FRANÇOISE DANTAS DE LIMA ______Tese De Doutorado Natal/RN, Abril De 2017

UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE CENTRO DE BIOCIÊNCIAS PROGRAMA DE PÓS-GRADUAÇÃO EM SISTEMÁTICA E EVOLUÇÃO

GENÉTICA MOLECULAR E ECOLOGIA EM UMA ABORDAGEM INTEGRATIVA PARA CONSERVAÇÃO DE Octopus insularis LEITE & HAIMOVICI, 2008 NO ATLÂNTICO TROPICAL

FRANÇOISE DANTAS DE LIMA ______Tese de Doutorado Natal/RN, abril de 2017

Françoise Dantas de Lima

Genética molecular e ecologia em uma abordagem integrativa para conservação de Octopus insularis Leite & Haimovici, 2008 no Atlântico

Tropical

Orientador: Dr. Sergio Maia Queiroz Lima

Co-orientadora: Dra. Tatiana Silva Leite

Tese apresentada ao Programa de Pós- Graduação em Sistemática e Evolução, Universidade Federal do Rio Grande do Norte, como requisito para obtenção do título de doutor.

Abril - 2017 Natal/RN

Universidade Federal do Rio Grande do Norte - UFRN Sistema de Bibliotecas - SISBI Catalogação de Publicação na Fonte. UFRN - Biblioteca Setorial Prof. Leopoldo Nelson - -Centro de Biociências - CB

Lima, Françoise Dantas de. Genética molecular e ecologia em uma abordagem integrativa para conservação de Octopus insularis Leite & Haimovici, 2008 no Atlântico Tropical / Françoise Dantas de Lima. - Natal, 2017. 175 f.: il.

Tese (Doutorado) - Universidade Federal do Rio Grande do Norte. Centro de Biociências. Programa de Pós-Graduação em Sistemática e Evolução. Orientador: Dr. Sergio Maia Queiroz Lima. Coorientadora: Dra. Tatiana Silva Leite.

1. Filogenia - Tese. 2. Filogeografia - Tese. 3. Biogeografia - Tese. 4. Modelagem de nicho - Tese. I. Lima, Sergio Maia Queiroz. II. Leite, Tatiana Silva. III. Universidade Federal do Rio Grande do Norte. IV. Título.

RN/UF/BSE-CB CDU 575

Genética molecular e ecologia em uma abordagem integrativa para conservação de

Octopus insularis Leite & Haimovici, 2008 no Atlântico Tropical

Aprovada em: 12 de abril de 2017

BANCA EXAMINADORA:

Dr. Sergio Maia Queiroz Lima (UFRN – Universidade Federal do Rio Grande do Norte) (Orientador/Presidente)

Dr. Paulo Cesar de Paiva (UFRJ – Universidade Federal do Rio de Janeiro) (Examinador externo à instituição)

Dr. Sergio R. Floeter (UFSC – Universidade Federal do Santa Catarina) (Examinador externo à instituição)

Dr. Adrian Garda (UFRN – Universidade Federal do Rio Grande do Norte) (Examinador interno)

Dr. Fúlvio Aurélio de Morais Freire (UFRN – Universidade Federal do Rio Grande do Norte) (Examinador interno)

Abril – 2017 Natal/RN

À Dona Branca, por fazer o sertão virar mar em mim.

AGRADECIMENTOS

Acima de tudo agradeço a minha mãe, Dona Branca, por nunca ter medido esforços em prol da educação de seus filhos, mesmo com todas as dificuldades que enfrentou no sertão do Rio Grande do Norte. Também agradeço a toda minha família pela compreensão e força ao longo desses anos, principalmente as manas Ninha, Fernanda e Corrinha. Amizade além dos laços de sangue. Ao Sergio Lima pela preciosa orientação e paciência ao inserir uma bióloga/ecóloga no mundo da genética molecular. Agradeço imensamente o apoio e as lições de caráter além das fronteiras acadêmicas. A Tatiana Leite pela co-orientação e por testemunhar mais uma etapa da minha vida acadêmica. Obrigada a você que me acompanha desde quando eu era um girininho. A Jan Strugnell, co-orientadora no exterior, que me recebeu de braços abertos na La Trobe University e na James Cook University, Australia. Obrigada pelos ensinamentos no campo da filogenia e no Sequenciamento de Nova Geração. Ao amigo Waldir Lima que teve a difícil tarefa de ensinar técnicas moleculares de laboratório a dois broncos do mar: Tiego Costa e eu. Obrigada pelos preciosos ensinamentos no início de todo esse processo. Agradeço também, ao Tiego por compartilhar comigo essa jornada e por comemorarmos juntos cada “luzinha verde que acendia na gelatina” (Costa 2014). Ao Instituto Chico Mendes de Conservação da Biodiversidade/ICMBio, por auxiliar a logística de coletas no Atol das Rocas e Fernando de Noronha, bem como a Marinha do Brasil por proporcionar expedições científicas aos arquipégos São Pedro e São Paulo e Trindade e Martim Vaz. Ao professor Carlos Rosas, da Universidade Nacional Autónoma do México, por mediar coleta de dados na região do Golfo do México. Ao professor Jorge Lins, pelos ensinamentos e oportunidades concedidas. Muito obrigada por acreditar na minha jornada. Ao Ricardo Marmota e sua operadora Abudefduf pelo apoio logístico fornecido nas coletas em Ilha Grande/RJ. Ao Carlos Sampaio, Buia, que nos recebeu em sua casa e auxiliou na logística de coleta em Salvador. Ao Bruno Batista, amigo pesquisador que facilitou a coleta de polvos no município de Itarema, Ceará.

A Olga Bojarczuk, pelas amostras coletadas no Panamá e Rodrigo Torres, por ceder amostras coletadas em Alagoas. Aos meus preciosos companheiros de campo, Jaciana Barbosa, Diego Batista, Leocledna Fernandes, Jarian Santas, Allyson Santos, Gustavo Mattos, Carlos Alberto, Zah, Felipe Buloto, Marcelo Renan e militares que serviam no POIT. Obrigada por compartilharem comigo grandes aventuras nas ilhas oceânicas brasileiras. Aos pescadores do Transmar pela ajuda nas coletas em São Pedro e São Paulo e pelos preciosos ensinamentos sobre os oceanos, além bom humor diário que sempre os acompanhava. Agradeço também aos pescadores de Rio do Fogo pela colaboração na coleta de tecidos. A esses grandes guerreiros do mar, meu imenso respeito, admiração e agradecimento. Ao amigo Juan Pablo Zurano que contribuiu com importantes dicas analíticas, as quais melhoraram o rendimento da tese. A todos os colegas de laboratório do LISE, LABECE, LABIPE e GEEFAA pela colaboração mútua nos projetos de pesquisa, pelo cafezinho sagrado de cada dia e por tonar essa jornada menos árdua através do bom humor e solicitude. Agradeço em especial a Lorena Candice e Jaciana Barbosa por toda a cumplicidade e apoio mútuo durante esse ciclo acadêmico. Amizade que a ciência não explica. Aos amigos, família que escolhi para vida, Maricota, Larinha, Jaciana, Marana, Glaucia, Suzy, Tanágara, Daniel, Geomar, Marília Gabriel, Gentil, Dudu, Shirley e tantos outros que sempre compartilham comigo importantes momentos da vida acadêmica e pessoal, com uma boa cerveja compondo o cenário. Aos amigos que a Austrália me proporcionou, os quais contribuíram com importantes dicas e análises para o melhoramento da tese, além da amizade e cumplicidade prestadas durante nove meses e que serão levados para sempre. Agradeço especialmente a Cecília, Carla, Renato, Raoani e Waldo pelo carinho ácido e palavras certeiras sempre que necessário. Aos membros da banca por aceitarem contribuir com suas experiências científicas para a melhoria da tese. Aos professores que compõem o Programa de Pós-Graduação em Sistemática e Evolução e à CAPES, pela bolsa concedida. A todos que cruzaram comigo seus caminhos acadêmicos durante essa jornada, mostrando as maravilhas do mundo científico e a importância da colaboração no processo da conservação de espécies marinhas. #ForaTemer.

SUMÁRIO INTRODUÇÃO GERAL ...... 19

OCTOPUS INSULARIS: O POLVO DE AMPLA DISTRIBUIÇÃO TROPICAL ...... 19

ABORDAGEM INTEGRATIVA PARA CONSERVAÇÃO DE ESPÉCIES ...... 21

APRESENTAÇÃO DA TESE ...... 25

OBJETIVO GERAL ...... 26

OBJETIVOS ESPECÍFICOS ...... 26

REFERÊNCIAS BIBLIOGRÁFICAS ...... 27

CAPÍTULO 1 - OCCURRENCE OF OCTOPUS INSULARIS LEITE AND HAIMOVICI, 2008

IN THE TROPICAL NORTHWESTERN ATLANTIC AND IMPLICATIONS OF SPECIES

MISIDENTIFICATION TO OCTOPUS FISHERIES MANAGEMENT ...... 35

ABSTRACT ...... 35

INTRODUCTION ...... 36

METHODS ...... 39

RESULTS ...... 41

Mitochondrial DNA ...... 41

Nuclear DNA ...... 43

DISCUSSION ...... 43

ACKNOWLEDGEMENTS ...... 47

REFERENCES ...... 48

FIGURES AND TABLES ...... 56

CAPÍTULO 2 - A BIOGEOGRAPHIC FRAMEWORK OF OCTOPOD SPECIES

DIVERSIFICATION: THE ROLE OF THE ISTHMUS OF PANAMA ...... 66

ABSTRACT ...... 66

INTRODUCTION ...... 67

METHODS ...... 70

Data collection ...... 70

Calibration priors ...... 71

Phylogenetic analysis ...... 72

Biogeographical analysis ...... 73

RESULTS ...... 74

Phylogenetic analysis ...... 74

Biogegraphical analysis ...... 75

DISCUSSION ...... 76

REFERENCES ...... 81

FIGURES AND TABLES ...... 89

SUPPLEMENTARY INFORMATION ...... 92

CAPÍTULO 3 - GLOBAL CLIMATE CHANGES OVER TIME SHAPING THE ECOLOGICAL

NICHE OF OCTOPUS INSULARIS LEITE AND HAIMOVICI, 2008 IN THE ATLANTIC

OCEAN ...... 97

ABSTRACT ...... 97

INTRODUCTION ...... 98

METHODS ...... 100

Species dataset ...... 100

Environmental variables ...... 101

Maxent model ...... 102

RESULTS ...... 103

Modern modeling of O. insularis: an exploratory approach ...... 103

Modeling of O. insularis over time ...... 104

DISCUSSION ...... 106

REFERENCES ...... 111

FIGURES AND TABLES ...... 122

SUPPLEMENTARY INFORMATION ...... 128

CAPÍTULO 4 - CARACTERÍSTICAS DA PAISAGEM INFLUENCIANDO ESTRUTURAÇÃO

POPULACIONAL DE OCTOPUS INSULARIS LEITE & HAIMOVICI, 2008 NO ATLÂNTICO

TROPICAL ...... 136

RESUMO ...... 136

INTRODUÇÃO ...... 137

MATERIAL E MÉTODOS ...... 141

Coleta de dados ...... 141

Amplificação e sequenciamento ...... 143

Análises moleculares ...... 143

Isolamento por resistência (IBR) ...... 145

RESULTADOS ...... 146

Estrutura populacional e filogeografia ...... 146

Isolamento por resistência (IBR) ...... 152

DISCUSSÃO ...... 153

Estruturação populacional em Octopus insularis ...... 153

Influência dos componentes da paisagem oceânica estrutura populacional ...... 155

Implicações para conservação e manejo dos estoques pesqueiros ...... 158

REFERÊNCIAS ...... 159

CONCLUSÕES GERAIS ...... 168

RECOMENDAÇÕES PARA CONSERVAÇÃO ...... 172

REFERÊNCIAS ...... 174

LISTA DE FIGURAS

Figure 1 - A espécie Octopus insularis em ambiente natural, mostrando a variabilidade de padrões corporais para comportamentos de camuflagem, forrageio e descanso. Fotos:

Françoise Lima ...... 20

CAPÍTULO 1

Figure 1 - Geographic locations of the coastal and oceanic regions along Tropical

Northwestern Atlantic and Tropical Southwestern Atlantic, where the samples were collected in the present study. Dark symbols represent samples correctly identified morphologically, while open symbols represent cases of misidentification. The areas where specimens were identified a priori as O. vulgaris and a posteriori as O. insularis are shown by open circles. The open triangles show the regions where O. maya was incorrectly assigned as O. vulgaris ... 56

Figure 2 - Molecular phylogeny constructed using Bayesian inference based on the General

Time Reversible model for a partial fragment of the COI gene. The Bayesian posterior probabilities are shown above nodes. Haplotypes in bold were obtained in present study, while the others were obtained from GenBank. The haplotype marked with an asterisk were previously identified as O. vulgaris. The haplotype (*) was shared by O. maya individuals collected in the cultivation center (Sisal, Mexico) and individuals identified a priori as O. vulgaris in fishing landings in port of Progreso, Mexico. Abbreviations: BA (Bahia State), CE

(Ceará State), RN (Rio Grande do Norte State), RJ (Rio de Janeiro State), SC (Santa Catarina

State), ASC/STH (Ascension and St Helena Islands), FNO (Fernando de Noronha archipelago), RAT (Rocas atoll), TMV (Trindade and Martin Vaz archipelago), DOMI

(Dominique), GUAD (Guadaloupe), MEXI (Mexico), PURI (Puerto Rico), TURK (Turkey), SPAI

(Spain), FRAN (France), GREE (Greece), SAFR (South Africa), SENE (Senegal), TRI (Tristan da Cunha), INDI (India), CHIN (China) and JAPA (Japan) ...... 57

Figure 4 - Molecular phylogeny resulting from Bayesian inference based on the General Time

Reversible model for a partial fragment of the EF1-a gene. The Bayesian posterior

probabilities are shown next to nodes. Haplotypes in bold were obtained in the present study, while the others were obtained from GenBank. The haplotype marked with an asterisk were previously identified as O. vulgaris. Abbreviations: BA (Bahia State), CE (Ceará State), RN

(Rio Grande do Norte State), FNO (Fernando de Noronha archipelago), RAT (Rocas atoll),

TMV (Trindade and Martin Vaz archipelago) and MEXI (Mexico) ...... 58

CAPÍTULO 2

Figure 1 - Localities of the specimens used in this study to estimate phylogenetic relationships and divergence times among octopods species. Orange circles represent species from the

Eastern Pacific, blue circles from the Western Atlantic, green circles from the Eastern Atlantic, and yellow circles are species from the Western Pacific. The Isthmus of Panama is indicated by a red square ...... 89

Figure 2 - Integrated Bayesian phylogenetic tree and reconstruction of ancestral state to infer historical biogeography of octopod species lineages. The Bayesian posterior probabilities of the clades are shown below the nodes. Pie charts show the posterior probabilities of ancestral areas on different nodes. The five clades discussed in this study is highlighted in the phylogeny. The transisthmian sister species pair/complex are indicated by an asterisk in the clades 1, 3 and 5. Gray area represents the interval of divergence time found in octopod species (5.22 - 17.24). The circles surrounding some pie charts on the nodes indicate vicariance events. The graph shows events of dispersal and vicariance (axis y) assigned to a time frame as a result of a modified Gaussian distribution. Vampyroteuthis infernalis is not shown on this figure due to its long branch length ...... 90

Figure S1 - Bayesian phylogenetic tree including all cephalopods species used in this study.

The bars on the nodes represent the 95% Highest Posterior Density intervals. The 95% HPD of calibrated nodes with three fossils information are shown in orange bars. The asterisk represents the biogeographical calibration. The mean ages of clades divergence are placed below each node (Ma)...... 92

CAPÍTULO 3

Figure 1 - Locations of O. insularis occurrence used to model the species suitable niche distribution along different climatic scenarios. Dark circles represent data collected in this study. White circles are presence data from bibliography. The marine realms according to

Spalding et al. (2007) are indicated by colours ...... 122

Figure 2 - The environmental variables used to model the O. insularis species distribution under temporal climate changes. LGM = Last Glacial Maximum, MH = Mid-Holocene, SST = sea surface temperature ...... 123

Figure 3 - Distribution of suitable climatic niche for O. insularis under two past scenarios, Last

Glacial Maximum (LGM) and Middle-Holocene, present conditions, and two future projections

(2100 and 2200). Details of Caribbean region and Northeast Brazil is shown for LGM predictions, since the species distribution is very restricted in this scenario...... 124

Figure 4 - A: Test of omission rate and predicted area as a function of the cumulative threshold, showing averaged over the 15 replicate runs. B: Receiver operating characteristic

(ROC) curve showing the mean AUC value over 15 the replicated runs...... 125

Figure 5 - Jackknife test of variable importance for training data. In blue, model gain using only that variable; in green, effect of removing that variable from the model, in red, total gain of the model with all variables...... 126

Figure 6 - Logistic curves showing the effects of each environmental variable on the Maxent prediction. The curves show how the logistic prediction changes as each environmental variable is varied, keeping all other environmental variables at their average sample ...... 127

Figure S1 - Distribution of suitable climatic niche for O. insularis predicted to modern scenario using all environmental variables available (bathymetry, slope, sea surface temperature

(SST), salinity, chlorophyll, and pH) – Exploratory analysis ...... 128

over the 15 replicate runs. B: Receiver operating characteristic (ROC) curve showing the mean AUC value over 15 the replicated runs...... 129

Figure S3 - Jackknife test of variable importance for training data used in the exploratory analysis. In blue, model gain using only that variable; in green, effect of removing that variable from the model, in red total gain of the model with all variables ...... 130

CAPÍTULO 4

Noronha, RN = Rio Grande do Norte, AL = Alagoas, BA = Bahia, TMV = arquipélago de

Trindade e Martim Vaz, ASC = ilha de Ascensão, STH = ilha de Santa Helena. Correntes oceânicas: nSEC = ramo norte da Corrente Sul Equatorial, sSEC = ramo sul da Corrente Sul

Equatorial, NBC = Corrente Norte do Brasil, NB = Corrente do Brasil, GC = Corrente das

Guianas, NECC = Norte Equatorial Contracorrente. Esquema de correntes baseado em

Lumpkin e Garzoli (2005) ...... 142

Figure 2 - Análise do GENELAND mostrando a estruturação genética das quatro populações do Octopus insularis ao longo do espaço geográfico. O gráfico à esquerda mostra as probabilidades dos agrupamentos pertencerem à diferentes clusters populacionais. As isoclinas em cada mapa representam as probabilidades posteriores de um grupo de localidades pertencer a mesma população ou cluster genético. A: São Pedro e São Paulo, B:

Alagoas, Salvador/BA e Trindade e Martim Vaz (Sul), C: Caribe, Itarema/CE, Rio do Fogo/RN,

Fernando de Noronha e Atol das Rocas (Centro-Norte), D: Ascensão e Santa Helena ..... 149

