DOCSLIB.ORG

ADCK4 Deficiency Destabilizes the Coenzyme Q Complex

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ADCK4 Deficiency Destabilizes the Coenzyme Q Complex BASIC RESEARCH www.jasn.org ADCK4 Deficiency Destabilizes the Coenzyme Q Complex, Which Is Rescued by 2,4-Dihydroxybenzoic Acid Treatment Eugen Widmeier ,1,2 Seyoung Yu,3,4 Anish Nag,5 Youn Wook Chung ,6 Makiko Nakayama,1 Lucía Fernández-del-Río,5 Hannah Hugo,1 David Schapiro,1 Florian Buerger,1 Won-Il Choi,1 Martin Helmstädter,2 Jae-woo Kim,4,7 Ji-Hwan Ryu ,4,6 Min Goo Lee,3,4 Catherine F. Clarke,5 Friedhelm Hildebrandt,1 and Heon Yung Gee 3,4 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background Mutations in ADCK4 (aarF domain containing kinase 4) generally manifest as steroid-resistant nephrotic syndrome and induce coenzyme Q10 (CoQ10)deficiency. However, the molecular mechanisms underlying steroid-resistant nephrotic syndrome resulting from ADCK4 mutations are not well under- stood, largely because the function of ADCK4 remains unknown. BASIC RESEARCH Methods To elucidate the ADCK4’s function in podocytes, we generated a podocyte-specific, Adck4-knockout mouse model and a human podocyte cell line featuring knockout of ADCK4. These knockout mice and podo- cytes were then treated with 2,4-dihydroxybenzoic acid (2,4-diHB), a CoQ10 precursor analogue, or with a vehicle only. We also performed proteomic mass spectrometry analysis to further elucidate ADCK4’sfunction. Results Absence of Adck4 in mouse podocytes caused FSGS and albuminuria, recapitulating features of nephrotic syndrome caused by ADCK4 mutations. In vitro studies revealed that ADCK4-knockout podo- cytes had significantly reduced CoQ10 concentration, respiratory chain activity, and mitochondrial poten- tial, and subsequently displayed an increase in the number of dysmorphic mitochondria. However, treatment of 3-month-old knockout mice or ADCK4-knockout cells with 2,4-diHB prevented the develop- ment of renal dysfunction and reversed mitochondrial dysfunction in podocytes. Moreover, ADCK4 inter- acted with mitochondrial proteins such as COQ5, as well as cytoplasmic proteins such as myosin and heat shock proteins. Thus, ADCK4 knockout decreased the COQ complex level, but overexpression of ADCK4 in ADCK4-knockout podocytes transfected with wild-type ADCK4 rescued the COQ5 level. Conclusions Our study shows that ADCK4 is required for CoQ10 biosynthesis and mitochondrial function in podocytes, and suggests that ADCK4 in podocytes stabilizes proteins in complex Q in podocytes. Our study also suggests a potential treatment strategy for nephrotic syndrome resulting from ADCK4 mutations. JASN 31: 1191–1211, 2020. doi: https://doi.org/10.1681/ASN.2019070756 Coenzyme Q (CoQ, ubiquinone)—a lipophilic com- Received July 30, 2019. Accepted February 22, 2020. ponent located in the inner mitochondrial mem- E.W. and S.Y. contributed equally to this work. brane, Golgi apparatus, and cell membranes—plays Published online ahead of print. Publication date available at 1 a pivotal role in oxidative phosphorylation. CoQ www.jasn.org. shuttles electrons from complexes I and II to complex Correspondence: Prof. Heon Yung Gee, Department of Pharma- 2 III in the mitochondrial respiratory chain. It also has cology, Yonsei University College of Medicine, Avison BioMedical a critical function in antioxidant defense because of Research Center Rm#225, 50-1 Yonsei-ro, Seodaemun-gu, Seoul 3 03722, Republic