University of Medical Sciences, Gonabad, Iran. DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6 242 Ethiop J Health Sci. Vol. 31, No. 2 March 2021 INTRODUCTION Sputum and bronchoalveolar lavage (BAL) in pulmonary disease, abscesses and skin biopsies in skin Mycobacterium tuberculosis (MTB) and infections are typically sent to medical laboratories for Nocardia asteroides (NA) are diagnosis of in all of these samples, both bacteria can worldwide- distributed bacteria (1,2). be present as possible causes of infection (10). Prompt These microorganisms can cause many and accurate diagnosis of patients will result in timely infections in humans especially those and appropriate treatment (10,11). Therefore, the who are immunocompromised. The development of new methods is necessity for clinical manifestations of these infections differential diagnosis of nocardiosis and tuberculosis are mostly pulmonary (1,3,4). (11). Tuberculosis and nocardiosis often have In order to rapid and efficient Identification of similar clinical symptoms and MTB and NA in clinical samples, we developed a radiological view, although extra multiplex real time PCR that identifies both bacteria at pulmonary infections have also been the same time in single tube with high sensitivity and reported in the brain, skin and lymphatic specificity. systems (1,5,6). In many cases, the bacteria that cause the infection are not MATERIAL AND METHODS properly diagnosed. However, accurate differential diagnosis of the causative Design of primers: We designed two pairs of agents of infections plays an essential dedicated primers to identify MTB and NA using role in their treatment. Usually, the first Beacon designer 7 software (Table 1). The melting step in the laboratory diagnosis of these temperature (Tm) of each primer pair was adjusted infections is established based on direct so that they did not have a significant distance but tests including gram stain, Ziel-Neelsen, the Tm of reaction products has a significant direct fluorescence test and culture distance to be distinguishable in melting curve methods. Both bacteria are directly seen analysis. M. tuberculosis and N. asteroides as gram positive and acid fast positive (7). After direct exams, culture of clinical reference DNA sequences were extracted from samples and identification tests are Gene Bank usually performed. Generally, clinical (http://www.ncbi.nlm.nih.gov/GenBank). We used samples are cultured based on the direct the target conserved sequence used in previous study results. The apparent similarity of studies and encoded the primers (11,12). The these bacteria in direct vision can cause primers were evaluated at NCBI database that the detection process to deviate in the proved to be unrelated to the genome of other wrong direction. In addition, the bacteria and human target. The primers were also cultivation technique for these bacteria, cross-analyzed for reactivity with together. especially MTB is time consuming and prolonged (8,9). Table 1: Primer sequences used to identify Mycobacterium tuberculosis (MTB) and Nocardia asteroides (NA) Primers names Primers sequences Tm of amplicons Mycobacterium F: 5´ GACCCGCCAGCCCAGGAT 3´ 90.2 tuberculosis (MTB) R: 5´TTCGGACCACCAGCACCTAA 3´ Nocardia asteroides (NA) F: 5´ TAGGGTGCGAGCGTTGTC 3´ 85.9 R: 5´CTTCTCAGCGTCAGTTACTTCC 3´ Beta actin F: 5′ GTGGGCCGCTCTAGGCACCAA 3´ 88.2 R: 5′ AAATCGTGCGTGACATCAAAGAG 3´ DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6 Development of a SYBR Green… Safar A.A. et al 243 Standard bacterial strains: M. pulmonary tuberculosis diagnosis. Sputum and tuberculosis H37R and N. asteroids ATCC other pulmonary secretions were collected. 