Figure 3 - Rede de haplótipos elaborada a partir do gene mitocondrial Citocromo Oxidase I as localidades de Octopus insularis ...... 151

Figure 4 - Bayesian Skyline Plot para reconstrução demográfica coalescente das quatro populações de Octopus insularis a partir do COI, mostrando a variação do tamanho populacional (Ne) (eixo y) ao longo do tempo em anos (eixo x). A: Centro-Norte, B: Sul. A linha preta indica a média do Ne e a área azul indica os limites da alta densidade posterior

(HPD)...... 152

Figure 5 - Mapa de resistência ambiental calculado a partir da teoria dos circuitos usando do raster da distribuição do nicho climático adequado para O. insularis. Os valores de resistência variam de 0 a 1 ...... 153

LISTA DE TABELAS

CAPITULO 1

Table 1 - Summary of the main morphological, ecological, reproductive and fishing differences among the three target species of octopus fisheries in the Tropical Northwestern Atlantic and

Tropical Southwestern Atlantic: O. insularis, O. maya, O. vulgaris. These data are according to Voss and Solís-Ramírez (1966), Arreguín-Sánchez et al. (2000), Otero et al. (2007), Leite et al. (2008), Moguel et al. (2010), FAO (2012), Norman et al. (2013), Lima et al. (2014),

SAGARPA (2014) and Lenz et al. (2015). ML = mantle length, TL = total length, BW = body weight ...... 59

Table 2 - List of specimens used in this study obtained from GenBank showing the species identification (priori and posteriori), sampling regions, GenBank accession number of DNA sequences and references. + indicates specimen morphologically identified by octopus’ taxonomist; * indicates discordance between previous and posterior identifications ...... 60

Table 3 - Estimates of evolutionary divergence over sequence pairs between groups (COI) conducted using the Kimura 2-parameter model. Centre diagonal (in bold) shows distance within each group. Standard error estimates are shown above the diagonal. Specimens marked with an asterisk were previously identified as O. vulgaris ...... 63

Table 4 - Estimates of evolutionary divergence over sequence pairs between groups (EF1-a) conducted using the Kimura 2-parameter model. Centre diagonal (in bold) shows distance within each group. Standard error estimates are shown above the diagonal. Specimens marked with an asterisk were previously identified as O. vulgaris ...... 64

CAPÍTULO 2

Table 1 - Details of fossil and biogeographical information used to calibrate the phylogeny, showing prior probability distributions and posterior probability densities after the Monte Carlo

Markov Chain (MCMC) run. Ma = millions of years ago, CI = confidence interval, HPD =

Highest Posterior Density...... 91

Table 2 - Divergence time estimates for each clade containing transisthmian sister species pair/complex. The events of dispersal and vicariance are shown for each clade. The possible routes of dispersal for the most recent common ancestor in each clade are also shown with their respective probabilities. EP = Eastern Pacific, WP = Western Pacific, WA = Western

Atlantic, Ma = millions of years ago, BBM = Bayesian Binary Method, HPD = Highest Posterior

Density ...... 91

CAPÍTULO 3

Table 1 - Geographical coordinates of all samples used to model the climatic suitable niche for O. insularis ...... 131

Table 2 - Description of 23 environmental variables initially used to build a correlation matrix

...... 134

CAPÍTULO 4

Table 1 - Valores das comparações par-a-par de FST entre as localidades de O. insularis das

áreas amostradas para o gene mitocondrial Citocromo Oxidase I. Abaixo da diagonal se encontram os valores de FST, acima da diagonal estão os valores dos testes de significância.

Os asteriscos indicam diferenças significativa entre as comparações par-a-par...... 146

Table 2 - Valores das comparações par-a-par de FST entre as populações de O. insularis das

áreas amostradas para o gene mitocondrial Citocromo Oxidase I. Abaixo da diagonal se encontram os valores de FST, acima da diagonal estão os valores dos testes de significância.

Os asteriscos indicam diferenças significativa entre as comparações par-a-par...... 147

Table 3 - Resultados da análise de variância molecular (AMOVA), com diferentes hipóteses biogeográficas de estruturação para as sequências do gene mitocondrial Citocromo Oxidase

I do polvo tropical Octopus insularis. Em negrito está destacada a hipótese que melhor explica a variação entre os grupos. K = número de grupos ...... 148

Table 4 - A análise espacial de variância molecular (SAMOVA) para diferentes números de populações (K) para o gene COI da espécie O. insularis. Em negrito o agrupamento populacional que mais explica a variação entre os grupos...... 148

Table 5 - Índices de diversidade genética e testes de equilíbrio das sequências do marcador mitocondrial COI para cada população de O. insularis. Número de sequências (N), número de haplótipos (H), número de sítios polimórficos (S), diversidade haplotípica (h) ...... 151

RESUMO A abordagem integrativa aplicada à conservação de uma espécie é essencial para a compreensão dos fatores que contribuem para a diversificação de populações, processos de especiação e identificação de padrões ecológicos. Para traçar um panorama de conservação para Octopus insularis, foi adotada uma abordagem integrativa que envolve elementos da filogenia, filogeografia, Barcoding, modelagem do nicho climático e genética da paisagem. O presente estudo foi realizado em 15 localidades da costa oeste e ilhas oceânicas do Atlântico

Tropical. Foi identificado um aumento da área de distribuição de O. insularis para o mar do

Caribe, o qual confirma o alto potencial da espécie para dominar ambientes de águas quentes e rasas. Além disso, verificou-se problemas com a identificação incorreta das espécies que compõem os estoques pesqueiros dessa região e do Golfo do México, o que pode ameaçar a espécie endêmica O. maya. Através do enfoque filogenético com inferência biogeográfica, foi possível identificar o Caribe como possível centro de origem do O. insularis, a qual divergiu de outras do gênero após o soerguimento do Istmo do Panamá. Três clados contendo espécies transistimianas confirmam a importância desse evento geológico no processo de especiação em octópodes. A influência dos processos climáticos subsequentes nas populações de O. insularis foi analisada através da modelagem do nicho em cinco cenários temporais. A análise revelou expansão do nicho de O. insularis, em direção a regiões temperadas nos cenários de aquecimento global. Já a filogeografia, estruturação populacional mostrou quatro populações/estoques bem delimitados geneticamente, devido ao regime da Corrente Sul Equatorial e montes submersos. Tais resultados corroboram a hipótese do isolamento por Resistência. Os resultados do presente estudo permitiram uma visão holística dos fatores genéticos, ecológicos e oceanográficos que influenciam a espécie

O. insularis e auxiliaram a traçar um atual panorama de conservação e regulamentação da espécie, bem como sugerir futuras medidas de manejo para e espécie.

Palavras-chave: filogenia, filogeografia, modelagem de nicho, Barcoding, genética da paisagem

ABSTRACT

The integrative approach applied to species conservation is essential to understand the factors that contribute to population diversification, speciation processes and identification of ecological patterns. To propose a panorama for the conservation of Octopus insularis, a wide distributed species in the Tropical Atlantic, an integrative approach involving phylogeny, phylogeography, Barcoding, climatic niche modeling and landscape genetics was adopted.

The present study was performed in 15 localities of the Tropical Atlantic west coast and oceanic islands. It was identified a northward increase in the O. insularis distribution area towards the Caribbean Sea, which confirms high potential of this species to dominate warm and shallow waters. Furthermore, misidentification of the species that compose fisheries stocks in the Gulf of Mexico was detected, which may threaten the endemic species O. maya.

By using phylogeny approach with biogeographic interference, it was possible to identify

Caribbean Sea as an origin area of O. insularis, which diverged from others congeners after the uplift of Isthmus of Panama. Tree clades formed by transisthmian species confirmed the importance of this geological event on speciation processes in octopod. The influence of the historical e future climate changes on distribution and expansion of O. insularis populations was analyzed by ecological niche modeling in five temporal scenarios. The analysis revealed a climatic niche expansion of O. insularis towards temperate regions on global warming scenarios. Whereas, phylogeography and population structure showed four populations/stocks well delimited, mainly due to South Equatorial Current and seamounts.

These results corroborate the Isolation by Distance hypothesis. The present results allowed a holistic view, including genetic, ecology and oceanographic factors, which influences O. insularis life history. Those findings can help to build an actual panorama of species conservation and regulation, as well, to suggest future management measures to attenuate possible consequence of global climatic changes.

Keywords: phylogeny, phylogeography, niche modeling, Barcoding, landscape genetics

INTRODUÇÃO GERAL

Amplamente adaptados a diversos tipos de ambientes, desde águas rasas tropicais até mares profundos (Jereb et al. 2014), os polvos desempenham um papel fundamental nas relações tróficas dos ecossistemas marinhos (Nesis 1987, Boyle & Rodhouse 2005), tanto como predadores de uma diversa fauna bentônica, como presas importantes de uma variedade de espécies que estão no topo de cadeia alimentar como os atuns, tubarões e mamíferos marinhos (Clarke 1996, Hanlon & Messenger 1996). Além disso, constituem importante recursos pesqueiros, fazendo parte de pescarias artesanais e industriais em diferentes regiões do mundo. Cerca de 31 espécies de polvos produzem em torno de 350.710 toneladas anuais de pescado, gerando mais de $US 2 bilhões para a economia global (Jereb et al. 2014). Dentre essas, se destacam como os principais alvos da pesca de polvo no mundo, as espécies do complexo Octopus cf. vulgaris Cuvier, 1797, O. maya Voss and Solís,

1966, O. mimus Gould, 1852, O. hubbsorum Berry 1953 e O. insularis Leite e Haimovici, 2008

(Nesis 1987, Boyle & Rodhouse 2005, Norman et al. 2014).

Octopus insularis: o polvo de ampla distribuição tropical

Até 2008 O. insularis era tratado como O. vulgaris, espécie considerada cosmopolita, comum na região Sul e Sudeste do Brasil. Diversos estudos subsequentes identificaram-no como uma espécie distinta morfológica, genética e comportamentalmente (Leite et al. 2008,

2009, Lima et al. 2014a), a qual deveria ter tratada sob regulamentações pesqueiras particulares (Lima et al. 2014b).

Octopus insularis, possui tamanho médio a grande, com braços curtos e grossos, manto e cabeça largos com pele rugosa marrom-avermelhada e lígula pequena (Leite et al.

2008). Inicialmente identificada na costa nordeste do Brasil, sua distribuição abrange principalmente as águas rasas da costa e ilhas oceânicas do Nordeste brasileiro, sendo a principal espécie de polvo alvo da pescaria comercial nessas regiões (Leite et al. 2009, Lima et al. 2014b) (Figura 1). Recentemente sua distribuição geográfica foi estendida para as ilhas do meio do Atlântico Ascensão e Santa Helena (Amor et al. 2015), o que evidenciou o alto 19

potencial dispersivo da espécie e atraiu a atenção para levantamentos que envolvessem toda

a região do Atlântico Tropical, incluindo o mar do Caribe, onde poucos estudos taxonômicos,

ecológicos e moleculares foram conduzidos com polvos até a presente data.

Octopus insularis alimenta-se principalmente de crustáceos, bivalves, gastrópodes e,

com menor frequência, também de cefalópodes e peixes (Bouth et al. 2011, Batista & Leite

2016, Leite et al. 2016). Assim como a maioria das espécies do gênero, O. insularis passa

por um período planctônico até se estabelecer no substrato e é caracterizado por possuir

elevada fecundidade (68.000 a 120.000 ovos) e ovos pequenos (~2 mm) (Lima et al. 2014 b,

Lenz et al. 2015). A espécie parece ser tolerante a uma ampla variação de temperatura e

salinidade ao longo da sua área de ocorrência. Ela já foi registrada desde regiões estuarinas

e poças de maré com elevadas temperaturas (até 310C), até águas subtropicais (~220C) no

arquipélago de Trindade e Martim Vaz (Bouth et al. 2011, Leite et al. 2016).

Medidas de conservação e manejo pesqueiro para a espécie foram propostas para o

Arquipélago de Fernando de Noronha (Leite et al. 2008) e costa nordeste do Brasil (Lima et

al. 2014a, Andrade 2015), as quais incluem um peso mínimo de captura de 500 g, o uso de

potes como petrecho seletivo e áreas de pesca em profundidade entre 5 e 15 m, evitando

recifes muito rasos, onde se encontram os juvenis, e áreas mais profundas onde as fêmeas

buscam proteção para desovar.

Figure 1 - A espécie Octopus insularis em ambiente natural, mostrando a variabilidade de padrões corporais para comportamentos de camuflagem, forrageio e descanso. Fotos: Françoise Lima

Abordagem integrativa para conservação de espécies

Divergências entre espécies e entre populações surgem da interação histórica e contemporânea entre um conjunto complexo de processos ecológicos, comportamentais, genéticos, oceanográficos, climáticos e tectônicos (Palumbi 1994, Grosberg & Cunningham

2001). Tais processos podem induzir adaptações locais, causar variações demográficas, deriva genética, isolamento reprodutivo e, consequentemente, podem levar a processos de especiação (Rundle & Nosil 2005, Arnegard et al. 2014). A abordagem integrativa aplicada à conservação, incluindo múltiplos componentes do ecossistema (biológico, químico, físico, econômico e social), aliados à genética e biogeografia, são essenciais para a compreensão holística dos fatores que contribuem para a diversificação de populações, processos de especiação e padrões ecológicos no tempo e no espaço (Carstens & Richards 2007,

Friedlander et al. 2007, Padial et al. 2010, Borja et al. 2016). Além disso, gera informações robustas para a manejo de espécies e comunidades marinhas, auxiliando também na delimitação de áreas prioritárias para conservação (Palumbi 2003, Leslie 2005).

Primeiramente é importante identificar se as populações são compostas de uma ou mais espécies, principalmente quando são animais comercialmente explorados. Quando um estoque explorado é representado por mais de uma espécie, existe o risco de sobre- exploração ou até mesmo extinção daquela mais susceptível (Thorpe et al. 2000, Solé-Cava and Cunha, 2012). Os caracteres morfológicos na abordagem taxonômica tradicional muitas vezes não são suficientes para a identificação correta das espécies, principalmente para polvos que, apesar dos complexos padrões corporais, possuem alta similaridade morfológica dentro do gênero Octopus, especialmente quando mortos (Ward 2000, Jereb et al. 2014).

Dessa forma, a delimitação de espécies tem sido proposta de forma pluralista, sob a luz da taxonomia integrativa, a qual engloba não apenas a abordagem morfológica, mas também nicho ecológico e genética molecular (DNA barcoding, filogenia e filogeografia) (Dayrat 2005,

Padial et al. 2010).

Para fins de conservação, também é importante entender como os processos

históricos, tais como mudanças climáticas globais e eventos geológicos, podem influenciar a distribuição e relações entre espécies (Parmesan 2006, Hill et al. 2011, Krapp 2012), o que pode ser avaliado através da abordagem filogenética e biogeográfica. Um exemplo clássico desses processos é o soerguimento do Istmo do Panamá (IP), uma imensa ponte terrestre que uniu a América Central e América do Sul, interrompendo o fluxo de águas entre os oceanos Atlântico e Pacífico e propiciando o desenvolvimento de condições únicas em cada lado da América (Collins et al. 1996, Coates & Stallard 2013, Leigh et al. 2013). O período de fechamento final do Istmo do Panamá ainda é uma questão controversa na ciência.

Entretanto, existem dois modelos principais que explicam seu processo de formação: o modelo Pleistoceno e o modelo Mioceno (Marek 2015). Alguns autores propuseram que o fechamento final do istmo foi no Plioceno tardio (modelo Pleistoceno), há aproximadamente

2,5 a 3,5 milhões de anos (Lessios 1981, Bartoli et al. 2005, Schneider & Schmittner 2006,

Coates & Stallard 2013, O’Dea et al. 2016), enquanto outros têm apontado que o fechamento do IP ocorreu no Mioceno (~15 Ma) (Montes et al. 2012, 2015, Bacon et al. 2013, 2015, Hoorn et al. 2015). Ambos os modelos concordam que esse complexo evento vicariante causou profundas mudanças climáticas e oceanográficas globais (Lear et al. 2003) e, por esse motivo, é conhecido como um dos mais importantes eventos geológicos que influenciou processos de especiação no ambiente marinho, bem como possibilitou intercâmbio de animais terrestres ao longo da América (Woodburne 2010, Leigh et al. 2013).

Estudos filogenéticos envolvendo espécies irmãs de peixes, crustáceos e moluscos dos dois lados do IP têm auxiliado na compreensão do papel de eventos vicariantes na especiação de organismos marinhos (Bermingham & Lessiost 1993, Knowlton 1993, Collins

1996, Bartoli et al. 2005, Bacon et al. 2013, Galván-Quesada et al. 2016, Cowman et al. 2017).

Voight (1988) e Nesis (2003), através da abordagem morfológica, identificaram nove pares de espécies de cefalópodes em ambos os lados da América. Entretanto, até o presente momento, não existe estudo filogenético baseado em dados moleculares para cefalópodes separados pelo IP. Dessa forma, esse será o primeiro estudo a analisar o papel do

soerguimento do Istmo do Panamá nos padrões e processos de especiação de cefalópodes da Família Octopodidae, através de uma análise integrativa abordando filogenia e biogeografia.

Além dos processos geológicos, mudanças climáticas em larga escala subsequentes ao soerguimento do IP, tais como eventos de glaciação que ocorreram no Quaternário, também influenciaram a história evolutiva de muitos organismos marinhos (Gehrels 1999,

Bartoli et al. 2005). Tais flutuações climáticas provocaram grandes variações na temperatura da superfície do mar, reorganização dos padrões de circulação marinha, bem como alterações no nível dos oceanos (Yokoyama et al. 2000, Clark et al. 2009, Sbrocco & Barber

2013, Ludt & Rocha 2015). Nesse contexto, a modelagem de distribuição do nicho climático de uma espécie pode auxiliar na compreensão de como esses mecanismos moldaram as trajetórias evolutivas das populações e no entendimento das consequências das mudanças climáticas futuras na distribuição de populações naturais (Dambach & Rödder 2011, Hattab et al. 2014, Brown et al. 2016). Além disso, a modelagem do nicho ecológico pode auxiliar na elaboração de hipóteses filogeográficas a serem testadas em abordagens metodológicas integrativas (Alvarado-Serrano & Knowles 2013).

No ambiente marinho, os processos de estruturação populacional são mais complexos quando comparados aos ambientes terrestres, pois são considerados sistemas

“abertos” e contínuos (Carr et al. 2003). Isso se dá em virtude da natureza tridimensional dos oceanos (devido a coluna d’água) e da presença das correntes oceânicas, as quais podem promover ampla dispersão de invertebrados durante o estágio larval pelágico (Cowen &

Sponaugle 2009). Nesse contexto, os padrões de circulação marinha, deságue de rios na costa, termoclinas e profundidade são considerados as principais barreiras no ambiente marinho, podendo impedir ou limitar o fluxo gênico entre populações (Hedgecock 1986,

Hellberg 2009). A abordagem filogeográfica incorpora o papel desses processos e barreiras oceanográficas na distribuição espacial da diversidade genética de uma espécie (Avise et al.