of Korea, or Dr. Friedhelm Hildebrandt, Boston its redox potential. The CoQ biosynthesis pathway Children’s Hospital, EN561, 300 Longwood Avenue, Boston, MA has been extensively studied in Saccharomyces cere- 02115. E-mail: [email protected] or friedhelm.hildebrandt@childrens. visiae.4 A minimum of 12 proteins, encoded by the harvard.edu Coq genes, form a complex that serves to stabilize Copyright © 2020 by the American Society of Nephrology JASN 31: 1191–1211, 2020 ISSN : 1046-6673/3106-1191 1191 BASIC RESEARCH www.jasn.org each other and is involved in coenzyme synthesis.5 Based on Significance Statement protein homology, approximately 15 homologous COQ genes have been identified in humans.1 ADCK4 mutations generally manifest as steroid-resistant nephrotic fi Primary CoQ deficiencies due to mutations in ubiquinone syndrome, and cause coenzyme Q10 (CoQ10)de ciency. However, ’ biosynthetic genes (COQ2, COQ4, COQ6, COQ7, COQ9, ADCK4 s function remains obscure. Using mouse and cell models, the authors demonstrated that podocyte-specific Adck4 deletion in PDSS1, PDSS2, aarF domain containing kinase 3 [ADCK3], mice significantly reduced survival and caused severe FSGS, effects – and ADCK4) have been identified.6 12 Clinical manifestations that were prevented by treatment with 2,4-dihydroxybenzoic acid of CoQ10 deficiency vary depending on the genes involved, (2,4-diHB), a CoQ10 precursor analogue. ADCK4-knockout podo- fi and mutations in the same gene can result in diverse pheno- cytes exhibited a signi cantly reduced CoQ10 level and defects in types depending on the mutated allele.13 COQ2,11 COQ6,10 mitochondrial function that were rescued by 2,4-diHB treatment, thus these phenotypes were attributed to decreased CoQ levels. 9 12 10 PDSS2, and ADCK4 have also been implicated in steroid- The authors also found that ADCK4 interacted with mitochondrial resistant nephrotic syndrome (SRNS). Although no effec- proteins, including COQ5, and that ADCK4 knockout decreased tive therapy has been described for SRNS, supplementation of COQ complex levels. These findings reveal that ADCK4 is required for CoQ biosynthesis and mitochondrial function in podocytes, CoQ10 in cases of SRNS resulting from CoQ deficiency acts to 10 alleviate the associated clinical symptoms.10,12,14 This is par- and suggests a treatment strategy for nephrotic syndrome caused by ADCK4 mutations. tially true for ADCK4-related glomerulopathy and several cases have been reported accordingly.12,14 Recently, 2,4- dihydroxybenzoic acid (2,4-diHB) has been shown to amelio- METHODS rate disparate phenotypes in yeast, mouse, and Caenorhabditis elegans models harboring a mutation in the respective Mouse Breeding and Maintenance COQ7, Mclk1,orclk-1 genes.15–17 In these studies, 2,4- The animal experimental protocols were reviewed and ap- diHB was shown to act as an alternate or “bypass” ring proved by the Institutional Animal Care and Use Committee precursor, able to restore endogenous CoQ biosynthesis. In at the University of Michigan (#08619), Boston Children’s addition, 2,4-diHB prevents renal disease of podocyte- Hospital (#13-01-2283), and Yonsei University College of 2 2 specific Coq6 / mice.18 Medicine (#2015-0179). All mice were handled in accordance ADCK3 (also known as COQ8A) and ADCK4 are two with the Guidelines for the Care and Use of Laboratory Ani- mammalian orthologs of yeast Coq8p/Abc1, which belong mals. Mice were housed under pathogen-free conditions