Oncogene (2011) 1–15 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE The pro-longevity gene FoxO3 is a direct target of the p53 tumor suppressor

VM Renault1, PU Thekkat1, KL Hoang1, JL White1, CA Brady2,3, D Kenzelmann Broz2, OS Venturelli1, TM Johnson2,3, PR Oskoui1, Z Xuan4, EE Santo5, MQ Zhang4,6, H Vogel7, LD Attardi1,2,3 and A Brunet1,3

1Department of Genetics, Stanford University, Stanford, CA, USA; 2Department of Radiation Oncology, Stanford University, Stanford, CA, USA; 3Cancer Biology Graduate Program, Stanford University, Stanford, CA, USA; 4Department of Molecular and Cell Biology, Center for Systems Biology, University of Texas at Dallas, Richardson, TX, USA; 5Department of Human Genetics, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; 6MOE Key Laboratory of Bioinformatics & Bioinformatics Division, TNLIS, Tsinghua University, Beijing, China and 7Department of Pathology, Stanford University, Stanford, CA, USA

FoxO transcription factors have a conserved role in 2005). The connection between aging and cancer raises longevity, and act as tissue-specific tumor suppressors the possibility that genes that extend lifespan may also in mammals. Several nodes of interaction have been be part of a molecular network that suppresses identified between FoxO transcription factors and p53, a tumorigenesis. An example for such genes is provided major tumor suppressor in humans and mice. However, by FoxO transcription factors, which have a pivotal role the extent and importance of the functional interaction at the interface between longevity and tumor suppres- between FoxO and p53 have not been fully explored. sion (Greer and Brunet, 2005). In invertebrates, FoxO Here, we show that p53 regulates the expression of factors are necessary to extend lifespan downstream of FoxO3, one of the four mammalian FoxO genes, in the insulin pathway (Kenyon, 2005). In mammals, the response to DNA damaging agents in both mouse four FoxO family members (FoxO1, FoxO3, FoxO4 embryonic fibroblasts and thymocytes. We find that p53 and FoxO6) also function downstream of the insulin- transactivates FoxO3 in cells by binding to a site in the signaling pathway (Greer and Brunet, 2005). Single- second intron of the FoxO3 gene, a genomic region nucleotide polymorphisms in the FoxO3 gene have recently found to be associated with extreme longevity in recently been found to be associated with extreme humans. While FoxO3 is not necessary for p53-dependent longevity in humans, suggesting a conserved function cell cycle arrest, FoxO3 appears to modulate p53- for FoxO3 in longevity (Willcox et al., 2008; Anselmi dependent apoptosis. We also find that FoxO3 loss does et al., 2009; Flachsbart et al., 2009; Pawlikowska et al., not interact with p53 loss for tumor development in vivo, 2009). Interestingly, the FoxO family has also been although the tumor spectrum of p53-deficient mice appears found to act as a lineage-specific tumor suppressor in to be affected by FoxO3 loss. Our findings indicate that mammals (Paik et al., 2007). Combined somatic deletion FoxO3 is a p53 target gene, and suggest that FoxO3 and of FoxO1, FoxO3 and FoxO4 in mice leads to the p53 are part of a regulatory transcriptional network that development of tumors, particularly thymic lymphomas may have an important role during aging and cancer. and hemangiomas (Paik et al., 2007). FoxO3/ mice can Oncogene advance online publication, 21 March 2011; also develop cancer, but at a lesser frequency and later doi:10.1038/onc.2011.35 in life than FoxO1/FoxO3/FoxO4 compound mutant mice (Paik et al., 2007). In humans, FoxO3 inactivation Keywords: FoxO transcription factors; p53; tumor is correlated with poor prognosis of breast cancers (Hu suppression; cancer; aging; longevity et al., 2004). Conversely, ectopic expression of FoxO3 in human cells is sufficient to delay tumor development in xenograft models (Hu et al., 2004; Seoane et al., 2004). Thus, FoxO3 may be an important part of a regulatory Introduction network that controls both aging and cancer. FoxO3 is a potent transcriptional activator that Aging and cancer are intimately linked. Many cancers triggers the expression of a program of genes involved have a striking age-dependent onset. Interventions that in cell cycle arrest, DNA repair, hypoxia response and extend lifespan, such as dietary restriction, decrease the apoptosis (Brunet et al., 1999; Medema et al., 2000; incidence of tumors (Hursting et al., 2003; Masoro, Tran et al., 2002; Seoane et al., 2004; You et al., 2006a; Bakker et al., 2007; Tothova et al., 2007; Paik et al., 2009; Renault et al., 2009). FoxO3 transcriptional Correspondence: Dr A Brunet, Department of Genetics, Stanford activity is inhibited in response to insulin and growth University, 300 Pasteur Drive, Alway M336, Stanford, CA 94305, USA. factors through phosphorylation-dependent nuclear E-mail: [email protected] export (Brunet et al., 1999, 2001, 2002). Although the Received 20 December 2010; accepted 18 January 2011 regulation of FoxO3 activity by post-translational FoxO3 is a direct target of p53 VM Renault et al 2 modifications, such as phosphorylation, has been well interaction between FoxO3 and p53 loss in cancer studied (Van Der Heide et al., 2004; Calnan and Brunet, progression in the absence of oncogenic stimulation 2008), the molecular mechanisms that regulate the has never been tested. expression of the FoxO3 gene remain mostly unclear. Here, we explore the connections between FoxO3, a Given the connection between aging and cancer, it is ubiquitously expressed FoxO family member, and p53 in interesting to note that there are a number of parallels cells and in mice. We find that p53 acts as a direct between FoxO3 and the tumor suppressor protein p53. upstream transcriptional activator of the FoxO3 gene in Like FoxO3, p53 induces cell cycle arrest, apoptosis and response to DNA damage in mouse embryonic fibro- DNA repair (Vousden and Lu, 2002). Several FoxO3 blasts (MEFs) and in lymphocytes. We show that p53 target genes, such as Gadd45, Wip1, p21Cip1, Puma and regulates the transcription of the FoxO3 gene by binding Sestrin1/PA26, are also regulated by p53 (Kastan et al., to a site in the second intron of the FoxO3 gene. 1992; el-Deiry et al., 1993; Fiscella et al., 1997; Velasco- Although FoxO3 is not necessary for p53-dependent Miguel et al., 1999; Nakano and Vousden, 2001; Yu cell cycle arrest, FoxO3 appears to have a role in et al., 2001). FoxO3 and p53 are extensively modified in p53-dependent apoptosis. While FoxO3 loss does not response to stress stimuli, through phosphorylation synergize with p53 loss for tumor development in vivo, and acetylation (Calnan and Brunet, 2008; Vousden tumor spectrum in p53-deficient mice appears to be and Prives, 2009), and both p53 and FoxO3 bind to and affected by the loss of one or both FoxO3 alleles. These are deacetylated by the Sirt1 deacetylase (Luo et al., results reveal a regulatory mechanism linking FoxO3 2001; Vaziri et al., 2001; Brunet et al., 2004; Motta et al., and p53, two critical molecules involved in the control of 2004). These extensive similarities between FoxO3 and longevity and tumor suppression. p53 suggest that both transcription factors may be part of a common regulatory complex. A number of direct and indirect links between FoxO3 and p53 have already been uncovered. First, FoxO3 Results directly binds to p53, at least in the context of overexpression (Nemoto et al., 2004; Wang et al., DNA damage and nutlin treatment increase FoxO3 2008). Second, FoxO3 leads to stabilization of the p53 protein levels in a p53-dependent manner in fibroblasts protein and activation of p53-dependent apoptosis To test whether p53 regulates FoxO3 expression in (You et al., 2006b). FoxO3 also upregulates p19ARF,a mammalian cells, we compared FoxO3 protein levels in þ / þ / positive upstream regulator of p53 (Bouchard et al., p53 and p53 primary MEFs in the absence or 2007). Conversely, p53 has been reported to inhibit presence of doxorubicin, a DNA damaging agent that FoxO3 function indirectly by upregulating serum- and activates endogenous p53. We found that doxorubicin þ / þ glucocorticoid-induced protein kinase (SGK), thereby treatment increased FoxO3 protein expression in p53 MEFs, but not in p53/ MEFs (Figure 1a). Changes in resulting in the phosphorylation of FoxO3 and its Cip1 sequestration in the cytoplasm (You et al., 2004). In FoxO3 protein levels were similar to those of p21 ,a addition, p53 has been found to inhibit FoxO3 well-known target of p53 (Figure 1a). To activate p53 transcriptional activity under conditions of oxidative in a more specific manner, we used nutlin, a chemical stress (Miyaguchi et al., 2009) and to induce FoxO3 compound that inhibits binding of p53 to Mdm2, a degradation (Fu et al., 2009). Whether FoxO3 and p53 intersect in other ways, for example by regulating each other’s transcription, remains largely unknown. p53+/+ p53-/- p53+/+ p53-/- p53 is a potent tumor suppressor in humans, as Dox: - + - + Nutlin Dox Nutlin Dox underscored by the fact that nearly all human tumors hr: 0 4848 04848 have mutations or deletions in the p53 gene itself or in FoxO3 the p53 pathway (Vogelstein et al., 2000). Mutations in FoxO3 p53 have been linked to poor prognosis in a variety of p21Cip1 human cancers, including lung (Quinlan et al., 1992), p53 breast (Deng et al., 1994) and gastric cancers (Scott p53 et al., 1991), as well as lymphomas (Gaidano et al., 1991; β-actin Lo Coco et al., 1993). Consistent with the prevalence of p53 loss in human tumors, p53/ mice are highly prone Mek1 to cancer early in life (Donehower et al., 1992; Harvey et al., 1993a, 1993b; Jacks et al., 1994). p53 þ / mice also Figure 1 Doxorubicin and nutlin elicit an increase in FoxO3 protein develop tumors with high frequency (Donehower et al., expression that is p53-dependent in MEFs. (a) Western blot of protein extracts from p53 þ / þ and p53/ MEFs incubated in the 1992; Harvey et al., 1993a, 1993b; Jacks et al., 1994). absence () or presence ( þ ) of doxorubicin (Dox, 0.2 mg/ml) for 8 h, The connection between FoxO3 and p53 in cells raises using antibodies to FoxO3, p21Cip1 (a well-known target of p53), p53 the possibility that FoxO3 functionally interacts with and Mek1 (loading control). (b) Western blot of protein extracts from p53 for tumor suppression. A dominant-negative form p53 þ / þ and p53/ MEFs incubated with nutlin (10 mM), a p53 activator, or doxorubicin (Dox, 0.2 mg/ml) for 0, 4 and 8 h, using of FoxO factors has been shown to accelerate antibodies to FoxO3, p53 and b-actin (loading control). Western Myc-driven tumorigenesis by blocking p53-dependent blots are representative of at least two independent experiments, apoptosis (Bouchard et al., 2007). However, the genetic conducted on independent cultures of MEFs.