1987, Avise 2009). Além disso, em se tratando de uma população sujeita à exploração

pesqueira, como é o caso do O. insularis, essa abordagem permite a identificação de estoques/populações presentes ao longo da distribuição da espécie para que, caso apresentem diferenças genéticas, possam ser tratados como unidades diferentes em que a captura e esforço de pesca devem ser distintos (Frankham et al. 2008, Freeland et al. 2011).

As populações de espécies sujeitas à exploração comercial, como é o caso de O. insularis, podem sofrer sérios danos decorrentes da sobre-exploração e falta de regulamentação pesqueira (Ward 2000). A redução do tamanho populacional provoca perda da diversidade genética e, consequentemente, reduz a capacidade dos indivíduos se adaptarem a novas mudanças ambientais (Schwartz et al. 2006, Freeland et al. 2011). Por outro lado, por ser uma espécie amplamente distribuída e tolerante a uma vasta gama de variações ambientais, O. insularis pode se beneficiar das mudanças climáticas futuras

(aquecimento global) e ampliar seus limites de distribuição, o que pode causar consequências como exclusão competitiva e reestruturação de cadeias tróficas inteiras.

A abordagem integrativa da conservação de O. insularis englobando ecologia, genética, morfologia e biogeografia é de fundamental importância para compreender como os fatores históricos e contemporâneos moldaram a distribuição e estruturação populacional da espécie (Padial et al. 2010). Adicionalmente, essa abordagem permite avaliar como e quais características climáticas e oceanográficas influenciaram a atual conformação do nicho ecológico desse polvo tropical, bem como o fluxo gênico entre suas populações (Slatkin 1987,

Cordellier & Pfenninger 2009, González-Wevar et al. 2016). Além disso, avaliar, através de análises filogenéticas, como processos biogeográficos e vicariantes mediaram especiação dentro do gênero Octopus possibilita identificar a origem de importantes traços da história de vida desses animais e explicar padrões de adaptação e ocupação de nichos ecológicos particulares (Lessios 2008, Cowman & Bellwood 2013). Com essa visão holística, é possível reconstruir e compreender os padrões históricos para traçar um atual e robusto panorama de conservação e regulamentação, bem como sugerir futuras medidas de manejo da espécie para atenuar as consequências das mudanças climáticas globais.

APRESENTAÇÃO DA TESE

O presente estudo será apresentado na forma de quatro capítulos, os quais abordam diferentes elementos da abordagem integrativa. O capítulo 1 objetiva compreender os limites norte de distribuição da espécie O. insularis, bem como identificar a composição dos estoques pesqueiros de polvos no Atlântico Tropical oeste. Esse capítulo já está publicado na revista

Marine Biodiversity. Uma vez registrada a ocorrência da espécie na região do Caribe, o capítulo 2 utiliza a abordagem genética com inferência biogeográfica, visando compreender como as espécies da Família Octopodidae se diversificaram após o soerguimento do IP, centro de origem das espécies transistimianas, bem como as rotas de dispersão dos polvos entre Atlântico e Pacífico. O capítulo 3 aborda variações na distribuição do nicho climático de

O. insularis sob cinco diferentes cenários de mudanças climáticas e como essa espécie tolerante a amplas variações de temperatura e salinidade poderá responder ao aquecimento global. Através da abordagem filogeográfica, o capítulo 4 objetiva identificar populações de

O. insularis geneticamente distintas ao longo de sua distribuição. Além disso, visa compreender como e quais fatores oceanográficos contribuem para a estruturação populacional da espécie, através de análises moleculares e modelagem de conectividade usando a teoria dos circuitos. Por fim, os resultados dos quatro capítulos serão discutidos na sessão de Conclusões gerais e propostas para o manejo e conservação serão apresentadas no final da tese.

OBJETIVO GERAL

Utilizar uma abordagem integrativa para avaliar como fatores genéticos, ecológicos e oceanográficos influenciam a história de vida de Octopus insularis, visando gerar informações robustas para embasar planos de manejo e conservação dessa espécie amplamente distribuída no Atlântico Tropical.

OBJETIVOS ESPECÍFICOS

• Identificar os limites norte de distribuição de O. insularis utilizando Barcoding e

morfologia;

• Verificar se existe problemas de identificação incorreta de espécies de polvos em

algumas pescarias nas províncias biogeográficas Atlântico Tropical Nordeste e

Atlântico Tropical Sudeste;

• Avaliar o papel do Istmo do Panamá no processo de especiação de octópodes no

Atlântico e Pacífico;

• Identificar o centro de origem e rotas de dispersão de espécies de polvos separadas

pelos Istmo do Panamá;

• Avaliar como as mudanças climáticas históricas e futuras influenciaram e influenciarão

a distribuição do nicho climático de O. insularis;

• Identificar as principais variáveis ambientais que influenciam a distribuição da espécie;

• Verificar como a diversidade gênica da espécie está particionada ao longo do espaço

geográfico, identificando populações/estoques geneticamente estruturados;

• Analisar o papel das características oceanográficas, como correntes marinhas e

montes submarinos na estruturação populacional de O. insularis;

• Utilizar resultados da abordagem integrativa na conservação de espécies para propor

um panorama holístico de manejo para O. insularis.

REFERÊNCIAS BIBLIOGRÁFICAS

Alvarado-Serrano DF, Knowles LL (2013) Ecological niche models in phylogeographic

studies: Applications, advances and precautions. Mol Ecol Resour 14:233–248

Amor MD, Laptikhovsky V, Norman MD, Strugnell JM (2015) Genetic evidence extends the

known distribution of Octopus insularis to the mid-Atlantic islands Ascension and St Helena.

J Mar Biol Assoc United Kingdom 1–6

Andrade LCA (2015) Estratégias de exploração e comércio da pesca artesanal de polvo. Tese

de doutorado. Universidade Federal do Rio Grande do Norte. 129p

Arnegard ME, McGee MD, Matthews B, Marchinko KB, Conte GL, Kabir S, Bedford N, Bergek

S, Chan YF, Jones FC, Kingsley DM, Peichel CL, Schluter D (2014) Genetics of ecological

divergence during speciation. Nature 511:1–17

Avise JC, Arnold J, Ball RM, Lambt T, Neigel JE, Carol A, Saunders NC (1987) Intraspecific

phylogeography: The mitochondrial DNA bridge between population genetics and

systematics. Ann Rev Ecol Syst 18:489–522

Avise JC (2009) Phylogeography: retrospect and prospect. J Biogeogr 36:3–15

Bacon CD, Mora A, Wagner WL, Jaramillo CA (2013) Testing geological models of evolution

of the Isthmus of Panama in a phylogenetic framework. Bot J Linn Soc 171:287–300

Bacon CD, Silvestro D, Jaramillo C, Smith BT, Chakrabarty P, Antonelli A (2015) Biological

evidence supports an early and complex emergence of the Isthmus of Panama. Proc Natl

Acad Sci 112:6110–6115

Bartoli G, Sarnthein M, Weinelt M, Erlenkeuser H, Lea DW (2005) Final closure of Panama

and the onset of northern hemisphere glaciation. Earth Planet Sci Lett 237:33–44

Batista AT, Leite TS (2016) Octopus insularis (Cephalopoda: Octopodidae) on the tropical

coast of Brazil: where it lives and what it eats. Brazilian J Oceanogr 64:353–364

Bermingham E, Lessiost HA (1993) Rate variation of protein and mitochondrial DNA evolution

as revealed by sea urchins separated by the Isthmus of Panama. Proc Natl Acad Sci

90:2734–2738

Borja Á, Elliott M, Andersen JH, Berg T, Carstensen J, Halpern BS, Heiskanen A-S, Korpinen

S, et al. (2016) Overview of integrative assessment of marine systems: the ecosystem

approach in practice. Front Mar Sci 3:1-68

Bouth HF, Leite TS, Lima FD, Oliveira JEL (2011) Atol das Rocas: an oasis for Octopus

insularis juveniles (Cephalopoda: Octopodidae). Zool (Curitiba, Impresso) 28:45–52

Boyle P, Rodhouse PG (2005) Cephalopods: ecology and fisheries. Blackwell Science, Oxford

Brown JL, Weber JJ, Alvarado-Serrano DF, Hickerson MJ, Franks SJ, Carnaval AC (2016)

Predicting the genetic consequences of future climate change: The power of coupling

spatial demography, the coalescent, and historical landscape changes. Am J Bot 103:153–

163

Carr MH, Neigel JE, Estes JA, Andelman S, WarneR RR, Largier JL (2003) Comparing marine

and terrestrial ecosystems: Implications for the design of coastal marine reserves. Ecol

Appl 13:90–107

Carstens BC, Richards CL (2007) Integrating coalescent and ecological niche modeling in

comparative phylogeography. Evolution 61:1439–1454

Clark PU, Dyke AS, Shakum JD, Carlson AE, Clark J, Wohlfarth B, Mitrovica JX, Hostetler

SW, McCabe AM, Shakun JD (2009) The Last Glacial Maximum. Science 325:710–714

Clarke MR (1996) The role of Cephalopods in the world’s oceans: general conclusion and the

future. Philos Trans R Soc Lond B 351:1105–1112

Coates AG, Stallard RF (2013) How old is the isthmus of Panama? Bull Mar Sci 89:801–813

Collins T (1996) Molecular comparisons of transisthmian species pairs: Rates and patterns of

evolution. In: Jackson JBC, Budd AF, Coates AG (eds) Evolution and Environment in

Tropical America. University of Chicago Press, Chicago, p 303–334

Collins LS, Budd AF, Coates AG (1996) American Seaway. Proc. Natl. Acad. Sci. 93:6069–

6072

Cordellier M, Pfenninger M (2009) Inferring the past to predict the future: Climate modelling

predictions and phylogeography for the freshwater gastropod Radix balthica (Pulmonata,

Basommatophora). Mol Ecol 18:534–544

Cowen RK, Sponaugle S (2009) Larval dispersal and marine population connectivity. Ann Rev

Mar Sci 1:443–466

Cowman PF, Bellwood DR (2013) Vicariance across major marine biogeographic barriers:

temporal concordance and the relative intensity of hard versus soft barriers. Proc Biol Sci

280:1–8

Cowman PF, Parravicini V, Kulbicki M, Floeter SR (2017) The biogeography of tropical reef

fishes: endemism and provinciality through time. Biol Rev:1–51

Dambach J, Rödder D (2011) Applications and future challenges in marine species distribution

modeling. Aquat Conserv Mar Freshw Ecosyst 21:92–100

Dayrat B (2005) Towards integrative taxonomy. Biol J Linn Soc 85:407–415

Frankham R, Ballou JD, Briscoe DA (2008) Fundamentos da Genética da Conservação. SBG,

Ribeirão Preto

Freeland JR, Kirk H, Petersen SD (2011) Molecular Ecology, 2nd ed. Wiley-Blackwell,

Chichester

Friedlander A, Kobayashi D, Bowen B, Meyers C, Papastamatiou Y, Demartini E (2007)

Connectivity and Integrated Ecosystem Studies. Mar Biogeogr Assess Northwest Hawaiian

Islands 291–330

Galván-Quesada S, Doadrio I, Alda F, Perdices A, Reina RG, Varela MG, Hernández N,

Mendoza AC, Bermingham E, Domínguez-Domínguez O (2016) Molecular phylogeny and

biogeography of the amphidromous fish genus Dormitator Gill 1861 (Teleostei: Eleotridae).

PLoS One 11:1–26

Gehrels WR (1999) Middle and late Holocene sea-level changes in Eastern Maine

reconstructed from foraminiferal saltmarsh stratigraphy and AMS 14c dates on basal peat.

Quat Res 52:350–359

González-Wevar CA, Rosenfeld S, Segovia NI, Hüne M, Gérard K, Ojeda J, Mansilla A, Brickle

P, Díaz A, Poulin E (2016) Genetics, gene flow, and glaciation: The case of the south

american limpet Nacella mytilina. PLoS One 11:1–24

Grosberg R, Cunningham CW (2001) Genetic structure in the sea: from populations to

communities. In: Bertness MD, Gaines SD, Hay ME (eds) Marine Community Ecology.

Sunderland, p 61–84

Hanlon RT, Messenger JB (1996) Cephalopodes Behaviour. Cambridge University Press,

Cambridge

Hattab T, Albouy C, Lasram FBR, Somot S, Le Loc’h F, Leprieur F (2014) Towards a better

understanding of potential impacts of climate change on marine species distribution: A

multiscale modelling approach. Glob Ecol Biogeogr 23:1417–1429

Hedgecock D (1986) Is Gene flow from pelagic larval dispersal important in the adaptation

and evolution of marine invertebrates? Bull Mar Sci 39:550–564

Hellberg ME (2009) Gene flow and isolation among populations of marine animals. Annu Rev

Ecol Evol Syst 40:291–310

Hill JK, Griffiths HM, Thomas CD (2011) Climate change and evolutionary adaptations at

species’ range margins. Annu Rev Entomol 56:143–59

Hoorn BC, Flantua S, America N (2015) An early start for the Panama land bridge. Science

348:186–187

Jereb P, Roper CFE, Norman MD, Finn JK (2014) Cephalopods of the world. An annotated

and illustrated catalogue of cephalopod species known to date. Octopods and vampire

squids. FAO species catalogue for ﬁshery purposes. Food and Agriculture Organization of

the United Nations, Rome

Knowlton N (1993) Divergence in protein, mitochondrial DNA, and reproductive compatibility

across the Isthmus of Panama. Science 260:1629–1632

Krapp M (2012) Middle Miocene climate evolution: the role of large-scale ocean circulation

and ocean gateways. Reports on Earth System Science, Hamburg

Lear CH, Rosenthal Y, Wright JD (2003) The closing of a seaway: Ocean water masses and

global climate change. Earth Planet Sci Lett 210:425–436

Leigh EG, O’Dea A, Vermeij GJ (2013) Historical biogeography of the isthmus of Panama.

Biol Rev 89:148–172

Leite TS, Batista AT, Lima FD, Barbosa JC, Mather J (2016) Geographic variability of Octopus

insularis diet: From oceanic island to continental populations. Aquat Biol 25:17–27

Leite TS, Haimovici M, Mather J, Oliveira JEL (2009) Habitat, distribution, and abundance of

the commercial octopus (Octopus insularis) in a tropical oceanic island, Brazil: Information

for management of an artisanal fishery inside a marine protected area. Fish Res 98:85–91

Leite TS, Haimovici M, Molina W, Warnke K (2008) Morphological and genetic description of

Octopus insularis, a new cryptic species in the Octopus vulgaris complex (Cephalopoda:

Octopodidae) from the tropical southwestern Atlantic. J Molluscan Stud 74:63–74

Lenz TM, Elias NH, Leite TS, Vidal EAG (2015) First description of the eggs and paralarvae

of the tropical octopus, Octopus insularis under culture conditions. Am Malacol Bull 33:1–

Leslie HM (2005) A synthesis of marine conservation planning approaches. Conserv Biol

19:1701–1713

Lessios HA (1981) Divergence in allopatry: Molecular and morphological differentiation

between sea urchins separated by the Isthmus of Panama. Evolution 35:618–634

Lessios HA (2008) The Great American Schism: Divergence of marine organisms after the

rise of the Central American Isthmus. Annu Rev Ecol Evol Syst 39:63–91

Lima FD, Leite TS, Haimovici M, Oliveira JEL (2014a) Gonadal development and reproductive

strategies of the tropical octopus (Octopus insularis) in northeast Brazil. Hydrobiologia

725:7–21

Lima FD, Leite TS, Haimovici M, Nóbrega MF, Oliveira JEL (2014b) Population structure and

reproductive dynamics of Octopus insularis (Cephalopoda: Octopodidae) in a coastal reef

environment along northeastern Brazil. Fish Res 152:86–92

Ludt WB, Rocha LA (2015) Shifting seas: The impacts of Pleistocene sea-level fluctuations

on the evolution of tropical marine taxa. J Biogeogr 42:25–38

Marek C (2015) The emergence of the Isthmus of Panama – a biological perspective. Master

Dissertation. Universität Gießen, Germany

Montes C, Cardona A, Jaramillo C, Pardo A, Silva JC, Valencia V, Ayala C, Pérez-Angel LC,

Rodriguez-Parra L a, Ramirez V, Niño H (2015) Middle Miocene closure of the Central

American Seaway. Science 348:226–229

Montes C, Cardona A, McFadden R, Morón SE, Silva CA, Restrepo-Moreno S, Ramírez DA,

Hoyos N, Wilson J, Farris D, Bayona GA, Jaramillo CA, Valencia V, Bryan J, Flores JA

(2012) Evidence for middle Eocene and younger land emergence in central Panama:

Implications for Isthmus closure. Bull Geol Soc Am 124:780–799

Nesis KN (1987) Cephalopods of the world. T.F.H. Publications, Moscou

Nesis KN (2003) Distribution of recent Cephalopoda and implications for Plio-Pleistocene

events. Berliner Paläobiol Abh 3:199–224

Norman MD, Hochberg FG, Finn JK (2014) Octopus and vampire squids. In: Jereb P, Roper

CFE, Norman MD, Finn JK (eds) Cephalopods of the world. An annotated and illustrated

catalogue of cephalopod species known to date. Octopods and vampire squids. FAO

species catalogue for ﬁshery purposes, vol. 3. FAO, Rome

O’Dea AO, Lessios HA, Coates AG, Eytan RI, Restrepo-Moreno SA, Cione AL, Collins LS, et

al. (2016) Formation of the Isthmus of Panama. Sci Adv 2:1–11

Padial JM, Miralles A, De la Riva I, Vences M (2010) The integrative future of taxonomy. Front

Zool 7:16

Palumbi SR (1994) Genetic divergence, reproductive isolation, and marine speciation. Annu

Rev Ecol Syst 25:547–572

Palumbi SR (2003) Population genetics, demographic connectivity, and the design of marine

reserves. Ecol Appl 13:146–158

Parmesan C (2006) Ecological and evolutionary responses to recent climate change. Annu

Ecol Evol Syst 37:637–669

Rundle HD, Nosil P (2005) Ecological speciation. Ecol Lett 8:336–352

Sbrocco EJ, Barber PH (2013) MARSPEC: Ocean climate layers for marine spatial ecology.