with to the microbial UbiB family; they appear to result from a light period from 7:00 AM to 7:00 PM and had ad libitum access gene duplication in vertebrates.6,19 UbiB and Coq8p are to water and irradiated rodent chow (catalog #0006972; required for CoQ biosynthesis in prokaryotes and yeast, re- LabDiet, St. Louis, MO). Targeted Adck4tm1a(EUCOMM)Hmgu spectively, and are speculated to activate an unknown mono- (Adck4tm1a) embryonic stem cells were obtained from oxygenase in the CoQ biosynthesis pathway.19 Coq8p, EUCOMM and injected into the blastocysts of mice. Chimeric ADCK3, and ADCK4 are present on the matrix side of the mice were bred with C57BL/6J mice to establish germline 1 1 inner mitochondrial membrane.20–22 Coq8p is essential for transmission. Nphs2.Cre (stock #008205) and Pgk1.Flpo the organization of high molecular mass Coq polypeptide (#011065) mice were obtained from Jackson Laboratory. complexes and for phosphorylated forms of the Coq3, Mouse lines were bred onto the C57BL/6J genetic background. Coq5, and Coq7 polypeptides that are involved in methyl- Genotyping was performed by PCR using the following pri- ation and hydroxylation steps in CoQ biosynthesis.21,23 Sim- mers: #1, GGATAGGGGGCTGGAGAGATG; #2, GCCCGC ilarly, it has been shown that ADCK3 interacts with CoQ CTCCCTGTATCTTAG; #3, TCGGAGAGGAAAGGACTG biosynthesis enzymes in a protein complex (complex Q).24 GAG; #4, CCCTTTCCCTTGAGTTCACAGC; and #5, TGG Moreover, ADCK3 lacks protein kinase activity in the trans CCTCAAACTCATGAAAATACTCC. Mice were maintained form; exhibits ATPase activity; and has highly conserved, un- in mixed sex and were randomly assigned to the different ex- orthodox protein kinase–like domains, including the KxGQ perimental groups. For mouse studies, experimental results motif, present in UbiB and eukaryotic COQ8 homologs, in- were validated over multiple litters, across several generations cluding ADCK4.25 of the mouse colony with n.6. Data collection of urine, whole However, it is not clear whether ADCK4 functions in a blood, and plasma analysis data were blinded to genotype so manner similar to that of ADCK3. Mutations in the ADCK4 that the operator did not know the genotype during perform- (also known as COQ8B) gene generally manifest as ing the measurements. Histologic and ultrastructural analysis adolescence-onset SRNS, sometimes accompanied with med- was not blinded to genotype but all samples were processed ullary nephrocalcinosis or extrarenal symptoms, including using the same protocol. seizures.12,26 The molecular mechanisms underlying SRNS resulting from ADCK4 mutations are not well understood, Supplementation of 2,4-diHB to the Mice in Drinking largely because the function of ADCK4 is unclear. Therefore, Water in this study, we investigated the function of ADCK4 using 2,4-diHB at a concentration of 25 mM was administered to mouse and cell models. the mice via drinking water and changed twice a week. 1192 JASN JASN 31: 1191–1211, 2020 www.jasn.org BASIC RESEARCH The treatment was started at 3 months of age and continued eosin, Periodic acid–Schiff, Masson trichrome, SFOG, and up to 18 months of age. Jones silver stain following the standard protocols for histo- logic examination. Urine Analysis Urine was collected by housing the mice overnight (12 hours) Ultrastructural Analysis in metabolic cages. All samples were immediately frozen and The kidney tissues and cells were fixed in 2.5% glutaraldehyde, stored at 280°C.
