DOCSLIB.ORG

Understanding Lamin A/C and Its Roles in Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

UNDERSTANDING LAMIN A/C AND ITS ROLES IN DISEASE PATHOLOGIES AUDREY WANG SHIMEI BSC (HONS.), NANYANG TECHNOLOGICAL UNIVERSITY A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2014 i ii ACKNOWLEDGEMENTS I would like to express my sincere gratitude to Professor Colin L. Stewart (THE BOSS) for his continuous support of my PhD study. His guidance, motivation and most importantly, his quirky sense of humour have made these six years a great learning journey. His unsurpassed knowledge of lamins has opened my eyes to the world of nuclear dynamics. His exquisite taste in excellent wines, good food and foresight in choosing awesome people for the group made everything better. I would like to thank my mentor Dr. Henning Horn, who has been a great teacher to me on both academic and personal level. I’m extremely grateful to him for all his advice at work and personal matters, through good and difficult times. I also thank each and everyone in the BS lab for their great advice, support and friendship. I am very blessed to be in this lab and could not have asked for better folks to work with. In particular, Alex, Hen, Rafidah, Xiaoqian, Esther and Gracy who have helped in more ways than one, and Tinka, Dave, Anna for helping to read through bits and pieces of this thesis. I also must thank my collaborators from Ludwig-Maximilians University Munich: the late Prof Boris Joffe whom, sadly, I never met in person, and a very kind and brilliant scientist, Dr Irina Solovei. Without their persistence and great ideas, we would not have been able to publish in Cell. I’d also like to thank Dr Nick Barker and Prof Barbara Knowles for some of mouse lines mentioned in this thesis. I would also like to thank the members of my Thesis Advisory Committee, Prof. Christoph Winkler (NUS), Prof. Phan Toan Thang (NUS) and Prof Brian Burke (IMB). I am grateful for their time and advice during my Phd studies. I would like to acknowledge the financial, academic and technical support of the Institute of Medical Biology, A-STAR, and particularly in the award of the Scientific Staff Development Award that provided the necessary financial support for this research. I would also like to mention Professor Urs Boelsterli who was my first supervisor and opened my eyes to the world of research in toxicology and mitochondrial metabolism. His great personality and passion in science has made me aspire to be a better person and scientist. Above all, I would like to thank my husband Desmond and daughter Yoghurt for their unequivocal support and great patience at all times. iii TABLE OF CONTENTS LIST OF FIGURES ..................................................................................... XV LIST OF SYMBOLS ................................................................................. XIX CHAPTER 1 - INTRODUCTION .................................................................. 1 1.1 The nuclear envelope and lamina proteins .............................................. 1 1.1.1 The nuclear envelope ............................................................................ 1 1.1.2 The nuclear lamins ................................................................................ 2 1.1.3 Genes encoding lamins ......................................................................... 3 1.1.4 Structure of lamins ................................................................................ 4 1.1.5 Post-translation processing of lamins ................................................... 5 1.1.6 Expression profile of lamins ................................................................. 6 1.1.7 Integral membrane proteins of the INM ............................................... 9 1.1.7a LEM domain-containing proteins ................................................. 10 1.1.7b Lamin B Receptor (LBR).............................................................. 12 1.1.7c SUN and KASH proteins .............................................................. 13 1.2 Functions of Lamins ................................................................................ 15 1.2.1 Maintenance of the nuclear architecture ............................................. 16 1.2.2 Cytoskeleton organization and function ............................................. 18 1.2.3 Involvement in cellular signaling and functions ................................. 19 1.2.3a Lamins in DNA replication ........................................................... 20 1.2.3b Lamins in gene regulation ............................................................. 20 1.2.3c Regulation of genomic stability .................................................... 22 iv 1.2.3d Regulation of adult stem cell differentiation ................................ 