19247 were prepared from Pasteur Institute of Initially, all specimens were stained with Ziel Iran. The DNA of these bacteria was used to Neelsen method and carefully studied by optimize Real Time PCR reactions. microscopy. DNA of all patient samples were Optimizing real time PCR reactions: extracted using the Roche's DNA extraction kit Singleplex Real time PCR reactions were after homogenization. The quality of DNA optimized using each primer pair separately and samples was evaluated using Human beta actin the standard DNA of each bacterium. These gene as control gene. Any samples that had reactions were performed using the Takara negative response to beta actin gene specific SYBR Green master mix and StepOne plus ABI primers were replaced with other ones. Finally, real time PCR equipment. Finally, after all samples were tested using NA and MTB optimizing each pair of primers separately, specific primers singleplex and multiplexed optimization was performed with both primer using both pairs of primers. In addition, all pairs in single tube. The multiplex real time PCR samples were tested with a commercial Sina- reaction mixture consisted one microliter (µl) of clone kit for detecting of M. tuberculosis. extracted DNA containing approximately 50 Detection of MTB and NA was done by nanogram (ng) of DNA, 10 µl of SYBR Green analyzing the melting curve and Tm of the master mix (2x), 0.4 µl of MTB and NA primers reaction curve. Tm values were 85.9 for NA and (10 pmol/µl) and deionized water to a final 90.2 for MTB. Because the Tm temperatures of volume of 20 µl. The best physical conditions each particular product were sufficiently far were optimized to 10 min at 95 degrees as pre- apart, NA and MTB were easily distinguishable. denaturation, 35 cycles of 95ᵒC for 15 seconds, RESULTS 60ᵒC for 45 seconds. Finally, the melting curve was drawn from 65°C to 95°C with a gradual The NA and MTB genome sequences were increase of 0.11ᵒC. After adjusting the physical downloaded from Gene Bank and the specificity and chemical conditions of the multiplex of the two primers was confirmed. In addition, reaction, the melt curve of the reactions was using the NCBI database, it was found that analyzed to confirm the specificity of the primers do not
Load more

Recommended publications
  • Accuprobe Mycobacterium Avium Complex Culture
    non-hybridized and hybridized probe. The labeled DNA:RNA hybrids are measured in a Hologic luminometer. A positive result is a luminometer reading equal to or greater than the cut-off. A value below this cut-off is AccuProbe® a negative result. REAGENTS Note: For information on any hazard and precautionary statements that MYCOBACTERIUM AVIUM may be associated with reagents, refer to the Safety Data Sheet Library at www.hologic.com/sds. COMPLEX CULTURE Reagents for the ACCUPROBE MYCOBACTERIUM AVIUM COMPLEX IDENTIFICATION TEST CULTURE IDENTIFICATION TEST are provided in three separate reagent kits: INTENDED USE The ACCUPROBE MYCOBACTERIUM AVIUM COMPLEX CULTURE ACCUPROBE MYCOBACTERIUM AVIUM COMPLEX PROBE KIT IDENTIFICATION TEST is a rapid DNA probe test which utilizes the Probe Reagent. (4 x 5 tubes) technique of nucleic acid hybridization for the identification of Mycobacterium avium complex Mycobacterium avium complex (M. avium complex) isolated from culture. Lysing Reagent. (1 x 20 tubes) Glass beads and buffer SUMMARY AND EXPLANATION OF THE TEST Infections caused by members of the M. avium complex are the most ACCUPROBE CULTURE IDENTIFICATION REAGENT KIT common mycobacterial infections associated with AIDS and other Reagent 1 (Lysis Reagent). 1 x 10 mL immunocompromised patients (7,15). The incidence of M. avium buffered solution containing 0.04% sodium azide complex as a clinically significant pathogen in cases of chronic pulmonary disease is also increasing (8,17). Recently, several Reagent 2 (Hybridization Buffer). 1 x 10 mL laboratories have reported that the frequency of isolating M. avium buffered solution complex is equivalent to or greater than the frequency of isolating M.