Oncogene FoxO3 is a direct target of p53 VM Renault et al 3 ubiquitin ligase critical for p53 degradation (Vassilev MEFs than in p53 þ / þ MEFs, whereas FoxO3 protein et al., 2004). Similar to what we observed for expression is similar in MEFs of both genotypes doxorubicin, nutlin treatment increased FoxO3 protein (see Figure 1), suggesting that there are additional levels in p53 þ / þ MEFs, but not in p53/ MEFs (Figure 1b). of regulation of the FoxO3 protein by p53. In contrast Together, these results indicate that p53 is necessary to FoxO3, other FoxO family members (FoxO1, FoxO4 for FoxO3 protein accumulation in MEFs in response to and FoxO6) did not show a p53-dependent increased DNA damage and nutlin. mRNA expression in response to nutlin and doxorubi- cin (Figures 2d–f). FoxO6 mRNA was induced in p53 is necessary for FoxO3 mRNA upregulation response to doxorubicin, but in a p53-independent in response to DNA damage or nutlin treatment manner (Figure 2f), raising the possibility that other in fibroblasts members of the p53 family (for example, p73) may be To determine whether the p53-dependent accumulation responsible for FoxO6 regulation in response to DNA of FoxO3 protein is due to transcriptional or post- damage. Collectively, these observations indicate that transcriptional changes, we compared FoxO3 mRNA p53 is necessary for the upregulation of FoxO3 mRNA levels in p53 þ / þ and p53/ MEFs in response to nutlin in MEFs in response to signals that activate p53. or doxorubicin (Figure 2a). We found that nutlin or doxorubicin led to an upregulation of FoxO3 mRNA p53 is necessary for FoxO3 mRNA upregulation in that was significantly attenuated in p53/ MEFs response to DNA damage in lymphocytes (Figure 2a), similar to two known p53 targets, p21Cip1 We next asked whether the induction of FoxO3 mRNA and Mdm2 (Figures 2b and c). We noted that FoxO3 by p53 was also observed in other cell types. We found mRNA expression at basal levels is lower in p53/ that FoxO3 mRNA was upregulated in response to

FoxO3 p53+/+ MEFs FoxO1 0.015 0.008 p53-/- MEFs mRNA mRNA 0.006 0.010 Gapdh Gapdh 0.004 * 0.005

* mRNA /

mRNA / * 0.002 * FoxO1 FoxO3 0.000 0.000 hr: 0 484 8 0 4848 hr: 0 4 848 04848 Nutlin Dox Nutlin Dox Nutlin Dox Nutlin Dox

p21Cip1 FoxO4 1.0 0.005

0.8 0.004 mRNA mRNA

0.6 0.003 Gapdh Gapdh

0.4 0.002 mRNA / mRNA /

0.2 0.001 Cip1 FoxO4 p21 0.0 *** *** *** *** *** 0.000 hr: 0 4848 04848 hr: 0 4848 04848 Nutlin Dox Nutlin Dox Nutlin Dox Nutlin Dox

2.0 Mdm2 0.0015 FoxO6 mRNA mRNA 1.5 0.0010 Gapdh Gapdh 1.0

0.0005 mRNA / mRNA / 0.5 Mdm2 *** ** FoxO6 0.0 0.0000 hr: 0 4848 04848 hr: 0 4 84 8 04 84 8 Nutlin Dox Nutlin Dox Nutlin Dox Nutlin Dox Figure 2 p53 is necessary for FoxO3 mRNA upregulation in response to doxorubicin or nutlin in MEFs. Real-time quantitative PCR analysis of FoxO3 (a), p21Cip1 (b), Mdm2 (c), FoxO1 (d), FoxO4 (e), and FoxO6 (f) mRNA levels in p53 þ / þ and p53/ MEFs in response to 4 and 8 h of treatment with nutlin (10 mM) or doxorubicin (Dox, 0.2 mg/ml). Mean þ / s.e.m. of two independent experiments conducted in triplicate. *Po0.05, **Po0.01, ***Po0.001 between p53 þ / þ and p53/ MEFs at a given time point, two-way analysis of variance with Bonferroni post-test.

Oncogene FoxO3 is a direct target of p53 VM Renault et al 4 g-irradiation in mouse thymocytes, but that this activity, are replaced by glutamine and serine, respec- upregulation was no longer observed in p53/ thymo- tively (Johnson et al., 2005). In addition, the transcrip- cytes (Figure 3a). The changes in FoxO3 mRNA levels tionally impaired p53 allele and a control wild-type in thymocytes were similar to the changes observed for (WT) allele of p53 were rendered inducible by the two well-known targets of p53, p21Cip1 (Figure 3b) presence of a transcriptional/translational STOP cas- and Mdm2 (Figure 3c). The expression of other FoxO sette flanked by LoxP sites upstream of the p53 coding family members (FoxO1, FoxO4 and FoxO6) was not region (p53LSLWT and p53LSL25,26) (Figure 4a) (Johnson strongly upregulated in response to g-irradiation in a et al., 2005). In p53LSLWT and p53LSL25,26 knock-in p53-dependent manner (Figures 3d–f), although FoxO1 MEFs, introduction of Cre recombinase allows expres- mRNA was slightly affected by p53 (Figure 3d). These sion of the WT or transcriptionally impaired p53 alleles findings indicate that the p53-dependent regulation of (Johnson et al., 2005). Northern blot experiments FoxO3 mRNA by DNA damaging agents is relatively revealed that the expression of FoxO3 mRNA was specific to this FoxO isoform, and is observed higher in p53LSLWT MEFs in the presence of Cre (that in multiple cell types. is, expressing WT p53) than in p53LSLWT MEFs in the absence of Cre (that is, not expressing p53), similar to p21Cip1 mRNA, a classical p53 target. These results p53 transcriptional activity is necessary and sufficient confirm that p53 is necessary for expression of the to regulate FoxO3 mRNA in fibroblasts FoxO3 mRNA (Figure 4b). In the presence of Cre, To determine whether FoxO3 mRNA upregulation in doxorubicin elicited a significant increase in FoxO3 and response to doxorubicin is mediated by p53’s ability to p21Cip1 mRNA in p53LSLWT MEFs, but not in p53LSL25,26 act as a transcriptional activator, we examined FoxO3 MEFs (Figure 4b). There was a slight upregulation of mRNA levels in knock-in MEFs expressing a transcrip- FoxO3 and p21Cip1 mRNA in p53LSL25,26 MEFs in the tionally impaired mutant of p53 under the control of the presence of Cre and doxorubicin (Figure 4b), consistent endogenous p53 promoter (Figure 4a). This mutant with the fact that the p5325,26 mutant is not completely p53 is transcriptionally deficient because leucine 25 and transcriptionally inactive (Johnson et al., 2005). tryptophan 26, two key residues for p53 transcriptional Together, these data indicate that p53 transcriptional

FoxO3 FoxO1 p53+/+ Thymocytes 0.08 0.025 p53-/- Thymocytes 0.020 0.06 * 0.015 mRNA mRNA mRNA mRNA 0.04 0.010 Gapdh FoxO1 FoxO3

*** / / Gapdh 0.02 0.005

0.00 0.000 γ-IR: –++ – γ-IR: –++ –

p21Cip1 FoxO4 0.04 0.015

0.03 0.010 mRNA mRNA mRNA mRNA 0.02

Cip1 0.005 Gapdh Gapdh FoxO4 p21 / 0.01 / *** 0.00 0.000 γ-IR: –++ – γ-IR: –++ –

Mdm2 FoxO6 0.25 0.00015 0.20 0.00010 0.15 mRNA mRNA mRNA mRNA 0.10 *** 0.00005 Gapdh Gapdh FoxO6 Mdm2 / / 0.05

0.00 0.00000 γ-IR: –++ – γ-IR: –++ – Figure 3 p53 is necessary for FoxO3 mRNA upregulation in response to g-irradiation in thymocytes. Real-time quantitative PCR analysis of FoxO3 (a), p21Cip1 (b), Mdm2 (c), FoxO1 (d), FoxO4 (e), and FoxO6 (f) mRNA levels in p53 þ / þ and p53/ thymocytes, 3 h after g-irradiation (g-IR, 10 Gy). Mean þ / s.e.m. of two independent experiments conducted in triplicate on samples from 3–5 mice per genotype. *Po0.05, ***Po0.001 between p53 þ / þ and p53/ thymocytes at a given time point, two-way analysis of variance with Bonferroni post-test.

Oncogene FoxO3 is a direct target of p53 VM Renault et al 5 AD1 AD2DNA binding domain Olig. p53 directly binds and transactivates regulatory regions in the FoxO3 gene p53LSL-WT To determine whether FoxO3 is a direct target gene of p53, we searched the 5-kb upstream regulatory region,

p53LSL-25,26 as well as all introns of the mouse FoxO3 gene, for the presence of putative p53 binding sites, based on the known p53 consensus binding site (el-Deiry et al., 1992). p53LSL-VP16 VP16 This analysis identified four potential p53 binding elements: three (p53-1, p53-2 and p53-3) in the FoxO3 p53LSL-25, 26 p53 LSL-WT p53 LSL-VP16 promoter, and one (p53-4) in the second intron of the Ad-Cre: - + +-++-++ FoxO3 gene (Figure 5a). p53-4 has a near-perfect match Dox: - -+ --+- -+ to the p53 consensus binding site and only one base pair of spacing between the two half-sites (Figure 5a), which is a characteristic of optimal p53 binding sites (el-Deiry FoxO3 et al., 1992). In addition, although the region containing p53-4 is not perfectly conserved in human FoxO3, there is also an optimal p53 binding site in the second intron of the human FoxO3 gene, suggesting that the presence of p53 binding site in the second intron may be a p21Cip1 conserved feature of the FoxO3 gene. Interestingly, the second intron of the human FoxO3 gene contains single- nucleotide polymorphisms associated with extreme human longevity (Willcox et al., 2008; Anselmi et al.,