Ecology 94:979

Schneider B, Schmittner A (2006) Simulating the impact of the Panamanian seaway closure

on ocean circulation, marine productivity and nutrient cycling. Earth Planet Sci Lett

246:367–380

Schwartz MK, Luikart G, Waples RS (2006) Genetic monitoring as a promising tool for

conservation and management. Trends Ecol Evol 22:25–33

Slatkin M (1987) Gene flow and the geographic structure of natural populations. Am J Trop

Med Hyg 82:235–42

Solé-Cava AM, Cunha HA (2012) A genética e a conservação da natureza. In Matioli, SR,

Fernandes, FMC (eds) Biologia Molecular e Evolução. Holos, Ribeirão Preto, 217-228

Thorpe JP, Sole-Cava AM, Watts PC (2000) Exploited marine invertebrates: genetics and

fisheries. Hydrobiologia 420:165-184

Voight JR (1988) Trans-Panamanian geminate octopods (Mollusca:Octopoda). Malacologia

29:289–294

Ward RD (2000) Genetics in fisheries management. Hydrobiologia 420:191–201

Woodburne MO (2010) The Great American Biotic Interchange: Dispersals, tectonics, climate,

sea level and holding pens. J Mamm Evol 17:245–264

Yokoyama Y, Lambeck K, Deckker P De, Johnston P, Fifield L (2000) Timing of the Last

Glacial Maximum from observed sea-level minima. Nature 406:713–6

CAPÍTULO 1

Occurrence of Octopus insularis Leite and Haimovici, 2008 in the Tropical Northwestern Atlantic and implications of species misidentification to octopus fisheries management

OCCURRENCE OF OCTOPUS INSULARIS LEITE AND HAIMOVICI, 2008 IN THE

TROPICAL NORTHWESTERN ATLANTIC AND IMPLICATIONS OF SPECIES

MISIDENTIFICATION TO OCTOPUS FISHERIES MANAGEMENT

Françoise D. de Lima1,2, Waldir M. Berbel-Filho2,3, Tatiana S. Leite4, Carlos Rosas5, Sergio M.

Q. Lima2

1 Programa de Pós-Graduação em Sistemática e Evolução. Universidade Federal do Rio

Grande do Norte, 59978-970 Lagoa Nova, Natal, RN, Brazil

2 Laboratório de Ictiologia Sistemática e Evolutiva, Departamento de Botânica e Zoologia,

Universidade Federal do Rio Grande do Norte, 59978-970 Lagoa Nova, Natal, RN, Brazil

3 Department of BioSciences, College of Science, Swansea University, SA2 8PP, Swansea,

Wales Wallace Building

4 Laboratório de Bentos e Cefalópodes, Departamento de Oceanografia e Limnologia,

Universidade Federal do Rio Grande do Norte, 59014-100 Mãe Luiza, Natal, RN, Brazil

5 Unidad Multidisciplinaria de Docencia e Investigación, Facultad de Ciencias, Universidad

Nacional Autónoma de México, Puerto de Abrigo, Sisal, Yucatán, México

Correspondence author: [email protected], +55 84 99991-3885

Abstract

The genus Octopus has been treated as a “catch all” taxon because many species have morphological similarities. To investigate the taxonomic status of the Octopus species in

Tropical Northwestern Atlantic (TNA) and Tropical Southwestern Atlantic (TSA), we sampled

Octopus insularis Leite and Haimovici, 2008 in three areas of the Northeastern Brazilian coast, four Brazilian oceanic islands and one island in Western Caribbean, Mexico. Samples of

Octopus maya Voss and Solís, 1966 were obtained from the cultivation center of the

Universidad Nacional Autónoma de México (UNAM) in Sisal city. Specimens previously

identified as Octopus vulgaris Cuvier, 1797 were collected in two regions of Southeast Brazil, in an industrial port in Progreso city (Southern Gulf of Mexico) and from a fish market in Isla

Mujeres, Mexico (Western Caribbean). Molecular species attribution was completed based on morphology of fresh specimens identified by an octopus specialist and then checked against previous identification (cultivation center and GenBank sequences). Molecular analysis of both mitochondrial (cytochrome oxidase I) and nuclear genes (elongation factor-1α), including

GenBank data, confirmed that one specimen collected at the Western Caribbean from Mexico and identified as O. insularis, shared the same haplotype of the species from the type locality, indicating the occurrence of this species in the Caribbean Sea. Phylogenetic analyses indicated that 21 GenBank sequences from TNA identified as O. vulgaris grouped within the

O. insularis clade and are most likely to be to the latter species. The COI analysis also showed that 18 individuals collected in fishing landings and fish markets, previously identified as O. vulgaris had the identical haplotype of O. maya collected in the UNAM cultivation center.

These results corroborate the misidentification of species in Mexico fisheries. Based on molecular and morphological data we extended the distribution of O. insularis to the TNA and revealed cases of misidentification among the most commercially exploited octopus species in this region.

Keywords: misidentification, fisheries management, molecular identification, Caribbean Sea and Gulf of Mexico

Introduction

The reduction of traditional fish catches has contributed to expanding fisheries on cephalopods (Caddy and Rodhouse 1998; Boyle and Rodhouse 2005). In this context, octopus may be better suited as targets for fishery exploitation than other marine groups due to resilience against fishing pressure (Jereb et al. 2013). The world catch of octopus is approximately 350,710 tons, which yields $1.07 and $ 1.33 billion per year by import and

export, respectively (FAO 2012). Many species of the genus Octopus, which contains the most important commercial octopus species around the world, have morphological and body patterns similarities, making their identification difficult (Norman and Hochberg 2005). Thus, it has been treated as “catch all” taxon, in which the majority of described octopuses have been placed; i.e. any species characterized by two rows of suckers and an ink sac (Guzik et al.

2005; Jereb et al. 2013). Although cryptic species of “Octopus-like” species have been described, their taxonomic status, distribution area, and phylogenetic relationships remain obscured (Warnke et al. 2004; Leite et al. 2008; Pliego-Cárdenas et al. 2014, Amor et al.

2015).

The use of morphological traits to delimit octopus species is difficult not only because of the meristics and morphometrics overlapping among species (Boyle and Rodhouse 2005) but also due to loss of diagnostic characters upon preservation (Voight 1991). Consequently, many species could be misidentified in commercial octopus fisheries (Ward 2000).

When a commercially exploited resource is represented by more than one species, there is a risk of overexploitation or even extinction of susceptible species without this being even noticed (Thorpe et al. 2000; Vecchione et al. 2000; Solé-Cava and Cunha 2012). Therefore, correct species identification of fisheries stocks is essential to understand the potential impact of catch rates on population abundance and viability (Garcia-Vazquez et al. 2012; Tillett et al.

2012).

Molecular techniques have been widely used to distinguish lineages for conservation biology

(Schwartz et al. 2006; Wenne et al. 2007; Waples 2008) and can also be useful to fisheries studies, including species identification and delimitation of stocks (Gusmão et al. 2000;

Vecchione et al. 2000; Taylor et al. 2012; Tourinho et al. 2012). Mitochondrial genes are particularly useful because they show sufficient sequence divergence to enable discrimination among closely related species in most animal groups (Hebert et al. 2003). Partial sequences of the mitochondrial gene cytochrome oxidase I (COI) are a powerful tool for identifying morphologically similar species (Hebert and Gregory 2005). Several studies have shown that

the COI ‘barcoding’ fragment is appropriate for discriminating many species of benthic octopuses (Allcock et al. 2011; Amor et al. 2015).

Although mitochondrial genes are widely used to identify species, it is important to analyze both nuclear and mitochondrial sequences. The approach of different molecular markers (e.g.

DNA sequencing, microsatellites, and single nucleotide polymorphisms/SNPs) recovers more faithfully the divergence of lineages since regions of DNA (and organelles) have different population sizes, and consequently distinct mutation rates (Solé-Cava and Cunha 2012).

Three large Octopus species are the main targets of cephalopod fisheries in Tropical

Northwestern Atlantic (TNA) and Tropical Southwestern Atlantic (TSA): O. insularis Leite and

Haimovici, 2008, O. maya Voss and Solís, 1966 and O. vulgaris Cuvier, 1797. These species have different reproductive and behavioral strategies and occupy specific ecological niches along their geographical distribution (Jereb et al. 2013) (Table 1).

The tropical species O. insularis is found in the warm waters of the North and Northeast

Brazilian coast and oceanic islands (Leite et al. 2009), and was recently recorded in the mid-

Atlantic islands of Ascension and Saint Helena (Amor et al. 2015), suggesting that its geographical distribution is not fully understood. O. maya is an endemic species from the Gulf of Mexico (Arreguín-Sánchez et al. 2000), where it is considered to be at maximum sustainable yield (FAO 2012). The O. vulgaris species complex has an extensive distribution across tropical, subtropical and temperate waters, and this specific name has been applied to five types of morphologically similar taxa around the world (Boyle and Rodhouse 2005;

Norman et al. 2014). Distinguishing morphological diagnostic characters are difficult to evaluate in dead animals, therefore these large species could be mixed in fisheries statistics.

Misidentification of morphologically similar species can also affect our understanding of the ecological and evolutionary processes in marine communities (Knowlton 2000). The consequences of these mistakes can lead to misinterpretation of biological indicators of environmental quality (Gabrielsen et al. 2012), under or overestimation of the species richness

(Bortolus 2008) and generate biologically and ecologically inappropriate information. This then

hinders the development of effective policies for the protection of ecosystems (Knowlton 1993,

2000).

Molecular markers can provide accurate species identification of economically exploited species, thus substantially improving the quality of management and conservation plans

(Waples 2008). This study aims to investigate the taxonomic status of the Octopus species in the TNA and TSA and discusses the possible implications of species misidentification to cephalopod fisheries.

Methods

Specimens and tissue samples of O. insularis were collected by snorkeling and SCUBA in three areas of the Northeastern Brazilian coast (Ceará – CE, Rio Grande do Norte – RN and

Bahia – BA), four Brazilian oceanic islands (São Pedro and São Paulo archipelago – SPS,

Fernando de Noronha archipelago – FNO, Rocas Atoll – RAT, and Trindade and Martim Vaz archipelago – TMV) (N = 33) (permit SISBIO 10706-5 and 30484-1) and Western Caribbean,

Isla Mujeres, in Mexico (N = 1). Tissue samples of O. maya were obtained from cultivation center of Universidad Nacional Autónoma de México (UNAM) in Sisal, Yucatán. These animals originated from the Gulf of Mexico (N = 6). Tissue samples previously identified as O. vulgaris were collected by SCUBA in two regions of Southeast Brazil (Rio de Janeiro – RJ and

Santa Catarina – SC) (N = 6), in an industrial port in Progreso city by fishing boats (Southern

Gulf of Mexico) (N = 19) and also were bought from a fish market in Isla Mujeres, Mexico (N

= 3) (Fig 1) (Table 2).

Before tissue collection, all specimens collected from Brazil, Isla Mujeres, cultivation center of

Sisal and four O. vulgaris from the port of Progreso, Mexico, were identified using diagnostic characters by an experienced octopus taxonomist (T.S. Leite). Muscle tissue from octopus arm was preserved in 95% ethanol and stored at -10o C. All collected individuals will be deposited at Museu de Organismos Aquáticos in Department of Oceanography and Limnology

of Federal University of Rio Grande do Norte. Genomic DNA was extracted using the GF-1

Nucleic Acid Extraction kit (Vivantis, Malaysis) according to the manufacturer’s instructions.

Cytochrome oxidase subunit I gene (COI) amplicons were obtained using universal primers

LCO1490 and HCO2198 (Folmer et al. 1994) and partial sequences of elongation factor-1α

(EF-1α) were amplified with the primers EF1(oct) and EF2(oct) (Guzik et al. 2005). The PCR amplification reactions of all sequences were conducted in a final volume of 25 µL containing

1 µL forward primer (10 mM), 1 µL reverse primer, 12.5 µL Taq DNA Polymerase Master Mix

(Ampliqon A/S, Copenhagen), 8.5 µL H2O and 2 µL DNA. PCR cycle parameters used to amplify COI were 3 min at 95°C for denaturation, followed by 40 cycles of 1 min at 94°C, 1 min at 45°C for annealing, 1.5 min at 72°C for extension and a ﬁnal extension step of 4 min at

72°C. The parameters used to amplify EF-1α sequences were according to Guzik et al. (2005).

From each sample, 25 µL of the PCR products were purified and sequenced by Macrogen

Inc, Seoul, Korea.

COI (N = 56) and EF-1α (N = 6) sequences available in GenBank were also used in this study.

A total of 158 sequences were used in this study, 124 sequences of COI and 34 of EF-1α

(Table 2).

Molecular species attribution was based on morphology of fresh specimens identified by octopus specialists and then checked against previous identification (fish market, cultivation samples, and GenBank sequences). Thus, each sample had both an “a priori” and an “a posteriori” classification.

The electropherograms were edited with Geneious 9.0.2 (http://www.geneious.com, Kearse et al. 2012) and sequences were aligned using Mega 6 (Tamura et al. 2013). The heterozygous sites of the nuclear gene were identified using Geneious 9.0.2 (75% peak similarity), confirmed visually and represented by IUPAC nucleotide ambiguity codes. Alleles for each individual were phased using the unphase tool implemented in DnaSP 5.10 with confidence probability thresholds of 0.90 (Librado and Rozas 2009).

For both genes, phylogenetic Bayesian coalescent reconstruction analysis of the subset of sequences consisting in distinct haplotypes as operational units was carried out in BEAST

1.75 (Drummond et al. 2012). The substitution model GTR+G was used for COI and HKY85+I for EF-1α, as suggested by jModeltest (Posada 2008). A total of 5x107 MCMC runs, saving one of each 5x10³ runs were performed, 10,000 trees were saved and the first 15% discarded as burnin. The convergence of MCMC runs and effective sample size (ESS≥200) was assessed using Tracer v1.6 (Rambaut et al. 2014). A consensus tree accessing the posteriori probability values of each clade was generated using TreeAnnotator 1.6.1 (Drummond et al.

2012).

According to the clade arrangement and species identification based on fresh specimens and museum collections, each sample was attributed to a posteriori species identification. A pairwise matrix of Kimura 2-parameter (K2P) was also performed in MEGA 6 (Tamura et al.

2013) to compare the genetic distances within and among each Octopus lineage.

The sequences of haplotypes generated in this study are accessible from GenBank under accession numbers KX611852-KX611865 for COI and KX641277-KX641281 for EF-1α.

For biogeographic delimitation system, the marine provinces and ecoregions followed the proposal of Spalding et al. (2007).

Results

Mitochondrial DNA

Partial COI sequences (478 bp) were used for 124 individuals (68 of this study and 56 from

GenBank), which comprised 35 haplotypes. The phylogenetic reconstruction showed three monophyletic and well-supported clades corresponding to O. insularis, O. maya and O. vulgaris (Fig. 2).

All individuals identified a priori as O. vulgaris from Puerto Rico, Guadalupe and Dominica

(Jassoud 2010) grouped within the O. insularis clade. A shared haplotype distributed among the individuals from Northeastern Brazilian coast (RN and CE) and oceanic islands of Rocas

Atoll and Fernando de Noronha archipelago, the latter type-locality of O. insularis, was also present in 18 individuals from Puerto Rico, Guadalupe, Dominica, and one from Isla Mujeres in Mexico, indicating the occurrence of O. insularis in the Caribbean Sea (TNA). The specimen from Isla Mujeres was the only one morphologically identified in the field as O. insularis at

TNA, an identity corroborated by both molecular markers.

Fifteen individuals collected in fishing landings in port of Progreso and fish markets in Isla

Mujeres were previously identified as O. vulgaris by local cephalopod researchers (non- taxonomists) and fishermen, but had the same haplotype of six individuals of bona fide O. maya collected in cultivation center of Sisal (Mexico), which confirms species misidentification in octopus fisheries of port of Progreso (Fig. 2). A different haplotype of O. maya obtained from GenBank grouped within this same clade. Two individuals from the port of Progreso erroneously identified as O. vulgaris a priori also had a different haplotype, which fell within

O. maya clade. The molecular analysis confirmed that four specimens collected in the port of

Progreso were correctly identified by a taxonomist as O. vulgaris.

A clade representing O. vulgaris formed three main well-supported subclades. The first subclade consisted of individuals from China, Japan (Type IV) and Turkey (sensu stricto SS); the second subclade included specimens from Turkey, Spain, France, Greece (sensu stricto

SS), Senegal, South Africa, Tristan da Cunha and India (Type III); and a third subclade included O. vulgaris individuals from port of Progreso /Mexico and South/Southeast of Brazil

(RJ and SC), which represent the O. vulgaris Types I and II, respectively (Fig. 2).

The K2P distance ranged from 0.1% (between O. insularis from Mexico and Caribbean Sea) to 20.9% (O. salutii and O. bicumaculoides) genetic divergence among groups (Table 3). The divergence between bona fide specimens of O. insularis from Northeastern Brazil to Mexico and Caribbean Sea was 0.2% and 0.3%, respectively. The divergence between O. maya identified a posteriori was 0.1%. The highest within group divergence was found in O. vulgaris

SS (2.1%).

In summary, the COI data set included 124 specimens, of which 68 were collected during field works and 56 were sequences retrieved from GenBank. Among the tissue samples obtained in this study, 26.5% (18 from 68) were incorrectly identified based on molecular analysis including bona fide specimens. Among GenBank sequences, 37.5% (21 from 56) were inconsistent with the a priori species identity, which is probably due to misidentification of the original specimen. All identification errors were recorded from the Tropical Northwestern

Atlantic.

Nuclear DNA

A 228 bp amplicon of EF-1α gene from 34 octopus sequences, representing 10 haplotypes, was analyzed. The phylogenetic reconstruction showed that one haplotype was shared by 24 individuals of O. insularis from Northeastern Brazilian coast (CE, RN, and BA), most of the oceanic islands (RAT, FNO and TMV) and Western Caribbean in Mexico (Fig. 3).

Although there are few octopus sequences of EF-1α gene available in GenBank, it does suggest misidentification in the landings of port of Progreso. An individual identified as O. vulgaris was actually O. maya, corroborating the result shown in the COI analysis.

The K2P distance and phylogenetic analysis were in agreement. The genetic divergence ranged from 0.2% (between O. insularis from Brazil and from Mexico) to 24.2% (between O. cyanea and O. vulgaris) (Table 4). The genetic divergence between O. maya identified a posteriori and O. vulgaris was also high (14.0%).

Discussion

The correct identification of species that compose fishery stocks is crucial for effective management of these resources, allowing the monitoring of population fluctuations, and consequently preventing species overexploitation (Tillet et al. 2000; Ward et al. 2000). In this study, species misidentification was observed in Octopus of Tropical Northwestern Atlantic.

Most specimens recorded in the Caribbean Sea as O. vulgaris shared the same haplotype as

O. insularis from Northeastern Brazil, including specimens from Fernando de Noronha archipelago, the type locality of the latter, suggesting that these octopuses are O. insularis. In the Gulf of Mexico, most specimens commonly identified as O. vulgaris were O. maya. This suggests that at least three different species are being economically exploited and misidentified in this area, with unknown results for cephalopod fisheries. The misidentification cases described here constitute examples of how helpful molecular approaches can be to distinguish closely related taxa, including commercially exploited marine invertebrates.