Load more

Recommended publications
  • FLNC Pathogenic Variants in Patients with Cardiomyopathies
    FLNC pathogenic variants in patients with cardiomyopathies: Prevalence and genotype-phenotype correlations Flavie Ader, Pascal de Groote, Patricia Réant, Caroline Rooryck-Thambo, Delphine Dupin-Deguine, Caroline Rambaud, Diala Khraiche, Claire Perret, Jean-François Pruny, Michèle Mathieu-dramard, et al. To cite this version: Flavie Ader, Pascal de Groote, Patricia Réant, Caroline Rooryck-Thambo, Delphine Dupin-Deguine, et al.. FLNC pathogenic variants in patients with cardiomyopathies: Prevalence and genotype-phenotype correlations. Clinical Genetics, Wiley, 2019, 96 (4), pp.317-329. 10.1111/cge.13594. hal-02268422 HAL Id: hal-02268422 https://hal-normandie-univ.archives-ouvertes.fr/hal-02268422 Submitted on 29 Jun 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. FLNC pathogenic variants in patients with cardiomyopathies Prevalence and genotype-phenotype correlations Running Title : FLNC variants genotype-phenotype correlation Flavie Ader1,2,3, Pascal De Groote4, Patricia Réant5, Caroline Rooryck-Thambo6, Delphine Dupin-Deguine7, Caroline Rambaud8, Diala Khraiche9, Claire Perret2, Jean Francois Pruny10, Michèle Mathieu Dramard11, Marion Gérard12, Yann Troadec12, Laurent Gouya13, Xavier Jeunemaitre14, Lionel Van Maldergem15, Albert Hagège16, Eric Villard2, Philippe Charron2, 10, Pascale Richard1, 2, 10. Conflict of interest statement: none declared for each author 1.
    [Show full text]
  • A Mutation Update for the FLNC Gene in Myopathies and Cardiomyopathies
    Received: 20 December 2019 | Revised: 12 February 2020 | Accepted: 25 February 2020 DOI: 10.1002/humu.24004 MUTATION UPDATE A mutation update for the FLNC gene in myopathies and cardiomyopathies Job A. J. Verdonschot1,2 | Els K. Vanhoutte1 | Godelieve R. F. Claes1 | Apollonia T. J. M. Helderman‐van den Enden1 | Janneke G. J. Hoeijmakers3 | Debby M. E. I. Hellebrekers1 | Amber de Haan1 | Imke Christiaans4,5 | Ronald H. Lekanne Deprez4 | Hanne M. Boen6 | Emeline M. van Craenenbroeck6 | Bart L. Loeys7 | Yvonne M. Hoedemaekers5,8 | Carlo Marcelis8 | Marlies Kempers8 | Esther Brusse9 | Jaap I. van Waning10,11 | Annette F. Baas12 | Dennis Dooijes12 | Folkert W. Asselbergs13 | Daniela Q. C. M. Barge‐Schaapveld14 | Pieter Koopman15 | Arthur van den Wijngaard1 | Stephane R. B. Heymans2,16,17 | Ingrid P. C. Krapels1 | Han G. Brunner1,8,18 1Department of Clinical Genetics, Maastricht University Medical Center, Maastricht, The Netherlands 2Department of Cardiology, Cardiovascular Research Institute (CARIM), Maastricht University Medical Center, Maastricht, The Netherlands 3Department of Neurology, Maastricht University Medical Center, Maastricht, The Netherlands 4Department of Clinical Genetics, Amsterdam University Medical Center, Amsterdam, The Netherlands 5Department of Clinical Genetics, University Medical Centre Groningen, Groningen, The Netherlands 6Department of Cardiology, Antwerp University Hospital, University of Antwerp, Antwerp, Belgium 7Department of Medical Genetics, Antwerp University Hospital, University of Antwerp, Antwerp, Belgium
    [Show full text]
  • Proteins That Mediate Protein Aggregation and Cytotoxicity Distinguish Alzheimer'S Hippocampus from Normal Controls