GAPDH 2009; Flachsbart et al., 2009). To assess whether p53 binds to these p53 binding sites in MEFs, we performed chromatin immunopreci- Figure 4 p53 transcriptional activity is necessary and sufficient for pitation (ChIP) assays with antibodies to p53 in FoxO3 mRNA upregulation. (a) Schematic of the p53 knock-in chromatin extracts from MEFs that had been treated alleles used. p53LSLWT: inducible allele encoding a form of wild- with doxorubicin. The recruitment of p53 to the type p53. p53LSL25,26: inducible allele encoding a transcriptionally regulatory regions of the FoxO3 gene was assessed by impaired mutant of p53 in which leucine 25 is replaced by a quantitative PCR using primers surrounding the p53-1 glutamine, and tryptophan 26 is replaced by a serine. p53LSLVP16: inducible allele encoding a mutant of p53 in which the transactiva- or p53-4 binding sites (Figure 5b). We found that tion domains (AD1 and AD2) are replaced by the transactivation endogenous p53 occupied the p53-4 binding site in the domain of VP16. AD: activation domain; Olig.; oligomerization intron of the FoxO3 gene in doxorubicin-treated MEFs domain. The star indicates the location of the 25,26 mutations. (Figure 5b). In contrast, p53 was not bound to the p53- (b) Northern blot analysis of MEFs in which the endogenous allele of p53 has been replaced by an allele encoding inducible forms of 1, p53-2, or p53-3 binding sites in the FoxO3 promoter WT p53 (p53LSLWT), a transcription-deficient mutant (p53LSL25,26), (Figure 5b and data not shown). Endogenous p53 was or a mutant of p53 in which the transactivation domains of p53 bound to the p53-4 binding site in the intron of the were replaced by that of VP16 (p53LSLVP16). The addition of an FoxO3 gene even in the absence of doxorubicin, but the adenovirus containing Cre recombinase (Ad-Cre) allows the recruitment of p53 to that site was slightly increased in deletion of the Lox-STOP-Lox (LSL) cassette upstream of each allele and allows the expression of each p53 variant. Cells were response to a short treatment with doxorubicin exposed to 8 h of doxorubicin (Dox, 0.2 mg/ml). Northern blots (Figure 5c). p53 occupancy at the p53 binding site in were analyzed with a probe to FoxO3, p21Cip1 (a known target of FoxO3 second intron was similar to that in the p21Cip1 p53) and GAPDH (loading control). promoter, although p53 recruitment to the p21Cip1 promoter in response to short treatment with doxor- ubicin was more robust (Figure 5c). Taken together, activity is necessary for the DNA damage-dependent these results indicate that p53 directly binds to a site increase in FoxO3 mRNA. within the second intron of the mouse FoxO3 gene To test whether p53 transcriptional activation is in vivo. sufficient to induce FoxO3 mRNA, we used MEFs with a knock-in mutation of p53 fused to the transactivation domain of the herpes virus transactivator VP16 p53 is necessary for FoxO3 transactivation (p53LSLVP16, Figure 4a), thus rendering p53 maximally To determine whether p53 can transactivate the FoxO3 active (Johnson et al., 2005, 2008). We observed that gene by binding to the p53-4 binding site, we generated similar to p21Cip1 mRNA, FoxO3 mRNA was potently reporter constructs in which luciferase expression is induced in Cre-treated p53LSLVP16 MEFs, even in the driven by an SV40 minimal promoter fused to a 500-bp absence of doxorubicin (Figure 4b). These findings region surrounding p53-1, p53-2, p53-3 or p53-4, and indicate that p53 transactivation activity is sufficient analyzed the luciferase activity of these reporter for FoxO3 mRNA upregulation. Taken together, constructs in p53 þ / þ and p53/ MEFs (Figure 5d and these results indicate that FoxO3 gene expression is data not shown). The region surrounding the p53-4 site transcriptionally regulated by p53. in the FoxO3 second intron induced transcriptional

Oncogene FoxO3 is a direct target of p53 VM Renault et al 6

100 500 ** 80 ** 400 60 300

40 200 20 ChIP enrichment 100 ChIP enrichment 0 0 IgG p53 IgG p53 IgG p53 IgG p53 Dox: - + - + - + - + - + - + - + - + + Dox: +++++++ p53: +/+ -/- +/+ -/- +/+ -/- +/+ -/- - p53-1 p53-4 p53 Cip1 - p53-1 p53-4 p53 (p21 ) (p21Cip1)

p53+/+ MEFs 100 80 p53-/- MEFs * 80 60 60 40

40 activity activity ** 20 20 ** Normalized luciferase Normalized luciferase 0 0 - p53-1 p53-4 p53-4 p53-4m Figure 5 p53 is recruited to a binding site in the second intron of the FoxO3 gene. (a) Location and sequence of the p53 binding sites (p53-1, p53-2, p53-3 and p53-4) in the promoter and second intron of the mouse FoxO3 gene. R: G or A; W: T or A; Y: C or T; E: exon; I: intron. Also depicted are the consensus for p53 binding sites, the p53 binding site in the p21Cip1 promoter, and the mutant of critical bases in p53-4 (p53-4 m). (b) ChIP on MEFs treated with doxorubicin (Dox, 0.2 mg/ml) for 16–20 h, using antibodies to p53 (colored bars) or control IgG (white bars). The chromatin bound to p53 or to the control IgG was analyzed by quantitative PCR with primers surrounding a region that did not contain p53 binding sites (), the distal p53 binding site in the FoxO3 promoter (p53-1), the p53-4 binding site in the FoxO3 intron 2 (p53-4), and the p53 binding site in the p21Cip1 promoter (p53 (p21Cip1)). The fold enrichment over the IgG control is represented. Mean þ / s.e.m. of three independent experiments. **Po0.01, one-way analysis of variance. (c) ChIP on p53 þ / þ and p53/ MEFs in the absence or presence of doxorubicin (Dox, 0.2 mg/ml) for 6 h, using antibodies to p53 or control IgG. The chromatin bound to p53 or to the control IgG was analyzed by quantitative PCR with primers surrounding a region that did not contain p53 binding sites (), the distal p53 binding site in the FoxO3 promoter (p53-1), the p53-4 binding site in the FoxO3 intron 2 (p53-4) and the p53 binding site in the p21Cip1 promoter (p53 (p21Cip1)). The fold enrichment over the IgG control is represented. Mean þ / s.d. from triplicates of one experiment. (d) Normalized activity of luciferase reporter constructs driven by 500 bp surrounding the p53 binding sites p53-1 or p53-4 in p53 þ / þ (black) and p53/ (white) MEFs. Mean þ / s.e.m. of four independent experiments conducted in triplicate. *Po0.05 between p53-4 and control in p53 þ / þ MEFs, **Po0.01 between p53 þ / þ and p53/ MEFs for p53-4, one-way ANOVA. (e) Normalized activity of luciferase reporter constructs driven by the region surrounding the p53-4 binding site or by the region surrounding the p53-4 binding site in which the p53 binding site was mutated (p53- 4m) in p53 þ / þ (black) and p53/ (white) MEFs. Mean þ / s.e.m. of three independent experiments conducted in triplicate. **Po0.01 between p53-4 m and p53-4 in p53 þ / þ MEFs, one-way ANOVA.

activation of the luciferase reporter gene in p53 þ / þ to the cells or because basal FoxO3 mRNA levels are MEFs, but not in p53/ MEFs (Figure 5d). In contrast, also regulated by p53 (see Figure 2a). Together, these the transcriptional activity of the p53-1, p53-2 and p53-3 findings indicate that the region surrounding p53-4 in regions was low, regardless of the presence of p53 the second intron of the FoxO3 gene can be transacti- (Figure 5d, data not shown). Note that the region vated by p53. surrounding the p53-4 binding site induced transcrip- To examine whether the transcriptional activity of the tional activation of the luciferase reporter gene in a p53- region containing p53-4 was indeed due to this p53 dependent manner even in the absence of doxorubicin, binding site, we created a luciferase reporter construct perhaps because transfection itself triggered a stress with a mutated version of p53-4 (p53-4 m) that can no

Oncogene FoxO3 is a direct target of p53 VM Renault et al 7 longer be bound by p53 because it is missing the critical are not regulated by p53 to the same extent as FoxO3 in bases necessary for p53 binding (Figure 5a). Mutating MEFs and thymocytes (see Figures 2 and 3), we the p53-4 site abolished the transcriptional activity of determined whether interfering with more than one the luciferase reporter gene (Figure 5e). These experi- FoxO family member had a more pronounced impact ments indicate that p53 binding to p53-4 in FoxO3 on cell cycle arrest than interfering with FoxO3 alone. second intron is pivotal for the regulation of the FoxO3 We found that nutlin-induced cell cycle arrest was gene by p53. attenuated in MEFs infected with lentiviruses expressing a short hairpin RNA directed to several FoxO family members (‘pan FoxO’) (Hribal et al., 2003) (Figures 6e p53-induced FoxO3 does not have a role in cell cycle and f), although nutlin still caused some cell cycle arrest arrest in MEFs in these cells. These findings suggest that the FoxO p53 is necessary for cell cycle arrest in response to family partially contributes to p53-dependent cell cycle double-strand breaks in MEFs (Kastan et al., 1992). arrest and that the role of FoxO3 in p53-dependent FoxO3 can also promote cell cycle arrest when over- cell cycle arrest may be masked by compensation by expressed in cells (Medema et al., 2000), although other FoxO isoforms. FoxO3 is not necessary for cell cycle arrest in response to DNA damage in MEFs (Castrillon et al., 2003). To test whether the upregulation of FoxO3 by p53 mediates p53-induced FoxO3 appears to have some role part of the cell cycle arrest controlled by p53, we isolated in apoptosis MEFs from FoxO3 þ / þ p53 þ / þ ( þ / þ ), FoxO3/ and FoxO has been shown to be important for p53- p53/ mice and assessed Bromodeoxyuridine (BrdU) dependent apoptosis in the context of Myc oncogene- incorporation in these cells in response to doxorubicin transformed cells (Bouchard et al., 2007). We asked (Figure 6a) and nutlin (Figure 6b). We found that whether FoxO3 had a role in p53-dependent apoptosis FoxO3/ MEFs underwent cell cycle arrest to the same in MEFs. MEFs do not usually respond to p53 extent as þ / þ MEFs in response to doxorubicin activation by undergoing apoptosis, unless they have (Figure 6a) and nutlin (Figure 6b). In contrast, p53/ been transformed with an oncogene, including MEFs were partially resistant to cell cycle arrest caused the adenovirus E1A protein (Lowe et al., 1993). We by doxorubicin (Figure 6a) and completely resistant to found that nutlin treatment combined with serum cell cycle arrest induced by nutlin (Figure 6b). These starvation slightly enhanced the percent of cells under- results indicate that unlike p53, FoxO3 is not necessary going apoptosis in E1A-transformed wild-type MEFs for DNA damage- and p53-dependent cell cycle arrest in (Figure 7a). FoxO3/ E1A-transformed MEFs ap- MEFs or that there is compensation by another factor, peared to be slightly impaired in their ability to undergo perhaps another FoxO isoform (see below). Figure 6c apoptosis in response to nutlin and serum starvation, shows that FoxO3 was dispensable for cell cycle arrest although this effect was more modest than that observed induced by long-term treatment by chronic oxidative in p53/ E1A-transformed MEFs (Figure 7a). We also stress (H2O2) and by hydroxyurea, which both lead to found that Bim, a well-known FoxO3 target involved p53-dependent cellular senescence (Marusyk et al., 2007) in apoptosis (Dijkers et al., 2000), was upregulated in (TMJ and LDA, unpublished). However, FoxO3/ response to g-irradiation in thymocytes and that this MEFs displayed significant cell cycle arrest compared upregulation was dependent on p53 (Figure 7b). Taken with þ / þ MEFs in basal long-term culture conditions together, these results are consistent with the notion that (Figure 6c), suggesting that FoxO3 loss may itself induce FoxO3 contributes, at least in part, to p53-mediated cell cycle arrest over several cellular passages. Consistent apoptosis. with the absence of role for FoxO3 in p53-dependent cell cycle arrest, the expression of p27Kip1, a well-known FoxO3 loss does not cooperate with p53 loss for tumor target of FoxO3 involved in cell cycle arrest (Kops et al., suppression in mice, but appears to have an impact on 2002), did not change in response to nutlin or tumor spectrum doxorubicin in p53 þ / þ MEFs, and was even upregulated Our study and published findings indicate that FoxO3 in p53/ MEFs (Figure 6d). These observations indicate and p53 interact in many different ways in cells. that the p53-dependent upregulation of FoxO3 mRNA Although the relevance of the interaction between and protein is not accompanied by an increase in FoxO3 FoxO3 and p53 in vivo has been tested in a mouse transcriptional activity toward p27Kip1, which is likely lymphoma model (Bouchard et al., 2007), it has not due to the fact that the FoxO3 protein is exported to the been assessed in the absence of oncogenic stimulation. cytoplasm in response to DNA damage in different cell Loss of one or both p53 alleles in mice results in types (AB, data not shown) (You et al., 2004). predisposition to cancer and death at an early age (Donehower et al., 1992; Jacks et al., 1994). In contrast, The role of FoxO3 in p53-dependent cell cycle arrest may FoxO3/ mice develop tumors only at a very low be masked by compensation by other FoxO family frequency, and tumor development in these mice members manifests late in life (Paik et al., 2007), probably due FoxO3 loss has been found to be compensated by other to the redundancy of FoxO family members. To test FoxO family members (Bouchard et al., 2007; Paik whether FoxO3 and p53 interacted in vivo for overall et al., 2007). Even though other FoxO family members survival and tumor survival, we generated a cohort