    [Show full text]
  • Actinomycesspp & Nocardiaspp
    PLUMB’S THERAPEUTICS BRIEF h PATHOGEN PROFILE h PEER REVIEWED Actinomyces spp & Nocardia spp J. Scott Weese, DVM, DVSc, DACVIM University of Guelph Actinomyces spp and Nocardia spp are members of class Acti- Nocardia spp nobacteria, which can cause opportunistic infections in dogs, The Nocardia genus contains more than 30 saprophytic species cats, and other species. Both can cause pyogranulomatous or that are widely, if not ubiquitously, disseminated in the environ- suppurative disease that is often slowly progressing and chal- ment. Disease occurs following inoculation of the bacterium into lenging to diagnose; however, some differences in organism tissue or via inhalation. and characteristics exist (Table 1, next page). The incidence of h Nocardia spp are regionally variable, with higher rates of disease caused by either is undefined and likely low. infection in dry, dusty, and windy regions (eg, southwestern United States, parts of Australia). Actinomyces spp h Nocardiosis is classically divided into 3 clinical forms: Many different species are present, and taxonomy continues to pulmonary, disseminated (systemic), and cutaneous/ change; some species previously known as Actinomyces have subcutaneous.11-15 been reclassified in other genera, such as Arcanobacterium spp • Clinical presentations are as would be expected with pul- and Trueperella spp. Regardless, disease aspects remain monary, systemic, or cutaneous infections. Pulmonary or unchanged. Commonly found as part of the oral, GI, and genital cutaneous disease can progress to disseminated disease. microbiotas,1-3 Actinomyces spp and related genera are of lim- ited virulence unless inoculated into tissue (eg, via bites, foreign Diagnosis bodies, or trauma). Early diagnosis may be missed.
    [Show full text]
  • Evaluation Ofapi Coryne System for Identifying Coryneform Bacteria
    756 Y Clin Pathol 1994;47:756-759 Evaluation of API Coryne system for identifying coryneform bacteria J Clin Pathol: first published as 10.1136/jcp.47.8.756 on 1 August 1994. Downloaded from A Soto, J Zapardiel, F Soriano Abstract that are aerobe or facultatively aerobe, non- Aim-To identify rapidly and accurately spore forming organisms of the following gen- coryneform bacteria, using a commercial era: Corynebacterium, Listeria, Actinomyces, strip system. Arcanobacterium, Erysipelothrix, Oerskovia, Methods-Ninety eight strains of Cory- Brevibacterium and Rhodococcus. It also per- nebacterium species and 62 additional mits the identification of Gardnerella vaginalis strains belonging to genera Erysipelorix, which often has a diphtheroid appearance and Oerskovia, Rhodococcus, Actinomyces, a variable Gram stain. Archanobacterium, Gardnerella and We studied 160 organisms in total from dif- Listeria were studied. Bacteria were ferent species of the Corynebacterium genus, as identified using conventional biochemi- well as from other morphological related gen- cal tests and a commercial system (API- era or groups, some of them not included in Coryne, BioMerieux, France). Fresh rab- the API Coryne database. bit serum was added to fermentation tubes for Gardnerella vaginalis isolates. Results-One hundred and five out ofthe Methods 160 (65.7%) organisms studied were cor- The study was carried out on Gram positive rectly and completely identified by the bacilli belonging to the genera Coryne- API Coryne system. Thirty five (21.8%) bacterium, Erysipelothrix, Oerskovia, Rhodococcus, more were correctly identified with addi- Actinomyces, Arcanobacterium, Gardnerella and tional tests. Seventeen (10-6%) organisms Listeria included in the API Coryne database were not identified by the system and (table 1).
    [Show full text]
  • Cord Factor (A,A-Trehalose 6,6'-Dimycolate) Inhibits Fusion Between Phospholipid Vesicles (Trehalose/Membrane Fusion/Liposomes/Tuberculosis/Nocardiosis) B
    Proc. Nati. Acad. Sci. USA Vol. 88, pp. 737-740, February 1991 Biochemistry Cord factor (a,a-trehalose 6,6'-dimycolate) inhibits fusion between phospholipid vesicles (trehalose/membrane fusion/liposomes/tuberculosis/nocardiosis) B. J. SPARGO*t, L. M. CROWE*, T. IONEDAf, B. L. BEAMAN§, AND J. H. CROWE* *Department of Zoology and §Department of Medical Microbiology and Immunology, University of California, Davis, CA 95616; and tUniversidade de Sio Paulo, Instituto de Quimica, 05508 Sao Paulo, S.P., Brazil Communicated by John D. Baldeschwieler, October 15, 1990 ABSTRACT The persistence of numerous pathogenic bac- antitumor activity (11), immunomodulation (12, 13), and teria important in disease states, such as tuberculosis, in granulomagenic activity (14). Indirect evidence has been humans and domestic animals has been ascribed to an inhibi- provided that CF might be responsible for inhibiting fusion tion of fusion between the phagosomal vesicles containing the between adjacent membranes in vivo (6). This finding is bacteria and lysosomes in the host cells [Elsbach, P. & Weiss, particularly appealing in view of the work of Goodrich and J. (1988) Biochim. Biophys. Adia 974, 29-52; Thoen, C. 0. Baldeschwieler (15, 16) and Hoekstra and coworkers (17, 18), (1988)J. Am. Vet. Med. Assoc. 193, 1045-1048]. In tuberculosis where carbohydrates anchored to the membrane by a hydro- this effect has been indirectly attributed to the production of phobic group have been shown to confer an inhibition of cord factor (a,a-trehalose 6,6'-dimycolate). We show here that fusion in model membrane systems. Goodrich and Balde- cord factor is extraordinarily effective at inhibiting Ca2+- schwieler (15, 16) reported that galactose anchored to cho- induced fusion between phospholipid vesicles and suggest a lesterol prevents fusion damage to liposomes during freezing mechanism by which cord factor confers this effect.