    Aging Cell (2016) pp1–16 Doi: 10.1111/acel.12501 Proteins that mediate protein aggregation and cytotoxicity distinguish Alzheimer’s hippocampus from normal controls Srinivas Ayyadevara,1,2 Meenakshisundaram types of aggregation, and/or aggregate-mediated cross-talk Balasubramaniam,2,3 Paul A. Parcon,2 Steven W. Barger,1,2 between tau and Ab. Knowledge of protein components that W. Sue T. Griffin,1,2 Ramani Alla,1,2 Alan J. Tackett,4 promote protein accrual in diverse aggregate types implicates Samuel G. Mackintosh,4 Emanuel Petricoin,5 Weidong Zhou5 common mechanisms and identifies novel targets for drug and Robert J. Shmookler Reis1,2,4 intervention. Key words: Abeta(1-42); acetylation (protein); aggregation 1McClellan Veterans Medical Center, Central Arkansas Veterans Healthcare Service, Little Rock, AR 72205, USA (protein); Alzheimer (Disease); beta amyloid; C. elegans; 2Department of Geriatrics, University of Arkansas for Medical Sciences, Little microtubule-associated protein tau; neurodegeneration; Rock, AR 72205, USA neurotoxicity; oxidation (protein); phosphorylation (protein); 3BioInformatics Program, University of Arkansas for Medical Sciences and University of Arkansas at Little Rock, Little Rock, AR 72205, USA proteomics. 4Department of Biochemistry & Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA 5 Center for Applied Proteomics and Molecular Medicine, George Mason Introduction University, Manassas, VA 20110, USA Summary Protein aggregation has long been recognized as a common feature of most or all age-dependent neurodegenerative diseases, and yet very little Neurodegenerative diseases are distinguished by characteristic is known about which features of aggregating proteins contribute to protein aggregates initiated by disease-specific ‘seed’ proteins; their accrual or their neurotoxicity.
    [Show full text]
  • Metformin Rescues Muscle Function in BAG3 Myofibrillar Myopathy Models
    bioRxiv preprint doi: https://doi.org/10.1101/574806; this version posted March 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Metformin rescues muscle function in BAG3 myofibrillar myopathy models Avnika A. Ruparelia1, Emily A. McKaige1, Caitlin Williams1, Keith E. Schulze2, Margit Fuchs3,4, Viola Oorschot5, Emmanuelle Lacene6, Meregalli Mirella7, Emily C. Baxter1, Yvan Torrente7, Georg Ramm5,8, Tanya Stojkovic9, Josée N. Lavoie3,4,10, and Robert J. Bryson-Richardson1* 1 School of Biological Sciences, Monash University, Melbourne 3800, Australia 2 Monash Micro Imaging, Monash University, Melbourne 3800, Australia 3 Centre de Recherche sur le Cancer de l'Université Laval, Ville de Québec, Quebec, Canada. 4 Oncologie, Centre de Recherche du Centre Hospitalier Universitaire (CHU) de Québec-Université Laval, Ville de Québec, Quebec, Canada. 5 Monash Ramaciotti Centre for Structural Cryo-Electron Microscopy, Monash University, Melbourne 3800, Australia 6 APHP, Centre de Référence de Pathologie Neuromusculaire Nord/Est/Ile-de-France, Institut de Myologie, Laboratoire de Pathologie Risler, GH Pitié-Salpêtrière, Paris, France. 7 Stem Cell Laboratory, Department of Pathophysiology and Transplantation, Università degli Studi di Milano, Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico di Milano, Centro Dino Ferrari, via F Sforza, 35, 20122 Milan, Italy 8 Biochemistry and Molecular Biology, Monash Biomedicine Discovery Institute, Monash University, Melbourne, Victoria, Australia. 9 Centre de référence des maladies neuromusculaires, Hôpital Pitié-Salpétrière, Assistance-Publique Hôpitaux de Paris, Paris, France.