Oncogene FoxO3 is a direct target of p53 VM Renault et al 8 80 100 *** * 80 60 60 40 *** 40 positive cells positive cells Percent BrdU 20 Percent BrdU 20 NS NS 0 0 Dox: - +-+-+ Nutlin: -+ -+ -+ +/+ FoxO3-/- p53-/- +/+ FoxO3-/- p53-/-

p27Kip1 p53+/+ MEFs 100 p53-/- MEFs *** 0.04 *** 80 *** *** 60 0.03 ** ** *** mRNA 40 mRNA ** ** 0.02 positive cells Percent BrdU Kip1 20 NS

NS Gapdh

p27 0.01 / 0 -HH O HU -HO HU - O HU 2 2 2 2 2 2 0.00 +/+ FoxO3 -/- p53-/- hr: 04848 04848 Nutlin Dox Nutlin Dox

150 PSR

100 PSR “Pan FoxO” FoxO1 ** 50 FoxO3 positive cells Percent BrdU FoxO4 0 Nutlin: -++ - FoxO6 PSR PSR β ‘‘Pan FoxO’’ actin

Figure 6 FoxO3 is not necessary for p53-dependent cell cycle arrest in MEFs, but other FoxO family members may compensate for FoxO3 loss. (a) Percent BrdU-positive cells in FoxO3 þ / þ p53 þ / þ ( þ / þ ), FoxO3/ and p53/ MEFs in the presence or absence of doxorubicin (Dox, 0.2 mg/ml) for 24 h. Mean þ / s.e.m. of three independent experiments, two of which were conducted with independent MEF cultures from distinct animals. ***Po0.001 between þ / þ and p53/ MEFs for the same treatment; ns: non significant between þ / þ and FoxO3/ MEFs for the same treatment, two-way analysis of variance with Bonferroni post-test. (b) Percent BrdU-positive cells in FoxO3 þ / þ p53 þ / þ ( þ / þ ), FoxO3/ and p53/ MEFs in the presence or absence of nutlin (10 mM) for 24–36 h. Mean þ / s.e.m. of three independent experiments. *Po0.05, ***Po0.001 between þ / þ and p53/ MEFs for the same treatment; ns: nonsignificant between þ / þ and FoxO3/ MEFs for the same treatment, two-way ANOVA with Bonferroni post-test. (c) Percent BrdU-positive cells in FoxO3 þ / þ p53 þ / þ ( þ / þ ), FoxO3/ and p53/ MEFs in the presence or absence of chronic treatment of H2O2 or hydroxyurea. Mean þ / s.e.m. of two independent experiments with different lines of MEFs. **Po0.01, ***Po0.001 between þ / þ and FoxO3/ or p53/ MEFs for the same treatment; ns: non significant between þ / þ and FoxO3/ MEFs for the same treatment, two-way ANOVA with Bonferroni post-test. (d) Real-time quantitative PCR analysis of p27Kip1 mRNA levels in p53 þ / þ and p53/ MEFs in response to 4 and 8 h of treatment with nutlin (10 mM) or doxorubicin (Dox, 0.2 mg/ml). Mean þ / s.e.m. of two independent experiments conducted in triplicate. ***Po0.001 between p53 þ / þ and p53/ MEFs at a given time point, two-way ANOVA with Bonferroni post-test. (e) Percent BrdU-positive cells in MEFs infected with control lentiviruses (pSicoR (PSR)) or with lentiviruses expressing a short hairpin RNA to FoxO family members (PSR ‘pan FoxO’) in the presence or absence of nutlin (Nutlin, 10 mM) for 24 h. The data are expressed as fold decrease, respective to the value obtained in the absence of nutlin. Mean þ / s.e.m. of two independent experiments. **Po0.01, between PSR and PSR ‘pan FoxO’-infected MEFs in the presence of nutlin, two-way ANOVA with Bonferroni post-test. (f) Western blot of protein extracts from MEFs infected with control lentiviruses (PSR) or with lentiviruses expressing a short hairpin RNA to FoxO family members (PSR ‘pan FoxO’), using antibodies to FoxO1, FoxO3, FoxO4, FoxO6 and b-actin.

of compound FoxO3/p53 mutant mice in a mixed cooperate to diminish overall survival in vivo. This result FVB/N-129Sv/J background and monitored overall further suggests that a model lacking an activated survival in these mice (Figure 8). Loss of one or both oncogene may not be sufficient to reveal FoxO3 alleles of FoxO3 did not accelerate the mortality rate of interaction with p53 for tumor suppression. Alterna- p53/ mice in this genetic background (Figure 8a). tively, the absence of synergy between FoxO3 and p53 Similarly, loss of one or both alleles of FoxO3 did not loss for tumor development could be due to the fact that significantly affect the survival rate of p53 þ / mice both molecules are the in same genetic pathway. (Figure 8b), indicating that FoxO3 and p53 loss do not Histopathological analysis on a subset of FoxO3/p53

Oncogene FoxO3 is a direct target of p53 VM Renault et al 80 9 FoxO3 gene expression has been shown to be upregu- lated in response to a number of other environmental 60 stimuli, including nutrient deprivation, growth factor deprivation and hypoxia (Furuyama et al., 2002; Imae 40 et al., 2003; Bakker et al., 2007; Essaghir et al., 2009), raising the possibility that p53 might transduce the

positive cells expression of FoxO3 in response to some of these 20 stimuli. The induction of FoxO3 mRNA by hypoxia in MEFs is dependent on hypoxia inducible factor 1-a Percent cleaved caspase 3 0 (Bakker et al., 2007), although whether hypoxia -S N S+N -S N S+N -S N S+N inducible factor 1 directly binds to FoxO3 regulatory +/+ FoxO3 -/- p53-/- regions is not known. In addition, E2F1, a transcription factor involved in cell cycle progression and apoptosis, Bim has been shown to upregulate FoxO3 mRNA in human 0.08 p53 +/+ Thymocytes neuroblastoma cell lines by binding to two conserved p53-/- Thymocytes sites in the promoter of the human FoxO3 gene (Nowak 0.06 et al., 2007). These observations raise the possibility that p53, hypoxia inducible factor 1 and E2F1 may all

Gapdh * interact in controlling the expression of the FoxO3 gene. 0.04 The regulation of FoxO3 gene expression by p53 may mRNA

mRNA / be specific to a subset of tissues or cell types. FoxO3 and 0.02 p53 are both expressed relatively ubiquitously, but may Bim function more prominently in some tissues/cells versus 0.00 others. A cell-type specific regulation has indeed been γ-IR: -+ -+ observed for the FoxO3 gene. For example, FoxO3 Figure 7 FoxO3 has a role in p53-dependent apoptosis. mRNA is upregulated by E2F1 in neuroblastoma cell (a) Percent cleaved caspase 3-positive cells in E1A-transformed lines and in U2OS cells, but not in HeLa cells, human MEFs (FoxO3 þ / þ p53 þ / þ ( þ / þ ), FoxO3/ and p53/) in the diploid foreskin fibroblasts or PC12 cells (Nowak et al., absence of treatment () or in response to nutlin (N), serum 2007). Similarly, FoxO3 mRNA expression is down- starvation (S), and nutlin þ serum starvation (N þ S). Mean þ / s.e.m. of three independent experiments. (b) Real-time quantitative regulated by growth factors in human AG01518 PCR analysis of Bim mRNA levels in p53 þ / þ and p53/ fibroblasts, but not in BJ-hTert fibroblasts (Essaghir thymocytes, 3 h after g-irradiation (g-IR, 10 Gy). Mean þ / et al., 2009). Whether the regulation of FoxO3 by p53, s.e.m. of two independent experiments conducted in triplicate on which we have identified in MEFs and thymocytes, is þ / þ samples from 3–5 mice per genotype. *Po0.05 between p53 and observed in all cell types will be interesting to test. While p53/ thymocytes at a given time point, two-way analysis of variance with Bonferroni post-test. our study was being completed, another study reported that in normal adult mouse liver, p53 could bind a response element 4 kb upstream of the FoxO3 transcrip- compound mutant mice revealed that the loss of FoxO3 tional start site and transactivate FoxO3 mRNA in the context of p53/ mice resulted in the appearance expression (Kurinna et al., 2010). During hepatic of tumors, such as adenocarcinomas and angiolipomas regeneration, the binding of p53 to the binding site (Figures 8c and d). As these tumor types are rarely seen upstream of the FoxO3 gene was disrupted, leading to a in p53/ mice in the same genetic background (Sharp- decrease in FoxO3 mRNA expression. Consistent with less et al., 2002), this result is consistent with the notion our findings, p53-dependent upregulation of FoxO3 was that FoxO3 loss may impact the tumor spectrum of also observed in MEFs and in mouse hepatoma cells p53-deficient mice. Collectively, these findings suggest overexpressing p53 (Kurinna et al., 2010). Interestingly, that FoxO3 and p53 are part of a common transcrip- another member of the p53 family, p73, also binds to the tional network that may affect cellular and organismal same regulatory region in the promoter of the FoxO3 responses that are important to counter aging and gene (Kurinna et al., 2010). Together with our study, cancer. these findings indicate that the p53 family of transcrip- tion factors regulates FoxO3 in a number of different cell types, by binding to at least two different binding Discussion sites in the FoxO3 gene, one 4 kb upstream of FoxO3 transcriptional start site and one in the second intron of Our results indicate that p53 transactivates the expres- the FoxO3 gene (our study). It is possible that p53 sion of the FoxO3 gene by binding to a site located in occupancy at different sites is dependent on cell type or the second intron of the FoxO3 gene. The regulation of specific environmental conditions. FoxO3 gene expression is likely an important mechan- p53 and FoxO3 interact at many levels: (1) p53 and ism for the generation of a pool of FoxO3 molecules FoxO3 proteins physically interact (Nemoto et al., 2004; that could be made active or inactive by post-transla- Wang et al., 2008); (2) p53 and FoxO3 share common tional modifications. Our data indicate that DNA target genes (Zhao et al., 2000; Tran et al., 2002; damage upregulates the expression of FoxO3 mRNA. Vousden and Lu, 2002; Jacobs et al., 2007; Riley et al.,