The diagnostic characters among Octopus species become less obvious in dead individuals

(Norman and Hochberg 2005). This makes the species identification in the field difficult, even for experienced researchers, thus resulting in misidentification (Fig. 2 and 3). This issue highlights the need for integrative data (molecular and morphological) to correctly identify

Octopus species that compose fisheries stocks.

Until this study, O. insularis was only recorded for three marine provinces: Tropical

Southwestern Atlantic (Leite et al. 2008), which includes the Brazilian oceanic islands and

Northeastern Brazil; North Brazil Shelf (Sales et al. 2013); and St. Helena and Ascension

Islands (Amor et al. 2015). Both phylogenetic reconstructions showed that the specimen collected in Isla Mujeres/Mexico grouped in the well-supported clade of O. insularis species.

Furthermore, the low genetic distance between the specimen from Isla Mujeres in Mexico and

O. insularis from Northeast Atlantic provide evidence of its presence in the TNA, a previously unknown location, representing the westernmost record of this species.

The life history of O. insularis contributes to a wide dispersal, once this species has planktonic paralarvae, high fecundity (around 93,000 eggs) and small eggs (~ 2.5 mm of length) (Lima et al. 2014a; Lenz et al. 2015) (Table 1). As observed for many species of Octopus, after hatching, the paralarvae spend some time (1 – 3 months for O. vulgaris) in the water column, and can travel long distances carried by ocean currents (Hanlon and Messenger 1996; Boyle and Rodhouse 2005), until they settle on the seabed (Mangold 1986; Villanueva et al. 1996).

The Tropical Atlantic realm is mainly under the influence of the South Equatorial Current,

which ﬂows to the Brazilian coast, where it bifurcates at about 12–14ºS. To the north, it becomes the North Brazil Current, which flows bordering the North Brazilian coast until the

Guyana Current. These currents are considered fast, with velocities between 40 and 60 cm/s

(Lumpkin and Garzoli 2005; Rudorff et al. 2009) and are sufficient to maintain larval connectivity between TNA and TSA (Rocha and Bowen 2008). The recent record of O. insularis in the mid-Atlantic islands Ascension and St Helena also corroborates its dispersive potential along the Tropical Atlantic waters (Amor et al. 2015).

The record of O. insularis in the Caribbean Sea also raises questions about the types of O. vulgaris as defined by Norman et al. (2014) to clarify the O. vulgaris species complex.

According to these authors, O. vulgaris Type I occurs through the Caribbean Sea and the Gulf of Mexico, south to at least Venezuela and north to South Carolina. The genetic analysis showed that O. vulgaris Type I collected in Gulf of Mexico grouped in the same clade of O. vulgaris Type II from Brazil, suggesting that this species occurring throughout the TNA and

TSA belongs to the same type. Therefore, we recommend a revision of the O. vulgaris types along this area.

Although in sympatry, a niche separation related to depth and temperature may be occurring between O. insularis and O. vulgaris, in which an adaptive advantage favors O. insularis in shallow warm waters (< 30 m), meanwhile O. vulgaris occupies deeper cold waters (> 30 m)

(F. Lima, unpublished data), as observed for these species in the Northeastern Brazil (Leite et al. 2008, 2009). Further ecological niche modeling and microhabitat studies could clarify this aspect of the natural history of these species, which may result in interesting evolutionary aspects of marine speciation.

The well-supported clades shown by the phylogenetic analysis and the low genetic distance between groups confirmed that all individuals collected in the landing at port of Progreso and identified as O. vulgaris were O. maya. This exemplifies the problem of species misidentification even though O. vulgaris and O. maya are putatively the two most currently commercially exploited octopus species in Mexico. In the Yucatan Peninsula, O. maya fishing

is carried out by small boats at depths ranging from 0 to 30 m, meanwhile, O. vulgaris is usually captured between depths of 18 and 55 m by the medium-sized fleet, which land almost exclusively in the port of Progreso (SAGARPA 2014). Thereby, most octopuses landed in the port of Progreso are reported as O. vulgaris. The O. maya individuals larger than 3.5 kg are usually classified as O. vulgaris by the fishermen from the medium-sized fleet and this mistake is recorded in the fishing statistics at the port of Progreso (C. Rosas personal communication).

The misidentification probably occurs due to lack of knowledge about diagnostic characters to identify large commercial octopuses. Also, an overlap of working areas (depths) of the two types of fleet was verified and the medium-sized boats also capture O. maya. According to

FAO (2012), O. maya accounts for one-third of octopus catches in Mexico and it is exploited at its maximum sustainable yield. Due to the intentional or accidental mixing of these two octopus species in fisheries landings of port of Progreso, the amount of catches of O. maya and O. vulgaris is uncertain. Consequently, O. maya is probably being caught more than the fishing statistics record it and its stocks may be overexploited without any management institution being notified.

Besides accurate fishery statistics, the correct identification of a target species is important for defining management and conservation proposals. After the description of O. insularis (Leite et al. 2008) from Northeastern Brazil, Lima et al. (2014b) found that this species has distinct biological features, such as smaller size at maturity and lower fecundity than O. vulgaris, which directly affects the decisions for the management of the species such as the catch minimum size.

Several ecological studies were performed with O. vulgaris in Bermuda, which raised important information about trophic interactions, habitat, diet, foraging and body patterns of this species in the Caribbean Sea (Mather 1988, 1993; Mather and O'Dor 1991; Opitz 1993;

Mather and Mather 1994; Judkins 2009). These studies were carried out in shallow waters and the habitat was similar to that described for O. insularis in Brazil (Leite et al. 2009; Bouth et al. 2010; Leite et al. 2016). Therefore, it is possible that scientific publication (Mather 1988,

1993; Mather and O'Dor 1991; Opitz 1993; Mather and Mather 1994; Judkins 2009) attributed to O. vulgaris in the shallow Caribbean Sea could be related to O. insularis.

Although challenging, integration of genetic results and traditional methods of fisheries stock assessment, could substantially improve management and conservation goals (Waples et al.

2008; von der Heyden et al. 2014). Our data extended the distribution of O. insularis to the

TNA and revealed cases of misidentification of the most commercially exploited octopus species in this area. This fact highlights the need for an integrative taxonomic method to correctly assign species identity, both for research and commercial aims, especially for this group of octopuses in which some diagnostic characters are difficult to see in deceased specimens. Meanwhile, we suggest that the identification of specimens occurs immediately after capture because it is easier to identify distinct morphological characters in fresh animals.

Therefore, we also propose a monitoring of octopus landings in the Caribbean countries and in the Yucatan Peninsula, in which a subset of specimens of commercial lots should be identified genetically in order to obtain the composition frequency of the stocks. Thus, it will be possible to record the amount of each species and populations that are being exploited to develop efficient management plans in order to avoid overexploitation of this important fishery resource.

Acknowledgements

We are thankful to the Chico Mendes Institute for Biodiversity Conservation (MMA/ICMBIO) and the Brazilian Navy for logistics support in the field work. We thank the Brazilian National

Research Council (CNPq 481492/2013-9) and Coordination for the Improvement of Higher

Education Personnel (CAPES 23038.004807/2014-01) for financial support and research grant (FD). WMBF receives a Ph.D. grant from Science without Borders Program/CNPq

(process 233161/2014-7). We are grateful to Dr. Jan Strugnell for reviewing an earlier version of this manuscript. We would also like to thank Nikeisha Caruana and Adam Amato for reviewing the English grammar.

References

Acosta-Jofré MS, Sahade R, Laudien J, Chiappero MB (2012) A contribution to the

understanding of phylogenetic relationships among species of the genus Octopus

(Octopodidae: Cephalopoda). Sci Mar 76:311–318

Allcock AL, Barratt I, Eléaume M, et al (2011) Cryptic speciation and the circumpolarity debate:

A case study on endemic Southern Ocean octopuses using the COI barcode of life.

Deep-Sea Res Pt II 58:242–249

Amor MD, Laptikhovsky V, Norman MD, Strugnell JM (2015) Genetic evidence extends the

known distribution of Octopus insularis to the mid-Atlantic islands Ascension and St

Helena. J MAR BIOL ASSOC UK 1–6

Arreguín-Sánchez F, Solís MJ, González De La Rosa ME (2000) Population dynamics and

stock assessment for Octopus maya (Cephalopoda: Octopodidae) fishery in the

Campeche Bank, Gulf of Mexico. Revi Biol Trop 48:323–331

Avise, JC (1994) Molecular markers, natural history, and evolution. Chapman and Hall, New

York

Bortolus A (2008) Error cascades in the biological sciences: the unwanted consequences of

using bad taxonomy in ecology. Ambio 37:114–118

Bouth HF; Leite TS; Lima FD; Lins-Oliveira JE (2011) Atol das Rocas: an oasis for Octopus

insularis (Cephalopoda: Octopodidae). Zoologia 28:45-52

Boyle P, Rodhouse, PG (2005) Cephalopods: ecology and fisheries. Blackwell Science,

Oxford

Caddy JF, Rodhouse P (1998) Cephalopod and groundfish landings: evidence for ecological

change in global fisheries. Rev Fish Biol Fish 8:431-444

Carlini DB, Young RE, Vecchione M (2001) A molecular phylogeny of the Octopoda (Mollusca:

Cephalopoda) evaluated in light of morphological evidence. Mol Phylogenet Evol 21:388–

Dai L, Zheng X, Kong L, Li Q (2012). DNA barcoding analysis of Coleoidea (Mollusca:

Cephalopoda) from Chinese waters. Mol Ecol Resour 12:437–447

Drummond AJ, Suchard MA, Xie D, Rambaut A (2012) Bayesian phylogenetics with BEAUti

and the BEAST 1.7. Mol Biol Evol 29:1969–73

Fadhlaoui-Zid K, Knittweis L, Aurelle D et al. (2012) Genetic structure of Octopus vulgaris

(Cephalopoda, Octopodidae) in the central Mediterranean Sea inferred from the

mitochondrial COIII gene. Comptes Rendus - Biologies, 335, 625–636.

FAO (2012) Fisheries and acquaculture statistics 2010. FAO yearbook, Rome

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of

mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol

Mar Biol Biotech 3:294–9

Gabrielsen T, Merkel B, Søreide J et al. (2012) Potential misidentifications of two climate

indicator species of the marine arctic ecosystem: Calanus glacialis and C. finmarchicus.

Polar Biol 35:1621-1628

Garcia-Vazquez E, Machado-Schiaffino G, Campo D, Juanes F (2012) Species

misidentification in mixed hake fisheries may lead to overexploitation and population

bottlenecks. Fish Res 114:52–55

Gusmão J, Lazoski C, Solé-Cava AM (2000) A new species of Penaeus (Crustacea,

Penaeidae) revealed by allozyme and cytochrome oxidase I analyses. Mar Biol 137:435-

446

Guzik MT, Norman MD, Crozier RH (2005) Molecular phylogeny of the benthic shallow-water

octopuses (Cephalopoda: Octopodinae). Mol Phylogenet Evol 37:235–48

Hanlon RT, Messenger JB (1996) Cephalopods Behaviour. Cambridge University Press,

Cambridge

Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003) Biological identifications through DNA

barcodes. P Roy Soc Lond B Bio 270:313–321

Hebert PDN, Gregory TR (2005) The promise of DNA barcoding for taxonomy. Syst Biol

54:852–859

Jassoud AFJ (2010) Genetic differentiation of eastern and western Atlantic Octopus vulgaris.

Dissertation, University of Puerto Rico

Jereb P, Roper CFE, Norman MD, Finn JK (2013) Cephalopods of the world. An annotated

and illustrated catalogue of cephalopod species known to date. Octopods and vampire

squids. FAO species catalogue for ﬁshery purposes. FAO, Rome

Juárez O, Rosas C, Arenta-Ortiz M (2012) Phylogenetic relationships of Octopus maya

revealed by mtDNA sequences. Cienc Mar 38: 563–575

Judkins HL (2009) Cephalopods of the broad Caribbean: distribution, abundance, and

ecological importance. Dissertation, University of South Florida

Kearse, M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A,

Markowitz S, Duran C, Thierer T, Ashton B, Mentjies P, Drummond A (2012) Geneious

Basic: an integrated and extendable desktop software platform for the organization and

analysis of sequence data. Bioinformatics 28:1647-1649

Keskin E, Atar HH (2011) Genetic divergence of Octopus vulgaris species in the eastern

Mediterranean. Biochem Syst Ecol 39:277–282

Keskin E, Atar HH (2013) DNA barcoding commercially important aquatic invertebrates of

Turkey. Mitochondrial DNA 24:440–450

Knowlton N (1993) Sibling species in the sea. Annu Rev Ecol Syst 24:189–216

Knowlton N (2000) Molecular genetic analyses of species boundaries in the sea.

Hydrobiologia 420:73–90

Leite TS, Haimovici M, Molina W, Warnke K (2008) Morphological and genetic description of

Octopus insularis, a new cryptic species in the Octopus vulgaris complex (Cephalopoda:

Octopodidae) from the tropical southwestern Atlantic. J Mollus Stud 74:63–74

Leite TS, Haimovici M, Mather J, Oliveira JEL (2009) Habitat, distribution, and abundance of

the commercial octopus (Octopus insularis) in a tropical oceanic island, Brazil:

information for management of an artisanal fishery inside a marine protected area. Fish

Res 98:85–91

Leite TS, Batista AT, Lima FD, Mather J (2016) Geographic variability of Octopus insularis

diet: from oceanic island to continental populations. Aquatic Biol 25:17-27

Lenz TM, Elias NH, Leite TS, Vidal EAG (2015) First description of the eggs and paralarvae

of the tropical octopus, Octopus insularis, under culture conditions. Am Malacol Bull

33:1–9

Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA

polymorphism data. Bioinformatics 25:1451–1452

Lima FD, Leite TS, Haimovici M, Oliveira JEL (2014a) Gonadal development and reproductive

strategies of the tropical octopus (Octopus insularis) in northeast Brazil. Hydrobiologia

725:7–21

Lima FD, Leite TS, Haimovici M, Nóbrega MF, Oliveira JEL (2014b) Population structure and

reproductive dynamics of Octopus insularis (Cephalopoda: Octopodidae) in a coastal

reef environment along northeastern Brazil. Fish Res 152:86–92

Lü ZM, Cui WT, Liu LQ, Li HM, Wu CW (2013) Phylogenetic relationships among Octopodidae

species in coastal waters of China inferred from two mitochondrial DNA gene sequences.

Genet Mol Res 12:3755–3765

Lumpkin R, Garzoli SL (2005) Near-surface circulation in the Tropical Atlantic Ocean. Deep-

Sea Res Pt II 52:495–518

Mangold K (1986) Reproduction. In: Boyle PR (ed) Cephalopod Life Cycles. II - Comparative

Reviews. Academic Press, London, pp 157-200

Mather JA (1988) Daytime activity of juvenile Octopus vulgaris in Bermuda. Malacologia

29:69-76

Mather JA (1993) Octopuses as predators: implications for management. In: Okutani T, O’Dor

RK, Kubodera T (eds), Recent Advances in Cephalopod Fisheries Biology. Tokai University

Press, Tokyo

Mather JA, O’Dor RK (1991) Foraging strategies and predation risk shape the natural history

of juvenile Octopus vulgaris. B Mar Sci 49:256-269

Mather JA, Mather DL (1994) Skin colours and patterns of juvenile Octopus vulgaris (Mollusca,

Cephalopoda) in Bermuda. Vie Milieu 44:267-272

Moguel C, Mascaró M, Avila-Poveda OH, Caamal C, Sanchez A, Pascual C, Rosas C (2010)

Morphological, physiological, and behavioral changes during post-hatching development

of Octopus maya (Mollusca: Cephalopoda) with special focus on digestive system. Aquat

Biol 9:35-48

Norman MD, Hochberg FG (2005) The current state of octopus taxonomy. Phuket Mar Biol

Cent Res Bul 66:127–154

Norman MD, Hochberg FG, Finn JK (2014) World octopod fisheries. In Jereb P, Roper CFE,

Norman MD, Finn JK (eds) Cephalopods of the world. An annotated and illustrated

catalogue of cephalopod species known to Date. Octopods and vampire squids, Food and

Agriculture Organization of the United Nations, Rome, pp 9–21

Opitz, 1993. A quantitative model of the trophic interactions in a Caribbean coral reef

ecosystem. In. Christensen V, Pauly D (eds.) Trophic models of aquatic ecosystems.

ICLARM Conf Proc, Makati, pp 259-267

Otero J, González AF, Sieiro MP, Guerra A (2007) Reproductive cycle and energy allocation

of Octopus vulgaris in Galician waters, NE Atlantic. Fish Res 85: 122–129

Pliego-Cárdenas R, Hochberg FG, León FJG, Barriga-Sosa IDLA (2014) Close genetic

relationships between two american octopuses: Octopus hubbsorum Berry, 1953, and

Octopus mimus Gould, 1852. J Shellfish Res 33:293–303

Posada D (2008) jModelTest: Phylogenetic Model Averaging. Mol Biol Evol 25: 1253-1256

Rambaut A, Suchard MA, Xie D, Drummond AJ (2014) Tracer v1.6.

http://beast.bio.ed.ac.uk/Tracer. Accessed 26 November 2015

Rocha LA, Bowen, BW (2008) Speciation in Coral-Reef Fishes J Fish Biol 72:1101–21

Rudorff CAG, Lorenzzetti JA., Gherardi DFM, Lins-Oliveira JE (2009) Modeling spiny lobster

larval dispersion in the Tropical Atlantic. Fish Res 96:206–215

SAGARPA (2014) Acuerdo por el que se da a conocer el Plan de Manejo Pesquero de pulpo

(O. maya y O. vulgaris) del Golfo de México y Mar Caribe, Mexico

Sales JBDL, Rego PS, Hilsdorf AWS, Moreira AA et al. (2013) Phylogeographical features of

Octopus vulgaris and Octopus insularis in the Southeastern Atlantic based on the

analysis of mitochondrial markers. J Shellfish Res 32:325–339

Schwartz MK, Luikart G, Waples RS (2006) Genetic monitoring as a promising tool for

conservation and management. Trends Ecol Evol 22:25–33

Spalding MD, Fox HE, Allen GR et al. (2007) Marine Ecoregions of the world : A

bioregionalization of coastal and shelf areas. Bioscience 57:573–583

Solé-Cava AM, Cunha HA (2012) A genética e a conservação da natureza. In Matioli, SR,

Fernandes, FMC (eds) Biologia Molecular e Evolução, 2rd ed. Holos, Ribeirão Preto, pp

217-228

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary

Genetics Analysis Version 6.0. Mol Biol Evol 30:2725-2729

Taylor AL, McKeown NJ, Shaw PW (2012) Molecular identification of three co-occurring and

easily misidentified octopus species using PCR-RFLP techniques. Conserv Genet Resour

4:885–887

Teske PR, Oosthuizen A, Papadopoulos I, Abstract NPB (2007) Phylogeographic structure of

Octopus vulgaris in South Africa revisited: Identification of a second lineage near Durban

harbour. Mar Biol 151:2119–2122

Thorpe JP, Sole-Cava AM, Watts PC (2000) Exploited marine invertebrates: genetics and

fisheries. Hydrobiologia 420:165-184

Tillett BJ, Meekan MG, Broderick D, Field IC, Cliff G, Ovenden JR (2012) Pleistocene isolation,

secondary introgression and restricted contemporary gene flow in the pig-eye shark,

Carcharhinus amboinensis across northern Australia. Conserv Genet 13:99–115

Tourinho JL, Solé-Cava AM, Lazoski C (2012) Cryptic species within the commercially most

important lobster in the tropical Atlantic, the spiny lobster Panulirus argus. Mar Biol

159:1897-1906

Vecchione M, Mickevich MF, Fauchald K, Collette BB, Williams AB, Munroe TA, Young RE

(2000) Importance of assessing taxonomic adequacy in determining fishing effects on

marine biodiversity. ICES J Mar Sci 57:677-681

Villanueva R, Nozais C, Boletzky SV (1996) Swimming behavior and food searching in

planktonic Octopus vulgaris Cuvier from hatching to settlement. J Exp Mar Biol Ecol

208:169–184

Voight JR (1991) Morphological variation in octopod specimens: reassessing the assumption

of preservation-induced deformation. Malacologia 33:241-253 von der Heyden S, Beger M, Toonen RJ et al (2014) The application of genetics to marine

management and conservation: Examples from the Indo-Pacific. Bull Mar Sci 90: 123–58

Voss GL, Solis-Ramirez M (1966) Octopus maya, a new species from the Bay of Campeche,

Mexico. B Mar Sci 16:615-625

Voss NA, Vecchione M, Toll RB, Sweeney MJ (1998) Systematic and Biogeography of

Cephalopods. Smithsonian Institution Press, Washington

Waples RS, Punt AE, Cope JM (2008) Integrating genetic data into management of marine

resources: how can we do it better? Fish Fish 9:423–449

Ward RD (2000) Genetics in fisheries management. Hydrobiologia 420:191–201

Warnke K, Söller R, Blohm D, Saint-Paul U (2004) A new look at geographic and phylogenetic

relationships within the species group surrounding Octopus vulgaris (Mollusca,

Cephalopoda ): indications of very wide distribution from mitochondrial DNA sequences.