24 1.3 Diseases associated with the nuclear lamina ......................................... 26 1.3.1 Laminopathies ..................................................................................... 27 1.3.2 Nuclear envelopathies ......................................................................... 31 1.3.3 Mechanisms of disease ....................................................................... 33 1.4 Lamins and cancer ................................................................................... 35 1.5 Mouse models of Lmna mutations .......................................................... 37 1.6 Cre-lox technology ................................................................................... 41 1.7 Aims and objectives.................................................................................. 43 CHAPTER 2 - MATERIALS AND METHODS ......................................... 47 2.1 Mouse husbandry ....................................................................................... 47 2.2 Generation of Lmna∆/∆ knockout mice ....................................................... 47 2.3 Genotyping of mutant mice ....................................................................... 48 2.4 RNA extraction and quantitative real time-PCR (qRT-PCR) ..................... 48 2.5 Immunoblot analysis of tissues and cell lines ............................................ 49 2.6 Histological studies and immunofluorescence microscopy ....................... 49 2.7 Extraction and cell culture of mouse adult fibroblasts (MAFs) ................. 51 2.8 Generation of the LbrGT/GT mice ................................................................ 52 v 2.9 Microscopy and image acquisition and analysis for chromocenters ......... 53 2.10 Transcriptome analysis of Lmna∆/∆ and LbrGT/GT myoblast cultures ........ 53 2.11 Deleting Lmna in the intestinal epithelial cells (IECs) ............................ 55 2.12 Isolation of intestinal epithelial cells (IECs) ............................................ 56 2.13 Deriving a tumour-sensitized mouse line lacking Lmna .......................... 56 2.14 Preparation and scoring of intestinal polyps ............................................ 57 2.15 Deleting Lmna in the intestinal stem cells ............................................... 57 2.16 Deleting Lmna in the keratinocytes of skin and tongue epithelium......... 58 2.17 Measurement of epidermis thickness in Lmna∆/∆/K14-Cre mice .................. 59 2.18 Analysis of hair cycle in Lmna∆/∆/K14-Cre mice .......................................... 60 2.19 Analysis of wound healing capacity of Lmna∆/∆/K14-Cre mice ................... 60 2.20 Isolation of keratinocytes from mouse dorsal skin .................................. 61 2.21 Gene expression microarray analysis of Lmna-null keratinocytes ......... 62 2.22 Two-stage chemical carcinogenesis in Lmna∆/∆/K14-Cre mouse skin .......... 63 2.23 Cell culture of N/TERT-1 keratinocytes, viral infection and knockdown assay to obtain LMNAKD .................................................................................. 64 2.24 Cell proliferation assay of LMNAKD N/TERT-1 keratinocytes ................ 64 vi CHAPTER 3- DERIVING AND CHARACTERIZING A CONDITIONAL LAMIN A/C KNOCKOUT MOUSE MODEL .............. 69 3.1 The conditional lamin A mouse model (LmnaFL/FL) ................................... 69 3.2 Creating and validating the global lamin A/C knockout mice (Lmna∆/∆) .. 70 3.3 Lamin A/C transcripts and proteins are depleted in Lmna∆/∆ mice ............ 71 3.4 Characterization of the Lmna∆/∆ knockout mice ........................................ 73 3.5 Histological analysis of Lmna∆/∆ tissues .................................................... 75 3.6 Redistribution of emerin in Lmna∆/∆ MAFs ............................................... 75 3.7 Conclusions ................................................................................................ 77 CHAPTER 4 – LAMIN B RECEPTOR (LBR) AND LAMIN A/C SEQUENTIALLY TETHER PERIPHERAL HETEROCHROMATIN AND INVERSELY REGULATE DIFFERENTIATION ........................... 79 4.1 The LBRGT mouse line ............................................................................... 79 4.2 LbrGT/GT mice exhibit anomalies in skin morphology ................................ 81 4.3 Mammalian rod cells with inverted nuclei do not express both lamin A/C and LBR ........................................................................................................... 83 4.4 Expression of LMNA/C and LBR is temporally coordinated ................... 84 4.4 Nuclei not expressing LMNA/C undergo nuclear inversion in LbrGT/GT mice………….. ...............................................................................................
Recommended publications
  • FLNC Missense Variants in Familial Noncompaction Cardiomyopathy