Oncogene FoxO3 is a direct target of p53 VM Renault et al 10 100 100 +/+ +/- FoxO3 +/+ p53 -/- (n=8) FoxO3 p53 (n=21) +/- +/- FoxO3 +/- p53 -/- (n=29) FoxO3 p53 (n=62) 75 75 -/- +/- FoxO3 -/- p53 -/- (n=21) FoxO3 p53 (n=21)

50 50 Percent survival Percent survival 25 25

0 0 0 100 200 300 400 500 0200 400 600 800 1000 Days Days

FoxO3 p53 FoxO3 p53 FoxO3 p53 FoxO3 p53 FoxO3 p53 FoxO3 p53 (n=4) (n=4) (n=13) (n=16) (n=3) (n=11)

Lymphoma 1 (25%) 1 (25%) 5 (38.5%) 10 (63%) 2 (66%) 6 (55%) Angiosarcoma 0 3 (75%) 0 6 (38%) 0 5 (45%) Fibrosarcoma 1 (25%) 0 2 (15.4%) 2 (13%) 0 0 Osteosarcoma 0 0 1 (7.7%) 0 0 1 (9.1%) Rhabdomyosarcoma 1 (25%) 0 1 (7.7%) 0 0 0 Other sarcoma 1 (25%) 0 2 (15.4%) 2 (13%) 0 1 (9.1%) Hemangioma 0 0 1 (7.7%) 0 0 0 Adenocarcinoma 0 0 2 (15.4%) 1 (6.3%) 0 0 Other carcinoma 0 0 3 (23.1%) 0 0 0 Angiolipoma 0 0 0 0 0 1 (9.1%) Glomerulonephritis 0 0 0 1 (6.3%) 1 (33%) 1 (9.1%)

iiiiii

iv v vi

Figure 8 FoxO3 loss does not affect survival in mice that are lacking one or both p53 alleles, but may alter tumor spectrum. (a) Percent survival of mice with different alleles of FoxO3 in the p53/ background as a function of time. Kaplan–Meier survival curves with the number of mice indicated for each genotype. P ¼ 0.10, logrank test. (b) Percent survival of mice with different alleles of FoxO3 in the p53 þ / background as a function of time. Kaplan–Meier survival curves with the number of mice indicated for each genotype. P ¼ 0.13, logrank test. (c) Tumor types and glomerulonephritis in mice with different alleles of FoxO3 in the p53 þ / and p53/ background. The number of mice is indicated for each genotype. (d) Examples of sarcomas and carcinomas in compound FoxO3/p53 mutant mice. Main panels: 50. Insets: 630. (i) Subcutaneous fibrosarcoma in a FoxO3 þ /p53/ mouse; (ii) osteosarcoma in the leg of a FoxO3/p53/ mouse; (iii) colon carcinoma in a FoxO3 þ /p53/ mouse; (iv) uterine carcinoma in a FoxO3 þ /p53 þ / mouse; (v) breast carcinoma in a FoxO3 þ /p53 þ / mouse; (vi) muscle carcinoma in the arm of a FoxO3 þ /p53 þ / mouse.

2008); (3) FoxO3 stabilizes p53 protein (You et al., FoxO3 protein activity (You et al., 2004; Fu et al., 2009; 2006b); (4) FoxO3 indirectly activates p53 by upregulat- Miyaguchi et al., 2009) suggests that co-incident signals ing p19ARF, which inhibits the p53 ubiquitin ligase may be needed to activate the FoxO3 molecules Mdm2 (Bouchard et al., 2007); (5) p53 indirectly inhibits generated by p53-dependent transcription. Careful FoxO3 activity by inducing SGK (You et al., 2004), or analysis of the kinetics of FoxO3 mRNA upregulation more directly, by inhibiting FoxO3 transcriptional and FoxO3 protein activation in response to co- activity (Miyaguchi et al., 2009) and by inducing FoxO3 occurring signals will be required to tease apart the degradation through Mdm2 (Fu et al., 2009); and molecular links between p53 and FoxO3. (6) FoxO3 is a p53 target gene (this study and (Kurinna The presence of a binding site for p53 in the second et al., 2010)). Thus, p53 and FoxO3 likely form a intron of the FoxO3 gene is a feature that is conserved in regulatory network that elicits appropriate cellular the human genome. Mining the genome-wide ChIP data responses in response to stress stimuli. Negative and available for p53 (Wei et al., 2006) revealed that p53 positive feedback loops within this transcriptional binds to FoxO3 second intron in the human genome in circuit could be beneficial for triggering a finely tuned human HCT116 cells. These observations suggest that response to cellular stresses. The observation that p53 the binding of p53 in the second intron of the FoxO3 upregulates FoxO3 mRNA but also indirectly inhibits gene may be crucial for the regulation of FoxO3 gene

Oncogene FoxO3 is a direct target of p53 VM Renault et al 11 expression in mammals. Binding sites in introns have using the following primers: forward 50-GGAGGGTCCTGG been reported previously for a number of p53 target GTAAATTTTGGGTATACCCAGATGAGTAG-30 and rev- genes, including TRAIL (Takimoto and El-Deiry, 2000), erse 50-CTACTCATCTGGGTATACCCAAAATTTACCCA GADD45 (Kastan et al., 1992; Smith et al., 1994) and GGACCCTCC-30. The mutated fragment was entirely se- Mdm2 (Juven et al., 1993; Wu et al., 1993). Thus, p53 quenced and subcloned into SV40-pGL3. The E1A plasmid binding sites in introns may act as enhancers. was described previously (Lowe and Ruley, 1993). The ‘Pan FoxO’ short hairpin RNA construct was generated by Particularly notable are the recent findings that the subcloning the following primers (Hribal et al., 2003) into second intron of the human FoxO3 gene contains single- the pSicoR lentiviral expression vector between the HpaI and nucleotide polymorphisms associated with extreme XhoI sites (Ventura et al., 2004): forward 50-TGGATAAGG longevity in human centenarians from Japanese, GCGACAGAACTTCAAGAGAGTTGCTGTCGCCCTTA German and Italian descent (Willcox et al., 2008; TCCTTTTTTC-30 and reverse 50-TCGAGAAAAAAGGAT Anselmi et al., 2009; Flachsbart et al., 2009). Although AAGGGCGACAGCAACTCTCTTGAAGTTGCTGTCGC the causative single-nucleotide polymorphism associated CCTTATCCA-30. with longevity in the FoxO3 gene has not been located yet, these observations raise the intriguing possibility Antibodies that sequence variations in the second intron of the Antibodies to human FoxO1, FoxO4, FoxO4, and mouse FoxO3 gene may be important for human longevity, FoxO6 were generated by immunizing rabbits with a fusion perhaps by leading to subtle differences in transcription protein between glutathione S-transferase and each FoxO factor binding in this region, ultimately affecting FoxO3 family member, and purified by affinity (Quality Controlled Biochemicals, Hopkinton, MA, USA). The FoxO3 antibody mRNA levels. (Greer et al., 2007; Renault et al., 2009) and the FoxO6 Given that FoxO3 and p53 share so many common antibody were used previously (de la Torre-Ubieta et al., functions, it is surprising to note that these two 2010). The antibody to Mek1 was described previously molecules have been reported to have antagonistic roles (Lenormand et al., 1993). Antibodies to p53 were obtained on organismal lifespan. Indeed, FoxO factors extend from Oncogene Science (Cambridge, MA, USA) (Ab1), from lifespan in invertebrates (Henderson and Johnson, 2001; Novocastra/Leica Microsystems (Bannockburn, IL, USA) Giannakou et al., 2004; Hwangbo et al., 2004), and or from Vector Laboratories (Burlingame, CA, USA) mutants of the insulin/IGF-1 receptor—which lead to (CM5), and from Santa Cruz Biotechnology (Santa Cruz, CA, USA) (DO-1, SC-126X; pAb 1801, S-98X). Antibodies FoxO activation—also display an extended lifespan Cip1 in mice (Bluher et al., 2003; Holzenberger et al., 2003). to p21 and b-actin were purchased from Santa Cruz Biotechnology and Novus Biologicals (Littleton, CO, USA), In contrast, p53 activity appears to promote aging in respectively. Antibodies to cleaved caspase 3 and to BrdU worms and flies (Bauer et al., 2005; Arum and Johnson, were purchased from Cell Signaling Technology (Danvers, 2007). Interestingly, ectopic expression of p53 decreased MA, USA) and from AbD Serotec (Raleigh, NC, USA), lifespan in male flies, but increased lifespan in female respectively. flies (Shen and Tower, 2010). In a FoxO-null back- ground, p53 no longer shortened the lifespan of males, Thymocyte extraction but still extended the lifespan of females, suggesting Thymocytes were extracted from 6- to 10-week-old mice of that, in males and females, FoxO has a differential role pure 129/Sv or mixed 129/Sv C57/Bl6 background, downstream of p53 (Shen and Tower, 2010). Increased as described (Ihrie et al., 2003). The following genotypes p53 activity has also been shown to elicit premature were compared: p53 þ / þ versus littermate p53/ or p53LSLWT aging in mice (Tyner et al., 2002; Maier et al., 2004), mice, which result in complete p53 deficiency. Briefly, mice although wildtype p53 overexpression can actually were euthanized and the thymi of the mice were removed prolong mouse lifespan in the context of p19Arf over- and placed in phosphate-buffered saline (PBS) on ice. Each et al. thymus was passed through a 40-mm nylon cell strainer (BD expression (Matheu , 2007). The molecular bases Biosciences, San Jose, CA, USA) and divided into two plates for the differences between FoxO3 and p53 in regulating (one treated and one untreated). Thymocytes were then lifespan are not known, but understanding of the g-irradiated with 10 Gy using a 137Cs irradiator, and RNA connections between these two molecules should give was isolated 3 h later using Trizol (Life Technologies, crucial insights into the mechanisms that regulate Carlsbad, CA, USA). longevity. Real-time PCR In all, 1 mg of total RNA was reverse transcribed with random hexamers using Superscript II reverse transcriptase (Invitrogen) Materials and methods or Moloney murine leukemia virus reverse transcriptase (Invitrogen), according to the manufacturer’s protocol. Real- Constructs time PCR was performed on a BIO-RAD (Hercules, CA, USA) A bacterial artificial chromosome containing the full-length iCycler using iQ SYBR green (BIO-RAD) with the following mouse FoxO3 gene was purchased from BACPAC Resource forward and reverse primers: Center (Oakland, CA, USA). The 500-bp regions surrounding FoxO3 forward: 50-AGTGGATGGTGCGCTGTGT-30 the four putative p53 binding sites in the FoxO3 regulatory FoxO3 reverse: 50-CTGTGCAGGGACAGGTTGT-30 region were amplified by PCR, and were subcloned into the Mdm2 forward: 50-AGCGCAAAACGACACTTACA-30 pGL3 vector with the minimal SV40 promoter (SV40-pGL3). Mdm2 reverse: 50-ACACAATGTGCTGCTGCTTC-30 The mutated p53-4 binding site was generated by site-directed p21Cip1 forward: 50-CACAGCTCAGTGGACTGGAA-30 mutagenesis (Quikchange, Agilent, Santa Clara, CA, USA) p21Cip1 reverse: 50-ACCCTAGACCCACAATGCAG-30