    [Show full text]
  • Non-Commercial Use Only
    Infectious Disease Reports 2014; volume 6:5327 A complicated case Introduction Correspondence: Chad J. Cooper, Department of of an immunocompetent Internal Medicine, Texas Tech University Health patient with disseminated Nocardia species are aerobic, gram positive Sciences Center, 4800 Alberta Ave, El Paso, TX nocardiosis filamentous branching bacteria that have the 79905, USA. potential to cause localized or disseminated Tel. +1.915.543.1009. E-mail: [email protected] Chad J. Cooper, Sarmad Said, infection. Nocardia species are ubiquitous in the environment as saprophytic components in Maryna Popp, Haider Alkhateeb, Key words: nocardia, lung abscess, brain abscess, dust, soil, water, decaying vegetation and stag- Carlos Rodriguez, septic emboli. nant matter.1 Nocardiosis mainly affects Mateo Porres Aguilar, Ogechika Alozie immunocompromised patients, although Contributions: the authors contributed equally. Department of Internal Medicine, Texas rarely immunocompetent individuals could Tech University Health Sciences Center, also be affected. The predominant form of Conflict of interests: the authors declare no El Paso, TX, USA nocardiosis is dependent on the species and potential conflict of interests. the geographical location.2 The majority of nocardiosis cases are caused by the N. aster- Received for publication: 28 January 2014. oides complex and N. brasiliensis. In the tropi- Revision received: 17 February 2014. Accepted for publication: 25 February 2014. Abstract cal climate cutaneous and lymphocutaneous infections caused by N. brasiliensis (myce- This work is licensed under a Creative Commons toma) predominate. In the temperate climate Nocardia species are aerobic, gram positive Attribution NonCommercial 3.0 License (CC BY- zone, pulmonary infections with N. asteroides NC 3.0). filamentous branching bacteria that have the complex will be more prevalent.2 The major potential to cause localized or disseminated risk factor for nocardia infection is being ©Copyright C.J.