J. Zool. Syst. Evol. Res 42:306–312

Wenne R, Boudry P, Hemmer-Hansen J, Lubieniecki KP, Was A, Kause A (2007) What role

for genomics in fisheries management and aquaculture? Aquat Living Resour 20:241–

255

Wielgus J, Cooper E, Torres R, Burke L (2010) Coastal Capital: Dominican Republic. Case

studies on the economic value of coastal ecosystems in the Dominican Republic. World

Resources Institute. http://www.wri.org/coastal-capital. Accessed 12 June 2015

Figures and Tables

30°N ± Progreso "# # !# 20°N Sisal Isla Mujeres ! !Guadalupe Puerto Rico ! Dominica

10°N

São Pedro and ! São Paulo 0° ! Rocas atoll Ceará ! ! ! Fernando de Rio Grande Noronha do Norte 10°S ! " Octopus vulgaris Bahia ! Octopus insularis # 20°S Octopus maya ! ! Trindade and O. vulgaris O. insularis " Martin Vaz # O. vulgaris O. maya Rio de Janeiro " Tropical Northwestern Atlantic Santa Catarina 30°S Tropical Southwestern Atlantic

0 450 900 Km 100°W 90°W 80°W 70°W 60°W 50°W 40°W 30°W 20°W

Figure 1 - Geographic locations of the coastal and oceanic regions along Tropical Northwestern Atlantic and Tropical Southwestern Atlantic, where the samples were collected in the present study. Dark symbols represent samples correctly identified morphologically, while open symbols represent cases of misidentification. The areas where specimens were identified a priori as O. vulgaris and a posteriori as O. insularis are shown by open circles. The open triangles show the regions where O. maya was incorrectly assigned as O. vulgaris

PURI* BA/TMV DOMI* 1 PURI* RN Octopus CE/RN/FNO/GUA* /RAT/MEXI/ DOMI*/PURI * insularis CE 0.78 CE/RAT ASC/STH RN SPS 1 Octopus mimus 0.97 Octopus hubbsorum Octopus sp.* 1 MEXI 1 Octopus MEXI(*) maya MEXI* Octopus bimaculoides MEXI SC 0.86 1 SC/RJ MEXI MEXI 0.84 SAFR/SENE/TRI INDI Octopus GREE vulgaris 1 FRAN 1 1 SPAI TURK TURK CHIN 0.73 1 JAPA CHIN 1 Octopus salutii Octopus salutii

0.02 Figure 2 - Molecular phylogeny constructed using Bayesian inference based on the General Time Reversible model for a partial fragment of the COI gene. The Bayesian posterior probabilities are shown above nodes. Haplotypes in bold were obtained in present study, while the others were obtained from GenBank. The haplotype marked with an asterisk were previously identified as O. vulgaris. The haplotype (*) was shared by O. maya individuals collected in the cultivation center (Sisal, Mexico) and individuals identified a priori as O. vulgaris in fishing landings in port of Progreso, Mexico. Abbreviations: BA (Bahia State), CE (Ceará State), RN (Rio Grande do Norte State), RJ (Rio de Janeiro State), SC (Santa Catarina State), ASC/STH (Ascension and St Helena Islands), FNO (Fernando de Noronha archipelago), RAT (Rocas atoll), TMV (Trindade and Martin Vaz archipelago), DOMI (Dominique), GUAD (Guadaloupe), MEXI (Mexico), PURI (Puerto Rico), TURK (Turkey), SPAI (Spain), FRAN (France), GREE (Greece), SAFR (South Africa), SENE (Senegal), TRI (Tristan da Cunha), INDI (India), CHIN (China) and JAPA (Japan) 57

Figure 3 - Molecular phylogeny resulting from Bayesian inference based on the General Time Reversible model for a partial fragment of the EF1-a gene. The Bayesian posterior probabilities are shown next to nodes. Haplotypes in bold were obtained in the present study, while the others were obtained from GenBank. The haplotype marked with an asterisk were previously identified as O. vulgaris. Abbreviations: BA (Bahia State), CE (Ceará State), RN (Rio Grande do Norte State), FNO (Fernando de Noronha archipelago), RAT (Rocas atoll), TMV (Trindade and Martin Vaz archipelago) and MEXI (Mexico)

Table 1 - Summary of the main morphological, ecological, reproductive and fishing differences among the three target species of octopus fisheries in the Tropical Northwestern Atlantic and Tropical Southwestern Atlantic: O. insularis, O. maya, O. vulgaris. These data are according to Voss and Solís-Ramírez (1966), Arreguín-Sánchez et al. (2000), Otero et al. (2007), Leite et al. (2008), Moguel et al. (2010), FAO (2012), Norman et al. (2013), Lima et al. (2014), SAGARPA (2014) and Lenz et al. (2015). ML = mantle length, TL = total length, BW = body weight

Reproductive Species Morphological characteristics Geographic distribution Habitat and Ecology Fisheries strategies The main target of octopus Robust arms around 3-4 times ﬁsheries in Northeastern The species is found in ML; Head nearly as wide as Small eggs (2.5 Brazil, where several hundred warm shallow waters, mantle; Moderate 2-4 enlarged mm), fecundity tons are ﬁshed each year with Southeast Atlantic, Brazilian on reefs and rocky suckers in mature male; Live around 93,000 eggs long line pots and snorkelling, coast and oceanic islands, in bottoms. It occurs in color yellow to reddish-brown, and small and walking on shallow reefs mid-Atlantic islands depths ranging from 0 O. insularis usually cream-brown; Red/white hatchlings; with the help of a hand hook. Ascension and St Helena to 30 m. In general, this reticulate at ventral arms when it Pelagic paralarvae; There are no management and Caribbean Sea (this species prefers dens is inside the den; Adult Life span around 1 measures for fishing, except in study). under rock in soft measurements: ML = 120-190 year. Fernando de Noronha island bottoms and horizontal mm, TL = 700 mm, BW = 1-2 Kg and Ceará state, with crevices. minimum catch size (ML = 80 mm) and number of pots. Moderate to large species; Elongated arms 3 to 4.5 times Eggs large (~17 This species is harvested on a ML; mm), low fecundity large scale using lines with Narrow head; (~2000 eggs) and It lives from 0 to 50 m bait or lures. The catches are Enlarged suckers absent; large hatchlings; Gulf of Mexico along the deep, usually in shallow around 8,000 tonnes annually. Color uniform dark brown, to (27 mm TL); O. maya coasts of Yucatan and water on seagrass Management: a closed fishing mottled to uniform pale cream; holobenthic Campeche, Mexico. meadows, shell beds season of 16 December to 31 A dark spot or ocellus located juveniles during first and reefs. July every year, an annual beneath each eye; Adult 10 days after hatch; catch quota and minimum measurements: ML = 210 mm, Life span around 1- catch size of 110 mm ML. TL = 1.3 m, BW = 1.5-5 Kg 2 years.

Moderate to large species; Arms This species complex has This species occurs Small eggs (2.0 It is one of the most valuable long (4-5.5 times ML); Male with an extensive global from 0 to 250 m, mm), high fecundity octopod species caught in the O. vulgaris conspicuous 2-3 enlarged distribution: sensu stricto - typically shallower than (100,000 to 500,000 world. This species complex is suckers; Color dark brown to red Mediterranean and north- 100 m. It lives on the eggs) and small harvested on artisanal and

brown. In general, it has darker east Atlantic, Type I - continental shelf on hatchlings (3 mm industrial scales throughout its color compared to O. insularis Caribbean and Gulf of rocky, sandy or muddy TL); range. There are some and O. maya; Color yellowish to Mexico, Type II - southeast substrates and Pelagic paralarvae; management measures brown in the inner of arm when it Atlantic, Type III - South commonly is night Life span around 1 according each region. In is inside the den; Adult Africa and southern Indian active. Usually it occurs to 2 years. some areas, like Spain, Italy measurements: ML = 150-250 Ocean and Type IV - east in colder waters in and Sahara Banks off West mm, TL = > 1 m, BW = 2-6 Kg Asia. relation to habitat Africa, it is considered occupied by O. maya overfished. and O. insularis.

Gene a priori a posteiori Local N GenBank Accession Number Reference

COI O. vulgaris Octopus sp.* Curaçao 1 JX500619 Jassoud 2010 COI O. vulgaris O. insularis* Dominica 6 JX500620-JX500625 Jassoud 2010 COI O. vulgaris O. insularis* Guadalupe 2 JX500640, JX500641 Jassoud 2010 COI O. vulgaris O. insularis* Puerto Rico 1 JX500642-JX500654 Jassoud 2010 3 COI O. vulgaris O. vulgaris France 1 JX500626 Jassoud 2010 COI O. vulgaris O. vulgaris Greece 2 JX500637, JX500639 Jassoud 2010 COI O. vulgaris O. vulgaris Spain 1 JX500676 Jassoud 2010 COI O. vulgaris O. vulgaris Turkey 2 KC789331, KC789332 Keskin and Atar 2013 COI O. vulgaris O. vulgaris Mediterranean 1 HQ908433 Keskin and Atar 2011 COI O. vulgaris O. vulgaris Senegal 2 DQ683225, DQ683226 Teske et al. 2007 COI O. vulgaris O. vulgaris South Africa 2 DQ683208, DQ683218 Teske et al. 2007 COI O. vulgaris O. vulgaris Tristan da Cunha 1 DQ683207 Teske et al. 2007

COI O. vulgaris O. vulgaris Kerala/India 1 KF489451.1 Nair and Vijayamma unpublished COI O. vulgaris O. vulgaris China 1 JX456270 Lü et al. 2013 COI O. vulgaris O. vulgaris China 2 HQ846110, HQ846154 Dai et al. 2012 COI O. vulgaris O. vulgaris Japan 2 AB430546, AB430548 Kaneko et al. 2011 COI O. vulgaris O. vulgaris Japan 1 AB052253 Minakata et al. unpublished COI O. insularis O. insularis Ascension/St 4 KP056552-KP056555 Amor et al. 2015 Helena COI O. maya O. maya Mexico 1 GU362545 Juarez et al. 2012 COI O. bimaculoides O. California 1 KF225006 Pliego-Cardenas et al. 2014 bimaculoides COI O. bimaculoides O. California 1 AF377967 Carlini et al. 2001 bimaculoides COI O. mimus O. mimus Chile/Pacific 3 GU355924, GU355926 Acosta-Jofre et al. 2012 COI O. hubbsorum O. hubbsorum Colombia 1 KF225005 Pliego-Cardenas et al. 2014 COI O. hubbsorum O. hubbsorum Mexico/Gulf 2 KF225002, KF225004 Pliego-Cardenas et al. 2014 California COI O. salutii O. salutii Mediterranean 2 KC894940, KC894941 Fadhlaoui-Zid et al. 2013 COI O. maya+ O. maya Sisal/Mexico 6 KX611862 Present study COI O. vulgaris O. maya* Fish market/Mexico 3 KX611862 Present study COI O. vulgaris O. maya* Progreso 1 KX611862, KX611863 Present study Port/Mexico 5 COI O. vulgaris+ O. vulgaris Progreso 4 KX611852-KX611854 Present study Port/Mexico COI O. insularis+ O. insularis Isla Mujeres/Mexico 1 KX611855 Present study COI O. insularis+ O. insularis BA/Brazil 3 KX611858 Present study COI O. insularis+ O. insularis CE/Brazil 5 KX611855, KX611856, Present study KX611859 COI O. insularis+ O. insularis RN/Brazil 5 KX611855, KX611864, Present study KX611865 COI O. insularis+ O. insularis FNA/Brazil 5 KX611855 Present study

COI O. insularis+ O. insularis RAT/Brazil 5 KX611855, KX611856 Present study COI O. insularis+ O. insularis SPA/Brazil 5 KX611857 Present study COI O. insularis+ O. insularis TMV/Brazil 5 KX611858 Present study COI O. vulgaris O. vulgaris RJ/Brazil 3 KX611860 Present study COI O. vulgaris O. vulgaris SC/Brazil 3 KX611860, KX611861 Present study EF1-α O. vulgaris O. vulgaris - 1 AY651883 Guzik et al. 2005 EF1-α O. tetricus O. tetricus - 2 AY651881, AY651882 Guzik et al. 2005 EF1-α Amphioctopus A. fangsiao - 1 AY651875 Guzik et al. 2005 fansiao EF1-α Abdopus aculeatus A. aculeatus - 1 AY651860 Guzik et al. 2005 EF1-α O. cyanea O. cyanea - 1 AY651867 Guzik et al. 2005 EF1-α O. insularis+ O. insularis Isla Mujeres/Mexico 1 KX641278 Present study EF1-α O. insularis+ O. insularis BA/Brazil 3 KX641278 Present study EF1-α O. insularis+ O. insularis CE/Brazil 3 KX641278 Present study EF1-α O. insularis+ O. insularis RN/Brazil 4 KX641277, KX641278, Present study KX641281 EF1-α O. insularis+ O. insularis FNA/Brazil 5 KX641277, KX641278, Present study KX641279 EF1-α O. insularis+ O. insularis RAT/Brazil 4 KX641278 Present study EF1-α O. insularis+ O. insularis SPA/Brazil 3 KX641279 Present study EF1-α O. insularis+ O. insularis TMV/Brazil 4 KX641278 Present study EF1-α O. vulgaris O. maya* Mexico 1 KX641280 Present study

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1. O. insularis Brasil 0.004 0.001 0.001 0.016 0.016 0.019 0.019 0.020 0.020 0.020 0.013 0.012 0.012 0.018 0.027 2. O. insularis Mexico 0.002 0 0.000 0.016 0.016 0.019 0.019 0.020 0.020 0.020 0.013 0.012 0.012 0.018 0.027 3. O. insularis* Caribbean 0.003 0.001 0.001 0.016 0.016 0.019 0.019 0.020 0.020 0.020 0.013 0.012 0.012 0.018 0.027 4. O. maya Mexico 0.082 0.081 0.081 0.001 0.000 0.024 0.025 0.025 0.025 0.025 0.016 0.016 0.016 0.019 0.028 5. O. maya* Mexico 0.081 0.081 0.081 0.001 0 0.024 0.025 0.025 0.025 0.025 0.016 0.016 0.016 0.019 0.028 6. O. vulgaris SS 0.127 0.126 0.126 0.161 0.161 0.021 0.007 0.006 0.003 0.006 0.023 0.021 0.021 0.025 0.025 7. O. vulgaris Brazil 0.118 0.116 0.117 0.155 0.155 0.033 0.001 0.004 0.007 0.008 0.023 0.021 0.020 0.024 0.027 8. O. vulgaris Mexico 0.123 0.121 0.122 0.157 0.157 0.029 0.007 0.002 0.006 0.008 0.023 0.020 0.020 0.025 0.026 9. O. vulgaris Type III 0.129 0.128 0.128 0.161 0.161 0.014 0.029 0.022 0.001 0.008 0.024 0.022 0.022 0.026 0.026 10. O. vulgaris Type IV 0.127 0.126 0.126 0.159 0.159 0.031 0.032 0.032 0.028 0.002 0.024 0.021 0.022 0.025 0.025 11. Octopus sp* 0.063 0.062 0.062 0.081 0.081 0.157 0.147 0.146 0.158 0.151 - 0.010 0.011 0.021 0.026 12. O. mimus 0.058 0.057 0.057 0.076 0.076 0.141 0.129 0.128 0.14 0.133 0.046 0 0.005 0.020 0.025 13. O. hubbsorum 0.061 0.059 0.06 0.078 0.078 0.143 0.132 0.131 0.143 0.136 0.048 0.011 0 0.020 0.025 14. O. bimaculoides 0.107 0.105 0.105 0.12 0.12 0.165 0.147 0.152 0.166 0.156 0.112 0.11 0.108 0 0.031 15. O. salutii 0.191 0.191 0.191 0.192 0.192 0.176 0.18 0.179 0.176 0.165 0.173 0.175 0.178 0.209 0.011

1 2 3 4 5 6 7 8 1. O. insularis 0.003 0.001 0.013 0.033 0.032 0.052 0.049 0.045 2. O. insularis Mexico 0.002 - 0.013 0.033 0.032 0.052 0.048 0.045 3. O. maya* Mexico 0.029 0.028 - 0.037 0.035 0.055 0.049 0.048 4. O. vulgaris 0.129 0.127 0.140 - 0.005 0.060 0.047 0.050 5. O. tetricus 0.122 0.120 0.134 0.006 0.000 0.058 0.050 0.048 6. O. cyanea 0.207 0.205 0.206 0.242 0.234 - 0.055 0.036 7. Amphioctopus fangsiao 0.187 0.185 0.191 0.197 0.204 0.227 - 0.049 8. Abdopus aculeatus 0.185 0.183 0.184 0.204 0.197 0.136 0.191 -

CAPÍTULO 2 A biogeographic framework of octopod species diversification: the role of the Isthmus

of Panama

A BIOGEOGRAPHIC FRAMEWORK OF OCTOPOD SPECIES DIVERSIFICATION: THE

ROLE OF THE ISTHMUS OF PANAMA

Françoise D. Lima1,2, Jan M. Strugnell3, Tatiana S. Leite4, Sergio M. Q. Lima2

1. Programa de Pós-Graduação em Sistemática e Evolução. Universidade Federal do Rio

Grande do Norte, 59978-900, Natal-RN, Brazil

2. Laboratório de Ictiologia Sistemática e Evolutiva, Departamento de Botânica e Zoologia,

Universidade Federal do Rio Grande do Norte, 59078-900, Natal-RN, Brazil

3 Department of Aquaculture, James Cook University. Townsville 4810, Queensland,

Australia.