    [Show full text]
  • Novel Pathogenic Variants in Filamin C Identified in Pediatric Restrictive Cardiomyopathy
    Novel pathogenic variants in filamin C identified in pediatric restrictive cardiomyopathy Jeffrey Schubert1, 2, Muhammad Tariq3, Gabrielle Geddes4, Steven Kindel4, Erin M. Miller5, and Stephanie M. Ware2. 1 Department of Molecular Genetics, Microbiology, and Biochemistry, University of Cincinnati College of Medicine, Cincinnati, OH; 2 Departments of Pediatrics and Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN; 3 Faculty of Applied Medical Science, University of Tabuk, Tabuk, Kingdom of Saudi Arabia; 4Department of Pediatrics, Medical College of Wisconsin, Milwaukee, WI; 5Cincinnati Children’s Hospital Medical Center, Cincinnati, OH. Correspondence: Stephanie M. Ware, MD, PhD Department of Pediatrics Indiana University School of Medicine 1044 W. Walnut Street Indianapolis, IN 46202 Telephone: 317 274-8939 Email: [email protected] Grant Sponsor: The project was supported by the Children’s Cardiomyopathy Foundation (S.M.W.), an American Heart Association Established Investigator Award 13EIA13460001 (S.M.W.) and an AHA Postdoctoral Fellowship Award 12POST10370002 (M.T.). ___________________________________________________________________ This is the author's manuscript of the article published in final edited form as: Schubert, J., Tariq, M., Geddes, G., Kindel, S., Miller, E. M., & Ware, S. M. (2018). Novel pathogenic variants in filamin C identified in pediatric restrictive cardiomyopathy. Human Mutation, 0(ja). https://doi.org/10.1002/humu.23661 Abstract Restrictive cardiomyopathy (RCM) is a rare and distinct form of cardiomyopathy characterized by normal ventricular chamber dimensions, normal myocardial wall thickness, and preserved systolic function. The abnormal myocardium, however, demonstrates impaired relaxation. To date, dominant variants causing RCM have been reported in a small number of sarcomeric or cytoskeletal genes, but the genetic causes in a majority of cases remain unexplained especially in early childhood.
    [Show full text]
  • Illuminating the Divergent Role of Filamin C Mutations in Human Cardiomyopathy
    Journal of Clinical Medicine Review Cardiac Filaminopathies: Illuminating the Divergent Role of Filamin C Mutations in Human Cardiomyopathy Matthias Eden 1,2 and Norbert Frey 1,2,* 1 Department of Internal Medicine III, University of Heidelberg, 69120 Heidelberg, Germany; [email protected] 2 German Centre for Cardiovascular Research, Partner Site Heidelberg, 69120 Heidelberg, Germany * Correspondence: [email protected] Abstract: Over the past decades, there has been tremendous progress in understanding genetic alterations that can result in different phenotypes of human cardiomyopathies. More than a thousand mutations in various genes have been identified, indicating that distinct genetic alterations, or combi- nations of genetic alterations, can cause either hypertrophic (HCM), dilated (DCM), restrictive (RCM), or arrhythmogenic cardiomyopathies (ARVC). Translation of these results from “bench to bedside” can potentially group affected patients according to their molecular etiology and identify subclinical individuals at high risk for developing cardiomyopathy or patients with overt phenotypes at high risk for cardiac deterioration or sudden cardiac death. These advances provide not only mechanistic insights into the earliest manifestations of cardiomyopathy, but such efforts also hold the promise that mutation-specific pathophysiology might result in novel “personalized” therapeutic possibilities. Recently, the FLNC gene encoding the sarcomeric protein filamin C has gained special interest since FLNC mutations were found in several distinct and possibly overlapping cardiomyopathy phenotypes. Specifically, mutations in FLNC were initially only linked to myofibrillar myopathy (MFM), but are now increasingly found in various forms of human cardiomyopathy. FLNC thereby Citation: Eden, M.; Frey, N. Cardiac represents another example for the complex genetic and phenotypic continuum of these diseases.
    [Show full text]
  • A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer.