    [Show full text]
  • Aerobic Gram-Positive Bacteria
    Aerobic Gram-Positive Bacteria Abiotrophia defectiva Corynebacterium xerosisB Micrococcus lylaeB Staphylococcus warneri Aerococcus sanguinicolaB Dermabacter hominisB Pediococcus acidilactici Staphylococcus xylosusB Aerococcus urinaeB Dermacoccus nishinomiyaensisB Pediococcus pentosaceusB Streptococcus agalactiae Aerococcus viridans Enterococcus avium Rothia dentocariosaB Streptococcus anginosus Alloiococcus otitisB Enterococcus casseliflavus Rothia mucilaginosa Streptococcus canisB Arthrobacter cumminsiiB Enterococcus durans Rothia aeriaB Streptococcus equiB Brevibacterium caseiB Enterococcus faecalis Staphylococcus auricularisB Streptococcus constellatus Corynebacterium accolensB Enterococcus faecium Staphylococcus aureus Streptococcus dysgalactiaeB Corynebacterium afermentans groupB Enterococcus gallinarum Staphylococcus capitis Streptococcus dysgalactiae ssp dysgalactiaeV Corynebacterium amycolatumB Enterococcus hiraeB Staphylococcus capraeB Streptococcus dysgalactiae spp equisimilisV Corynebacterium aurimucosum groupB Enterococcus mundtiiB Staphylococcus carnosusB Streptococcus gallolyticus ssp gallolyticusV Corynebacterium bovisB Enterococcus raffinosusB Staphylococcus cohniiB Streptococcus gallolyticusB Corynebacterium coyleaeB Facklamia hominisB Staphylococcus cohnii ssp cohniiV Streptococcus gordoniiB Corynebacterium diphtheriaeB Gardnerella vaginalis Staphylococcus cohnii ssp urealyticusV Streptococcus infantarius ssp coli (Str.lutetiensis)V Corynebacterium freneyiB Gemella haemolysans Staphylococcus delphiniB Streptococcus infantarius
    [Show full text]
  • Nocardia Bacteremia: a Single-Center Retrospective Review and A
    International Journal of Infectious Diseases 92 (2020) 197–207 Contents lists available at ScienceDirect International Journal of Infectious Diseases journal homepage: www.elsevier.com/locate/ijid Nocardia bacteremia: A single-center retrospective review and a systematic review of the literature a,b, a,b,c a,b,c Eloise Williams *, Adam W. Jenney , Denis W. Spelman a Microbiology Unit, Alfred Health, 55 Commercial Rd, Melbourne, Victoria, Australia b Department of Infectious Diseases, Alfred Health, 55 Commercial Rd, Melbourne, Victoria, Australia c Department of Infectious Diseases, Monash University, Melbourne, Victoria, Australia A R T I C L E I N F O A B S T R A C T Article history: Objectives: Nocardia bacteremia is a rare but severe disease associated with high mortality. This Received 14 August 2019 systematic review is the largest and most comprehensive review performed over the past 20 years. Received in revised form 21 December 2019 Methods: A single-center retrospective review of Nocardia bacteremia was performed using hospital Accepted 13 January 2020 microbiology records from January 1, 2010 to December 31, 2017. A systematic literature review was also performed to identify cases of Nocardia bacteremia described in the NCBI PubMed database in English Keywords: between January 1, 1999 and December 31, 2018. Nocardia Results: Four new cases of Nocardia bacteremia are described. The systematic review identified 134 cases Nocardiosis with sufficient information available for analysis. Of the total 138 cases, the median age was 58 years Bacteremia (interquartile range (IQR) 44–69 years) and 70% were male. Eighty-one percent were immunocom- Central line-associated bloodstream infection promised (corticosteroid use (49%), hematological malignancy (20%), solid organ transplant (20%), Immunocompromise solid organ malignancy (19%), and hematopoietic stem cell transplantation (15%)) and 29% had endovascular devices.
    [Show full text]
  • Author Section
    AUTHOR SECTION patients with new onset of fever, demographic, clinical, and laborato- Mycoplasma spp. Overall, the spectrum of antibacterial activity indi- ry variables were obtained during the 2 days after inclusion, while cates a potential role for this combination in the treatment of diffi- microbiological results for a follow-up period of 7 days were collect- cult-to-treat Gram-positive infections, including those caused by ed. Patients were followed up for survival or death, up to a maximum multidrug-resistant organisms. Since this activity extends to Gram- of 28 days after inclusion. MEASUREMENTS AND RESULTS: Of negative respiratory bacteria, quinupristin/dalfopristin may also find all patients, 95% had SIRS, 44% had sepsis with a microbiologically a role in the treatment of atypical, as well as typical, pneumonia. confirmed infection, and 9% died. A model with a set of variables all significantly (p<0.01) contributing to the prediction of mortality was Boubaker A. et al. [Investigation of the urinary tract in children in nuclear med- derived.The set included the presence of hospital-acquired fever, the icine]. Rev Med Suisse Romande. 2000; 120(3) : 251-7.p Abstract: peak respiratory rate, the nadir score on the Glasgow coma scale, and The early detection of urologic abnormalities by antenatal sonogra- the nadir albumin plasma level within the first 2 days after inclusion. phy has resulted in the investigation of many infants and neonates for This set of variables predicted mortality for febrile patients with suspicion of either obstructive uropathy or reflux nephropathy. microbiologically confirmed infection even better.The predictive val- Nuclear medicine techniques allow to assess renal parenchyma ues for mortality of SIRS and sepsis were less than that of our set of integrity, to detect pyelonephritic scars and to measure absolute and variables.