4 Laboratório de Bentos e Cefalópodes, Departamento de Oceanografia e Limnologia,

Universidade Federal do Rio Grande do Norte, 59014-100, Natal-RN, Brazil

Abstract

The uplift of the Isthmus of Panama (IP) created a land bridge between Central and

South America and caused the separation of the western Atlantic and eastern Pacific oceans, resulting in profound changes in the environmental and oceanographic conditions. To evaluate how these changes have influenced speciation processes in octopod, samples from Atlantic and Pacific were obtained via SCUBA, fish markets and Genbank. Fragments of two mitochondrial (Cytochrome oxidase subunit I, COI and 16S rDNA) and two nuclear

(Rhodopsin and Elongation Factor-1α, EF-1α) genes were amplified in this study in order to build a Bayesian phylogenetic tree, using one biogeographical and four fossil calibrations.

Reconstruct Ancestral State in Phylogenies (RASP) was used to infer historical biogeography of the lineages and routes of dispersal of the species. The results revealed three well- supported clades of transisthmian octopus species pair/complex (TSSP/TSSC) and additional

two clades showing a low probability of species diversification having been influenced by the

IP. The divergence times estimated in the present study revealed that octopods TSSP/TSSC from Atlantic and Pacific diverged between the middle Miocene and early Pliocene (mean range = 5 - 18 Ma). Given that the oceanographic changes caused by the uplift of the IP were so strong as to affect the global climate, we suggest that octopods TSSP/TSSC probably diverged as a consequence of these physical and environmental barriers, even before the complete uplift of the IP 3 Ma, suggested by the Late Pliocene model. The results obtained in this phylogenetic reconstruction also pointed out that the similar species of octopods in each ocean share a recent common ancestral from Pacific. Thus, it is more probable that divergences among these octopods were influenced by the uplift of IP than they have undergone independent processes of evolutionary convergence.

Keywords: phylogeny, vicariance, dispersal, speciation, fossil calibration

Introduction

The formation of the Isthmus of Panama (IP) caused profound changes in the environmental and oceanographic conditions (Haug & Tiedemann 1998, Bartoli et al. 2005,

Schneider & Schmittner 2006), which influenced dispersal and speciation processes in terrestrial and marine biota (Lessios 1981, Knowlton & Weigt 1998, Leigh et al. 2013). Given that, the closure of the connection between the Atlantic and Pacific oceans is considered the most important vicariant event of the Cenozoic (O’Dea et al. 2016), which provides a remarkable system to study evolutionary processes in a natural environment.

The uplift of the Isthmus of Panama was a long geological process which created a land bridge between Central and South America and caused the separation of the western Atlantic and eastern Pacific oceans. The age of final closure of the IP, as well as its role in fundamental evolutionary processes has been controversial (O’Dea et al. 2016, Winston et al. 2016) and two approaches were proposed to describe this event: the Late Pliocene and the Middle

Miocene models). Using geological, fossil and molecular data (Lessios 1981, Coates et al.

1992, Bartoli et al. 2005, Schneider & Schmittner 2006, Coates & Stallard 2013, O’Dea et al.

2016) several authors have proposed that the final closure of isthmus was in the late Pliocene approximately 2.5-3.5 millions years ago (Ma). However, recent studies based on dispersal waves of terrestrial organisms and geochronological information have pointed out that the closure of the this seaway occurred during the Miocene (15 Ma) (Bacon et al. 2015, Hoorn et al. 2015, Montes et al. 2015).

According to Late Pliocene model, this long process initiated with a collision of Central

America with South America about 15-24 Ma ago and the formation of volcanic arc around the early Miocene (Coates & Stallard 2013). During the middle Miocene (around 10 Ma), successive collisions caused widespread shallowing of the oceans, major changes of the oceanic conditions, and deep and intermediate waters exchange between the Atlantic and

Pacific were extinguished (Keigwin 1982, Coates et al. 2004). Between 6-4 Ma oceanic conditions including temperature, salinity, sedimentary carbon content, and habitat availability on each side of the isthmus changed substantially (Haug & Tiedemann 1998, Leigh et al.

2013). By 3 Mya, the uplift of the IP completely separated the waters of the tropical western

Atlantic and the tropical eastern Pacific (Coates & Stallard 2013, O’Dea et al. 2016).

Studies based on Uranium-lead geochronology in detrital zircons in the Andes,

Panamanian fluvial deposits, and inferences on terrestrial and aquatic dispersal provide a different insight for the early closure of the IP, the Miocene model (Montes et al. 2012, 2015,

Bacon et al. 2013, 2015). In this model, the isthmus formation started around 38–28 Ma and the collision between the southern tip of Central America and South America occurred during the Late Oligocene (28.1–23.0 Ma). Montes et al. (2015) suggested the complete closure, interrupting the water connection between the eastern Pacific and western Atlantic was around

14-15 Ma.

Due to oceanographic, biotic, and habitat differences between the western Atlantic and eastern Pacific during and after the emergence of the Isthmus, marine populations of different taxa on each side evolved independently (Collins 1996, Lessios 1998). The species that

diverged as a consequence of uplift of the Isthmus of Panama are closely related morphologically and genetically and are called transisthmian sister species pairs/complex

(TSSP/TSSC) (Marko 2002, Lessios 2008, Marek 2015). According to the transisthmian sister species complex concept, several species on one side of the Isthmus can represent the putative sister to the species on the other side (Marek 2015).

The timing of the uplift of the Isthmus is widely used as a biogeographical calibration point and is considered one of the most important geological events for calibrating molecular clocks (Lessios 2008, Gleadall 2013). However, to evaluate the influence of the final seaway closure on divergence and distribution of Atlantic and Pacific sister species, it is important to use calibration independent of the isthmus formation to avoid biases in the divergence time interpretation (Marko 2002, O’Dea et al. 2016). As such molecular phylogenies containing species on each side of the IP have been calibrated using the fossil record and/or the molecular evolutionary rate of a particular gene (Bermingham & Lessios 1993, Knowlton 1993,

Collins 1996, Bartoli et al. 2005, Bacon et al. 2013, Galván-Quesada et al. 2016)

Nesis (2003) stated that there are no cephalopod species occurring in both side of the

IP, although nine pairs of similar species are known in the eastern Pacific and western Atlantic: two pairs of shallow-water squids (Family Loliginidae) and seven of benthic octopuses (Family

Octopodidae). According to Voight (1988), the high degree of similarity among pairs of pygmy, ocellated, common and stripped octopods species distributed along either side of Central

America is evidence that each pair shares a common ancestor, which is a more parsimonious explanation than a convergent evolution.

The greatest diversity of benthic octopuses occurs in the Family Octopodidae, which has more than 300 species worldwide (Boyle and Rodhouse 2005, Norman et al. 2014). Some species have a planktonic phase before settling on the substrate and are characterised by high fecundity (20,000 – 500,000 eggs) and small eggs (2 - 5 mm). Other species have low fecundity (50 – 800 eggs), large eggs (6-18 mm) and the hatchling settles straight on the seabed (Mangold 1986, Villanueva et al. 1997). The oceanographic characteristics such as

temperature, ocean currents, and productivity are important determinants of larval trait evolution and their ability to dispersal (Robertson & Collin 2015). For this reason, the contrasting life history traits among octopod species make them an interesting model to study the processes of speciation and adaptive divergence after environmental changes caused by a vicariant event.

The emergence of geographical barriers, such as the formation of the Isthmus of

Panama, interrupts gene flow between populations. The vicariant populations can evolve different genotypic characteristics over time, although they can retain similar morphological and behavioural characteristics (Palumbi 1994, Knowlton 2000, Cowman &

Bellwood 2017). To understand how the uplift of the IP has influenced speciation and dispersal processes in octopods species in the Atlantic and Pacific oceans, this study aims to identify putative transisthmian sister species pairs/complexes, which share morphological, behavioural, and life history similarities. Additionally, we aim to understand how the environmental changes caused by this vicariant event influenced speciation processes in octopuses with different life histories traits.

Methods

Data collection

Tissue samples of octopods species were collected by snorkeling and SCUBA in Brazil

(Northeastern coast and four oceanic islands) (permit SISBIO 10706-5 and 30484-1), from fish markets and landings in Mexico (Isla Mujeres, Sisal and port of Progreso), Chile coast, and Atlantic side of Panama (Figure 1) (Table S1). Muscle tissues were taken from octopod arms preserved in 95% ethanol and stored at -20oC.

Initial analyses were performed using sequences generated in the present study and those obtained from GenBank in order to evaluate the closest phylogenetic relationships among octopods species occurring in the Atlantic and Pacific. A total of 135 sequences from

30 cephalopods species (70 from this study and 65 obtained from GenBank) were chosen to

estimate divergence times and infer phylogenetic relationships. The sequences of genes fragments generated in this study are accessible from GenBank under accession numbers showed in the Table 1.

Calibration priors

To calibrate the species tree we used four fossils and also biogeographical information

(Table 1). Octopods rarely fossilize well due to possessing a lack of hard parts (Strugnell et al. 2006). Calibration points used include:

1 - The biogeographical prior was the separation of deep sea Muusoctopus longibrachus subspecies (Muusoctopus longibrachus longibrachus Ibáñez, Sepúlveda and Chong, 2006 and Muusoctopus longibrachus akambei Gleadall, Guerro-Kommritz, Hochberg and

Laptikhovsky, 2010 as a result of events related to the Last Glacial Maximum (LGM). A normal prior was set on the M. longibrachus node with a mean of 24±5 kya, yielding a range between

5% and 95% quartiles of 15–33 kya (Gleadall et al. 2013).

2 – Divergence between Argonauta and Tremoctopus. An exponential prior was used based on the earliest record of the Argonautidae, the fossil Obinautilus pulcher from the

Oligocene (29 Ma) (Kobayashi 1954). The upper bound of 64 Ma was placed at the last occurrence of ammonites as a prior 95% confidence interval of the distribution of Argonauta

(Strugnell et al. 2008).

3 - Split between the suborders Cirrata (Opisthoteuthis massyae) and Incirrata based on the fossils of Keuppia levante, Keuppia hyperbolaris and Styletoctopus annae from the

Upper Cenomanian, between the Toarcian (180 Ma) and the and the early Turonian (95 Ma).

These fossils are regarded as the earliest representatives of the Incirrata (Fuchs et al. 2009).

This is represented by an exponential prior on the MRCA of these groups, with the minimum age of 95 Ma and 180 Ma as an upper bound on the prior 95% confidence interval.

4 – Separation of Vampyromorpha (Vampyroteuthis infernalis) and Octopoda. An exponential prior with lower bound of 162 Ma was chosen based on the fossil Vampyronassa

rhodanica from the Lower Callovian of the Jurassic (Fisher & Riou 2002). The upper bound of

250 Ma was based on studies of Strugnell et al. (2006) and Kröger et al. (2011), who affirm that Vampyropods diverged by or before the Permian.

Phylogenetic analysis

Genomic DNA was extracted using the GF-1 Nucleic Acid Extraction kit (Vivantis,

Malaysia) according to the manufacturer’s instructions. Fragments of two mitochondrial

(Cytochrome oxidase subunit I, COI and 16S rDNA) and two nuclear (Rhodopsin and

Elongation Factor-1α, EF-1α) genes were amplified in this study. Cytochrome oxidase I gene amplicons were obtained using universal primers LCO1490 and HCO2198 (Folmer et al.

1994) and partial sequences of 16S rDNA were amplified with the primers 16SarL and 16SbrH

(Palumbi 1996). The forward and reverse primers for amplification of Rhodopsin (RhFwd1 5’

GATCGTTACAATGTCATCGGTAGACC 3’, RhRev4 5’ GAGAAAGAATGCGAAGATGCTA 3’) and EF-1α (EFFwd1 5’ TCTGGTTGGCATGGTGATAACATG 3’, EFRev3 5’

ATTGTCATTAACCACCCTGGAC 3’) were designed from octopus sequences available on

GenBank using the software Geneious 9.0.2 (Kearse et al. 2012).

The PCR amplification reactions of all sequences were conducted in a final volume of

25 µL containing 1 µL forward primer, 1 µL reverse primer (10 mM), 12.5 µL Taq DNA

Polymerase Master Mix (Ampliqon A/S) or MyTaq RedMix (Bioline), 8.5 µL H2O and 2 µL DNA.

PCR cycle parameters used to amplify COI and 16S genes were 3 min at 95°C for denaturation, followed by 35 cycles of 1 min at 94°C, 1 min at 45°C for annealing, 1.5 min at

72°C for extension and a ﬁnal extension step of 4 min at 72°C. The parameters used to amplify

Rhodopsin and EF-1α genes are detailed in Allcock et al. (2008). The PCR products were purified and sequenced by Macrogen Inc, Seoul, Korea.

Electropherograms were edited with Geneious 9.0.2 (Kearse et al. 2012) and sequences were aligned by ClustalW using Mega 6 (Tamura et al. 2013). Unalignable loop regions of 16S rDNA and gaps of EF1-alpha were removed before analysis using Gblocks software

(Castresana 2000). The substitution model for each gene was chosen on the basis of the hierarchical and Akaike information criterion tests using the software jModeltest (Posada

2008). The substitution models most suitable for each gene according to both tests were

GTR+G (COI), GTR+G+I (16S), and HKY85+G (Rhodopsin and EF1-alpha).

Bayesian phylogenetic inference on the subset of sequences was carried out in BEAST

1.8.4 (Drummond et al. 2012). A total of 33 specimens (COI – 33, 16S rDNA – 32, rhodopsin

– 27, EF1-alpha – 8) were included in subsequent analyses as separate partitions with unlinked substitution models and linked clock and tree models. An uncorrelated lognormal relaxed clock model incorporating Yule speciation-process prior on branching rates was used.

Monte Carlo Markov Chain (MCMC) run were performed for 3x108 generations, sampling one tree each 3x104 runs. The convergence of MCMC runs, effective sample size, and the correct

‘burn-in’ for the analysis were assessed using Tracer v1.6 (Rambaut et al. 2014). A consensus tree accessing the posteriori probability values of each clade was generated using

TreeAnnotator 1.8.3 (Drummond et al. 2012) and displayed using FigTree 1.4.3.

Biogeographical analysis

The distribution ranges of the species were divided into four areas: Western Atlantic

(WA), Eastern Atlantic (EA), Western Pacific (WP), and Eastern Pacific (EP) (Figure 1).

Reconstruct Ancestral State in Phylogenies (RASP) software package (Yu et al. 2015) was used to infer historical biogeography of the lineages, based on present-day distributions of cephalopods species (Jereb et al. 2014). We used the Bayesian Binary Method (BBM) to estimate the probabilities of ancestral ranges by calculating the average probability of presence (1) and absence (0) over all sampled generations of the ancestral species in each area (Yu et al. 2015). Events of vicariance, dispersal and extinction, as well as the route of dispersal on the nodes were also calculated by BBM model in RASP. The analysis was carried out with the Maximum Clade Credibility Tree (MCCT) from BEAST phylogenetic

reconstruction, setting four heated MCMC chains, which run simultaneously for 5x106 generations, sampled every 1000 generations.

The Time-Event Curve (TEC) was obtained by re-calculating the time of each node using the time of the root. The events on the node were treated using a modified Gaussian distribution (Yu et al. 2015). Thus, events of extinction, dispersal, and vicariance are assigned to a time frame. This analysis was also carried out using RASP.

All the clades considered as transisthmian must contain species from each side of the

IP and must have diverged after a vicariance event indicated by the RASP analysis.

Results

A total of 1992 bp of the combined dataset (COI – 609, 16S – 396, Rhodopsin - 546, EF

– 441) were used to infer phylogenetic relationships and divergence times among 30 cephalopods species.

Phylogenetic analysis

The Bayesian phylogenetic tree, built using a relaxed phylogenetic approach reveals three well-supported clades of transisthmian octopus species pair/complex (clades 1, 3, 5), which undergone vicariance processes as indicated by the RASP analysis (Figure 2). An additional two clades were also recovered in which the divergence processes among the species showed a low probability of having been influenced by the IP (clades 2 and 4) (Figure

2). The divergence time estimation indicated that the mean age of separation among

TSSP/TSSC varies from 5.22 to 17.24 Ma (Table 2).

Clade 1 is comprised of the deep sea Muusoctopus species and is characterized by two vicariance events. The first occurred 11.39 million years ago (5.08, 20.77 95% HPD) at the divergence of M. januari (WA) and a clade containing M. yaquinae (EP) and M. longibrachus subspecies (Posterior probability [PP] = 1). The second vicariance event corresponds to the divergence of M. longibrachus longibrachus and M. longibrachus akambei.

Clade 2 is comprised of the nocturnal species Callistoctopus ornatus from WP and

Callistoctopus sp. and C. macropus from WA and EA, respectively (PP = 1). The divergence between those two lineages from Atlantic and Pacific happened 5.22 Ma (2.21, 10.96 95%

HPD).

The pygmy octopuses (Paroctopus) species that are distributed either side of Isthmus of Panama formed a highly-supported monophyletic clade (clade 3, PP = 1). These

Paroctopus species diverged from the most recent common at 17.44 Ma (8.99, 30.31 95%

HPD).

The long-armed mimic octopuses Macrotritopus defilippi from Western Atlantic and

Octopodidade sp. (White V, as referred by Norman 2000) from Western Pacific are sister taxa

(PP = 1) and are estimated to have diverged 7.83 Ma (2.82, 15.88 95% HPD), as shown in the clade 4.

The transisthmian sister species complex in the clade 5 form a well-supported monophyletic group (PP = 1), and were estimated to have had a common ancestor 8.03 Ma

(4.27, 13.58 95% HPD) (PP = 1). In this clade, O. insularis, O. maya, and O. hummelincki from

WA are the sister taxa to O. mimus and O. hubbsorum from EP and seem to have diverged after a vicariance event indicated by the RASP analysis.