    [Show full text]
  • ACTN2 Variant Associated with a Cardiac Phenotype Suggestive of Left-Dominant Arrhythmogenic Cardiomyopathy
    ACTN2 variant associated with a cardiac phenotype suggestive of left-dominant arrhythmogenic cardiomyopathy Jean-Marc Good, MD, PhD,* Florence Fellmann, MD, PhD,* Zahurul A. Bhuiyan, MBBS, PhD, FESC,* Samuel Rotman, MD,† Etienne Pruvot, MD,‡ Jurg€ Schl€apfer, MD‡ From the *Department of Genetic Medicine, Lausanne University Hospital and University of Lausanne, Lausanne, Switzerland, †Service of Clinical Pathology, Lausanne University Hospital and University of Lausanne, Lausanne, Switzerland, and ‡Department of Cardiology, Lausanne University Hospital and University of Lausanne, Lausanne, Switzerland. Introduction Arrhythmogenic cardiomyopathy (ACM) is a heritable heart KEY TEACHING POINTS disease characterized by fibrofatty replacement of the cardio- The variant p.Tyr473Cys in the ACTN2 gene, coding myocytes. It can result in life-threatening arrhythmias and for the Z-disk protein alpha-actinin-2, leads to a sudden cardiac death (SCD). Arrhythmogenic right ventricu- dominantly inherited phenotype suggestive of left- lar dysplasia/cardiomyopathy (ARVD/C) is the most com- dominant arrhythmogenic cardiomyopathy (ACM). mon form of ACM, while left-dominant or biventricular This implies that analysis of ACTN2 might be ACM is less frequent.1 Genes involved in ACM pathology mainly encode desmosomal protein,2 but anomalies in other considered in patients with ACM in whom genetic genes have been described.3,4 screening was inconclusive. Variants in the alpha-actinin-2 (ACTN2) gene have been The signal for plakoglobin was markedly reduced in associated with different cardiac manifestations, including the myocardial biopsy of our index case. This hypertrophic cardiomyopathy (HCM), dilated cardiomyopa- 5–9 6 further supports the concept that plakoglobin thy (DCM), atrial arrhythmia, left ventricular noncom- fi fi de ciency may be a common feature of ACMs, paction (LVNC), idiopathic ventricular brillation, and independently of their molecular origin.
    [Show full text]
  • Epigenetic Modifications to Cytosine and Alzheimer's Disease
    University of Kentucky UKnowledge Theses and Dissertations--Chemistry Chemistry 2017 EPIGENETIC MODIFICATIONS TO CYTOSINE AND ALZHEIMER’S DISEASE: A QUANTITATIVE ANALYSIS OF POST-MORTEM TISSUE Elizabeth M. Ellison University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/ETD.2017.398 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Ellison, Elizabeth M., "EPIGENETIC MODIFICATIONS TO CYTOSINE AND ALZHEIMER’S DISEASE: A QUANTITATIVE ANALYSIS OF POST-MORTEM TISSUE" (2017). Theses and Dissertations--Chemistry. 86. https://uknowledge.uky.edu/chemistry_etds/86 This Doctoral Dissertation is brought to you for free and open access by the Chemistry at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Chemistry by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • Cytoskeletal Remodeling in Cancer
    biology Review Cytoskeletal Remodeling in Cancer Jaya Aseervatham Department of Ophthalmology, University of Texas Health Science Center at Houston, Houston, TX 77054, USA; [email protected]; Tel.: +146-9767-0166 Received: 15 October 2020; Accepted: 4 November 2020; Published: 7 November 2020 Simple Summary: Cell migration is an essential process from embryogenesis to cell death. This is tightly regulated by numerous proteins that help in proper functioning of the cell. In diseases like cancer, this process is deregulated and helps in the dissemination of tumor cells from the primary site to secondary sites initiating the process of metastasis. For metastasis to be efficient, cytoskeletal components like actin, myosin, and intermediate filaments and their associated proteins should co-ordinate in an orderly fashion leading to the formation of many cellular protrusions-like lamellipodia and filopodia and invadopodia. Knowledge of this process is the key to control metastasis of cancer cells that leads to death in 90% of the patients. The focus of this review is giving an overall understanding of these process, concentrating on the changes in protein association and regulation and how the tumor cells use it to their advantage. Since the expression of cytoskeletal proteins can be directly related to the degree of malignancy, knowledge about these proteins will provide powerful tools to improve both cancer prognosis and treatment. Abstract: Successful metastasis depends on cell invasion, migration, host immune escape, extravasation, and angiogenesis. The process of cell invasion and migration relies on the dynamic changes taking place in the cytoskeletal components; actin, tubulin and intermediate filaments. This is possible due to the plasticity of the cytoskeleton and coordinated action of all the three, is crucial for the process of metastasis from the primary site.