    [Show full text]
  • Computer Assisted Classification and Identification of Actinomycetes
    Computer Assisted Classification and Identification of Actinomycetes Jongsik Chun (B.Sc. Microbiology, Seoul National University, Seoul, Korea) NEWCASTLE UNIVERSITY LIERARY 094 52496 3 Thesis submitted in accordance with the requirements of the University of Newcastle upon Tyne for the Degree of Doctor of Philosophy Department of Microbiology The Medical School Newcastle upon Tyne England-UK July 1995 ABSTRACT Three computer software packages were written in the C++ language for the analysis of numerical phenetic, 16S rRNA sequence and pyrolysis mass spectrometric data. The X program, which provides routines for editing binary data, for calculating test error, for estimating cluster overlap and for selecting diagnostic and selective tests, was evaluated using phenotypic data held on streptomycetes. The AL16S program has routines for editing 16S rRNA sequences, for determining secondary structure, for finding signature nucleotides and for comparative sequence analysis; it was used to analyse 16S rRNA sequences of mycolic acid-containing actinomycetes. The ANN program was used to generate backpropagation-artificial neural networks using pyrolysis mass spectra as input data. Almost complete 1 6S rDNA sequences of the type strains of all of the validly described species of the genera Nocardia and Tsukamurel!a were determined following isolation and cloning of the amplified genes. The resultant nucleotide sequences were aligned with those of representatives of the genera Corynebacterium, Gordona, Mycobacterium, Rhodococcus and Turicella and phylogenetic trees inferred by using the neighbor-joining, least squares, maximum likelihood and maximum parsimony methods. The mycolic acid-containing actinomycetes formed a monophyletic line within the evolutionary radiation encompassing actinomycetes. The "mycolic acid" lineage was divided into two clades which were equated with the families Coiynebacteriaceae and Mycobacteriaceae.
    [Show full text]
  • Nocardia Abscessus Cutaneous Abscess: a Case Report and Review of the Literature
    Ann Clin Microbiol Vol. 21, No. 3, September, 2018 https://doi.org/10.5145/ACM.2018.21.3.64 pISSN 2288-0585⋅eISSN 2288-6850 Nocardia abscessus Cutaneous Abscess: A Case Report and Review of the Literature 1 2 3 2 Hee Sue Park , Bo Ra Son , Min Suk Song , Kyeong Seob Shin 1Department of Laboratory Medicine, Chungbuk National University Hospital, Departments of 2Laboratory Medicine and 3Microbiology, Chungbuk National University College of Medicine, Cheongju, Korea We describe a cutaneous abscess caused by Nocardia isolate was confirmed to be N. abscessus by 16S abscessus in a previously healthy woman. A 74- rRNA sequencing analysis. The isolate was suscep- year-old woman presented with recurrent bullae on tible to trimethoprim-sulfamethoxazole, amikacin, ce- her left forearm that developed 1 week prior and was fotaxime and erythromycin but resistant to penicillin. initially suspected to be a cutaneous infection with The patient was treated with clarithromycin but sub- Mycobacteria or Tinea corporis. Histopathologically, sequently lost to follow-up. To the best of our knowl- the skin lesion formed an abscess. A smear revealed edge, this is the first report of a human cutaneous a few branched Gram-positive filamentous micro- infection with N. abscessus in Korea. (Ann Clin organisms that formed a creamy white colony on a Microbiol 2018;21:64-67) blood agar plate after incubation for 3 days. The col- ony tested negative on acid-fast bacilli (AFB) stain- Key Words: Cutaneous abscess, Nocardia abscessus, ing, but was positive on modified AFB staining. The 16S rRNA sequence INTRODUCTION We describe a forearm abscess due to N.