Biogegraphical analysis

Reconstruct Ancestral State in Phylogenies (RASP) showed that the most recent common ancestors of the TSSP/TSSC originated from the Pacific (Table 2). Clades 1, 3, and

5 had high probabilities of an ancestral distribution in the East Pacific (PP = 0.88, 0.87, 0.87, respectively). The clades 2 and 4 were estimated to have originated from ancestors distributed in the Western Pacific Ocean (PP = 0.37, 0.88, respectively). The dispersal routes for each

TSSP/TSSC clade estimated by Bayesian Binary Method are shown in the table 2.

The biogeographical analysis revealed five vicariance and 10 dispersal events on the well-supported nodes of five transisthmian species pair/complex during the early Miocene to

early Pliocene (Table 3). The time-event curve (TEC) analysis shows an increase of vicariance and dispersal events after the middle Miocene (~ 15 Ma) with peak in the early Pliocene (~ 5

Ma).

Discussion

Bayesian phylogenetic inference revealed high probabilities of transisthmian sister species pair/complexes in three genera of octopods species and low probabilities in two genera. These species diverged between 18 and 5 Ma, before the complete closure of Isthmus of Panama suggested by the Late Pliocene model (3 Ma). The ancestral area reconstruction analysis showed vicariance events on each node of TSSP/TSSC and an increase of dispersal and vicariance during the process of isthmus formation, which indicates an influence of the emergence of the geological barrier (Isthmus of Panama) on the divergence processes among octopods species. In addition, the RASP results suggest that the most recent common ancestor of the five clades occupied the Pacific Ocean and the most probable route of dispersal before the closure of the IP is from Pacific to Atlantic.

The divergence times estimated in the present study revealed that octopods

TSSP/TSSC from Atlantic and Pacific diverged between the middle Miocene and early

Pliocene (mean range = 5 - 18 Ma). This suggests that after 15 Ma (age of the isthmus final closure in the Miocene model) there was likely sufficient connectivity between Caribbean and

Pacific oceans to maintain dispersal for some octopus species between these locations up until as recently as the early Pliocene.

The emergence of the Isthmus of Panama was a long process, which caused profound but gradual changes in a range of oceanographic conditions including temperature, salinity, circulation and productivity (O’Dea et al. 2016). The seaway is understood to have been shallowing by the middle Miocene, decreasing in depth from over 2000 m to less than 1000 m deep (Coates 1997). Reorganizations of ocean circulation from eastward-flowing to westward- flowing occurred during the Late Oligocene, increasing productivity within the Caribbean

during the Early Miocene (Bartoli et al. 2005, Schneider & Schmittner 2006). Temperature and salinity began to increase approximately 7 Ma (Collins 1996). Around 4 Ma, the narrowing of the seaway began to extinguish Caribbean upwelling and the primary productivity of this region dropped dramatically, while it increased in the eastern Pacific (Pennington et al. 2006,

Lessios 2008, Coates & Stallard 2013, Leigh et al. 2013).

Given that the oceanographic changes were so strong as to affect the global climate

(Lear et al. 2003), we suggest that octopods TSSP/TSSC probably diverged as a consequence of these physical and environmental barriers, even before the complete uplift of the IP 3 Ma, suggested by the Late Pliocene model. A revision carried out by Lessios (2008) indicated that 73 from 115 geminate clades including echinoids, crustaceans, fishes, and mollusks, split earlier of the final closure of the IP. A similar result was verified by O’Dea et al.

(2016), who used 38 comparisons based on fossil-calibrated phylogenies and revealed that

26 (68%) produced estimates of separation that occurred before than 12 Ma. Marko et al

(2002) studying divergences among six pairs of geminates in the Arcidae bivalves also found out that isolation of geminate species did not necessarily occur in the latest stages of closure of the Central American seaway.

The soft-bodied cephalopods are poorly represented in the fossil record, which make the octopuses phylogenies calibration difficult (Strugnell et al. 2006). However, divergence times of non-calibrated nodes generated in the present study are consistent with previous studies. Using two biogeographical calibrations (LGM and uplift of the IP) Gleadall (2013) estimated that Enteroctopus and Muusoctopus lineages separated 22 +/- 2.2 Ma which is in accordance with the present study (22 Ma, 10-40 95% HPD in this study). The age of separation between M. januari and M. yaquinae clade (11Ma, 5-21 95% HPD) is also in accordance with Gleadall’s (2013) results (13.4 Ma). Furthermore Amor et al. (2015) using the rate of evolution for COI in cephalopods estimated 19.0–40.9 Ma to segregation between the vulgaris and mimus groups, which is in accordance with the results of this study (29 Ma, 18-

43 95% HPD).

According to the reconstruction ancestral area analysis, the most recent common ancestors of all octopods TSSP/TSSC originated from the Pacific Ocean. The shift in the ocean circulation flow from east-west to west-east would carry paralarvae of many species from the Pacific into the Atlantic before the final closure of the IP (Bartoli et al. 2005, Schneider

& Schmittner 2006). Several studies have proposed that many Caribbean species of bivalves, gastropods, and fishes also derived from Pacific ancestors (Bermingham et al. 1997, Meyer

2003, Leigh et al. 2013, LaBella et al. 2016). Additionally, Leigh et al. (2013) pointed out that fossil evidence indicates a Pacific origin for six gastropod species that occupied both sides of tropical America and have become extinct in the Atlantic.

The earliest divergence of all octopods TSSP/TSSC investigated in this study occurred between the pygmy octopuses P. digueti from Eastern Pacific and P. mercatoris / P. cf. joubini from Western Atlantic 17.44 Ma (8.99, 30.31 95% HPD, clade 3). Lower fecundity rates (20-

320 eggs and benthic hatchling) (Forsythe & Toll 1991) combined with small adult size (body weight from 20 g to 85 g) (Norman et al. 2014) may have reduced the ability of these species to maintain dispersion after the first environmental changes resulting from the formation of the

IP.

The divergence among the deep sea species M. januari and M. yaquinae group was around 11 Ma (5.08, 20.77 95% HPD, clade 1). This split was probably influenced by the shoaling of the IP, which shut off deep water connection between 12 and 9.2 Ma (Coates et al. 1992, Lear et al. 2003). The deep divergences among transisthmian species can also be explained by the extinction of geminates as a consequence of the uplift of the isthmus (Lessios

1998, Leigh et al. 2013). Marko (2005) affirms that molluscan transisthmian taxa from the EP and the WA may be rare due to successive events of extinction caused by the seaway closure, in which at least 70% of some molluscan subgeneric groups were lost.

The clade including Macrotritopus defilippi from Western Atlantic and Octopodidae sp.

(White V) (Norman 2000) from Western Pacific shared a MRCA up to 8 Ma (2.82, 15.88 95%

HPD, clade 4). These sand-dwelling species have similar morphological and complex

behavioral characteristics, such as mimicry and ‘flatfish swimming’ (octopus that mimicked the shape, swimming actions, speed, duration, and the coloration of swimming flounders) (Hanlon et al. 2008). They also appear to have evolved from a sand-dwelling common ancestor with extremely long arms (Huffard et al. 2010) and with small and planktonic eggs at the Pacific

Ocean. However, these relationships and routes of dispersal may be biased because the M. defilippi from the Mediterranean Sea (locality of the species holotype) was not available for this analysis.

The most recent divergence in our analysis is the nocturnal Callistoctopus species from

Western Pacific and Western Atlantic at 5 Ma (2.21, 10.96 95% HPD, clade 2). C. ornatus occupies a broad area at Indian and western and central Pacific oceans, while C. macropus occurs at Mediterranean Sea and eastern Atlantic Ocean (Voss 1981, Norman et al. 2014).

The nocturnal Callistoctopus sp. from Brazilian coast is morphologically, genetically and behaviorally similar to C. ornatus and C. macropus (T. S. Leite and F. D. Lima personal communication). Also, all the species in the clade 2 have small and planktonic eggs, which may have facilitated their dispersal and diversification across the seas (Boyle & Rodhouse

2005, Norman et al. 2014). The BBM analysis pointed to the WP - WA as more plausible dispersal route of the nocturnal species, suggesting that the channel before the final closure of the IP was the likely pathway. However, the posterior probability is low (PP BBM route =

0.37), which suggests that alternative routes of colonization, such as from Indo-Pacific to

Eastern Atlantic, were also likely to have been taken. Schneider and Schmittner (2006) pointed out an intimate connection between the tropical gateways of Panama and Indonesia in a way that reduced outflow of upper ocean Pacific waters via the Panama seaway into the

Atlantic is compensated by increased flow towards the Indonesian Archipelago. Given that the divergence of these species occurred shortly before the total closure of the isthmus, this interflow may explain the dispersion of species from the West to East Pacific and, subsequently to the West Atlantic via the Panama seaway.

Clade 5 includes Octopus species with remarkable evolutionary success in term of diversification, distribution, and abundance on both sides of the Americas. This TSSC groups

O. maya, O. hummelincki and O. insularis from the WA and O. mimus and O. hubbsorum from the EP, which have different reproductive strategies and shared a common ancestor 8 Ma

(4.27, 13.58 95% HPD). The species O. mimus and O. hubbsorum are very closely related and may represent a single species (Pliego-Cárdenas et al. 2014). They are the putative transisthmian sister taxa of O. insularis, since they also share similar morphological characteristics (medium/large muscular species, ocellus absent, white spots on dorsal mantle, skin texture of irregular patch and groove system), habitat preferences (reefs and rocky bottoms in shallow waters) and life history (small and planktonic eggs) (Leite et al. 2008, 2009,

Norman et al. 2014).

Prior to the divergence of the species in the clade 5, speciation processes appear to have occurred within the Eastern Pacific around 19 Ma (10-29 95% HPD). These processes derived a clade containing two ocellated species with different reproductive traits (O. bimaculoides and O. bimaculatus, holobenthic and pelago-benthic hatchling, respectively) in

EP, and another clade containing the endemic ocellated species from Galapagos, O. oculifer

(holobenthic mode), and the TSSC concerned. The divergence time between O. oculifer and the clade 5 (12 Ma, 7-20 95% HPD) was slightly after the formation of seamounts in Galápagos at 14.5 Ma (Werner et al. 2015), suggesting that this species successfully settled on the rising island and became endemic due to its low dispersive ability.

Even though the divergence of O. oculifer was not precipitated by a vicariance event related to the formation of IP, the subsequent evolutionary processes were, and seem to have generated a species with very similar characteristics in WA, O. maya. The ocellated O. maya, endemic to the Gulf of Mexico, has large eggs and benthic hatchlings (Arreguín-Sánchez et al. 2000). It probably inherited these traits from the same ancestor it shared with O. oculifer in the past. Although studies have pointed O. bimaculatus as transisthmian sister taxon of O. maya (Voight 1988, Nesis 2003, Juárez et al. 2012, Allcock et al. 2015), this study suggests

O. oculifer as similar species of O. maya on the Pacific side, since they also share morphological, behavioural, and ecological similarities.

The long geological history of the Isthmus of Panama had an immense impact on the speciation processes of marine biota in the Atlantic and Pacific oceans (Coates et al. 1992,

Bartoli et al. 2005, O’Dea et al. 2007, 2016, Coates & Stallard 2013). The divergence processes among octopods TSSP/TSSC occurred up to 5 Ma (2.21 Ma, lower bound of the

95% HPD interval), a long time after the final closure of the IP proposed by the Miocene model,

15 Ma. Considering the influence of the extreme environmental changes during this geological event in the speciation processes, the divergence times of the octopods species are according to the classic Pliocene model.

The results obtained in this phylogenetic reconstruction also point out that the similar species of octopods in each ocean share a recent common ancestral from Pacific. Thus, it is more probable that divergences among these octopods were influenced by the uplift of

Isthmus of Panama than they have undergone independent processes of evolutionary convergence.

References

Arreguín-Sánchez F, Solís MJ, González De La Rosa ME (2000) Population dynamics and

stock assessment for Octopus maya (Cephalopoda: Octopodidae) fishery in the Campeche

Bank, Gulf of Mexico. Rev Biol Trop 48:323–331

Allcock AL, Strugnell J, Johnson MP (2008) How useful are the recommended counts and

indices in the systematics of the Octopodidae (Mollusca: Cephalopoda). Biol J Linn Soc

95:205–218

Allcock AL, Lindgren A, Strugnell JM (2015) The contribution of molecular data to our

understanding of cephalopod evolution and systematics: A review. J Nat Hist 49:1–49

Amor MD, Laptikhovsky V, Norman MD, Strugnell JM (2015) Genetic evidence extends the

known distribution of Octopus insularis to the mid-Atlantic islands Ascension and St Helena.

J Mar Biol Assoc United Kingdom 1–6

Bacon CD, Mora A, Wagner WL, Jaramillo CA (2013) Testing geological models of evolution

of the Isthmus of Panama in a phylogenetic framework. Bot J Linn Soc 171:287–300

Bacon CD, Silvestro D, Jaramillo C, Smith BT, Chakrabarty P, Antonelli A (2015) Biological

evidence supports an early and complex emergence of the Isthmus of Panama. Proc Natl

Acad Sci 112:6110–6115

Bartoli G, Sarnthein M, Weinelt M, Erlenkeuser H, Lea DW (2005) Final closure of Panama

and the onset of northern hemisphere glaciation. Earth Planet Sci Lett 237:33–44

Bermingham E, Lessios HA (1993) Rate variation of protein and mitochondrial DNA evolution

as revealed by sea urchins separated by the Isthmus of Panama. Proc Natl Acad Sci

90:2734–2738

Bermingham E, Shawn McCafferty S, Martin AP (1997) Fish Biogeography and Molecular

Clocks: Perspectives from the Panamanian Isthmus. In: Kocher TD, Stepien CA (eds)

Molecular Systematics of Fishes. Academic Press, New York, p 113–128

Boyle P, Rodhouse PG (2005) Cephalopods: ecology and fisheries. Blackwell Science, Oxford

Castresana J (2000) Selection of conserved blocks from multiple alignments for their use in

phylogenetic analysis. Mol Biol Evol 17:540-552

Coates AG, George T, Dowsett HJ, Survey USG, Bybell LM, Jung P, Obando J (1992) Closure

of the Isthmus of Panama: The near-shore marine record of Costa Rica and western

Panama. Geol Soc Am Bull 104:814–828

Coates AG (1997) The forging of Central America. In: Coates AG (ed) Central America: A

natural and cultural history. Yale University Press, New Haven, p 1–37

Coates AG, Collins LS, Aubury MP, Berggren WA (2004) The geology of the Darien, Panama,

and the late Miocene-Pliocene collision of the Panama arc with northwestern South

America. Bull Geol Soc Am 116:1327–1344

Coates AG, Stallard RF (2013) How old is the isthmus of Panama? Bull Mar Sci 89:801–813

Collins T (1996) Molecular comparisons of transisthmian species pairs: Rates and patterns of

evolution. In: Jackson JBC, Budd AF, Coates AG (eds) Evolution and environment in

tropical America. University of Chicago Press, Chicago, p 303–334

Cowman PF, Parravicini V, Kulbicki M, Floeter SR (2017) The biogeography of tropical reef

fishes: Endemism and provinciality through time. Biol Rev doi:10.1111/brv.12323

Drummond AJ, Suchard MA, Xie D, Rambaut A (2012) Bayesian Phylogenetics with BEAUti

and the BEAST 1.7. Mol Biol Evol 29:1969-1973

Fisher JC, Riou B (2002) Vampyronassa rhodanica nov. gen. nov. sp., vampyromorpha

(Cephalopoda, Coleoidea) du Callovien inférieur de la Voulte-sur-Rhône (Ardéche,

France). Ann Paléontol 88:1–17

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of

mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol

Mar Biol Biotechnol 3:294–9

Forsythe JW, Toll RB (1991) Clarification of the western Atlantic Ocean pygmy octopus

complex: The identity and life history of Octopus joubini (Cephalopoda: Octopodinae). Bull

Mar Sci 49:88–97

Fuchs D, Bracchi G, Weis R (2009) New Octopods (Cephalopoda: Coleoidea ) from the late

Cretaceous (Upper Cenomanian) of Hâkel Hândjoula, Lebanon. Palaeontology 52:65–81

Galván-Quesada S, Doadrio I, Alda F, Perdices A, Reina RG, Varela MG, Hernández N,

Mendoza AC, Bermingham E, Domínguez-Domínguez O (2016) Molecular phylogeny and

biogeography of the amphidromous fish genus Dormitator Gill 1861 (Teleostei: Eleotridae).

PLoS One 11:1–26

Gleadall IG (2013) A molecular sequence proxy for Muusoctopus januarii and calibration of

recent divergence among a group of mesobenthic octopuses. J Exp Mar Bio Ecol 447:106–

122

Hanlon RT, Conroy LA, Forsythe JW (2008) Mimicry and foraging behaviour of two tropical

sand-flat octopus species off North Sulawesi, Indonesia. Biol J Linn Soc 93:23–38

Haug GH, Tiedemann R (1998) Effect of theformation of the Isthmus of Panama on Atlantic

Ocean thermohaline circulation. Lett to Nat 393:673–676

Hoorn BC, Flantua S, America N (2015) An early start for the Panama land bridge. Science

348:186–187

Huffard CL, Saarman N, Hamilton H, Simison WB (2010) The evolution of conspicuous

facultative mimicry in octopuses: an example of secondary adaptation? Biol J Linn Soc

101:68–77

Jereb P, Roper CFE, Norman MD, Finn JK (2014) Cephalopods of the world. An annotated

and illustrated catalogue of cephalopod species known to date. Octopods and vampire

squids. FAO species catalogue for ﬁshery purposes. Food and Agriculture Organization of

the United Nations, Rome

Juárez O, Rosas C, Arenta-Ortiz M (2012) Phylogenetic relationships of Octopus maya

revealed by mtDNA sequences. Ciencias Mar 38:563–575

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A,

Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious

Basic: An integrated and extendable desktop software platform for the organization and

analysis of sequence data. Bioinformatics 28:1647–1649

Keigwin L (1982) Isotopic paleoceanography of the Caribbean. Science 217:350–353

Knowlton N (1993) Divergence in protein, mitochondrial DNA, and reproductive compatibility

across the Isthmus of Panama. Science 260:1629–1632

Knowlton N (2000) Molecular genetic analyses of species boundaries in the sea.

Hydrobiologia 420:73–90

Knowlton N, Weigt LA (1998) New dates and new rates for divergence across the Isthmus of

Panama. Proc R Soc Lond B 265:2257–2263

Kobayashi T (1954) A new Palaeogene paracenoceratoid from southern Kyushu in Japan.

Jap J Geol Geogr 24:181–184

Kröger B, Vinther J, Fuchs D (2011) Cephalopod origin and evolution: A congruent picture

emerging from fossils, development and molecules. Bioessays 33:602–613

LaBella AL, Dover CL Van, Jollivet D, Cunningham CW (2017) Gene flow between Atlantic

and Pacific Ocean basins in three lineages of deep-sea clams (Bivalvia: Vesicomyidae:

Pliocardiinae) and subsequent limited gene flow within the Atlantic. Deep Res II 137:307–

317