    [Show full text]
  • Current Understanding of the Role of Cytoskeletal Cross-Linkers in the Onset and Development of Cardiomyopathies
    International Journal of Molecular Sciences Review Current Understanding of the Role of Cytoskeletal Cross-Linkers in the Onset and Development of Cardiomyopathies Ilaria Pecorari 1, Luisa Mestroni 2 and Orfeo Sbaizero 1,* 1 Department of Engineering and Architecture, University of Trieste, 34127 Trieste, Italy; [email protected] 2 University of Colorado Cardiovascular Institute, University of Colorado Anschutz Medical Campus, Aurora, CO 80045, USA; [email protected] * Correspondence: [email protected]; Tel.: +39-040-5583770 Received: 15 July 2020; Accepted: 10 August 2020; Published: 15 August 2020 Abstract: Cardiomyopathies affect individuals worldwide, without regard to age, sex and ethnicity and are associated with significant morbidity and mortality. Inherited cardiomyopathies account for a relevant part of these conditions. Although progresses have been made over the years, early diagnosis and curative therapies are still challenging. Understanding the events occurring in normal and diseased cardiac cells is crucial, as they are important determinants of overall heart function. Besides chemical and molecular events, there are also structural and mechanical phenomena that require to be investigated. Cell structure and mechanics largely depend from the cytoskeleton, which is composed by filamentous proteins that can be cross-linked via accessory proteins. Alpha-actinin 2 (ACTN2), filamin C (FLNC) and dystrophin are three major actin cross-linkers that extensively contribute to the regulation of cell structure and mechanics. Hereby, we review the current understanding of the roles played by ACTN2, FLNC and dystrophin in the onset and progress of inherited cardiomyopathies. With our work, we aim to set the stage for new approaches to study the cardiomyopathies, which might reveal new therapeutic targets and broaden the panel of genes to be screened.
    [Show full text]
  • Understanding Lamin A/C and Its Roles in Disease
    UNDERSTANDING LAMIN A/C AND ITS ROLES IN DISEASE PATHOLOGIES AUDREY WANG SHIMEI BSC (HONS.), NANYANG TECHNOLOGICAL UNIVERSITY A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2014 i ii ACKNOWLEDGEMENTS I would like to express my sincere gratitude to Professor Colin L. Stewart (THE BOSS) for his continuous support of my PhD study. His guidance, motivation and most importantly, his quirky sense of humour have made these six years a great learning journey. His unsurpassed knowledge of lamins has opened my eyes to the world of nuclear dynamics. His exquisite taste in excellent wines, good food and foresight in choosing awesome people for the group made everything better. I would like to thank my mentor Dr. Henning Horn, who has been a great teacher to me on both academic and personal level. I’m extremely grateful to him for all his advice at work and personal matters, through good and difficult times. I also thank each and everyone in the BS lab for their great advice, support and friendship. I am very blessed to be in this lab and could not have asked for better folks to work with. In particular, Alex, Hen, Rafidah, Xiaoqian, Esther and Gracy who have helped in more ways than one, and Tinka, Dave, Anna for helping to read through bits and pieces of this thesis. I also must thank my collaborators from Ludwig-Maximilians University Munich: the late Prof Boris Joffe whom, sadly, I never met in person, and a very kind and brilliant scientist, Dr Irina Solovei.
    [Show full text]