    [Show full text]
  • CHAPTER 7 Clinical Microbiology
    P1: OSO LWBK192-07 LWBK192-Hubbard November 21, 2008 14:10 CHAPTER 7 Clinical Microbiology LYNNE HAMILTON, PhD, MT (ASCP) AND HAL LARSEN, MT (ASCP), CLS (NCA), PhD I. BACTERIA A. Prokaryotic organisms 1. Bacteria are unicellular organisms that lack a true nucleus and nuclear membrane. The lack of mitochondria, endoplasmic reticulum, and Golgi bodies also differentiates the prokaryotic bacteria from eukaryotes. 2. The bacterial genome is a single, closed, circular chromosome of double-stranded DNA called the nucleoid. Plasmids are small circular molecules of extrachromosomal circular DNA. Antibiotic resistance is often encoded by genes located on plasmids. Chromosomal or plasmid gene exchange via transformation, transduction, or conjuga- tion are means of genetic recombination. 3. Reproduction of bacteria is achieved by binary fission, a means of asexual reproduc- tion. Prokaryotes do not reproduce sexually. 4. Energy generation of bacteria is cytoplasmic membrane-associated via the electron transport chain. 5. Bacteria usually range in size from 0.2 to 2 um in diameter and 1 to 6 um in length. The four basic morphological types are cocci (spherical-shaped cells), bacilli (rod-shaped cells), spirilla (spiral-shaped cells), and vibrios (comma-shaped cells (Figure 7–1). B. Growth and nutrition 1. Prokaryotic bacteria have three major nutritional needs for growth. a. A source of carbon is needed for the synthesis of cellular constituents. b. A source of nitrogen is necessary for the synthesis of protein. c. Energy (ATP) is needed for cellular functions. 2. The optimum pH for the growth of most bacteria is 7.0 to 7.5. Acidophiles grow at an acidic pH and alkaliphiles grow optimally at an alkaline pH.
    [Show full text]
  • Pulmonary Nocardiosis Caused By
    Yagi et al. BMC Infectious Diseases 2014, 14:684 http://www.biomedcentral.com/1471-2334/14/684 CASE REPORT Open Access Pulmonary nocardiosis caused by Nocardia cyriacigeorgica in patients with Mycobacterium avium complex lung disease: two case reports Kazuma Yagi1, Makoto Ishii1*, Ho Namkoong1, Takahiro Asami1, Hiroshi Fujiwara2, Tomoyasu Nishimura3, Fumitake Saito1, Yoshifumi Kimizuka1, Takanori Asakura1, Shoji Suzuki1, Tetsuro Kamo1, Sadatomo Tasaka1, Tohru Gonoi4, Katsuhiko Kamei4,5, Tomoko Betsuyaku1 and Naoki Hasegawa2 Abstract Background: Pulmonary nocardiosis frequently occurs in immunocompromised hosts and in some immunocompetent hosts with chronic lung disease; however, few reports have described pulmonary nocardiosis with nontuberculous mycobacterial lung infection. Here we report for the first time two cases of pulmonary nocardiosis caused by Nocardia cyriacigeorgica associated with Mycobacterium avium complex (MAC) lung disease caused by M. avium. Case presentation: Case 1 is that of a 72-year-old Japanese man with untreated MAC lung disease, who was diagnosed with rheumatoid arthritis and initiated on methotrexate. After 3 years of methotrexate therapy, the patient remained smear-negative and culture-positive for MAC, but also became smear-positive for Nocardia species. He received trimethoprim/sulfamethoxazole, and his symptoms and lung infiltrates improved. Case 2 is that of an immunocompetent 53-year-old Japanese woman with MAC lung disease, who was treated with a combined therapy of clarithromycin, rifampicin, ethambutol, and levofloxacin. MAC sputum culture was negative after 1 year of combined treatment, which was maintained for 2 years. After four treatment-free years, Nocardia species were occasionally isolated from her sputum, although MAC was rarely isolated from sputum cultures over the same period.
    [Show full text]