Oncogene FoxO3 is a direct target of p53 VM Renault et al 12 FoxO1 forward: 50-ACGAGTGGATGGTGAAGAGC-30 (Life Technologies or Sigma Aldrich, St Louis, MO, USA) FoxO1 reverse: 50-TGCTGTGAAGGGACAGATTG-30 were coupled to rabbit secondary antibody-coated Dynal FoxO4 forward: 50-GGTGCCCTACTTCAAGGACA-30 magnetic beads (Life Technologies) in PBS þ 5 mg/ml BSA FoxO4 reverse: 50-GGTTCAGCATCCACCAAGAG-30 overnight at 4 1C. Chromatin extracts were pre-cleared on FoxO6 forward: 50-TGCCCTACTTCAAGGATAAAGG-30 beads and then incubated with the beads coupled to the FoxO6 reverse: 50-CAGCTGCTTCTTGCTCG-30 p53 antibody overnight at 4 1C. The beads were washed twice p27Kip1 forward: 50-GGACCAAATGCCTGACTCGT-30 in 1 ml low-salt ChIP buffer (0.1% SDS, 1% Triton X-100, p27Kip1 reverse: 50-CGCTTCCTCATCCCTGGAC-30 2mM EDTA, 20 mM Tris–HCl, pH 8.1, 150 mM NaCl), three Bim forward: 50-TCCTGTGCAATCCGTATCTCC-30 times in 1 ml high-salt ChIP buffer (0.1% SDS, 1% Triton Bim reverse: 50-CGCAAGCTTCCATACGACAGT-30 X-100, 2 mM EDTA, 20 mM Tris–HCl, pH 8.1, 500 mM Gapdh forward: 50-TGTGTCCGTCGTGGATCTGA-30 NaCl), four times with 1 ml LiCl ChIP buffer (0.25 M LiCl, Gapdh reverse: 50-TTGCTGTTGAAGTCGCAGGAG-30 1% IGEPAL CA630, 1% deoxycholic acid (sodium salt), 1 mM The experiments were conducted in triplicate and the results EDTA, 10 mM Tris, pH 8.1), and once or twice in 1 ml TE were expressed as 2(gene-of-interest number of cyclesb-actin number of cycles). buffer. The chromatin complex was eluted in 200–300 mlofIP elution buffer (1% SDS, 0.1 M NaHCO3)at651C overnight. The DNA was purified by phenol/chloroform/isoamyl- Northern blot alcohol and by PCR purification columns (Qiagen, Valencia, MEFs were isolated at embryonic day 13.5 from mice of CA, USA). Quantitative PCR was performed in triplicate different genotypes (p53LSLWT, p53LSL25,26 and p53LSLVP16). using SYBR green (BIO-RAD) and a 7900HT Fast Real- MEFs were infected by adenovirus expressing the Cre Time PCR Machine (Life Technologies) or a BIO-RAD recombinase (University of Iowa) at a multiplicity of infection iCycler on 2.5 ml of eluted DNA using the following sets of of 100 for 24 h, as described (Johnson et al., 2005). RNA was primers: isolated using the Trizol protocol. For northern blot experi- Mouse negative control forward: 50-GGGGGATAATGAT ments, 15 mg of RNA was resolved on a denaturing agarose gel TGCAAAA-30 and transferred onto a nylon membrane. Prehybridization and Mouse negative control reverse: 50-GCGTGGACAGAGAT hybridization were performed using ExpressHyb hybridization CTAGGC-30 solution (Clontech, Mountain View, CA, USA). Probes were p53-1 forward: 50-CCTAATGCCACAGCAGAACTCATC-30 prepared using a Prime-It II random primer labeling kit p53-1 reverse: 50-TGGGAATGGAACTCAGTCAGTGC-30 (Agilent, Santa Clara, CA, USA). A KpnI-NotI fragment of p53-4 forward: 50-GGGTGGGGGATTCTTTTCACTC-30 the mouse FoxO3 complementary DNA was used as a probe. p53-4 reverse: 50-CGAGGTAAGCCAGCACATACAAAT The probe for p21Cip1 was described (Attardi et al., 2000). G-30 p53 (p21Cip1)forward:50-GAGACCAGCAGCAAAATCG-30 Cip1 0 0 Western blot p53 (p21 ) reverse: 5 -CAGCCCCACCTCTTCAATTC-3 Cells were lysed in lysis buffer (Tris–HCl pH 8.0 (50 mM), For each primer set, a standard curve was established using NaCl (100 mM), ethylene glycol tetraacetic acid (2 mM), NaF a 5- to 10-fold dilution series. (10 mM), b-glycerophosphate (40 mM), Triton X-100 (0.4%), aprotinin (10 mg/ml), phenylmethylsulfonyl fluoride (1 mM). In Luciferase assays all, 50 mg of protein extract was resolved by SDS–polyacryla- MEFs were cultivated in Dulbecco’s modified Eagle’s mide gel electrophoresis and transferred to nitrocellulose medium supplemented with 10% fetal bovine serum membranes. The membranes were incubated with primary (Life Technologies) and antibiotics (50 U/ml penicillin, 50 mg/ antibodies, and the primary antibodies were visualized using ml streptomycin, 2 mM glutamine). For luciferase assays, horseradish peroxidase-conjugated anti-mouse or anti-rabbit MEFs were seeded at 35 000 cells per well in 24-well plates. secondary antibodies and enhanced chemiluminescence (GE In all, 125 ng of vector encoding the luciferase reporter under Healthcare, Piscataway, NJ, USA). different promoters was transfected together with 62.5 ng of a vector expressing Renilla luciferase to control for variation in ChIP with p53 antibodies transfection efficiency. Two days after transfection, cells MEFs were seeded in 15-cm dishes at a density of 105–4 105 were lysed and firefly luciferase and Renilla luciferase were cells per ml. Twelve to twenty-four hours after plating, cells measured according to the Promega protocol (Promega, were stimulated with doxorubicin (0.2 mg/ml) for 18–20 h Madison, WI, USA). (Figure 4b) or 6 h (Figure 4c). Cells were cross-linked with formaldehyde (1%) for 10 min and incubated with glycine Lentiviral infection of MEFs (0.125 M) for 5 min. Cells were washed with PBS and lysed in Lentiviruses were produced by transfection of 293T cells with the Farnham lysis buffer (5 mM PIPES, 85 mM KCl, 0.5% the pSicoR lentiviral vectors and the helper plasmids 8.2 and NP-40, protease inhibitor cocktail (#11697498001, Roche VSVg. MEFs were plated at 105 cells per ml in 10-cm plates, USA, Indianapolis, IN, USA). Nuclear extracts were collected and 0.45-mm-filtered 293T supernatant was applied 24 h later by centrifuging at 2000 r.p.m. for 5 min. The cell nuclei and the infection was repeated 2–3 times in the presence were re-suspended in RIPA buffer (1 PBS, 1% NP-40, 0.5% of polybrene (8 mg/ml). Puromycin (5 mg/ml) was added Na-deoxycholate, 0.1% SDS, supplemented with Roche to select MEFs that were infected with the virus. On day protease inhibitor cocktail). Chromatin was sonicated 5 post-infection, MEFs were used for BrdU or western 5–8 times, for 30 s each time, with a Sonics VirCell 130 blot assays. sonicator (Sonics & Materials, Newtown, CT, USA) equipped with a stepped microtip. The chromatin was flash-frozen in liquid nitrogen and an aliquot was used to verify that BrdU incorporation assays sonication was effective. Antibodies to p53 (Figure 5b: DO-1 FoxO3 þ / þ p53 þ / þ , p53/ or FoxO3/ MEFs were seeded in and pAb 1801 from Santa Cruz, 2.5 mg each; Figure 5c: CM5 cover chambers at 300 000 cells per ml. Cells were stimulated from Novocastra, 25 ml per reaction) or IgG control with doxorubicin (0.2 mg/ml) or nutlin (10 mM) for 24 h, unless

Oncogene FoxO3 is a direct target of p53 VM Renault et al 13 otherwise noted. BrdU was added for the last 16 h, and the age at a maximum of five mice per cage with standard chow cells were fixed in 4% formaldehyde for 10 min and and water ad libitum in a standard light–day cycle. Mice were permeabilized in 0.4 % Triton for 30 min. Coverslips were monitored once to twice a week, and were killed by CO2 incubated with 2 N HCl for 30 min, and washed extensively asphyxiation and scored as a death in survival analysis when with PBS. Non-specific antibody-binding sites were blocked by moribund or if external tumors exceeded 1 cm in diameter. incubation with PBS containing 10% goat serum and 7.5% Survival analysis was performed using Kaplan–Meier curves BSA. Coverslips were then incubated with primary antibodies with the logrank test. (rat anti-BrdU, 1:500) for 2 h, and washed five times with PBS. Cells were then incubated for 1 h with a secondary antibody Histopathology (goat anti-rat Alexa 488, 1:400). Coverslips were mounted in All tissues, except skin and bone marrow, were fixed in 10% Vectashield (Vector Laboratories, Burlingame, CA, USA) formaldehyde for 24 to 48 h. Bones from the head, legs and rib containing 4-6-diamidino-2-phenyl indole and examined under cage were fixed in Bouin’s fixative for 1 week before being epifluorescent illumination using a Zeiss (Thornwood, NY, decalcified for 48 h. Tissues were embedded in paraffin, USA) microscope digital camera with AxioVision 4 software. sectioned in 5-mm sections, dewaxed and stained with For quantification, at least 250–400 cells per coverslip were hematoxylin and eosin at the Comparative Medicine counted in a blinded manner. The ratio of BrdU-positive Department, Stanford Medical School. Tumors were identified nuclei over the total number of nuclei was calculated. in a blinded manner.

