Development of a SYBR Green Multiplex Real Time PCR For

Development of a SYBR Green Multiplex Real Time PCR For

Development of a SYBR Green… Safar Ali. A. et al 241 ORIGINAL ARTICLE Development of a SYBR Green Multiplex Real Time PCR for Simultaneous Detection of Mycobacterium Tuberculosis and Nocardia Asteroides in Respiratory Samples Safar Ali Alizadeh1*, Amir Javadi2, Jalal Mardaneh3,4, Neda Nasirian5, Sajjad Alizadeh6, Maryam Mohammadbeigi7, Siamak Heidarzadeh8 5Department of pathology, School of Medicine, Qazvin University of Medical Sciences, OPEN ACCESS Qazvin, Iran. 6Medical Doctor, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. Citation: Safar Ali Alizadeh, Amir 7Department of Microbiology and Immunology, School of Medicine, Qazvin University of Javadi, Jalal Mardaneh, Neda Nasirian, Medical Sciences, Qazvin, Iran. Sajjad Alizadeh, Maryam 8Department of Microbiology and Virology, School of Medicine, Zanjan University of Mohammadbeigi, Siamak Heidarzadeh. Medical Sciences, Zanjan, Iran. Development of an SYBR Green *Email: [email protected] Multiplex Real Time PCR for Simultaneous Detection of ABSTRACT Mycobacterium Tuberculosis and Nocardia Asteroides in Respiratory Samples. Ethiop J Health Sci. 2021; BACKGROUND፡ Nocardia asteroides and Mycobacterium 31(2):241 tuberculosis are worldwide-distributed bacteria. These infectious doi:http://dx.doi.org/10.4314/ejhs.v31i2.6 Received: October 27, 2020 agents can cause many infections in humans, especially in Accepted: November 23, 2020 immunocompromised individuals. Pulmonary infections are more Published: March 1, 2021 common and have similar clinical symptoms. Proper diagnosis Copyright : © 2021 Safar A.A.., et al. This is an open access article distributed and treatment of these patients are important for accurate under the terms of the Creative treatment and could be lifesaving. Commons Attribution License, which permits unrestricted use, distribution, METHODS: In this study, a multiplex real-time PCR assay was and reproduction in any medium, established for the simultaneous detection of the N. asteroides provided the original author and source and M. tuberculosis. Both this homemade multiplex real time are credited. Funding: This work was supported by PCR and routine commercial tuberculosis tests were performed Qazvin University of Medical Sciences on 150 pulmonary specimens collected from individuals suspected (grant number to have tuberculosis. IR.QUMS.REC.1397.012). Competing Interests: The authors RESULTS: From 150 specimens, 20 samples were acid fast declare that this manuscript was positive, 14 positives for M. tuberculosis by singleplex real time approved by all authors in its form and that no competing interest exists. PCR, 10 positives for N. asteroides by singleplex real time PCR Affiliation and Correspondence: and 2 positives for M. tuberculosis and N. asteroides by multiplex 1Medical Microbiology Research real time PCR whereas 14 samples were positive for M. Center, Qazvin University of Medical Sciences, Qazvin, Iran. tuberculosis with commercial test. Differential diagnosis of 2Department of Social Medicine, pulmonary tuberculosis is useful for their proper treatment. School of Medicine, Qazvin CONCLUSION: Our test had good performance for differential University of Medical Sciences, Qazvin, Iran. diagnosis of tuberculosis and nocardiosis. Therefore, it is 3Department of Microbiology, School recommended to be used to diagnose such patients. of Medicine, Infectious Diseases Research Center, Gonabad University KEYWORDS: Mycobacterium tuberculosis, Nocardia asteroides, of Medical Sciences, Gonabad, Iran. Respiratory samples 4Department of Microbiology, School of Medicine, Student Research Committee, Gonabad University of Medical Sciences, Gonabad, Iran. DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6 242 Ethiop J Health Sci. Vol. 31, No. 2 March 2021 INTRODUCTION Sputum and bronchoalveolar lavage (BAL) in pulmonary disease, abscesses and skin biopsies in skin Mycobacterium tuberculosis (MTB) and infections are typically sent to medical laboratories for Nocardia asteroides (NA) are diagnosis of in all of these samples, both bacteria can worldwide- distributed bacteria (1,2). be present as possible causes of infection (10). Prompt These microorganisms can cause many and accurate diagnosis of patients will result in timely infections in humans especially those and appropriate treatment (10,11). Therefore, the who are immunocompromised. The development of new methods is necessity for clinical manifestations of these infections differential diagnosis of nocardiosis and tuberculosis are mostly pulmonary (1,3,4). (11). Tuberculosis and nocardiosis often have In order to rapid and efficient Identification of similar clinical symptoms and MTB and NA in clinical samples, we developed a radiological view, although extra multiplex real time PCR that