    FLNC Missense Variants in Familial Noncompaction Cardiomyopathy

    Cardiogenetics 2019; volume 9:8181 FLNC missense variants than 2 according to current echocardio- in familial noncompaction graphic criteria, or 2.3 on CMR.1,2 Correspondence: Jaap I. van Waning, Approximately 10% of patients diagnosed Department of Clinical Genetics, EE 2038, cardiomyopathy with NCCM have concurrent congenital Erasmus MC, POB 2040, 3000CA Rotterdam, heart defects (CHD).3,4 the Netherlands. Tel.: +3107038388 - Fax: +3107043072. Jaap I. van Waning,1 In 30-40% of cases diagnosed with E-mail: [email protected] Yvonne M. Hoedemaekers,2 NCCM a pathogenic variant can be identi- 2,3 4 Wouter P. te Rijdt, Arne I. Jpma, fied. Around 80% of these pathogenic vari- Acknowledgements: JVW was supported by a Daphne Heijsman,4 Kadir Caliskan,5 ants involve the same sarcomere genes, that grant from the Jaap Schouten Foundation. Elke S. Hoendermis,6 are the major causes for hypertrophic car- WPTR was supported by a Young Talent Program (CVON PREDICT) grant 2017T001 Tineke P. Willems,7 diomyopathy (HCM) and dilated cardiomy- - Dutch Heart Foundation. 8 opathy (DCM), in particular MYH7, Arthur van den Wijngaard, 5,6 3 MYBPC3 and TTN. Filamin C (FLNC) Albert Suurmeijer, Conflict of interest: the authors declare no plays a central role in muscle functioning Marjon A. van Slegtenhorst,1 potential conflict of interest. by maintaining the structural integrity of the Jan D.H. Jongbloed,2 muscle fibers. Pathogenic variants in FLNC Received for publication: 20 March 2019. Danielle F. Majoor-Krakauer,1 2 were found to be associated with a wide Revision received: 29 July 2019. Paul A.
  • Emery-Dreifuss Muscular Dystrophy: the Most Recognizable Laminopathy

    Emery-Dreifuss Muscular Dystrophy: the Most Recognizable Laminopathy

    Review paper Emery-Dreifuss muscular dystrophy: the most recognizable laminopathy Agnieszka Madej-Pilarczyk, Andrzej Kochański Neuromuscular Unit, Mossakowski Medical Research Centre, Polish Academy of Sciences, Warsaw, Poland The authors dedicate this review to Prof. Irena Hausmanowa-Petrusewicz. Folia Neuropathol 2016; 54 (1): 1-8 DOI: 10.5114/fn.2016.58910 Abstract Emery-Dreifuss muscular dystrophy (EDMD), a rare inherited disease, is characterized clinically by humero-peroneal muscle atrophy and weakness, multijoint contractures, spine rigidity and cardiac insufficiency with conduction defects. There are at least six types of EDMD known so far, of which five have been associated with mutations in genes encoding nuclear proteins. The majority of the EDMD cases described so far are of the emerinopathy (EDMD1) kind, with a recessive X-linked mode of inheritance, or else laminopathy (EDMD2), with an autosomal dominant mode of inheritance. In the work described here, the authors have sought to describe the history by which EDMD came to be distinguished as a separate entity, as well as the clinical and genetic characteristics of the disease, the pathophysiolo- gy of lamin-related muscular diseases and, finally, therapeutic issues, prevention and ethical aspects. Key words: Emery-Dreifuss muscular dystrophy, emerin, lamin A/C, laminopathy, LMNA gene. embryo nic development [14,35]. Lamin A/C plays the Introduction role of a structural integrator in a cell nucleus, ensur- Laminopathies fall within a group of rare diseas- ing the maintenance of the latter’s shape, as well as es connected with structural/functional defects of its mechanical endurance (mechanotransduction). the proteins making up the nuclear envelope (which It takes part in regulation of the cell-division cycle, is composed of inner and outer nuclear membranes).
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • FLNC Pathogenic Variants in Patients with Cardiomyopathies

    FLNC Pathogenic Variants in Patients with Cardiomyopathies

    FLNC pathogenic variants in patients with cardiomyopathies: Prevalence and genotype-phenotype correlations Flavie Ader, Pascal de Groote, Patricia Réant, Caroline Rooryck-Thambo, Delphine Dupin-Deguine, Caroline Rambaud, Diala Khraiche, Claire Perret, Jean-François Pruny, Michèle Mathieu-dramard, et al. To cite this version: Flavie Ader, Pascal de Groote, Patricia Réant, Caroline Rooryck-Thambo, Delphine Dupin-Deguine, et al.. FLNC pathogenic variants in patients with cardiomyopathies: Prevalence and genotype-phenotype correlations. Clinical Genetics, Wiley, 2019, 96 (4), pp.317-329. 10.1111/cge.13594. hal-02268422 HAL Id: hal-02268422 https://hal-normandie-univ.archives-ouvertes.fr/hal-02268422 Submitted on 29 Jun 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. FLNC pathogenic variants in patients with cardiomyopathies Prevalence and genotype-phenotype correlations Running Title : FLNC variants genotype-phenotype correlation Flavie Ader1,2,3, Pascal De Groote4, Patricia Réant5, Caroline Rooryck-Thambo6, Delphine Dupin-Deguine7, Caroline Rambaud8, Diala Khraiche9, Claire Perret2, Jean Francois Pruny10, Michèle Mathieu Dramard11, Marion Gérard12, Yann Troadec12, Laurent Gouya13, Xavier Jeunemaitre14, Lionel Van Maldergem15, Albert Hagège16, Eric Villard2, Philippe Charron2, 10, Pascale Richard1, 2, 10. Conflict of interest statement: none declared for each author 1.
  • Three New Cases of Dilated Cardiomyopathy Caused by Mutations in LMNA Gene