Apoptosis assays in E1A-transformed MEFs Phoenix cells were plated at 200 000 cells per ml in 10-cm plates Conflict of interest and transfected with 10 mg of the E1A-encoding plasmid with the calcium phosphate method. Phoenix cell supernatant was The authors declare no conflict of interest. filtered through 0.45-mm filters onto MEFs (70 000 cells per ml in 10-cm plates) in the presence of polybrene (8 mg/ml) and the infection was repeated once. Infected MEFs were selected Acknowledgements 24 h after the last infection with selection media containing 250 mg/ml hygromycin. E1A-transformed MEFs were seeded WethankDrRonDePinhoforhisgenerousgiftoftheFoxO3/ on coverslips at 200 000 cells per well. mice. We thank Julien Sage for critical discussion, reading of the 24 h later, MEFs were stimulated with nutlin (10 mM) for 8 h manuscript, help with tumor analysis and in the presence or absence of serum in the medium. Cells were for taking the pictures for Figure 8d. We thank Jamie Brett fixed in 4% formaldehyde for 10 min and permeabilized in for reading the manuscript. We thank Pauline Chu (Compara- 0.4% Triton for 30 min. Non-specific antibody binding sites tive Medicine Department, Stanford Medical School) for her were blocked by incubation with PBS containing 10% goat help in processing the histopathology samples. We thank Dan serum and 7.5% BSA. Coverslips were then incubated with Calnan for participating in earlier aspects of this work. This primary antibodies (rat anti-cleaved caspase 3, 1:500) for 2 h, work was supported by NIH R01 AG026648 and a McCormick and washed five times with PBS. Cells were then incubated for Award for Women in Science (AB). ZX, EES and MQZ were 1 h with a secondary antibody (goat anti-rat Alexa 555, 1:400). supported partly by NIH R01 HG001696. VMR received Coverslips were mounted in Vectashield containing support from the Dean’s Fellowship at Stanford University. 4-6-diamidino-2-phenyl indole and examined under epifluor- Author contributions: VMR designed, performed and analyzed escent illumination using a Zeiss microscope digital camera the lifespan and tumor spectrum of compound FoxO3/p53 with AxioVision 4 software. For quantification, at least mice (Figure 8). PUT completed Figure 1b, Figure 5b, 250–400 cells per coverslip were counted in a blinded manner. Figure 6b, Figure 6e, Figure 7a and helped with Figure 2 The proportion of cleaved caspase-3-positive nuclei over the and Figure 6d. KLH completed Figure 5d, Figure 5e, total number of nuclei was calculated. Figure 6a, Figure 6b and Figure 6c. JLW completed Figure 2, Figure 6d, and helped with Figure 3 and Figure 7b. CAB Mouse crosses and survival curves completed Figure 3 and Figure 7b. DKB completed Figure 5c. Aging cohorts were produced by three different mating OSV initiated this project as her Honors Thesis and completed strategies: (i) FoxO3/p53 þ / (male) and FoxO3 þ /p53/ Figure 1a. TMJ completed Figure 4b. PRO completed (female), (ii) FoxO3 þ /p53 þ / and FoxO3 þ /p53 þ / and Figure 6f. ZX and EES identified p53 binding sites in FoxO3 (iii) FoxO3 þ /p53 þ / þ and FoxO3 þ / þ p53 þ /. Twenty-one regulatory regions (Figure 5a) under the supervision of MQZ. FoxO3/p53/, 29 FoxO3 þ /p53/ and 8 FoxO3 þ / þ p53/ HV performed the tumor identification (Figure 8b). LDA mice were generated. Twenty-one FoxO3/p53 þ /, supervised CAB, DKB and TMJ, and provided ideas. AB 62 FoxO3 þ /p53 þ / and 21 FoxO3 þ / þ p53 þ / mice were supervised VMR, PUT, KLH, JLW, OSV and PRO. The generated. The cohorts were on a mixed FVB/N and 129Sv/J manuscript was written by AB, VMR and OSV, with input background. Animals were genotyped by PCR and allowed to from LDA.

References

Anselmi CV, Malovini A, Roncarati R, Novelli V, Villa F, Attardi LD, Reczek EE, Cosmas C, Demicco EG, McCurrach ME, Condorelli G et al. (2009). Association of the FOXO3A locus Lowe SW et al. (2000). PERP, an apoptosis-associated target of with extreme longevity in a southern Italian centenarian study. p53, is a novel member of the PMP-22/gas3 family. Genes Dev 14: Rejuvenation Res 12: 95–104. 704–718. Arum O, Johnson TE. (2007). Reduced expression of the Caenorhab- Bakker WJ, Harris IS, Mak TW. (2007). FOXO3a is activated in ditis elegans p53 ortholog cep-1 results in increased longevity. response to hypoxic stress and inhibits HIF1-induced apoptosis via J Gerontol A Biol Sci Med Sci 62: 951–959. regulation of CITED2. Mol Cell 28: 941–953.

Oncogene FoxO3 is a direct target of p53 VM Renault et al 14 Bauer JH, Poon PC, Glatt-Deeley H, Abrams JM, Helfand SL. (2005). Greer EL, Brunet A. (2005). FOXO transcription factors at the Neuronal expression of p53 dominant-negative proteins in adult interface between longevity and tumor suppression. Oncogene 24: Drosophila melanogaster extends life span. Curr Biol 15: 2063–2068. 7410–7425. Bluher M, Kahn BB, Kahn CR. (2003). Extended longevity in mice Greer EL, Dowlatshahi D, Banko MR, Villen J, Hoang K, Blanchard lacking the insulin receptor in adipose tissue. Science 299: 572–574. D et al. (2007). An AMPK-FOXO pathway mediates longevity Bouchard C, Lee S, Paulus-Hock V, Loddenkemper C, Eilers M, induced by a novel method of dietary restriction in C elegans. Curr Schmitt CA. (2007). FoxO transcription factors suppress Biol 17: 1646–1656. Myc-driven lymphomagenesis via direct activation of Arf. Genes Harvey M, McArthur MJ, Montgomery Jr CA, Bradley A, Dev 21: 2775–2787. Donehower LA. (1993a). Genetic background alters the spectrum Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS et al. (1999). of tumors that develop in p53-deficient mice. FASEB J 7: 938–943. Akt promotes cell survival by phosphorylating and inhibiting a Harvey M, McArthur MJ, Montgomery Jr CA, Butel JS, Bradley A, Forkhead transcription factor. Cell 96: 857–868. Donehower LA. (1993b). Spontaneous and carcinogen-induced Brunet A, Datta SR, Greenberg ME. (2001). Transcription-dependent tumorigenesis in p53-deficient mice. Nat Genet 5: 225–229. and -independent control of neuronal survival by the PI3K-Akt Henderson ST, Johnson TE. (2001). daf-16 integrates developmental signaling pathway. Curr Opin Neurobiol 11: 297–305. and environmental inputs to mediate aging in the nematode Brunet A, Kanai F, Stehn J, Xu J, Sarbassova D, Frangioni JV et al. Caenorhabditis elegans. Curr Biol 11: 1975–1980. (2002). 14–3–3 transits to the nucleus and participates in dynamic Holzenberger M, Dupont J, Ducos B, Leneuve P, Geloen A, Even PC nucleocytoplasmic transport. J Cell Biol 156: 817–828. et al. (2003). IGF-1 receptor regulates lifespan and resistance to Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y et al. oxidative stress in mice. Nature 421: 182–187. (2004). Stress-dependent regulation of FOXO transcription factors Hribal ML, Nakae J, Kitamura T, Shutter JR, Accili D. (2003). Regu- by the SIRT1 deacetylase. Science 303: 2011–2015. lation of insulin-like growth factor-dependent myoblast differentiation Calnan DR, Brunet A. (2008). The FoxO code. Oncogene 27: 2276–2288. by Foxo forkhead transcription factors. JCellBiol162: 535–541. Castrillon DH, Miao L, Kollipara R, Horner JW, DePinho RA. Hu MC, Lee DF, Xia W, Golfman LS, Ou-Yang F, Yang JY et al. (2003). Suppression of ovarian follicle activation in mice by the (2004). IkappaB kinase promotes tumorigenesis through inhibition transcription factor Foxo3a. Science 301: 215–218. of forkhead FOXO3a. Cell 117: 225–237. de la Torre-Ubieta L, Gaudilliere B, Yang Y, Ikeuchi Y, Yamada T, Hursting SD, Lavigne JA, Berrigan D, Perkins SN, Barrett JC. (2003). DiBacco S et al. (2010). A FOXO-Pak1 transcriptional pathway Calorie restriction, aging, and cancer prevention: mechanisms of controls neuronal polarity. Genes Dev 24: 799–813. action and applicability to humans. Annu Rev Med 54: 131–152. Deng G, Chen LC, Schott DR, Thor A, Bhargava V, Ljung BM et al. Hwangbo DS, Gersham B, Tu MP, Palmer M, Tatar M. (2004). (1994). Loss of heterozygosity and p53 gene mutations in breast Drosophila dFOXO controls lifespan and regulates insulin cancer. Cancer Res 54: 499–505. signalling in brain and fat body. Nature 429: 562–566. Dijkers PF, Medemadagger RH, Lammers JJ, Koenderman L, Ihrie RA, Reczek E, Horner JS, Khachatrian L, Sage J, Jacks T et al. Coffer PJ. (2000). Expression of the pro-apoptotic bcl-2 family (2003). Perp is a mediator of p53-dependent apoptosis in diverse cell member bim is regulated by the forkhead transcription factor types. Curr Biol 13: 1985–1990. FKHR-L1. Curr Biol 10: 1201–1204. Imae M, Fu Z, Yoshida A, Noguchi T, Kato H. (2003). Nutritional Donehower LA, Harvey M, Slagle BL, McArthur MJ, Montgomery Jr and hormonal factors control the gene expression of FoxOs, CA, Butel JS et al. (1992). Mice deficient for p53 are developmen- the mammalian homologues of DAF-16. J Mol Endocrinol 30: tally normal but susceptible to spontaneous tumours. Nature 356: 253–262. 215–221. Jacks T, Remington L, Williams BO, Schmitt EM, Halachmi S, el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B. Bronson RT et al. (1994). Tumor spectrum analysis in p53-mutant (1992). Definition of a consensus binding site for p53. Nat Genet 1: mice. Curr Biol 4: 1–7. 45–49. Jacobs SB, Basak S, Murray JI, Pathak N, Attardi LD. (2007). Siva is el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent an apoptosis-selective p53 target gene important for neuronal cell JM et al. (1993). WAF1, a potential mediator of p53 tumor death. Cell Death Differ 14: 1374–1385. suppression. Cell 75: 817–825. Johnson TM, Hammond EM, Giaccia A, Attardi LD. (2005). The Essaghir A, Dif N, Marbehant CY, Coffer PJ, Demoulin JB. (2009). p53QS transactivation-deficient mutant shows stress-specific The transcription of FOXO genes is stimulated by FOXO3 and apoptotic activity and induces embryonic lethality. Nat Genet 37: repressed by growth factors. J Biol Chem 284: 10334–10342. 145–152. Fiscella M, Zhang H, Fan S, Sakaguchi K, Shen S, Mercer WE et al. Johnson TM, Meade K, Pathak N, Marques MR, Attardi LD. (2008). (1997). Wip1, a novel human protein phosphatase that is induced Knockin mice expressing a chimeric p53 protein reveal mechanistic in response to ionizing radiation in a p53-dependent manner. differences in how p53 triggers apoptosis and senescence. Proc Natl Proc Natl Acad Sci USA 94: 6048–6053. Acad Sci USA 105: 1215–1220. Flachsbart F, Caliebe A, Kleindorp R, Blanche H, von Eller-Eberstein Juven T, Barak Y, Zauberman A, George DL, Oren M. (1993). Wild H, Nikolaus S et al. (2009). Association of FOXO3A variation type p53 can mediate sequence-specific transactivation of an internal with human longevity confirmed in German centenarians. Proc Natl promoter within the mdm2 gene. Oncogene 8: 3411–3416. Acad Sci USA 106: 2700–2705. Kastan MB, Zhan Q, el-Deiry WS, Carrier F, Jacks T, Walsh WV Fu W, Ma Q, Chen L, Li P, Zhang M, Ramamoorthy S et al. (2009). et al. (1992). A mammalian cell cycle checkpoint pathway MDM2 acts downstream of p53 as an E3 ligase to promote FOXO utilizing p53 and GADD45 is defective in ataxia-telangiectasia. ubiquitination and degradation. J Biol Chem 284: 13987–14000. Cell 71: 587–597. Furuyama T, Yamashita H, Kitayama K, Higami Y, Shimokawa I, Kenyon C. (2005). The plasticity of aging: insights from long-lived Mori N. (2002). Effects of aging and caloric restriction on the gene mutants. Cell 120: 449–460. expression of Foxo1, 3, and 4 (FKHR, FKHRL1, and AFX) in the Kops GJ, Dansen TB, Polderman PE, Saarloos I, Wirtz KW, rat skeletal muscles. Microsc Res Tech 59: 331–334. Coffer PJ et al. (2002). Forkhead transcription factor FOXO3a Gaidano G, Ballerini P, Gong JZ, Inghirami G, Neri A, Newcomb EW protects quiescent cells from oxidative stress. Nature 419: 316–321. et al. (1991). p53 mutations in human lymphoid malignancies: Kurinna S, Stratton SA, Tsai WW, Akdemir KC, Gu W, Singh P et al. association with Burkitt lymphoma and chronic lymphocytic (2010). Direct activation of forkhead box O3 by tumor suppressors leukemia. Proc Natl Acad Sci USA 88: 5413–5417. p53 and p73 is disrupted during liver regeneration in mice. Giannakou ME, Goss M, Junger MA, Hafen E, Leevers SJ, Hepatology 52: 1023–1032. Partridge L. (2004). Long-lived drosophila with overexpressed Lenormand P, Sardet C, Page` s G, L’Allemain G, Brunet A, dFOXO in adult fat body. Science 305: 361. Pouysse´gur J. (1993). Growth factors induce nuclear translocation