identifies both bacteria at pulmonary infections have also been the same time in single tube with high sensitivity and reported in the brain, skin and lymphatic specificity. systems (1,5,6). In many cases, the bacteria that cause the infection are not MATERIAL AND METHODS properly diagnosed. However, accurate differential diagnosis of the causative Design of primers: We designed two pairs of agents of infections plays an essential dedicated primers to identify MTB and NA using role in their treatment. Usually, the first Beacon designer 7 software (Table 1). The melting step in the laboratory diagnosis of these temperature (Tm) of each primer pair was adjusted infections is established based on direct so that they did not have a significant distance but tests including gram stain, Ziel-Neelsen, the Tm of reaction products has a significant direct fluorescence test and culture distance to be distinguishable in melting curve methods. Both bacteria are directly seen analysis. M. tuberculosis and N. asteroides as gram positive and acid fast positive (7). After direct exams, culture of clinical reference DNA sequences were extracted from samples and identification tests are Gene Bank usually performed. Generally, clinical (http://www.ncbi.nlm.nih.gov/GenBank). We used samples are cultured based on the direct the target conserved sequence used in previous study results. The apparent similarity of studies and encoded the primers (11,12). The these bacteria in direct vision can cause primers were evaluated at NCBI database that the detection process to deviate in the proved to be unrelated to the genome of other wrong direction. In addition, the bacteria and human target. The primers were also cultivation technique for these bacteria, cross-analyzed for reactivity with together. especially MTB is time consuming and prolonged (8,9). Table 1: Primer sequences used to identify Mycobacterium tuberculosis (MTB) and Nocardia asteroides (NA) Primers names Primers sequences Tm of amplicons Mycobacterium F: 5´ GACCCGCCAGCCCAGGAT 3´ 90.2 tuberculosis (MTB) R: 5´TTCGGACCACCAGCACCTAA 3´ Nocardia asteroides (NA) F: 5´ TAGGGTGCGAGCGTTGTC 3´ 85.9 R: 5´CTTCTCAGCGTCAGTTACTTCC 3´ Beta actin F: 5′ GTGGGCCGCTCTAGGCACCAA 3´ 88.2 R: 5′ AAATCGTGCGTGACATCAAAGAG 3´ DOI: http://dx.doi.org/10.4314/ejhs.v31i2.6 Development of a SYBR Green… Safar A.A. et al 243 Standard bacterial strains: M. pulmonary tuberculosis diagnosis. Sputum and tuberculosis H37R and N. asteroids ATCC other pulmonary secretions were collected. 19247 were prepared from Pasteur Institute of Initially, all specimens were stained with Ziel Iran. The DNA of these bacteria was used to Neelsen method and carefully studied by optimize Real Time PCR reactions. microscopy. DNA of all patient samples were Optimizing real time PCR reactions: extracted using the Roche's DNA extraction kit Singleplex Real time PCR reactions were after homogenization. The quality of DNA optimized using each primer pair separately and samples was evaluated using Human beta actin the standard DNA of each bacterium. These gene as control gene. Any samples that had reactions were performed using the Takara negative response to beta actin gene specific SYBR Green master mix and StepOne plus ABI primers were replaced with other ones. Finally, real time PCR equipment. Finally, after all samples were tested using NA and MTB optimizing each pair of primers separately, specific primers singleplex and multiplexed optimization was performed with both primer using both pairs of primers. In addition, all pairs in single tube. The multiplex real time PCR samples were tested with a commercial Sina- reaction mixture consisted one microliter (µl) of clone kit for detecting of M. tuberculosis. extracted DNA containing approximately 50 Detection of MTB and NA was done by nanogram (ng) of DNA, 10 µl of SYBR Green analyzing the melting curve and Tm of the master mix (2x), 0.4 µl of MTB and NA primers reaction curve. Tm values were 85.9 for NA and (10 pmol/µl) and deionized water to a final 90.2 for MTB. Because the Tm temperatures of volume of 20 µl. The best physical conditions each particular product were sufficiently far were optimized to 10 min at 95 degrees as pre- apart, NA and MTB were easily distinguishable. denaturation, 35 cycles of 95ᵒC for 15 seconds, RESULTS 60ᵒC for 45 seconds. Finally, the melting curve was drawn from 65°C to 95°C with a gradual The NA and MTB genome sequences were increase of 0.11ᵒC. After adjusting the physical downloaded from Gene Bank and the specificity and chemical conditions of the multiplex of the two primers was confirmed. In addition, reaction, the melt curve of the reactions was using the NCBI database, it was found that analyzed to confirm the specificity of the primers do not

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    6 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us