    Three New Cases of Dilated Cardiomyopathy Caused by Mutations in LMNA Gene

    Acta Myologica • 2017; XXXVI: p. 207-212 Three new cases of dilated cardiomyopathy caused by mutations in LMNA gene Larysa N. Sivitskaya1, Nina G. Danilenko1, Tatiyana G. Vaikhanskaya2, Tatsiyana V. Kurushka2 and Oleg G. Davydenko1 1 Institute of Genetics and Cytology, National Academy of Sciences of Belarus, Minsk, Belarus; 2 Republican Scientific and Practical Center of Cardiology, Minsk, Belarus Three cases of delated cardiomyopathy (DCM) with conduc- Mutations in LMNA affect lamins’ dimerization and as- tion defects (OMIM 115200), limb girdle muscular dystrophy sembly (1, 2). It apparently leads to nuclear stability loss 1B (OMIM 159001) and autosomal dominant Emery-Dreifuss and inability to perform functions in its entirety. The muscular dystrophy 2 (OMIM 181350), all associated with dif- ferent LMNA mutations are presented. Three heterozygous mutations in LMNA lead to at least 10 clinically distinct missense mutations were identified in unrelated patients – p. phenotypes, termed laminopathies, affecting different W520R (c.1558T > C), p.T528R (с.1583С > G) and p.R190P tissues including cardiac and skeletal muscle, cutane- (c.569G > C). We consider these variants as pathogenic, lead- ous, nervous and adipose tissue. There is no explicit ing to isolated DCM with conduction defects or syndromic relation between syndrome development and mutation DCM forms with limb-girdle muscular dystrophy and Emery- domain localization. A number of hot spots were de- Dreifuss muscular dystrophy. The mutations were not detected in the ethnically matched control group and publicly available scribed in LMNA, but the mutations common for lami- population databases. Their de novo occurrence led to the de- nopathies were not found.
  • Impairments in Contractility and Cytoskeletal Organisation Cause Nuclear Defects in Nemaline Myopathy

    Impairments in Contractility and Cytoskeletal Organisation Cause Nuclear Defects in Nemaline Myopathy

    bioRxiv preprint doi: https://doi.org/10.1101/518522; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Impairments in contractility and cytoskeletal organisation cause nuclear defects in nemaline myopathy Jacob A Ross1, Yotam Levy1, Michela Ripolone2, Justin S Kolb3, Mark Turmaine4, Mark Holt5, Maurizio Moggio2, Chiara Fiorillo6, Johan Lindqvist3, Nicolas Figeac5, Peter S Zammit5, Heinz Jungbluth5,7,8, John Vissing9, Nanna Witting9, Henk Granzier3, Edmar Zanoteli10, Edna C Hardeman11, Carina Wallgren- Pettersson12, Julien Ochala1,5. 1. Centre for Human & Applied Physiological Sciences, School of Basic & Medical Biosciences, Faculty of Life Sciences & Medicine, Guy’s Campus, King’s College London, SE1 1UL, UK 2. Neuromuscular and Rare Diseases Unit, Department of Neuroscience, Fondazione IRCCS Ca' Granda, Ospedale Maggiore Policlinico, Milan 20122, Italy 3. Department of Cellular and Molecular Medicine, University of Arizona, Tucson, Arizona, 85721, USA 4. Division of Biosciences, University College London, Gower Street, London WC1E 6BT, UK 5. Randall Centre for Cell and Molecular Biophysics, School of Basic & Medical Biosciences, Faculty of Life Sciences & Medicine, Guy’s Campus, King’s College London, SE1 1UL, UK 6. Molecular Medicine, IRCCS Fondazione Stella Maris, Pisa and Department of Neuroscience, Rehabilitation, Ophthalmology, Genetics, Maternal and Child Health, University of Genova, Genoa, Italy 7. Department of Paediatric Neurology, Neuromuscular Service, Evelina's Children Hospital, Guy's and St Thomas' Hospital National Health Service Foundation Trust, London, SE1 9RT, UK 8. Department of Basic and Clinical Neuroscience, Institute of Psychiatry, Psychology & Neuroscience, King's College, London, SE1 1UL, UK 9.
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals

    Identification of the Binding Partners for Hspb2 and Cryab Reveals

    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
  • A Single-Cell Transcriptional Atlas Identifies Extensive Heterogeneity in the Cellular Composition of Tendons

    A Single-Cell Transcriptional Atlas Identifies Extensive Heterogeneity in the Cellular Composition of Tendons

    bioRxiv preprint doi: https://doi.org/10.1101/801266; this version posted October 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A single-cell transcriptional atlas identifies extensive heterogeneity in the cellular composition of tendons Jacob B Swanson1, Andrea J De Micheli2, Nathaniel P Disser1, Leandro M Martinez1, Nicholas R Walker1,3, Benjamin D Cosgrove2, Christopher L Mendias1,3,* 1Hospital for Special Surgery, New York, NY, USA 2Meining School of Biomedical Engineering, Cornell University, Ithaca, NY, USA 3Department of Physiology and Biophysics, Weill Cornell Medical College, New York, NY, USA *Corresponding Author Christopher Mendias, PhD Hospital for Special Surgery 535 E 70th St New York, NY 10021 USA +1 212-606-1785 [email protected] Keywords: tenocyte; tendon fibroblast; pericyte; single-cell RNA sequencing bioRxiv preprint doi: https://doi.org/10.1101/801266; this version posted October 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Tendon is a dense, hypocellular connective tissue that transmits forces between muscles and bones. Cellular heterogeneity is increasingly recognized as an important factor in the biological basis of tissue homeostasis and disease, but little is known about the diversity of cells that populate tendon. Our objective was to explore the heterogeneity of cells in mouse Achilles tendons using single-cell RNA sequencing. We identified 13 unique cell types in tendons, including 4 previously undescribed populations of fibroblasts.
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy

    Genetic Mutations and Mechanisms in Dilated Cardiomyopathy

    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
  • A Mutation Update for the FLNC Gene in Myopathies and Cardiomyopathies

    A Mutation Update for the FLNC Gene in Myopathies and Cardiomyopathies

    Received: 20 December 2019 | Revised: 12 February 2020 | Accepted: 25 February 2020 DOI: 10.1002/humu.24004 MUTATION UPDATE A mutation update for the FLNC gene in myopathies and cardiomyopathies Job A. J. Verdonschot1,2 | Els K. Vanhoutte1 | Godelieve R. F. Claes1 | Apollonia T. J. M. Helderman‐van den Enden1 | Janneke G. J. Hoeijmakers3 | Debby M. E. I. Hellebrekers1 | Amber de Haan1 | Imke Christiaans4,5 | Ronald H. Lekanne Deprez4 | Hanne M. Boen6 | Emeline M. van Craenenbroeck6 | Bart L. Loeys7 | Yvonne M. Hoedemaekers5,8 | Carlo Marcelis8 | Marlies Kempers8 | Esther Brusse9 | Jaap I. van Waning10,11 | Annette F. Baas12 | Dennis Dooijes12 | Folkert W. Asselbergs13 | Daniela Q. C. M. Barge‐Schaapveld14 | Pieter Koopman15 | Arthur van den Wijngaard1 | Stephane R. B. Heymans2,16,17 | Ingrid P. C. Krapels1 | Han G. Brunner1,8,18 1Department of Clinical Genetics, Maastricht University Medical Center, Maastricht, The Netherlands 2Department of Cardiology, Cardiovascular Research Institute (CARIM), Maastricht University Medical Center, Maastricht, The Netherlands 3Department of Neurology, Maastricht University Medical Center, Maastricht, The Netherlands 4Department of Clinical Genetics, Amsterdam University Medical Center, Amsterdam, The Netherlands 5Department of Clinical Genetics, University Medical Centre Groningen, Groningen, The Netherlands 6Department of Cardiology, Antwerp University Hospital, University of Antwerp, Antwerp, Belgium 7Department of Medical Genetics, Antwerp University Hospital, University of Antwerp, Antwerp, Belgium
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions

    Defining Functional Interactions During Biogenesis of Epithelial Junctions

    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.