Oncogene FoxO3 is a direct target of p53 VM Renault et al 15 of MAP kinases (p42mapk and p44mapk) but not of their activator Shen J, Tower J. (2010). Drosophila foxo acts in males to cause sexual- MAP kinase kinase (p45 mapkk) in fibroblasts. J Cell Biol 122: dimorphism in tissue-specific p53 life span effects. Exp Gerontol 45: 1079–1088. 97–105. Lo Coco F, Gaidano G, Louie DC, Offit K, Chaganti RS, Dalla- Smith ML, Chen IT, Zhan Q, Bae I, Chen CY, Gilmer TM et al. Favera R. (1993). p53 mutations are associated with histologic (1994). Interaction of the p53-regulated protein Gadd45 with transformation of follicular lymphoma. Blood 82: 2289–2295. proliferating cell nuclear antigen. Science 266: 1376–1380. Lowe SW, Ruley HE. (1993). Stabilization of the p53 tumor Takimoto R, El-Deiry WS. (2000). Wild-type p53 transactivates suppressor is induced by adenovirus 5 E1A and accompanies the KILLER/DR5 gene through an intronic sequence-specific apoptosis. Genes Dev 7: 535–545. DNA-binding site. Oncogene 19: 1735–1743. Lowe SW, Ruley HE, Jacks T, Housman DE. (1993). p53-dependent Tothova Z, Kollipara R, Huntly BJ, Lee BH, Castrillon DH, apoptosis modulates the cytotoxicity of anticancer agents. Cell 74: Cullen DE et al. (2007). FoxOs are critical mediators of hematopoietic 957–967. stem cell resistance to physiologic oxidative stress. Cell 128: 325–339. Luo J, Nikolaev AY, Imai S, Chen D, Su F, Shiloh A et al. (2001). Tran H, Brunet A, Grenier JM, Datta SR, Fornace Jr AJ, DiStefano Negative control of p53 by Sir2alpha promotes cell survival under PS et al. (2002). DNA repair pathway stimulated by the forkhead stress. Cell 107: 137–148. transcription factor FOXO3a through the Gadd45 protein. Maier B, Gluba W, Bernier B, Turner T, Mohammad K, Guise T et al. Science 296: 530–534. (2004). Modulation of mammalian life span by the short isoform of Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, p53. Genes Dev 18: 306–319. Igelmann H et al. (2002). p53 mutant mice that display early ageing- Marusyk A, Wheeler LJ, Mathews CK, DeGregori J. (2007). p53 associated phenotypes. Nature 415: 45–53. mediates senescence-like arrest induced by chronic replicational Van Der Heide LP, Hoekman MF, Smidt MP. (2004). The ins and outs stress. Mol Cell Biol 27: 5336–5351. of FoxO shuttling: mechanisms of FoxO translocation and Masoro EJ. (2005). Overview of caloric restriction and ageing. transcriptional regulation. Biochem J 380(Part 2): 297–309. Mech Ageing Dev 126: 913–922. Vassilev LT, Vu BT, Graves B, Carvajal D, Podlaski F, Filipovic Z Matheu A, Maraver A, Klatt P, Flores I, Garcia-Cao I, Borras C et al. et al. (2004). in vivo activation of the p53 pathway by small-molecule (2007). Delayed ageing through damage protection by the Arf/p53 antagonists of MDM2. Science 303: 844–848. pathway. Nature 448: 375–379. Vaziri H, Dessain SK, Ng Eaton E, Imai SI, Frye RA, Pandita TK Medema RH, Kops GJ, Bos JL, Burgering BM. (2000). AFX-like et al. (2001). hSIR2(SIRT1) functions as an NAD-dependent p53 Forkhead transcription factors mediate cell-cycle regulation by Ras deacetylase. Cell 107: 149–159. and PKB through p27kip1. Nature 404: 782–787. Velasco-Miguel S, Buckbinder L, Jean P, Gelbert L, Talbott R, Miyaguchi Y, Tsuchiya K, Sakamoto K. (2009). P53 negatively Laidlaw J et al. (1999). PA26, a novel target of the p53 tumor regulates the transcriptional activity of FOXO3a under oxidative suppressor and member of the GADD family of DNA damage and stress. Cell Biol Int 33: 853–860. growth arrest inducible genes. Oncogene 18: 127–137. Motta MC, Divecha N, Lemieux M, Kamel C, Chen D, Gu W et al. Ventura A, Meissner A, Dillon CP, McManus M, Sharp PA, Van Parijs L (2004). Mammalian SIRT1 represses forkhead transcription factors. et al. (2004). Cre-lox-regulated conditional RNA interference from Cell 116: 551–563. transgenes. Proc Natl Acad Sci USA 101: 10380–10385. Nakano K, Vousden KH. (2001). PUMA, a novel proapoptotic gene, Vogelstein B, Lane D, Levine AJ. (2000). Surfing the p53 network. is induced by p53. Mol Cell 7: 683–694. Nature 408: 307–310. Nemoto S, Fergusson MM, Finkel T. (2004). Nutrient availability Vousden KH, Lu X. (2002). Live or let die: the cell’s response to p53. regulates SIRT1 through a forkhead-dependent pathway. Science Nat Rev Cancer 2: 594–604. 306: 2105–2108. Vousden KH, Prives C. (2009). Blinded by the light: the growing Nowak K, Killmer K, Gessner C, Lutz W. (2007). E2F-1 regulates complexity of p53. Cell 137: 413–431. expression of FOXO1 and FOXO3a. Biochim Biophys Acta 1769: Wang F, Marshall CB, Yamamoto K, Li GY, Plevin MJ, You H et al. 244–252. (2008). Biochemical and structural characterization of an intramo- Paik JH, Ding Z, Narurkar R, Ramkissoon S, Muller F, Kamoun WS lecular interaction in FOXO3a and its binding with p53. J Mol Biol et al. (2009). FoxOs cooperatively regulate diverse pathways 384: 590–603. governing neural stem cell homeostasis. Cell Stem Cell 5: 540–553. Wei CL, Wu Q, Vega VB, Chiu KP, Ng P, Zhang T et al. (2006). A Paik JH, Kollipara R, Chu G, Ji H, Xiao Y, Ding Z et al. (2007). global map of p53 transcription-factor binding sites in the human FoxOs are lineage-restricted redundant tumor suppressors and genome. Cell 124: 207–219. regulate endothelial cell homeostasis. Cell 128: 309–323. Willcox BJ, Donlon TA, He Q, Chen R, Grove JS, Yano K et al. Pawlikowska L, Hu D, Huntsman S, Sung A, Chu C, Chen J et al. (2008). FOXO3A genotype is strongly associated with human (2009). Association of common genetic variation in the insulin/IGF1 longevity. Proc Natl Acad Sci USA 105: 13987–13992. signaling pathway with human longevity. Aging Cell 8: 460–472. Wu X, Bayle JH, Olson D, Levine AJ. (1993). The p53-mdm-2 Quinlan DC, Davidson AG, Summers CL, Warden HE, Doshi HM. autoregulatory feedback loop. Genes Dev 7: 1126–1132. (1992). Accumulation of p53 protein correlates with a poor You H, Jang Y, You-Ten AI, Okada H, Liepa J, Wakeham A et al. prognosis in human lung cancer. Cancer Res 52: 4828–4831. (2004). p53-dependent inhibition of FKHRL1 in response to DNA Renault VM, Rfafalski VA, Morgan AA, Salih DA, Brett JO, Webb damage through protein kinase SGK1. Proc Natl Acad Sci USA AE et al. (2009). FoxO3 regulates neural stem cell homeostasis. 101: 14057–14062. Cell Stem Cell 5: 527–539. You H, Pellegrini M, Tsuchihara K, Yamamoto K, Hacker G, Riley T, Sontag E, Chen P, Levine A. (2008). Transcriptional control Erlacher M et al. (2006a). FOXO3a-dependent regulation of Puma of human p53-regulated genes. Nat Rev Mol Cell Biol 9: 402–412. in response to cytokine/growth factor withdrawal. J Exp Med 203: Scott N, Sagar P, Stewart J, Blair GE, Dixon MF, Quirke P. (1991). 1657–1663. p53 in colorectal cancer: clinicopathological correlation and You H, Yamamoto K, Mak TW. (2006b). Regulation of transactiva- prognostic significance. Br J Cancer 63: 317–319. tion-independent proapoptotic activity of p53 by FOXO3a. Seoane J, Le HV, Shen L, Anderson SA, Massague J. (2004). Proc Natl Acad Sci USA 103: 9051–9056. Integration of Smad and forkhead pathways in the control of Yu J, Zhang L, Hwang PM, Kinzler KW, Vogelstein B. (2001). PUMA neuroepithelial and glioblastoma cell proliferation. Cell 117: induces the rapid apoptosis of colorectal cancer cells. Mol Cell 7: 211–223. 673–682. Sharpless NE, Alson S, Chan S, Silver DP, Castrillon DH, Zhao R, Gish K, Murphy M, Yin Y, Notterman D, Hoffman WH DePinho RA. (2002). p16(INK4a) and p53 deficiency cooperate in et al. (2000). Analysis of p53-regulated gene expression patterns tumorigenesis. Cancer Res 62: 2761–2765. using oligonucleotide arrays. Genes Dev 14: 981–993.

Oncogene